WorldWideScience

Sample records for factor kb activation

  1. Analysis of employee benefits in Factoring KB, a.s.v

    OpenAIRE

    Vachoušek, Stanislav

    2011-01-01

    The main objective of this work is to analyze employee benefits - benefits of Factoring KB, a.s. The theoretical part of the generally specifies the basic concepts related to employee benefits needed to cope with the analytical part. The content of this section is primarily a system of employee benefits, classification of employee benefits, tax savings and marginally trends in providing benefits. The analytical part is devoted exclusively to Factoring KB, there is an analysis of employee bene...

  2. Modulation of NF-KB in rescued irradiated cells

    International Nuclear Information System (INIS)

    Lam, R.K.K.; Fung, Y.K.; Han, W.; Li, L.; Chiu, S.K.; Cheng, S.H.; Yu, K.N.

    2015-01-01

    Studies by different groups on the rescue effect, where unirradiated bystander cells mitigated the damages in the irradiated cells, since its discovery by the authors' group in 2011 were first reviewed. The properties of the rescue effect were then examined using a novel experimental set-up to physically separate the rescue signals from the bystander signals. The authors' results showed that the rescue effect was mediated through activation of the nuclear factor-KB (NF-KB) response pathway in the irradiated cells, and that the NF-KB activation inhibitor BAy -1 1-7082 did not affect the activation of this response pathway in the irradiated cells induced by direct irradiation. (authors)

  3. Constitutive Activation of NF-KB in Prostate Carcinoma Cells Through a Positive Feedback Loop: Implication of Inducible IKK-Related Kinase (IKKi)

    National Research Council Canada - National Science Library

    Budunova, Irina V

    2005-01-01

    The overall goal of this project is to understand the role of inducible IKK-related kinase IKKi in constitutive activation of anti-apoptotic transcription factor NF-KB prostate carcinoma (PC) cells...

  4. The reverse-mode NCX1 activity inhibitor KB-R7943 promotes prostate cancer cell death by activating the JNK pathway and blocking autophagic flux.

    Science.gov (United States)

    Long, Zhou; Chen, BaiJun; Liu, Qian; Zhao, Jiang; Yang, ZhenXing; Dong, XingYou; Xia, LiuBin; Huang, ShengQuan; Hu, XiaoYan; Song, Bo; Li, LongKun

    2016-07-05

    We explored the effects of KB-R7943, an inhibitor of reverse-mode NCX1 activity, in prostate cancer (PCa). NCX1 was overexpressed in PCa tissues and cell lines, and higher NCX1 levels were associated higher PCa grades. At concentrations greater than 10 μM, KB-R7943 dose-dependently decreased PC3 and LNCaP cell viability. KB-R7943 also increased cell cycle G1/S phase arrest and induced apoptosis in PC3 cells. KB-R7943 increased autophagosome accumulation in PCa cells as indicated by increases in LC3-II levels and eGFP-LC3 puncta. Combined treatment with chloroquine (CQ) and KB-R7943 decreased P62 and increased LC3-II protein levels in PC3 cells, indicating that KB-R7943 blocked autophagic flux. KB-R7943 induced autophagosome accumulation mainly by downregulating the PI3K/AKT/m-TOR pathway and upregulating the JNK pathway. In xenograft experiments, KB-R7943 inhibited tumor growth. Combined treatment with KB-R7943 and an autophagy inhibitor inhibited growth and increased apoptosis. These results indicate that KB-R7943 promotes cell death in PCa by activating the JNK signaling pathway and blocking autophagic flux.

  5. Capsaicin induces cell cycle arrest and apoptosis in human KB cancer cells.

    Science.gov (United States)

    Lin, Chia-Han; Lu, Wei-Cheng; Wang, Che-Wei; Chan, Ya-Chi; Chen, Mu-Kuan

    2013-02-25

    Capsaicin, a pungent phytochemical in a variety of red peppers of the genus Capsicum, has shown an anti-proliferative effect on various human cancer cell lines. In contrast, capsaicin has also been considered to promote the growth of cancer cells. Thus, the effects of capsaicin on various cell types need to be explored. The anti-proliferative effects of capsaicin on human KB cancer cells are still unknown. Therefore, we examined the viability, cell cycle progression, and factors associated with apoptosis in KB cells treated with capsaicin. The cell proliferation/viability and cytotoxicity of KB cells exposed to capsaicin were determined by a sulforhodamine B colorimetric assay and trypan blue exclusion. Apoptosis was detected by Hoechst staining and confirmed by western blot analysis of poly-(ADP-ribose) polymerase cleavage. Cell cycle distribution and changes of the mitochondrial membrane potential were analyzed by flow cytometry. Furthermore, the expression of caspase 3, 8 and 9 was evaluated by immunoblotting. We found that treatment of KB cells with capsaicin significantly reduced cell proliferation/viability and induced cell death in a dose-dependent manner compared with that in the untreated control. Cell cycle analysis indicated that exposure of KB cells to capsaicin resulted in cell cycle arrest at G2/M phase. Capsaicin-induced growth inhibition of KB cells appeared to be associated with induction of apoptosis. Moreover, capsaicin induced disruption of the mitochondrial membrane potential as well as activation of caspase 9, 3 and poly-(ADP-ribose) polymerase in KB cells. Our data demonstrate that capsaicin modulates cell cycle progression and induces apoptosis in human KB cancer cells through mitochondrial membrane permeabilization and caspase activation. These observations suggest an anti-cancer activity of capsaicin.

  6. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking.

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-12-18

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking*

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-01-01

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. PMID:26453302

  8. Establishment and characterization of arsenic trioxide resistant KB/ATO cells.

    Science.gov (United States)

    Zhang, Yun-Kai; Dai, Chunling; Yuan, Chun-Gang; Wu, Hsiang-Chun; Xiao, Zhijie; Lei, Zi-Ning; Yang, Dong-Hua; Le, X Chris; Fu, Liwu; Chen, Zhe-Sheng

    2017-09-01

    Arsenic trioxide (ATO) is used as a chemotherapeutic agent for the treatment of acute promyelocytic leukemia. However, increasing drug resistance is reducing its efficacy. Therefore, a better understanding of ATO resistance mechanism is required. In this study, we established an ATO-resistant human epidermoid carcinoma cell line, KB/ATO, from its parental KB-3-1 cells. In addition to ATO, KB/ATO cells also exhibited cross-resistance to other anticancer drugs such as cisplatin, antimony potassium tartrate, and 6-mercaptopurine. The arsenic accumulation in KB/ATO cells was significantly lower than that in KB-3-1 cells. Further analysis indicated that neither application of P-glycoprotein inhibitor, breast cancer resistant protein (BCRP) inhibitor, or multidrug resistance protein 1 (MRP1) inhibitor could eliminate ATO resistance. We found that the expression level of ABCB6 was increased in KB/ATO cells. In conclusion, ABCB6 could be an important factor for ATO resistance in KB/ATO cells. The ABCB6 level may serve as a predictive biomarker for the effectiveness of ATO therapy.

  9. The clinical significance of HER-2 and NF-KB expression in gastric cancer.

    Science.gov (United States)

    Li, Xiaogai; Tu, Jiancheng; Zhang, Di; Xu, Zhigao; Yang, Guifang; Gong, Lingling; Yu, Mingxia

    2013-09-01

    To investigate the expression of human epidermal growth factor 2 (HER-2) and Nuclear factor-Kb (NF-KB) in gastric cancer, and the relation of these two parameters with stage, grade and metastasis of gastric cancer. The serum level of HER-2 in 75 gastric cancer patients and control participants were determined by enzyme-linked immunosorbent assay (ELISA) kits. Expression of HER-2 and NF-KB protein were detected by immunohistochemical staining (SP method) of paraffin-embedded tissues in 75 tumors (observed group) and 22 normal gastric specimens. The clinical pathological data was statistically analyzed. Serum HER-2 level were significantly increased in study group compared with those in the control group (pKB in the observed group was 24.00% (18/75) and 62.67% (47/75) respectively. The expression of HER-2 and NF-KB were not correlated with age and gender, but with stage, grade and metastasis (pKB was correlated with tumor size (pKB had a positive rate of 94.44% (17/18), but a positive rate of 52.63% (30/57) when HER-2 was negative. Expression of NF-KB in gastric cancer tissue was correlated with HER-2 expression (X2 = 8.514, pKB in gastric cancer tissue is correlated with HER-2 expression, and they may play a very important role in the progress of gastric cancer.

  10. KB WOT Fisheries 2017

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and advance the expertise needed to carry out the statutory obligations in fisheries monitoring and advice of The Netherlands. The contents of the KB WOT Fisheries programme for 2017 reflects the scientific and management needs of the WOT

  11. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  12. A method for sensible heat flux model parameterization based on radiometric surface temperature and environmental factors without involving the parameter KB-1

    Science.gov (United States)

    Zhuang, Qifeng; Wu, Bingfang; Yan, Nana; Zhu, Weiwei; Xing, Qiang

    2016-05-01

    Sensible heat flux is a key component of land-atmosphere interaction. In most parameterizations it is calculated with surface-air temperature differences and total aerodynamic resistance to heat transfer (Rae) that is related to the KB-1 parameter. Suitable values are hard to obtain since KB-1 is related both to canopy characteristics and environmental conditions. In this paper, a parameterize method for sensible heat flux over vegetated surfaces (maize field and grass land in the Heihe river basin of northwest China) was proposed based on the radiometric surface temperature, surface resistance (Rs) and vapor pressures (saturated and actual) at the surface and the atmosphere above the canopy. A biophysics-based surface resistance model was revised to compute surface resistance with several environmental factors. The total aerodynamic resistance to heat transfer is directly calculated by combining the biophysics-based surface resistance and vapor pressures. One merit of this method is that the calculation of KB-1 can be avoided. The method provides a new way to estimate sensible heat flux over vegetated surfaces and its performance compares well to the LAS measured sensible heat and other empirical or semi-empirical KB-1 based estimations.

  13. [Effects of metformin on human oral cancer KB cell proliferation and apoptosis in vitro].

    Science.gov (United States)

    Wang, Fang; Xu, Jincheng; Xia, Fei; Liu, Zhe; Zhao, Surong; Liu, Hao; Jiang, Zhiwen

    2014-02-01

    To investigate the effects of metformin on the proliferation and apoptosis of human oral cancer cell line KB in vitro. Human oral cancer cell line KB was exposed to different doses of metformin (0, 1.25, 2.5, 5, 10, and 20 mmol/L), and the changes in cell viability were detected using MTT assay. Colony formation of the cells was observed following an 8-day metformin exposure. The changes in mitochondrial membrane potential were measured by JC-1 assay, and PI staining was used to observe the cell apoptosis. Western blotting was employed to detect the changes in the protein expressions of GRP78 and activated caspase-3. Metformin exposure caused time- and dose-dependent suppression of KB cell proliferation, and exposure to 5 mmol/L metformin for 24, 48 and 72 h resulted in cell survival rates of 68.0%, 36.9%, and 14.5%, respectively. Metformin significantly inhibited KB cell colony formation. Exposure of the cells to increased concentrations of metformin gradually increased the apoptotic rate and decreased mitochondrial membrane potential. Metformin caused an initial up-regulation followed by a down-regulation of GRP78 expression in KB cells and increased the expression of activated caspase-3. Metformin can inhibit the proliferation and induce apoptosis of KB cells, the mechanism of which may involve the activation of the mitochondrial apoptotic pathway and endoplasmic reticulum stress.

  14. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Mi-Ra; Lee, Sook-Young; Kim, Do Kyoung; Moon, Sung-Min; Kim, Chun Sung; Cho, Seung Sik; Yoon, Goo; Im, Hee-Jeong; You, Jae-Seek; Oh, Ji-Su; Kim, Su-Gwan

    2014-02-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 µM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico‑A‑induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and -3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico‑A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer.

  15. Aloin Inhibits Interleukin (IL)-1β-Stimulated IL-8 Production in KB Cells.

    Science.gov (United States)

    Na, Hee Sam; Song, Yu Ri; Kim, Seyeon; Heo, Jun-Young; Chung, Hae-Young; Chung, Jin

    2016-06-01

    Interleukin (IL)-1β, which is elevated in oral diseases including gingivitis, stimulates epithelial cells to produce IL-8 and perpetuate inflammatory responses. This study investigates stimulatory effects of salivary IL-1β in IL-8 production and determines if aloin inhibits IL-1β-stimulated IL-8 production in epithelial cells. Saliva was collected from volunteers to determine IL-1β and IL-8 levels. Samples from volunteers were divided into two groups: those with low and those with high IL-1β levels. KB cells were stimulated with IL-1β or saliva with or without IL-1 receptor agonist or specific mitogen-activated protein kinase (MAPK) inhibitors. IL-8 production was measured by enzyme-linked immunosorbent assay (ELISA). MAPK protein expression involved in IL-1β-induced IL-8 secretion was detected by Western blot. KB cells were pretreated with aloin, and its effect on IL-1β-induced IL-8 production was examined by ELISA and Western blot analysis. Saliva with high IL-1β strongly stimulated IL-8 production in KB cells, and IL-1 receptor agonist significantly inhibited IL-8 production. Low IL-1β-containing saliva did not increase IL-8 production. IL-1β treatment of KB cells induced activation of MAPK signaling molecules as well as nuclear factor-kappa B. IL-1β-induced IL-8 production was decreased by p38 and extracellular signal-regulated kinase (ERK) inhibitor treatment. Aloin pretreatment inhibited IL-1β-induced IL-8 production in a dose-dependent manner and inhibited activation of the p38 and ERK signaling pathway. Finally, aloin pretreatment also inhibited saliva-induced IL-8 production. Results indicated that IL-1β in saliva stimulates epithelial cells to produce IL-8 and that aloin effectively inhibits salivary IL-1β-induced IL-8 production by mitigating the p38 and ERK pathway. Therefore, aloin may be a good candidate for modulating oral inflammatory diseases.

  16. KB425796-A, a novel antifungal antibiotic produced by Paenibacillus sp. 530603.

    Science.gov (United States)

    Kai, Hirohito; Yamashita, Midori; Takase, Shigehiro; Hashimoto, Michizane; Muramatsu, Hideyuki; Nakamura, Ikuko; Yoshikawa, Koji; Ezaki, Masami; Nitta, Kumiko; Watanabe, Masato; Inamura, Noriaki; Fujie, Akihiko

    2013-08-01

    The novel antifungal macrocyclic lipopeptidolactone, KB425796-A (1), was isolated from the fermentation broth of bacterial strain 530603, which was identified as a new Paenibacillus species based on morphological and physiological characteristics, and 16S rRNA sequences. KB425796-A (1) was isolated as white powder by solvent extraction, HP-20 and ODS-B column chromatography, and lyophilization, and was determined to have the molecular formula C79H115N19O18. KB425796-A (1) showed antifungal activities against Aspergillus fumigatus and the micafungin-resistant infectious fungi Trichosporon asahii, Rhizopus oryzae, Pseudallescheria boydii and Cryptococcus neoformans.

  17. Antiproliferative activity of flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the MCF7, KB, and NIH/3T3 cell lines.

    Science.gov (United States)

    Nedel, Fernanda; Begnini, Karine; Carvalho, Pedro Henrique de Azambuja; Lund, Rafael Guerra; Beira, Fátima T A; Del Pino, Francisco Augusto B

    2012-11-01

    This study assessed the antiproliferative effect in vitro of the flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the human breast adenocarcinoma (MCF-7), human mouth epidermal carcinoma (KB), and mouse embryonic fibroblast (NIH 3T3) cell lines, using sulforhodamine B (SRB) assay. A cell density of 2×10(4)/well was seeded in 96-well plates, and samples at different concentrations ranging from 10 to 500 mg/mL were tested. The optical density was determined in an ELISA multiplate reader (Thermo Plate TP-Reader). Results demonstrated that the hexane extract presented antiproliferative activity against both the tumor cell lines KB and MCF-7, presenting a GI(50) (MCF-7=13.09 mg/mL), TGI (KB=37.76 mg/mL), and IL(50) (KB=291.07 mg/mL). Also, the hexane extract presented antiproliferative activity toward NIH 3T3 cells GI(50) (183.65 mg/mL), TGI (280.54 mg/mL), and IL(50) (384.59 mg/mL). The results indicate that the flower hexane extract obtained from M. spicata associated with M. rotundifolia presents an antineoplastic activity against KB and MCF-7, although an antiproliferative effect at a high concentration of the extract was observed toward NIH 3T3.

  18. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway

    Science.gov (United States)

    KIM, JAE-SUNG; PARK, MI-RA; LEE, SOOK-YOUNG; KIM, DO KYOUNG; MOON, SUNG-MIN; KIM, CHUN SUNG; CHO, SEUNG SIK; YOON, GOO; IM, HEE-JEONG; YOU, JAE-SEEK; OH, JI-SU; KIM, SU-GWAN

    2014-01-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 μM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico-A-induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and −3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico-A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer. PMID:24337492

  19. Na+/Ca2+ exchange inhibitor, KB-R7943, attenuates contrast-induced acute 
kidney injury.

    Science.gov (United States)

    Yang, Dingwei; Yang, Dingping; Jia, Ruhan; Tan, Jin

    2013-01-01

    Intracellular Ca2+ overload is considered to be a key factor in contrast-induced acute kidney injury (CI-AKI). The Na+/Ca2+ exchanger (NCX) system is one of the main pathways of intracellular Ca2+ overload. We investigated the effects of KB-R7943, an inhibitor of the reverse mode of NCX, on CI-AKI in a rat model. Rats were divided into control group, CI-AKI group and pretreatment groups (with KB-R7943 dose of 5 or 10 mg/kg). CI-AKI was induced by diatrizoate administration in rats with cholesterol-supplemented diet for 8 weeks. Renal function and renal hemodynamics were determined 1 day following contrast medium administration. Renal histopathology was observed by light microscope. Renal tubular apoptosis was examined by TUNEL. Renal endothelin-1 (ET-1) was measured by radioimmunoassay. Renal malondialdehyde (MDA) and catalase (CAT) were measured as oxidative markers. Levels of serum creatinine (Scr), renal ET-1, MDA and CAT, and resistance index (RI) of renal blood vessels increased significantly in CI-AKI rats. The 
increases in Scr and RI of renal blood vessels induced by diatrizoate were suppressed significantly and 
dose-dependently by pretreatment with KB-R7943. Histopathological and TUNEL results showed that 
the contrast medium-induced severe renal tubular 
necrosis and apoptosis were significantly and dose-dependently attenuated by KB-R7943. KB-R7943 significantly suppressed the increment of renal ET-1 content and MDA and CAT level induced by contrast medium administration. Activation of the reverse mode of NCX, followed by ET-1 overproduction and increased oxidative stress, seems to play an important role in the pathogenesis of CI-AKI. The inhibitor of the reverse mode of NCX, KB-R7943, has renoprotective effects on CI-AKI.

  20. Glaucarubinone sensitizes KB cells to paclitaxel by inhibiting ABC transporters via ROS-dependent and p53-mediated activation of apoptotic signaling pathways.

    Science.gov (United States)

    Karthikeyan, Subburayan; Hoti, Sugeerappa Laxmanappa; Nazeer, Yasin; Hegde, Harsha Vasudev

    2016-07-05

    Multidrug resistance (MDR) is considered to be the major contributor to failure of chemotherapy in oral squamous cell carcinoma (SCC). This study was aimed to explore the effects and mechanisms of glaucarubinone (GLU), one of the major quassinoids from Simarouba glauca DC, in potentiating cytotoxicity of paclitaxel (PTX), an anticancer drug in KB cells. Our data showed that the administration of GLU pre-treatment significantly enhanced PTX anti-proliferative effect in ABCB1 over-expressing KB cells. The Rh 123 drug efflux studies revealed that there was a significant transport function inhibition by GLU-PTX treatment. Interestingly, it was also found that this enhanced anticancer efficacy of GLU was associated with PTX-induced cell arrest in the G2/M phase of cell cycle. Further, the combined treatment of GLU-PTX had significant decrease in the expression levels of P-gp, MRPs, and BCRP in resistant KB cells at both mRNA and protein levels. Furthermore, the combination treatments showed significant reactive oxygen species (ROS) production, chromatin condensation and reduced mitochondrial membrane potential in resistant KB cells. The results from DNA fragmentation analysis also demonstrated the GLU induced apoptosis in KB cells and its synergy with PTX. Importantly, GLU and/or PTX triggered apoptosis through the activation of pro-apoptotic proteins such as p53, Bax, and caspase-9. Our findings demonstrated for the first time that GLU causes cell death in human oral cancer cells via the ROS-dependent suppression of MDR transporters and p53-mediated activation of the intrinsic mitochondrial pathway of apoptosis. Additionally, the present study also focussed on investigation of the protective effect of GLU and combination drugs in human normal blood lymphocytes. Normal blood lymphocytes assay indicated that GLU is able to induce selective toxicity in cancer cells and in silico molecular docking studies support the choice of GLU as ABC inhibitor to enhance PTX efficacy

  1. Introducing the Forensic Research/Reference on Genetics knowledge base, FROG-kb.

    Science.gov (United States)

    Rajeevan, Haseena; Soundararajan, Usha; Pakstis, Andrew J; Kidd, Kenneth K

    2012-09-01

    Online tools and databases based on multi-allelic short tandem repeat polymorphisms (STRPs) are actively used in forensic teaching, research, and investigations. The Fst value of each CODIS marker tends to be low across the populations of the world and most populations typically have all the common STRP alleles present diminishing the ability of these systems to discriminate ethnicity. Recently, considerable research is being conducted on single nucleotide polymorphisms (SNPs) to be considered for human identification and description. However, online tools and databases that can be used for forensic research and investigation are limited. The back end DBMS (Database Management System) for FROG-kb is Oracle version 10. The front end is implemented with specific code using technologies such as Java, Java Servlet, JSP, JQuery, and GoogleCharts. We present an open access web application, FROG-kb (Forensic Research/Reference on Genetics-knowledge base, http://frog.med.yale.edu), that is useful for teaching and research relevant to forensics and can serve as a tool facilitating forensic practice. The underlying data for FROG-kb are provided by the already extensively used and referenced ALlele FREquency Database, ALFRED (http://alfred.med.yale.edu). In addition to displaying data in an organized manner, computational tools that use the underlying allele frequencies with user-provided data are implemented in FROG-kb. These tools are organized by the different published SNP/marker panels available. This web tool currently has implemented general functions possible for two types of SNP panels, individual identification and ancestry inference, and a prediction function specific to a phenotype informative panel for eye color. The current online version of FROG-kb already provides new and useful functionality. We expect FROG-kb to grow and expand in capabilities and welcome input from the forensic community in identifying datasets and functionalities that will be most helpful

  2. The +37 kb Cebpa Enhancer Is Critical for Cebpa Myeloid Gene Expression and Contains Functional Sites that Bind SCL, GATA2, C/EBPα, PU.1, and Additional Ets Factors

    Science.gov (United States)

    Cooper, Stacy; Guo, Hong; Friedman, Alan D.

    2015-01-01

    The murine Cebpa gene contains an evolutionarily conserved 453 bp enhancer located at +37 kb that, together with its promoter, directs expression to myeloid progenitors and to long-term hematopoietic stem cells in transgenic mice. In human acute myeloid leukemia cases, the enhancer lacks point mutations but binds the RUNX1-ETO oncoprotein. The enhancer contains the H3K4me1 and H3K27Ac histone modifications, denoting an active enhancer, at progressively increasing levels as long-term hematopoietic stem cells transition to granulocyte-monocyte progenitors. We previously identified four enhancer sites that bind RUNX1 and demonstrated that their integrity is required for maximal enhancer activity in 32Dcl3 myeloid cells. The +37 kb Cebpa enhancer also contains C/EBP, Ets factor, Myb, GATA, and E-box consensus sites conserved in the human +42 kb CEBPA enhancer. Mutation of the two C/EBP, seven Ets, one Myb, two GATA, or two E-box sites reduces activity of an enhancer-promoter reporter in 32Dcl3 cells. In 293T gel shift assays, exogenous C/EBPα binds both C/EBP sites, c-Myb binds the Myb site, PU.1 binds the second Ets site, PU.1, Fli-1, ERG, and Ets1 bind the sixth Ets site, GATA2 binds both GATA sites, and SCL binds the second E-box. Endogenous hematopoietic RUNX1, PU.1, Fli-1, ERG, C/EBPα, GATA2, and SCL were previously shown to bind the enhancer, and we find that endogenous PU.1 binds the second Ets site in 32Dcl3 cells. Using CRISPR/Cas9, we developed 32Dcl3 lines in which the wild-type enhancer alleles are replaced with a variant mutant in the seven Ets sites. These lines have 20-fold reduced Cebpa mRNA when cultured in IL-3 or G-CSF, demonstrating a critical requirement for enhancer integrity for optimal Cebpa expression. In addition, these results indicate that the +37 kb Cebpa enhancer is the focus of multiple regulatory transcriptional pathways that impact its expression during normal hematopoiesis and potentially during myeloid transformation. PMID:25938608

  3. Protective effect of Na(+)/Ca (2+) exchange blocker KB-R7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rats.

    Science.gov (United States)

    Lv, Yan; Ren, Yongkui; Sun, Lufan; Wang, Shaojun; Wei, Minjie; Jia, Dalin

    2013-06-01

    Reverse-mode activation of the Na(+)/Ca(2+) exchanger (NCX) during reperfusion following ischemia contributes to Ca(2+) overload and cardiomyocyte injury. KB-R7943, a selective reverse-mode NCX inhibitor, reduces lethal reperfusion injury under non-ischemic conditions. However, the effectiveness of this compound under ischemic conditions is unclear. In the present study, we studied the effects of KB-R7943 in an animal model of hyperlipidemia. We further assessed whether the K ATP (+) channels are involved in potential protective mechanisms of KB-R7943. Twelve rats were fed normal chow, while 48 animals were fed a high cholesterol diet. The hearts from the control and hypercholesterolemic rats were subjected to 25 min of global ischemia followed by a 120-min reperfusion. Before this, hearts from hypercholesterolemic rats either received no intervention (cholesterol control group) or were pre-treated with 1 μM KB-R7943 and 0.3 μM of K ATP (+) blocker glibenclamide or glibenclamide alone. The infarction sizes (triphenyltetrazolium assay) were 35 ± 5.0 % in the control group, 46 ± 8.7 % in the cholesterol control group (p KB-R7943 group (p KB-R7943 and glibenclamide group, and 47 ± 8.5 % in the glibenclamide group (p KB-R7943 attenuated the magnitude of cell apoptosis (p KB-R7943 reduces the infarction size and apoptosis in hyperlipidemic animals through the activation of K ATP (+) channels.

  4. ARMed SPHINCS computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.; Cheng, C.-M.; Chung, K.-M.; Persiano, G.; Yang, B.-Y.

    2016-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on an embedded microprocessor with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41KB signature on an ARM Cortex

  5. OC-2-KB: A software pipeline to build an evidence-based obesity and cancer knowledge base.

    Science.gov (United States)

    Lossio-Ventura, Juan Antonio; Hogan, William; Modave, François; Guo, Yi; He, Zhe; Hicks, Amanda; Bian, Jiang

    2017-11-01

    Obesity has been linked to several types of cancer. Access to adequate health information activates people's participation in managing their own health, which ultimately improves their health outcomes. Nevertheless, the existing online information about the relationship between obesity and cancer is heterogeneous and poorly organized. A formal knowledge representation can help better organize and deliver quality health information. Currently, there are several efforts in the biomedical domain to convert unstructured data to structured data and store them in Semantic Web knowledge bases (KB). In this demo paper, we present, OC-2-KB (Obesity and Cancer to Knowledge Base), a system that is tailored to guide the automatic KB construction for managing obesity and cancer knowledge from free-text scientific literature (i.e., PubMed abstracts) in a systematic way. OC-2-KB has two important modules which perform the acquisition of entities and the extraction then classification of relationships among these entities. We tested the OC-2-KB system on a data set with 23 manually annotated obesity and cancer PubMed abstracts and created a preliminary KB with 765 triples. We conducted a preliminary evaluation on this sample of triples and reported our evaluation results.

  6. ARMed SPHINCS : computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.

    2015-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on a "very small device" with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41\\,KB signature on an ARM Cortex M3

  7. MicroRNA-205 suppresses the oral carcinoma oncogenic activity via down-regulation of Axin-2 in KB human oral cancer cell.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Sun-Young; Lee, Seul Ah; Park, Min-Gyeong; Yu, Sun-Kyoung; Lee, Myoung-Hwa; Park, Mi-Ra; Kim, Su-Gwan; Oh, Ji-Su; Lee, Sook-Young; Kim, Chun Sung; Kim, Heung-Joong; Chun, Hong Sung; Kim, Jin-Soo; Moon, Sung-Min; Kim, Do Kyung

    2014-02-01

    MicroRNA (miRNA) is a small noncoding RNA molecule, 19-25 nucleotides in length, which regulates several pathways including cell development, cell proliferation, carcinogenesis, apoptosis, etc. In this study, the over-expression of microRNA-205 (miR-205) increased the number of apoptotic cells by at least 4 times compared to the control. In addition, over-expressed miRNA in KB oral cancer cells triggered apoptosis via the caspase cascade, including the cleavage of caspase-9, caspase-7, caspase-3, and PARP. Flow cytometry showed that apoptotic cell death was increased significantly by 35.33% in KB oral cancer cells with over-expressed miR-205 compared to the control. The microarray data showed that axis inhibitor protein 2 (Axin2) was down-regulated in KB oral cancer cells transfected with miR-205. In addition, Axin2 was down-regulated by approximately 50% by over-expressed miR-205 at both the mRNA and protein levels. Interestingly, Axin2 was up-regulated in KB oral cancer compared to human normal oral keratinocytes. Furthermore, the cell cytotoxicity and apoptotic population of KB oral cancer cells were increased significantly after Axin2 siRNA transfection. These results suggest that Axin2 is might be as potential oncogene in KB oral cancer cells. The luciferase assay showed that over-expressed miR-205 in KB oral cancer cells suppressed AXIN2 expression through an interaction with its own binding site at AXIN2 3'UTR (64-92). These results suggest that miR-205 is a novel anti-oncogenic miRNA in KB oral cancer cells, and may have potential applications in oral cancer therapy.

  8. Paracetamol - toxicity and microbial utilization. Pseudomonas moorei KB4 as a case study for exploring degradation pathway.

    Science.gov (United States)

    Żur, Joanna; Wojcieszyńska, Danuta; Hupert-Kocurek, Katarzyna; Marchlewicz, Ariel; Guzik, Urszula

    2018-09-01

    Paracetamol, a widely used analgesic and antipyretic drug, is currently one of the most emerging pollutants worldwide. Besides its wide prevalence in the literature only several bacterial strains able to degrade this compound have been described. In this study, we isolated six new bacterial strains able to remove paracetamol. The isolated strains were identified as the members of Pseudomonas, Bacillus, Acinetobacter and Sphingomonas genera and characterized phenotypically and biochemically using standard methods. From the isolated strains, Pseudomonas moorei KB4 was able to utilize 50 mg L -1 of paracetamol. As the main degradation products, p-aminophenol and hydroquinone were identified. Based on the measurements of specific activity of acyl amidohydrolase, deaminase and hydroquinone 1,2-dioxygenase and the results of liquid chromatography analyses, we proposed a mechanism of paracetamol degradation by KB4 strain under co-metabolic conditions with glucose. Additionally, toxicity bioassays and the influence of various environmental factors, including pH, temperature, heavy metals at no-observed-effective-concentrations, and the presence of aromatic compounds on the efficiency and mechanism of paracetamol degradation by KB4 strain were determined. This comprehensive study about paracetamol biodegradation will be helpful in designing a treatment systems of wastewaters contaminated with paracetamol. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts

    Science.gov (United States)

    Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.

    2016-01-01

    Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

  10. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

    Science.gov (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

    2017-06-01

    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  11. KB-R7943 reduces 4-aminopyridine-induced epileptiform activity in adult rats after neuronal damage induced by neonatal monosodium glutamate treatment.

    Science.gov (United States)

    Hernandez-Ojeda, Mariana; Ureña-Guerrero, Monica E; Gutierrez-Barajas, Paola E; Cardenas-Castillo, Jazmin A; Camins, Antoni; Beas-Zarate, Carlos

    2017-05-09

    Neonatal monosodium glutamate (MSG) treatment triggers excitotoxicity and induces a degenerative process that affects several brain regions in a way that could lead to epileptogenesis. Na + /Ca 2+ exchangers (NCX1-3) are implicated in Ca 2+ brain homeostasis; normally, they extrude Ca 2+ to control cell inflammation, but after damage and in epilepsy, they introduce Ca 2+ by acting in the reverse mode, amplifying the damage. Changes in NCX3 expression in the hippocampus have been reported immediately after neonatal MSG treatment. In this study, the expression level of NCX1-3 in the entorhinal cortex (EC) and hippocampus (Hp); and the effects of blockade of NCXs on the seizures induced by 4-Aminopyridine (4-AP) were analysed in adult rats after neonatal MSG treatment. KB-R7943 was applied as NCXs blocker, but is more selective to NCX3 in reverse mode. Neonatal MSG treatment was applied to newborn male rats at postnatal days (PD) 1, 3, 5, and 7 (4 g/kg of body weight, s.c.). Western blot analysis was performed on total protein extracts from the EC and Hp to estimate the expression level of NCX1-3 proteins in relative way to the expression of β-actin, as constitutive protein. Electrographic activity of the EC and Hp were acquired before and after intracerebroventricular (i.c.v.) infusion of 4-AP (3 nmol) and KB-R7943 (62.5 pmol), alone or in combination. All experiments were performed at PD60. Behavioural alterations were also recorder. Neonatal MSG treatment significantly increased the expression of NCX3 protein in both studied regions, and NCX1 protein only in the EC. The 4-AP-induced epileptiform activity was significantly higher in MSG-treated rats than in controls, and KB-R7943 co-administered with 4-AP reduced the epileptiform activity in more prominent way in MSG-treated rats than in controls. The long-term effects of neonatal MSG treatment include increases on functional expression of NCXs (mainly of NCX3) in the EC and Hp, which seems to contribute to

  12. KB WOT Fisheries 2013 - Maintaining Excellence and Innvovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Beek, van F.A.

    2013-01-01

    Het KB programma voor Visserijonderzoek onderhoudt en ontwikkelt de expertise, die nodig is om de WOT voor de visserij uit te voeren. De inhoud van het KB WOT-programma voor 2013 weerspiegelt de recente discussies tussen IMARES, CVO en EZ over de toekomstige richting van het onderzoek. De KB

  13. In vitro Cytotoxicity, Pharmacokinetics, Tissue Distribution, and Metabolism of Small-Molecule Protein Kinase D Inhibitors, kb-NB142-70 and kb-NB165-09, in Mice bearing Human Cancer Xenografts

    Science.gov (United States)

    Guo, Jianxia; Clausen, Dana M.; Beumer, Jan H.; Parise, Robert A.; Egorin, Merrill J.; Bravo-Altamirano, Karla; Wipf, Peter; Sharlow, Elizabeth R.; Wang, Qiming Jane; Eiseman, Julie L.

    2012-01-01

    Purpose Protein kinase D (PKD) mediates diverse biological responses including cell growth and survival. Therefore, PKD inhibitors may have therapeutic potential. We evaluated the in vitro cytotoxicity of two PKD inhibitors, kb-NB142-70 and its methoxy analog, kb-NB165-09, and examined their in vivo efficacy and pharmacokinetics. Methods The in vitro cytotoxicities of kb-NB142-70 and kb-NB165-09 were evaluated by MTT assay against PC-3, androgen independent prostate cancer cells, and CFPAC-1 and PANC-1, pancreatic cancer cells. Efficacy studies were conducted in mice bearing either PC-3 or CPFAC-1 xenografts. Tumor-bearing mice were euthanized between 5 and 1440 min after iv dosing, and plasma and tissue concentrations were measured by HPLC-UV. Metabolites were characterized by LC-MS/MS. Results kb-NB142-70 and kb-NB165-09 inhibited cellular growth in the low-mid μM range. The compounds were inactive when administered to tumor-bearing mice. In mice treated with kb-NB142-70, the plasma Cmax was 36.9 nmol/mL and the PC-3 tumor Cmax was 11.8 nmol/g. In mice dosed with kb-NB165-09, the plasma Cmax was 61.9 nmol/mL while the PANC-1 tumor Cmax was 8.0 nmol/g. The plasma half-lives of kb-NB142-70 and kb-NB165-09 were 6 and 14 min, respectively. Both compounds underwent oxidation and glucuronidation. Conclusions kb-NB142-70 and kb-NB165-09 were rapidly metabolized, and concentrations in tumor were lower than those required for in vitro cytotoxicity. Replacement of the phenolic hydroxyl group with a methoxy group increased the plasma half-life of kb-NB165-09 2.3-fold over that of kb-NB142-70. Rapid metabolism in mice suggests that next-generation compounds will require further structural modifications to increase potency and/or metabolic stability. PMID:23108699

  14. Growth characteristics of Lactobacillus brevis KB290 in the presence of bile.

    Science.gov (United States)

    Kimoto-Nira, Hiromi; Suzuki, Shigenori; Suganuma, Hiroyuki; Moriya, Naoko; Suzuki, Chise

    2015-10-01

    Live Lactobacillus brevis KB290 have several probiotic activities, including immune stimulation and modulation of intestinal microbial balance. We investigated the adaptation of L. brevis KB290 to bile as a mechanism of intestinal survival. Strain KB290 was grown for 5 days at 37 °C in tryptone-yeast extract-glucose (TYG) broth supplemented with 0.5% sodium acetate (TYGA) containing 0.15%, 0.3%, or 0.5% bile. Growth was determined by absorbance at 620 nm or by dry weight. Growth was enhanced as the broth's bile concentration increased. Bile-enhanced growth was not observed in TYG broth or with xylose or fructose as the carbon source, although strain KB290 could assimilate these sugars. Compared with cells grown without bile, cells grown with bile had twice the cell yield (dry weight) and higher hydrophobicity, which may improve epithelial adhesion. Metabolite analysis revealed that bile induced more lactate production by glycolysis, thus enhancing growth efficiency. Scanning electron microscopy revealed that cells cultured without bile for 5 days in TYGA broth had a shortened rod shape and showed lysis and aggregation, unlike cells cultured for 1 day; cells grown with bile for 5 days had an intact rod shape and rarely appeared damaged. Cellular material leakage through autolysis was lower in the presence of bile than in its absence. Thus lysis of strain KB290 cells cultured for extended periods was suppressed in the presence of bile. This study provides new role of bile and sodium acetate for retaining an intact cell shape and enhancing cell yield, which are beneficial for intestinal survival. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Report of the KB-WOT fisheries programme carried out in 2007

    NARCIS (Netherlands)

    Dickey-Collas, M.; Beek, van F.A.

    2008-01-01

    This report documents the activities of the KB WOT fisheries programme in 2007. It gives the results, products and documents the experienced gained by staff through the programme. It also shows how the individual projects fit into the research priority areas of WOT fisheries programme for 2007. The

  16. Alpinia pricei Rhizome Extracts Induce Cell Cycle Arrest in Human Squamous Carcinoma KB Cells and Suppress Tumor Growth in Nude Mice

    Directory of Open Access Journals (Sweden)

    You-Cheng Hseu

    2011-01-01

    Full Text Available Alpinia pricei has been shown to induce apoptosis in human squamous carcinoma (KB cells. In this study, we report the effectiveness of the ethanol (70% extracts of A. pricei rhizome (AP extracts in terms of tumor regression as determined using both in vitro cell culture and in vivo athymic nude mice models of KB cells. We found that the AP extract (25–200 μg/mL treatment decreased the proliferation of KB cells by arresting progression through the G2/M phase of the cell cycle. This cell cycle blockade was associated with reductions in cyclin A and B1, Cdc2, and Cdc25C, and increased p21/WAF1, Wee1, p53 and phospho-p53 (p-p53 in a dose- and time-dependent manner. Moreover, we found that AP extract treatment decreased metalloproteinase-9 (MMP-9 and urokinase plasminogen activator (u-PA expression, while expression of their endogenous inhibitors, tissue inhibitor of MMP-1 (TIMP-1 and plasminogen activator inhibitor-1 (PAI-1, were increased in KB cells. Furthermore, AP extract treatment effectively delayed tumor incidence in nude mice inoculated with KB cells and reduced the tumor burden. AP extract treatment also induced apoptotic DNA fragmentation, as detected by in situ TUNEL staining. Thus, A. pricei may possess antitumor activity in human squamous carcinoma (KB cells.

  17. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    Science.gov (United States)

    Doherty, Ben; Lawlor, Denise; Gillet, Jean-Pierre; Gottesman, Michael; O'Leary, John J; Stordal, Britta

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer. A Taqman low-density array was used to characterize the expression of 380 genes previously associated with chemoresistance. Identified pathways were further analyzed using cytotoxicity assays, metabolomics and western blots. KB-8-5-11 cells were sensitive to CuSO4 and the glutathione inhibitor buthionine sulphoximine. Expression of ATPase, Cu(2+) transporting alpha (ATP7A) and ATP7B were decreased at the protein and gene levels respectively in KB-8-5-11. KB-8-5-11 had decreased gene expression of glutathione S-transferase pi 1 (GSTP1), GSTA4 and GSTK1. Cisplatin treatment significantly lowered total cellular glutathione in parental KB-3-1 cells. Glutathione also tended to be lower in KB-8-5-11 cells compared to KB-3-1 cells. KB-8-5-11 cells have alterations in their copper transporters and glutathione metabolism, contributing to their cisplatin-sensitive phenotype.

  18. [Effect of the 10 kb sequence of piscine Streptococcus agalactiae on bacterial virulence].

    Science.gov (United States)

    Liu, Guangjin; Zhu, Jielian; Shi, Ziwei; Ding, Ming; Wang, Ruyi; Yao, Huochun; Lu, Chengping; Xu, Pao

    2016-01-04

    From the previous comparative genomic analysis, we found a specific unknown 10 kb sequence (including 11 Open reading Frames) in Chinese piscine strain GD201008-001 genome. To study the role of 10 kb in the pathogenicity of piscine S. agalactiae, the 10 kb sequence was deleted from the GD201008-001 genome. The isogenic mutant Δ10 kb was constructed by using the temperature-sensitive Streptococcus-E. coli shuttle vector pSET4s. We compared the growth characteristics, adherence to HEp-2 cell and bacterial virulence in a zebrafish infection model between wild strain and mutant. Meanwhile the expressions of the known virulence genes from GD201008-001 and Δ10 kb were also quantified by real-time PCR. The Δ10 kb showed no significant differences in bacterial morphology and adherence to HEp-2 cells compared with the wild-type strain, but the speed of growth was slightly slower than the wild strain. Furthermore the 50% lethal dose of Δ10 kb was decreased up to 10-fold (P kb sequence of piscine Streptococcus agalactiae exerts a significant effect on bacterial virulence and probably regulates the virulence genes expression of GD20 1008-001.

  19. Radiative transfer in disc galaxies - V. The accuracy of the KB approximation

    Science.gov (United States)

    Lee, Dukhang; Baes, Maarten; Seon, Kwang-Il; Camps, Peter; Verstocken, Sam; Han, Wonyong

    2016-12-01

    We investigate the accuracy of an approximate radiative transfer technique that was first proposed by Kylafis & Bahcall (hereafter the KB approximation) and has been popular in modelling dusty late-type galaxies. We compare realistic galaxy models calculated with the KB approximation with those of a three-dimensional Monte Carlo radiative transfer code SKIRT. The SKIRT code fully takes into account of the contribution of multiple scattering whereas the KB approximation calculates only single scattered intensity and multiple scattering components are approximated. We find that the KB approximation gives fairly accurate results if optically thin, face-on galaxies are considered. However, for highly inclined (I ≳ 85°) and/or optically thick (central face-on optical depth ≳1) galaxy models, the approximation can give rise to substantial errors, sometimes, up to ≳40 per cent. Moreover, it is also found that the KB approximation is not always physical, sometimes producing infinite intensities at lines of sight with high optical depth in edge-on galaxy models. There is no `simple recipe' to correct the errors of the KB approximation that is universally applicable to any galaxy models. Therefore, it is recommended that the full radiative transfer calculation be used, even though it is slower than the KB approximation.

  20. Nuclear factor kB (NF-KB): signalosoma and its importance in cancer and inflammatories diseases

    International Nuclear Information System (INIS)

    Echeverri, Nancy P; Mockus, Ismena S

    2008-01-01

    The nuclear factor B (NF- B) is a dimer conformed by Rel family. NF- B is found in cytoplasm bound to inhibitor proteins (I B). I B are phosphorylated by different kinases who are part of signalosome as IeB kinases (IKK , IKK and NF- B essential modulator or NEMO), the mitogenic activated protein kinase (MAPK or p38) and NF-eB inducer kinase (NIK). These kinases are activated by different cytokines and ultraviolet light, I B phosphorylated induce their ubiquitination and proteosome degradation subsequently NF- B release and nucleus translocation. Nowadays, the NF- B activation by oxidative stress, genotoxic stress and DNA damage pathways. In contrast with the classical pathway, in this pathway there are a SUMOilation and nuclear translocation of NEMO. In nucleus NEMO interact with ataxia telangiectasia muted which is activated by chromatin changes and DNA damage. The complex ATM/NEMO is later translocated to cytoplasm where IKK is phosphorylated by ATM bringing to ubiquitination and thus NF- B releasing which is translocated to nucleus. NF- B induces survival rising antioxidants enzymes as superoxide dismutase, catalase and glutathione. These enzymes act in the control of oxidative species levels in the cell. NF- B over expression is related with inflammation and cancer. Nowadays, is development a pharmacological search which can act inhibiting NF- B signalosome molecules, not only to inflammatory disease whereas to radiotherapy and chemotherapy cancer resistance.

  1. Alteration in Inflammation-related miR-146a Expression in NF-KB Signaling Pathway in Diabetic Rat Hippocampus.

    Science.gov (United States)

    Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza

    2016-03-01

    The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.

  2. Thermal performance measurements on ATLAS-SCT KB forward modules

    CERN Document Server

    Donegà, M; D'Onofrio, M; Ferrère, D; Hirt, C; Ikegami, Y; Kohriki, T; Kondo, T; Lindsay, S; Mangin-Brinet, M; Niinikoski, T O; Pernegger, H; Perrin, E; Taylor, G; Terada, S; Unno, Y; Wallny, R; Weber, M

    2003-01-01

    The thermal design of the KB module is presented. A Finite Elements Analysis (FEA) has been used to finalize the module design. The thermal performance of an outer irradiated KB module has been measured at different cooling conditions. The thermal runaway of the module has been measured. The FEA model has been compared with the measurements and has been used to predict the thermal performance in a realistic SCT scenario.

  3. The protective effect of Na+/Ca2+ exchange blocker kb-r7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rat.

    Science.gov (United States)

    Ren, Yongkui; Deng, Liju; Cai, Yunfei; Lv, Yan; Jia, Dalin

    2014-11-01

    KB-R7943 reduces lethal reperfusion injury under normal conditions, but its effectiveness under certain pathological states is in dispute. In the present study, we sought to determine the effect of KB-R7943 in hyperlipidemic animals and assess if the K ATP (+) are involved in the protective mechanisms. In group 1 (G1), isolated rat hearts underwent 25 min global ischemia (GI) and 120 min reperfusion (R). In group 2 (G2), G1 was repeated but the animals were subjected to a 1.5 % cholesterol-enriched diet during 6 weeks (hypercholesterolemic animals). In group 3 (G3), G2 was repeated but 1 μM KB-R7943 was added to the perfusate for 10 min from the start of reperfusion. In group 4 (G4), G3 was repeated, and glibenclamide (K ATP (+) , blocker, 0.3 μM) was administered. The infarct size was measured by triphenyltetrazolium. The infarct size was 35 ± 5.0 % in G1 and 46 ± 8.7 % in G2 (P KB-R7943 reduced the infarct size (28.6 ± 3.3 % in G3 vs. G2, P KB-R7943 attenuated apoptotic cell (G3 vs. G2, P KB-R7943. Thus, diet-induced hypercholesterolemia enhances myocardial injury; KB-R7943 reduces infarct size and apoptosis in hyperlipidemic animals through the activation of K(+)ATP channels.

  4. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  5. Fluorescent Inhibitors as Tools To Characterize Enzymes: Case Study of the Lipid Kinase Phosphatidylinositol 4-Kinase IIIβ (PI4KB).

    Science.gov (United States)

    Humpolickova, Jana; Mejdrová, Ivana; Matousova, Marika; Nencka, Radim; Boura, Evzen

    2017-01-12

    The lipid kinase phosphatidylinositol 4-kinase IIIβ (PI4KB) is an essential host factor for many positive-sense single-stranded RNA (+RNA) viruses including human pathogens hepatitis C virus (HCV), Severe acute respiratory syndrome (SARS), coxsackie viruses, and rhinoviruses. Inhibitors of PI4KB are considered to be potential broad-spectrum virostatics, and it is therefore critical to develop a biochemical understanding of the kinase. Here, we present highly potent and selective fluorescent inhibitors that we show to be useful chemical biology tools especially in determination of dissociation constants. Moreover, we show that the coumarin-labeled inhibitor can be used to image PI4KB in cells using fluorescence-lifetime imaging microscopy (FLIM) microscopy.

  6. The redesigned Forensic Research/Reference on Genetics-knowledge base, FROG-kb.

    Science.gov (United States)

    Kidd, Kenneth K; Soundararajan, Usha; Rajeevan, Haseena; Pakstis, Andrew J; Moore, Katherine N; Ropero-Miller, Jeri D

    2018-03-01

    The Forensic Resource/Reference on Genetics-knowledge base (FROG-kb) web site was introduced in 2011 and in the five years since the previous publication ongoing research into how the database can better serve forensics has resulted in extensive redesign of the database interface and functionality. Originally designed as a prototype to support forensic use of single nucleotide polymorphisms (SNPs), FROG-kb provides a freely accessible web interface that facilitates forensic practice and can be useful for teaching and research. Based on knowledge gained through its use, the web interface has been redesigned for easier navigation through the multiple components. The site also has functional enhancements, extensive new documentation, and new reference panels of SNPs with new curated data. FROG-kb focuses on single nucleotide polymorphisms (SNPs) and provides reference population data for several published panels of individual identification SNPs (IISNPs) and several published panels of ancestry inference SNPs (AISNPs). For each of the various marker panels with reference population data, FROG-kb calculates random match probabilities (RMP) and relative likelihoods of ancestry for a user-entered genotype profile (either completely or partially specified). Example genotype profiles are available and the User's Manual presents interpretation guidelines for the calculations. The extensive documentation along with ongoing updates makes FROG-kb a comprehensive tool in facilitating use of SNPs in forensic practice and education. An overview of the new FROG-kb with examples and material explaining the results of its use are presented here. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. The Half-Life of the HSV-1 1.5 kb LAT Intron is similar to the half-Life of the 2.0 kb LAT Intron

    Science.gov (United States)

    Brinkman, Kerry K.; Mishra, Prakhar; Fraser, Nigel W.

    2013-01-01

    Herpes Simplex Virus type 1 (HSV-1) establishes a latent infection in the sensory neurons of the peripheral nervous system of humans. Although about 80 genes are expressed during the lytic cycle of the virus infection, essentially only one gene is expressed during the latent cycle. This gene is known as the latency associated transcript (LAT) and it appears to play a role in the latency cycle through an anti-apoptotic function in the 5’ end of the gene and miRNA encoded along the length of the transcript which down regulate some of the viral immediate early (IE) gene products. The LAT gene is about 8.3 kb long and consists of two exons separated by an unusual intron. The intron between the exons consists of two nested introns. This arrangement of introns has been called a twintron. Furthermore, the larger (2 kb) intron has been shown to be very stable. In this study we measure the stability of the shorter 1.5 kb nested intron and find its half-life is similar to the longer intron. This was achieved by deleting the 0.5 kb overlapping intron from a plasmid construct designed to express the LAT transcript from a tet-inducible promoter, and measuring the half-life of the 1.5 kb intron in tissue culture cells. This finding supports the hypothesis that it is the common branch-point region of these nested introns that is responsible for their stability. PMID:23335177

  8. KB WOT Fisheries 2018: maintaining excellence and innovation in fisheries research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and develop expertise needed to carry out the Dutch statutory obligations in fisheries monitoring and advice. The KB WOT Fisheries programme developed for 2018 reflects the scientific and management needs of the WOT fisheries programme. The

  9. KB WOT Fisheries 2015 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2015-01-01

    The KB WOT Fisheries programme is essential to the maintenance and development of the expertise which are needed for the Dutch statutory obligations in fisheries monitoring and advice. The contents of the KB WOT Fisheries programme for 2015 reflects the needs of the research developments the WOT

  10. Fabrication of nested elliptical KB mirrors using profile coating for synchrotron radiation X-ray focusing

    International Nuclear Information System (INIS)

    Liu Chian; Ice, G.E.; Liu, W.; Assoufid, L.; Qian, J.; Shi, B.; Khachatryan, R.; Wieczorek, M.; Zschack, P.; Tischler, J.Z.

    2012-01-01

    This paper describes fabrication methods used to demonstrate the advantages of nested or Montel optics for micro/nanofocusing of synchrotron X-ray beams. A standard Kirkpatrick-Baez (KB) mirror system uses two separated elliptical mirrors at glancing angles to the X-ray beam and sequentially arranged at 90° to each other to focus X-rays successively in the vertical and horizontal directions. A nested KB mirror system has the two mirrors positioned perpendicular and side-by-side to each other. Compared to a standard KB mirror system, Montel optics can focus a larger divergence and the mirrors can have a shorter focal length. As a result, nested mirrors can be fabricated with improved demagnification factor and ultimately smaller focal spot, than with a standard KB arrangement. The nested system is also more compact with an increased working distance, and is more stable, with reduced complexity of mirror stages. However, although Montel optics is commercially available for laboratory X-ray sources, due to technical difficulties they have not been used to microfocus synchrotron radiation X-rays, where ultra-precise mirror surfaces are essential. The main challenge in adapting nested optics for synchrotron microfocusing is to fabricate mirrors with a precise elliptical surface profile at the very edge where the two mirrors meet and where X-rays scatter. For example, in our application to achieve a sub-micron focus with high efficiency, a surface figure root-mean-square (rms) error on the order of 1 nm is required in the useable area along the X-ray footprint with a ∼0.1 mm-diameter cross section. In this paper we describe promising ways to fabricate precise nested KB mirrors using our profile coating technique and inexpensive flat Si substrates.

  11. KB WOT Fisheries 2014 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2013-01-01

    The KB WOT Fisheries programme is fundamental to the maintenance and development of expertise needed to carry out the statutory obligations of the Dutch WOT Fisheries monitoring and advice. The structure of the KB WOT Fisheries programme 2014 is a result of discussions on the research direction and

  12. The UniProtKB/Swiss-Prot knowledgebase and its Plant Proteome Annotation Program.

    Science.gov (United States)

    Schneider, Michel; Lane, Lydie; Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Bougueleret, Lydie; Bairoch, Amos

    2009-04-13

    The UniProt knowledgebase, UniProtKB, is the main product of the UniProt consortium. It consists of two sections, UniProtKB/Swiss-Prot, the manually curated section, and UniProtKB/TrEMBL, the computer translation of the EMBL/GenBank/DDBJ nucleotide sequence database. Taken together, these two sections cover all the proteins characterized or inferred from all publicly available nucleotide sequences. The Plant Proteome Annotation Program (PPAP) of UniProtKB/Swiss-Prot focuses on the manual annotation of plant-specific proteins and protein families. Our major effort is currently directed towards the two model plants Arabidopsis thaliana and Oryza sativa. In UniProtKB/Swiss-Prot, redundancy is minimized by merging all data from different sources in a single entry. The proposed protein sequence is frequently modified after comparison with ESTs, full length transcripts or homologous proteins from other species. The information present in manually curated entries allows the reconstruction of all described isoforms. The annotation also includes proteomics data such as PTM and protein identification MS experimental results. UniProtKB and the other products of the UniProt consortium are accessible online at www.uniprot.org.

  13. FragKB: structural and literature annotation resource of conserved peptide fragments and residues.

    Directory of Open Access Journals (Sweden)

    Ashish V Tendulkar

    Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.

  14. Chemoresistance to 5-FU inhibited by 635 nm LED irradiation in CD133+ KB cell line.

    Science.gov (United States)

    Kim, Donghwi; Park, Mineon; Jang, Hyunwoong; Hyun, Hoon; Lim, Wonbong

    2018-01-01

    Consistent with cancer stem cell theory, a small fraction of cancer cells, described as cancer stem cells (CSCs), may promote tumor recurrence and anti-cancer drug resistance. Therefore, much effort has been devoted to the development of CSC targeted therapy to vanquish drug resistance. In this study, we have investigated the effect of multiple light-emitting diode (LED) irradiation treatments with conventional anti-cancer drugs on CSC-like oral cancer cells that acquired stemness by ectopic over expression of CD133. To evaluate combined LED irradiation anti-cancer drug effects, we investigated the chemosensitizing effect of 635 nm irradiation on 5-fluorouracil (5FU)-treated KB CD133+ and KB Vec cells, interrogating the underlying molecular mechanisms associated with stemness and apoptosis that are responsible for chemopreventive activity. In addition, combination therapy with LED irradiation and 5-FU treatment was carried out in KB CD133+ and KB Vec cell-inoculated mouse models. LED irradiation of 635 nm inhibited CSC-like properties consistent with a decrease in OCT4 and NANOG protein expression, reducing colony-forming ability. In addition, LED irradiation enhanced 5-FU-induced cytotoxicity and improved 5-FU chemosensitivity in KB CD133+ via enhancement of apoptosis. These findings were validated in vivo, wherein LED irradiation combined with 5-FU treatment inhibited tumor growth in KB CD133+ -inoculated mice. Collectively, our results provide novel evidence for 635 nm irradiation-induced 5-FU chemosensitization of CSC in oral cancer. In addition, this research highlights that 635 nm LED irradiation may serve as an adjunct treatment to conventional chemotherapeutic drugs in patients with oral cancer.

  15. The human thyroglobulin gene is over 300 kb long and contains introns of up to 64 kb

    NARCIS (Netherlands)

    Baas, F.; van Ommen, G. J.; Bikker, H.; Arnberg, A. C.; de Vijlder, J. J.

    1986-01-01

    Thyroglobulin (Tg), the precursor of thyroid hormones, is a 660.000 Da dimeric glycoprotein synthesized exclusively in the thyroid gland. We have cloned the human thyroglobulin gene from cosmid and phage libraries and constructed a complete restriction map. The gene encodes an 8.7 kb mRNA, covers at

  16. Inhibition of the cardiac ATP-dependent potassium current by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Vornanen, Matti

    2014-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, in cardiomyocytes KB-R7943 also effectively blocks several K(+) currents including the delayed rectifier, IKr, and background inward rectifier, IK1. In the present study we analyze the effects of KB-R7943 on the ATP-dependent potassium current (IKATP) recorded by whole-cell patch-clamp in ventricular cardiomyocytes from a mammal (mouse) and a fish (crucian carp). IKATP was induced by external application of a mitochondrial uncoupler CCCP (3×10(-7) M) and internal perfusion of the cell with ATP-free pipette solution. A weakly inwardly rectifying current with a large outward component, recorded in the presence of CCCP, was blocked with 10(-5) M glibenclamide by 56.1±4.6% and 56.9±3.6% in crucian carp and mouse ventricular myocytes, respectively. In fish cardiomyocytes IKATP was blocked by KB-R7943 with an IC50 value of 3.14×10(-7) M, while in mammalian cells IC50 was 2.8×10(-6) M (PKB-R7943 inhibited CCCP-induced IKATP by 99.9±0.13% and 97.5±1.2% in crucian carp and mouse ventricular myocytes, respectively. In crucian carp the IKATP is about an order of magnitude more sensitive to KB-R7943 than the background IK1, but in mammals IKATP and IK1 are almost equally sensitive to KB-R7943. Therefore, the ability of KB-R7943 to block IKATP should be taken into account together with INCX inhibition when investigating possible cardioprotective effects of this compound. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Umbelliferone arrest cell cycle at G0/G1 phase and induces apoptosis in human oral carcinoma (KB) cells possibly via oxidative DNA damage.

    Science.gov (United States)

    Vijayalakshmi, Annamalai; Sindhu, Ganapathy

    2017-08-01

    Umbelliferone (UMB) has widespread pharmacological activity, comprising anti-inflammatory, anti-oxidant, anti-genotoxic and anti-immunomodulatory but the anticancer activity remains unknown in human oral carcinoma (HOC) KB cells. MTT assay determinations was revealed that treatment of KB cells with UMB, prevent and reduce the cell proliferation with the IC 50 - 200μM as well as induces loss of cell viability, morphology change and internucleosomal DNA fragmentation in a concentration dependent manner. Acridine orange and ethidium bromide dual staining assay established that UMB induced apoptosis in KB cells in a dose dependent manner. Alkaline comet assay determination revealed UMB has the potential to increase oxidative DNA damage in KB cells through DNA tail formation significantly (pKB cells. Similarly, we observed increased DNA damage stimulated apoptotic morphological changes in UMB treated cells. Taken together, the present study suggests that UMB exhibits anticancer effect on KB cell line with the increased generation of intracellular ROS, triggered oxidative stress mediated depolarization of mitochondria, which contributes cell death via DNA damage as well as cell cycle arrest at G0/G1 phase. The results have also provided us insight in the pharmacological backgrounds for the potential use of UMB, to target divergent pathways of cell survival and cell death. To conclude UMB could develop as a novel candidate for cancer chemoprevention and therapy, which is our future focus and to develop a connectivity map between in vivo and in vitro activity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. UniProtKB amid the turmoil of plant proteomics research

    Directory of Open Access Journals (Sweden)

    Michel eSchneider

    2012-12-01

    Full Text Available The UniProt knowledgebase (UniProtKB provides a single, centralized, authoritative resource for protein sequences and functional information. The majority of its records is based on automatic translation of coding sequences (CDS provided by submitters at the time of initial deposition to the nucleotide sequence databases (INSDC. More and more frequently, only the raw sequence of a complete genome is deposited to the nucleotide sequence databases and the gene model predictions and annotations are kept in separate, specialized model organism databases (MODs. In order to be able to provide the complete proteome of model organisms, UniProtKB had to implement pipelines for import of protein sequences from Ensembl and EnsemblGenomes.A single genome can be the target of several unrelated sequencing projects and the final assembly and gene model predictions may diverge quite significantly. In addition, several cultivars of the same species are often sequenced -1001 Arabidopsis cultivars are currently under way- and the resulting proteomes are far from being identical. Therefore, one challenge for UniProtKB is to store and organize these data in a convenient way and to clearly defined reference proteomes that should be made available to users. Manual annotation is one of the landmarks of the Swiss-Prot section of UniProtKB. Besides adding functional annotation, curators are checking, and often correcting, gene model predictions. For plants, this task is limited to Arabidopsis thaliana and Oryza sativa subsp japonica. Proteomics data providing experimental evidences confirming the existence of proteins or identifying sequence features such as post translational modifications are also imported into UniProtKB records and the knowledgebase is cross-referenced to numerous proteomics resources.

  19. Biomarkers’ Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM

    Directory of Open Access Journals (Sweden)

    Gretchen L. W. Heavner

    2018-02-01

    Full Text Available Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1TM, including several reductive dehalogenases (RDases and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR as a targeted approach for quantifying transcript copies in the KB-1TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10−12 to 5.9 × 10−10 microelectron equivalents per cell per hour (μeeq/cell∙h. Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA and the hydrogenase HupL (R2 = 0.83 and 0.88, respectively, but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1TM. Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1TM. The addition of oxygen induced cell stress that caused respiration

  20. Biomarkers' Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM.

    Science.gov (United States)

    Heavner, Gretchen L W; Mansfeldt, Cresten B; Debs, Garrett E; Hellerstedt, Sage T; Rowe, Annette R; Richardson, Ruth E

    2018-02-08

    Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR) rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC) containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1 TM , including several reductive dehalogenases (RDases) and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs) and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR) as a targeted approach for quantifying transcript copies in the KB-1 TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1 TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10 -12 to 5.9 × 10 -10 microelectron equivalents per cell per hour (μeeq/cell∙h). Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA) and the hydrogenase HupL (R² = 0.83 and 0.88, respectively), but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1 TM . Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1 TM . The addition of oxygen induced cell stress that caused respiration rates

  1. Inhibition of the cardiac inward rectifier potassium currents by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Alekseeva, Eugenia I; Vornanen, Matti

    2013-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, KB-R7943 is shown to be a potent blocker of several ion currents including inward and delayed rectifier K(+) currents of cardiomyocytes. To further characterize KB-R7943 as a blocker of the cardiac inward rectifiers we compared KB-R7943 sensitivity of the background inward rectifier (IK1) and the carbacholine-induced inward rectifier (IKACh) currents in mammalian (Rattus norvegicus; rat) and fish (Carassius carassius; crucian carp) cardiac myocytes. The basal IK1 of ventricular myocytes was blocked with apparent IC50-values of 4.6×10(-6) M and 3.5×10(-6) M for rat and fish, respectively. IKACh was almost an order of magnitude more sensitive to KB-R7943 than IK1 with IC50-values of 6.2×10(-7) M for rat and 2.5×10(-7) M for fish. The fish cardiac NCX current was half-maximally blocked at the concentration of 1.9-3×10(-6) M in both forward and reversed mode of operation. Thus, the sensitivity of three cardiac currents to KB-R7943 block increases in the order IK1~INCXrectifier potassium currents, in particular IKACh, should be taken into account when interpreting the data with this inhibitor from in vivo and in vitro experiments in both mammalian and fish models. © 2013.

  2. Inhibition of Akt activity induces the mesenchymal-to-epithelial reverting transition with restoring E-cadherin expression in KB and KOSCC-25B oral squamous cell carcinoma cells

    Directory of Open Access Journals (Sweden)

    Hong Sam-Pyo

    2009-02-01

    Full Text Available Abstract Background The Akt/PKB family of kinases is frequently activated in human cancers, including oral squamous cell carcinoma (OSCC. Akt-induced epithelial-to-mesenchymal transition (EMT involves downregulation of E-cadherin, which appears to result from upregulation of the transcription repressor Snail. Recently, it was proposed that carcinoma cells, especially in metastatic sites, could acquire the mesenchymal-to-epithelial reverting transition (MErT in order to adapt the microenvironments and re-expression of E-cadherin be a critical indicator of MErT. However, the precise mechanism and biologic or clinical importance of the MErT in cancers have been little known. This study aimed to investigate whether Akt inhibition would restore the expression of E-cadherin and β-catenin, reduce that of Vimentin, and induce the MErT in OSCC cells with low or negative expression of E-cadherin. We also investigate whether inhibition of Akt activity would affect the E-cadherin repressors and signaling molecules like NF-κB, ERK, and p38. Methods We screened several OSCC cell lines in order to select suitable cell line models for inducing MErT, using immunoblotting and methylation specific-PCR. We examined whether Akt inhibitor phosphatidylinositol ether lipid analogues (PIA treatment would restore the expression of E-cadherin and β-catenin, reduce that of Vimentin, and induce the MErT in KB and KOSCC-25B cells using RT-PCR, immunoblotting, immunofluorescence analysis, and in vitro migration assay. We also investigated whether inhibition of Akt activity would affect the E-cadherin repressors, including Snail, Twist, and SIP-1/ZEB-2 and signaling molecules like NF-κB, ERK, JNK, and p38 using RT-PCR, immunoblotting, and immunofluorescence analysis. Results Of the 7 OSCC cell lines, KB and KOSCC-25B showed constitutively activated phosphorylated Akt and low or negative expression of E-cadherin. Inhibition of Akt activity by PIA decreased NF-κB signaling

  3. Apoptosis-Inducing Effect of Three Medicinal Plants on Oral Cancer Cells KB and ORL-48

    Directory of Open Access Journals (Sweden)

    Mohd Zabidi Majid

    2014-01-01

    Full Text Available Brucea javanica, Azadirachta indica, and Typhonium flagelliforme are medicinal plants commonly used to treat conditions associated with tumour formation. This study aimed to determine the antiproliferative activity of these plants extracts on KB and ORL-48 oral cancer cell lines and to suggest their mode of cell death. The concentration producing 50% cell inhibition (IC50 was determined and the activity was examined under an inverted microscope. Immunohistochemistry fluorescent staining method (TUNEL was performed to indicate the mechanism of cell death and the fragmented DNA band pattern produced was obtained for verification. Compared to Azadirachta sp. and Typhonium sp., the antiproliferative activity of Brucea sp. extract was the most potent on both KB and ORL-48 cells with IC50 of 24.37 ± 1.75 and 6.67 ± 1.15 µg/mL, respectively. Signs of cell attrition were observed 24 hr after treatment. Green fluorescent spots indicating cell death by apoptosis were observed in images of both cells following treatment with all the three extracts. DNA fragments harvested from Brucea-treated cells produced bands in a ladder pattern suggesting the apoptotic effect of the extract. It is thus concluded that Brucea sp. extract exhibited cytotoxic activity on ORL-48 cells and their action mechanism is via apoptosis.

  4. A low-delay 8 Kb/s backward-adaptive CELP coder

    Science.gov (United States)

    Neumeyer, L. G.; Leblanc, W. P.; Mahmoud, S. A.

    1990-01-01

    Code excited linear prediction coding is an efficient technique for compressing speech sequences. Communications quality of speech can be obtained at bit rates below 8 Kb/s. However, relatively large coding delays are necessary to buffer the input speech in order to perform the LPC analysis. A low delay 8 Kb/s CELP coder is introduced in which the short term predictor is based on past synthesized speech. A new distortion measure that improves the tracking of the formant filter is discussed. Formal listening tests showed that the performance of the backward adaptive coder is almost as good as the conventional CELP coder.

  5. Paradoxical effects of KB-R7943 on arrhythmogenicity in a chronic myocardial infarction rabbit model.

    Science.gov (United States)

    Chang, Po-Cheng; Wo, Hung-Ta; Lee, Hui-Ling; Wen, Ming-Shien; Chou, Chung-Chuan

    2015-07-01

    Na(+)/Ca(2+) exchanger blockade has been reported to be anti-arrhythmic in different models. The effects of KB-R7943, a Na(+)/Ca(2+) exchanger blocker, on arrhythmogenesis in hearts with chronic myocardial infarction (MI) remain unclear. Dual voltage and intracellular Ca(2+) (Cai) optical mapping was performed in nine rabbit hearts with chronic MI and four control hearts. Electrophysiology studies including inducibility of ventricular tachyarrhythmias, ventricular fibrillation dominant frequency, action potential, Cai alternans, Cai decay, and conduction velocity were performed. The same protocol was repeated in the presence of KB-R7943 (0.5, 1, and 5μM) after the baseline studies. KB-R7943 was effective in suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias in hearts with chronic MI. Surprisingly, KB-R7943 increased the inducibility of ventricular tachyarrhythmias in a dose-dependent manner (11%, 11%, 22%, and 56% at baseline and with 0.5, 1, and 5μM KB-R7943, respectively, p=0.02). Optical mapping analysis revealed that the underlying mechanisms of the induced ventricular tachyarrhythmias were probably spatially discordant alternans with wave breaks and rotors. Further analysis showed that KB-R7943 significantly enhanced both action potential (p=0.033) and Cai (p=0.001) alternans, prolonged Cai decay (tau value) in a dose-dependent manner (p=0.004), and caused heterogeneous conduction delay especially at peri-infarct zones during rapid burst pacing. In contrast, KB-R7943 had insignificant effects in control hearts. In this chronic MI rabbit model, KB-R7943 has contrasting effects on arrhythmogenesis, suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias, but enhancing the inducibility of tachyarrhythmias. The mechanism is probably the enhanced spatially discordant alternans because of prolonged Cai decay and heterogeneous conduction delay. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier

  6. A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

    Science.gov (United States)

    Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

    2013-12-01

    The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    LENUS (Irish Health Repository)

    Doherty, Ben

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer.

  8. Combination of Aloe vera and xenograft induction on decreasing of NF-kb of tooth extraction socket preservation in Cavia cobaya

    Directory of Open Access Journals (Sweden)

    Utari Kresnoadi

    2014-03-01

    Full Text Available Background: Tooth extraction can naturally cause inflammation triggering osteoclast proliferation and alveolar bone resorption. Preservation of the tooth extraction sockets is needed for patients in order to reduce alveolar bone resorption risks. Aloe vera is known to have anthraquinones components, namely Aloin, Aloe emedin, and barbaloin, considered as anti-inflammation. Therefore, to overcome the inflammation, the role of NF-kb is very significant to decrease nuclear factor kappa b (NF-kb. As a result, inflammation risks will be decreased. Purpose: The study was aimed to determine the induction effect of combination of Aloe vera and XCB into tooth extraction sockets to reduce inflammation by reducing NF-kb expression, osteoclasts and osteoblasts. Methods: Forty-eight Cavia cobaya were divided into eight groups, each group consisted of six animals. The mandibular incisors of those Cavia cobaya were extracted and induced with either PEG, XCB, Aloe vera, or the combination of Aloe vera + XCB. Those animals were sacrificed on day 7 and day 30 after the extraction. Then immunohistochemical and histopathology examinations were conducted to observe NF-kb expression, osteoblasts and osteoclasts. Results: It was known that in group induced with the combination of Aloe vera and xenograft concelous bovine, the growth of osteoblasts was high, while NF-kb expression and osteoclasts reduced. Conclusion: It can be concluded that the induction of the combination of Aloe vera and XCB into the tooth extraction sockets can reduce NF-kb expression and osteoclast, as a result, alveolar bone resorption risks decrease, and osteoblast increase.Latar belakang: Trauma mekanis akibat pencabutan gigi asli menyebabkan keradangan. Keradangan memicu proliferasi osteoklas sehingga menyebabkan resorpsi tulang alveolararis. Pada pembuatan gigi tiruan, resorpsi tulang alveolar yang terjadi, sangat tidak diinginkan, sebab resorpsi tulang alveolar mengurangi keberhasilan

  9. Cordyceps militaris Fraction induces apoptosis and G2/M Arrest via c-Jun N-Terminal kinase signaling pathway in oral squamous carcinoma KB Cells.

    Science.gov (United States)

    Xie, Wangshi; Zhang, Zhang; Song, Liyan; Huang, Chunhua; Guo, Zhongyi; Hu, Xianjing; Bi, Sixue; Yu, Rongmin

    2018-01-01

    Cordyceps militaris fraction (CMF) has been shown to possess in vitro antitumor activity against human chronic myeloid leukemia K562 cells in our previous research. The in vitro inhibitory activities of CMF on the growth of KB cells were evaluated by viability assay. The apoptotic and cell cycle influences of CMF were detected by 4',6-diamidino-2-phenylindole staining and flow cytometry assay. The expression of different apoptosis-associated proteins and cell cycle regulatory proteins was examined by Western blot assay. The nuclear localization of c-Jun was observed by fluorescence staining. The objective of this study was to investigate the antiproliferative effect of CMF as well as the mechanism underlying the apoptosis and cell cycle arrest it induces in KB cells. CMF suppressed KB cells' proliferation in a dose- and time-dependent manner. Flow cytometric analysis indicated that CMF induced G2/M cell cycle arrest and apoptosis. Western blot analysis revealed that CMF induced caspase-3, caspase-9, and PARP cleavages, and increased the Bax/Bcl-2 ratio. CMF also led to increased expression of p21, decreased expression of cyclin B1, mitotic phosphatase cdc25c, and mitotic kinase cdc2, as well as unchanged expression of p53. In addition, CMF stimulated c-Jun N-terminal kinases (JNK) protein phosphorylations, resulting in upregulated expression of c-Jun and nuclear localization of c-Jun. Pretreatment with JNK inhibitor SP600125 suppressed CMF-induced apoptosis and G2/M arrest. CMF is capable of modulating c-Jun caspase and Bcl-2 family proteins through JNK-dependent apoptosis, which results in G2/M phase arrest in KB cells. CMF could be developed as a promising candidate for the new antitumor agents. CMF exhibited strong anticancer activity against oral squamous carcinoma KB cellsCMF inhibited KB cells' proliferation via induction of apoptosis and G2/M cell cycle arrestCMF activated JNK signaling pathway and promoted the nuclear localization of c-JunCMF regulated the

  10. ARSENITE ACTIVATES KB-DEPENDENT IL-8 GENE EXPRESSION IN AIRWAY EPITHELIM IN THE ABSENCE OF NUCLEAR TRANSLOCATION OF NF-KB

    Science.gov (United States)

    Airway epithelial cells respond to certain environmental stresses by mounting a proinflammatory response, which is characterized by enhanced synthesis and release of the neutrophil chemotactic and activating factor interleukin-8 (IL-8). IL-8 expression is regulated at the transcr...

  11. Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

    Science.gov (United States)

    Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

    2013-06-01

    Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

  12. Pyramidatine (Z88) Sensitizes Vincristine-Resistant Human Oral Cancer (KB/VCR) Cells to Chemotherapeutic Agents by Inhibition of P-glycoprotein.

    Science.gov (United States)

    Liu, Zulong; Zhu, Hengrui; Qu, Shijin; Tang, Lisha; Cao, Lihuan; Yu, Wenbo; Yang, Xianmei; Jiang, Songmin; Zhu, Dayuan; Tan, Changheng; Yu, Long

    2018-01-01

    Multi-drug resistance (MDR) remains a major impediment in cancer therapy. A major goal for scientists is to discover more effective compounds that are able to circumvent MDR and simultaneously have minimal adverse side effects. In the present study, we aim to determine the anti-MDR effects of pyramidatine (Z88), a cinnamic acid-derived bisamide compound isolated from the leaves of Aglaia perviridis, on KB/VCR (vincristineresistant human oral cancer cells) and MCF-7/ADR (adriamycin-resistant human breast adenocarcinoma) cells. Cell viability and average resistant fold (RF) of Z88 were examined by Cell Counting Kit-8 (CCK-8) assay. Flow cytometry, western blot, RT-PCR, Rhodamine 123 accumulation assay and P-glycoprotein (P-gp) ATPase assay were used to demonstrate the anti-MDR activity and mechanism of Z88. The average RF of Z88 is 0.09 and 0.51 in KB/VCR and MCF-7/ADR cells. A CCK-8 assay showed that Z88 could enhance the cytotoxicity of VCR toward KB/VCR cells. A FACS analysis revealed that Z88 could enhance the VCR-induced apoptosis as well as G2/M arrest in a dose-dependent manner in KB/VCR cells. Western blot results showed that the expression levels of PARP, Bax, and cyclin B1 all increased after treatment with 0.2 µmol/L (µM) of VCR combined with 10 µM of Z88 for 24 h in KB/VCR cells. Z88 also could enhance the accumulation of rhodamine 123. Further studies showed that Z88 could inhibit the verapamil stimulated Pgp ATPase activity. Additionally, qPCR detection and western blot assays revealed that Z88 could decrease the expression of P-gp at both RNA and protein level. Z88 exerted potent anti-MDR activity in vitro and its mechanisms are associated with dualinhibition of the function and expression of P-gp. These findings encourage efforts to develop more effective reversal agents to circumvent MDR based on Z88. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  14. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1.

    Science.gov (United States)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-04-04

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1.

  15. KB-R7943, a plasma membrane Na(+)/Ca(2+) exchanger inhibitor, blocks opening of the mitochondrial permeability transition pore.

    Science.gov (United States)

    Wiczer, Brian M; Marcu, Raluca; Hawkins, Brian J

    2014-01-31

    The isothiourea derivative, KB-R7943, inhibits the reverse-mode of the plasma membrane sodium/calcium exchanger and protects against ischemia/reperfusion injury. The mechanism through which KB-R7943 confers protection, however, remains controversial. Recently, KB-R7943 has been shown to inhibit mitochondrial calcium uptake and matrix overload, which may contribute to its protective effects. While using KB-R7943 for this purpose, we find here no evidence that KB-R7943 directly blocks mitochondrial calcium uptake. Rather, we find that KB-R7943 inhibits opening of the mitochondrial permeability transition pore in permeabilized cells and isolated liver mitochondria. Furthermore, we find that this observation correlates with protection against calcium ionophore-induced mitochondrial membrane potential depolarization and cell death, without detrimental effects to basal mitochondrial membrane potential or complex I-dependent mitochondrial respiration. Our data reveal another mechanism through which KB-R7943 may protect against calcium-induced injury, as well as a novel means to inhibit the mitochondrial permeability transition pore. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Pressure derivatives of elastic moduli of fused quartz to 10 kb

    Science.gov (United States)

    Peselnick, L.; Meister, R.; Wilson, W.H.

    1967-01-01

    Measurements of the longitudinal and shear moduli were made on fused quartz to 10 kb at 24??5??C. The anomalous behavior of the bulk modulus K at low pressure, ???K ???P 0, at higher pressures. The pressure derivative of the rigidity modulus ???G ???P remains constant and negative for the pressure range covered. A 15-kb hydrostatic pressure vessel is described for use with ultrasonic pulse instrumentation for precise measurements of elastic moduli and density changes with pressure. The placing of the transducer outside the pressure medium, and the use of C-ring pressure seals result in ease of operation and simplicity of design. ?? 1967.

  17. The expressions of NF-kb and TGFb-1 on odontoblast-like cells of human dental pulp injected with propolis extracts

    Directory of Open Access Journals (Sweden)

    Ira Widjiastuti

    2014-03-01

    Full Text Available Background: Propolis is known to have beneficial effects, namely anti- bacterial, anti-viral, anti-inflammatory, antioxidant, and immunomodulatory. Propolis extracts with anti-inflammatory properties are expected to be useful in treating inflamed pulp tissue with a diagnosis of reversible pulpitis. The inflammation of pulp tissue is caused by bacteria, namely Lactobacillus acidophilus. This research used odontoblast like cells derived from pulp tissue of human third molars. Odontoblast like cells exposed to Lactobacillus achidophilus were used as a model of proinflammatory cytokine signaling. This research examined the effects of propolis extracts on odontoblast like cells exposed to Lactobacillus acidophilus. Purpose: This research was aimed to determine the effectiveness of propolis extracts on the activities of odontoblast-like cells exposed to Lactobacillus acidophillus by measuring the expressions of NFkb and TGF- b1. Methods: First, pulp odontoblast cultures were derived from human dental pulp tissues of impacted third molars removed by using digestion method. Next, odontoblast-like cells exposed to inactive Lactobacillus acidophilus bacteria were given propolis extract. Finally, the activities of odontoblast-like cells were monitored by measuring the expressions of NF-kb and TGFb-1 with immunocytochemistry technique. Results: A decline NF-kb expression and on increase of TGFb-1 expression on odontoblast like cells exposed to inactive Lactobacillus acidophilus. Conclusion: Propolis extracts inhibit the expression of NF-kb, and increase the expression of TGF-b1 in pulp odontoblast-like cells exposed to inactive Lactobacillus acidophillus.Latar belakang: Propolis dilaporkan mempunyai efek menguntungkan yaitu bersifat anti bakteri, anti virus, anti inflamasi, anti oksidan, dan imunomodulator. Ekstrak propolis dengan sifat anti inflamasi diharapkan bermanfaat untuk mengobati jaringan pulpa yang mengalami inflamasi dengan diagnosis pulpitis

  18. The KB WOT Fisheries Programme carried out in 2015

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is established to maintain and develop the expertise needed to carry out the statutory obligations of the Netherlands in fisheries monitoring and advice. It is also a flexible program which responds to changes over time in WOT requirements, fisheries management and

  19. One-step FPLC-size-exclusion chromatography procedure for purification of rDMBT1 6 kb with increased biological activity

    DEFF Research Database (Denmark)

    Tuttolomondo, Martina; Hansen, Pernille Lund; Mollenhauer, Jan

    2018-01-01

    from saliva or produced in vitro and purified by a multistep affinity purification procedure using bacteria, followed by FPLC. Here, we compared a simple, one-step FPLC-SEC protocol for purification of recombinant DMBT1 6 kb, with that of the standard bacteria affinity purification-based protocol. Our...

  20. Loss of retrovirus production in JB/RH melanoma cells transfected with H-2Kb and TAP-1 genes.

    Science.gov (United States)

    Li, M; Xu, F; Muller, J; Huang, X; Hearing, V J; Gorelik, E

    1999-01-20

    JB/RH1 melanoma cells, as well as other melanomas of C57BL/6 mice (B16 and JB/MS), express a common melanoma-associated antigen (MAA) encoded by an ecotropic melanoma-associated retrovirus (MelARV). JB/RH1 cells do not express the H-2Kb molecules due to down-regulation of the H-2Kb and TAP-1 genes. When JB/RH1 cells were transfected with the H-2Kb and cotransfected with the TAP-1 gene, it resulted in the appearance of H-2Kb molecules and an increase in their immunogenicity, albeit they lost expression of retrovirus-encoded MAA recognized by MM2-9B6 mAb. Loss of MAA was found to result from a complete and stable elimination of ecotropic MelARV production in the H-2Kb/TAP-1-transfected JB/RH1 cells. Northern blot analysis showed no differences in ecotropic retroviral messages in MelARV-producing and -nonproducing melanoma cells, suggesting that loss of MelARV production was not due to down-regulation of MelARV transcription. Southern blot analysis revealed several rearrangements in the proviral DNA of H-2Kb-positive JB/RH1 melanoma cells. Sequence analysis of the ecotropic proviral DNA from these cells showed numerous nucleotide substitutions, some of which resulted in the appearance of a novel intraviral PstI restriction site and the loss of a HindIII restriction site in the pol region. PCR amplification of the proviral DNAs indicates that an ecotropic provirus found in the H-2Kb-positive cells is novel and does not preexist in the parental H-2Kb-negative melanoma cells. Conversely, the ecotropic provirus of the parental JB/RH1 cells was not amplifable from the H-2Kb-positive cells. Our data indicate that stable loss of retroviral production in the H-2Kb/TAP-1-transfected melanoma cells is probably due to the induction of recombination between a productive ecotropic MelARV and a defective nonecotropic provirus leading to the generation of a defective ecotropic provirus and the loss of MelARV production and expression of the retrovirus-encoded MAA. Copyright 1999

  1. Identification of MHC class I H-2 Kb/Db-restricted immunogenic peptides derived from retinal proteins

    DEFF Research Database (Denmark)

    Wang, Mingjun; Bai, Fang; Pries, Mette

    2006-01-01

    PURPOSE: To identify H-2 Kb/Db-binding immunogenic peptides derived from retinal proteins. METHODS: Computer-based prediction was used to identify potentially H-2 Kb/Db-binding peptides derived from the interphotoreceptor retinol-binding protein (IRBP), soluble retinal antigen (S...... on day 21 after immunization with IRBP or IRBP and the immunogenic peptides. RESULTS: All the 21 predicted peptides were found to upregulate expression of H-2 Kb/Db on RMA-S cells. Five peptides, the two IRBP-derived peptides IRBP89-96 and IRBP(101-108), and the three PEDF-derived peptides, PEDF389....... The immunogenic peptides alone did not induce inflammation in the eyes, but they could enhance severity of uveitis induced by IRBP. CONCLUSIONS: Five of 21 H-2 Kb/Db-binding retinal protein-derived peptides were found to be immunogenic, suggesting that these peptides could function as autoantigenic epitopes...

  2. Crystal structure and thermal behavior of KB3O6

    International Nuclear Information System (INIS)

    Bubnova, R.S.; Fundamenskij, V.S.; Filatov, S.K.; Polyakova, I.G.

    2004-01-01

    The structure of potassium triborate prepared in metastable state by crystallization from melt at ∼ 800 deg C was studied by the method of X-ray diffraction analysis. It was ascertained that KB 3 O 6 belongs to monoclinic crystal system, space group P2 1 /c, a = 9.319(1), b = 6.648(1), c = 21.094(2) A, β = 94.38(1) deg, Z = 12. The compound is referred to a new structural type. Anion of the structure is a single boron-oxygen frame formed by three independent rigid triborate rings of [B 3 O 5 ] - , each of them consisting of two BO 3 triangles and BO 4 tetrahedron. Phase transformations during KB 3 O 6 heating up to 800 deg C, as well as thermal expansion in the range of 20-650 deg C, were studied [ru

  3. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  4. Mapping autonomously replicating sequence elements in a 73-kb ...

    Indian Academy of Sciences (India)

    Autonomously replicating sequence (ARS) elements are the genetic determinants of replication origin function in yeasts. They can be easily identified as the plasmids containing them transform yeast cells at a high frequency. As the first step towards identifying all potential replication origins in a 73-kb region of the long arm ...

  5. NcoI dimorphic site located 8kb 3' to the human apolipoprotein AIV (APOA4) gene

    Energy Technology Data Exchange (ETDEWEB)

    Coleman, R T; Malloy, M J; Kane, J P; Frossard, P M

    1988-02-11

    pA4C3 a 0.5kb fragment from the 3' end of the human apolipoprotein AIV cDNA was isolated from a human intestine cDNA library and cloned into the EcoRI site of the plasmid pUC18. NcoI (CCATGG) (New England Biolabs) detects a single two-allele polymorphism with a band at either 18.6kb or at 12.6kb. The human apolipoprotein AI-CIII-AIV gene complex has been assigned to the long arm of chromosome 11 by Southern blot analysis of human-Chinese hamster cell hybrids. Co-dominant segregation was demonstrated in one family of six individuals.

  6. Sakharov at KB-11. The path of a genius

    International Nuclear Information System (INIS)

    Ilkaev, Radii I

    2012-01-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined. (conferences and symposia)

  7. Sakharov at KB-11. The path of a genius

    Science.gov (United States)

    Ilkaev, Radii I.

    2012-02-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined.

  8. Study on the effect of paclitaxel nanostructure lipid carrier cooperated with radiation on the KB Cells

    International Nuclear Information System (INIS)

    Liu Min; Li Zhihui; Xu Yujie

    2011-01-01

    Objective: To investigate the cytotoxicity effect of paclitaxel nanostructure lipid carrier (TAX-NLC) cooperated with radiation treatment on the KB cells. Methods: The cytotoxicity effect of TAX-NLC compared with free paclitaxel (TAX) on the KB cells was measured by MTT assay, and the cell cycle distribution was analyzed by flow cytometry. Results: The cytotoxicity effect of TAX-NLC was stronger than that of the free TAX. And the cooperative effect between the TAX-NLC and ionized radiation were observed, the cooperative effect of TAX-NLC was stronger than that of the free TAX. Flow cytometric analysis indicated that the rearrangement of cell cycle in KB cells were induced by TAX-NLC. The more G2/M phase cells were observed in KB cells treated by TAX-NLC compared with free TAX. The effect of TAX-NLC in the rearrangement of cell cycle was stronger than that of the free TAX. Conclusion: The cytotoxicity effect of TAX-NLC is stronger than that of the free TAX. And the cooperative effect of TAX-NLC is stronger than that of the free TAX. (authors)

  9. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    FluKB is a knowledge-based system focusing on data and analytical tools for influenza vaccine discovery. The main goal of FluKB is to provide access to curated influenza sequence and epitope data and enhance the analysis of influenza sequence diversity and the analysis of targets of immune...... responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  10. Phylogeography, salinity adaptations and metabolic potential of the Candidate Division KB1 Bacteria based on a partial single cell genome.

    Directory of Open Access Journals (Sweden)

    Lisa M Nigro

    2016-08-01

    Full Text Available Deep-sea hypersaline anoxic basins (DHABs and other hypersaline environments contain abundant and diverse microbial life that has adapted to these extreme conditions. The bacterial Candidate Division KB1 represents one of several uncultured groups that has been consistently observed in hypersaline microbial diversity studies. Here we report the phylogeography of KB1, its phylogenetic relationships to Candidate Division OP1 Bacteria, and its potential metabolic and osmotic stress adaptations based on a partial single cell amplified genome (SAG of KB1 from Orca Basin, the largest hypersaline seafloor brine basin in the Gulf of Mexico. Our results are consistent with the hypothesis – previously developed based on 14C incorporation experiments with mixed-species enrichments from Mediterranean seafloor brines - that KB1 has adapted its proteins to elevated intracellular salinity, but at the same time KB1 apparently imports glycine betaine; this compatible solute is potentially not limited to osmoregulation but could also serve as a carbon and energy source.

  11. Disruption of a -35kb enhancer impairs CTCF binding and MLH1 expression in colorectal cells.

    Science.gov (United States)

    Liu, Qing; Thoms, Julie A; Nunez, Andrea C; Huang, Yizhou; Knezevic, Kathy; Packham, Deborah; Poulos, Rebecca C; Williams, Rachel; Beck, Dominik; Hawkins, Nicholas J; Ward, Robyn L; Wong, Jason W H; Hesson, Luke B; Sloane, Mathew A; Pimanda, John

    2018-06-13

    MLH1 is a major tumour suppressor gene involved in the pathogenesis of Lynch syndrome and various sporadic cancers. Despite their potential pathogenic importance, genomic regions capable of regulating MLH1 expression over long distances have yet to be identified. Here we use chromosome conformation capture (3C) to screen a 650-kb region flanking the MLH1 locus to identify interactions between the MLH1 promoter and distal regions in MLH1 expressing and non-expressing cells. Putative enhancers were functionally validated using luciferase reporter assays, chromatin immunoprecipitation and CRISPR-Cas9 mediated deletion of endogenous regions. To evaluate whether germline variants in the enhancer might contribute to impaired MLH1 expression in patients with suspected Lynch syndrome, we also screened germline DNA from a cohort of 74 patients with no known coding mutations or epimutations at the MLH1 promoter. A 1.8kb DNA fragment, 35kb upstream of the MLH1 transcription start site enhances MLH1 gene expression in colorectal cells. The enhancer was bound by CTCF and CRISPR-Cas9 mediated deletion of a core binding region impairs endogenous MLH1 expression. 5.4% of suspected Lynch syndrome patients have a rare single nucleotide variant (G>A; rs143969848; 2.5% in gnomAD European, non-Finnish) within a highly conserved CTCF binding motif, which disrupts enhancer activity in SW620 colorectal carcinoma cells. A CTCF bound region within the MLH1 -35 enhancer regulates MLH1 expression in colorectal cells and is worthy of scrutiny in future genetic screening strategies for suspected Lynch syndrome associated with loss of MLH1 expression. Copyright ©2018, American Association for Cancer Research.

  12. Faktor-faktor yang Berhubungan Dengan Unmet Need KB Pasca-Salin IUD post-placenta di Kamar Rawat Pasca-bersalin RSUP DR. M. Djamil periode Januari-Maret 2013

    Directory of Open Access Journals (Sweden)

    Sari Handayani Utami

    2013-09-01

    Full Text Available AbstrakWanita pada periode post-partum memiliki angka unmet need terhadap kontrasepsi, padahal ini waktu yang tepat untuk mulai memakai kontrasepsi. Salah satu kontrasepsi pasca-salin terkini yang mulai disosialisasikan adalah IUD post-placenta. Namun demikian, masih belum banyak wanita pasangan usia subur yang menggunakan alat kontrasepsi ini bahkan mengetahuinya. Tujuan dari penelitian ini adalah untuk mengetahui faktor-faktor yang berhubungan dengan unmet need KB pasca-salin IUD post-placenta. Jenis penelitian survey dengan desain cross sectional study. Waktu pengambilan data dari 12 Januari sampai dengan 12 Maret 2013. Sampel adalah wanita pasangan usia subur yang melahirkan pervaginam dan dipilih secara accidental sampling. Penelitian dilakukan pada 88 orang responden dengan 50 orang bukan akseptor KB IUD post-placenta dan 38 orang akseptor KB IUD Post-placenta. Pengumpulan data dilakukan menggunakan kuesioner melalui wawancara terpimpin. Data dianalisis secara univariat dan bivariat. Hasil penelitian menunjukkan faktor yang memiliki hubungan signifikan dengan unmet need IUD post-placenta adalah faktor pengetahuan (p value = 0,001, sedangkan faktor lain yang tidak memiliki hubungan signifikan adalah faktor pendidikan (p value = 0,222, faktor status ekonomi (p value = 1,000, dan faktor konseling KB (p value = 0,583.Kata kunci: faktor yang berhubungan, unmet need, KB pasca-salin, IUD post-placentaAbstractThe women in post-partum period have unmet need rate to contraception, whereas it’s approriate time to start using contraception. One of recent post-partum contraception method is IUD post-placenta. But, only a few women of fertile age couple use this contraception even has known it. The purpose of this study was to determine the factors associated to unmet need of post-partum contraception IUD post-placenta. This survey study with cross sectional design study. The data was collected from January 12 until March 12 2013. The subject were

  13. Cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror

    International Nuclear Information System (INIS)

    Yuan Sheng; Goldberg, Kenneth A.; Yashchuk, Valeriy V.; Celestre, Richard; McKinney, Wayne R.; Morrison, Gregory; Macdougall, James; Mochi, Iacopo; Warwick, Tony

    2011-01-01

    At the Advanced Light Source (ALS), we are developing broadly applicable, high-accuracy, in-situ, at-wavelength wavefront slope measurement techniques for Kirkpatrick-Baez (KB) mirror nano-focusing. In this paper, we report an initial cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror. This cross-check provides a validation of the in-situ shearing interferometry, currently under development at the ALS.

  14. CLCNKB mutations causing mild Bartter syndrome profoundly alter the pH and Ca2+ dependence of ClC-Kb channels.

    Science.gov (United States)

    Andrini, Olga; Keck, Mathilde; L'Hoste, Sébastien; Briones, Rodolfo; Mansour-Hendili, Lamisse; Grand, Teddy; Sepúlveda, Francisco V; Blanchard, Anne; Lourdel, Stéphane; Vargas-Poussou, Rosa; Teulon, Jacques

    2014-09-01

    ClC-Kb, a member of the ClC family of Cl(-) channels/transporters, plays a major role in the absorption of NaCl in the distal nephron. CLCNKB mutations cause Bartter syndrome type 3, a hereditary renal salt-wasting tubulopathy. Here, we investigate the functional consequences of a Val to Met substitution at position 170 (V170M, α helix F), which was detected in eight patients displaying a mild phenotype. Conductance and surface expression were reduced by ~40-50 %. The regulation of channel activity by external H(+) and Ca(2+) is a characteristic property of ClC-Kb. Inhibition by external H(+) was dramatically altered, with pKH shifting from 7.6 to 6.0. Stimulation by external Ca(2+) on the other hand was no longer detectable at pH 7.4, but was still present at acidic pH values. Functionally, these regulatory modifications partly counterbalance the reduced surface expression by rendering V170M hyperactive. Pathogenic Met170 seems to interact with another methionine on α helix H (Met227) since diverse mutations at this site partly removed pH sensitivity alterations of V170M ClC-Kb. Exploring other disease-associated mutations, we found that a Pro to Leu substitution at position 124 (α helix D, Simon et al., Nat Genet 1997, 17:171-178) had functional consequences similar to those of V170M. In conclusion, we report here for the first time that ClC-Kb disease-causing mutations located around the selectivity filter can result in both reduced surface expression and hyperactivity in heterologous expression systems. This interplay must be considered when analyzing the mild phenotype of patients with type 3 Bartter syndrome.

  15. Alignment of KB mirrors with at-wavelength metrology tool simulated using SRW

    Science.gov (United States)

    Idir, Mourad; Rakitin, Maksim; Gao, Bo; Xue, Junpeng; Huang, Lei; Chubar, Oleg

    2017-08-01

    Synchrotron Radiation Workshop (SRW) is a powerful synchrotron radiation simulation tool and has been widely used at synchrotron facilities all over the world. During the last decade, many types of X-ray wavefront sensors have been developed and used. In this work, we present our recent effort on the development of at-wavelength metrology simulation based on SRW mainly focused on the Hartmann Wavefront Sensor (HWS). Various conditions have been studied to verify that the simulated HWS is performing as expected in terms of accuracy. This at-wavelength metrology simulation tool is then used to align KB mirrors by minimizing the wavefront aberrations. We will present our optimization process to perform an `in situ' alignment using conditions as close as possible to the real experiments (KB mirrors with different levels of figure errors or different misalignment geometry).

  16. Glucocorticoid-like activity of propylparaben, butylparaben, diethylhexyl phthalate and tetramethrin mixtures studied in the MDA-kb2 cell line.

    Science.gov (United States)

    Klopčič, Ivana; Kolšek, Katra; Dolenc, Marija Sollner

    2015-01-22

    Endocrine-disrupting compounds can interfere with the endocrine organs or hormone system and cause tumors, birth defects and developmental disorders in humans. The estrogen-like activity of compounds has been widely studied but little is known concerning their possible modulation of the glucocorticoid receptor. Steroidal (synthetic and natural) and non-steroidal endocrine-active compounds commonly occur as complex mixtures in human environments. Identification of such molecular species, which are responsible for modulating the glucocorticoid receptor are necessary to fully assess their risk. We have used the MDA-kb2 cell line, which expresses endogenous glucocorticoid receptor and a stably transfected luciferase reporter gene construct, to quantify the glucocorticoid-like activity of four compounds present in products in everyday use - propylparaben (PP), butylparaben (BP), diethylhexyl phthalate (DEHP) and tetramethrin (TM). We tested all possible combinations of these compounds at two concentrations (1 μM and 10 nM) and compared their glucocorticoid-like activity. At the concentration of 1 μM seven mixtures were identified to have glucocorticoid-like activity except: DEHP+TM, BP+TM, DEHP+PP+TM, BP+PP+TM. At the concentration of 10 nM only three mixtures have glucocorticoid modulatory activity: DEHP+PP, BP+PP, DEHP+BP+PP+TM. Identified glucocorticoid-like activities were between 1.25 and 1.51 fold at the concentration of 1 μM and between 1.23 and 1.44 fold at the concentration of 10 nM in comparison with the solvent control. Individually BP, PP, and DEHP had glucocorticoid-like activity of 1.60, 1.57 and 1.50 fold over the solvent control at the concentration of 1 μM. On the other hand PP and DEHP, at the concentration of 10nM, showed no glucocorticoid-like activity, while BP showed 1.44 fold. The assertion that individual glucocorticoid-like compounds do not produce harm because they are present at low, ineffective levels in humans may be irrelevant when we

  17. [Effect of smokers'sera on Porphyromonas gingivalis internalizing KB cells and the expression of matrix metalloproteinase-1, -9 and tissue inhibitor of metalloproteinase-1].

    Science.gov (United States)

    Wang, Hongyan; Tan, Lisi; Liu, Junchao; Li, Qian; Pan, Yaping; Zhong, Ming

    2014-01-01

    To investigate the effects of serum from smoking individuals or non-smoking individuals with periodontitis on Porphyromonas gingivalis (Pg) internalizing KB cells, and the expression of matrix metalloproteinase(MMP)-1, MMP-9, tissue inhibitor of metalloproteinase-1 (TIMP-1) in the culture supernatant of KB cells. The venous blood of 20 periodontitis patients' (10 smoking and 10 non-smoking) was extracted under the informed consent and centrifuged for serum. The smoking-individual serum (Y group) and non-smoking-individual (N group) serum were added to the model of Pg internalizing KB cells for 12 hours, plated on brain-heart infusion (BHI) and incubated anaerobically at 37 °C for 5 days. The colony forming units (CFU) of cell-invasive bacteria were estimated by colony counting. MMP-1, MMP-9 and TIMP-1 protein levels in culture supernatant were determined by enzyme-linked immunosorbent assay(ELISA) in the two groups following co-culture of Pg with KB cells for 12 hours. The CFU were (11.2 ± 1.1)×10(4), (12.6 ± 1.2)×10(4), (44.7 ± 1.3)×10(4) CFU/ml when adding 200, 400, 800 µl Y-group serum to the model of Pg co-culture with KB cells and when the serum was extracted from N group, the CFU were (33.6 ± 1.4)×10(4),(38.9 ± 1.1)×10(4), (11.2 ± 1.2)×10(4) CFU/ml respectively. When 200, 400, 800 µl Y group-serum was added to co-culture fluid of Pg internalizing KB cells, the concentrations of MMP-1 secreted from KB cells were (107.2 ± 21.5), (165.9 ± 20.2), (434.4 ± 48.0) µg/L respectively, the concentrations of MMP-9 were (3.99 ± 0.29), (4.21 ± 0.61), (5.62 ± 0.47) µg/L respectively, the concentrations of TIMP-1 were (401.3 ± 12.7), (418.3 ± 28.5), (637.3 ± 37.3) µg/L. When the serum (200, 400, 800 µl) extracted from N group, the concentration of MMP-1 and MMP-9 secreted by KB cell were (77.6 ± 10.8), (84.7 ± 10.2) and (98.2 ± 9.7) µg/L and (3.84 ± 0.52), (4.02 ± 0.68), (4.25 ± 0.37) µg/L, respectively. The concentration of TIMP-1 were

  18. Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

    Science.gov (United States)

    Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

    2017-03-01

    This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

  19. Characterization of five partial deletions of the factor VIII gene

    International Nuclear Information System (INIS)

    Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.

    1987-01-01

    Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes

  20. Transcriptional activation of Mina by Sp1/3 factors.

    Science.gov (United States)

    Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

    2013-01-01

    Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

  1. Identification and characterization of survivin-derived H-2Kb-restricted CTL epitopes

    DEFF Research Database (Denmark)

    Hofmann, Uta B; Voigt, Heike; Andersen, Mads H

    2009-01-01

    for potential binding K(b)-restricted octamer peptide epitopes. Two epitopes, which bind strongly to K(b), were selected to test their immunogenicity in vivo. Spleen cells from mice vaccinated by intradermal injection of mature DC pulsed with these peptides displayed reactivity to the respective epitopes...

  2. One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1

    Science.gov (United States)

    Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.

    2014-01-01

    Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158

  3. KB-R7943, an inhibitor of the reverse Na+/Ca2+ exchanger, blocks N-methyl-D-aspartate receptor and inhibits mitochondrial complex I

    Science.gov (United States)

    Brustovetsky, Tatiana; Brittain, Matthew K; Sheets, Patrick L; Cummins, Theodore R; Pinelis, Vsevolod; Brustovetsky, Nickolay

    2011-01-01

    BACKGROUND AND PURPOSE An isothiourea derivative (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea methane sulfonate (KB-R7943), a widely used inhibitor of the reverse Na+/Ca2+ exchanger (NCXrev), was instrumental in establishing the role of NCXrev in glutamate-induced Ca2+ deregulation in neurons. Here, the effects of KB-R7943 on N-methyl-D-aspartate (NMDA) receptors and mitochondrial complex I were tested. EXPERIMENTAL APPROACH Fluorescence microscopy, electrophysiological patch-clamp techniques and cellular respirometry with Seahorse XF24 analyzer were used with cultured hippocampal neurons; membrane potential imaging, respirometry and Ca2+ flux measurements were made in isolated rat brain mitochondria. KEY RESULTS KB-R7943 inhibited NCXrev with IC50= 5.7 ± 2.1 µM, blocked NMDAR-mediated ion currents, and inhibited NMDA-induced increase in cytosolic Ca2+ with IC50= 13.4 ± 3.6 µM but accelerated calcium deregulation and mitochondrial depolarization in glutamate-treated neurons. KB-R7943 depolarized mitochondria in a Ca2+-independent manner. Stimulation of NMDA receptors caused NAD(P)H oxidation that was coupled or uncoupled from ATP synthesis depending on the presence of Ca2+ in the bath solution. KB-R7943, or rotenone, increased NAD(P)H autofluorescence under resting conditions and suppressed NAD(P)H oxidation following glutamate application. KB-R7943 inhibited 2,4-dinitrophenol-stimulated respiration of cultured neurons with IC50= 11.4 ± 2.4 µM. With isolated brain mitochondria, KB-R7943 inhibited respiration, depolarized organelles and suppressed Ca2+ uptake when mitochondria oxidized complex I substrates but was ineffective when mitochondria were supplied with succinate, a complex II substrate. CONCLUSIONS AND IMPLICATIONS KB-R7943, in addition to NCXrev, blocked NMDA receptors in cultured hippocampal neurons and inhibited complex I in the mitochondrial respiratory chain. These findings are critical for the correct interpretation of experimental

  4. Composition and size of Apollo asteroid 1984 KB

    Science.gov (United States)

    Bell, Jeffrey F.; Hawke, B. Ray; Brown, Robert Hamilton

    1988-01-01

    The Class S object-typifying spectral signatures of olivine, pyroxene, and NiFe metal are noted in the present reflection spectra and thermal-emission radiometric data for the earth orbit-crossing Apollo object, 1984KB; a surface material akin to the rare lodranite meteorites. While the Class S object identification is strengthened by standard asteroid thermal model's indication of an about 0.7-km radius, and albedo of about 0.16, which is inconsistent with the IR spectrum, is obtained by an analysis of the same thermal data with a bare-rock thermal model. The object must have a significant regolith despite its small size.

  5. Mirror profile optimization for nano-focusing KB mirror

    International Nuclear Information System (INIS)

    Zhang Lin; Baker, Robert; Barrett, Ray; Cloetens, Peter; Dabin, Yves

    2010-01-01

    A KB focusing mirror width profile has been optimized to achieve nano-focusing for the nano-imaging end-station ID22NI at the ESRF. The complete mirror and flexure bender assembly has been modeled in 3D with finite element analysis using ANSYS. Bender stiffness, anticlastic effects and geometrical non-linear effects have been considered. Various points have been studied: anisotropy and crystal orientation, stress in the mirror and bender, actuator resolution and the mirror-bender adhesive bonding... Extremely high performance of the mirror is expected with residual slope error smaller than 0.6 μrad, peak-to-valley, compared to the bent slope of 3000 μrad.

  6. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  7. Molecular characterization of Rhodococcus equi isolates from horses in Poland: pVapA characteristics and plasmid new variant, 85-kb type V.

    Science.gov (United States)

    Witkowski, Lucjan; Rzewuska, Magdalena; Takai, Shinji; Chrobak-Chmiel, Dorota; Kizerwetter-Świda, Magdalena; Feret, Małgorzata; Gawryś, Marta; Witkowski, Maciej; Kita, Jerzy

    2017-01-26

    Rhodococcus equi is one of the most significant bacterial pathogens affecting foals up to 6 months of age worldwide. Rhodococcosis is present in Poland however information about molecular characterization of R. equi isolates is scarce. This study describes molecular characterization of Rhodococcus equi infection on 13 horse breeding farms in Poland between 2001 and 2012. Samples were collected by tracheobronchial aspiration from pneumonic foals or during necropsy. The R. equi isolates were genotyped by plasmid profiling and pulsed-field gel electrophoresis. Totally, 58 R. equi isolates were investigated. One isolate lost its plasmid. Among the 57 VapA-positive isolates, 48 contained 85-kb type I plasmid (82.8%), 8 contained 87-kb type I plasmid (13.8%). One isolate (1.7%) had a unique restriction cleavage pattern and the 2nd fragment of EcoRI digests of this plasmid DNA was about 2600 bases smaller than that of the 85 kb type I. This new plasmid variant was designated as the "85-kb type V". Among the 58 isolates typeable with VspI-PFGE, ten PFGE clusters were detected. The majority of foals were infected mostly with isolates of low genetic diversity. Most of clinical isolates of R. equi from foals in Poland contain pVapA 85-kb type I and 87-kb type I similarly to the other European countries and the United States. However, the new variant of pVapA 85-kb type V was identified. The chromosomal variability was detected among some of the investigated isolates and the presence of farm-specific isolates might be possible.

  8. HLA-C -35kb expression SNP is associated with differential control of β-HPV infection in squamous cell carcinoma cases and controls.

    Directory of Open Access Journals (Sweden)

    Karin A Vineretsky

    Full Text Available A single nucleotide polymorphism (SNP 35 kb upstream of the HLA-C gene is associated with HLA-C expression, and the high expressing genotype (CC has been associated with HIV-I control. HLA-C is unique among the classical MHC class I molecules for its role in the control of viral infections and recognition of abnormal or missing self. This immunosurveillance is central to the pathogenesis of non-melanoma skin cancer (NMSC, and of squamous cell carcinoma (SCC in particular. While sun exposure is a major risk factor for these cancers, cutaneous infections with genus β-HPV have been implicated in the development of SCC. We hypothesized that the high expression HLA-C genotype is associated with β-HPV infections. Therefore, we investigated the association between β-HPV serology and the -35 kb SNP (rs9264942 in a population-based case-control study of 510 SCC cases and 608 controls. Among controls, the high expression -35 kb SNP genotype (CC reduced the likelihood of positive serology for multiple (≥2 β-HPV infections (OR = 0.49, 95% CI: 0.25-0.97, and β-HPV species 2 infection (OR = 0.43, 95% CI: 0.23-0.79. However, no association with β-HPV status was observed among SCC cases. Our findings suggest that underlying immunogenotype plays an important role in differential control of β-HPV in SCC cases and controls.

  9. Male infertility is significantly associated with multiple deletions in an 8.7-kb segment of sperm mtDNA in Pakistan.

    Science.gov (United States)

    Mughal, Irfan Afzal; Irfan, Asma; Jahan, Sarwat; Hameed, Abdul

    2017-06-12

    This study aimed to find a link between sperm mitochondrial DNA mutations and male infertility in Pakistan. DNA from semen samples was extracted and amplified by PCR using 7.8-kb deletion-specific primers. The PCR products were separated on agarose gel, visualized under UV-illumination, and then photographed. The results were genotyped and the data were analyzed using SPSS. Deletion analysis of the 8.7-kb fragment by long PCR revealed multiple deletions. The frequency of deletion was much higher in infertile groups as compared to the control group. Further, on comparison between different subtypes of infertile groups, the deletions were highest in the oligoasthenoteratozoospermia (OAT) group. The statistical analysis of case and control groups showed a significant association of the 8.7-kb deletion with human male infertile groups (P = 0.031), and particularly a very significant association with the OAT subgroup (P = 0.019). A significant association has been found between human male infertility and mtDNA deletions in an 8.7-kb segment of sperm mtDNA in a Pakistani population.

  10. Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUD and ADHD.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Steinberg, Bruce; Modestino, Edward J; Fried, Lyle; Baron, David; Siwicki, David; Braverman, Eric R; Badgaiyan, Rajendra D

    2018-03-01

    Background Addictive-like behaviors (e.g., hoarding and shopping) may be the result of the cumulative effects of dopaminergic and other neurotransmitter genetic variants as well as elevated stress levels. We, therefore, propose that dopamine homeostasis may be the preferred goal in combating such challenging and unwanted behaviors, when simple dopaminergic activation through potent agonists may not provide any resolution. Case presentation C.J. is a 38-year-old, single, female, living with her mother. She has a history of substance use disorder as well as attention deficit hyperactivity disorder, inattentive type. She had been stable on buprenorphine/naloxone combination and amphetamine, dextroamphetamine mixed salts for many years when unexpectedly she lost her job for oversleeping and not calling into work. KB200z (a pro-dopamine compound) was added to her regimen for complaints of low drive and motivation. After taking this nutraceutical for 4 weeks, she noticed a marked improvement in her mental status and many behaviors. She noted that her shopping and hoarding addictions had appreciably decreased. Furthermore, her lifelong history of terrifying lucid dreams was eliminated. Finally, she felt more in control; her locus of control shifted from external to more internal. Discussion The hypothesis is that C.J.'s reported, behavioral, and psychological benefits resulted from the pro-dopamine-regulating effect of KB220Z across the brain reward system. Conclusions This effect, we surmise, could be the result of a new dopamine balance, across C.J.'s brain reward system. Dopamine homeostasis is an effect of KB220Z seen in both animal and human placebo-controlled fMRI experiments.

  11. Transgenic rabbits as a model organism for production of human clotting factor VIII

    International Nuclear Information System (INIS)

    Vasicek, D.; Chrenek, P.; Makarevich, A.; Bauer, M.; Jurcik, R.; Suvegova, K.; Rafay, J.; Bulla, J.; Hetenyi, L.; Erickson, J.; Paleyanda, R.K.

    2005-01-01

    Human clotting factor VIII (hFVIII) is a very complex and large protein whose expression is difficult, as hFVIII requires extensive post-translational modification to be biologically active. This paper reports the generation of transgenic rabbits as a model species for testing the expression of hFVIII in the mammary gland. For micro-injection, a fusion gene construct was used, consisting of 2.5 kb murine whey acidic protein (mWAP) promoter, 7.2 kb cDNA of hFVIII, and 4.6 kb of 3' flanking sequences of the mWAP gene. from 130 micro-injected zygotes transferred into recipients, 30 offspring were delivered. The pups were screened for the transgene by PCR, using DNA isolated from the ear, and results were confirmed by Southern blot analysis. The transgene was identified in one female founder animal, and it was transmitted to the offspring in a Mendelian fashion, thus demonstrating stable integration of the gene construct into the germline of the transgenic rabbits. (author)

  12. HINT-KB: The human interactome knowledge base

    KAUST Repository

    Theofilatos, Konstantinos A.

    2012-01-01

    Proteins and their interactions are considered to play a significant role in many cellular processes. The identification of Protein-Protein interactions (PPIs) in human is an open research area. Many Databases, which contain information about experimentally and computationally detected human PPIs as well as their corresponding annotation data, have been developed. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://150.140.142.24:84/Default.aspx) which is a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, estimates a set of features of interest and computes a confidence score for every candidate protein interaction using a modern computational hybrid methodology. © 2012 IFIP International Federation for Information Processing.

  13. Deletion of 2.7 kb near HOXD3 in an Arabian horse with occipitoatlantoaxial malformation.

    Science.gov (United States)

    Bordbari, M H; Penedo, M C T; Aleman, M; Valberg, S J; Mickelson, J; Finno, C J

    2017-06-01

    In the horse, the term occipitoatlantoaxial malformation (OAAM) is used to describe a developmental defect in which the first cervical vertebra (atlas) resembles the base of the skull (occiput) and the second cervical vertebra (axis) resembles the atlas. Affected individuals demonstrate an abnormal posture and varying degrees of ataxia. The homeobox (HOX) gene cluster is involved in the development of both the axial and appendicular skeleton. Hoxd3-null mice demonstrate a strikingly similar phenotype to Arabian foals with OAAM. Whole-genome sequencing was performed in an OAAM-affected horse (OAAM1) and seven unaffected Arabian horses. Visual inspection of the raw reads within the region of HOXD3 identified a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3. A genotyping assay revealed that both parents of OAAM1 were heterozygous for the deletion. Additional genotyping identified two of 162 heterozygote Arabians, and the deletion was not present in 371 horses of other breeds. Comparative genomics studies have revealed that this region is highly conserved across species and that the entire genomic region between Hoxd4 and Hoxd3 is transcribed in mice. Two additional Arabian foals diagnosed with OAAM (OAAM 2 and 3) were genotyped and did not have the 2.7-kb deletion. Closer examination of the phenotype in these cases revealed notable variation. OAAM3 also had facial malformations and a patent ductus arteriosus, and the actual malformation at the craniocervical junction differed. Genetic heterogeneity may exist across the HOXD locus in Arabian foals with OAAM. © 2017 Stichting International Foundation for Animal Genetics.

  14. Kirkpatrick-Baez (KB) and Lobster Eye (LE) Optics for Astronomical and Laboratory Applications

    International Nuclear Information System (INIS)

    Hudec, R.; Hudec, R.

    2010-01-01

    Most of grazing incidence (reflective) X-ray imaging systems used in astronomy and in other (laboratory) applications are based on the Wolter 1 (or modified) arrangement. But there were proposed also other designs and configurations, which are considered for future applications for both in laboratory and (finitely) in space. The Kirkpatrick-Baez (KB) lenses as well as various types of Lobster-Eye (LE) optics and MCP/Micropore optics serve as an example. Analogously to Wolter lenses, the X-rays are mostly reflected twice in these systems to create focal images. The KB systems have already found wide usage in laboratory and synchrotron, both application are reviewed and discussed in detail in this paper. While this paper focuses on future possible applications of non-Wolter grazing incidence systems in space and astronomy, we also discuss in detail applications in other areas of science, where (in contrary to astronomy) some of these systems have demonstrated their advantages

  15. Improved Antitumoral Activity of Extracts Derived from Cultured ...

    African Journals Online (AJOL)

    Antiproliferative activity was assayed in four cancer cell lines (Hep-2, HeLa, SiHa, and KB) while cytotoxic activity was evaluated on a normal cell line (MDCK). Results: The 10-day cultivation organic extract exhibited increased antiproliferative activity compared with the control on human carcinoma nasopharynx (KB) and ...

  16. Receptor-mediated targeting of 67Ga-Deferoxamine-Folate to folate-receptor-positive human kb tumor xenografts

    International Nuclear Information System (INIS)

    Mathias, Carla J.; Wang, Susan; Low, Philip S.; Waters, David J.; Green, Mark A.

    1999-01-01

    The radiochemical synthesis and stability of 67 Ga-deferoxamine-folate ([ 67 Ga]Ga-DF-Folate) were examined as a function of DF-Folate concentration. Optimal labeling occurred at DF-Folate concentrations ≥2.5 μg/mL. To define the possible biological significance of variations in product formulation, the biodistribution of [ 67 Ga]Ga-DF-Folate was examined as a function of administered deferoxamine-folate dose in an athymic mouse KB tumor model. The folate-receptor-positive KB tumors were found to concentrate the 67 Ga radiolabel in a dose-dependent fashion, consistent with saturable involvement of the folate receptor in mediating tumor accumulation of the radiopharmaceutical

  17. Ornithine aminotransferase (OAT): recombination between an X-linked OAT sequence (7.5 kb) and the Norrie disease locus.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Spence, M A; Cortessis, V; Sparkes, R S; Kivlin, J D; Mohandas, T; Inana, G

    1990-01-01

    A human ornithine aminotransferase (OAT) locus has been mapped to the Xp11.2, as has the Norrie disease locus. We used a cDNA probe to investigate a 3-generation UCLA family with Norrie disease; a 4.2-kb RFLP was detected and a maximum lod score of 0.602 at zero recombination fraction was calculated. We used the same probe to study a second multigeneration family with Norrie disease from Utah. A different RFLP of 7.5 kb in size was identified and a recombinational event between the OAT locus represented by this RFLP and the disease loci was observed. Linkage analysis of these two loci in this family revealed a maximum load score of 1.88 at a recombination fraction of 0.10. Although both families have affected members with the same disease, the lod scores are reported separately because the 4.2- and 7.5-kb RFLPs may represent two different loci for the X-linked OAT.

  18. Effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer.

    Science.gov (United States)

    Shen, Shan; Tang, Jingxia

    2017-08-01

    The present study describes the effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer. Oral cancer is twice as common in men than women. More than 90% of oral cancers in men and 85% in women are linked to lifestyle and environmental factors. PPP2R2B methylation may be associated with survival and prognosis in patients with gliomas. In tumor cell proliferation and apoptosis, the mechanism of PPP2R2B remains unclear. In the present study, we found that PPP2R2B expression of H1299 cells is significantly decreased after being treated by GA-13315. KB cells were isolated from patients with oral cancer and treated with GA-13315 (5 µM). Cells without GA-13315 treatment served as the control group. An MTT experiment was performed to detect the post-treatment cell growth between the groups. A flow cytometry was used to detect cell apoptosis. Western blot analysis and quantitative polymerase chain reaction methods were used for detecting the expression of PPP2R2B. Compared with the control group, the cell proliferation of the treatment group slowed after being treated with GA-13315. The difference was statistically significant (Poral cancer were weakened after being treated by GA-13315. GA-13315 can accelerate the apoptosis of oral cancer cells and presents a dose correlation. The biological effect is exerted through the decrease of PPP2R2B.

  19. Stroke Risk Factors and Symptoms

    Science.gov (United States)

    ... » [ pdf, 433 kb ] Order Materials » Stroke Risk Factors and Symptoms Risk Factors for a Stroke Stroke prevention is still ... it. Treatment can delay complications that increase the risk of stroke. Transient ischemic attacks (TIAs). Seek help. ...

  20. Breeding of transgenic cattle for human coagulation factor IX by a combination of lentiviral system and cloning.

    Science.gov (United States)

    Monzani, P S; Sangalli, J R; De Bem, T H C; Bressan, F F; Fantinato-Neto, P; Pimentel, J R V; Birgel-Junior, E H; Fontes, A M; Covas, D T; Meirelles, F V

    2013-02-28

    Recombinant coagulation factor IX must be produced in mammalian cells because FIX synthesis involves translational modifications. Human cell culture-based expression of human coagulation factor IX (hFIX) is expensive, and large-scale production capacity is limited. Transgenic animals may greatly increase the yield of therapeutic proteins and reduce costs. In this study, we used a lentiviral system to obtain transgenic cells and somatic cell nuclear transfer (SCNT) to produce transgenic animals. Lentiviral vectors carrying hFIX driven by 3 bovine β-casein promoters were constructed. Bovine epithelial mammary cells were transduced by lentivirus, selected with blasticidin, plated on extracellular matrix, and induced by lactogenic hormones; promoter activity was evaluated by quantitative PCR. Transcriptional activity of the 5.335-kb promoter was 6-fold higher than the 3.392- and 4.279-kb promoters, which did not significantly differ. Transgenic bovine fibroblasts were transduced with lentivirus carrying the 5.335-kb promoter and used as donor cells for SCNT. Cloned transgenic embryo production yielded development rates of 28.4%, similar to previous reports on cloned non-transgenic embryos. The embryos were transferred to recipient cows (N = 21) and 2 births of cloned transgenic cattle were obtained. These results suggest combination of the lentiviral system and cloning may be a good strategy for production of transgenic cattle.

  1. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    OpenAIRE

    Shen, Yue; Wang, Yun; Chen, Tai; Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synI...

  2. Structural and biophysical characterization of the PI4KB:14-3-3 protein complex

    Czech Academy of Sciences Publication Activity Database

    Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 191 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : PI4KB * 14-3-3 proteins Subject RIV: CE - Biochemistry

  3. Melting relations in the Fe-rich portion of the system FeFeS at 30 kb pressure

    Science.gov (United States)

    Brett, R.; Bell, P.M.

    1969-01-01

    The melting relations of FeFeS mixtures covering the composition range from Fe to Fe67S33 have been determined at 30 kb pressure. The phase relations are similar to those at low pressure. The eutectic has a composition of Fe72.9S27.1 and a temperature of 990??C. Solubility of S in Fe at elevated temperatures at 30 kb is of the same order of magnitude as at low pressure. Sulfur may have significantly lowered the melting point of iron in the upper mantle during the period of coalescence of metal prior to core formation in the primitive earth. ?? 1969.

  4. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  5. UniProtKB/Swiss-Prot, the Manually Annotated Section of the UniProt KnowledgeBase: How to Use the Entry View.

    Science.gov (United States)

    Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Schneider, Michel; Bansal, Parit; Bridge, Alan J; Poux, Sylvain; Bougueleret, Lydie; Xenarios, Ioannis

    2016-01-01

    The Universal Protein Resource (UniProt, http://www.uniprot.org ) consortium is an initiative of the SIB Swiss Institute of Bioinformatics (SIB), the European Bioinformatics Institute (EBI) and the Protein Information Resource (PIR) to provide the scientific community with a central resource for protein sequences and functional information. The UniProt consortium maintains the UniProt KnowledgeBase (UniProtKB), updated every 4 weeks, and several supplementary databases including the UniProt Reference Clusters (UniRef) and the UniProt Archive (UniParc).The Swiss-Prot section of the UniProt KnowledgeBase (UniProtKB/Swiss-Prot) contains publicly available expertly manually annotated protein sequences obtained from a broad spectrum of organisms. Plant protein entries are produced in the frame of the Plant Proteome Annotation Program (PPAP), with an emphasis on characterized proteins of Arabidopsis thaliana and Oryza sativa. High level annotations provided by UniProtKB/Swiss-Prot are widely used to predict annotation of newly available proteins through automatic pipelines.The purpose of this chapter is to present a guided tour of a UniProtKB/Swiss-Prot entry. We will also present some of the tools and databases that are linked to each entry.

  6. STUDI NILAI ANAK, JUMLAH ANAK YANG DIINGINKAN, DAN KEIKUTSERTAAN ORANG TUA DALAM PROGRAM KB

    Directory of Open Access Journals (Sweden)

    Hartoyo Hartoyo

    2011-01-01

    Full Text Available  This research was to analyze the correlation between mother and family characteristics with value of children and the influence factors of demand for children and involvement of parent in family planning programme. This research involved 60 families who be acceptor and non-acceptor KB that were selected randomly. Mother’s age had significant correlation with power and influence dimension, working status of mother had significant correlation with stimulation and fun dimension and morality dimension, mother’s education had significant correlation with morality dimension, the number of living children had significant correlation with adult status and social identity dimension and economic utility and security in old age dimension. Moreover, family size variable had significant positive influence to demand for children. Beside that, age of mother’s first marriage and difference of the number of living children with demand for children had significant positive influence to participating family in family planning programme. 

  7. The simplest possible design for a KB microfocus mirror system?

    Energy Technology Data Exchange (ETDEWEB)

    Collins, S. P., E-mail: steve.collins@diamond.ac.uk; Scott, S. M.; Hawkins, D. M.; Fabrizi, F.; Moser, B.; Nisbet, G.; Sutter, J. P. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Harwin, R. C. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Department of Physics, Cavendish Laboratory, JJ Thomson Avenue, Cambridge, CB3 0HE (United Kingdom); Harwin, W. S. [School of Systems Engineering, University of Reading, Whiteknights, Reading, Berkshire, RG6 6AH (United Kingdom)

    2016-07-27

    We report a design for a Kirkpatrick-Baez (KB) microfocussing mirror system. The main components are described, with emphasis on a ‘tripod’ manipulator, where we outline the required coordinate transformation calculations. The merit of this device lies in its simplicity of design, minimal degrees of freedom, and speed and ease of setup on a beamline. Test results and an example of the mirrors in use on Diamond Beamline I16, showing a high-resolution polar domain map of KTiOPO{sub 4} with a spot size of 1.25 µm × 1.5 µm, are presented.

  8. Heparanase enhances the generation of activated factor X in the presence of tissue factor and activated factor VII.

    Science.gov (United States)

    Nadir, Yona; Brenner, Benjamin; Fux, Liat; Shafat, Itay; Attias, Judith; Vlodavsky, Israel

    2010-11-01

    Heparanase is an endo-β-D-glucuronidase dominantly involved in tumor metastasis and angiogenesis. Recently, we demonstrated that heparanase is involved in the regulation of the hemostatic system. Our hypothesis was that heparanase is directly involved in activation of the coagulation cascade. Activated factor X and thrombin were studied using chromogenic assays, immunoblotting and thromboelastography. Heparanase levels were measured by enzyme-linked immunosorbent assay. A potential direct interaction between tissue factor and heparanase was studied by co-immunoprecipitation and far-western assays. Interestingly, addition of heparanase to tissue factor and activated factor VII resulted in a 3- to 4-fold increase in activation of the coagulation cascade as shown by increased activated factor X and thrombin production. Culture medium of human embryonic kidney 293 cells over-expressing heparanase and its derivatives increased activated factor X levels in a non-enzymatic manner. When heparanase was added to pooled normal plasma, a 7- to 8-fold increase in activated factor X level was observed. Subsequently, we searched for clinical data supporting this newly identified role of heparanase. Plasma samples from 35 patients with acute leukemia at presentation and 20 healthy donors were studied for heparanase and activated factor X levels. A strong positive correlation was found between plasma heparanase and activated factor X levels (r=0.735, P=0.001). Unfractionated heparin and an inhibitor of activated factor X abolished the effect of heparanase, while tissue factor pathway inhibitor and tissue factor pathway inhibitor-2 only attenuated the procoagulant effect. Using co-immunoprecipitation and far-western analyses it was shown that heparanase interacts directly with tissue factor. Overall, our results support the notion that heparanase is a potential modulator of blood hemostasis, and suggest a novel mechanism by which heparanase increases the generation of activated

  9. Corallocins A-C, Nerve Growth and Brain-Derived Neurotrophic Factor Inducing Metabolites from the Mushroom Hericium coralloides.

    Science.gov (United States)

    Wittstein, Kathrin; Rascher, Monique; Rupcic, Zeljka; Löwen, Eduard; Winter, Barbara; Köster, Reinhard W; Stadler, Marc

    2016-09-23

    Three new natural products, corallocins A-C (1-3), along with two known compounds were isolated from the mushroom Hericium coralloides. Their benzofuranone and isoindolinone structures were elucidated by spectral methods. All corallocins induced nerve growth factor and/or brain-derived neurotrophic factor expression in human 1321N1 astrocytes. Furthermore, corallocin B showed antiproliferative activity against HUVEC and human cancer cell lines MCF-7 and KB-3-1.

  10. Melting relations and elemental distribution of portion of the system Fe-S-Si-O to 32 KB with planetary application

    Science.gov (United States)

    Huang, W. L.

    1980-01-01

    The melting relations and distribution of K and Cs in portions of the system was determined at high pressures. Ferrosilite is stable as a primary phase at high pressures because of the incongruent melting of ferrosilite to quartz plus liquid and the boundary between the one and two liquid fields on the joint Fe(1-x) O-FeS-SiO2 shifts away from silica with increasing pressures. Potassium K was found to have limited solubility in metal sulfide liquids at pressures up to 45 kb. The speculation that K may dissolve significantly in metal-metal sulfide liquids after undergoing first order isomorphic transition was tested by determining the distribution of Cs between sulfide and silicate liquids as an analogy to K. At 45 kb, 1400 C and 27 kb, 1300 C only limited amounts of Cs were detected in quench sulfide liquids even at pressures beyond the isomorphic transition of Cs.

  11. Structural analysis of phosphatidylinositol 4-kinase III beta (PI4KB) - 14-3-3 protein complex reveals internal flexibility and explains 14-3-3 mediated protection from degradation in vitro

    Czech Academy of Sciences Publication Activity Database

    Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

    2017-01-01

    Roč. 200, č. 1 (2017), s. 36-44 ISSN 1047-8477 R&D Projects: GA ČR(CZ) GA17-05200S Institutional support: RVO:61388963 Keywords : lipid * kinase * PI4KB * 14-3-3 protein * phosphatidylinositol Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 2.767, year: 2016

  12. VenomKB, a new knowledge base for facilitating the validation of putative venom therapies.

    Science.gov (United States)

    Romano, Joseph D; Tatonetti, Nicholas P

    2015-11-24

    Animal venoms have been used for therapeutic purposes since the dawn of recorded history. Only a small fraction, however, have been tested for pharmaceutical utility. Modern computational methods enable the systematic exploration of novel therapeutic uses for venom compounds. Unfortunately, there is currently no comprehensive resource describing the clinical effects of venoms to support this computational analysis. We present VenomKB, a new publicly accessible knowledge base and website that aims to act as a repository for emerging and putative venom therapies. Presently, it consists of three database tables: (1) Manually curated records of putative venom therapies supported by scientific literature, (2) automatically parsed MEDLINE articles describing compounds that may be venom derived, and their effects on the human body, and (3) automatically retrieved records from the new Semantic Medline resource that describe the effects of venom compounds on mammalian anatomy. Data from VenomKB may be selectively retrieved in a variety of popular data formats, are open-source, and will be continually updated as venom therapies become better understood.

  13. The rates and patterns of deletions in the human factor IX gene

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))

    1994-02-01

    Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.

  14. FACTOR NUCLEAR kB (NF-kB: SIGNALOSOMA Y SU IMPORTANCIA EN ENFERMEDADES INFLAMATORIAS Y CÁNCER

    Directory of Open Access Journals (Sweden)

    Nancy P. Echeverry R.L

    2008-04-01

    Full Text Available El factor nuclear kB (NF-kB es un dímero constituido por proteínas de la familia Rel. El NF-kB se encuentra en el citoplasma unido a proteínas inhibidoras (IkB. Las IkB son fosforiladas por diferentes cinasas que hacen parte del signalosoma como las cinasas de IKKa e IKKb y el modulador esencial de NF-kB (NEMO, la proteína cinasa activadora de mitosis (MAPK o p38 y la cinasa inductora de NF-kB (NIK. Estas cinasas al ser activadas por señales dependientes de citocinas y luz ultravioleta, fosforilan las IkB provocando su ubiquitinación, su degradación por proteosoma y la subsecuente liberación y translocación al núcleo de NF-kB. Recientemente se le ha dado una gran importancia al NF-kB en la vía de señalización desencadenada por estrés oxidativo, estrés genotóxico y daño en el DNA. A diferencia de la vía denominada clásica, en esta ruta ocurre una SUMOilación de NEMO y translocación al núcleo. En el núcleo NEMO interactúa con la proteína de la ataxia telangiectasia mutada (ATM activada en respuesta a modificaciones en la cromatina y daño en el DNA. El complejo ATM/NEMO es translocado al citoplasma donde la ATM fosforila a las IKK llevando a la ubiquitinación y posterior liberación de NF-kB que es translocado al núcleo. NF-kB desencadena procesos de supervivencia incluyendo el aumento de la transcripción de enzimas antioxidantes como la superóxido dismutasa, catalasa y glutatión. Estas enzimas participan en el control de los niveles de especies reactivas de oxígeno en la célula. La sobreactivación de NF-kB se relaciona con inflamación y cáncer. En la actualidad se desarrolla una búsqueda de fármacos que actúen sobre moléculas del signalosoma de NF-kB, no sólo para el manejo de enfermedades inflamatorias sino también para el uso durante el tratamiento de tumores resistentes a radio y quimioterapia.

  15. Activation of human factor V by factor Xa and thrombin

    International Nuclear Information System (INIS)

    Monkovic, D.D.; Tracy, P.B.

    1990-01-01

    The activation of human factor V by factor Xa and thrombin was studied by functional assessment of cofactor activity and sodium dodecyl sulfate-polycarylamide gel electrophoresis followed by either autoradiography of 125 I-labeled factor V activation products or Western blot analyses of unlabeled factor V activation products. Cofactor activity was measured by the ability of the factor V/Va peptides to support the activation of prothrombin. The factor Xa catalyzed cleavage of factor V was observed to be time, phospholipid, and calcium ion dependent, yielding a cofactor with activity equal to that of thrombin-activated factor V (factor Va). The cleavage pattern differed markedly from the one observed in the bovine system. The factor Xa activated factor V subunits expressing cofactor activity were isolated and found to consist of peptides of M r 220,000 and 105,000. Although thrombin cleaved the M r 220,000 peptide to yield peptides previously shown to be products of thrombin activation, cofactor activity did not increase. N-Terminal sequence analysis confirmed that both factor Xa and thrombin cleave factor V at the same bond to generate the M r 220,000 peptide. The factor Xa dependent functional assessment of 125 I-labeled factor V coupled with densitometric analyses of the cleavage products indicated that the cofactor activity of factor Xa activated factor V closely paralleled the appearance of the M r 220,000 peptide. The data indicate that factor Xa is as efficient an enzyme toward factor V as thrombin

  16. The nonenzymatic subunit of pseutarin C, a prothrombin activator from eastern brown snake (Pseudonaja textilis) venom, shows structural similarity to mammalian coagulation factor V.

    Science.gov (United States)

    Rao, Veena S; Swarup, Sanjay; Kini, R Manjunatha

    2003-08-15

    Pseutarin C is a group C prothrombin activator from the venom of the eastern brown snake Pseudonaja textilis. It is a multi-subunit protein complex consisting of catalytic and nonenzymatic subunits similar to coagulation factor Xa and factor Va, respectively. Here we describe the complete sequence of the nonenzymatic subunit. Based on the partial amino acid sequence of the nonenzymatic subunit, degenerate primers were designed. Using a "walking" strategy based on sequentially designed primers, we determined the complete cDNA sequence of the nonenzymatic subunit. The cDNA encodes a protein of 1461 amino acid residues, which includes a 30-residue signal peptide, a mature protein of 1430 amino acid residues, and a stop codon. cDNA blot analysis showed a single transcript of approximately 4.6 kb. The deduced amino acid sequence shows approximately 50% identity to mammalian factor V and by homology has a similar domain structure consisting of domains A1-A2-B-A3-C1-C2. Interestingly, the B domain of pseutarin C is shorter than that of mammalian factor V (FV). Although most of the proteolytic activation sites are conserved, 2 of 3 proteolytic sites cleaved by activated protein C are mutated, and thus activated protein C is not able to inactivate this procoagulant toxin. The predicted posttranslational modifications, including disulfide bonds, N-glycosylation, phosphorylation, and sulfation, in pseutarin C are significantly different compared with bovine factor V. Thus, our data demonstrate that the nonenzymatic subunit of group C prothrombin activators is structurally similar to mammalian FV.

  17. 3,3′,4,4′,5-Pentachlorobiphenyl Inhibits Drug Efflux Through P-Glycoprotein in KB-3 Cells Expressing Mutant Human P-Glycoprotein

    Directory of Open Access Journals (Sweden)

    Hiroshi Fujise

    2004-01-01

    Full Text Available The effects on the drug efflux of 3,3′,4,4′,5-pentachlorobiphenyl (PCB-126, the most toxic of all coplanar polychlorinated biphenyls (Co-PCBs, were examined in KB-3 cells expressing human wild-type and mutant P-glycoprotein in which the 61st amino acid was substituted for serine or phenylalanine (KB3-Phe61. In the cells expressing P-glycoproteins, accumulations of vinblastine and colchicine decreased form 85% to 92% and from 62% to 91%, respectively, and the drug tolerances for these chemicals were increased. In KB3-Phe61, the decreases in drug accumulation were inhibited by adding PCB-126 in a way similar to that with cyclosporine A: by adding 1 μM PCB-126, the accumulations of vinblastine and colchicine increased up to 3.3- and 2.3-fold, respectively. It is suggested that PCB-126 decreased the drug efflux by inhibiting the P-glycoprotein in KB3-Phe61. Since there were various P-glycoproteins and many congeners of Co-PCBs, this inhibition has to be considered a new cause of the toxic effects of Co-PCBs.

  18. Plasmid DNA studies in Lactobacillus plantarum strains isolated from olive fermentations: production of and immunity to plantaricin OL15 is associated to a 9.6 Kb plasmid (pOL15

    Directory of Open Access Journals (Sweden)

    Mourad, Kacem

    2007-06-01

    Full Text Available Previously 12 Lactobacillus plantarum strains were isolated from fermented olives. Among these, only L. plantarum OL15 produced bacteriocin (plantaricin OL15. In this study, the 12 strains were examined for plasmid DNA content. Of these, 9 strains have shown one to three plasmid bands ranging in size from 5.4 to 12.2 kb. L. plantarum OL15 exhibited one plasmid (9.6 kb which was named pOL15. After curing with novobiocin and ethidium bromide, the plasmid profile analysis of non producing derivatives, showed that the 9.6 kb plasmid pOL15 harbored by the parental strain had been lost in all cases and none of them regained the ability to produce plantaricin OL15 suggesting that the production of plantaricin OL15 is plasmid linked. Plantaricin OL15 was not inactived by amylase and lipase suggesting that plantaricin OL15 activity was not dependent on the presence of either a carbohydrate or lipid moiety. Plantaricin OL15 showed activity against lactic acid bacteria of different species and also against olive spoilage and phytopathogenic bacteria, including Pseudomonas and Erwinia.En un estudio previo, se aislaron 12 cepas de Lactobacillus plantarum a partir de aceitunas fermentadas. Entre ellas, solo L. plantarum OL15 produjo bacteriocinas (plantaricin OL15. En este estudio, se examinó el contenido de AND plásmido en las 12 cepas citadas. Entre ellas, 9 cepas han mostrado de una a tres bandas de plásmido con tamaños en el rango de 5.4 a 12.2 kb. L. plantarum OL15 exhibió un plásmido (9.6 kb que se denominó pOL15. Después del curado con novobiocina y bromuro de etidio, la pérdida del plásmido pOL15 asociada a la pérdida de su facultad para producir plantaricin OL15, sugiere que la producción de plantaricina OL15 está ligada al plásmido. La plantaricin OL15 no se inactivó por amilasa ni por lipasa sugiriendo que su actividad no es dependiente de la presencia de carbohidratos o lípidos. La plantaricina OL15 mostró actividad frente a

  19. In Vivo Deletion of the Cebpa +37 kb Enhancer Markedly Reduces Cebpa mRNA in Myeloid Progenitors but Not in Non-Hematopoietic Tissues to Impair Granulopoiesis

    Science.gov (United States)

    Guo, Hong; Cooper, Stacy; Friedman, Alan D.

    2016-01-01

    The murine Cebpa gene contains a +37 kb, evolutionarily conserved 440 bp enhancer that directs high-level expression to myeloid progenitors in transgenic mice. The enhancer is bound and activated by Runx1, Scl, GATA2, C/EBPα, c-Myb, Pu.1, and additional Ets factors in myeloid cells. CRISPR/Cas9-mediated replacement of the wild-type enhancer with a variant mutant in its seven Ets sites leads to 20-fold reduction of Cebpa mRNA in the 32Dcl3 myeloid cell line. To determine the effect of deleting the enhancer in vivo, we now characterize C57BL/6 mice in which loxP sites flank a 688 bp DNA segment containing the enhancer. CMV-Cre mediated germline deletion resulted in diminution of the expected number of viable Enh(f/f);CMV-Cre offspring, with 28-fold reduction in marrow Cebpa mRNA but normal levels in liver, lung, adipose, intestine, muscle, and kidney. Cre-transduction of lineage-negative marrow cells in vitro reduced Cebpa mRNA 12-fold, with impairment of granulocytic maturation, morphologic blast accumulation, and IL-3 dependent myeloid colony replating for >12 generations. Exposure of Enh(f/f);Mx1-Cre mice to pIpC led to 14-fold reduction of Cebpa mRNA in GMP or CMP, 30-fold reduction in LSK, and deletion and confirmed marrow-intrinsic impairment of granulopoiesis and B cell generation with LSK and monocyte lineage expansion. These findings demonstrate a critical role for the +37 kb Cebpa enhancer for hematopoietic-specific Cebpa expression, with enhancer deletion leading to impaired myelopoiesis and potentially preleukemic progenitor expansion. PMID:26937964

  20. Platelet-derived growth factor (PDGF) B-chain gene expression by activated blood monocytes precedes the expression of the PDGF A-chain gene

    International Nuclear Information System (INIS)

    Martinet, Y.; Jaffe, H.A.; Yamauchi, K.; Betsholtz, C.; Westermark, B.; Heldin, C.H.; Crystal, R.G.

    1987-01-01

    When activated, normal human blood monocytes are known to express the c-sis proto-oncogene coding for PDGF B-chain. Since normal human platelet PDGF molecules are dimers of A and B chains and platelets and monocytes are derived from the same marrow precursors, activated blood monocytes were simultaneously evaluated for their expression of PDGF A and B chain genes. Human blood monocytes were purified by adherence, cultured with or without activation by lipopolysaccharide and poly(A)+ RNA evaluated using Northern analysis and 32 P-labeled A-chain and B-chain (human c-sis) probes. Unstimulated blood monocytes did not express either A-chain or B-chain genes. In contrast, activated monocytes expressed a 4.2 kb mRNA B-chain transcript at 4 hr, but the B-chain mRNA levels declined significantly over the next 18 hr. In comparison, activated monocytes expressed very little A-chain mRNA at 4 hr, but at 12 hr 1.9, 2.3, and 2.8 kb transcripts were observed and persisted through 24 hr. Thus, activation of blood monocytes is followed by PDGF B-chain gene expression preceding PDGF A-chain gene expression, suggesting a difference in the regulation of the expression of the genes for these two chains by these cells

  1. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene; Saidi, Rabie; Hoehndorf, Robert; Martin, Maria J.; Solovyev, Victor

    2016-01-01

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  2. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene

    2016-07-08

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  3. COPPER-DEPENDENT INFLAMMATION AND NUCLEAR FACTOR-KB ACTIVATION BY PARTICULATE AIR POLLUTION

    Science.gov (United States)

    Particulate air pollution causes increased cardiopulmonary morbidity and mortality, but the chemical determinants responsible for its biologic effects are not understood. We studied the effect of total suspended particulates collected in Provo, Utah, an area where an increase in ...

  4. Structural basis for hijacking of human ACBD3 and PI4KB proteins by picornaviruses

    Czech Academy of Sciences Publication Activity Database

    Klíma, Martin; Chalupská, Dominika; Rozycki, B.; Humpolíčková, Jana; Smola, Miroslav; Horová, Vladimíra; Hexnerová, Rozálie; Veverka, Václav; Toth, D.; Balla, T.; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 129 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR(CZ) GJ17-07058Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : picornavirus * ACBD3 * PI4KB Subject RIV: CE - Biochemistry

  5. The 0.3-kb fragment containing the R-U5-5'leader sequence of Friend murine leukemia virus influences the level of protein expression from spliced mRNA.

    Science.gov (United States)

    Choo, Yeng Cheng; Seki, Yohei; Machinaga, Akihito; Ogita, Nobuo; Takase-Yoden, Sayaka

    2013-04-19

    A neuropathogenic variant of Friend murine leukemia virus (Fr-MLV) clone A8 induces spongiform neurodegeneration when infected into neonatal rats. Studies with chimeras constructed from the A8 virus and the non-neuropathogenic Fr-MLV clone 57 identified a 0.3-kb KpnI-AatII fragment containing a R-U5-5'leader sequence as an important determinant for inducing spongiosis, in addition to the env gene of A8 as the primary determinant. This 0.3-kb fragment contains a 17-nucleotide difference between the A8 and 57 sequences. We previously showed that the 0.3-kb fragment influences expression levels of Env protein in both cultured cells and rat brain, but the corresponding molecular mechanisms are not well understood. Studies with expression vectors constructed from the full-length proviral genome of Fr-MLV that incorporated the luciferase (luc) gene instead of the env gene found that the vector containing the A8-0.3-kb fragment yielded a larger amount of spliced luc-mRNA and showed higher expression of luciferase when compared to the vector containing the 57-0.3-kb fragment. The amount of total transcripts from the vectors, the poly (A) tail length of their mRNAs, and the nuclear-cytoplasm distribution of luc-mRNA in transfected cells were also evaluated. The 0.3-kb fragment did not influence transcription efficiency, mRNA polyadenylation or nuclear export of luc-mRNA. Mutational analyses were carried out to determine the importance of nucleotides that differ between the A8 and 57 sequences within the 0.3-kb fragment. In particular, seven nucleotides upstream of the 5'splice site (5'ss) were found to be important in regulating the level of protein expression from spliced messages. Interestingly, these nucleotides reside within the stem-loop structure that has been speculated to limit the recognition of 5'ss. The 0.3-kb fragment containing the R-U5-5'leader sequence of Fr-MLV influences the level of protein expression from the spliced-mRNA by regulating the splicing

  6. SATB1 packages densely-looped, transciptionally-active chromatinfor coordinated expression of cytokine genes

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Shutao; Lee, Charles C.; Kohwi-Shigematsu, Terumi

    2006-05-23

    SATB1 is an important regulator of nuclear architecture that anchors specialized DNA sequences onto its cage-like network and recruits chromatin remodeling/modifying factors to control gene transcription. We studied the role of SATB1 in regulating the coordinated expression of Il5, Il4, and Il13 from the 200kb cytokine gene cluster region of mouse chromosome 11 during T-helper 2 (Th2)-cell activation. We show that upon cell activation, SATB1 is rapidly induced to form a unique transcriptionally-active chromatin structure that includes the cytokine gene region. Chromatin is folded into numerous small loops all anchored by SATB1, is histone H3 acetylated at lysine 9/14, and associated with Th2-specific factors, GATA3, STAT6, c-Maf, the chromatin-remodeling enzyme Brg-1, and RNA polymerase II across the 200kb region. Before activation, the chromatin displays some of these features, such as association with GATA3 and STAT6, but these were insufficient for cytokine gene expression. Using RNA interference (RNAi), we show that upon cell activation, SATB1 is not only required for chromatin folding into dense loops, but also for c-Maf induction and subsequently for Il4, Il5, and Il13 transcription. Our results show that SATB1 is an important determinant for chromatin architecture that constitutes a novel higher-order, transcriptionally-active chromatin structure upon Th2-cell activation.

  7. Identification of herpes simplex virus type 1 proteins encoded within the first 1.5 kb of the latency-associated transcript.

    Science.gov (United States)

    Henderson, Gail; Jaber, Tareq; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2009-09-01

    Expression of the first 1.5 kb of the latency-associated transcript (LAT) that is encoded by herpes simplex virus type 1 (HSV-1) is sufficient for wild-type (wt) levels of reactivation from latency in small animal models. Peptide-specific immunoglobulin G (IgG) was generated against open reading frames (ORFs) that are located within the first 1.5 kb of LAT coding sequences. Cells stably transfected with LAT or trigeminal ganglionic neurons of mice infected with a LAT expressing virus appeared to express the L2 or L8 ORF. Only L2 ORF expression was readily detected in trigeminal ganglionic neurons of latently infected mice.

  8. Tissue factor-dependent activation of tritium-labeled factor IX and factor X in human plasma

    International Nuclear Information System (INIS)

    Morrison, S.A.; Jesty, J.

    1984-01-01

    A comparism was made of the tissue factor-dependent activation of tritium-labeled factor IX and factor X in a human plasma system and a study was made of the role of proteases known to stimulate factor VII activity. Plasma was defibrinated by heating and depleted of its factors IX and X by passing it through antibody columns. Addition of human brain thromboplastin, Ca2+, and purified 3H-labeled factor X to the plasma resulted, after a short lag, in burst-like activation of the factor X, measured as the release of radiolabeled activation peptide. The progress of activation was slowed by both heparin and a specific inhibitor of factor Xa but factor X activation could not be completely abolished by such inhibitors. In the case of 3H-factor IX activation, the rate also increased for approximately 3 min after addition of thromboplastin, but was not subsequently curtailed. A survey of proteases implicated as activators of factor VII in other settings showed that both factor Xa and factor IXa could accelerate the activation of factor IX. However, factor Xa was unique in obliterating activation when present at concentrations greater than approximately 1 nM. Heparin inhibited the tissue factor-dependent activation of factor IX almost completely, apparently through the effect of antithrombin on the feedback reactions of factors Xa and IXa on factor VII. These results suggest that a very tight, biphasic control of factor VII activity exists in human plasma, which is modulated mainly by factor Xa. At saturation of factor VIIa/tissue factor, factor IX activation was significantly more rapid than was previously found in bovine plasma under similar conditions. The activation of factor X at saturation was slightly more rapid than in bovine plasma, despite the presence of heparin

  9. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    Science.gov (United States)

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  10. SAFOD Brittle Microstructure and Mechanics Knowledge Base (BM2KB)

    Science.gov (United States)

    Babaie, Hassan A.; Broda Cindi, M.; Hadizadeh, Jafar; Kumar, Anuj

    2013-07-01

    Scientific drilling near Parkfield, California has established the San Andreas Fault Observatory at Depth (SAFOD), which provides the solid earth community with short range geophysical and fault zone material data. The BM2KB ontology was developed in order to formalize the knowledge about brittle microstructures in the fault rocks sampled from the SAFOD cores. A knowledge base, instantiated from this domain ontology, stores and presents the observed microstructural and analytical data with respect to implications for brittle deformation and mechanics of faulting. These data can be searched on the knowledge base‧s Web interface by selecting a set of terms (classes, properties) from different drop-down lists that are dynamically populated from the ontology. In addition to this general search, a query can also be conducted to view data contributed by a specific investigator. A search by sample is done using the EarthScope SAFOD Core Viewer that allows a user to locate samples on high resolution images of core sections belonging to different runs and holes. The class hierarchy of the BM2KB ontology was initially designed using the Unified Modeling Language (UML), which was used as a visual guide to develop the ontology in OWL applying the Protégé ontology editor. Various Semantic Web technologies such as the RDF, RDFS, and OWL ontology languages, SPARQL query language, and Pellet reasoning engine, were used to develop the ontology. An interactive Web application interface was developed through Jena, a java based framework, with AJAX technology, jsp pages, and java servlets, and deployed via an Apache tomcat server. The interface allows the registered user to submit data related to their research on a sample of the SAFOD core. The submitted data, after initial review by the knowledge base administrator, are added to the extensible knowledge base and become available in subsequent queries to all types of users. The interface facilitates inference capabilities in the

  11. Low LET radiation-induced telomerase catalytic subunit promoter activation is mediated by nuclear factor Kappa B

    International Nuclear Information System (INIS)

    Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.

    2003-01-01

    Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span

  12. A Role for the NF-kb/Rel Transcription Factors in Human Breast Cancer

    National Research Council Canada - National Science Library

    Baldwin, Albert

    1998-01-01

    Human breast cancer is characterized by the inappropriate expression of growth factors, kinases and possibly certain transcription factors Our project has focused on the regulation of the NF-kB family...

  13. A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

    DEFF Research Database (Denmark)

    Becher, Naja; Gjørup, Vibike; Christensen, Rikke

    2012-01-01

    A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

  14. Identification of two small RNAs within the first 1.5-kb of the herpes simplex virus type 1-encoded latency-associated transcript.

    Science.gov (United States)

    Peng, Weiping; Vitvitskaia, Olga; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2008-01-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected neurons. In the rabbit or mouse ocular models of infection, expression of the first 1.5 kb of LAT coding sequences is sufficient for and necessary for wild-type levels of spontaneous reactivation from latency. The antiapoptosis functions of LAT, which maps to the same 1.5 kb of LAT, are important for the latency-reactivation cycle because replacement of LAT with other antiapoptosis genes (the baculovirus IAP gene or the bovine herpesvirus type 1 latency-related gene) restores wild-type levels of reactivation to a LAT null mutant. A recent study identified a micro-RNA within LAT that can inhibit apoptosis (Gupta et al, Nature 442: 82-85). In this study, the authors analyzed the first 1.5 kb of LAT for additional small RNAs that may have regulatory functions. Two LAT-specific small RNAs were detected in productively infected human neuroblastoma cells within the first 1.5 kb of LAT, in a region that is important for inhibiting apoptosis. Although these small RNAs possess extensive secondary structure and a stem-loop structure, bands migrating near 23 bases were not detected suggesting these small RNAs are not true micro-RNAs. Both of the small LAT-specific RNAs have the potential to base pair with the ICP4 mRNA. These two small LAT RNAs may play a role in the latency-reactivation cycle by reducing apoptosis and/or by reducing ICP4 RNA expression.

  15. Induction of necrosis and apoptosis to KB cancer cells by sanguinarine is associated with reactive oxygen species production and mitochondrial membrane depolarization

    International Nuclear Information System (INIS)

    Chang, M.-C.; Chan, C.-P.; Wang, Y.-J.; Lee, P.-H.; Chen, L.-I; Tsai, Y.-L.; Lin, B.-R.; Wang, Y.-L.; Jeng, J.-H.

    2007-01-01

    Sanguinarine is a benzopheanthridine alkaloid present in the root of Sanguinaria canadensis L. and Chellidonium majus L. In this study, sanguinarine (2 and 3 μM) exhibited cytotoxicity to KB cancer cells by decreasing MTT reduction to 83% and 52% of control after 24-h of exposure. Sanguinarine also inhibited the colony forming capacity (> 52-58%) and growth of KB cancer cells at concentrations higher than 0.5-1 μM. Short-term exposure to sanguinarine (> 0.5 μM) effectively suppressed the adhesion of KB cells to collagen and fibronectin (FN). Sanguinarine (2 and 3 μM) induced evident apoptosis as indicated by an increase in sub-G0/G1 populations, which was detected after 6-h of exposure. Only a slight increase in cells arresting in S-phase and G2/M was noted. Induction of KB cell apoptosis and necrosis by sanguinarine (2 and 3 μM) was further confirmed by Annexin V-PI dual staining flow cytometry and the presence of DNA fragmentation. The cytotoxicity by sanguinarine was accompanied by an increase in production of reactive oxygen species (ROS) and depolarization of mitochondrial membrane potential as indicated by single cell flow cytometric analysis of DCF and rhodamine fluorescence. NAC (1 and 3 mM) and catalase (2000 U/ml) prevented the sanguinarine-induced ROS production and cytotoxicity, whereas dimethylthiourea (DMT) showed no marked preventive effect. These results suggest that sanguinarine has anticarcinogenic properties with induction of ROS production and mitochondrial membrane depolarization, which mediate cancer cell death

  16. The effect of Lactobacillus brevis KB290 against irritable bowel syndrome: a placebo-controlled double-blind crossover trial

    Directory of Open Access Journals (Sweden)

    Murakami Katsumi

    2012-08-01

    Full Text Available Abstract Background Irritable bowel syndrome (IBS is a functional disorder of the digestive tract that causes chronic abdominal symptoms. We evaluated the effects of Lactobacillus brevis KB290 (KB290, which has been demonstrated to be effective at improving bowel movements and the composition of intestinal microflora, on IBS symptoms. Methods We performed a placebo control double-blind cross matched trial. Thirty-five males and females (aged 6 years and above who had been diagnosed with IBS according to the Rome III criteria were divided into 2 groups, and after a 4-week pre-trial observation period, they were administered test capsules containing KB290 or placebo for 4 weeks (consumption period I. Then, the capsule administration was suspended for 4 weeks in both groups (washout period, before the opposite capsules were administered for a further 4 weeks (consumption period II. Fecal samples were collected on the first day of the pre-consumption observation period, the last day of consumption period I, the last day of the washout period, and the last day of consumption period II. In addition, the subjects’ IBS symptoms and quality of life (QOL and any adverse events that they experienced were evaluated. Results No significant difference in IBS symptoms was noted among the various periods. However, the mean QOL scores were improved during the test capsule consumption. The frequencies of watery and mushy feces were significantly lower in the test capsule consumption period than during the pre-consumption observation period, and the frequency of abdominal pain was significantly reduced in the test capsule consumption period compared with the other periods. The frequency of the genus Bifidobacterium was significantly higher, and that of the genus Clostridium was significantly lower, after the test capsule consumption than after the placebo consumption. The frequencies of the genera Lactobacillus, Bacteroides, and Enterococcus were also

  17. Immobilization of Cellulase from Bacillus subtilis UniMAP-KB01 on Multi-walled Carbon Nanotubes for Biofuel Production

    Science.gov (United States)

    Naresh, Sandrasekaran; Hoong Shuit, Siew; Kunasundari, Balakrishnan; Hoo Peng, Yong; Qi, Hwa Ng; Teoh, Yi Peng

    2018-03-01

    Bacillus subtilis UniMAP-KB01, a cellulase producer was isolated from Malaysian mangrove soil. Through morphological identification it was observed that the B. subtilis appears to be in rod shaped and identified as a gram positive bacterium. Growth profile of isolated B. subtilis was established by measuring optical density (OD) at 600 nm for every 1 hour intervals. Polymath software was employed to plot the growth profile and the non-linear plot established gave the precision value of linear regression, R2 of 0.9602, root mean square deviation (RMSD) of 0.0176 and variance of 0.0025. The hydrolysis capacity testing revealed the cellulolytic index of 2.83 ± 0.46 after stained with Gram’s Iodine. The harvested crude enzyme after 24 hours incubation in carboxymethylcellulose (CMC) broth at 45°C and 100 RPM, was tested for enzyme activity. Through Filter Paper Assay (FPA), the cellulase activity was calculated to be 0.05 U/mL. The hydrolysis capacity testing and FPA shown an acceptable value for thermophilic bacterial enzyme activity. Thus, this isolated strain reasoned to be potential for producing thermostable cellulase which will be immobilized onto multi-walled carbon nanotubes and the cellulolytic activity will be characterized for biofuel production.

  18. Anti-cancer activity of compounds from Bauhinia strychnifolia stem.

    Science.gov (United States)

    Yuenyongsawad, Supreeya; Bunluepuech, Kingkan; Wattanapiromsakul, Chatchai; Tewtrakul, Supinya

    2013-11-25

    The stem and root of Bauhinia strychnifolia Craib (Fabaceae family) have been traditionally used in Thailand to treat fever, alcoholic toxication, allergy and cancer. An EtOH extract of Bauhinia strychnifolia showed good inhibitory activity against several cancer cell lines including HT-29, HeLa, MCF-7 and KB. As there has been no previous reports on chemical constituents of Bauhinia strychnifolia, this study is aimed to isolate the pure compounds with anti-cancer activity. Five pure compounds were isolated from EtOH extract of Bauhinia strychnifolia stem using silica gel, dianion HP-20 and sephadex LH-20 column chromatography and were tested for their cytotoxic effects against HT-29, HeLa, MCF-7 and KB cell lines using the Sulforhodamine B (SRB) assay. Among five compounds, 3,5,7,3',5'-pentahydroxyflavanonol-3-O-α-l-rhamnopyranoside (2) possessed very potent activity against KB (IC₅₀=0.00054μg/mL), HT-29 (IC₅₀=0.00217 μg/mL), MCF-7 (IC₅₀=0.0585 μg/mL) and HeLa cells (IC₅₀=0.0692 μg/mL). 3,5,7-Trihydroxychromone-3-O-α-l-rhamnopyranoside (3) also showed good activity against HT-29 (IC₅₀=0.02366 μg/mL), KB (IC₅₀=0.0412 μg/mL) and MCF-7 (IC₅₀=0.297 μg/mL), respectively. The activity of 2 (IC₅₀=0.00054 μg/mL) against KB cell was ten times higher than that of the positive control, Camptothecin (anti-cancer drug, IC₅₀=0.0057 μg/mL). All compounds did not show any cytotoxicity with normal cells at the concentration of 1 μg/mL. This is the first report of compounds 2 and 3 on anti-cancer activity and based on the anti-cancer activity of extracts and pure compounds isolated from Bauhinia strychnifolia stem, it might be suggested that this plant could be useful for treatment of cancer. © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    Directory of Open Access Journals (Sweden)

    Birte Möhlendick

    Full Text Available Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH of single cells. The protocol is based on an established adapter-linker PCR (WGAM and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost- effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  20. An in vitro reprogrammable antiviral RISC with size-preferential ribonuclease activity.

    Science.gov (United States)

    Omarov, Rustem T; Ciomperlik, Jessica; Scholthof, Herman B

    2016-03-01

    Infection of Nicotiana benthamiana plants with Tomato bushy stunt virus (TBSV) mutants compromised for silencing suppression induces formation of an antiviral RISC (vRISC) that can be isolated using chromatography procedures. The isolated vRISC sequence-specifically degrades TBSV RNA in vitro, its activity can be down-regulated by removing siRNAs, and re-stimulated by exogenous supply of siRNAs. vRISC is most effective at hydrolyzing the ~4.8kb genomic RNA, but less so for a ~2.2kb TBSV subgenomic mRNA (sgRNA1), while the 3' co-terminal sgRNA2 of ~0.9kb appears insensitive to vRISC cleavage. Moreover, experiments with in vitro generated 5' co-terminal viral transcripts show that RNAs of ~2.7kb are efficiently cleaved while those of ~1.1kb or shorter are unaffected. The isolated antiviral ribonuclease complex fails to degrade ~0.4kb defective interfering RNAs (DIs) in vitro, agreeing with findings that in plants DIs are not targeted by silencing. Copyright © 2016. Published by Elsevier Inc.

  1. Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

    Science.gov (United States)

    2018-01-01

    Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

  2. Activation of cAMP-dependent signaling pathway induces mouse organic anion transporting polypeptide 2 expression.

    Science.gov (United States)

    Chen, Chuan; Cheng, Xingguo; Dieter, Matthew Z; Tanaka, Yuji; Klaassen, Curtis D

    2007-04-01

    Rodent Oatp2 is a hepatic uptake transporter for such compounds as cardiac glycosides. In the present study, we found that fasting resulted in a 2-fold induction of Oatp2 expression in liver of mice. Because the cAMP-protein kinase A (PKA) signaling pathway is activated during fasting, the role of this pathway in Oatp2 induction during fasting was examined. In Hepa-1c1c7 cells, adenylyl cyclase activator forskolin as well as two cellular membrane-permeable cAMP analogs, dibutyryl cAMP and 8-bromo-cAMP, induced Oatp2 mRNA expression in a time- and dose-dependent manner. These three chemicals induced reporter gene activity in cells transfected with a luciferase reporter gene construct containing a 7.6-kilobase (kb) 5'-flanking region of mouse Oatp2. Transient transfection of cells with 5'-deletion constructs derived from the 7.6-kb Oatp2 promoter reporter gene construct, as well as 7.6-kb constructs in which a consensus cAMP response element (CRE) half-site CGTCA (-1808/-1804 bp) was mutated or deleted, confirms that this CRE site was required for the induction of luciferase activity by forskolin. Luciferase activity driven by the Oatp2 promoter containing this CRE site was induced in cells cotransfected with a plasmid encoding the protein kinase A catalytic subunit. Cotransfection of cells with a plasmid encoding the dominant-negative CRE binding protein (CREB) completely abolished the inducibility of the reporter gene activity by forskolin. In conclusion, induction of Oatp2 expression in liver of fasted mice may be caused by activation of the cAMP-dependent signaling pathway, with the CRE site (-1808/-1804) and CREB being the cis- and trans-acting factors mediating the induction, respectively.

  3. Enhanced B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation contributes to ABCC1-mediated chemoresistance and glutathione-mediated survival in acquired topoisomerase II poison-resistant cancer cells.

    Science.gov (United States)

    Chen, Huang-Hui; Chang, Hsin-Huei; Chang, Jang-Yang; Tang, Ya-Chu; Cheng, Yung-Chi; Lin, Li-Mei; Cheng, Shu-Ying; Huang, Chih-Hsiang; Sun, Man-Wu; Chen, Chiung-Tong; Kuo, Ching-Chuan

    2017-12-01

    Nuclear factor erythroid-2-related factor 2 (NRF2) mainly regulates transcriptional activation through antioxidant-responsive elements (AREs) present in the promoters of NRF2 target genes. Recently, we found that NRF2 was overexpressed in a KB-derived drug-resistant cancer cell panel. In this panel, KB-7D cells, which show acquired resistance to topoisomerase II (Top II) poisons, exhibited the highest NRF2 activation. To investigate whether NRF2 directly contributed to acquired resistance against Top II poisons, we manipulated NRF2 by genetic and pharmacological approaches. The result demonstrated that silencing of NRF2 by RNA interference increased the sensitivity and treatment with NRF2 activator decreased the sensitivity of KB and KB-7D cells toward Top II poisons. Further, increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation activated NRF2 signaling in KB-7D cells. Moreover, increased binding of NRF2 to an ARE in the promoter of ATP-binding cassette subfamily C member 1 (ABCC1) directly contributed to Top II poison resistance. In addition, activation of NRF2 increased glutathione level and antioxidant capacity in KB-7D cells compared with that in KB cells; moreover, high glutathione level provided survival advantage to KB-7D cells. Our study is the first to show that aberrant NRF2 activation is via increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation, which increases the acquired resistance and promote the survival of Top II poison-resistant cancer cells. Importantly, NRF2 downstream effectors ABCC1 and glutathione directly contribute to acquired resistance and survival, respectively. These results suggest that blockade of NRF2 signaling may enhance therapeutic efficacy and reduce the survival of Top II poison-refractory tumors in clinical. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Modulation of transcription factors by curcumin.

    Science.gov (United States)

    Shishodia, Shishir; Singh, Tulika; Chaturvedi, Madan M

    2007-01-01

    Curcumin is the active ingredient of turmeric that has been consumed as a dietary spice for ages. Turmeric is widely used in traditional Indian medicine to cure biliary disorders, anorexia, cough, diabetic wounds, hepatic disorders, rheumatism, and sinusitis. Extensive investigation over the last five decades has indicated that curcumin reduces blood cholesterol, prevents low-density lipoprotein oxidation, inhibits platelet aggregation, suppresses thrombosis and myocardial infarction, suppresses symptoms associated with type II diabetes, rheumatoid arthritis, multiple sclerosis, and Alzheimer's disease, inhibits HIV replication, enhances wound healing, protects from liver injury, increases bile secretion, protects from cataract formation, and protects from pulmonary toxicity and fibrosis. Evidence indicates that the divergent effects of curcumin are dependent on its pleiotropic molecular effects. These include the regulation of signal transduction pathways and direct modulation of several enzymatic activities. Most of these signaling cascades lead to the activation of transcription factors. Curcumin has been found to modulate the activity of several key transcription factors and, in turn, the cellular expression profiles. Curcumin has been shown to elicit vital cellular responses such as cell cycle arrest, apoptosis, and differentiation by activating a cascade of molecular events. In this chapter, we briefly review the effects of curcumin on transcription factors NF-KB, AP-1, Egr-1, STATs, PPAR-gamma, beta-catenin, nrf2, EpRE, p53, CBP, and androgen receptor (AR) and AR-related cofactors giving major emphasis to the molecular mechanisms of its action.

  5. Early Intervention of Intravenous KB220IV- Neuroadaptagen Amino-Acid Therapy (NAAT)™ Improves Behavioral Outcomes in a Residential Addiction Treatment Program: A Pilot Study

    Science.gov (United States)

    Miller, Merlene; Chen, Amanda LC; Stokes, Stan D.; Silverman, Susan; Bowirrat, Abdalla; Manka, Matthew; Manka, Debra; Miller, David K.; Perrine, Kenneth; Chen, Thomas JH; Bailey, John A.; Downs, William; Waite, Roger L.; Madigan, Margaret A.; Braverman, Eric R.; Damle, Uma; Kerner, Mallory; Giordano, John; Morse, Siobhan; Oscar-Berman, Marlene; Barh, Debmalya; Blum, Kenneth

    2014-01-01

    Substance use disorders (SUD) are inheritable and the culprit is hypodopaminergic function regulated by reward genes. We evaluated a natural dopaminergic agonist; KB220 intravenous (IV) and oral variants, to improve dopaminergic function in SUD. Our pilot experiment found a significant reduction of chronic symptoms, measured by the Chronic Abstinence Symptom Severity (CASS) Scale. The combined group (IV and oral) did significantly better than the oral-only group over the first week and 30-day follow-up period. Next, the combination was given to129 subjects and three factors; Emotion, Somatic, and Impaired Cognition, with eigenvalues greater than one were extracted for baseline CASS-Revised (CASS-R) variables. Paired sample t-tests for pre and post-treatment scales showed significant declines (p = .00001) from pre- to post-treatment: t = 19.1 for Emotion, t = 16.1 for Somatic, and t = 14.9 for Impaired Cognition. In a two-year follow-up of 23 subjects who underwent KB220IV therapy (at least five IV treatments over seven days) plus orals for 30+ days: 21 (91%) were sober at six months, 19 (82%) having no relapse; 19 (82%) were sober at one year, 18 (78%) having no relapse; and 21 (91%) were sober two-years post-treatment, 16 (70%) having no relapse. We await additional research and advise caution in interpreting these encouraging results. PMID:23457891

  6. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  7. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  8. Metabolic Responses in Endothelial Cells Following Exposure to Ketone Bodies

    Directory of Open Access Journals (Sweden)

    Erika Meroni

    2018-02-01

    Full Text Available The ketogenic diet (KD is a high-fat, low-carbohydrate diet based on the induction of the synthesis of ketone bodies (KB. Despite its widespread use, the systemic impact of KD is not completely understood. The purpose of this study was to evaluate the effects of physiological levels of KB on HMEC-1 endothelial cells. To this aim, DNA oxidative damage and the activation of Nrf2, a known transcriptional factor involved in cell responses to oxidative stress, were assessed. The exposure of cells to KB exerted a moderate genotoxic effect, measured by a significant increase in DNA oxidative damage. However, cells pre-treated with KB for 48 h and subjected to a secondary oxidative insult (H2O2, significantly decreased DNA damage compared to control oxidized cells. This protection occurred by the activation of Nrf2 pathway. In KB-treated cells, we found increased levels of Nrf2 in nuclear extracts and higher gene expression of HO-1, a target gene of Nrf2, compared to control cells. These results suggest that KB, by inducing moderate oxidative stress, activate the transcription factor Nrf2, which induces the transcription of target genes involved in the cellular antioxidant defense system.

  9. Retrospective analysis in oculocutaneous albinism patients for the 2.7 kb deletion in the OCA2 gene revealed a co-segregation of the controversial variant, p.R305W.

    Science.gov (United States)

    Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing

    2017-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.

  10. Differentiation and fiber type-specific activity of a muscle creatine kinase intronic enhancer

    Directory of Open Access Journals (Sweden)

    Tai Phillip WL

    2011-07-01

    Full Text Available Abstract Background Hundreds of genes, including muscle creatine kinase (MCK, are differentially expressed in fast- and slow-twitch muscle fibers, but the fiber type-specific regulatory mechanisms are not well understood. Results Modulatory region 1 (MR1 is a 1-kb regulatory region within MCK intron 1 that is highly active in terminally differentiating skeletal myocytes in vitro. A MCK small intronic enhancer (MCK-SIE containing a paired E-box/myocyte enhancer factor 2 (MEF2 regulatory motif resides within MR1. The SIE's transcriptional activity equals that of the extensively characterized 206-bp MCK 5'-enhancer, but the MCK-SIE is flanked by regions that can repress its activity via the individual and combined effects of about 15 different but highly conserved 9- to 24-bp sequences. ChIP and ChIP-Seq analyses indicate that the SIE and the MCK 5'-enhancer are occupied by MyoD, myogenin and MEF2. Many other E-boxes located within or immediately adjacent to intron 1 are not occupied by MyoD or myogenin. Transgenic analysis of a 6.5-kb MCK genomic fragment containing the 5'-enhancer and proximal promoter plus the 3.2-kb intron 1, with and without MR1, indicates that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers (types I and IIa, respectively, but is not required for expression in fast-twitch muscle fibers (types IIb and IId. Conclusions In this study, we discovered that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers and that MR1's positive transcriptional activity depends on a paired E-box MEF2 site motif within a SIE. This is the first study to delineate the DNA controls for MCK expression in different skeletal muscle fiber types.

  11. A potential contributory role for ciliary dysfunction in the 16p11.2 600 kb BP4-BP5 pathology

    NARCIS (Netherlands)

    Migliavacca, Eugenia; Golzio, Christelle; Männik, Katrin; Blumenthal, Ian; Oh, Edwin C.; Harewood, Louise; Kosmicki, Jack A.; Loviglio, Maria Nicla; Giannuzzi, Giuliana; Hippolyte, Loyse; Maillard, Anne M.; Alfaiz, Ali Abdullah; Witwicki, Robert; Didelot, Gérard; Van Der Werf, Ilse; Alfaiz, Ali A.; Zazhytska, Marianna; Chrast, Jacqueline; Macé, Aurélien; Bergmann, Sven; Kutalik, Zoltan; Siffredi, Vanessa; Zufferey, Flore; Martinet, Danielle; Bena, Frédérique; Rauch, Anita; Bouquillon, Sonia; Delobel, Bruno; Boute, Odile; Duban-Bedu, Bénédicte; Le Caignec, Cédric; Isidor, Bertrand; Chiesa, Jean; Keren, Boris; Gilbert-Dussardier, Brigitte; Touraine, Renaud; Campion, Dominique; Thambo, Caroline Rooryck; Mathieu-Dramard, Michèle; Plessis, Ghislaine; Kooy, Frank; Peeters, Hilde; Ounap, Katrin; Vulto-Van Silfhout, Anneke T.; De Vries, Bert B.; Van Binsbergen, Ellen; Nordgren, Ann; Mucciolo, Mafalda; Renieri, Alessandra; Rajcan-Separovic, Evica; Philipps, John A.; Ellis, Richard J.; Van Haelst, Mieke M.; Andrieux, Joris; Gusella, James F.; Daly, Mark J.; Beckmann, Jacques S.; Jacquemont, Sébastien; Talkowski, Michael E.; Katsanis, Nicholas; Reymond, Alexandre

    2015-01-01

    The 16p11.2 600 kb copy-number variants (CNVs) are associated with mirror phenotypes on BMI, head circumference, and brain volume and represent frequent genetic lesions in autism spectrum disorders (ASDs) and schizophrenia. Here we interrogated the transcriptome of individuals carrying reciprocal

  12. Somatomedin-C/insulin-like growth factor-I and Insulin-like growth factor-II mRNAs in rate fetal and adult tissues

    International Nuclear Information System (INIS)

    Lund, P.K.; Moats-Staats, B.M.; Hynes, M.A.; Simmons, J.G.; Jansen, M.; D'ercole, A.J.; Van Wyk, J.J.

    1986-01-01

    Somatomedin-C or insulin-like growth factor I (Sm-C/IGF-I) and insulin-like growth factor II (IGF-II) have been implicated in the regulation of fetal growth and development. In the present study 32 P-labeled complementary DNA probes encoding human and mouse Sm-C/IGF-I and human IGF-II were used in Northern blot hybridizations to analyze rat Sm-C/IGF-I and IGF-II mRNAs in poly(A + ) RNAs from intestine, liver, lung, and brain of adult rats and fetal rats between day 14 and 17 of gestation. In fetal rats, all four tissues contained a major mRNA of 1.7 kilobase (kb) that hybridized with the human Sm-C/IGF-I cDNA and mRNAs of 7.5, 4.7, 1.7, and 1.2 kb that hybridized with the mouse Sm-C/IGF-I cDNA. Adult rat intestine, liver, and lung also contained these mRNAs but Sm-C/IGF-I mRNAs were not detected in adult rat brain. These findings provide direct support for prior observations that multiple tissues in the fetus synthesize immunoreactive Sm-C/IGF-I and imply a role for Sm-C/IGF-I in fetal development as well as postnatally. Multiple IGF-II mRNAs of estimated sizes 4.7, 3.9, 2.2, 1.75, and 1.2 kb were observed in fetal rat intestine, liver, lung, and brain. The 4.7- and 3.9-kb mRNAs were the major hybridizing IGF-II mRNAs in all fetal tissues. Higher abundance of IGF-II mRNAs in rat fetal tissues compared with adult tissues supports prior hypotheses, based on serum IGF-II concentrations, that IGF-II is predominantly a fetal somatomedin. IGF-II mRNAs are present, however, in some poly(A + ) RNAs from adult rat tissues. The brain was the only tissue in the adult rat where the 4.7- and 3.9-kb IGF-II mRNAs were consistently detected. These findings suggest that a role for IGF-II in the adult rat, particularly in the central nervous system, cannot be excluded

  13. Activation of factor VII bound to tissue factor: A key early step in the tissue factor pathway of blood coagulation

    International Nuclear Information System (INIS)

    Rao, L.V.M.; Rapaport, S.I.

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. The earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were made with purified factor VII, X, and tissue factor; in some experiments antithrombin III and heparin were added to prevent back-activation of factor VII. Factor X was activated at similar rates in reaction mixtures containing either VII or factor VIIa after an initial 30-sec lag with factor VII. In reaction mixtures with factor VII a linear activation of factor X was established several minutes before cleavage of 125 I-labeled factor VII to the two-chain activated molecule was demonstrable on gel profiles. These data suggest that factor VII/tissue factor cannot activate measurable amounts of factor X over several minutes. Overall, the results support the hypothesis that a rapid preferential activation of factor VII bound to tissue factor by trace amounts of factor Xa is a key early step in tissue factor-dependent blood coagulation

  14. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  15. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    Science.gov (United States)

    Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni; Mitchell, Leslie A.; Luo, Zhouqing; Fan, Yanqun; Zhou, Baojin; Wen, Bo; Tan, Fengji; Wang, Yujia; Zi, Jin; Xie, Zexiong; Li, Bingzhi; Yang, Kun; Richardson, Sarah M.; Jiang, Hui; French, Christopher E.; Nieduszynski, Conrad A.; Koszul, Romain; Marston, Adele L.; Yuan, Yingjin; Wang, Jian; Bader, Joel S.; Dai, Junbiao; Boeke, Jef D.; Xu, Xun; Cai, Yizhi; Yang, Huanming

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synII is mainly caused by the deletion of 13 tRNAs. By both complementation assays and SCRaMbLE, we targeted and debuged the origin of a growth defect at 37°C in glycerol medium, which is related to misregulation of the HOG response. Despite the subtle differences, the synII strain shows highly consistent biological processes comparable to the native strain. PMID:28280153

  16. Identification of a 3.0-kb Major Recombination Hotspot in Patients with Sotos Syndrome Who Carry a Common 1.9-Mb Microdeletion

    Science.gov (United States)

    Visser, Remco; Shimokawa, Osamu; Harada, Naoki; Kinoshita, Akira; Ohta, Tohru; Niikawa, Norio; Matsumoto, Naomichi

    2005-01-01

    Sotos syndrome (SoS) is a congenital dysmorphic disorder characterized by overgrowth in childhood, distinctive craniofacial features, and mental retardation. Haploinsufficiency of the NSD1 gene owing to either intragenic mutations or microdeletions is known to be the major cause of SoS. The common ∼2.2-Mb microdeletion encompasses the whole NSD1 gene and neighboring genes and is flanked by low-copy repeats (LCRs). Here, we report the identification of a 3.0-kb major recombination hotspot within these LCRs, in which we mapped deletion breakpoints in 78.7% (37/47) of patients with SoS who carry the common microdeletion. The deletion size was subsequently refined to 1.9 Mb. Sequencing of breakpoint fragments from all 37 patients revealed junctions between a segment of the proximal LCR (PLCR-B) and the corresponding region of the distal LCR (DLCR-2B). PLCR-B and DLCR-2B are the only directly oriented regions, whereas the remaining regions of the PLCR and DLCR are in inverted orientation. The PLCR, with a size of 394.0 kb, and the DLCR, with a size of of 429.8 kb, showed high overall homology (∼98.5%), with an increased sequence similarity (∼99.4%) within the 3.0-kb breakpoint cluster. Several recombination-associated motifs were identified in the hotspot and/or its vicinity. Interestingly, a 10-fold average increase of a translin motif, as compared with the normal distribution within the LCRs, was recognized. Furthermore, a heterozygous inversion of the interval between the LCRs was detected in all fathers of the children carrying a deletion in the paternally derived chromosome. The functional significance of these findings remains to be elucidated. Segmental duplications of the primate genome play a major role in chromosomal evolution. Evolutionary study showed that the duplication of the SoS LCRs occurred 23.3–47.6 million years ago, before the divergence of Old World monkeys. PMID:15580547

  17. Differential proteolytic activation of factor VIII-von Willebrand factor complex by thrombin

    International Nuclear Information System (INIS)

    Hill-Eubanks, D.C.; Parker, C.G.; Lollar, P.

    1989-01-01

    Blood coagulation factor VIII (fVIII) is a plasma protein that is decreased or absent in hemophilia A. It is isolated as a mixture of heterodimers that contain a variably sized heavy chain and a common light chain. Thrombin catalyzes the activation of fVIII in a reaction that is associated with cleavages in both types of chain. The authors isolated a serine protease from Bothrops jararacussu snake venom that catalyzes thrombin-like heavy-chain cleavage but not light-chain cleavage in porcine fVIII as judged by NaDodSO 4 /PAGE and N-terminal sequence analysis. Using a plasma-free assay of the ability of activated 125 I-fVIII to function as a cofactor in the activation of factor X by factor IXa, they found that fVIII is activated by the venom enzyme. The venom enzyme-activated fVIII was isolated in stable form by cation-exchange HPLC. von Willebrand factor inhibited venom enzyme-activated fVIII but not thrombin-activated fVIII. These results suggest that the binding of fVIII to von Willebrand factor depends on the presence of an intact light chain and that activated fVIII must dissociate from von Willebrand factor to exert its cofactor effect. Thus, proteolytic activation of fVIII-von Willebrand factor complex appears to be differentially regulated by light-chain cleavage to dissociate the complex and heavy-chain cleavage to activate the cofactor function

  18. Activation of factor VII bound to tissue factor: a key early step in the tissue factor pathway of blood coagulation.

    OpenAIRE

    Rao, L V; Rapaport, S I

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and factor IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. Our earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were ma...

  19. The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

    Science.gov (United States)

    Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

    2014-04-01

    α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

  20. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle

    DEFF Research Database (Denmark)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole

    The spectacular increase in productivity of dairy cattle has been accompanied by a decline in fertility. It is assumed that this reduction is due to the negative energy balance of high producing cows. We herein describe the dissection of a fertility QTL in Nordic Red cattle to a 660-Kb deletion...

  1. Deleterious effect of salusin-β in paraventricular nucleus on sympathetic activity and blood pressure via NF-κB signaling in a rat model of obesity hypertension.

    Science.gov (United States)

    Huang, Xiaodong; Wang, Yanchun; Ren, Kuang

    2015-08-01

    The paraventricular nucleus (PVN) has been shown to play a critical role in regulating blood pressure and sympathetic activity in obesity hypertension (OH). Salusin-β is a bioactive peptide with potential roles in mediating cardiovascular activity. The study was designed to test the hypothesis that salusin-β in the PVN can modulate sympathetic activity and blood pressure in OH. Male Sprague-Dawley rats were used to induce OH by a 12-week feeding of a high-fat diet (42% kcal as fat). Microinjection of salusin-β into the PVN increased the renal sympathetic nerve activity (RSNA), mean arterial pressure (MAP) and heart rate (HR) in a dose-dependent manner, whereas salusin-β antibody elicited significant decreases in RSNA, MAP and HR, and abolished the effects of salusin-β only in the OH rats. As expected, the OH rats had a higher norepinephrine level, which was further increased by salusin-β. Furthermore, salusin-β in the PVN accelerated the nuclear translocation of the p65 subunit of nuclear factor kappa B (NF-KB) and the degradation of IKB-α (an endogenous inhibitor of NF-KB). Pretreatment with pyrrolidine dithiocarbamate (an exogenous inhibitor of NF-KB) decreased RSNA, MAP and HR, and abolished the effects of salusin-β in the PVN in the OH rats. We concluded that salusin-β in the PVN markedly increased sympathetic outflow and blood pressure in diet-induced OH rats via NF-κB signaling.

  2. Terminal uranium(V/VI) nitride activation of carbon dioxide and carbon disulfide. Factors governing diverse and well-defined cleavage and redox reactions

    International Nuclear Information System (INIS)

    Cleaves, Peter A.; Gardner, Benedict M.; Liddle, Stephen T.; Kefalidis, Christos E.; Maron, Laurent; Tuna, Floriana; McInnes, Eric J.L.; Lewis, William

    2017-01-01

    The reactivity of terminal uranium(V/VI) nitrides with CE 2 (E=O, S) is presented. Well-defined C=E cleavage followed by zero-, one-, and two-electron redox events is observed. The uranium(V) nitride [U(Tren TIPS )(N)][K(B15C5) 2 ] (1, Tren TIPS =N(CH 2 CH 2 NSiiPr 3 ) 3 ; B15C5=benzo-15-crown-5) reacts with CO 2 to give [U(Tren TIPS )(O)(NCO)][K(B15C5) 2 ] (3), whereas the uranium(VI) nitride [U(Tren TIPS )(N)] (2) reacts with CO 2 to give isolable [U(Tren TIPS )(O)(NCO)] (4); complex 4 rapidly decomposes to known [U(Tren TIPS )(O)] (5) with concomitant formation of N 2 and CO proposed, with the latter trapped as a vanadocene adduct. In contrast, 1 reacts with CS 2 to give [U(Tren TIPS )(κ 2 -CS 3 )][K(B15C5) 2 ] (6), 2, and [K(B15C5) 2 ][NCS] (7), whereas 2 reacts with CS 2 to give [U(Tren TIPS )(NCS)] (8) and ''S'', with the latter trapped as Ph 3 PS. Calculated reaction profiles reveal outer-sphere reactivity for uranium(V) but inner-sphere mechanisms for uranium(VI); despite the wide divergence of products the initial activation of CE 2 follows mechanistically related pathways, providing insight into the factors of uranium oxidation state, chalcogen, and NCE groups that govern the subsequent divergent redox reactions that include common one-electron reactions and a less-common two-electron redox event. Caution, we suggest, is warranted when utilising CS 2 as a reactivity surrogate for CO 2 . (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  3. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    Energy Technology Data Exchange (ETDEWEB)

    Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  4. Anti-inflammatory and cytotoxic activities of five Veronica species.

    Science.gov (United States)

    Harput, U Sebnem; Saracoglu, Iclal; Inoue, Makoto; Ogihara, Yukio

    2002-04-01

    Biological activities of five Veronica species (Scrophulariaceae), V. cymbalaria, V. hederifolia, V. pectinata var. glandulosa, V. persica and V. polita were studied for their anti-inflammatory and cytotoxic activities. Their methanol extracts showed both the inhibitory activity of nitric oxide (NO) production in lipopolysaccharide (LPS)-stimulated macrophages and cytotoxic activity against KB epidermoid carcinoma and B16 melanoma. When the methanol extracts were fractionated between water and chloroform, water fractions significantly inhibited NO production without any cytotoxicity, while chloroform fractions showed cytotoxicity dose-dependently. When the radical scavenging activity was determined using 2,2-diphenyl-1-picryl-hydrazyl (DPPH), water fractions of the five Veronica species scavenged free radicals effectively, suggesting that the inhibitory effect of this species on NO production was due to their radical scavenging activity. On the other hand, chloroform fractions of Veronica species except for V. cymbalaria showed similar cytotoxic activity against KB and B16 melanoma cells.

  5. PGen: large-scale genomic variations analysis workflow and browser in SoyKB.

    Science.gov (United States)

    Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti

    2016-10-06

    With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most

  6. Effect of surface charge and agglomerate degree of magnetic iron oxide nanoparticles on KB cellular uptake in vitro.

    Science.gov (United States)

    Ge, Yuqing; Zhang, Yu; Xia, Jingguang; Ma, Ming; He, Shiying; Nie, Fang; Gu, Ning

    2009-10-15

    We synthesized three types of magnetic iron oxide nanoparticles (MNPs), which were meso-2,3-dimercaptosuccinic acid (DMSA) coated MNPs (DMSA@MNPs, 17.3+/-4.8 nm, negative charge), chitosan (CS) coated MNPs (CS@MNPs, 16.5+/-6.1 nm, positive charge) and magnetic nanoparticles agglomerates, formed by electronic aggregation between DMSA@MNPs and CS (CS-DMSA@MNPs, 85.7+/-72.9 nm, positive charge) respectively. The interactions of these MNPs with Oral Squamous Carcinoma Cell KB were investigated. The results showed that cellular uptakes of MNPs were on the dependence of incubation time, nanoparticles concentration and nanoparticles properties such as surface charge, size, etc. The cellular uptake was enhanced with the increase of incubation time and nanoparticles concentration. Although all MNPs could enter to cells, we observed apparent differences in the magnitude of nanoparticles uptaken. The cellular uptake of CS-DMSA@MNPs by KB cells was the highest and that of DMSA@MNPs was the lowest among the three types of MNPs. The same conclusions were drawn via the reduction of water proton relaxation times T(2)(*), resulting from the different iron load of labeled cells using a 1.5T clinical MR imager. The finding of this study will have implications in the chemical design of nanomaterials for biomedical applications.

  7. Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

    Science.gov (United States)

    Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

    1998-08-01

    Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

  8. Kinetics of the Factor XIa catalyzed activation of human blood coagulation Factor IX

    International Nuclear Information System (INIS)

    Walsh, P.N.; Bradford, H.; Sinha, D.; Piperno, J.R.; Tuszynski, G.P.

    1984-01-01

    The kinetics of activation of human Factor IX by human Factor XIa was studied by measuring the release of a trichloroacetic acid-soluble tritium-labeled activation peptide from Factor IX. Initial rates of trichloroacetic acid-soluble 3 H-release were linear over 10-30 min of incubation of Factor IX (88 nM) with CaCl 2 (5 mM) and with pure (greater than 98%) Factor XIa (0.06-1.3 nM), which was prepared by incubating human Factor XI with bovine Factor XIIa. Release of 3 H preceded the appearance of Factor IXa activity, and the percentage of 3 H released remained constant when the mole fraction of 3 H-labeled and unlabeled Factor IX was varied and the total Factor IX concentration remained constant. A linear correlation (r greater than 0.98, P less than 0.001) was observed between initial rates of 3 H-release and the concentration of Factor XIa, measured by chromogenic assay and by radioimmunoassay and added at a Factor IX:Factor XIa molar ratio of 70-5,600. Kinetic parameters, determined by Lineweaver-Burk analysis, include K/sub m/ (0.49 microM) of about five- to sixfold higher than the plasma Factor IX concentration, which could therefore regulate the reaction. The catalytic constant (k/sub cat/) (7.7/s) is approximately 20-50 times higher than that reported by Zur and Nemerson for Factor IX activation by Factor VIIa plus tissue factor. Therefore, depending on the relative amounts of Factor XIa and Factor VIIa generated in vivo and other factors which may influence reaction rates, these kinetic parameters provide part of the information required for assessing the relative contributions of the intrinsic and extrinsic pathways to Factor IX activation, and suggest that the Factor XIa catalyzed reaction is physiologically significant

  9. Chronic myeloid leukemia may be associated with several bcr-abl transcripts including the acute lymphoid leukemia-type 7 kb transcript

    NARCIS (Netherlands)

    Selleri, L.; von Lindern, M.; Hermans, A.; Meijer, D.; Torelli, G.; Grosveld, G.

    1990-01-01

    In the majority of Philadelphia (Ph)-positive chronic myeloid leukemia (CML) patients, the c-abl gene is fused to the bcr gene, resulting in the transcription of an 8.5 kb chimeric bcr-abl mRNA, which is translated into a p210bcr-abl fusion protein. In about 50% of the Ph-positive acute lymphoid

  10. Activation of 125I-Factor IX and 125I-Factor X: Effect of tissue factor and Factor VII, Factor Xsub(a) and thrombin

    International Nuclear Information System (INIS)

    Oesterud, B.; Rapaport, S.I.

    Activation of Factor IX and Factor X was studied by adding 125 I-Factor IX or 125 I-Factor X to reaction mixtures and quantitating cleavage products by reduced sodium dodecylsulfate gel electrophoresis. Thrombin failed to activate Factors IX or X; Factor Xsub(a) produced insignificant amounts of cleavage products of both factors. In contrast, the reaction product of tissue factor and Factor VII cleaved large amounts of both Factor IX and Factor X in purified systems and in plasma. In incubation mixtures of plasma containing added 125 I-Factor IX or 125 I-Factor X, tissue factor and Ca 2+ ions, the percentage of total radioactivity in the heavy chain peak of 125 I-IXsub(a) and the heavy chain of 125 I-Xsub(a) increased at a similar rate. When the tissue factor was diluted, similar curves were obtained for percent cleavage of 125 I-Factor IX and percent cleavage of 125 I-Factor X plotted against tissue factor concentration. These findings support the hypothesis that activation of Factor IX by the tissue factor-Factor VII reaction product represents a physiologically significant step in normal haemostasis. (author)

  11. Giant panda BAC library construction and assembly of a 650-kb contig spanning major histocompatibility complex class II region

    Directory of Open Access Journals (Sweden)

    Pan Hui-Juan

    2007-09-01

    Full Text Available Abstract Background Giant panda is rare and endangered species endemic to China. The low rates of reproductive success and infectious disease resistance have severely hampered the development of captive and wild populations of the giant panda. The major histocompatibility complex (MHC plays important roles in immune response and reproductive system such as mate choice and mother-fetus bio-compatibility. It is thus essential to understand genetic details of the giant panda MHC. Construction of a bacterial artificial chromosome (BAC library will provide a new tool for panda genome physical mapping and thus facilitate understanding of panda MHC genes. Results A giant panda BAC library consisting of 205,800 clones has been constructed. The average insert size was calculated to be 97 kb based on the examination of 174 randomly selected clones, indicating that the giant panda library contained 6.8-fold genome equivalents. Screening of the library with 16 giant panda PCR primer pairs revealed 6.4 positive clones per locus, in good agreement with an expected 6.8-fold genomic coverage of the library. Based on this BAC library, we constructed a contig map of the giant panda MHC class II region from BTNL2 to DAXX spanning about 650 kb by a three-step method: (1 PCR-based screening of the BAC library with primers from homologous MHC class II gene loci, end sequences and BAC clone shotgun sequences, (2 DNA sequencing validation of positive clones, and (3 restriction digest fingerprinting verification of inter-clone overlapping. Conclusion The identifications of genes and genomic regions of interest are greatly favored by the availability of this giant panda BAC library. The giant panda BAC library thus provides a useful platform for physical mapping, genome sequencing or complex analysis of targeted genomic regions. The 650 kb sequence-ready BAC contig map of the giant panda MHC class II region from BTNL2 to DAXX, verified by the three-step method, offers a

  12. Role of hepsin in factor VII activation in zebrafish.

    Science.gov (United States)

    Khandekar, Gauri; Jagadeeswaran, Pudur

    2014-01-01

    Factor VII, the initiator of the extrinsic coagulation cascade, circulates in human plasma mainly in its zymogen form, factor VII and in small amounts in its activated form, factor VIIa. However, the mechanism of initial generation of factor VIIa is not known despite intensive research using currently available model systems. Earlier findings suggested serine proteases factor VII activating protease and hepsin play a role in activating factor VII, however, it has remained controversial. In this paper we estimated the levels of factor VIIa and factor VII for the first time in zebrafish adult population and also reevaluated the role of the above two serine proteases in activating factor VII in vivo using zebrafish as a model system. Knockdown of factor VII activating protease and hepsin was performed followed by assaying for their effect on factor VIIa concentration and extrinsic coagulation as measured by the kinetic prothrombin time. Factor VII activating protease knockdown showed no change in kinetic prothrombin time and no effect on factor VIIa levels while hepsin knockdown increased the kinetic prothrombin time and significantly reduced the factor VIIa plasma levels. Our results thus indicate that hepsin plays a physiologically important role in factor VII activation and hemostasis in zebrafish. © 2013.

  13. Key factors of enterprise innovation activity

    Directory of Open Access Journals (Sweden)

    Pichugina Maryna Anatoliivna

    2015-02-01

    Full Text Available The article deals with the studies of factors and conditions that define enterprise innovative activity. It is distinguished factors that influence the orientation on innovation of a company and factors that influence the innovation ability. It is noted an interdependence between innovative ability, orientation and activity. The article is also dedicated to analyses of influence specific industry characteristics and inner view of enterprise. It is discussed the influence of such factors as knowledge base, the organizational learning mechanisms, an external openness and the structure of innovative connections on the company opportunities to innovate. It is tried to focus on the impact of the environment on enterprise capabilities.

  14. Evaluation of some biological activities of Abelia triflora R Br ...

    African Journals Online (AJOL)

    Antidiabetic and cardiovascular activities were determined by screening for peroxisome proliferator-activated receptor alpha (PPARα) and PPARɣ agonistic activities. In vitro cytotoxic activity was determined against a set of four human cancer cell lines (SK-MEL, KB, BT-549, SK-OV-3) and two non-cancerous kidney cell ...

  15. Encouraging post-stroke patients to be active seems possible: results of an intervention study with knowledge brokers.

    Science.gov (United States)

    Willems, Mia; Schröder, Carin; van der Weijden, Trudy; Post, Marcel W; Visser-Meily, Anne M

    2016-08-01

    Although physical activity and exercise for stroke patients is highly recommended for fast recovery, patients in hospitals and rehabilitation centres are insufficiently encouraged to be physically active. In this study, we investigated the impact of knowledge brokers (KBs), enterprising nurses and therapists, on health professionals' (HP) performance to encourage stroke inpatients to be physically active. This multicenter intervention study used a pre-post test design. Two or three KBs were trained in each stroke unit of 12 hospitals and 10 rehabilitation centres in The Netherlands. Questionnaires were completed by patients and HPs before and after the KB-intervention. The primary outcome was encouragement given by HPs to their patients to be physically active, as reported by patients and HPs. After the KB-intervention, many more patients (48%; N=217) reported at least some encouragement by HPs to be physically active than before (26%; N=243, pbrokers (KBs), since the KB-intervention was shown to increase the encouragement felt by stroke patients to be physically active. It seems worthwhile to involve physicians, nurses and patients' families more frequently in efforts to encourage stroke patients to be physically active.

  16. Promoting the use of measurement tools in practice: a mixed-methods study of the activities and experiences of physical therapist knowledge brokers.

    Science.gov (United States)

    Rivard, Lisa M; Russell, Dianne J; Roxborough, Lori; Ketelaar, Marjolijn; Bartlett, Doreen J; Rosenbaum, Peter

    2010-11-01

    The use of knowledge brokers (KBs) has been recommended as a mechanism to facilitate the use of research evidence in clinical practice. However, little has been written regarding the practical implementation of the KB role. This article (1) describes the brokering activities of 24 pediatric physical therapist KBs (in Ontario, Alberta, and British Columbia, Canada), and (2) reports KBs' perceptions of the utility of their role and their experiences with the brokering process. A mixed-methods research design was used in this investigation, which was part of a larger knowledge translation (KT) study that demonstrated the effectiveness of using KBs to implement a group of evidence-based measurement tools into practice. The KBs completed weekly activity logs, which were summarized and described. Semi-structured telephone interviews with KBs were analyzed qualitatively to provide insight into their perceptions of their role and the brokering process. Major interview themes were identified and verified through member checking. Brokering activities varied considerably as KBs adapted to meet the needs of their colleagues. The KBs indicated that they highly valued the connection to the research community and spoke of the enthusiastic engagement of their physical therapist colleagues (and others in their organization) in the brokering process. They discussed the importance of understanding the practice context and organizational factors that could affect knowledge transfer. The KBs spoke of the need to dedicate time for the role and had a strong sense of the supports needed to implement a KB role in future. Considerable variation in brokering activities was demonstrated across KB participants. The KBs perceived their role as useful and indicated that organizational commitment is crucial to the success of this KT strategy.

  17. Estrogen-induced transcription factor EGR1 regulates c-Kit transcription in the mouse uterus to maintain uterine receptivity for embryo implantation.

    Science.gov (United States)

    Park, Mira; Kim, Hye-Ryun; Kim, Yeon Sun; Yang, Seung Chel; Yoon, Jung Ah; Lyu, Sang Woo; Lim, Hyunjung Jade; Hong, Seok-Ho; Song, Haengseok

    2018-07-15

    Early growth response 1 (Egr1) is a key transcription factor that mediates the action of estrogen (E 2 ) to establish uterine receptivity for embryo implantation. However, few direct target genes of EGR1 have been identified in the uterus. Here, we demonstrated that E 2 induced EGR1-regulated transcription of c-Kit, which plays a crucial role in cell fate decisions. Spatiotemporal expression of c-Kit followed that of EGR1 in uteri of ovariectomized mice at various time points after E 2 treatment. E 2 activated ERK1/2 and p38 to induce EGR1, which then activated c-Kit expression in the uterus. EGR1 transfection produced rapid and transient induction of c-KIT in a time- and dose-dependent manner. Furthermore, luciferase assays to measure c-Kit promoter activity confirmed that a functional EGR1 binding site(s) (EBS) was located within -1 kb of the c-Kit promoter. Site-directed mutagenesis and chromatin immunoprecipitation-PCR for three putative EBS within -1 kb demonstrated that the EBS at -818/-805 was critical for EGR1-dependent c-Kit transcription. c-Kit expression was significantly increased in the uterus on day 4 and administration of Masitinib, a c-Kit inhibitor, effectively interfered with embryo implantation. Collectively, our results showed that estrogen induces transcription factor EGR1 to regulate c-Kit transcription for uterine receptivity for embryo implantation in the mouse uterus. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Super-resolution imaging of a 2.5 kb non-repetitive DNA in situ in the nuclear genome using molecular beacon probes

    Science.gov (United States)

    Ni, Yanxiang; Cao, Bo; Ma, Tszshan; Niu, Gang; Huo, Yingdong; Huang, Jiandong; Chen, Danni; Liu, Yi; Yu, Bin; Zhang, Michael Q; Niu, Hanben

    2017-01-01

    High-resolution visualization of short non-repetitive DNA in situ in the nuclear genome is essential for studying looping interactions and chromatin organization in single cells. Recent advances in fluorescence in situ hybridization (FISH) using Oligopaint probes have enabled super-resolution imaging of genomic domains with a resolution limit of 4.9 kb. To target shorter elements, we developed a simple FISH method that uses molecular beacon (MB) probes to facilitate the probe-target binding, while minimizing non-specific fluorescence. We used three-dimensional stochastic optical reconstruction microscopy (3D-STORM) with optimized imaging conditions to efficiently distinguish sparsely distributed Alexa-647 from background cellular autofluorescence. Utilizing 3D-STORM and only 29–34 individual MB probes, we observed 3D fine-scale nanostructures of 2.5 kb integrated or endogenous unique DNA in situ in human or mouse genome, respectively. We demonstrated our MB-based FISH method was capable of visualizing the so far shortest non-repetitive genomic sequence in 3D at super-resolution. DOI: http://dx.doi.org/10.7554/eLife.21660.001 PMID:28485713

  19. Plasma factor VII-activating protease is increased by oral contraceptives and induces factor VII activation in-vivo

    DEFF Research Database (Denmark)

    Sidelmann, Johannes Jakobsen; Skouby, Sven O.; Kluft, Cornelis

    2011-01-01

    progestins. FSAP genotypes, FSAP and factor VII (FVII) plasma measures were assessed at baseline and after 6 cycles of OC. The 1601GA genotype was present in 49 (8.3%) of the women and was associated with significantly reduced levels of FSAP (P≤0.001). OC use increased FSAP antigen by 25% and FSAP activity......Oral contraceptive (OC) use influences the hemostatic system significantly and is a risk factor for development of cardiovascular disease. Factor VII-activating protease (FSAP) has potential effects on hemostasis. The 1601GA genotype of the 1601G/A polymorphism in the FSAP gene expresses a FSAP...... by 59% (P0.05). The relative increase in FSAP activity was significantly higher in women carrying the 1601GG genotype (63%) than in women carrying 1601GA genotype (50%) (P=0.01) and was associated with an increased activation of FVII. In conclusion: OC use increases the plasma measures of FSAP...

  20. FACTOR TRANSCRIPCIONAL NF-KB EN LA APOPTOSIS DEL CARDIOMIOCITO ACTIVADA POR ESTRES HIPEROSMOTICO

    OpenAIRE

    EISNER SAGUES, VERONICA RAQUEL; EISNER SAGUES, VERONICA RAQUEL

    2004-01-01

    En el cardiomiocito, la apoptosis o muerte celular programada tipo I se desencadena por múltiples estímulos fisiopatológicos, comprometiendo significativamente la funcionalidad del tejido cardiaco. Los factores transcripcionales son articuladores fundamentales de los programas génicos que permiten a las células ya sea adaptarse o ejecutar su muerte frente a estos estímulos. Este Laboratorio ha establecido que el estrés hiperosmótico gatilla una rápida y potente muerte del cardiomiocito ...

  1. Factor VII-activating protease

    DEFF Research Database (Denmark)

    Ramanathan, Ramshanker; Gram, Jørgen B; Sand, Niels Peter R

    2017-01-01

    : Factor VII-activating protease (FSAP) may regulate development of cardiovascular disease (CVD). We evaluated sex differences in FSAP measures and examined the association between FSAP and coronary artery calcification (CAC) in a middle-aged population. Participants were randomly selected citizens...

  2. Plasma factor VII-activating protease is increased by oral contraceptives and induces factor VII activation in-vivo

    DEFF Research Database (Denmark)

    Sidelmann, Johannes J; Skouby, Sven O; Kluft, Cornelis

    2011-01-01

    Oral contraceptive (OC) use influences the hemostatic system significantly and is a risk factor for development of cardiovascular disease. Factor VII-activating protease (FSAP) has potential effects on hemostasis. The 1601GA genotype of the 1601G/A polymorphism in the FSAP gene expresses a FSAP...... progestins. FSAP genotypes, FSAP and factor VII (FVII) plasma measures were assessed at baseline and after 6 cycles of OC. The 1601GA genotype was present in 49 (8.3%) of the women and was associated with significantly reduced levels of FSAP (P=0.001). OC use increased FSAP antigen by 25% and FSAP activity...

  3. Induction of mitophagy-mediated antitumor activity with folate-appended methyl-β-cyclodextrin.

    Science.gov (United States)

    Kameyama, Kazuhisa; Motoyama, Keiichi; Tanaka, Nao; Yamashita, Yuki; Higashi, Taishi; Arima, Hidetoshi

    2017-01-01

    Mitophagy is the specific autophagic elimination system of mitochondria, which regulates cellular survival via the removal of damaged mitochondria. Recently, we revealed that folate-appended methyl-β-cyclodextrin (FA-M-β-CyD) provides selective antitumor activity in folate receptor-α (FR-α)-expressing cells by the induction of autophagy. In this study, to gain insight into the detailed mechanism of this antitumor activity, we focused on the induction of mitophagy by the treatment of FR-α-expressing tumor cells with FA-M-β-CyD. In contrast to methyl-β-cyclodextrin, FA-M-β-CyD entered KB cells, human epithelial cells from a fatal cervical carcinoma (FR-α (+)) through FR-α-mediated endocytosis. The transmembrane potential of isolated mitochondria after treatment with FA-M-β-CyD was significantly elevated. In addition, FA-M-β-CyD lowered adenosine triphosphate (ATP) production and promoted reactive oxygen species production in KB cells (FR-α (+)). Importantly, FA-M-β-CyD enhanced light chain 3 (LC3) conversion (LC3-I to LC3-II) in KB cells (FR-α (+)) and induced PTEN-induced putative kinase 1 (PINK1) protein expression, which is involved in the induction of mitophagy. Furthermore, FA-M-β-CyD had potent antitumor activity in BALB/c nu/nu mice xenografted with KB cells (FR-α (+)) without any significant side effects. Taken together, these findings demonstrate that the autophagic cell death elicited by FA-M-β-CyD could be associated with mitophagy induced by an impaired mitochondrial function.

  4. Tissue- and agonist-specific regulation of human and murine plasminogen activator inhibitor-1 promoters in transgenic mice.

    Science.gov (United States)

    Eren, M; Painter, C A; Gleaves, L A; Schoenhard, J A; Atkinson, J B; Brown, N J; Vaughan, D E

    2003-11-01

    Numerous studies have described regulatory factors and sequences that control transcriptional responses in vitro. However, there is a paucity of information on the qualitative and quantitative regulation of heterologous promoters using transgenic strategies. In order to investigate the physiological regulation of human plasminogen activator inhibitor type-1 (hPAI-1) expression in vivo compared to murine PAI-1 (mPAI-1) and to test the physiological relevance of regulatory mechanisms described in vitro, we generated transgenic mice expressing enhanced green fluorescent protein (EGFP) driven by the proximal -2.9 kb of the hPAI-1 promoter. Transgenic animals were treated with Ang II, TGF-beta1 and lipopolysaccharide (LPS) to compare the relative activation of the human and murine PAI-1 promoters. Ang II increased EGFP expression most effectively in brain, kidney and spleen, while mPAI-1 expression was quantitatively enhanced most prominently in heart and spleen. TGF-beta1 failed to induce activation of the hPAI-1 promoter but potently stimulated mPAI-1 in kidney and spleen. LPS administration triggered robust expression of mPAI-1 in liver, kidney, pancreas, spleen and lung, while EGFP was induced only modestly in heart and kidney. These results indicate that the transcriptional response of the endogenous mPAI-1 promoter varies widely in terms of location and magnitude of response to specific stimuli. Moreover, the physiological regulation of PAI-1 expression likely involves a complex interaction of transcription factors and DNA sequences that are not adequately replicated by in vitro functional studies focused on the proximal -2.9 kb promoter.

  5. ZNF322, a novel human C2H2 Krueppel-like zinc-finger protein, regulates transcriptional activation in MAPK signaling pathways

    International Nuclear Information System (INIS)

    Li Yongqing; Wang Yuequn; Zhang Caibo; Yuan Wuzhou; Wang Jun; Zhu Chuanbing; Chen Lei; Huang Wen; Zeng Weiqi; Wu Xiushan; Liu Mingyao

    2004-01-01

    Cardiac differentiation involves a cascade of coordinated gene expression that regulates cell proliferation and matrix protein formation in a defined temporal-spatial manner. The C 2 H 2 zinc finger-containing transcription factors have been implicated as critical regulators of multiple cardiac-expressed genes and are important for human heart development and diseases. Here we have identified and characterized a novel zinc-finger gene named ZNF322 using degenerated primers from a human embryo heart cDNA library. The gene contains four exons and spans 23.2 kb in chromosome 6p22.1 region, and transcribes a 2.7 kb mRNA that encodes a protein with 402 amino acid residues. The predicted protein contains 9 tandem C 2 H 2 -type zinc-finger motifs. Northern blot analysis shows that ZNF322 is expressed in every human tissue examined at adult stage and during embryonic developmental stages from 80 days to 24 weeks. When overexpressed in COS-7 cells, ZNF322-EGFP fusion protein is detected in the nucleus and cytoplasm. Reporter gene assays show that ZNF322 is a transcriptional activator. Furthermore, overexpression of ZNF322 in COS-7 cells activates the transcriptional activity of SRE and AP-1. Together, these results suggest that ZNF322 is a member of the zinc-finger transcription factor family and may act as a positive regulator in gene transcription mediated by the MAPK signaling pathways

  6. A Socio-Economic and Environmental Information Needs Knowledge Base (SEE-IN KB) in Support of SDG Implementation and Monitoring

    Science.gov (United States)

    Plag, H. P.; Jules-Plag, S.

    2016-12-01

    The UN Agenda 2030 has seventeen Sustainable Development Goals (SDGs) to be reach by 2030, which are detailed in 170 Targets. A monitioring framework of 240 SDG Indicators provides the metrics to measure progress towards these targets. The SDG Indicators are report cards for the progress towards the targets and a measure to assess potential impacts of policies and other means in support of SDG implementation. The Socio-Economic and Environmental Information Needs Knowledge Base (SEE-IN KB) collects information on objects such as user types, applications, observational requirements, a number of needs, societal goals and targets, indicators and indices, models, services, and datasets, as well as the interconnections between these objects, including links to Essential Variables (EVs). This enables gap analyses, prioritizations of Earth observations, and discovery of products and services meeting the information needs. "What if?" questions supports knowledge creation supporting the development of policies and activities to make progress towards the SDGs. Increasingly, user types, applications and requirements are linked to actual persons, models and datasets, respectively, and this allows both the social networking of providers and users and the execution of business processes. A core function of the SEE-IN KB is to facilitate the linkage of societal goals, targets, and indicators to EVs that need to be monitored in order to measure progress towards the targets. Applying a goal-based approach used to identify the EVs to the SDG Indicators revealed that some SDG Indicators require traditional Earth observations for quantification, while many of the EVs are related to the built environment. For many of the SDG Indicators, integration of socio-economic statistical data with environmental data, including in situ observations, is of importance. The goal-based approach was also applied to the SDG Targets, and this analysis showed that many of the Targets would benefit from

  7. Terminal uranium(V/VI) nitride activation of carbon dioxide and carbon disulfide. Factors governing diverse and well-defined cleavage and redox reactions

    Energy Technology Data Exchange (ETDEWEB)

    Cleaves, Peter A.; Gardner, Benedict M.; Liddle, Stephen T. [School of Chemistry, The University of Manchester (United Kingdom); Kefalidis, Christos E.; Maron, Laurent [LPCNO, CNRS and INSA, Universite Paul Sabatier, Toulouse (France); Tuna, Floriana; McInnes, Eric J.L. [School of Chemistry and Photon Science Institute, The University of Manchester (United Kingdom); Lewis, William [School of Chemistry, The University of Nottingham (United Kingdom)

    2017-02-24

    The reactivity of terminal uranium(V/VI) nitrides with CE{sub 2} (E=O, S) is presented. Well-defined C=E cleavage followed by zero-, one-, and two-electron redox events is observed. The uranium(V) nitride [U(Tren{sup TIPS})(N)][K(B15C5){sub 2}] (1, Tren{sup TIPS}=N(CH{sub 2}CH{sub 2}NSiiPr{sub 3}){sub 3}; B15C5=benzo-15-crown-5) reacts with CO{sub 2} to give [U(Tren{sup TIPS})(O)(NCO)][K(B15C5){sub 2}] (3), whereas the uranium(VI) nitride [U(Tren{sup TIPS})(N)] (2) reacts with CO{sub 2} to give isolable [U(Tren{sup TIPS})(O)(NCO)] (4); complex 4 rapidly decomposes to known [U(Tren{sup TIPS})(O)] (5) with concomitant formation of N{sub 2} and CO proposed, with the latter trapped as a vanadocene adduct. In contrast, 1 reacts with CS{sub 2} to give [U(Tren{sup TIPS})(κ{sup 2}-CS{sub 3})][K(B15C5){sub 2}] (6), 2, and [K(B15C5){sub 2}][NCS] (7), whereas 2 reacts with CS{sub 2} to give [U(Tren{sup TIPS})(NCS)] (8) and ''S'', with the latter trapped as Ph{sub 3}PS. Calculated reaction profiles reveal outer-sphere reactivity for uranium(V) but inner-sphere mechanisms for uranium(VI); despite the wide divergence of products the initial activation of CE{sub 2} follows mechanistically related pathways, providing insight into the factors of uranium oxidation state, chalcogen, and NCE groups that govern the subsequent divergent redox reactions that include common one-electron reactions and a less-common two-electron redox event. Caution, we suggest, is warranted when utilising CS{sub 2} as a reactivity surrogate for CO{sub 2}. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  8. Regulation of the human ADAMTS-4 promoter by transcription factors and cytokines

    International Nuclear Information System (INIS)

    Thirunavukkarasu, Kannan; Pei, Yong; Moore, Terry L.; Wang, He; Yu, Xiao-peng; Geiser, Andrew G.; Chandrasekhar, Srinivasan

    2006-01-01

    ADAMTS-4 (aggrecanase-1) is a metalloprotease that plays a role in aggrecan degradation in the cartilage extracellular matrix. In order to understand the regulation of ADAMTS-4 gene expression we have cloned and characterized a functional 4.5 kb human ADAMTS-4 promoter. Sequence analysis of the promoter revealed the presence of putative binding sites for nuclear factor of activated T cells (NFAT) and Runx family of transcription factors that are known to regulate chondrocyte maturation and differentiation. Using promoter-reporter assays and mRNA analysis we have analyzed the role of chondrocyte-expressed transcription factors NFATp and Runx2 and have shown that ADAMTS-4 is a potential downstream target of these two factors. Our results suggest that inhibition of the expression/function of NFATp and/or Runx2 may enable us to modulate aggrecan degradation in normal physiology and/or in degenerative joint diseases. The ADAMTS-4 promoter would serve as a valuable mechanistic tool to better understand the regulation of ADAMTS-4 expression by signaling pathways that modulate cartilage matrix breakdown

  9. The interaction of parsing rules and argument – Predicate constructions: implications for the structure of the Grammaticon in FunGramKB

    Directory of Open Access Journals (Sweden)

    María del Carmen Fumero Pérez

    2017-07-01

    Full Text Available The Functional Grammar Knowledge Base (FunGramKB, (Periñán-Pascual and Arcas-Túnez 2010 is a multipurpose lexico-conceptual knowledge base designed to be used in different Natural Language Processing (NLP tasks. It is complemented with the ARTEMIS (Automatically Representing Text Meaning via an Interlingua–based System application, a parsing device linguistically grounded on Role and Reference Grammar (RRG that transduces natural language fragments into their corresponding grammatical and semantic structures. This paper unveils the different phases involved in its parsing routine, paying special attention to the treatment of argumental constructions. As an illustrative case, we will follow all the steps necessary to effectively parse a For-Benefactive structure within ARTEMIS. This methodology will reveal the necessity to distinguish between Kernel constructs and L1-constructions, since the latter involve a modification of the lexical template of the verb. Our definition of L1-constructions leads to the reorganization of the catalogue of FunGramKB L1-constructions, formerly based on Levin’s (1993 alternations. Accordingly, a rearrangement of the internal configuration of the L1-Constructicon within the Grammaticon is proposed.

  10. Lineage II (Serovar 1/2a and 1/2c) Human Listeria monocytogenes Pulsed-Field Gel Electrophoresis Types Divided into PFGE Groups Using the Band Patterns Below 145.5 kb.

    Science.gov (United States)

    Lopez-Valladares, Gloria; Danielsson-Tham, Marie-Louise; Goering, Richard V; Tham, Wilhelm

    2017-01-01

    Among 504 clinical lineage II isolates of Listeria monocytogenes isolated during 1958-2010 in Sweden, 119 pulsed-field gel electrophoresis (PFGE) types (AscI) have been identified based on the number and distribution of all banding patterns in each DNA profile. In this study, these types were further divided into PFGE groups based on the configuration of small bands with sizes kb. The 504 isolates included 483 serovar 1/2a isolates distributed into 114 PFGE types and 21 serovar 1/2c isolates distributed into 9 PFGE types; these were further divided into 21 PFGE groups. PFGE group, that is, configuration of small bands below 145.5 kb, and serovars were correlated. L. monocytogenes isolates belonging to PFGE groups A, B, C, E, F, H, K, L, M, S, V, W, Y, and Ö-6 to Ö-12 shared serovar 1/2a, with one exception. PFGE group E also included two PFGE types sharing serovar 1/2c and four PFGE types belonging to either serovar 1/2a or 1/2c. Isolates belonging to PFGE group N shared serovar 1/2c. In contrast to lineage I isolates, small fragments kb were visible in all L. monocytogenes isolates belonging to lineage II. In the results from both the present and previous studies, the genomic region of small bands was genetically more conservative than in large bands. The distribution of these small bands established the relatedness of strains and defined a genetic marker for both lineages I and II, while also establishing their serogroup. The division of L. monocytogenes PFGE types into PFGE groups is advantageous as the profile of every new isolate can be identified easily and quickly through first studying the PFGE group affiliation of the isolate based on the smaller band patterns kb, and then identifying the PFGE type based on the band patterns >145.5 kb.

  11. A 320 mV, 6 kb subthreshold 10T SRAM employing voltage lowering techniques

    International Nuclear Information System (INIS)

    Cai Jiangzheng; Zhang Sumin; Yuan Jia; Shang Xinchao; Chen Liming; Hei Yong

    2015-01-01

    This paper presents a 6 kb SRAM that uses a novel 10T cell to achieve a minimum operating voltage of 320 mV in a 130 nm CMOS process. A number of low power circuit techniques are included to enable the proposed SRAM to operate in the subthreshold region. The reverse short channel effect and the reverse narrow channel effect are utilized to improve the performance of the SRAM. A novel subthreshold pulse generation circuit produces an ideal pulse to make read operation stable. A floating write bit-line effectively reduces the standby leakage consumption. Finally, a short read bit-line makes the read operation fast and energy-saving. Measurements indicate that these techniques are effective, the SRAM can operate at 800 kHz and consume 1.94 μW at its lowest voltage (320 mV). (paper)

  12. Neuropsychological phenotype of a patient with a de novo 970 kb interstitial deletion in the distal 16p11.2 region

    Directory of Open Access Journals (Sweden)

    Egger JI

    2014-03-01

    Full Text Available Jos I M Egger,1–3 Willem M A Verhoeven,1,4 Wim Verbeeck,5 Nicole de Leeuw61Vincent van Gogh Institute for Psychiatry, Centre of Excellence for Neuropsychiatry, Venray, the Netherlands; 2Donders Institute for Brain, Cognition and Behaviour, Radboud University Nijmegen, Nijmegen, the Netherlands; 3Behavioural Science Institute, Radboud University Nijmegen, Nijmegen, the Netherlands; 4Erasmus University Medical Centre, Department of Psychiatry, Rotterdam, the Netherlands; 5Vincent van Gogh Institute for Psychiatry, Centre for Autism and ADHD, Venray, the Netherlands; 6Department of Human Genetics, Radboud University Medical Centre, Nijmegen, the NetherlandsAbstract: The 16p11.2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay, symptoms from the autism spectrum, epilepsy, congenital anomalies, and obesity. These phenotypes are often related to a proximal 16p11.2 deletion of approximately 600 kb (BP4–BP5 that includes the SH2B1 gene that is reported to be causative for morbid obesity. This more centromeric deletion is most strongly related to autism spectrum susceptibility and is functionally different from the more distal 16p12.2p11.2 region, which includes the so-called atypical 16p11.2 BP2–BP3 deletion (approximately 220 kb presenting with developmental delay, behavioral problems and mild facial dysmorphisms. Here, an adult male with a long history of maladaptive behaviors is described who was referred for diagnostic assessment of his amotivational features. Extensive neuropsychological examination demonstrated rigid thinking, anxious beliefs, and ideas of reference in the presence of normal intelligence. Microarray analysis demonstrated a de novo 970 kb 16p11.2 BP1–BP4 microdeletion that can be regarded as explanatory for his behavioral profile. It is concluded that microdeletion syndromes are not exclusively related to intellectual disabilities and

  13. Hemophilia B with mutations at glycine-48 of factor IX exhibited delayed activation by the factor VIIa-tissue factor complex.

    Science.gov (United States)

    Wu, P C; Hamaguchi, N; Yu, Y S; Shen, M C; Lin, S W

    2000-10-01

    Gly-48 is in the conserved DGDQC sequence (residues 47-51 of human factor IX) of the first EGF (EGF-1)-like domain of factor IX. The importance of the Gly-48 is manifested by two hemophilia B patients; factor IXTainan and factor IXMalmo27, with Gly-48 replaced by arginine (designated IXG48R) and valine (IXG48V), respectively. Both patients were CRM+ exhibiting mild hemophilic episodes with 25% (former) and 19% (latter) normal clotting activities. We characterize both factor IX variants to show the roles of Gly-48 and the conservation of the DGDQC sequence in factor IX. Purified plasma and recombinant factor IX variants exhibited approximately 26%-27% normal factor IX's clotting activities with G48R or G48V mutation. Both variants depicted normal quenching of the intrinsic fluorescence by increasing concentrations of calcium ions and Tb3+, indicating that arginine and valine substitution for Gly-48 did not perturb the calcium site in the EGF-1 domain. Activation of both mutants by factor XIa appeared normal. The reduced clotting activity of factors IXG48R and IXG48V was attributed to the failure of both mutants to cleavage factor X: in the presence of only phospholipids and calcium ions, both mutants showed a 4 to approximately 7-fold elevation in Km, and by adding factor VIIIa to the system, although factor VIIIa potentiated the activation of factor X by the mutants factor IXaG48R and factor IXaG48V, a 2 to approximately 3-fold decrease in the catalytic function was observed with the mutant factor IXa's, despite that they bound factor VIIIa on the phospholipid vesicles with only slightly reduced affinity when compared to wild-type factor IXa. The apparent Kd for factor VIIIa binding was 0.83 nM for normal factor IXa, 1.74 nM for IXaG48R and 1.4 nM for IXaG48V. Strikingly, when interaction with the factor VIIa-TF complex was examined, both mutations were barely activated by the VIIa-TF complex and they also showed abnormal interaction with VIIa-TF in bovine

  14. Putative dopamine agonist (KB220Z) attenuates lucid nightmares in PTSD patients: role of enhanced brain reward functional connectivity and homeostasis redeeming joy.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Agan, Gozde; Fratantonio, James L; Simpatico, Thomas; Gold, Mark S

    2015-06-01

    Lucid dreams are frequently pleasant and training techniques have been developed to teach dreamers to induce them. In addition, the induction of lucid dreams has also been used as a way to ameliorate nightmares. On the other hand, lucid dreams may be associated with psychiatric conditions, including Post-Traumatic Stress Disorder (PTSD) and Reward Deficiency Syndrome-associated diagnoses. In the latter conditions, lucid dreams can assume an unpleasant and frequently terrifying character. We present two cases of dramatic alleviation of terrifying lucid dreams in patients with PTSD. In the first case study, a 51-year-old, obese woman, diagnosed with PTSD and depression, had attempted suicide and experienced terrifying lucid nightmares linked to sexual/physical abuse from early childhood by family members including her alcoholic father. Her vivid "bad dreams" remained refractory in spite of 6 months of treatment with Dialectical Behavioral Therapy (DBT) and standard pharmaceutical agents which included prazosin, clonidie and Adderall. The second 39-year-old PTSD woman patient had also suffered from lucid nightmares. The medication visit notes reveal changes in the frequency, intensity and nature of these dreams after the complex putative dopamine agonist KB220Z was added to the first patient's regimen. The patient reported her first experience of an extended period of happy dreams. The second PTSD patient, who had suffered from lucid nightmares, was administered KB220Z to attenuate methadone withdrawal symptoms and incidentally reported dreams full of happiness and laughter. These cases are discussed with reference to the known effects of KB220Z including enhanced dopamine homeostasis and functional connectivity of brain reward circuitry in rodents and humans. Their understanding awaits intensive investigation involving large-population, double-blinded studies.

  15. The 253-kb inversion and deep intronic mutations in UNC13D are present in North American patients with familial hemophagocytic lymphohistiocytosis 3.

    Science.gov (United States)

    Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian

    2014-06-01

    The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.

  16. [Quality management in a combined clinic - the quality management system according to DIN EN ISO 9001 of the The German Association of Spa Accommodation Resorts e. V. (VdKB)].

    Science.gov (United States)

    Eckert, H; Schulze, U

    2004-06-01

    The implementation of a quality system in health care organizations offers huge potentials for improvement and development. But the realization of such systems necessitates high investments, which small companies and family businesses often are unable to raise. The German Association of Spa Accommodation Resorts (VdKB) commissioned two consultants to develop a reasonably priced implementation concept of a DIN EN ISO 9001 quality system specially adjusted to small companies and family businesses in medical spa and rehabilitation services, which was successfully accredited in May 2003. This paper describes fundamental requirements in combine management systems, considers the pros and cons of management combines and demonstrates the practical realization of combine requirements on the example of the VdKB-combine system.

  17. Recombinant activated factor VII in cardiac surgery: single-center experience.

    Science.gov (United States)

    Singh, Sarvesh Pal; Chauhan, Sandeep; Choudhury, Minati; Malik, Vishwas; Choudhary, Shiv Kumar

    2014-02-01

    The widespread off-label use of recombinant activated factor VII for the control of refractory postoperative hemorrhage continues despite a warning from the Food and Drug Administration. Although effective in reducing the need for transfusion of blood and blood products, safety concerns still prevail. To compare the dosing and efficacy of recombinant activated factor VII between pediatric and adult patients, and in the operating room and intensive care unit. The records of 69 patients (33 children and 36 adults) who underwent cardiovascular surgery and received recombinant activated factor VII were reviewed retrospectively. The dose of recombinant activated factor VII, mediastinal drainage, use of blood and blood products, incidence of thrombosis, and 28-day mortality were studied. the efficacy of recombinant activated factor VII was comparable in adults and children, despite the lower dose in adults. Prophylactic use of recombinant activated factor VII decreased the incidence of mediastinal exploration and the duration of intensive care unit stay. A 4.3% incidence of thrombotic complications was observed in this study. The efficacious dose of recombinant activated factor VII is much less in adults compared to children. Prophylactic use of recombinant activated factor VII decreases the dose required, the incidence of mediastinal exploration, and intensive care unit stay, with no survival benefit.

  18. Potential Role of Activating Transcription Factor 5 during Osteogenesis

    Directory of Open Access Journals (Sweden)

    Luisa Vicari

    2016-01-01

    Full Text Available Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2, encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.

  19. Potential Role of Activating Transcription Factor 5 during Osteogenesis.

    Science.gov (United States)

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo

    2016-01-01

    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.

  20. Activity-guided isolation of cytotoxic bis-bibenzyl constituents from Dumortiera hirsuta.

    Science.gov (United States)

    Toyota, Masao; Ikeda, Risa; Kenmoku, Hiromichi; Asakawa, Yoshinori

    2013-01-01

    Activity-guided fractionation of the ether extract of Dumortiera hirsute (Japanese liverwort), using cytotoxicity testing with cultured HL 60 and KB cells, resulted in the isolation of a new cytotoxic bis-bibenzyl compound, along with the two known bis-bibenzyls: isomarchantin C and isoriccardin C. The structural determination of the new bis-bibenzyl through extensive NMR spectral data indicated a derivative of marchantin A, which has been isolated from the liverwort Marchantia polymorpha. The cytotoxicity of the bis-bibenzyls was evaluated by the MTT (3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay using cultured HL 60 and KB cells.

  1. Spherical α-MnO2 Supported on N-KB as Efficient Electrocatalyst for Oxygen Reduction in Al–Air Battery

    Directory of Open Access Journals (Sweden)

    Kui Chen

    2018-04-01

    Full Text Available Traditional noble metal platinum (Pt is regarded as a bifunctional oxygen catalyst due to its highly catalytic efficiency, but its commercial availability and application is often restricted by high cost. Herein, a cheap and effective catalyst mixed with α-MnO2 and nitrogen-doped Ketjenblack (N-KB (denoted as MnO2-SM150-0.5 is examined as a potential electrocatalyst in oxygen reduction reactions (ORR and oxygen evolution reactions (OER. This α-MnO2 is prepared by redox reaction between K2S2O8 and MnSO4 in acid conditions with a facile hydrothermal process (named the SM method. As a result, MnO2-SM150-0.5 exhibits a good catalytic performance for ORR in alkaline solution, and this result is comparable to a Pt/C catalyst. Moreover, this catalyst also shows superior durability and methanol tolerance compared with a Pt/C catalyst. It also displays a discharge voltage (~1.28 V at a discharge density of 50 mA cm−2 in homemade Al–air batteries that is higher than commercial 20% Pt/C (~1.19 V. The superior electrocatalytic performance of MnO2-SM150-0.5 could be attributed to its higher Mn3+/Mn4+ ratio and the synergistic effect between MnO2 and the nitrogen-doped KB. This study provides a novel strategy for the preparation of an MnO2-based composite electrocatalyst.

  2. Physical activity and cardiovascular disease risk factors among ...

    African Journals Online (AJOL)

    Background: Cardiovascular diseases (CVD) risk factors are increasing at an unprecedented rate in developing countries. However, fewer studies have evaluated the role of physical activity in preventing CVD in these countries. We assessed level physical activity and its relationship with CVD risk factors among young and ...

  3. A new automated method for continuous registration of factor VII activation in vitro. Activation is accelerated by the concentration of factor VII and the activity state of the protein

    DEFF Research Database (Denmark)

    Bladbjerg, Else-Marie; Jespersen, J; Gram, J

    1994-01-01

    When a plasma sample is exposed to tissue factor, single-chain factor VII (FVII) is gradually converted to the active two-chain form (FVIIa). In the present study, we have constructed a measurement system, which allows continuous registration of the activation of FVII to FVIIa in vitro....... In this system, FVII activation follows parabolic kinetic after an initial lag-phase. The slope of the linear phase is a measure of the protein concentration of factor VII (FVIItotal), while the length of the non-linear phase represents the velocity of FVII activation. The time required for complete activation...

  4. Whole transcriptomic and proteomic analyses of an isogenic M. tuberculosis clinical strain with a naturally occurring 15 Kb genomic deletion.

    Directory of Open Access Journals (Sweden)

    Carla Duncan

    Full Text Available Tuberculosis remains one of the most difficult to control infectious diseases in the world. Many different factors contribute to the complexity of this disease. These include the ability of the host to control the infection which may directly relate to nutritional status, presence of co-morbidities and genetic predisposition. Pathogen factors, in particular the ability of different Mycobacterium tuberculosis strains to respond to the harsh environment of the host granuloma, which includes low oxygen and nutrient availability and the presence of damaging radical oxygen and nitrogen species, also play an important role in the success of different strains to cause disease. In this study we evaluated the impact of a naturally occurring 12 gene 15 Kb genomic deletion on the physiology and virulence of M. tuberculosis. The strains denominated ON-A WT (wild type and ON-A NM (natural mutant were isolated from a previously reported TB outbreak in an inner city under-housed population in Toronto, Canada. Here we subjected these isogenic strains to transcriptomic (via RNA-seq and proteomic analyses and identified several gene clusters with differential expression in the natural mutant, including the DosR regulon and the molybdenum cofactor biosynthesis genes, both of which were found in lower abundance in the natural mutant. We also demonstrated lesser virulence of the natural mutant in the guinea pig animal model. Overall, our findings suggest that the ON-A natural mutant is less fit to cause disease, but nevertheless has the potential to cause extended transmission in at-risk populations.

  5. Essential Oil from Cryptomeria japonica Induces Apoptosis in Human Oral Epidermoid Carcinoma Cells via Mitochondrial Stress and Activation of Caspases

    Directory of Open Access Journals (Sweden)

    Ji-Young Kim

    2012-03-01

    Full Text Available Cryptomeria japonica D. Don (C. japonica has been used in traditional medicines from Asia for a variety of indications, including liver ailments, and an antitussive, and for its antiulcer activities. We examined the cell viability and apoptosis of KB cells treated with C. japonica essential oil at several concentrations for 12 h by MTT assay, Hoechst-33258 dye staining, DNA fragmentation, flow cytometry (cell cycle, and Western blotting for mitochondria stress, activation of caspases, and poly (ADP-ribose polymerase. The essential oil induced the apoptosis of KB cells in a dose-dependent manner, which was verified by DNA fragmentation, appearance of apoptotic bodies, and the sub-G1 ratio. The essential oil also induced rapid and transient caspase-3 activity and cleavage of PARP of the KB cells. Treating the cells with the oil also caused changes in the mitochondrial level of the Bcl-2 family proteins such as Bcl-2 and Bax, thereby inducing the release of cytochrome c into the cytosol. The essential oil of C. japonica may have potential as a cancer chemopreventive and therapeutic agent.

  6. Multiple determinants controlling activation of yeast replication origins late in S phase.

    Science.gov (United States)

    Friedman, K L; Diller, J D; Ferguson, B M; Nyland, S V; Brewer, B J; Fangman, W L

    1996-07-01

    Analysis of a 131-kb segment of the left arm of yeast chromosome XIV beginning 157 kb from the telomere reveals four highly active origins of replication that initiate replication late in S phase. Previous work has shown that telomeres act as determinants for late origin activation. However, at least two of the chromosome XIV origins maintain their late activation time when located on large circular plasmids, indicating that late replication is independent of telomeres. Analysis of the replication time of plasmid derivatives containing varying amounts of chromosome XIV DNA show that a minimum of three chromosomal elements, distinct from each tested origin, contribute to late activation time. These late determinants are functionally equivalent, because duplication of one set of contributing sequences can compensate for the removal of another set. Furthermore, insertion of an origin that is normally early activated into this domain results in a shift to late activation, suggesting that the chromosome XIV origins are not unique in their ability to respond to the late determinants.

  7. Radiation activation of transcription factors in mammalian cells

    International Nuclear Information System (INIS)

    Kraemer, M.; Stein, B.; Mai, S.; Kunz, E.; Koenig, H.; Ponta, H.; Herrlich, P.; Rahmsdorf, H.J.; Loferer, H.; Grunicke, H.H.

    1990-01-01

    In mammalian cells radiation induces the enhanced transcription of several genes. The cis acting elements in the control region of inducible genes have been delimited by site directed mutagenesis. Several different elements have been found in different genes. They do not only activate gene transcription in response to radiation but also in response to growth factors and to tumor promoter phorbol esters. The transcription factors binding to these elements are present also in non-irradiated cells, but their DNA binding activity and their transactivating capability is increased upon irradiation. The signal chain linking the primary radiation induced signal (damaged DNA) to the activation of transcription factors involves the action of (a) protein kinase(s). (orig.)

  8. Activity of recombinant factor VIIa under different conditions in vitro

    DEFF Research Database (Denmark)

    Bladbjerg, Else-Marie; Jespersen, Jørgen

    2008-01-01

    Recombinant activated factor VII (NovoSeven; Novo Nordisk A/S, Måløv, Denmark) is an effective drug for treatment of bleeding in patients with haemophilia A or B and inhibitors. Little is known about physiological conditions influencing the efficacy of recombinant activated factor VII. We...... investigated the in-vitro effects of pH, temperature, and haemodilution on the activity of recombinant activated factor VII. Samples from eight healthy volunteers were spiked with recombinant activated factor VII (final concentration 1.7 microg/ml) and adjusted to pH 6.0, 6.5, 7.0, and 7.4 or analysed at 30......, 33, 37, and 40 degrees C, or diluted 0, 10, 20, 40, and 60% with dextran before analysis. Samples were analysed as rotational thromboelastometry in whole blood (clotting time, clot formation time, and maximum clot firmness) with and without Innovin (tissue factor), and as factor VII coagulant...

  9. Shivajiella indica gen. nov., sp. nov., a marine bacterium of the family "Cyclobacteriaceae" with nitrate reducing activity

    Digital Repository Service at National Institute of Oceanography (India)

    AnilKumar, P.; Aravind, R.; Francis, K.; Bhumika, V.; Ritika, C.; Priyashanth, P.; Srinivas T.N.R.

    phase contrast microscopy. Motility was also assessed on Motility-Indole-Lysine HiVeg TM medium (cat. no. MV847; HIMEDIA) with agar 2 gl -1 (by inoculating the active culture suspension using sterile inoculation needle and checking for spreading... assessed using the Hi25 TM Enterobacteriaceae identification kit (cat. no. KB003) and the HiCarbohydrate TM kit parts A, B and C (cat. no. KB009) (HIMEDIA) according to the manufacturer’s protocol. Please see the supplementary Table 2 for explanation...

  10. Brain-derived neurotrophic factor (BDNF) -TrKB signaling modulates cancer-endothelial cells interaction and affects the outcomes of triple negative breast cancer.

    Science.gov (United States)

    Tsai, Yi-Fang; Tseng, Ling-Ming; Hsu, Chih-Yi; Yang, Muh-Hwa; Chiu, Jen-Hwey; Shyr, Yi-Ming

    2017-01-01

    There is good evidence that the tumor microenvironment plays an important role in cancer metastasis and progression. Our previous studies have shown that brain-derived neurotrophic factor (BDNF) participates in the process of metastasis and in the migration of cancer cells. The aim of this study was to investigate the role of BDNF on the tumor cell microenvironment, namely, the cancer cell-endothelial cell interaction of TNBC cells. We conducted oligoneucleotide microarray analysis of potential biomarkers that are able to differentiate recurrent TNBC from non-recurrent TNBC. The MDA-MB-231 and human endothelial HUVEC lines were used for this study and our approaches included functional studies, such as migration assay, as well as Western blot and real-time PCR analysis of migration and angiogenic signaling. In addition, we analyzed the survival outcome of TNBC breast cancer patients according to their expression level of BDNF using clinical samples. The results demonstrated that BDNF was able to bring about autocrinal (MDA-MB-231) and paracrinal (HUVECs) regulation of BDNF-TrkB gene expression and this affected cell migratory activity. The BDNF-induced migratory activity was blocked by inhibitors of ERK, PI3K and TrkB when MDA-MB-231 cells were examined, but only an inhibitor of ERK blocked this activity when HUVEC cells were used. Furthermore, decreased migratory activity was found for △BDNF and △TrkB cell lines. Ingenuity pathway analysis (IPA) of MDA-MB-231 cells showed that BDNF is a key factor that is able to regulate a network made up of metalloproteases and calmodulin. Protein expression levels in a tissue array of tumor slices were found to be correlated with patient prognosis and the results showed that there was significant correlation of TrkB expression, but not of BDNF. expressionwith patient DFS and OS. Our study demonstrates that up-regulation of the BDNF signaling pathway seems tobe involved in the mechanism associated with early recurrence in

  11. Platelet factor 4 impairs the anticoagulant activity of activated protein C.

    LENUS (Irish Health Repository)

    Preston, Roger J S

    2012-02-01

    Platelet factor 4 (PF4) is an abundant platelet alpha-granule chemokine released following platelet activation. PF4 interacts with thrombomodulin and the gamma-carboxyglutamic acid (Gla) domain of protein C, thereby enhancing activated protein C (APC) generation by the thrombin-thrombomodulin complex. However, the protein C Gla domain not only mediates protein C activation in vivo, but also plays a critical role in modulating the diverse functional properties of APC once generated. In this study we demonstrate that PF4 significantly inhibits APC anti-coagulant activity. PF4 inhibited both protein S-dependent APC anticoagulant function in plasma and protein S-dependent factor Va (FVa) proteolysis 3- to 5-fold, demonstrating that PF4 impairs protein S cofactor enhancement of APC anticoagulant function. Using recombinant factor Va variants FVa-R506Q\\/R679Q and FVa-R306Q\\/R679Q, PF4 was shown to impair APC proteolysis of FVa at position Arg(306) by 3-fold both in the presence and absence of protein S. These data suggest that PF4 contributes to the poorly understood APC resistance phenotype associated with activated platelets. Finally, despite PF4 binding to the APC Gla domain, we show that APC in the presence of PF4 retains its ability to initiate PAR-1-mediated cytoprotective signaling. In summary, we propose that PF4 acts as a critical regulator of APC generation, but also differentially targets APC toward cytoprotective, rather than anticoagulant function at sites of vascular injury with concurrent platelet activation.

  12. Platelet factor 4 impairs the anticoagulant activity of activated protein C.

    LENUS (Irish Health Repository)

    Preston, Roger J S

    2009-02-27

    Platelet factor 4 (PF4) is an abundant platelet alpha-granule chemokine released following platelet activation. PF4 interacts with thrombomodulin and the gamma-carboxyglutamic acid (Gla) domain of protein C, thereby enhancing activated protein C (APC) generation by the thrombin-thrombomodulin complex. However, the protein C Gla domain not only mediates protein C activation in vivo, but also plays a critical role in modulating the diverse functional properties of APC once generated. In this study we demonstrate that PF4 significantly inhibits APC anti-coagulant activity. PF4 inhibited both protein S-dependent APC anticoagulant function in plasma and protein S-dependent factor Va (FVa) proteolysis 3- to 5-fold, demonstrating that PF4 impairs protein S cofactor enhancement of APC anticoagulant function. Using recombinant factor Va variants FVa-R506Q\\/R679Q and FVa-R306Q\\/R679Q, PF4 was shown to impair APC proteolysis of FVa at position Arg(306) by 3-fold both in the presence and absence of protein S. These data suggest that PF4 contributes to the poorly understood APC resistance phenotype associated with activated platelets. Finally, despite PF4 binding to the APC Gla domain, we show that APC in the presence of PF4 retains its ability to initiate PAR-1-mediated cytoprotective signaling. In summary, we propose that PF4 acts as a critical regulator of APC generation, but also differentially targets APC toward cytoprotective, rather than anticoagulant function at sites of vascular injury with concurrent platelet activation.

  13. Formation of tissue factor activity following incubation of recombinant human tissue factor apoprotein with plasma lipoproteins

    International Nuclear Information System (INIS)

    Sakai, T.; Kisiel, W.

    1990-01-01

    Incubation of recombinant human tissue factor apoprotein (Apo-TF) with human plasma decreased the recalcified clotting time of this plasma in a time-and dose-dependent manner suggesting relipidation of the Apo-TF by plasma lipoproteins. Incubation of Apo-TF with purified preparations of human very low density, low density and high density lipoproteins resulted in tissue factor activity in a clotting assay. The order of effectiveness was VLDL greater than LDL much greater than HDL. Tissue factor activity generated by incubation of a fixed amount of Apo-TF with plasma lipoproteins was lipoprotein concentration-dependent and saturable. The association of Apo-TF with lipoprotein particles was supported by gel filtration studies in which 125 I-Apo-TF coeluted with the plasma lipoprotein in the void volume of a Superose 6 column in the presence and absence of calcium ions. In addition, void-volume Apo-TF-lipoprotein fractions exhibited tissue factor activity. These results suggest that the factor VIII-bypassing activity of bovine Apo-TF observed in a canine hemophilic model may be due, in part, to its association with plasma lipoproteins and expression of functional tissue factor activity

  14. Stem cell factor stimulates chicken osteoclast activity in vitro

    NARCIS (Netherlands)

    van't Hof, R. J.; von Lindern, M.; Nijweide, P. J.; Beug, H.

    1997-01-01

    Stem cell factor (SCF) is a polypeptide growth factor active on multiple cell types, mainly of hematopoietic origin. We studied the effects of avian SCF on the differentiation of chicken osteoclasts from their putative progenitors as well as on the bone-resorbing activity of terminally

  15. Activated factor X signaling via protease-activated receptor 2 suppresses pro-inflammatory cytokine production from LPS-stimulated myeloid cells.

    LENUS (Irish Health Repository)

    Gleeson, Eimear M

    2013-07-19

    Vitamin K-dependent proteases generated in response to vascular injury and infection enable fibrin clot formation, but also trigger distinct immuno-regulatory signaling pathways on myeloid cells. Factor Xa, a protease crucial for blood coagulation, also induces protease-activated receptor-dependent cell signaling. Factor Xa can bind both monocytes and macrophages, but whether factor Xa-dependent signaling stimulates or suppresses myeloid cell cytokine production in response to Toll-like receptor activation is not known. In this study, exposure to factor Xa significantly impaired pro-inflammatory cytokine production from lipopolysaccharide-treated peripheral blood mononuclear cells, THP-1 monocytic cells and murine macrophages. Furthermore, factor Xa inhibited nuclear factor-kappa B activation in THP-1 reporter cells, requiring phosphatidylinositide 3-kinase activity for its anti-inflammatory effect. Active-site blockade, γ-carboxyglutamic acid domain truncation and a peptide mimic of the factor Xa inter-epidermal growth factor-like region prevented factor Xa inhibition of lipopolysaccharide-induced tumour necrosis factor-α release. In addition, factor Xa anti-inflammatory activity was markedly attenuated by the presence of an antagonist of protease-activated receptor 2, but not protease-activated receptor 1. The key role of protease-activated receptor 2 in eliciting factor Xa-dependent anti-inflammatory signaling on macrophages was further underscored by the inability of factor Xa to mediate inhibition of tumour necrosis factor-α and interleukin-6 release from murine bone marrow-derived protease-activated receptor 2-deficient macrophages. We also show for the first time that, in addition to protease-activated receptor 2, factor Xa requires a receptor-associated protein-sensitive low-density lipoprotein receptor to inhibit lipopolysaccharide-induced cytokine production. Collectively, this study supports a novel function for factor Xa as an endogenous, receptor

  16. PKD1 mediates negative feedback of PI3K/Akt activation in response to G protein-coupled receptors.

    Directory of Open Access Journals (Sweden)

    Yang Ni

    Full Text Available We examined whether protein kinase D1 (PKD1 mediates negative feeback of PI3K/Akt signaling in intestinal epithelial cells stimulated with G protein-coupled receptor (GPCR agonists. Exposure of intestinal epithelial IEC-18 cells to increasing concentrations of the PKD family inhibitor kb NB 142-70, at concentrations that inhibited PKD1 activation, strikingly potentiated Akt phosphorylation at Thr(308 and Ser(473 in response to the mitogenic GPCR agonist angiotensin II (ANG II. Enhancement of Akt activation by kb NB 142-70 was also evident in cells with other GPCR agonists, including vasopressin and lysophosphatidic acid. Cell treatment with the structurally unrelated PKD family inhibitor CRT0066101 increased Akt phosphorylation as potently as kb NB 142-70 [corrected]. Knockdown of PKD1 with two different siRNAs strikingly enhanced Akt phosphorylation in response to ANG II stimulation in IEC-18 cells. To determine whether treatment with kb NB 142-70 enhances accumulation of phosphatidylinositol (3,4,5-trisphosphate (PIP3 in the plasma membrane, we monitored the redistribution of Akt-pleckstrin homology domain-green fluorescent protein (Akt-PH-GFP in single IEC-18 cells. Exposure to kb NB 142-70 strikingly increased membrane accumulation of Akt-PH-GFP in response to ANG II. The translocation of the PIP3 sensor to the plasma membrane and the phosphorylation of Akt was completed prevented by prior exposure to the class I p110α specific inhibitor A66. ANG II markedly increased the phosphorylation of p85α detected by a PKD motif-specific antibody and enhanced the association of p85α with PTEN. Transgenic mice overexpressing PKD1 showed a reduced phosphorylation of Akt at Ser(473 in intestinal epithelial cells compared to wild type littermates. Collectively these results indicate that PKD1 activation mediates feedback inhibition of PI3K/Akt signaling in intestinal epithelial cells in vitro and in vivo.

  17. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Science.gov (United States)

    Rogers, Elizabeth E; Stenger, Drake C

    2012-01-01

    A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

  18. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available A ≈ 38kB plasmid (pXF-RIV5 was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51 sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th century.

  19. Alternative pathways of thromboplastin-dependent activation of human factor X in plasma

    International Nuclear Information System (INIS)

    Marlar, R.A.; Griffin, J.H.

    1981-01-01

    To determine the interrelationships of the major coagulation pathways, the activation of 3H-labeled factor X in normal and various deficient human plasmas was evaluated when clotting was triggered by dilute rabbit or human thromboplastin. Various dilutions of thromboplastin and calcium were added to plasma samples containing 3H-factor X, and the time course of factor X activation was determined. At a 1/250 dilution of rabbit brain thromboplastin, the rate of factor X activation in plasmas deficient in factor VIII or factor IX was 10% of the activation rate of normal plasma or of factor XI deficient plasma. Reconstitution of the deficient plasmas with factors VIII or IX, respectively, reconstituted normal factor X activation. Similar results were obtained when various dilutions of human thromboplastin replaced the rabbit thromboplastin. From these plasma experiments, it is inferred that the dilute thromboplastin-dependent activation of factor X requires factors VII, IX, and VIII. An alternative extrinsic pathway that involves factors IX and VIII may be the physiologic extrinsic pathway and hence help to explain the consistent clinical observations of bleeding diatheses in patients deficient in factors IX or VIII

  20. CACTA-superfamily transposable element is inserted in MYB transcription factor gene of soybean line producing variegated seeds.

    Science.gov (United States)

    Yan, Fan; Di, Shaokang; Takahashi, Ryoji

    2015-08-01

    The R gene of soybean, presumably encoding a MYB transcription factor, controls seed coat color. The gene consists of multiple alleles, R (black), r-m (black spots and (or) concentric streaks on brown seed), and r (brown seed). This study was conducted to determine the structure of the MYB transcription factor gene in a near-isogenic line (NIL) having r-m allele. PCR amplification of a fragment of the candidate gene Glyma.09G235100 generated a fragment of about 1 kb in the soybean cultivar Clark, whereas a fragment of about 14 kb in addition to fragments of 1 and 1.4 kb were produced in L72-2040, a Clark 63 NIL with the r-m allele. Clark 63 is a NIL of Clark with the rxp and Rps1 alleles. A DNA fragment of 13 060 bp was inserted in the intron of Glyma.09G235100 in L72-2040. The fragment had the CACTA motif at both ends, imperfect terminal inverted repeats (TIR), inverse repetition of short sequence motifs close to the 5' and 3' ends, and a duplication of three nucleotides at the site of integration, indicating that it belongs to a CACTA-superfamily transposable element. We designated the element as Tgm11. Overall nucleotide sequence, motifs of TIR, and subterminal repeats were similar to those of Tgm1 and Tgs1, suggesting that these elements comprise a family.

  1. Enhanced Antitumoral Activity of Extracts Derived from Cultured Udotea flabellum (Chlorophyta

    Directory of Open Access Journals (Sweden)

    Rosa Moo-Puc

    2011-01-01

    Full Text Available Very few studies have been performed to evaluate the effect of culture conditions on the production or activity of active metabolites in algae. Previous studies suggest that the synthesis of bioactive compounds is strongly influenced by irradiance level. To investigate whether the antiproliferative activity of Udotea flabellum extracts is modified after cultivation, this green alga was cultured under four photon flux densities (PFD for 30 days. After 10, 20, and 30 days, algae were extracted with dichloromethane: methanol and screened for antiproliferative activity against four human cancer cell lines (laryngeal—Hep-2, cervix—HeLa, cervix squamous—SiHa and nasopharynx—KB by SRB assay. Lipid and phenol content were evaluated by standardized methods on algae organic extracts. After 10 days of cultivation, organic U. flabellum extracts showed a significant increase in antiproliferative activity on Hela and SiHa cells when compared to noncultured algae extracts. Extracts obtained after 10 and 20 days of culture were active on KB and Hep-2 cells. Total phenol and polyunsaturated fatty acid content in organic extracts changed with cultivation time but not by irradiance treatment. Extracts from U. flabellum obtained after 10 and 20 days of culture have been selected for fractionation and isolation of active compounds.

  2. Induction of mitophagy-mediated antitumor activity with folate-appended methyl-β-cyclodextrin

    Directory of Open Access Journals (Sweden)

    Kameyama K

    2017-04-01

    Full Text Available Kazuhisa Kameyama,1,* Keiichi Motoyama,1,* Nao Tanaka,1 Yuki Yamashita,1 Taishi Higashi,1 Hidetoshi Arima1,2,* 1Department of Physical Pharmaceutics, Graduate School of Pharmaceutical Sciences, 2Program for Leading Graduate Schools “HIGO (Health Life Science: Interdisciplinary and Glocal Oriented Program,” Kumamoto University, Kumamoto, Japan *These authors contributed equally to this work Abstract: Mitophagy is the specific autophagic elimination system of mitochondria, which regulates cellular survival via the removal of damaged mitochondria. Recently, we revealed that folate-appended methyl-β-cyclodextrin (FA-M-β-CyD provides selective antitumor activity in folate receptor-α (FR-α-expressing cells by the induction of autophagy. In this study, to gain insight into the detailed mechanism of this antitumor activity, we focused on the induction of mitophagy by the treatment of FR-α-expressing tumor cells with FA-M-β-CyD. In contrast to methyl-β-cyclodextrin, FA-M-β-CyD entered KB cells, human epithelial cells from a fatal cervical carcinoma (FR-α (+ through FR-α-mediated endocytosis. The transmembrane potential of isolated mitochondria after treatment with FA-M-β-CyD was significantly elevated. In addition, FA-M-β-CyD lowered adenosine triphosphate (ATP production and promoted reactive oxygen species production in KB cells (FR-α (+. Importantly, FA-M-β-CyD enhanced light chain 3 (LC3 conversion (LC3-I to LC3-II in KB cells (FR-α (+ and induced PTEN-induced putative kinase 1 (PINK1 protein expression, which is involved in the induction of mitophagy. Furthermore, FA-M-β-CyD had potent antitumor activity in BALB/c nu/nu mice xenografted with KB cells (FR-α (+ without any significant side effects. Taken together, these findings demonstrate that the autophagic cell death elicited by FA-M-β-CyD could be associated with mitophagy induced by an impaired mitochondrial function. Keywords: mitophagy, autophagy, folate receptor, methyl

  3. Detecting Differential Transcription Factor Activity from ATAC-Seq Data

    Directory of Open Access Journals (Sweden)

    Ignacio J. Tripodi

    2018-05-01

    Full Text Available Transcription factors are managers of the cellular factory, and key components to many diseases. Many non-coding single nucleotide polymorphisms affect transcription factors, either by directly altering the protein or its functional activity at individual binding sites. Here we first briefly summarize high-throughput approaches to studying transcription factor activity. We then demonstrate, using published chromatin accessibility data (specifically ATAC-seq, that the genome-wide profile of TF recognition motifs relative to regions of open chromatin can determine the key transcription factor altered by a perturbation. Our method of determining which TFs are altered by a perturbation is simple, is quick to implement, and can be used when biological samples are limited. In the future, we envision that this method could be applied to determine which TFs show altered activity in response to a wide variety of drugs and diseases.

  4. Influences of species of metals and supports on the hydrogenation activity of carbon-supported metal sulfides catalysts; Tanso biryushi tanji shokubai no suisoka kassei ni taisuru kassei kinzoku oyobi tantaishu no eikyo

    Energy Technology Data Exchange (ETDEWEB)

    Sakanishi, K.; Hasuo, H.; Taniguchi, H.; Nagamatsu, T.; Mochida, I. [Kyushu University, Fukuoka (Japan). Institute of Advanced Material Study

    1996-10-28

    In order to design catalysts suitable for primary liquefaction stage and secondary upgrading stage respectively in the multi-stage liquefaction process, various carbon-supported catalysts were prepared. Catalytic activities of them were investigated for the hydrogenation of 1-methylnaphthalene, to discuss the influences of metals and carbon species on the catalytic activity. Various water soluble and oil soluble Mo and Ni salts were used for NiMo supported catalysts. Among various carbon supports, Ketjen Black (KB) was effective for preparing the catalyst showing the most excellent hydrogenation activity. The KB and Black Pearl 2000 (BP2000) showing high hydrogenation activity were fine particles having high specific surface area more than 1000 m{sup 2}/g and primary particle diameter around 30 nm. This was inferred to contribute to the high dispersion support of active metals. Since such fine particles of carbon exhibited hydrophobic surface, they were suitable for preparing catalysts from the methanol-soluble metals. Although Ni and Mo added iron-based catalysts provided lower aromatic hydrogenation activity, they exhibited liquefaction activity competing with the NiMo/KB catalyst. 3 refs., 1 fig., 3 tabs.

  5. The significance of human factors in nuclear activities

    International Nuclear Information System (INIS)

    Weil, L.; Berg, H.P.

    1999-01-01

    Human factors is an aspect increasingly investigated in the last few years in efforts and programmes for enhancing the operational safety of nuclear systems. Methodology has been elaborated for analysis and evaluation of human reliability, or development of instruments supporting the decisions to be taken by the operators at the man-control room interface of nuclear installations, as well as initial approaches to introduce organisational factors which may influence the man-machine function allocation, and thus are an element of the safety culture concept. The significance of human factors in nuclear activities, as well as activities at the national and international level for optimisation of the man-machine interface and the man-organisation interface are discussed. (orig./CB) [de

  6. The human interactome knowledge base (hint-kb): An integrative human protein interaction database enriched with predicted protein–protein interaction scores using a novel hybrid technique

    KAUST Repository

    Theofilatos, Konstantinos A.

    2013-07-12

    Proteins are the functional components of many cellular processes and the identification of their physical protein–protein interactions (PPIs) is an area of mature academic research. Various databases have been developed containing information about experimentally and computationally detected human PPIs as well as their corresponding annotation data. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://biotools.ceid.upatras.gr/hint-kb/), a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, cal-culatesasetoffeaturesofinterest and computesaconfidence score for every candidate protein interaction. This confidence score is essential for filtering the false positive interactions which are present in existing databases, predicting new protein interactions and measuring the frequency of each true protein interaction. For this reason, a novel machine learning hybrid methodology, called (Evolutionary Kalman Mathematical Modelling—EvoKalMaModel), was used to achieve an accurate and interpretable scoring methodology. The experimental results indicated that the proposed scoring scheme outperforms existing computational methods for the prediction of PPIs.

  7. Antioxidant and anticancer activities of freshwater green algae, Cladophora glomerata and Microspora floccosa, from Nan River in northern Thailand

    Directory of Open Access Journals (Sweden)

    Warawut Chulalaksananukul

    2013-05-01

    Full Text Available Organic solvent and hot water extracts of freshwater macroalgae, Cladophora glomerata and Microspora floccosa, harvested from Nan River in northern Thailand were screened for antioxidant and anticancer activities using DPPH free radical scavenging assay and inhibition of proliferation of the KB human oral cancer cell lines respectively. The ethyl acetate extract of C. glomerata showed the highest total phenol content (18.1±2.3 mg GAE/g, radical scavenging activity (49.8±2.7% DPPH scavenging at 100 g/ml and in vitro growth inhibition (IC50=1420.0±66 g/g of the KB cell lines. These results indicate that C. glomerata could be a source of valuable bioactive materials.

  8. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  9. Coagulation factor XI improves host defence during murine pneumonia-derived sepsis independent of factor XII activation

    NARCIS (Netherlands)

    Stroo, Ingrid; Zeerleder, Sacha; Ding, Chao; Luken, Brenda M.; Roelofs, Joris J. T. H.; de Boer, Onno J.; Meijers, Joost C. M.; Castellino, Francis J.; van 't Veer, Cornelis; van der Poll, Tom

    2017-01-01

    Bacterial pneumonia, the most common cause of sepsis, is associated with activation of coagulation. Factor XI (FXI), the key component of the intrinsic pathway, can be activated via factor XII (FXII), part of the contact system, or via thrombin. To determine whether intrinsic coagulation is involved

  10. Eco RV RFLP at the insulin-like growth factor I (IGF I) locus on chromosome 12

    Energy Technology Data Exchange (ETDEWEB)

    Schneid, H; Noguiez, P; Girard, F; Binoux, M; Le Bouc, Y [INSERM U 142, Paris (France)

    1988-09-26

    The human liver IFG I cDNA insert from the {lambda}TG03 (1) was subcloned in PGEM4 (pTG 3906). The 660 bp Eco RI-Bam HI fragment containing the 5{prime} untranslated, the coding and the 3{prime} untranslated region of the IGF IA gene (exons 1, 2, 3 and 5) was used. Eco RV digestion of genomic DNA and hybridization with the IGF I probe reveals invariant fragments of 20; 8, 7 and 5 kb and polymorphic fragments of 13 kb (allele 1) and 11, 5 kb (allele 2). The frequency of alleles was studied in 51 unrelated European Caucasians. Co-dominant segregation was observed in 2 European families (9 individuals). Hind III and Pvu II digestions show previous described RFLP. Allelic frequencies however were: Hind III (5, 2 kb allele = 0, 14 and 4, 9 kb allele = 0, 86) and Pvu II (5 kb allele = 0, 14 and 4, 7 kb allele = 0, 86). Hind III and Pvu II RFLPs are linked. Among the DNA of the 14 individuals, where Eco RV RFLP was found, only one exhibited Hind III and Pvu II RFLPs.

  11. Increased volume of distribution for recombinant activated factor VII and longer plasma-derived factor VII half-life may explain their long lasting prophylactic effect.

    Science.gov (United States)

    Mathijssen, Natascha C J; Masereeuw, Rosalinde; Holme, Pal Andre; van Kraaij, Marian G J; Laros-van Gorkom, Britta A P; Peyvandi, Flora; van Heerde, Waander L

    2013-08-01

    Prophylaxis with plasma-derived or recombinant activated factor VII is beneficial in severe factor VII deficiency. To understand why prophylactic treatment with both products is efficacious, we conducted a pharmacokinetic study. Ten factor VII deficient patients were treated with either recombinant activated (20 μg/kg) or plasma-derived (25 IU/kg) factor VII in a cross-over design. Pharmacokinetic parameters were analyzed through activated factor VII activity, factor VII clotting activity, and factor VII antigen levels on depicted time points. Factor VII activity half-lifes, determined by non-compartmental and one-compartmental analysis (results in brackets), were shorter for recombinant activated (1.4h; 0.7h) than for plasma-derived factor VII (6.8h; 3.2h); both recombinant activated (5.1h; 2.1h and plasma-derived factor VII (5.8h; 3.2h) resulted in longer half-lives of factor VII antigen. Activated factor VII half-lives (based on activated factor VII activity levels) were significantly higher compared to factor VII clotting activity (1.6h; 0.9h). Volumes of distribution were significantly higher for activated factor VII (236 ml/kg; 175 ml/kg, measured by activated factor VII) as compared to plasma-derived factor VII (206 ml/kg; 64 ml/kg, measured by factor FVII activity), suggesting a plasma- and extracellular fluid distribution for recombinant activated factor VII. Recombinant activated factor VII showed significantly shorter half-lifes than plasma-derived factor VII. Volumes of distribution were significantly higher for treatment with recombinant activated factor VII. The longer half-life for plasma-derived factor VII, compared to recombinant activated factor VII, and the increased volume of distribution for recombinant activated factor VII, compared to plasma-derived factor VII may further elucidate the beneficial effect of prophylactic treatment of both products. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Studies on levels and interactions of contact activation factors in plasma

    International Nuclear Information System (INIS)

    Hoem, N.O.

    1992-01-01

    Summary of findings and conclusions of relevance: A part of the thesis concerns the effects of intravenous contrast media on the blood pressure and on factors of the contact activation system in the rat. The intravenous injection of dextran induced a profound and lasting fall in blood pressure, preceded by significant lowering in prekallikrein and activation factor 12. The non-ionic radiographic contrast media iohexol caused no significant alterations, neither in blood pressure, nor in levels of contact factors, whereas the ionic radiographic contrast media iodipamide had effects. It induced a rapid, but short-lived, fall in blood pressure and a small, but statistically significant reduction in the measurable amount of activation factor 12a. An observation of significance was that pretreatment of the rats with iodipamide almost blocked the dextran-induced blood pressure fall, and abolished the reduction in prekallikrein and activation factor 12a. It is concluded that the ionic radiographic contrast media used was capable of blocking dextran shock in the rat by preventing an activation of contact activation system. 130 refs., 5 figs

  13. Factor XII-independent activation of the bradykinin-forming cascade

    DEFF Research Database (Denmark)

    Joseph, Kusumam; Tholanikunnel, Baby G; Bygum, Anette

    2013-01-01

    and assayed for kallikrein formation. C1-INH was removed from factor XII-deficient plasma by means of immunoadsorption. RESULTS: We demonstrate that prekallikrein-HK will activate to kallikrein in phosphate-containing buffers and that the rate is further accelerated on addition of heat shock protein 90...... the prekallikrein-HK complex to prevent HK cleavage either by prekallikrein or by prekallikrein-HK autoactivation to generate kallikrein. In patients with hereditary angioedema, kallikrein and bradykinin formation can occur without invoking factor XII activation, although the kallikrein formed can rapidly activate...

  14. Common gene variants in the tumor necrosis factor (TNF and TNF receptor superfamilies and NF-kB transcription factors and non-Hodgkin lymphoma risk.

    Directory of Open Access Journals (Sweden)

    Sophia S Wang

    Full Text Available A promoter polymorphism in the pro-inflammatory cytokine tumor necrosis factor (TNF (TNF G-308A is associated with increased non-Hodgkin lymphoma (NHL risk. The protein product, TNF-alpha, activates the nuclear factor kappa beta (NF-kappaB transcription factor, and is critical for inflammatory and apoptotic responses in cancer progression. We hypothesized that the TNF and NF-kappaB pathways are important for NHL and that gene variations across the pathways may alter NHL risk.We genotyped 500 tag single nucleotide polymorphisms (SNPs from 48 candidate gene regions (defined as 20 kb 5', 10 kb 3' in the TNF and TNF receptor superfamilies and the NF-kappaB and related transcription factors, in 1946 NHL cases and 1808 controls pooled from three independent population-based case-control studies. We obtained a gene region-level summary of association by computing the minimum p-value ("minP test". We used logistic regression to compute odds ratios and 95% confidence intervals for NHL and four major NHL subtypes in relation to SNP genotypes and haplotypes. For NHL, the tail strength statistic supported an overall relationship between the TNF/NF-kappaB pathway and NHL (p = 0.02. We confirmed the association between TNF/LTA on chromosome 6p21.3 with NHL and found the LTA rs2844484 SNP most significantly and specifically associated with the major subtype, diffuse large B-cell lymphoma (DLBCL (p-trend = 0.001. We also implicated for the first time, variants in NFKBIL1 on chromosome 6p21.3, associated with NHL. Other gene regions identified as statistically significantly associated with NHL included FAS, IRF4, TNFSF13B, TANK, TNFSF7 and TNFRSF13C. Accordingly, the single most significant SNPs associated with NHL were FAS rs4934436 (p-trend = 0.0024, IRF4 rs12211228 (p-trend = 0.0026, TNFSF13B rs2582869 (p-trend = 0.0055, TANK rs1921310 (p-trend = 0.0025, TNFSF7 rs16994592 (p-trend = 0.0024, and TNFRSF13C rs6002551 (p-trend = 0.0074. All associations were

  15. Isolation of a 97-kb minimal essential MHC B locus from a new reverse-4D BAC library of the golden pheasant.

    Directory of Open Access Journals (Sweden)

    Qing Ye

    Full Text Available The bacterial artificial chromosome (BAC system is widely used in isolation of large genomic fragments of interest. Construction of a routine BAC library requires several months for picking clones and arraying BACs into superpools in order to employ 4D-PCR to screen positive BACs, which might be time-consuming and laborious. The major histocompatibility complex (MHC is a cluster of genes involved in the vertebrate immune system, and the classical avian MHC-B locus is a minimal essential one, occupying a 100-kb genomic region. In this study, we constructed a more effective reverse-4D BAC library for the golden pheasant, which first creates sub-libraries and then only picks clones of positive sub-libraries, and identified several MHC clones within thirty days. The full sequencing of a 97-kb reverse-4D BAC demonstrated that the golden pheasant MHC-B locus contained 20 genes and showed good synteny with that of the chicken. The notable differences between these two species were the numbers of class II B loci and NK genes and the inversions of the TAPBP gene and the TAP1-TAP2 region. Furthermore, the inverse TAP2-TAP1 was unique in the golden pheasant in comparison with that of chicken, turkey, and quail. The newly defined genomic structure of the golden pheasant MHC will give an insight into the evolutionary history of the avian MHC.

  16. Hybrid Active-Passive Microwave Photonic Filter with High Quality Factor

    International Nuclear Information System (INIS)

    En-Ming, Xu; Xin-Liang, Zhang; Li-Na, Zhou; Yu, Zhang; De-Xiu, Huang

    2009-01-01

    A hybrid high quality factor (Q-factor) microwave photonic filter with a cascaded active filter and a passive filter is presented and experimentally demonstrated. The active infinite impulse response filter is realized by a recirculating delay line loop with a semiconductor optical amplifier, and a much narrower 3 dB bandwidth of response peaks can be achieved. A passive finite impulse response filter is realized by an unbalance Mach–Zehnder interferometer, and it is cascaded to select the desired filter frequencies and to suppress the intermediate peaks. Compared with the purely active filter scheme, the free spectrum range and the Q-factor of the hybrid structure can be doubled. Stable operation and a high Q-factor of 362 are experimentally demonstrated

  17. Bg1II polymorphism of the epidermal growth factor receptor (EGF-R) gene

    Energy Technology Data Exchange (ETDEWEB)

    Biunno, I; Pozzi, M R; Radice, P; Mondini, P; Pierotti, M A; Porta, G D [Istituto Nazionale Tumori, Milan (Italy); Haley, J; Waterfield, M D [Ludwig Institute for Cancer Research, London (England)

    1988-08-11

    A 770 bp cDNA fragment was derived from the cytoplasmic portion of the EGF-R (ref. Libermann et al., 1985). Bg1II identifies 4 invariant bands of 7.0, 5.0, 3.5 and 1.2 kb and a two allele polymorphism with a band of either 10.6 kb (lane 1) or 9.4 kb (lane 3). An heterozygote individual is represented. The frequency was analyzed in 78 unrelated European Caucasians. Its chromosomal location was determined. Co-dominant segregation was demonstrated in three families of 12 individuals. A rare variant of 8.3 kb was seen in one chromosome out of the 144 examined. This allelic form has not yet been fully characterized.

  18. Rational design of novel highly potent and selective phosphatidylinositol 4-kinase III-beta (PI4KB) inhibitors as broad-spectrum antiviral agents and tools for chemical biology

    Czech Academy of Sciences Publication Activity Database

    Mejdrová, Ivana; Humpolíčková, Jana; Nencka, Radim; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 333 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR GJ15-21030Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : PI4KB * antivirals Subject RIV: CE - Biochemistry

  19. Adenovirus-dependent changes in cell membrane permeability: role of Na/sup +/, K/sup +/-ATPase

    Energy Technology Data Exchange (ETDEWEB)

    Seth, P.; Pastan, I.; Willingham, M.C.

    1987-03-01

    Adenovirus-dependent release of choline phosphate from KB cells at pH 6.0 was partially blocked by ouabain. In K/sup +/-containing medium, maximum inhibition of release was obtained by 10/sup -5/ M ouabain and half-maximal inhibition was achieved by about 0.5 x 10/sup -6/ M ouabain. Ouabain did not block either the binding or the uptake of adenovirus by KB cells. Without K/sup +/, about 25% of cell-associated choline phosphate was released by adenovirus, whereas with 1 mM K/sup +/ about 50% was released. This activation by K/sup +/ was blocked by 0.1 mM ouabain. HeLa cells behaved like KB cells, but a mutant of HeLa cells resistant to ouabain (D98-OR) released much lower amounts of choline phosphate in response to human adenovirus type 2 (Ad2). Wild-type D98-OR cells bound nearly the same amount of adenovirus as did normal HeLa cells. Ad2 also increased the activity of Na/sup +/, K/sup +/-ATPase in KB cells, with maximum activation at 50..mu..g of Ad2 per ml. In D98-OR cells, Ad2 failed to activate Na/sup +/, K/sup +/, ATPase activity. Ad2-dependent lysis of endocytic vesicles (receptosomes) was assayed by measuring Ad2-dependent enhancement of epidermal growth factor-Pseudomonas exotoxin toxicity. This action of adenovirus was increased when K/sup +/ was present in the medium. Under the conditions used, K/sup +/ had no effect on the amount of Ad2 or epidermal growth factor taken up by the cells. On the basis of these results, it is suggested that Ad2-dependent cellular efflux of choline phosphate and adenovirus-dependent lysis of receptosomes may require Na/sup +/, K/sup +/-ATPase activity.

  20. Furan- and Thiophene-2-Carbonyl Amino Acid Derivatives Activate Hypoxia-Inducible Factor via Inhibition of Factor Inhibiting Hypoxia-Inducible Factor-1

    Directory of Open Access Journals (Sweden)

    Shin-ichi Kawaguchi

    2018-04-01

    Full Text Available Induction of a series of anti-hypoxic proteins protects cells during exposure to hypoxic conditions. Hypoxia-inducible factor-α (HIF-α is a major transcription factor that orchestrates this protective effect. To activate HIF exogenously, without exposing cells to hypoxic conditions, many small-molecule inhibitors targeting prolyl hydroxylase domain-containing protein have been developed. In addition, suppression of factor inhibiting HIF-1 (FIH-1 has also been shown to have the potential to activate HIF-α. However, few small-molecule inhibitors of FIH-1 have been developed. In this study, we synthesized a series of furan- and thiophene-2-carbonyl amino acid derivatives having the potential to inhibit FIH-1. The inhibitory activities of these compounds were evaluated in SK-N-BE(2c cells by measuring HIF response element (HRE promoter activity. Several furan- and thiophene-2-carbonyl amino acid derivatives inhibited FIH-1 based on correlations among the docking score of the FIH-1 active site, the chemical structure of the compounds, and biological HIF-α/HRE transcriptional activity.

  1. PENGARUH PERUBAHAN BENTUK KELEMBAGAAN PROGRAM KB PADA PENGELOLAAN KAMPANYE PROGRAM KB DI TINGKAT FRONTLINER

    Directory of Open Access Journals (Sweden)

    Djoko Setyabudi

    2016-03-01

    Full Text Available This research is aimed at examining the effects of the form of family planning institutions on the ways family planning frontliner (PLKB in Central Java manage their campaign programs. The research findings indicate that the form of family planning institutions, the number of tasks, and incentives given to PLKB, influence the performance of PLKB. another important factor which is significant to the frontliner’s performances is not the form of the institutions, but the way the campaign is managed in each of family planning institution.

  2. Platelet-derived growth factor inhibits platelet activation in heparinized whole blood.

    Science.gov (United States)

    Selheim, F; Holmsen, H; Vassbotn, F S

    1999-08-15

    We previously have demonstrated that human platelets have functionally active platelet-derived growth factor alpha-receptors. Studies with gel-filtered platelets showed that an autocrine inhibition pathway is transduced through this tyrosine kinase receptor during platelet activation. The physiological significance of this inhibitory effect of platelet-derived growth factor on gel-filtered platelets activation is, however, not known. In the present study, we investigated whether platelet-derived growth factor inhibits platelet activation under more physiological conditions in heparinized whole blood, which represents a more physiological condition than gel-filtered platelets. Using flow cytometric assays, we demonstrate here that platelet-derived growth factor inhibits thrombin-, thrombin receptor agonist peptide SFLLRN-, and collagen-induced platelet aggregation and shedding of platelet-derived microparticles from the platelet plasma membrane during platelet aggregation in stirred heparinized whole blood. The inhibitory effect of platelet-derived growth factor was dose dependent. However, under nonaggregating conditions (no stirring), we could not demonstrate any significant effect of platelet-derived growth factor on thrombin- and thrombin receptor agonist peptide-induced platelet surface expression of P-selectin. Our results demonstrate that platelet-derived growth factor appears to be a true antithrombotic agent only under aggregating conditions in heparinized whole blood.

  3. A putative autonomous 20.5 kb-CACTA transposon insertion in an F3'H allele identifies a new CACTA transposon subfamily in Glycine max

    Directory of Open Access Journals (Sweden)

    Vodkin Lila

    2008-12-01

    in the gray trichome allele t*. Conclusion The molecular characterization of a 20.5 kb insertion in the flavonoid 3'-hydroxylase (F3'H gene of a soybean gray pubescence allele (t* identified the structure of a CACTA transposon designated Tgmt*. Besides the terminal inverted repeats and subterminal repeated motifs,Tgmt* encoded a large gene with two putative functions that are required for excision and transposition of a CACTA element, a transposase and the DNA binding protein known to associate to the subterminal repeated motifs. The degree of dissimilarity between Tgmt* transposase and subterminal repeated motifs with those of previously characterized defective CACTA elements (Tgm1-7 were evidence of the existence of two subfamilies of CACTA transposons in soybean, an observation not previously reported in other plants. In addition, our analyses of a genetically active and potentially autonomous element sheds light on the complete structure of a soybean element that is useful for annotation of the repetitive fraction of the soybean genome sequence and may prove useful for transposon tagging or transposon display experiments in different genetic lines.

  4. Factors of the active listening of preschool children

    Directory of Open Access Journals (Sweden)

    Purić Daliborka S.

    2016-01-01

    Full Text Available Active listening is a communication skill which is crucial for the development of cooperative relationships in the group, culture of friendship and fellowship, it is also important for the development of literacy skills and talent for speaking. Furthermore, it contributes to the improvement of the level of knowledge, skills and school achievement, as well as to the development of self-confidence of children. Developing of active listening is an important task in the activities with children of preschool age. In this paper, the author, wanting to determine the importance of the factors of active listening of preschool children, examines how preschool teachers (N = 198: (a evaluate the importance of certain elements of active listening that relate to the speaker and the listener, and (b estimate their role in the process of developing active listening skills of preschool children as an essential element of successful interpersonal communication. Results of the survey show that preschool teachers attach greater importance to the factors of active listening related to the listener (attention, listening skill, interest in the subject, than to the factors related to the speaker (motivation for listening, quality of the narrative. More than two-thirds of surveyed preschool teachers (172 or 86.9% define its impact on the stimulation of active listening of children as significant. Work experience and professional qualifications as independent variables significantly influence the attitudes of preschool teachers about the importance of their impact in stimulating active listening. Preschool teacher is a key element of the training of preschool children in the area of the basic communication skills of active listening. In this sense, the results of our survey show that in the context of academic study programs for education of preschool teachers special attention is given to the communication skills and to their role in the development of active listening

  5. Gathering Stones: The Problems of Modern Cultural and Activity Research

    Directory of Open Access Journals (Sweden)

    Reed M.,

    2017-08-01

    Full Text Available Cultural-Historical Psychology 2017. Vol. 13, no. 1, 4–22 doi:10.17759/chp.2017130101 ISSN: 1816-5435 / 2224-8935 (online Gathering Stones: The Problems of Modern Cultural and Activity Research 28 Reed M., Ph.D., Senior Lecturer in Education, University of Bristol, Graduate School of Education, Bristol, Great Britain , Malcolm.Reed@bristol.ac.uk Download PDF-fulltext (306 kbFull Text in Russian (PDF, 306 kbPrintRUIn Russian Abstract This paper explores the verbal image of ‘gathering stones’ in order to appreciate the continuing relevance of Vygotsky to the tradition of inquiry that has been inspired by his example and his work. It considers how our tradition is built on the ancient and critical activity of problematization. The meaning and inner value of tradition is explored in relation to problems we address now and have addressed historically, in particular in relation to the problem of an ascendant version of enculturation. The argument ends with a reflection on the difficulties we still face in addressing educational needs.

  6. PMS2 inactivation by a complex rearrangement involving an HERV retroelement and the inverted 100-kb duplicon on 7p22.1.

    Science.gov (United States)

    Vogt, Julia; Wernstedt, Annekatrin; Ripperger, Tim; Pabst, Brigitte; Zschocke, Johannes; Kratz, Christian; Wimmer, Katharina

    2016-11-01

    Biallelic PMS2 mutations are responsible for more than half of all cases of constitutional mismatch repair deficiency (CMMRD), a recessively inherited childhood cancer predisposition syndrome. The mismatch repair gene PMS2 is partly embedded within one copy of an inverted 100-kb low-copy repeat (LCR) on 7p22.1. In an individual with CMMRD syndrome, PMS2 was found to be homozygously inactivated by a complex chromosomal rearrangement, which separates the 5'-part from the 3'-part of the gene. The rearrangement involves sequences of the inverted 100-kb LCR and a human endogenous retrovirus element and may be associated with an inversion that is indistinguishable from the known inversion polymorphism affecting the ~0.7-Mb sequence intervening the LCR. Its formation is best explained by a replication-based mechanism (RBM) such as fork stalling and template switching/microhomology-mediated break-induced replication (FoSTeS/MMBIR). This finding supports the hypothesis that the inverted LCR can not only facilitate the formation of the non-allelic homologous recombination-mediated inversion polymorphism but it also promotes the occurrence of more complex rearrangements that can be associated with a large inversion, as well, but are mediated by a RBM. This further suggests that among the inversion polymorphism on 7p22.1, more complex rearrangements might be hidden. Furthermore, as the locus is embedded in a common fragile site (CFS) region, this rearrangement also supports the recently raised hypothesis that CFS sequence motifs may facilitate replication-based rearrangement mechanisms.

  7. Platelet activating factor activity in the phospholipids of bovine spermatozoa

    Energy Technology Data Exchange (ETDEWEB)

    Parks, J.E.; Hough, S.; Elrod, C. (Cornell Univ., Ithaca, NY (USA))

    1990-11-01

    Platelet activating factor (PAF) has been detected in sperm from several mammalian species and can affect sperm motility and fertilization. Because bovine sperm contain a high percentage of ether-linked phospholipid precursors required for PAF synthesis, a study was undertaken to determine the PAF activity of bovine sperm phospholipids. Total lipids of washed, ejaculated bull sperm were extracted, and phospholipids were fractionated by thin-layer chromatography. Individual phospholipid fractions were assayed for PAF activity on the basis of (3H)serotonin release from equine platelets. PAF activity was detected in the PAF fraction (1.84 pmol/mumol total phospholipid) and in serine/inositol (PS/PI), choline (CP), and ethanolamine phosphoglyceride (EP) and cardiolipin (CA) fractions. Activity was highest in the CP fraction (8.05 pmol/mumol total phospholipid). Incomplete resolution of PAF and neutral lipids may have contributed to the activity in the PS/PI and CA fractions, respectively. Phospholipids from nonsperm sources did not stimulate serotonin release. Platelet activation by purified PAF and by sperm phospholipid fractions was inhibited by the receptor antagonist SRI 63-675. These results indicate that bovine sperm contain PAF and that other sperm phospholipids, especially CP and EP, which are high in glycerylether components, are capable of receptor-mediated platelet activation.

  8. Fine Mapping Suggests that the Goat Polled Intersex Syndrome and the Human Blepharophimosis Ptosis Epicanthus Syndrome Map to a 100-kb Homologous Region

    OpenAIRE

    Schibler, Laurent; Cribiu, Edmond P.; Oustry-Vaiman, Anne; Furet, Jean-Pierre; Vaiman, Daniel

    2000-01-01

    To clone the goat Polled Intersex Syndrome (PIS) gene(s), a chromosome walk was performed from six entry points at 1q43. This enabled 91 BACs to be recovered from a recently constructed goat BAC library. Six BAC contigs of goat chromosome 1q43 (ICC1–ICC6) were thus constructed covering altogether 4.5 Mb. A total of 37 microsatellite sequences were isolated from this 4.5-Mb region (16 in this study), of which 33 were genotyped and mapped. ICC3 (1500 kb) was shown by genetic analysis to encompa...

  9. Diagnostics of the Factors Influencing the Export Activity of an Enterprise

    Directory of Open Access Journals (Sweden)

    Skrynkovskyy Ruslan M.

    2017-09-01

    Full Text Available The modern practice of doing business proves that a successful entrance of any enterprise to external (international markets depends on the level of its readiness for carrying out foreign economic activity. Under such circumstances, the process of targeted analysis and assessment of factors influencing the export activity of the enterprise is relevant, expedient and important. The aim of the article is the formation and development of theoretical and methodological bases for diagnosing factors influencing the export activity of an enterprise on the basis of theory and practice in the field of management and administration. It is found that the diagnostics should be understood as the process of identification, analysis and evaluation of influence (functional, dysfunctional of the factors (circumstances, conditions, etc. on the export activity of an enterprise in order to identify and solve problems (current, possible ones in the sphere of supply and implementation of specific actions (steps related to its entrance to external (international markets. It is determined that the key business indicators of the system for diagnosing the factors influencing the export activity of an enterprise are indicators reflecting the influence of the main factors on its export activity: level of fulfillment of obligations in terms of cost; level of conclusion of “expensive contracts”; share of renewed business contracts in the total number of contracts; level of satisfaction of claims; level of delivery variability. The prospect for further research in this scientific direction is developing a system of partial diagnostic goals of the integrated system of goals for conducting economic diagnostics of enterprises taking into account the diagnostics of factors influencing the export activity of an enterprise as a partial diagnostic goal.

  10. Biosynthesis of 10 kDa and 7.5 kDa insulin-like growth factor II in a human rhabdomyosarcoma cell line

    DEFF Research Database (Denmark)

    Nielsen, F C; Haselbacher, G; Christiansen, Jan

    1993-01-01

    In the present study we have analysed the expression of insulin-like growth factor II (IGF-II) in the human rhabdomyosarcoma cell line IN157.IN157 cells express high levels of three IGF-II mRNAs of 6.0 kb, 4.8 kb and 4.2 kb. In contrast, normal skeletal muscle expresses a negligible amount of IGF......-II mRNA. Two forms of IGF-II with molecular masses of 7.5 kDa and 10 kDa, corresponding to the mature IGF-II and IGF-II with a C-terminal extension of 21 amino acids (IGF-IIE21), were secreted into the culture medium at amounts of 17 ng/ml (2.3 nM) and 15 ng/ml (1.5 nM), respectively. IN157 cells also......-II and IGF-IIE21 with Kd values of 0.5 nM and 2 nM, respectively, and IGF-I with about 500 times lower affinity. IGF-II and IGF-IIE21 stimulated DNA synthesis via the IGF-I receptor, whereas the IGF-II/Man 6-P receptor mediated their rapid internalization and inactivation. During culture of IN157 cells about...

  11. Protamine sulfate down-regulates thrombin generation by inhibiting factor V activation.

    LENUS (Irish Health Repository)

    Ni Ainle, Fionnuala

    2009-08-20

    Protamine sulfate is a positively charged polypeptide widely used to reverse heparin-induced anticoagulation. Paradoxically, prospective randomized trials have shown that protamine administration for heparin neutralization is associated with increased bleeding, particularly after cardiothoracic surgery with cardiopulmonary bypass. The molecular mechanism(s) through which protamine mediates this anticoagulant effect has not been defined. In vivo administration of pharmacologic doses of protamine to BALB\\/c mice significantly reduced plasma thrombin generation and prolonged tail-bleeding time (from 120 to 199 seconds). Similarly, in pooled normal human plasma, protamine caused significant dose-dependent prolongations of both prothrombin time and activated partial thromboplastin time. Protamine also markedly attenuated tissue factor-initiated thrombin generation in human plasma, causing a significant decrease in endogenous thrombin potential (41% +\\/- 7%). As expected, low-dose protamine effectively reversed the anticoagulant activity of unfractionated heparin in plasma. However, elevated protamine concentrations were associated with progressive dose-dependent reduction in thrombin generation. To assess the mechanism by which protamine mediates down-regulation of thrombin generation, the effect of protamine on factor V activation was assessed. Protamine was found to significantly reduce the rate of factor V activation by both thrombin and factor Xa. Protamine mediates its anticoagulant activity in plasma by down-regulation of thrombin generation via a novel mechanism, specifically inhibition of factor V activation.

  12. Statistical method application to knowledge base building for reactor accident diagnostic system

    International Nuclear Information System (INIS)

    Yoshida, Kazuo; Yokobayashi, Masao; Matsumoto, Kiyoshi; Kohsaka, Atsuo

    1989-01-01

    In the development of a knowledge based expert system, one of key issues is how to build the knowledge base (KB) in an efficient way with keeping the objectivity of KB. In order to solve this issue, an approach has been proposed to build a prototype KB systematically by a statistical method, factor analysis. For the verification of this approach, factor analysis was applied to build a prototype KB for the JAERI expert system DISKET. To this end, alarm and process information was generated by a PWR simulator and the factor analysis was applied to this information to define taxonomy of accident hypotheses and to extract rules for each hypothesis. The prototype KB thus built was tested through inferring against several types of transients including double-failures. In each diagnosis, the transient type was well identified. Furthermore, newly introduced standards for rule extraction showed good effects on the enhancement of the performance of prototype KB. (author)

  13. Recombinant activated factor VII: 30 years of research and innovation.

    Science.gov (United States)

    Hedner, Ulla

    2015-06-01

    Recombinant activated factor VII (rFVIIa) was initially developed to treat bleeding episodes in patients with congenital haemophilia and inhibitors. The story of its development began in the 1970s, when FVIIa was identified as one of the activated coagulation factors that has minimal potential for inducing thromboembolic side-effects. Extensive research over the last 30 years has greatly increased our knowledge of the characteristics of FVII, its activation, and the mechanisms by which rFVIIa restores haemostasis. In haemophilia, the haemostatic effect of rFVIIa is mediated via binding to thrombin-activated platelets at the site of injury, thereby enhancing thrombin generation also in the absence of factor (F) VIII or FIX. The mechanism of action of rFVIIa has also allowed its successful use in other clinical scenarios characterised by impaired thrombin generation, and its licensed uses have now been extended to acquired haemophilia, congenital FVII deficiency and Glanzmann's thrombasthenia. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Monosodium Urate in the Presence of RANKL Promotes Osteoclast Formation through Activation of c-Jun N-Terminal Kinase

    Directory of Open Access Journals (Sweden)

    Jung-Yoon Choe

    2015-01-01

    Full Text Available The aim of this study was to clarify the role of monosodium urate (MSU crystals in receptor activator of nuclear factor kB ligand- (RANKL- RANK-induced osteoclast formation. RAW 264.7 murine macrophage cells were incubated with MSU crystals or RANKL and differentiated into osteoclast-like cells as confirmed by staining for tartrate-resistant acid phosphatase (TRAP and actin ring, pit formation assay, and TRAP activity assay. MSU crystals in the presence of RANKL augmented osteoclast differentiation, with enhanced mRNA expression of NFATc1, cathepsin K, carbonic anhydrase II, and matrix metalloproteinase-9 (MMP-9, in comparison to RAW 264.7 macrophages incubated in the presence of RANKL alone. Treatment with both MSU crystals and RANKL induced osteoclast differentiation by activating downstream molecules in the RANKL-RANK pathway including tumor necrosis factor receptor-associated factor 6 (TRAF-6, JNK, c-Jun, and NFATc1. IL-1b produced in response to treatment with both MSU and RANKL is involved in osteoclast differentiation in part through the induction of TRAF-6 downstream of the IL-1b pathway. This study revealed that MSU crystals contribute to enhanced osteoclast formation through activation of RANKL-mediated pathways and recruitment of IL-1b. These findings suggest that MSU crystals might be a pathologic causative agent of bone destruction in gout.

  15. Influence of jasmonic acid as potential activator of induced ...

    Indian Academy of Sciences (India)

    MADU

    seed vigor and reduction in market acceptability of the produce. ... effect prior to the challenge of infection and induces defense against KB probably by maintaining a critical balance ..... could be a strategy to combat KB infection through.

  16. Kruppel-like factor 2 (KLF2) regulates proinflammatory activation of monocytes

    Science.gov (United States)

    Das, Hiranmoy; Kumar, Ajay; Lin, Zhiyong; Patino, Willmar D.; Hwang, Paul M.; Feinberg, Mark W.; Majumder, Pradip K.; Jain, Mukesh K.

    2006-01-01

    The mechanisms regulating activation of monocytes remain incompletely understood. Herein we provide evidence that Kruppel-like factor 2 (KLF2) inhibits proinflammatory activation of monocytes. In vitro, KLF2 expression in monocytes is reduced by cytokine activation or differentiation. Consistent with this observation, KLF2 expression in circulating monocytes is reduced in patients with chronic inflammatory conditions such as coronary artery disease. Adenoviral overexpression of KLF2 inhibits the LPS-mediated induction of proinflammatory factors, cytokines, and chemokines and reduces phagocytosis. Conversely, short interfering RNA-mediated reduction in KLF2 increased inflammatory gene expression. Reconstitution of immunodeficient mice with KLF2-overexpressing monocytes significantly reduced carrageenan-induced acute paw edema formation. Mechanistically, KLF2 inhibits the transcriptional activity of both NF-κB and activator protein 1, in part by means of recruitment of transcriptional coactivator p300/CBP-associated factor. These observations identify KLF2 as a novel negative regulator of monocytic activation. PMID:16617118

  17. Estrogens and growth factors induce the mRNA of the 52K-pro-cathepsin-D secreted by breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Cavailles, V; Augereau, P; Garcia, M; Rochefort, H

    1988-03-25

    The estrogen-induced 52K protein secreted by human breast cancer cells is a lysosomal protease recently identified as a pro-cathepsin D by sequencing several cDNA clones isolated from MCF/sub 7/ cells. Using one of these clones, the authors detected, in MCF/sub 7/ cells a 2.2 kb mRNA whose level was rapidly increased 4- to 10-fold by estradiol, but not by other classes of steroids. Other mitogens, such as epidermal growth factor and insulin, also induced the 2.2 kb mRNA in a dose-dependent manner. Induction with epidermal growth factor was as rapid but was 2- to 3-fold lower than with estradiol. Antiestrogens had no effect on the 52K-cathepsin-D mRNA in MCF/sub 7/ cells, but became estrogen agonists in two antiestrogen-resistant sublines R/sub 27/ and LY2. The use of transcription and translation inhibitors and nuclear run-on experiments indicate that estradiol enhances transcription of the 52K-cathepsin-D gene in MCF/sub 7/ cells.

  18. Taq I polymorphism in the 5' region of the von Willebrand Factor (vWF) gene

    Energy Technology Data Exchange (ETDEWEB)

    Lavergne, J M; Bahnak, B R; Assouline, Z; Pietu, G; Kerbiriou-Nabias, D; Meulien, P; Pavirani, A; Meyer, D

    1988-03-25

    pvWFIPC8 is a 2.28 Kb partial cDNA clone for human von Willebrand factor (vWF) isolated from a human lung cDNA library and inserted into the EcoRI site of pUC9. The sequence includes the last 1330 nucleotides that encode for vWF propeptide and 950 nucleotides that encode for mature vWF. Taq I (TCGA) identifies plural invariant bands and two variant bands with alleles at 2.3 (Al) and 1.0 (A2). The frequency was determined in 33 unrelated European and North American caucasians. The extreme 3' region of pvWFIPC8 corresponds to the 5' boundary of an area that could possibly hybridize with similar sequences on human chromosome 22. The 5' 1.74 Kb portion of pvWFIPC8 generated by Bam HI digestion that corresponds to sequences only on chromosome 12 also demonstrates the polymorphism. Co-dominant segregation was demonstrated in 6 families of 48 individuals.

  19. A single cis element maintains repression of the key developmental regulator Gata2.

    Directory of Open Access Journals (Sweden)

    Jonathan W Snow

    2010-09-01

    Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.

  20. Assembly and activation of neurotrophic factor receptor complexes.

    Science.gov (United States)

    Simi, Anastasia; Ibáñez, Carlos F

    2010-04-01

    Neurotrophic factors play important roles in the development and function of both neuronal and glial elements of the central and peripheral nervous systems. Their functional diversity is in part based on their ability to interact with alternative complexes of receptor molecules. This review focuses on our current understanding of the mechanisms that govern the assembly and activation of neurotrophic factor receptor complexes. The realization that many, if not the majority, of these complexes exist in a preassembled form at the plasma membrane has forced the revision of classical ligand-mediated oligomerization models, and led to the discovery of novel mechanisms of receptor activation and generation of signaling diversity which are likely to be shared by many different classes of receptors.

  1. Factor VII-activating protease in patients with acute deep venous thrombosis

    DEFF Research Database (Denmark)

    Sidelmann, Johannes J; Vitzthum, Frank; Funding, Eva

    2008-01-01

    Factor VII-activating protease (FSAP) is involved in haemostasis and inflammation. FSAP cleaves single chain urokinase-type plasminogen activator (scu-PA). The 1601GA genotype of the 1601G/A polymorphism in the FSAP gene leads to the expression of a FSAP variant with reduced ability to activate scu......-PA, without affecting the ability to activate coagulation Factor VII (FVII). Previous studies have investigated the association of the 1601GA genotype with incidence and progression of carotid stenosis and deep venous thrombosis (DVT). The present study is the first to evaluate the potential association...... between the FSAP phenotype and DVT. We studied the association between the 1601G/A polymorphism, FSAP activity, FSAP antigen, Factor VIIa (FVIIa), prothrombin fragment 1+2 (F1+2), and C-reactive protein (CRP) in plasmas of 170 patients suspected for DVT. FSAP genotypes were equally distributed in patients...

  2. Comparison of Some Cardiovascular Risk Factors between Active and Sedentary Elderly Men

    Directory of Open Access Journals (Sweden)

    H. Najafgholizadeh

    2017-04-01

    Full Text Available Background: One of the major problems threatening the world’s people are cardiovascular diseases, accounting for 30% of the deaths. The factors exposing people to this danger are called risk factors. Objective: This study aimed to compare the cardiovascular risk factors and C-reactive protein between active and sedentary elderly men. Methods: The study was a descriptive comparison of two groups that were conducted in Rasht city in 2015. The subjects of this study consist of 30 active elderly men and 30 sedentary elderly men who were selected non-randomly and purposefully. Inclusion criteria of research for active subjects were have regular physical activity at least six months and don’t use cigarette and pills that affect profile lipids and inclusion criteria for sedentary subjects were don’t have regular physical activity and also don’t use cigarette and pills that affect profile lipids. The measured cardiovascular risk factors of subjects include fasting blood sugar (FBS, triglyceride (TG, total cholesterol (TC, highdensity lipoprotein (HDL, low-density lipoprotein (LDL, very low-density lipoprotein (VLDL, glycated haemoglobinA1c (HbA1c, and C-reactive protein (CRP. The statistical methods used for data analysis are Kolmogorov-Smirnov test, t-student, and U Mann-Whitney with significance level less than 0.05. Findings: The t-student exam shows that cardiovascular risk factors, including FBS, TG, TC, HDL, VLDL, HbA1c, and CRP, in active elderly men are lower than sedentary elderly men. This difference is also statistically significant (P≤0/01. Conclusion: The study showed that cardiovascular risk factors in active elderly men are less than sedentary ones. However, 80% of active elderly men had still at least one or several cardiovascular risk factors.

  3. Physical Activity : The interplay between individual and neighbourhood factors

    NARCIS (Netherlands)

    M.A. Beenackers (Marielle)

    2013-01-01

    textabstractPhysical inactivity is among the most important and prevalent risk factors of many major diseases. Although the health benefits of regular exercise and a physically active lifestyle are well known, many people are still not active. Understanding why some population groups are physically

  4. Tissue factor-dependent vascular endothelial growth factor production by human fibroblasts in response to activated factor VII.

    Science.gov (United States)

    Ollivier, V; Bentolila, S; Chabbat, J; Hakim, J; de Prost, D

    1998-04-15

    The transmembrane protein tissue factor (TF) is the cell surface receptor for coagulation factor VII (FVII) and activated factor VII (FVIIa). Recently, TF has been identified as a regulator of angiogenesis, tumor growth, and metastasis. This study was designed to link the binding of FVII(a) to its receptor, TF, with the subsequent triggering of angiogenesis through vascular endothelial growth factor (VEGF) production by human lung fibroblasts. We report that incubation of fibroblasts, which express constitutive surface TF, with FVII(a) induces VEGF synthesis. FVII(a)-induced VEGF secretion, assessed by a specific enzyme-linked immunosorbent assay, was time- and concentration-dependent. VEGF secretion was maximal after 24 hours of incubation of the cells with 100 nmol/L FVII(a) and represented a threefold induction of the basal VEGF level. Reverse transcriptase-polymerase chain reaction analysis of VEGF detected three mRNA species of 180, 312, and 384 bp corresponding, respectively, to VEGF121, VEGF165, and VEGF189. A 2.5- to 3.5-fold increase was observed for the 180- and 312-bp transcripts at 12 and 24 hours, respectively. FVII(a)-dependent VEGF production was inhibited by a pool of antibodies against TF, pointing to the involvement of this receptor. On specific active-site inhibition with dansyl-glutamyl-glycinyl-arginyl chloromethyl ketone, FVIIa lost 70% of its capacity to elicit VEGF production. Consistent with this, the native form (zymogen) of FVII only had a 1.8-fold stimulating effect. Protein tyrosine kinase and protein kinase C are involved in signal transduction leading to VEGF production, as shown by the inhibitory effects of genistein and GF 109203X. The results of this study indicate that TF is essential for VIIa-induced VEGF production by human fibroblasts and that its role is mainly linked to the proteolytic activity of the TF-VIIa complex.

  5. Factor analysis shows association between family activity environment and children's health behaviour.

    Science.gov (United States)

    Hendrie, Gilly A; Coveney, John; Cox, David N

    2011-12-01

    To characterise the family activity environment in a questionnaire format, assess the questionnaire's reliability and describe its predictive ability by examining the relationships between the family activity environment and children's health behaviours - physical activity, screen time and fruit and vegetable intake. This paper describes the creation of a tool, based on previously validated scales, adapted from the food domain. Data are from 106 children and their parents (Adelaide, South Australia). Factor analysis was used to characterise factors within the family activity environment. Pearson-Product Moment correlations between the family environment and child outcomes, controlling for demographic variation, were examined. Three factors described the family activity environment - parental activity involvement, opportunity for role modelling and parental support for physical activity - and explained 37.6% of the variance. Controlling for demographic factors, the scale was significantly correlated with children's health behaviour - physical activity (r=0.27), screen time (r=-0.24) and fruit and vegetable intake (r=0.34). The family activity environment questionnaire shows high internal consistency and moderate predictive ability. This study has built on previous research by taking a more comprehensive approach to measuring the family activity environment. This research suggests the family activity environment should be considered in family-based health promotion interventions. © 2011 The Authors. ANZJPH © 2011 Public Health Association of Australia.

  6. Tissue factor activates allosteric networks in factor VIIa through structural and dynamic changes

    DEFF Research Database (Denmark)

    Madsen, Jesper Jonasson; Persson, E.; Olsen, O. H.

    2015-01-01

    that are not likely to be inferred from mutagenesis studies. Furthermore, paths from Met306 to Ile153 (N-terminus) and Trp364, both representing hallmark residues of allostery, are 7% and 37% longer, respectively, in free FVIIa. Thus, there is significantly weaker coupling between the TF contact point and key......Background: Tissue factor (TF) promotes colocalization of enzyme (factorVIIa) and substrate (FX or FIX), and stabilizes the active conformation of FVIIa. Details on how TF induces structural and dynamic changes in the catalytic domain of FVIIa to enhance its efficiency remain elusive. Objective......: To elucidate the activation of allosteric networks in the catalytic domain of the FVIIa protease it is when bound to TF.MethodsLong-timescale molecular dynamics simulations of FVIIa, free and in complex with TF, were executed and analyzed by dynamic network analysis. Results: Allosteric paths of correlated...

  7. Factors associated with Spanish older people's membership in political organizations: the role of active aging activities.

    Science.gov (United States)

    Serrat, Rodrigo; Villar, Feliciano; Celdrán, Montserrat

    2015-09-01

    This study explores older people's membership in political organizations by using data from the Survey on older people 2010, carried out by Spain's National Institute for older people and social services. The objectives were to describe the extent of this kind of participation among Spaniards aged 65 and over, and to analyze the factors that are associated with it. Results show that only slightly less than 7 % of the sample belonged to a political organization. To analyze the factors related to this membership, a set of models of multivariate analyses were run, including socioeconomic resources and participation in other types of active aging activity (participation in leisure, learning, and productive activities). Educational level, leisure activities, learning activities, and only volunteering in the case of productive activities were found to be associated with membership in political organizations. Results provide partial support for the socioeconomic resources model and suggest that engagement in leisure activities, learning activities, and volunteering might have an enhancing effect on membership in political organizations.

  8. Risk factors for glucose intolerance in active acromegaly

    Directory of Open Access Journals (Sweden)

    Kreze A.

    2001-01-01

    Full Text Available In the present retrospective study we determined the frequency of glucose intolerance in active untreated acromegaly, and searched for risk factors possibly supporting the emergence of the diabetic condition. Among 43 patients, 8 (19%; 95% CI: 8-33% had diabetes mellitus and 2 (5%; 1-16% impaired glucose tolerance. No impaired fasting glycemia was demonstrable. The frequency of diabetes was on average 4.5 times higher than in the general Slovak population. Ten factors suspected to support progression to glucose intolerance were studied by comparing the frequency of glucose intolerance between patients with present and absent risk factors. A family history of diabetes and arterial hypertension proved to have a significant promoting effect (P<0.05, chi-square test. A significant association with female gender was demonstrated only after pooling our data with literature data. Concomitant prolactin hypersecretion had a nonsignificant promoting effect. In conclusion, the association of active untreated acromegaly with each of the three categories of glucose intolerance (including impaired fasting glycemia, not yet studied in this connection was defined as a confidence interval, thus permitting a sound comparison with the findings of future studies. Besides a family history of diabetes, female gender and arterial hypertension were defined as additional, not yet described risk factors.

  9. The hematopoietic transcription factor PU.1 regulates RANK gene expression in myeloid progenitors

    International Nuclear Information System (INIS)

    Kwon, Oh Hyung; Lee, Chong-Kil; Lee, Young Ik; Paik, Sang-Gi; Lee, Hyun-Jun

    2005-01-01

    Osteoclasts are bone resorbing cells of hematopoietic origin. The hematopoietic transcription factor PU.1 is critical for osteoclastogenesis; however, the molecular mechanisms of PU.1-regulated osteoclastogenesis have not been explored. Here, we present evidence that the receptor activator of nuclear factor κB (RANK) gene that has been shown to be crucial for osteoclastogenesis is a transcriptional target of PU.1. The PU.1 -/- progenitor cells failed to express the RANK gene and reconstitution of PU.1 in these cells induced RANK expression. Treatment of the PU.1 reconstituted cells with M-CSF and RANKL further augmented the RANK gene expression. To explore the regulatory mechanism of the RANK gene expression by PU.1, we have cloned the human RANK promoter. Transient transfection assays have revealed that the 2.2-kb RANK promoter was functional in a monocyte line RAW264.7, whereas co-transfection of PU.1 transactivated the RANK promoter in HeLa cells. Taken together, these results suggest that PU.1 regulates the RANK gene transcription and this may represent one of the key roles of PU.1 in osteoclast differentiation

  10. Hemophilia as a defect of the tissue factor pathway of blood coagulation: Effect of factors VIII and IX on factor X activation in a continuous-flow reactor

    International Nuclear Information System (INIS)

    Repke, D.; Gemmell, C.H.; Guha, A.; Turitto, V.T.; Nemerson, Y.; Broze, G.J. Jr.

    1990-01-01

    The effect of factors VIII and IX on the ability of the tissue factor-factor VIIa complex to activate factor X was studied in a continuous-flow tubular enzyme reactor. Tissue factor immobilized in a phospholipid bilayer on the inner surface of the tube was exposed to a perfusate containing factors VIIa, VIII, IX, and X flowing at a wall shear rate of 57, 300, or 1130 sec -1 . The addition of factors VIII and IX at their respective plasma concentrations resulted in a further 2 endash-to 3 endash fold increase. The direct activation of factor X by tissue factor-factor VIIa could be virtually eliminated by the lipoprotein-associated coagulation inhibitor. These results suggest that the tissue factor pathway, mediated through factors VIII and IX, produces significant levels of factor Xa even in the presence of an inhibitor of the tissue factor-factor VIIa complex; moreover, the activation is dependent on local shear conditions. These findings are consistent both with a model of blood coagulation in which initiation of the system results from tissue factor and with the bleeding observed in hemophilia

  11. Factors Associated with Physical Activity Behaviors Among Rural Adolescents

    OpenAIRE

    Urruty, Kenli A.

    2009-01-01

    The "obesity epidemic" in the United States is a current health concern that has sparked research interest in physical activity as a means of weight management. However, little research has examined the physical activity behaviors of rural adolescents. The goal of the current study was to use a biopsychosocial framework to examine the physical activity behaviors of a sample of rural adolescents, and explore factors associated with physical activity participation. A sample of 162 ninth- an...

  12. Reactive oxygen species are crucial for hydroxychavicol toxicity toward KB epithelial cells.

    Science.gov (United States)

    Jeng, J H; Wang, Y J; Chang, W H; Wu, H L; Li, C H; Uang, B J; Kang, J J; Lee, J J; Hahn, L J; Lin, B R; Chang, M C

    2004-01-01

    Betel quid (BQ) chewing shows a strong correlation to the incidence of oral submucous fibrosis (OSF), leukoplakia and oral cancer. BQ contains mainly areca nut, lime, Piper betle leaf (PBL) and the inflorescence of P. betle (IPB). Hydroxychavicol (4-allyl-catechol, HC), as a major phenolic compound in PBL and IPB, is shown to induce oxidative stress, glutathione (GSH) depletion and cell cycle deregulation. Using bivariate BrdU/PI flow cytometry, KB cells in DNA synthesis (S phase) are shown to be sensitive to the toxic effect of HC and show cell cycle arrest and apoptosis following exposure to 0.1 and 0.3 mM HC. HC-induced apoptosis and cell cycle arrest are associated with mitochondrial membrane potential (delta Psim) depolarization as revealed by a decrease in rhodamine fluorescence. N-acetyl-L-cysteine (1 mM), superoxide dismutase (100 U/ml) and catalase (1000 U/ml) were effective in prevention of HC-induced GSH depletion (as indicated by chloromethylfluorescein fluorescence), reactive oxygen species (ROS) production (by dichlorofluorescein fluorescence), cell cycle arrest and apoptosis. However, dimethylthiourea (2 mM), neocuproine (1 mM), 1,10-phenanthroline (200 microM) and desferrioxamine (0.5 mM) showed little effect on HC-induced cell changes. HC elevated the cellular and mitochondrial GSH levels at moderate concentrations (0.05-0.1 mM), whereas at a concentration of 0.3 mM, inhibitory effects were noted. These results indicate that HC consumption may be associated with BQ-chewing-related oral mucosal diseases via GSH depletion, ROS production, mitochondrial dysfunction, cell cycle disturbance and the induction of apoptosis. These events are related to the production of superoxide radicals and hydrogen peroxide.

  13. Evidence supporting the use of recombinant activated factor VII in congenital bleeding disorders

    DEFF Research Database (Denmark)

    Johansson, Pär I; Ostrowski, Sisse R

    2010-01-01

    Recombinant activated factor VII (rFVIIa, NovoSeven) was introduced in 1996 for the treatment of hemophilic patients with antibodies against coagulation factor VIII or IX.......Recombinant activated factor VII (rFVIIa, NovoSeven) was introduced in 1996 for the treatment of hemophilic patients with antibodies against coagulation factor VIII or IX....

  14. Preparation of factor VII concentrate using CNBr-activated Sepharose 4B immunoaffinity chromatography.

    Science.gov (United States)

    Mousavi Hosseini, Kamran; Nasiri, Saleh

    2015-01-01

    Factor VII concentrates are used in patients with congenital or acquired factor VII deficiency or treatment of hemophilia patients with inhibitors. In this research, immunoaffinity chromatography was used to purify factor VII from prothrombin complex (Prothrombin- Proconvertin-Stuart Factor-Antihemophilic Factor B or PPSB) which contains coagulation factors II, VII, IX and X. The aim of this study was to improve purity, safety and tolerability as a highly purified factor VII concentrate. PPSB was prepared using DEAE-Sephadex and was used as the starting material for purification of coagulation factor VII. Prothrombin complex was treated by solvent/detergent at 24°C for 6 h with constant stirring. The mixture of PPSB in the PBS buffer was filtered and then chromatographed using CNBr-activated Sepharose 4B coupled with specific antibody. Factors II, IX, VII, X and VIIa were assayed on the fractions. Fractions of 48-50 were pooled and lyophilized as a factor VII concentrate. Agarose gel electrophoresis was performed and Tween 80 was measured in the factor VII concentrate. Specific activity of factor VII concentrate increased from 0.16 to 55.6 with a purificationfold of 347.5 and the amount of activated factor VII (FVIIa) was found higher than PPSB (4.4-fold). RESULTS of electrophoresis on agarose gel indicated higher purity of Factor VII compared to PPSB; these finding revealed that factor VII migrated as alpha-2 proteins. In order to improve viral safety, solvent-detergent treatment was applied prior to further purification and nearly complete elimination of tween 80 (2 μg/ml). It was concluded that immuonoaffinity chromatography using CNBr-activated Sepharose 4B can be a suitable choice for large-scale production of factor VII concentrate with higher purity, safety and activated factor VII.

  15. [Factors conditioning taking up sport activity by disabled people].

    Science.gov (United States)

    Plinta, Ryszard; Sobiecka, Joanna

    2002-01-01

    The aim of the study was to answer the following questions: What factors determine that disabled people take up systematic sport activity or should make such a decision? What reasons are able to eliminate the handicapped from process of regular going in for sport? Three groups of men participated. The group of disabled sportsmen included 39 subjects, the group of non-active disabled people 36 subjects and the group of able-bodied students 45 subjects. All the involved people answered the questions of the questionnaire, which concerned factors associated with sport activity of the handicapped and their socio-demographic characteristics, among other things. The opportunity of improvement of the health status is the main advantage of the sport for disabled people (53%). The chance of self-testing and sport competition was pointed out by 47% of subjects. The most common reason for taking up sport activity was sport passion (over 50%). The others were: possibility of creating new contacts with people, improvement of the physical condition, chance of self-testing and passing free time (23%). The lack of free time was the factor eliminating from sport activity in the second group (28%). The other problem was the shortage of appropriate clubs, equipment, infrastructure etc. (almost 25%). Students concluded that sport for disabled people aims to improve the mental condition mainly (42%). Quite similar percentage of the group (38%) didn't see any reason that was able to exclude the handicapped from goingin for sport. (1) Not only does active going in for sport improve the physical condition of the handicapped but strengthen them psychically as well. (2) The lack of sport activity in disabled people is to a high degree a result of low number of sport clubs, organisations, buildings as well as presence of architectural barriers.

  16. Activated human neutrophils release hepatocyte growth factor/scatter factor.

    LENUS (Irish Health Repository)

    McCourt, M

    2012-02-03

    BACKGROUND: Hepatocyte growth factor or scatter factor (HGF\\/SF) is a pleiotropic cytokine that has potent angiogenic properties. We have previously demonstrated that neutrophils (PMN) are directly angiogenic by releasing vascular endothelial growth factor (VEGF). We hypothesized that the acute inflammatory response can stimulate PMN to release HGF. AIMS: To examine the effects of inflammatory mediators on PMN HGF release and the effect of recombinant human HGF (rhHGF) on PMN adhesion receptor expression and PMN VEGF release. METHODS: In the first experiment, PMN were isolated from healthy volunteers and stimulated with tumour necrosis factor-alpha (TNF-alpha), lipopolysaccharide (LPS), interleukin-8 (IL-8), and formyl methionyl-leucyl-phenylalanine (fMLP). Culture supernatants were assayed for HGF using ELISA. In the second experiment, PMN were lysed to measure total HGF release and HGF expression in the PMN was detected by Western immunoblotting. Finally, PMN were stimulated with rhHGF. PMN CD 11a, CD 11b, and CD 18 receptor expression and VEGF release was measured using flow cytometry and ELISA respectively. RESULTS: TNF-alpha, LPS and fMLP stimulation resulted in significantly increased release of PMN HGF (755+\\/-216, 484+\\/-221 and 565+\\/-278 pg\\/ml, respectively) compared to controls (118+\\/-42 pg\\/ml). IL-8 had no effect. Total HGF release following cell lysis and Western blot suggests that HGF is released from intracellular stores. Recombinant human HGF did not alter PMN adhesion receptor expression and had no effect on PMN VEGF release. CONCLUSIONS: This study demonstrates that pro-inflammatory mediators can stimulate HGF release from a PMN intracellular store and that activated PMN in addition to secreting VEGF have further angiogenic potential by releasing HGF.

  17. The glycoprotein Ib-IX-V complex contributes to tissue factor-independent thrombin generation by recombinant factor VIIa on the activated platelet surface

    NARCIS (Netherlands)

    Weeterings, Cees; de Groot, Philip G.; Adelmeijer, Jelle; Lisman, Ton

    2008-01-01

    Several lines of evidence suggest that recombinant factor VIIa (rFVIIa) is able to activate factor X on an activated platelet, in a tissue factor-independent manner. We hypothesized that, besides the anionic surface, a receptor on the activated platelet surface is involved in this process. Here, we

  18. Demographic factors, workplace factors and active transportation use in the USA: a secondary analysis of 2009 NHTS data.

    Science.gov (United States)

    Quinn, Tyler D; Jakicic, John M; Fertman, Carl I; Barone Gibbs, Bethany

    2017-05-01

    While active transportation has health, economic and environmental benefits, participation within the USA is low. The purpose of this study is to examine relationships of demographic and workplace factors with health-enhancing active transportation and commuting. Participants in the 2009 National Household Travel Survey reported demographics, workplace factors (time/distance to work, flextime availability, option to work from home and work start time) and active transportation (for any purpose) or commuting (to and from work, workers only) as walking or biking (≥10 min bouts only). Multiple logistic regression examined cross-sectional relationships between demographics and workplace factors with active transportation and commuting. Among 152 573 participants, active transportation was reported by 1.11% by biking and 11.74% by walking. Among 111 808 working participants, active commuting was reported by 0.80% by biking and 2.76% by walking. Increased odds (pbike but decreased odds of walk transporting. Inconsistent patterns were observed by race, but whites had greater odds of any biking (p<0.05). Odds of active commuting were higher with a flexible schedule (p<0.001), the option to work from home (p<0.05), shorter time and distance to work (both p<0.001), and work arrival time between 11:00 and 15:59 (walking only, p=0.001). Active transportation differed across demographic and workplace factors. These relationships could inform infrastructure policy decisions and workplace wellness programming targeting increased active transportation. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  19. Factors Affecting EWS-FLI1 Activity in Ewing's Sarcoma

    Science.gov (United States)

    Herrero-Martin, David; Fourtouna, Argyro; Niedan, Stephan; Riedmann, Lucia T.; Schwentner, Raphaela; Aryee, Dave N. T.

    2011-01-01

    Ewing's sarcoma family tumors (ESFT) are characterized by specific chromosomal translocations, which give rise to EWS-ETS chimeric proteins. These aberrant transcription factors are the main pathogenic drivers of ESFT. Elucidation of the factors influencing EWS-ETS expression and/or activity will guide the development of novel therapeutic agents against this fatal disease. PMID:22135504

  20. TALE factors poise promoters for activation by Hox proteins.

    Science.gov (United States)

    Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G

    2014-01-27

    Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Psychosocial factors underlying physical activity

    Directory of Open Access Journals (Sweden)

    Ji Cheng-Ye

    2007-09-01

    of physical activity on academic achievement and other factors beyond physical health; barriers of not having enough time and having too many assignments perceived to hinder frequent physical activity; and parental approval. More rigorous research on psychosocial determinants with close-ended items developed from these open-ended data and with larger sample sizes of students is necessary. Research with parents and school staff will be needed to understand the perceptions of these stakeholder groups key to creating the students' social environment.

  2. Psychosocial factors underlying physical activity.

    Science.gov (United States)

    Zhang, Juan; Middlestadt, Susan E; Ji, Cheng-Ye

    2007-09-19

    factors beyond physical health; barriers of not having enough time and having too many assignments perceived to hinder frequent physical activity; and parental approval. More rigorous research on psychosocial determinants with close-ended items developed from these open-ended data and with larger sample sizes of students is necessary. Research with parents and school staff will be needed to understand the perceptions of these stakeholder groups key to creating the students' social environment.

  3. Selected cultural factors associated with physical activity among Latino women.

    Science.gov (United States)

    Jurkowski, Janine M; Mosquera, Margarita; Ramos, Blanca

    2010-01-01

    In the United States, Latinos are the largest ethnic group after non-Hispanic whites. Latinos currently represent 15% of the U.S. population and their numbers are growing in nontraditional areas. Latino women (Latinas) disproportionately experience chronic disease risk factors and report low levels of leisure time physical activity. This study examined cultural factors associated with leisure time physical activity among Latinas living in a new Latino destination in northeastern New York. Community-based participatory research, a collaborative approach in which community members are equitably and actively involved in the research process, was employed for this study. The Latina Health Survey was administered in Spanish and English to 289 Latina adults through snowball sampling. Women reported that their national origin was predominantly Puerto Rican (58.7%) or Dominican (18.2%). Only 6.6% of women met American College of Sports Medicine's physical activity recommendations of exercising 5 days a week; 25% participated in physical activity two or more times per week. Acculturation and religious service attendance at least once a week was positively associated and fast food consumption one or more times a week was negatively associated with physical activity. This study implicates the need for physical activity promotion efforts among Latinas who are culturally responsive and that address fast food consumption. In addition to acculturation, other, more specific cultural factors need to be examined to understand physical activity correlates among Latinas. Research among Latinas living in new Latino destinations is important for understanding behavior and tailoring health interventions among Latinos living in nontraditional areas. Copyright 2010 Jacobs Institute of Women

  4. Changes in CVD risk factors in the activity counseling trial

    Directory of Open Access Journals (Sweden)

    Meghan Baruth

    2011-01-01

    Full Text Available Meghan Baruth1, Sara Wilcox1, James F Sallis3, Abby C King4,5, Bess H Marcus6, Steven N Blair1,21Department of Exercise Science, 2Department of Epidemiology and Biostatistics, Arnold School of Public Health, University of South Carolina, Public Health Research Center, Columbia, SC, USA; 3Department of Psychology, San Diego State University, San Diego, CA, USA; 4Department of Health Research and Policy, 5Stanford Prevention Research Center, Department of Medicine, Stanford University School of Medicine, Stanford, CA, USA; 6Behavioral and Social Sciences Section, Brown University Program in Public Health, Providence, RI, USAAbstract: Primary care facilities may be a natural setting for delivering interventions that focus on behaviors that improve cardiovascular disease (CVD risk factors. The purpose of this study was to examine the 24-month effects of the Activity Counseling Trial (ACT on CVD risk factors, to examine whether changes in CVD risk factors differed according to baseline risk factor status, and to examine whether changes in fitness were associated with changes in CVD risk factors. ACT was a 24-month multicenter randomized controlled trial to increase physical activity. Participants were 874 inactive men and women aged 35–74 years. Participants were randomly assigned to one of three arms that varied by level of counseling, intensity, and resource requirements. Because there were no significant differences in change over time between arms on any of the CVD risk factors examined, all arms were combined, and the effects of time, independent of arm, were examined separately for men and women. Time × Baseline risk factor status interactions examined whether changes in CVD risk factors differed according to baseline risk factor status. Significant improvements in total cholesterol, high-density lipoprotein cholesterol (HDL-C and low-density lipoprotein cholesterol, the ratio of total cholesterol to HDL-C, and triglycerides were seen in

  5. The Sclerotinia sclerotiorum Mating Type Locus (MAT) Contains a 3.6-kb Region That Is Inverted in Every Meiotic Generation

    Science.gov (United States)

    Maruthachalam, Karunakaran; Wu, Bo-Ming; Subbarao, Krishna V.

    2013-01-01

    Sclerotinia sclerotiorum is a fungal plant pathogen and the causal agent of lettuce drop, an economically important disease of California lettuce. The structure of the S. sclerotiorum mating type locus MAT has previously been reported and consists of two idiomorphs that are fused end-to-end as in other homothallics. We investigated the diversity of S. sclerotiorum MAT using a total of 283 isolates from multiple hosts and locations, and identified a novel MAT allele that differed by a 3.6-kb inversion and was designated Inv+, as opposed to the previously known S. sclerotiorum MAT that lacked the inversion and was Inv-. The inversion affected three of the four MAT genes: MAT1-2-1 and MAT1-2-4 were inverted and MAT1-1-1 was truncated at the 3’-end. Expression of MAT genes differed between Inv+ and Inv- isolates. In Inv+ isolates, only one of the three MAT1-2-1 transcript variants of Inv- isolates was detected, and the alpha1 domain of Inv+ MAT1-1-1 transcripts was truncated. Both Inv- and Inv+ isolates were self-fertile, and the inversion segregated in a 1∶1 ratio regardless of whether the parent was Inv- or Inv+. This suggested the involvement of a highly regulated process in maintaining equal proportions of Inv- and Inv+, likely associated with the sexual state. The MAT inversion region, defined as the 3.6-kb MAT inversion in Inv+ isolates and the homologous region of Inv- isolates, was flanked by a 250-bp inverted repeat on either side. The 250-bp inverted repeat was a partial MAT1-1-1 that through mediation of loop formation and crossing over, may be involved in the inversion process. Inv+ isolates were widespread, and in California and Nebraska constituted half of the isolates examined. We speculate that a similar inversion region may be involved in mating type switching in the filamentous ascomycetes Chromocrea spinulosa, Sclerotinia trifoliorum and in certain Ceratocystis species. PMID:23457637

  6. Factors Affecting EWS-FLI1 Activity in Ewing's Sarcoma

    Directory of Open Access Journals (Sweden)

    David Herrero-Martin

    2011-01-01

    Full Text Available Ewing's sarcoma family tumors (ESFT are characterized by specific chromosomal translocations, which give rise to EWS-ETS chimeric proteins. These aberrant transcription factors are the main pathogenic drivers of ESFT. Elucidation of the factors influencing EWS-ETS expression and/or activity will guide the development of novel therapeutic agents against this fatal disease.

  7. Specific features of domestic banks activity in the factoring services market

    Directory of Open Access Journals (Sweden)

    Trygub Olena V.

    2014-01-01

    Full Text Available The article analyses specific features of formation and development of the domestic factoring market. In the result of the study the article establishes that development of factoring in Ukraine took place due to active participation of banking institutions in this process and nowadays they are leaders in the domestic factoring services market due to possessing significant competitive advantages if compared with non-banking companies that specialise in factoring. The article detects that nowadays the banks are not only offerers of factoring services and finance factoring operations of other market participants, but also take an active part in establishment of factoring branches and are consumers of factoring services. In order to accelerate development of international factoring in Ukraine, the article offers such forms of state support of banks, which render factoring services to domestic exporters. The article recommends to focus banks’ attention, under modern conditions that are characterised with volatility of financial markets, on factoring servicing of those clients, whom they have long business relations with, without jeopardising themselves through provision of factoring services to a big number of small debtors. The article provides schemes of banks’ co-operation in the sphere of “non-classic” factoring with accredited factoring companies.

  8. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Kinetics of activation of the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein.

    Science.gov (United States)

    Hoggett, J G; Brierley, I

    1992-11-01

    The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid.

  10. Construction of a mouse model of factor VIII deficiency by gene targeting

    Energy Technology Data Exchange (ETDEWEB)

    Bi, L.; Lawler, A.; Gearhart, J. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)] [and others

    1994-09-01

    To develop a small animal model of hemophilia A for gene therapy experiments, we set out to construct a mouse model for factor VIII deficiency by gene targeting. First, we screened a mouse liver cDNA library using a human FVIII cDNA probe. We cloned a 2.6 Kb partial mouse factor VIII cDNA which extends from 800 base pairs of the 3{prime} end of exon 14 to the 5{prime} end of exon 26. A mouse genomic library made from strain 129 was then screened to obtain genomic fragments covering the exons desired for homologous recombination. Two genomic clones were obtained, and one covering exon 15 through 22 was used for gene targeting. To make gene targeting constructs, a 5.8 Kb genomic DNA fragment covering exons 15 to 19 of the mouse FVIII gene was subcloned, and the neo expression cassette was inserted into exons 16 and 17 separately by different strategies. These two constructs were named MFVIIIC-16 and MFVIIIC-17. The constructs were linearized and transfected into strain 129 mouse ES cells by electroporation. Factor VIII gene-knockout ES cell lines were selected by G-418 and screened by genomic Southern blots. Eight exon 16 targeted cell lines and five exon 17 targeted cell lines were obtained. Three cell lines from each construct were injected into blastocysts and surgically transferred into foster mothers. Multiple chimeric mice with 70-90% hair color derived from the ES-cell genotype were seen with both constructs. Germ line transmission of the ES-cell genotype has been obtained for the MFVIIIC-16 construct, and multiple hemophilia A carrier females have been identified. Factor VIII-deficient males will be conceived soon.

  11. Glioma-secreted soluble factors stimulate microglial activation: The role of interleukin-1β and tumor necrosis factor-α.

    Science.gov (United States)

    Hwang, Ji-Sun; Jung, Eun-Hye; Kwon, Mi-Youn; Han, Inn-Oc

    2016-09-15

    We aimed to elucidate the effect of soluble factors secreted by glioma on microglial activation. Conditioned medium (CM) from glioma cells, CRT-MG and C6, significantly induced nitric oxide (NO) production and stimulated the mRNA expression of inducible NO synthase (iNOS), interleukin (IL)-1beta, IL-6, tumor necrosis factor-alpha (TNF-α) and cyclooxygenase 2 (COX-2) in BV2 cells. Glioma CM stimulated p38 mitogen-activated protein kinase (MAPK) phosphorylation, and a p38 MAPK inhibitor, SB203580, suppressed CM-induced NO production in BV2 cells. In addition, CM stimulated nuclear factor-kappaB (NF-κB) DNA binding and transcriptional activity, which was repressed by SB203580. Gliomas displayed higher mRNA expression and release of TNF-α and IL-1β than primary astrocyte cells. Neutralization of TNF-α and IL-1β in C6-CM using a neutralizing antibody inhibited NO/iNOS expression in BV-2 cells. These results indicate potential contribution of diffusible tumor-derived factors to regulate microglial activation and subsequent tumor microenvironment. Copyright © 2016. Published by Elsevier B.V.

  12. Human β-globin locus control region: Analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice

    International Nuclear Information System (INIS)

    Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.

    1991-01-01

    The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained

  13. Topical application of recombinant activated factor VII during cesarean delivery for placenta previa.

    Science.gov (United States)

    Schjoldager, Birgit T B G; Mikkelsen, Emmeli; Lykke, Malene R; Præst, Jørgen; Hvas, Anne-Mette; Heslet, Lars; Secher, Niels J; Salvig, Jannie D; Uldbjerg, Niels

    2017-06-01

    During cesarean delivery in patients with placenta previa, hemorrhaging after removal of the placenta is often challenging. In this condition, the extraordinarily high concentration of tissue factor at the placenta site may constitute a principle of treatment as it activates coagulation very effectively. The presumption, however, is that tissue factor is bound to activated factor VII. We hypothesized that topical application of recombinant activated factor VII at the placenta site reduces bleeding without affecting intravascular coagulation. We included 5 cases with planned cesarean delivery for placenta previa. After removal of the placenta, the surgeon applied a swab soaked in recombinant activated factor VII containing saline (1 mg in 246 mL) to the placenta site for 2 minutes; this treatment was repeated once if the bleeding did not decrease sufficiently. We documented the treatment on video recordings and measured blood loss. Furthermore, we determined hemoglobin concentration, platelet count, international normalized ratio, activated partial thrombin time, fibrinogen (functional), factor VII:clot, and thrombin generation in peripheral blood prior to and 15 minutes after removal of the placenta. We also tested these blood coagulation variables in 5 women with cesarean delivery planned for other reasons. Mann-Whitney test was used for unpaired data. In all 5 cases, the uterotomy was closed under practically dry conditions and the median blood loss was 490 (range 300-800) mL. There were no adverse effects of recombinant activated factor VII and we did not measure factor VII to enter the circulation. Neither did we observe changes in thrombin generation, fibrinogen, activated partial thrombin time, international normalized ratio, and platelet count in the peripheral circulation (all P values >.20). This study indicates that in patients with placenta previa, topical recombinant activated factor VII may diminish bleeding from the placenta site without initiation

  14. Activation measurements for thermal neutrons. Part J. Evaluation of thermal neutron transmission factors

    International Nuclear Information System (INIS)

    Egbert, Stephen D.

    2005-01-01

    In order to relate thermal neutron activation measurements in samples to the calculated free-in-air thermal neutron activation levels given in Chapter 3, use is made of sample transmission factors. Transmission factors account for the modification of the fluence and activation at each sample's in situ location. For the purposes of this discussion, the transmission factor (TF) is defined as the ratio of the in situ sample activation divided by the free-in-air (FIA) activation at a height of 1 m above ground at the same ground range. The procedures for calculation of TF's and example results are presented in this section. (author)

  15. A biallelic RFLP of the human. alpha. 2-C4 adrenergic receptor gene (ADRA2RL2) localized on the short arm of chromosome 4 and encoding the putative. alpha. 2B receptor is identified with Bsu 36 L using a 1. 5 kb probe (p ADRA2RL2)

    Energy Technology Data Exchange (ETDEWEB)

    Hoeche, M.R.; Berrettini, W.H. (Clinical Neurogenetics Branch, Bethesda, MD (USA)); Regan, J.W. (Duke Univ. Medical Center, Durham, NC (USA))

    1989-12-11

    A 1.5 kb Eco RI cDNA fragment representing the human alpha2-C4 adrenergic receptor (AR) gene encoding the putative alpha2B-AR, containing approximately 1270 bp of the coding and 240 bp of the 3{prime}flanking region, inserted into pSP65, was used as a probe (p ADRA2RL2). This clone was obtained by screening a human kidney lambda GT10 cDNA library with the 0.95 kb Pst I restriction fragment derived from the coding block of the gene for the human platelet alpha2-AR. Hybridization of human genomic DNA digested with Bsu 36 I identifies a two allele polymorphism with bands at 12 kb and 5.8 kb. 20 unrelated North American caucasian subjects were evaluated with frequencies of: A allele, 0.45; B allele, 0.55, heterozygosity (obs), 0.5. This alpha2-AR gene has been mapped in a separation effort in 59 CEPH reference pedigrees to the tip of the short arm of chromosome 4 just proximal to GB (4p 16.3) reported to be linked to the Huntingston's disease gene. Codominant inheritance was observed in seven families with two and three generations, respectively. The number of meioses scored was 95.

  16. Social and Health Factors Associated with Physical Activity among Kuwaiti College Students.

    Science.gov (United States)

    Al-Isa, Abdulwahab Naser; Campbell, Jennifer; Desapriya, Ediriweera; Wijesinghe, Namal

    2011-01-01

    Our aim was to explore the social and health factors that are associated with the level of physical activity among Kuwaiti college students. A random sample of 787 students (48% males and 52% females) was chosen and weight and height were measured to obtain body mass index (BMI, kg/m(2)). Associated social and health factors were obtained using a questionnaire. Those reporting being physically inactive numbered 354 and the remaining 433 were active. Obesity among males was 13% and was 10.5% among females. The social and health factors that were found to be significantly associated with physical activity among the students were gender (P degree (P benefits of being physically active should be instituted to increase the practice of sports and other physical activities in order to control and decrease obesity-related morbidity and mortality.

  17. Time-activity relationships to VOC personal exposure factors

    Science.gov (United States)

    Edwards, Rufus D.; Schweizer, Christian; Llacqua, Vito; Lai, Hak Kan; Jantunen, Matti; Bayer-Oglesby, Lucy; Künzli, Nino

    Social and demographic factors have been found to play a significant role in differences between time-activity patterns of population subgroups. Since time-activity patterns largely influence personal exposure to compounds as individuals move across microenvironments, exposure subgroups within the population may be defined by factors that influence daily activity patterns. Socio-demographic and environmental factors that define time-activity subgroups also define quantifiable differences in VOC personal exposures to different sources and individual compounds in the Expolis study. Significant differences in exposures to traffic-related compounds ethylbenzene, m- and p-xylene and o-xylene were observed in relation to gender, number of children and living alone. Categorization of exposures further indicated time exposed to traffic at work and time in a car as important determinants. Increased exposures to decane, nonane and undecane were observed for males, housewives and self-employed. Categorization of exposures indicated exposure subgroups related to workshop use and living downtown. Higher exposures to 3-carene and α-pinene commonly found in household cleaning products and fragrances were associated with more children, while exposures to traffic compounds ethylbenzene, m- and p-xylene and o-xylene were reduced with more children. Considerable unexplained variation remained in categorization of exposures associated with home product use and fragrances, due to individual behavior and product choice. More targeted data collection methods in VOC exposure studies for these sources should be used. Living alone was associated with decreased exposures to 2-methyl-1-propanol and 1-butanol, and traffic-related compounds. Identification of these subgroups may help to reduce the large amount of unexplained variation in VOC exposure studies. Further they may help in assessing impacts of urban planning that result in changes in behavior of individuals, resulting in shifts in

  18. In vivo bioimaging with tissue-specific transcription factor activated luciferase reporters.

    OpenAIRE

    Buckley, SM; Delhove, JM; Perocheau, DP; Karda, R; Rahim, AA; Howe, SJ; Ward, NJ; Birrell, MA; Belvisi, MG; Arbuthnot, P; Johnson, MR; Waddington, SN; McKay, TR

    2015-01-01

    The application of transcription factor activated luciferase reporter cassettes in vitro is widespread but potential for in vivo application has not yet been realized. Bioluminescence imaging enables non-invasive tracking of gene expression in transfected tissues of living rodents. However the mature immune response limits luciferase expression when delivered in adulthood. We present a novel approach of tissue-targeted delivery of transcription factor activated luciferase reporter lentiviruse...

  19. Model of a ternary complex between activated factor VII, tissue factor and factor IX.

    Science.gov (United States)

    Chen, Shu-wen W; Pellequer, Jean-Luc; Schved, Jean-François; Giansily-Blaizot, Muriel

    2002-07-01

    Upon binding to tissue factor, FVIIa triggers coagulation by activating vitamin K-dependent zymogens, factor IX (FIX) and factor X (FX). To understand recognition mechanisms in the initiation step of the coagulation cascade, we present a three-dimensional model of the ternary complex between FVIIa:TF:FIX. This model was built using a full-space search algorithm in combination with computational graphics. With the known crystallographic complex FVIIa:TF kept fixed, the FIX docking was performed first with FIX Gla-EGF1 domains, followed by the FIX protease/EGF2 domains. Because the FIXa crystal structure lacks electron density for the Gla domain, we constructed a chimeric FIX molecule that contains the Gla-EGF1 domains of FVIIa and the EGF2-protease domains of FIXa. The FVIIa:TF:FIX complex has been extensively challenged against experimental data including site-directed mutagenesis, inhibitory peptide data, haemophilia B database mutations, inhibitor antibodies and a novel exosite binding inhibitor peptide. This FVIIa:TF:FIX complex provides a powerful tool to study the regulation of FVIIa production and presents new avenues for developing therapeutic inhibitory compounds of FVIIa:TF:substrate complex.

  20. Symbiotic Activity of Pea (Pisum sativum after Application of Nod Factors under Field Conditions

    Directory of Open Access Journals (Sweden)

    Anna Siczek

    2014-04-01

    Full Text Available Growth and symbiotic activity of legumes are mediated by Nod factors (LCO, lipo-chitooligosaccharides. To assess the effects of application of Nod factors on symbiotic activity and yield of pea, a two-year field experiment was conducted on a Haplic Luvisol developed from loess. Nod factors were isolated from Rhizobium leguminosarum bv. viciae strain GR09. Pea seeds were treated with the Nod factors (10−11 M or water (control before planting. Symbiotic activity was evaluated by measurements of nitrogenase activity (acetylene reduction assay, nodule number and mass, and top growth by shoot mass, leaf area, and seed and protein yield. Nod factors generally improved pea yield and nitrogenase activity in the relatively dry growing season 2012, but not in the wet growing season in 2013 due to different weather conditions.

  1. Cyclin D3 interacts with human activating transcription factor 5 and potentiates its transcription activity

    International Nuclear Information System (INIS)

    Liu Wenjin; Sun Maoyun; Jiang Jianhai; Shen Xiaoyun; Sun Qing; Liu Weicheng; Shen Hailian; Gu Jianxin

    2004-01-01

    The Cyclin D3 protein is a member of the D-type cyclins. Besides serving as cell cycle regulators, D-type cyclins have been reported to be able to interact with several transcription factors and modulate their transcriptional activations. Here we report that human activating transcription factor 5 (hATF5) is a new interacting partner of Cyclin D3. The interaction was confirmed by in vivo coimmunoprecipitation and in vitro binding analysis. Neither interaction between Cyclin D1 and hATF5 nor interaction between Cyclin D2 and hATF5 was observed. Confocal microscopy analysis showed that Cyclin D3 could colocalize with hATF5 in the nuclear region. Cyclin D3 could potentiate hATF5 transcriptional activity independently of its Cdk4 partner. But Cyclin D1 and Cyclin D2 had no effect on hATF5 transcriptional activity. These data provide a new clue to understand the new role of Cyclin D3 as a transcriptional regulator

  2. Giving Children a Voice: Exploring Qualitative Perspectives on Factors Influencing Recess Physical Activity

    Science.gov (United States)

    Pawlowski, Charlotte Skau; Schipperijn, Jasper; Tjørnhøj-Thomsen, Tine; Troelsen, Jens

    2018-01-01

    Facilitators and barriers to recess physical activity are not well understood. To date, research on recess physical activity has predominantly focused on quantitative measures typically focusing on a narrow set of predefined factors, often constructed by adults. To really understand the factors affecting recess physical activity it is crucial to…

  3. Effect of montelukast on platelet activating factor- and tachykinin induced mucus secretion in the rat

    Directory of Open Access Journals (Sweden)

    Groneberg David A

    2008-02-01

    Full Text Available Abstract Background Platelet activating factor and tachykinins (substance P, neurokinin A, neurokinin B are important mediators contributing to increased airway secretion in the context of different types of respiratory diseases including acute and chronic asthma. Leukotriene receptor antagonists are recommended as add-on therapy for this disease. The cys-leukotriene-1 receptor antagonist montelukast has been used in clinical asthma therapy during the last years. Besides its inhibitory action on bronchoconstriction, only little is known about its effects on airway secretions. Therefore, the aim of this study was to evaluate the effects of montelukast on platelet activating factor- and tachykinin induced tracheal secretory activity. Methods The effects of montelukast on platelet activating factor- and tachykinin induced tracheal secretory activity in the rat were assessed by quantification of secreted 35SO4 labelled mucus macromolecules using the modified Ussing chamber technique. Results Platelet activating factor potently stimulated airway secretion, which was completely inhibited by the platelet activating factor receptor antagonist WEB 2086 and montelukast. In contrast, montelukast had no effect on tachykinin induced tracheal secretory activity. Conclusion Cys-leukotriene-1 receptor antagonism by montelukast reverses the secretagogue properties of platelet activating factor to the same degree as the specific platelet activating factor antagonist WEB 2086 but has no influence on treacheal secretion elicited by tachykinins. These results suggest a role of montelukast in the signal transduction pathway of platelet activating factor induced secretory activity of the airways and may further explain the beneficial properties of cys-leukotriene-1 receptor antagonists.

  4. Factors Associated with Nursing Activities in Humanitarian Aid and Disaster Relief

    Science.gov (United States)

    Noguchi, Norihito; Inoue, Satoshi; Shimanoe, Chisato; Shibayama, Kaoru; Shinchi, Koichi

    2016-01-01

    Background Although nurses play an important role in humanitarian aid and disaster relief (HA/DR), little is known about the nursing activities that are performed in HA/DR. We aimed to clarify the nursing activities performed by Japanese nurses in HA/DR and to examine the factors associated with the frequency of nursing activities. Methods A self-administered questionnaire survey was completed by 147 nurses with HA/DR experience. The survey extracted information on demographic characteristics, past experience (e.g., disaster medical training experience, HA/DR experience), circumstances surrounding their dispatched to HA/DR (e.g., team size, disaster type, post-disaster phase, mission term), and the frequency of nursing activities performed under HA/DR. The frequency of nursing activities was rated on a 5-point Likert scale. Evaluation of nursing activities was conducted based on the “nursing activity score”, which represents the frequency of each nursing activity. Factors related to the nursing activity score were evaluated by multiple logistic regression analysis. Results Nurses were involved in 27 nursing activities in HA/DR, 10 of which were performed frequently. On analysis, factors significantly associated with nursing activity score were nursing license as a registered nurse (OR 7.79, 95% CI 2.95–20.57), two or more experiences with disaster medical training (OR 2.90 95%, CI 1.12–7.49) and a post-disaster phase of three weeks or longer (OR 8.77, 95% CI 2.59–29.67). Conclusions These results will contribute to the design of evidence-based disaster medical training that improves the quality of nursing activities. PMID:26959351

  5. Evaluation of the purified fraction of Wilbrandia (c. f. verticillata for antitumour activity

    Directory of Open Access Journals (Sweden)

    V. S. N. Rao

    1991-01-01

    Full Text Available Cucurbatacins are known to produce cytotoxic and anticancer activities. Two novel norcucurbitacin glucosides (Wvl and Wv2 have recently been isolated from a purified fraction obtained from the rhizome of Wilbrandia verticillata. The present study evaluates the cytotoxic and anti-tumour activities of the norcucurbitacins. We have found a regular cytotoxicity in KB cells (Cy50 = 12µg/ml as well as a significant inhibition in the Walker 256 carcinosarcoma growth (approximately 75%.

  6. Symbiotic Activity of Pea (Pisum sativum) after Application of Nod Factors under Field Conditions

    OpenAIRE

    Siczek, Anna; Lipiec, Jerzy; Wielbo, Jerzy; Kidaj, Dominika; Szarlip, Paweł

    2014-01-01

    Growth and symbiotic activity of legumes are mediated by Nod factors (LCO, lipo-chitooligosaccharides). To assess the effects of application of Nod factors on symbiotic activity and yield of pea, a two-year field experiment was conducted on a Haplic Luvisol developed from loess. Nod factors were isolated from Rhizobium leguminosarum bv. viciae strain GR09. Pea seeds were treated with the Nod factors (10−11 M) or water (control) before planting. Symbiotic activity was evaluated by measurement...

  7. Mechanism of action of recombinant activated factor VII: an update.

    Science.gov (United States)

    Hedner, Ulla

    2006-01-01

    Bleeding episodes in patients with hemophilia and inhibitors must be managed using agents that are hemostatically active in the absence of factor VIII or IX. Activated prothrombin complex concentrates have long been used in this context. However, the search for safer and more effective agents has led to the development of recombinant activated factor VII (rFVIIa; NovoSeven, Novo Nordisk, Bagsvaerd, Denmark). This paper presents an update on the mechanism of action of rFVIIa, and describes how pharmacologic doses of this agent enhance thrombin production and thus contribute to the development of a stable, lysis-resistant fibrin plug at the site of vessel damage. This mechanism explains the reported efficacy of rFVIIa in a range of clinical situations characterized by impaired thrombin generation.

  8. Prdm9 Controls Activation of Mammalian Recombination Hotspots

    OpenAIRE

    Parvanov, Emil D.; Petkov, Petko M.; Paigen, Kenneth

    2009-01-01

    Mammalian meiotic recombination, which preferentially occurs at specialized sites called hotspots, assures the orderly segregation of meiotic chromosomes and creates genetic variation among offspring. A locus on mouse Chr 17, that controls activation of recombination at multiple distant hotspots, has been mapped within a 181 Kb interval, three of whose genes can be eliminated as candidates. The remaining gene, Prdm9, codes for a zinc finger containing histone H3K4 trimethylase that is uniquel...

  9. Giving children a voice: Exploring qualitative perspectives on factors influencing recess physical activity

    DEFF Research Database (Denmark)

    Pawlowski, Charlotte Skau; Schipperijn, Jasper; Tjørnhøj-Thomsen, Tine

    2018-01-01

    Facilitators and barriers to recess physical activity are not well understood. To date, research on recess physical activity has predominantly focused on quantitative measures typically focusing on a narrow set of predefined factors, often constructed by adults. To really understand the factors...... 11–12-year-old children. The socio-ecological model was used as the overall theoretical framework. Twelve factors were identified as influencing the children’s recess physical activity: bodily self-esteem and ability; gender; gendered school culture; peer influence; conflicts and exclusion; space...... and place experiences; lack of play facilities; outdoor play policy; use of electronic devices; recess duration; organised activities; and weather. These factors were located within different layers of the socio-ecological model, but were interdependent. The findings speak for implementing a combination...

  10. Synthesis and characterization of 18F-labeled active site inhibited factor VII (ASIS)

    DEFF Research Database (Denmark)

    Erlandsson, Maria; Nielsen, Carsten Haagen; Jeppesen, Troels Elmer

    2015-01-01

    Activated factor VII blocked in the active site with Phe-Phe-Arg-chloromethyl ketone (active site inhibited factor VII (ASIS)) is a 50-kDa protein that binds with high affinity to its receptor, tissue factor (TF). TF is a transmembrane glycoprotein that plays an important role in, for example......, thrombosis, metastasis, tumor growth, and tumor angiogenesis. The aim of this study was to develop an 18F-labeled ASIS derivative to assess TF expression in tumors. Active site inhibited factor VII was labeled using N-succinimidyl-4-[18F]fluorobenzoate, and the [18F]ASIS was purified on a PD-10 desalting...... column. The radiochemical yield was 25 ± 6%, the radiochemical purity was >97%, and the pseudospecific radioactivity was 35 ± 9 GBq/µmol. The binding efficacy was evaluated in pull-down experiments, which monitored the binding of unlabeled ASIS and [18F]ASIS to TF and to a specific anti-factor VII...

  11. Cloning and functional analysis of human mTERFL encoding a novel mitochondrial transcription termination factor-like protein

    International Nuclear Information System (INIS)

    Chen Yao; Zhou Guangjin; Yu Min; He Yungang; Tang Wei; Lai Jianhua; He Jie; Liu Wanguo; Tan Deyong

    2005-01-01

    Serum plays an important role in the regulation of cell cycle and cell growth. To identify novel serum-inhibitory factors and study their roles in cell cycle regulation, we performed mRNA differential display analysis of U251 cells in the presence or absence of serum and cloned a novel gene encoding the human mitochondrial transcription termination factor-like protein (mTERFL). The full-length mTERFL cDNA has been isolated and the genomic structure determined. The mTERFL gene consists of three exons and encodes 385 amino acids with 52% sequence similarity to the human mitochondrial transcription termination factor (mTERF). However, mTERFL and mTERF have an opposite expression pattern in response to serum. The expression of mTERFL is dramatically inhibited by the addition of serum in serum-starved cells while the mTERF is rather induced. Northern blot analysis detected three mTERFL transcripts of 1.7, 3.2, and 3.5 kb. Besides the 3.2 kb transcript that is unique to skeletal muscle, other two transcripts express predominant in heart, liver, pancreas, and skeletal muscle. Expression of the GFP-mTERFL fusion protein in HeLa cells localized it to the mitochondria. Furthermore, ectopic expression of mTERFL suppresses cell growth and arrests cells in the G1 stage demonstrated by MTT and flow cytometry analysis. Collectively, our data suggest that mTERFL is a novel mTERF family member and a serum-inhibitory factor probably participating in the regulation of cell growth through the modulation of mitochondrial transcription

  12. Immobilisation of homogeneous olefin polymerisation catalysts. Factors influencing activity and stability

    NARCIS (Netherlands)

    Severn, J.R.; Chadwick, J.C.

    2013-01-01

    The activity and stability of homogeneous olefin polymerisation catalysts, when immobilised on a support, are dependent on both chemical and physical effects. Chemical factors affecting catalyst activity include the ease of formation of the active species, which is strongly dependent on the

  13. Antiandrogenic activity of phthalate mixtures: Validity of concentration addition

    International Nuclear Information System (INIS)

    Christen, Verena; Crettaz, Pierre; Oberli-Schrämmli, Aurelia; Fent, Karl

    2012-01-01

    Phthalates and bisphenol A have very widespread use leading to significant exposure of humans. They are suspected to interfere with the endocrine system, including the androgen, estrogen and the thyroid hormone system. Here we analyzed the antiandrogenic activity of six binary, and one ternary mixture of phthalates exhibiting complete antiandrogenic dose–response curves, and binary mixtures of phthalates and bisphenol A at equi-effective concentrations of EC 10 , EC 25 and EC 50 in MDA-kb2 cells. Mixture activity followed the concentration addition (CA) model with a tendency to synergism at high and antagonism at low concentrations. Isoboles and the toxic unit approach (TUA) confirmed the additive to synergistic activity of the binary mixtures BBP + DBP, DBP + DEP and DEP + BPA at high concentrations. Both methods indicate a tendency to antagonism for the EC 10 mixtures BBP + DBP, BBP + DEP and DBP + DEP, and the EC 25 mixture of DBP + BPA. A ternary mixture revealed synergism at the EC 50 , and weak antagonistic activity at the EC 25 level by the TUA. A mixture of five phthalates representing a human urine composition and reflecting exposure to corresponding parent compounds showed no antiandrogenic activity. Our study demonstrates that CA is an appropriate concept to account for mixture effects of antiandrogenic phthalates and bisphenol A. The interaction indicates a departure from additivity to antagonism at low concentrations, probably due to interaction with the androgen receptor and/or cofactors. This study emphasizes that a risk assessment of phthalates should account for mixture effects by applying the CA concept. -- Highlights: ► Antiandrogenic activity of mixtures of 2 and 3 phthalates are assessed in MDA-kb2 cells. ► Mixture activities followed the concentration addition model. ► A tendency to synergism at high and antagonism at low levels occurred.

  14. Antiandrogenic activity of phthalate mixtures: Validity of concentration addition

    Energy Technology Data Exchange (ETDEWEB)

    Christen, Verena [University of Applied Sciences Northwestern Switzerland, School of Life Sciences, Gründenstrasse 40, CH-4132 Muttenz (Switzerland); Crettaz, Pierre; Oberli-Schrämmli, Aurelia [Swiss Federal Office of Public Health, Division Chemical Products, 3003 Bern (Switzerland); Fent, Karl, E-mail: karl.fent@bluewin.ch [University of Applied Sciences Northwestern Switzerland, School of Life Sciences, Gründenstrasse 40, CH-4132 Muttenz (Switzerland); Swiss Federal Institute of Technology Zürich (ETH Zürich), Department of Environmental Sciences, 8092 Zürich (Switzerland)

    2012-03-01

    Phthalates and bisphenol A have very widespread use leading to significant exposure of humans. They are suspected to interfere with the endocrine system, including the androgen, estrogen and the thyroid hormone system. Here we analyzed the antiandrogenic activity of six binary, and one ternary mixture of phthalates exhibiting complete antiandrogenic dose–response curves, and binary mixtures of phthalates and bisphenol A at equi-effective concentrations of EC{sub 10}, EC{sub 25} and EC{sub 50} in MDA-kb2 cells. Mixture activity followed the concentration addition (CA) model with a tendency to synergism at high and antagonism at low concentrations. Isoboles and the toxic unit approach (TUA) confirmed the additive to synergistic activity of the binary mixtures BBP + DBP, DBP + DEP and DEP + BPA at high concentrations. Both methods indicate a tendency to antagonism for the EC{sub 10} mixtures BBP + DBP, BBP + DEP and DBP + DEP, and the EC{sub 25} mixture of DBP + BPA. A ternary mixture revealed synergism at the EC{sub 50}, and weak antagonistic activity at the EC{sub 25} level by the TUA. A mixture of five phthalates representing a human urine composition and reflecting exposure to corresponding parent compounds showed no antiandrogenic activity. Our study demonstrates that CA is an appropriate concept to account for mixture effects of antiandrogenic phthalates and bisphenol A. The interaction indicates a departure from additivity to antagonism at low concentrations, probably due to interaction with the androgen receptor and/or cofactors. This study emphasizes that a risk assessment of phthalates should account for mixture effects by applying the CA concept. -- Highlights: ► Antiandrogenic activity of mixtures of 2 and 3 phthalates are assessed in MDA-kb2 cells. ► Mixture activities followed the concentration addition model. ► A tendency to synergism at high and antagonism at low levels occurred.

  15. Urokinase-type plasminogen activator receptor (uPAR), tissue factor (TF) and epidermal growth factor receptor (EGFR)

    DEFF Research Database (Denmark)

    Christensen, Anders; Kiss, Katalin; Lelkaitis, Giedrius

    2017-01-01

    Background: Tumor-specific biomarkers are a prerequisite for the development of targeted imaging and therapy in oral squamous cell carcinoma (OSCC). urokinase-type Plasminogen Activator Receptor (uPAR), Tissue Factor (TF) and Epidermal Growth Factor Receptor (EGFR) are three biomarkers that exhib...... with a reduced survival. uPAR seems to be a prognostic biomarker in oral cancer....

  16. ANALYSIS OF THE EXTERNAL FACTORS OF INFLUENCE ON INNOVATION ACTIVITY OF AN INDUSTRIAL ENTERPRISE

    Directory of Open Access Journals (Sweden)

    I. A. Salikov

    2014-01-01

    Full Text Available Summary. For successful functioning and development of the enterprise is a need to strive as possible deeper and more dynamic influence on parameters and objects OK-environmental management, primarily due to increase their innovation activity. Innovative activity of enterprises influenced by many factors. They can be classified on the factors of direct influence (micro and factors of indirect impacts (macro. Factors of direct impact of the influence on the pace and scale of development of the enterprise, on its effectiveness, because the whole spectrum of these factors acts as a limiter. Macro factors create the General conditions of existence of the enterprise in the external environment. To analyses these factors approach was used to SNW-analysis. As a result of analysis, factors of micro and macro-were classified on: stimulating, it minesweepers and dissuasive. Also studied were the degree of influence of these factors on the innovative activity of the enterprise. Reviewed rating factors hindering the development of innovation activity of industrial enterprise in Russia. In the result of which identified factors that hinder the development of innovative activity, and justified in the direction of overcoming them. It should be noted that the distinction between enabling and constraining factors is rather thin and conditional. So, the factors initially restraining innovation, at a certain point can be transformed into a stimulus for its development. Accounting for these factors, creation of necessary conditions and introduction of innovations in various aspects of the functioning of industrial enterprises will allow them to provide competitor-term benefits and sustainable development in a rapidly changing environment and the external environment.

  17. Diisononyl phthalate aggravates allergic dermatitis by activation of NF-kB.

    Science.gov (United States)

    Kang, Jun; Song, Jing; Shen, Shiping; Li, Baizhan; Yang, Xu; Chen, Mingqing

    2016-12-20

    Several epidemiological studies have suggested a possible link between exposure to Diisononyl phthalate (DINP) and the development of allergies. These findings remain controversial since there is insufficient scientific evidence to assess the ability of DINP to influence allergic immune responses. In addition, the mechanisms behind DINP-caused allergic diseases have not been fully elucidated. In this study, Balb/c mice were orally exposed to DINP for 3 weeks and were then sensitized with fluorescein isothiocyanate (FITC). We showed that oral exposure to DINP could aggravate allergic-dermatitis-like lesions, indicated by an increase in the number of mast cells, and in increased skin edema in FITC-induced contact hypersensitivity. This deterioration was concomitant with increased total serum immunoglobulin-E and Th2 cytokines. We determined the oxidative damage and the activation of nuclear factor-kb (NF-kB). The data demonstrated that DINP could promote oxidative damage and the activation of NF-kB in the skin. The expression of thymic stromal lymphopoietin and the activation of signal transducer and activator of transcriptions 3, 5 and 6 were enhanced concomitant with exacerbated allergic dermatitis effects and the activation of NF-kB induced by DINP. These effects were alleviated by pyrollidine dithiocarbamate, an inhibitor of NF-kB. The results suggest that oral exposure to DINP aggravated allergic contact dermatitis, which was positively regulated via NF-kB.

  18. Estudo histoquímico comparativo da matriz extracelular dc tumores primários e metastáticos em ratos nude xenotransplantados com células KB

    Directory of Open Access Journals (Sweden)

    Terezinha Regina Prúpere Ogata

    1997-08-01

    Full Text Available Estudou-se comparativamente, através de métodos histoquímicos, a expressão dos componentes da matriz extracelular de tumores primitivos e metastáticos em ratos nude, xenotransplantados com células KB. Em ambas as neoplasias observou-se uma variabilidade tanto qualitativa como quantitativa dos componentes matriciais, coexistência de diferentes tipos de fibras, pouca representatividade de fibras elásticas de glicosaminoglicanas ácidas e sulfatadas e de polissacarídeos neutros, além da ausência de membrana basal.

  19. Determination of calibration factors for field measurements of liquid and gaseous activities

    International Nuclear Information System (INIS)

    Jose, M.T.; Ravi, T.; Raghunath, V.M.

    1994-01-01

    While working out the procedures for calibration and activity estimation of 41 Ar gaseous effluent earlier, it was felt necessary to obtain similar factors for liquid and gas activity measurements for other energies also. The paper describes the work done towards this and the conversion factors and minimum detectable levels established. (author). 3 tabs., 1 ref

  20. Effects of taxol and ionizing radiation on cytotoxicity and prostaglandin production in KB, RPMI-2650, SW-13 and L929

    International Nuclear Information System (INIS)

    Lee, Keon Il; Yoo, Dong Soo

    1998-01-01

    The author evaluated the effects of taxol, a microtubular inhibitor, as a possible radiation sensitizer and the production of prostaglandins on three human cancer cell lines (KB, RPMI-2650 and SW-13) and one murine cell line (L929). Each cell line was divided into four groups (control, taxol only, radiation only and combination of taxol and radiation). The treatment consisted of a single irradiation of 10 Gy and graded doses (5, 50, 100, 200, 300, 500 nM) of taxol for a 24-h period. The cytotoxicity of taxol alone was measured at 1 day after (1-day group) and 4 days after (4-day group) the treatment. The survival ratio of cell was analyzed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyl tetrazolium bromide) test. Prostaglandins (PGE2 and PGI2) were measured in the culture medium by a radioimmunoassay. The results obtained were as follows ; 1. There was a significantly in creased cytotoxicity of KB cells in 4-day group than those in 1-day group. There was a high correlation between doses of taxol and cell viability in both groups (1-day group R=0.82741, 4-day group R=0.84655). 2. There was a significantly increased cytotoxicity of RPMI-2650 cells treated with high concentration of taxol in 4-day group than those in 1-day group. Also there was a high correlation between doses of taxol and cell viability in 4-day group (R=0.93917). 3. There was a significantly increased cytotoxicity of SW-13 cell treated with high concentration of taxol in 4-day group than those in 1-day group. However no high correlation was observed between doses of taxol and cell viability in both groups (1-day group R=0.46362, 4-day group R=0.65425). 4. There was a significantly increased cytotoxicity of L929 cells treated with low concentration of taxol in 4-day group than those in 1-day group. At the same time, there was a low correlation between doses of taxol and cell viability in both groups (1-day group R=0.34237, 4-day group R=0.23381). 5. In 1-day group of L929 cells, higher

  1. Analysis of gene and protein name synonyms in Entrez Gene and UniProtKB resources

    KAUST Repository

    Arkasosy, Basil

    2013-05-11

    Ambiguity in texts is a well-known problem: words can carry several meanings, and hence, can be read and interpreted differently. This is also true in the biological literature; names of biological concepts, such as genes and proteins, might be ambiguous, referring in some cases to more than one gene or one protein, or in others, to both genes and proteins at the same time. Public biological databases give a very useful insight about genes and proteins information, including their names. In this study, we made a thorough analysis of the nomenclatures of genes and proteins in two data sources and for six different species. We developed an automated process that parses, extracts, processes and stores information available in two major biological databases: Entrez Gene and UniProtKB. We analysed gene and protein synonyms, their types, frequencies, and the ambiguities within a species, in between data sources and cross-species. We found that at least 40% of the cross-species ambiguities are caused by names that are already ambiguous within the species. Our study shows that from the six species we analysed (Homo Sapiens, Mus Musculus, Arabidopsis Thaliana, Oryza Sativa, Bacillus Subtilis and Pseudomonas Fluorescens), rice (Oriza Sativa) has the best naming model in Entrez Gene database, with low ambiguities between data sources and cross-species.

  2. [Physical activity and cardiovascular risk factors among Chilean young men and women].

    Science.gov (United States)

    Arteaga, Antonio; Bustos, Patricia; Soto, Rodrigo; Velasco, Nicolás; Amigo, Hugo

    2010-10-01

    Physical activity (PA) has a protective role in cardiovascular diseases. To quantify PA in young adults and to correlate it with cardiovascular risk factors. A cross-sectional study was performed employing the international physical activity questionnaire (IPAQ), to measure the PA of 983 randomly selected young adults from Valparaiso region born between 1974 and 1978. Its results were associated with levels of obesity, insulin resistance and cardiovascular risk factors defined by the National Cholesterol Education Program-Adult Treatment Panel III (NCEP- ATP III) RESULTS: Mean physical activity among men and women was 3731 ± 3923 and 1360 ± 2303 METs-minutes/week, respectively (p women and 21.5% of men had an insufficient level of physical activity (p men and 23.4% of women had an intense level of physical activity (p physical activity and insulin resistance. A high physical activity was protective, specially among men, against a low HDL cholesterol level and high triglyceride levels with Odds Ratios of 0.59 (confidence interval (CI): 0,35-0.98) and 0.49 (CI: 0,27-0,87) respectively, after adjusting for body mass index and age. In this sample, men had higher levels of physical activity, that was protective against insulin resistance and the presence of cardiovascular risk factors.

  3. Evaluating the Factors that Activate the Development of Public-Private Partnership in Foreign Economic Activity

    Directory of Open Access Journals (Sweden)

    Pyroh Olha V.

    2017-12-01

    Full Text Available The article is concerned with research on public-private partnership in foreign economic activity as process of interaction of the State and business-structures – entities of economic activity of Ukraine along with foreign entities of economic activity, this process includes attraction of investments, acceleration of economic development, etc. The factors determining public-private partnership in the foreign economic sphere (system of the State government bodies, system of economic relations in the State, financial resources of various States, experience in the implementation of public-private partnership projects, trust between partners are researched and generalized. Influence of each of the factors was defined by means of conjunctive analysis, determining that the system of economic relations in the State is most influenced by the formation of conditions, rules and implementation of principles of functioning of public-private partnership in the foreign economic sphere.

  4. Polysaccharides from the fungus Scleroderma nitidum with anti-inflammatory potential modulate cytokine levels and the expression of Nuclear Factor kB

    Directory of Open Access Journals (Sweden)

    Marília S. Nascimento

    2012-02-01

    Full Text Available Several pharmacological properties are attributed to polysaccharides and glucans derived from fungi such as tumor, anti-inflammatory, and immunomodulatory activity. In this work, the anti-inflammatory potential of polysaccharides from the fungus Scleroderma nitidum and their possible action mechanism were studied. The effect of these polymers on the inflammatory process was tested using the carrageenan and histamine-induced paw edema model and the sodium thioglycolate and zymosan-induced model. The polysaccharides from S. nitidum were effective in reducing edema (73% at 50 mg/kg and cell infiltrate (37% at 10 mg/kg in both inflammation models tested. Nitric oxide, a mediator in the inflammatory process, showed a reduction of around 26% at 10 mg/kg of body weight. Analysis of pro-and anti-inflammatory cytokines showed that in the groups treated with polysaccharides from S. nitidum there was an increase in cytokines such as IL-1ra, IL-10, and MIP-1β concomitant with the decrease in INF-γ (75% and IL-2 (22%. We observed the influence of polysaccharides on the modulation of the expression of nuclear factor κB. This compound reduced the expression of NF-κB by up to 64%. The results obtained suggest that NF-κB modulation an mechanisms that explain the anti-inflammatory effect of polysaccharides from the fungus S. nitidum.

  5. Social and Health Factors Associated with Physical Activity among Kuwaiti College Students

    Directory of Open Access Journals (Sweden)

    Abdulwahab Naser Al-Isa

    2011-01-01

    Full Text Available Our aim was to explore the social and health factors that are associated with the level of physical activity among Kuwaiti college students. A random sample of 787 students (48% males and 52% females was chosen and weight and height were measured to obtain body mass index (BMI, kg/m2. Associated social and health factors were obtained using a questionnaire. Those reporting being physically inactive numbered 354 and the remaining 433 were active. Obesity among males was 13% and was 10.5% among females. The social and health factors that were found to be significantly associated with physical activity among the students were gender (P<.001, marital status (P<.05, BMI category (obese or nonobese (P<.05, last dental and health checkup (P<.01, desiring a higher degree (P<.001, and countries preferred for visiting (P<.01. Males significantly exceeded females in the practice of physical activity. In conclusion, behavioural modifications, intervention studies, and health education touting the benefits of being physically active should be instituted to increase the practice of sports and other physical activities in order to control and decrease obesity-related morbidity and mortality.

  6. Novel tumor necrosis factor-responsive mammalian neutral sphingomyelinase-3 is a C-tail-anchored protein.

    Science.gov (United States)

    Krut, Oleg; Wiegmann, Katja; Kashkar, Hamid; Yazdanpanah, Benjamin; Krönke, Martin

    2006-05-12

    Two genes encoding neutral sphingomyelinases-1 and -2 (sphingomyelin phosphodiesterases-2 and -3) have been recently identified that hydrolyze sphingomyelin to phosphorylcholine and ceramide. Data bank searches using a peptide sequence derived from a previously purified bovine neutral sphingomyelinase (nSMase) allowed us to identify a cDNA encoding a novel human sphingomyelinase, nSMase3, that shows only a little homology to nSMase1 and -2. nSMase3 was biochemically characterized by overexpression in a yeast strain, JK9-3ddeltaIsc1p, lacking endogenous SMase activity. Similar to nSMase2, nSMase3 is Mg2+-dependent and shows optimal activity at pH 7, which is enhanced in the presence of phosphatidylserine and inhibited by scyphostatin. nSMase3 is ubiquitously expressed as a 4.6-kb mRNA species. nSMase3 lacks an N-terminal signal peptide, yet contains a 23-amino-acid transmembrane domain close to the C terminus, which is indicative for the family of C-tail-anchored integral membrane proteins. Cellular localization studies with hemagglutinin-tagged nSMase3 demonstrated colocalization with markers of the endoplasmic reticulum as well as with Golgi markers. Tumor necrosis factor stimulates rapid activation of nSMase3 in MCF7 cells with peak activity at 1.5 min, which was impaired by expression of dominant negative FAN.

  7. An increase in circulating B cell-activating factor in childhood-onset ocular myasthenia gravis.

    Science.gov (United States)

    Motobayashi, Mitsuo; Inaba, Yuji; Nishimura, Takafumi; Kobayashi, Norimoto; Nakazawa, Yozo; Koike, Kenichi

    2015-04-01

    Myasthenia gravis is a B cell-mediated autoimmune disorder. The pathophysiology of childhood-onset ocular myasthenia gravis remains unclear. We investigated serum B cell-activating factor levels and other immunological parameters in child patients with ocular myasthenia gravis. Blood samples were obtained from 9 children with ocular myasthenia gravis and 20 age-matched controls. We assayed serum concentrations of B cell-activating factor, anti-acetylcholine receptor antibody titers, 7 types of cytokines (interleukins-2, -4, -6, -10, and -17A; interferon-γ; tumor necrosis factor-α) as well as the percentages of peripheral blood CD4+, CD8+, and CD19+ cells. Serum B cell-activating factor levels were significantly higher before immunosuppressive therapy in patients with childhood-onset ocular myasthenia gravis than in controls and decreased after immunosuppressive therapy. A significant positive correlation was observed between serum B cell-activating factor levels and anti-acetylcholine receptor antibody titers in patients with myasthenia gravis. Serum B cell-activating factor concentrations did not correlate with the percentages of CD4+, CD8+, and CD19+ cells or the CD4+/CD8+ ratio. No significant differences were observed in the levels of the 7 different types of cytokines examined, including interleukin-17A, between preimmunosuppressive therapy myasthenia gravis patients and controls. Circulating B cell-activating factor may play a key role in the pathophysiology of childhood-onset ocular myasthenia gravis. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Mechanisms of integrin-vascular endothelial growth factor receptor cross-activation in angiogenesis.

    Science.gov (United States)

    Mahabeleshwar, Ganapati H; Feng, Weiyi; Reddy, Kumar; Plow, Edward F; Byzova, Tatiana V

    2007-09-14

    The functional responses of endothelial cells are dependent on signaling from peptide growth factors and the cellular adhesion receptors, integrins. These include cell adhesion, migration, and proliferation, which, in turn, are essential for more complex processes such as formation of the endothelial tube network during angiogenesis. This study identifies the molecular requirements for the cross-activation between beta3 integrin and tyrosine kinase receptor 2 for vascular endothelial growth factor (VEGF) receptor (VEGFR-2) on endothelium. The relationship between VEGFR-2 and beta3 integrin appears to be synergistic, because VEGFR-2 activation induces beta3 integrin tyrosine phosphorylation, which, in turn, is crucial for VEGF-induced tyrosine phosphorylation of VEGFR-2. We demonstrate here that adhesion- and growth factor-induced beta3 integrin tyrosine phosphorylation are directly mediated by c-Src. VEGF-stimulated recruitment and activation of c-Src and subsequent beta3 integrin tyrosine phosphorylation are critical for interaction between VEGFR-2 and beta3 integrin. Moreover, c-Src mediates growth factor-induced beta3 integrin activation, ligand binding, beta3 integrin-dependent cell adhesion, directional migration of endothelial cells, and initiation of angiogenic programming in endothelial cells. Thus, the present study determines the molecular mechanisms and consequences of the synergism between 2 cell surface receptor systems, growth factor receptor and integrins, and opens new avenues for the development of pro- and antiangiogenic strategies.

  9. Survivin counteracts the therapeutic effect of microtubule de-stabilizers by stabilizing tubulin polymers

    Directory of Open Access Journals (Sweden)

    Hsieh Hsing-Pang

    2009-07-01

    Full Text Available Abstract Background Survivin is a dual function protein. It inhibits the apoptosis of cells by inhibiting caspases, and also promotes cell growth by stabilizing microtubules during mitosis. Over-expression of survivin has been demonstrated to induce drug-resistance to various chemo-therapeutic agents such as cisplatin (DNA damaging agent and paclitaxel (microtubule stabilizer in cancers. However, survivin-induced resistance to microtubule de-stabilizers such as Vinca alkaloids and Combretastatin A-4 (CA-4-related compounds were seldom demonstrated in the past. Furthermore, the question remains as to whether survivin plays a dominant role in processing cytokinesis or inhibiting caspases activity in cells treated with anti-mitotic compounds. The purpose of this study is to evaluate the effect of survivin on the resistance and susceptibility of human cancer cells to microtubule de-stabilizer-induced cell death. Results BPR0L075 is a CA-4 analog that induces microtubule de-polymerization and subsequent caspase-dependent apoptosis. To study the relationship between the expression of survivin and the resistance to microtubule de-stabilizers, a KB-derived BPR0L075-resistant cancer cell line, KB-L30, was generated for this study. Here, we found that survivin was over-expressed in the KB-L30 cells. Down-regulation of survivin by siRNA induced hyper-sensitivity to BPR0L075 in KB cells and partially re-stored sensitivity to BPR0L075 in KB-L30 cells. Western blot analysis revealed that down-regulation of survivin induced microtubule de-stabilization in both KB and KB-L30 cells. However, the same treatment did not enhance the down-stream caspase-3/-7 activities in BPR0L075-treated KB cells. Translocation of a caspase-independent apoptosis-related molecule, apoptosis-inducing factor (AIF, from cytoplasm to the nucleus was observed in survivin-targeted KB cells under BPR0L075 treatment. Conclusion In this study, survivin plays an important role in the

  10. Tissue Factor-Expressing Tumor-Derived Extracellular Vesicles Activate Quiescent Endothelial Cells via Protease-Activated Receptor-1

    Directory of Open Access Journals (Sweden)

    Sara P. Y. Che

    2017-11-01

    Full Text Available Tissue factor (TF-expressing tumor-derived extracellular vesicles (EVs can promote metastasis and pre-metastatic niche formation, but the mechanisms by which this occurs remain largely unknown. We hypothesized that generation of activated factor X (FXa by TF expressed on tumor-derived EV could activate protease-activated receptors (PARs on non-activated endothelial cells to induce a pro-adhesive and pro-inflammatory phenotype. We obtained EV from TF-expressing breast (MDA-MB-231 and pancreatic (BxPC3 and Capan-1 tumor cell lines. We measured expression of E-selectin and secretion of interleukin-8 (IL-8 in human umbilical vein endothelial cells after exposure to EV and various immunologic and chemical inhibitors of TF, FXa, PAR-1, and PAR-2. After 6 h of exposure to tumor-derived EV (pretreated with factor VIIa and FX in vitro, endothelial cells upregulated E-selectin expression and secreted IL-8. These changes were decreased with an anti-TF antibody, FXa inhibitors (FPRCK and EGRCK, and PAR-1 antagonist (E5555, demonstrating that FXa generated by TF-expressing tumor-derived EV was signaling through endothelial PAR-1. Due to weak constitutive PAR-2 expression, these endothelial responses were not induced by a PAR-2 agonist peptide (SLIGKV and were not inhibited by a PAR-2 antagonist (FSLLRY after exposure to tumor-derived EV. In conclusion, we found that TF-expressing cancer-derived EVs activate quiescent endothelial cells, upregulating E-selectin and inducing IL-8 secretion through generation of FXa and cleavage of PAR-1. Conversion of resting endothelial cells to an activated phenotype by TF-expressing cancer-derived EV could promote cancer metastases.

  11. Engineering blood meal-activated systemic immunity in the yellow fever mosquito, Aedes aegypti.

    Science.gov (United States)

    Kokoza, V; Ahmed, A; Cho, W L; Jasinskiene, N; James, A A; Raikhel, A

    2000-08-01

    Progress in molecular genetics makes possible the development of alternative disease control strategies that target the competence of mosquitoes to transmit pathogens. We tested the regulatory region of the vitellogenin (Vg) gene of Aedes aegypti for its ability to express potential antipathogen factors in transgenic mosquitoes. Hermes-mediated transformation was used to integrate a 2.1-kb Vg-promoter fragment driving the expression of the Defensin A (DefA) coding region, one of the major insect immune factors. PCR amplification of genomic DNA and Southern blot analyses, carried out through the ninth generation, showed that the Vg-DefA transgene insertion was stable. The Vg-DefA transgene was strongly activated in the fat body by a blood meal. The mRNA levels reached a maximum at 24-h postblood meal, corresponding to the peak expression time of the endogenous Vg gene. High levels of transgenic defensin were accumulated in the hemolymph of bloodfed female mosquitoes, persisting for 20-22 days after a single blood feeding. Purified transgenic defensin showed antibacterial activity comparable to that of defensin isolated from bacterially challenged control mosquitoes. Thus, we have been able to engineer the genetically stable transgenic mosquito with an element of systemic immunity, which is activated through the blood meal-triggered cascade rather than by infection. This work represents a significant step toward the development of molecular genetic approaches to the control of vector competence in pathogen transmission.

  12. 78 FR 46418 - Proposed Information Collection (Obligation To Report Factors Affecting Entitlement) Activity...

    Science.gov (United States)

    2013-07-31

    ... (Obligation To Report Factors Affecting Entitlement) Activity; Comment Request AGENCY: Veterans Benefits... use of other forms of information technology. Title: Obligation to Report Factors Affecting... entitlement factors. Individual factors such as income, marital status, and the beneficiary's number of...

  13. In vitro effects of recombinant activated factor VII on thrombin generation and coagulation following inhibition of platelet procoagulant activity by prasugrel.

    Science.gov (United States)

    Mazzeffi, Michael; Szlam, Fania; Jakubowski, Joseph A; Tanaka, Kenichi A; Sugidachi, Atsuhiro; Levy, Jerrold H

    2013-07-01

    Prasugrel is a thienopyridyl P2Y12 antagonist with potent antiplatelet effects. At present, little is known about its effects on thrombin generation or what strategies may emergently reverse its anticoagulant effects. In the current study we evaluated whether recombinant activated factor VII may reverse prasugrel induced effects and increase thrombin generation in an in vitro model. The effect of prasugrel active metabolite, PAM (R-138727), was evaluated on platelet aggregation, thrombin generation, and rotational thromboelastometry parameters using blood from 20 healthy volunteers. Additionally, we evaluated the effects of adenosine diphosphate (ADP) and recombinant activated factor VII on restoring these parameters towards baseline values. PAM reduced maximum platelet aggregation and led to platelet disaggregation. It also decreased peak thrombin, increased lag time, and increased time to peak thrombin. Treatment with recombinant activated factor VII restored all three parameters of thrombin generation towards baseline. ADP decreased lag time and time to peak thrombin, but had no effect on peak thrombin. When recombinant activated factor VII and ADP were combined they had a greater effect on thrombin parameters than either drug alone. PAM also increased thromboelastometric clotting time and clot formation time, but had no effect on maximum clot firmness. Treatment with either recombinant activated factor VII or ADP restored these values towards baseline. Recombinant activated factor VII restores thrombin generation in the presence of PAM. In patients taking prasugrel with life-threatening refractory bleeding it has the potential to be a useful therapeutic approach. Additional clinical studies are needed to validate our findings. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Regulation of platelet activating factor receptor coupled phosphoinositide-specific phospholipase C activity

    International Nuclear Information System (INIS)

    Morrison, W.J.

    1988-01-01

    The major objectives of this study were two-fold. The first was to establish whether binding of platelet activating factor (PAF) to its receptor was integral to the stimulation of polyphosphoinositide-specific phospholipase C (PLC) in rabbit platelets. The second was to determine regulatory features of this receptor-coupled mechanism. [ 3 H]PAF binding demonstrated two binding sites, a high affinity site with a inhibitory constant (Ki) of 2.65 nM and a low affinity site with a Ki of 0.80 μM. PAF receptor coupled activation of phosphoinositide-specific PLC was studied in platelets which were made refractory, by short term pretreatments, to either PAF or thrombin. Saponin-permeabilized rabbit platelets continue to regulate the mechanism(s) coupling PAF receptors to PLC stimulation. However, TRPγS and GDPβS, which affect guanine nucleotide regulatory protein functions, were unable to modulate the PLC activity to any appreciable extent as compared to PAF. The possible involvement of protein kinase C (PKC) activation in regulating PAF-stimulated PLC activity was studied in rabbit platelets pretreated with staurosporine followed by pretreatments with PAF or phorbol 12-myristate 13-acetate (PMA)

  15. Motivational factors and stages of change for physical activity among college students in Amman, Jordan.

    Science.gov (United States)

    Madanat, Hala; Merrill, Ray M

    2006-01-01

    The purpose of this study was to investigate physical activity levels across the five stages of change for physical activity and to identify motivational factors for physical activity according to these stages of change among college students in Amman, Jordan. Analyses were based on a cross-sectional survey of 431 students, with a mean age of 21.1 (SD=0.16) and 67.5% female. Based on the recommendation that physical activity requires at least 30 minutes of physical activity 3 or more days per week, men were more likely than women to classify themselves in later stages: 7.3% vs. 9.5% in the precontemplation stage, 17.4% vs. 14.7% in the contemplation stage, 50.0% vs. 63.5% in the preparation stage, 9.4% vs. 5.6% in the action stage, and 15.9% vs. 6.7% in the maintenance stage [X2(4) = 14.04, p = 0.0072]. Seven potential motivational items for physical activity were assessed using factor analysis: experience better self-worth, prevent chronic disease, relieve stress, stay in shape, longevity, recreation/fun, and social benefits. Two factor groupings were identified from these items. The first factor included the first five items, labeled as "Physical and Mental". The second factor included the last two items, labeled as "Social and Recreational." "Physical and Mental" items compared with "Social and Recreational" items were most likely to motivate physical activity across the stages of change for physical activity. The strongest motivator of physical activity was to stay in shape. The weakest motivator of physical activity was for social reasons. The influence of the intermediate motivational factors was slightly affected by the students' stage of change for physical activity. Motivators for physical activity did not differ according to sex. These results provide important information about the motivational factors for physical activity for college-aged students in Jordan that can be useful in developing effective physical activity intervention programs.

  16. Multiple factors and processes involved in host cell killing by bacteriophage Mu: characterization and mapping.

    Science.gov (United States)

    Waggoner, B T; Marrs, C F; Howe, M M; Pato, M L

    1984-07-15

    The regions of bacteriophage Mu involved in host cell killing were determined by infection of a lambda-immune host with 12 lambda pMu-transducing phages carrying different amounts of Mu DNA beginning at the left end. Infecting lambda pMu phages containing 5.0 (+/- 0.2) kb or less of the left end of Mu DNA did not kill the lambda-immune host, whereas lambda pMu containing 5.1 kb did kill, thus locating the right end of the kil gene between approximately 5.0 and 5.1 kb. For the Kil+ phages the extent of killing increased as the multiplicity of infection (m.o.i.) increased. In addition, killing was also affected by the presence of at least two other regions of Mu DNA: one, located between 5.1 and 5.8 kb, decreased the extent of killing; the other, located between 6.3 and 7.9 kb, greatly increased host cell killing. Killing was also assayed after lambda pMu infection of a lambda-immune host carrying a mini-Mu deleted for most of the B gene and the middle region of Mu DNA. Complementation of mini-Mu replication by infecting B+ lambda pMu phages resulted in killing of the lambda-immune, mini-Mu-containing host, regardless of the presence or absence of the Mu kil gene. The extent of host cell killing increased as the m.o.i. of the infecting lambda pMu increased, and was further enhanced by both the presence of the kil gene and the region located between 6.3 and 7.9 kb. These distinct processes of kil-mediated killing in the absence of replication and non-kil-mediated killing in the presence of replication were also observed after induction of replication-deficient and kil mutant prophages, respectively.

  17. Psychosocial factors and theory in physical activity studies in minorities.

    Science.gov (United States)

    Mama, Scherezade K; McNeill, Lorna H; McCurdy, Sheryl A; Evans, Alexandra E; Diamond, Pamela M; Adamus-Leach, Heather J; Lee, Rebecca E

    2015-01-01

    To summarize the effectiveness of interventions targeting psychosocial factors to increase physical activity (PA) among ethnic minority adults and explore theory use in PA interventions. Studies (N = 11) were identified through a systematic review and targeted African American/Hispanic adults, specific psychosocial factors, and PA. Data were extracted using a standard code sheet and the Theory Coding Scheme. Social support was the most common psychosocial factor reported, followed by motivational readiness, and self-efficacy, as being associated with increased PA. Only 7 studies explicitly reported using a theoretical framework. Future efforts should explore theory use in PA interventions and how integration of theoretical constructs, including psychosocial factors, increases PA.

  18. Influences of lifestyle factors on cardiac autonomic nervous system activity over time

    NARCIS (Netherlands)

    Hu, Mandy Xian; Lamers, Femke; de Geus, Eco J C; Penninx, Brenda W J H

    Physical activity, alcohol use and smoking might affect cardiovascular disease through modifying autonomic nervous system (ANS) activity. We investigated: 1) whether there are consistent relationships between lifestyle factors and cardiac ANS activity over time, and 2) whether 2-year changes in

  19. Alternative complement pathway and factor B activities in rats with altered blood levels of thyroid hormone

    Energy Technology Data Exchange (ETDEWEB)

    Bitencourt, C.S. [Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Duarte, C.G.; Azzolini, A.E.C.S.; Assis-Pandochi, A.I. [Departamento de Física e Química, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)

    2012-03-02

    Evaluating the activity of the complement system under conditions of altered thyroid hormone levels might help elucidate the role of complement in triggering autoimmune processes. Here, we investigated alternative pathway (AP) activity in male Wistar rats (180 ± 10 g) after altering their thyroid hormone levels by treatment with triiodothyronine (T3), propylthiouracil (PTU) or thyroidectomy. T3 and thyroxine (T4) levels were determined by chemiluminescence assays. Hemolytic assays were performed to evaluate the lytic activity of the AP. Factor B activity was evaluated using factor B-deficient serum. An anti-human factor B antibody was used to measure factor B levels in serum by radial immunodiffusion. T3 measurements in thyroidectomized animals or animals treated with PTU demonstrated a significant reduction in hormone levels compared to control. The results showed a reduction in AP lytic activity in rats treated with increasing amounts of T3 (1, 10, or 50 µg). Factor B activity was also decreased in the sera of hyperthyroid rats treated with 1 to 50 µg T3. Additionally, treating rats with 25 µg T3 significantly increased factor B levels in their sera (P < 0.01). In contrast, increased factor B concentration and activity (32%) were observed in hypothyroid rats. We conclude that alterations in thyroid hormone levels affect the activity of the AP and factor B, which may in turn affect the roles of AP and factor B in antibody production.

  20. Alternative complement pathway and factor B activities in rats with altered blood levels of thyroid hormone

    International Nuclear Information System (INIS)

    Bitencourt, C.S.; Duarte, C.G.; Azzolini, A.E.C.S.; Assis-Pandochi, A.I.

    2012-01-01

    Evaluating the activity of the complement system under conditions of altered thyroid hormone levels might help elucidate the role of complement in triggering autoimmune processes. Here, we investigated alternative pathway (AP) activity in male Wistar rats (180 ± 10 g) after altering their thyroid hormone levels by treatment with triiodothyronine (T3), propylthiouracil (PTU) or thyroidectomy. T3 and thyroxine (T4) levels were determined by chemiluminescence assays. Hemolytic assays were performed to evaluate the lytic activity of the AP. Factor B activity was evaluated using factor B-deficient serum. An anti-human factor B antibody was used to measure factor B levels in serum by radial immunodiffusion. T3 measurements in thyroidectomized animals or animals treated with PTU demonstrated a significant reduction in hormone levels compared to control. The results showed a reduction in AP lytic activity in rats treated with increasing amounts of T3 (1, 10, or 50 µg). Factor B activity was also decreased in the sera of hyperthyroid rats treated with 1 to 50 µg T3. Additionally, treating rats with 25 µg T3 significantly increased factor B levels in their sera (P < 0.01). In contrast, increased factor B concentration and activity (32%) were observed in hypothyroid rats. We conclude that alterations in thyroid hormone levels affect the activity of the AP and factor B, which may in turn affect the roles of AP and factor B in antibody production

  1. [Factors influencing research activity of Andalusian nurses and improvement strategies].

    Science.gov (United States)

    López Alonso, Sergio R; Gálvez González, María; Amezcua, Manuel

    2013-04-01

    To identify factors influencing research activity of Andalusian nurses and to find improvement strategies. Qualitative research using SWOT analysis (weaknesses, threats, strengths, opportunities). Nurses were selected deliberately in eight groups according to predetermined criteria. Analysis included categorization and relationship of factors and strategies. 81 participants were included in groups of 7-12 range. 45 categories were identified with 212 factors: 12 weaknesses (50 factors), 10 strengths (44 factors), 12 threats (68 factors) and 11 opportunities (50 factors). In addition, 32 categories were identified with 53 strategies: 14 categories of W-T strategies (42 strategies), 3 categories of S-T strategies (11 strategies), 5 categories of W-O strategies (13 strategies) and 10 categories of S-O strategies (41 strategies). Nurses identified numerous factors, mainly threats. The strategies are focused on W-T but they also suggest many but weak 5-0 strategies due to the low potential of the opportunities and strengths perceived.

  2. Newly diagnosed congenital factor VII deficiency and utilization of recombinant activated factor VII (NovoSeven(®)).

    Science.gov (United States)

    Bartosh, Nicole S; Tomlin, Tara; Cable, Christian; Halka, Kathleen

    2013-01-01

    This case report presents a newly diagnosed congenital factor VII deficiency treated with recombinant activated factor VII (rFVIIa). Congenital factor VII deficiency is a rare autosomal-recessive bleeding disorder that occurs in fewer than 1/500,000 persons. Its presentation can vary from epistaxis to hemarthroses and severe central nervous system bleeding, and correlates poorly with factor VII levels. Our patient had not had a significant hemostatic challenge prior to his presentation and therefore never had any symptomatology suggestive of this disease. He was treated with rFVIIa, and was able to undergo repair of his fractures without bleeding. A 19-year-old African-American male presented to the emergency room after an altercation that resulted in significant trauma. He sustained bilateral mandibular angle fractures and orbital floor fractures, requiring urgent surgical correction. On initial evaluation, he was noted to have a prolonged prothrombin time of 40.1 seconds, with an International Normalized Ratio of 4.0, a normal activated partial thromboplastin time of 29.9 seconds, and a platelet count of 241. After receiving vitamin K and fresh frozen plasma, he was taken to the operating room for a temporary rigid maxillomandibular fixation. A 1:1 mixing study with normal plasma corrected the prothrombin time (decreasing from 40.7 to 14.7 seconds) and a factor VII assay revealed 5% of the normal factor VII level. The patient was diagnosed with congenital factor VII deficiency. Due to his coagulopathy and the extensive surgical correction needed, rFVIIa was administered and surgery was accomplished without hemorrhagic sequelae. This case report and review describes a rare congenital disease, the history of rFVIIa use, and its mechanism. rFVIIA use in our patient provided a treatment option that allowed the necessary surgical correction, but further prospective studies on dose optimization would ensure adequate dosing with minimal risk of severe side effects.

  3. Are school factors and urbanization supportive for being physically active and engaging in less screen-based activities?

    NARCIS (Netherlands)

    Kopcakova, Jaroslava; Dankulincova Veselska, Zuzana; Madarasova Geckova, Andrea; Klein, Daniel; van Dijk, Jitse P; Reijneveld, Sijmen A

    The aim was to assess the association between physical activity and screen-based activities in adolescents and selected school factors and urbanization and whether these associations were modified by degree of urbanization. We obtained data regarding the fifth-ninth grade students from 130 schools

  4. Multiple distinct stimuli increase measured nucleosome occupancy around human promoters.

    Directory of Open Access Journals (Sweden)

    Chuong D Pham

    Full Text Available Nucleosomes can block access to transcription factors. Thus the precise localization of nucleosomes relative to transcription start sites and other factor binding sites is expected to be a critical component of transcriptional regulation. Recently developed microarray approaches have allowed the rapid mapping of nucleosome positions over hundreds of kilobases (kb of human genomic DNA, although these approaches have not yet been widely used to measure chromatin changes associated with changes in transcription. Here, we use custom tiling microarrays to reveal changes in nucleosome positions and abundance that occur when hormone-bound glucocorticoid receptor (GR binds to sites near target gene promoters in human osteosarcoma cells. The most striking change is an increase in measured nucleosome occupancy at sites spanning ∼1 kb upstream and downstream of transcription start sites, which occurs one hour after addition of hormone, but is lost at 4 hours. Unexpectedly, this increase was seen both on GR-regulated and GR-non-regulated genes. In addition, the human SWI/SNF chromatin remodeling factor (a GR co-activator was found to be important for increased occupancy upon hormone treatment and also for low nucleosome occupancy without hormone. Most surprisingly, similar increases in nucleosome occupancy were also seen on both regulated and non-regulated promoters during differentiation of human myeloid leukemia cells and upon activation of human CD4+ T-cells. These results indicate that dramatic changes in chromatin structure over ∼2 kb of human promoters may occur genomewide and in response to a variety of stimuli, and suggest novel models for transcriptional regulation.

  5. Genetic mapping of the LOBED LEAF 1 (ClLL1) gene to a 127.6-kb region in watermelon (Citrullus lanatus L.).

    Science.gov (United States)

    Wei, Chunhua; Chen, Xiner; Wang, Zhongyuan; Liu, Qiyan; Li, Hao; Zhang, Yong; Ma, Jianxiang; Yang, Jianqiang; Zhang, Xian

    2017-01-01

    The lobed leaf character is a unique morphologic trait in crops, featuring many potential advantages for agricultural productivity. Although the majority of watermelon varieties feature lobed leaves, the genetic factors responsible for lobed leaf formation remain elusive. The F2:3 leaf shape segregating population offers the opportunity to study the underlying mechanism of lobed leaf formation in watermelon. Genetic analysis revealed that a single dominant allele (designated ClLL1) controlled the lobed leaf trait. A large-sized F3:4 population derived from F2:3 individuals was used to map ClLL1. A total of 5,966 reliable SNPs and indels were identified genome-wide via a combination of BSA and RNA-seq. Using the validated SNP and indel markers, the location of ClLL1 was narrowed down to a 127.6-kb region between markers W08314 and W07061, containing 23 putative ORFs. Expression analysis via qRT-PCR revealed differential expression patterns (fold-changes above 2-fold or below 0.5-fold) of three ORFs (ORF3, ORF11, and ORF18) between lobed and non-lobed leaf plants. Based on gene annotation and expression analysis, ORF18 (encoding an uncharacterized protein) and ORF22 (encoding a homeobox-leucine zipper-like protein) were considered as most likely candidate genes. Furthermore, sequence analysis revealed no polymorphisms in cDNA sequences of ORF18; however, two notable deletions were identified in ORF22. This study is the first report to map a leaf shape gene in watermelon and will facilitate cloning and functional characterization of ClLL1 in future studies.

  6. Risk factors for active trachoma among children aged 1-9 years in ...

    African Journals Online (AJOL)

    Background: Trachoma is a public health problem in sub-Saharan Africa. Data on risk factors for active trachoma are limited. There is a need for understanding the factors affecting trachoma in order to plan for targeted interventions. The aim of the study was to examine the relationship between potential risk factors and ...

  7. Development of a dual luciferase activity and fluorescamine protein assay adapted to a 384 micro-well plate format: Reducing variability in human luciferase transactivation cell lines aimed at endocrine active substances

    Science.gov (United States)

    Brennan, Jennifer; Tillitt, Donald E.

    2018-01-01

    There is a need to adapt cell bioassays to 384-well and 1536-well formats instead of the traditional 96-well format as high-throughput screening (HTS) demands increase. However, the sensitivity and performance of the bioassay must be re-verified in these higher micro-well plates, and verification of cell health must also be HT (high-throughput). We have adapted two commonly used human breast luciferase transactivation cell bioassays, the recently re-named estrogen agonist/antagonist screening VM7Luc4E2 cell bioassay (previously designated BG1Luc4E2) and the androgen/glucocorticoid screening MDA-kb2 cell bioassay, to 384-well formats for HTS of endocrine-active substances (EASs). This cost-saving adaptation includes a fast, accurate, and easy measurement of protein amount in each well via the fluorescamine assay with which to normalize luciferase activity of cell lysates without requiring any transfer of the cell lysates. Here we demonstrate that by accounting for protein amount in the cell lysates, antagonistic agents can easily be distinguished from cytotoxic agents in the MDA-kb2 and VM7Luc4E2 cell bioassays. Additionally, we demonstrate via the fluorescamine assay improved interpretation of luciferase activity in wells along the edge of the plate (the so-called “edge effect”), thereby increasing usable wells to the entire plate, not just interior wells.

  8. Factor Xa stimulates fibroblast procollagen production, proliferation, and calcium signaling via PAR1 activation

    International Nuclear Information System (INIS)

    Blanc-Brude, Olivier P.; Archer, Fabienne; Leoni, Patricia; Derian, Claudia; Bolsover, Steven; Laurent, Geoffrey J.; Chambers, Rachel C.

    2005-01-01

    Fibroblast proliferation and procollagen production are central features of tissue repair and fibrosis. In addition to its role in blood clotting, the coagulation cascade proteinase thrombin can contribute to tissue repair by stimulating fibroblasts via proteolytic activation of proteinase-activated receptor-1 (PAR 1 ). During hemostasis, the coagulation cascade proteinase factor X is converted into factor Xa. We have previously shown that factor Xa upregulates fibroblast proliferation via production of autocrine PDGF. In this study, we further examined the effects of factor Xa on fibroblast function and aimed to identify its signaling receptor. We showed that factor Xa stimulates procollagen promoter activity and protein production by human and mouse fibroblasts. This effect was independent of PDGF and thrombin production, but dependent on factor Xa proteolytic activity. We also showed that PAR 1 -deficient mouse fibroblasts did not upregulate procollagen production, mobilize cytosolic calcium, or proliferate in response to factor Xa. Desensitization techniques and PAR 1 -specific agonists and inhibitors were used to demonstrate that PAR 1 mediates factor Xa signaling in human fibroblasts. This is the first report that factor Xa stimulates extracellular matrix production. In contrast with endothelial cells and vascular smooth muscle cells, fibroblasts appear to be the only cell type in which the effects of factor Xa are mediated mainly via PAR 1 and not PAR 2 . These findings are critical for our understanding of tissue repair and fibrotic mechanisms, and for the design of novel approaches to inhibit the profibrotic effects of the coagulation cascade without compromising blood hemostasis

  9. Production of active pigment epithelium-derived factor inE. coli.

    Science.gov (United States)

    Zhang, Tao; Guan, Ming; Lu, Yuan

    2005-03-01

    Human pigment epithelium-derived factor (PEDF), a neurotrophic factor, is the most potent natural inhibitor of angiogenesis. To produce the active PEDF, the gene coding for the human PEDF protein was expressed in E. coli. The rPEDF protein was expressed at 457 mg l-1 as a soluble protein. The yield of purified GST fusion protein was 14 mg l-1. Purified rPEDF inhibited tube formation in endothelial cells.

  10. [Immunoexpression and clinical significance of interleukin-21 and receptor activator of nuclear factor κB ligand in human periapical granulomas and radicular cysts].

    Science.gov (United States)

    Hu, Juhua; Li, Qian; Wang, Yanqing; Li, Song

    2015-06-01

    This study aimed to detect the immunoexpression of interleukin-21 (IL-21) and receptor activator. of nuclear factor KB ligand (RANKL) in periapical granulomas (PGs) and radicular cysts (RCs). The interaction of IL-21 with RANKL and its role in periapical pathogenesis were also speculated. A total of 32 PGs and 23 RCs were selected as experimental samples. Lesion size and occurrence of tenderness were recorded. Up to 10 healthy gingival tissues were collected as normal control samples. All tissues were subjected to immunohistocheincal analysis with anti-human IL-21 and RANKL polyclonal antibodies. The correlations of IL-21 with RANKL, lesion size, and the occurrence of tenderness of the PGs and RCs were evaluated. IL-21-positive cells were detected in all periapical lesion tissues but not in normal tissues. In the cyst group and granuloma group, the corresponding expression levels of IL-21 were 59.92±6.57 and 36.80± 6.81, whereas those of RANKL were 68.81±18.59 and 36.12±14.87, respectively. Moreover, t-test revealed a significantly higher expression of IL-21 and RANKL in RCs than in PGs (P<0.05). IL-21 and RANKL were positively correlated in both PGs and RCs (P<0.05). Furthermore, IL-21 was correlated with lesion size (P<0.05). This study demonstrated that IL-21 is potentially involved in the pathogenesis of apical periodontitis lesions. A role in the exacerbation of chronic inflammation, as well as in bone resorption, is suspected. Further studies are required to elucidate the specific functions of IL-21 in periradicular inflammatory processes.

  11. An integrative review: work environment factors associated with physical activity among white-collar workers.

    Science.gov (United States)

    Lin, Yun-Ping; McCullagh, Marjorie C; Kao, Tsui-Sui; Larson, Janet L

    2014-02-01

    The purpose of this review is to synthesize the research evidence for the role of the work environment-workplace physical activity policies and resources and job strain factors-in explaining physical activity in white-collar workers. White-collar workers are at risk for developing a sedentary lifestyle, which contributes to all-cause mortality. Understanding how work environment can influence worker physical activity is important for the development of effective interventions. We reviewed 15 research articles that describe the relationship between work environment factors and physical activity in predominantly white-collar workers. Relatively consistent evidence was found for the effects of supportive workplace policies and resources. Weak evidence was found for the effects of job strain. Both work environment factors have the potential to influence physical activity but require further exploration to fully understand their contribution to physical activity in white-collar workers. Limitations and implications are discussed.

  12. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    Directory of Open Access Journals (Sweden)

    Pellegrini Matteo

    2011-10-01

    Full Text Available Abstract Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle.

  13. A specific colorimetric assay for measuring transglutaminase 1 and factor XIII activities.

    Science.gov (United States)

    Hitomi, Kiyotaka; Kitamura, Miyako; Alea, Mileidys Perez; Ceylan, Ismail; Thomas, Vincent; El Alaoui, Saïd

    2009-11-15

    Transglutaminase (TGase) is an enzyme that catalyzes both isopeptide cross-linking and incorporation of primary amines into proteins. Eight TGases have been identified in humans, and each of these TGases has a unique tissue distribution and physiological significance. Although several assays for TGase enzymatic activity have been reported, it has been difficult to establish an assay for discriminating each of these different TGase activities. Using a random peptide library, we recently identified the preferred substrate sequences for three major TGases: TGase 1, TGase 2, and factor XIII. In this study, we use these substrates in specific tests for measuring the activities of TGase 1 and factor XIII.

  14. Activation of Rho GTPases by Cytotoxic Necrotizing Factor 1 Induces Macropinocytosis and Scavenging Activity in Epithelial Cells

    Science.gov (United States)

    Fiorentini, Carla; Falzano, Loredana; Fabbri, Alessia; Stringaro, Annarita; Logozzi, Mariaantonia; Travaglione, Sara; Contamin, Stéphanette; Arancia, Giuseppe; Malorni, Walter; Fais, Stefano

    2001-01-01

    Macropinocytosis, a ruffling-driven process that allows the capture of large material, is an essential aspect of normal cell function. It can be either constitutive, as in professional phagocytes where it ends with the digestion of captured material, or induced, as in epithelial cells stimulated by growth factors. In this case, the internalized material recycles back to the cell surface. We herein show that activation of Rho GTPases by a bacterial protein toxin, the Escherichia coli cytotoxic necrotizing factor 1 (CNF1), allowed epithelial cells to engulf and digest apoptotic cells in a manner similar to that of professional phagocytes. In particular, we have demonstrated that 1) the activation of all Rho, Rac, and Cdc42 by CNF1 was essential for the capture and internalization of apoptotic cells; and 2) such activation allowed the discharge of macropinosomal content into Rab7 and lysosomal associated membrane protein-1 acidic lysosomal vesicles where the ingested particles underwent degradation. Taken together, these findings indicate that CNF1-induced “switching on” of Rho GTPases may induce in epithelial cells a scavenging activity, comparable to that exerted by professional phagocytes. The activation of such activity in epithelial cells may be relevant, in mucosal tissues, in supporting or integrating the scavenging activity of resident macrophages. PMID:11452003

  15. Elevated circulating soluble thrombomodulin activity, tissue factor activity and circulating procoagulant phospholipids: new and useful markers for pre-eclampsia?

    Science.gov (United States)

    Rousseau, Aurélie; Favier, Rémi; Van Dreden, Patrick

    2009-09-01

    One of the most frequently proposed mechanisms for pre-eclampsia refers to uteroplacental thrombosis. However, the contribution of classical thrombotic risk factors remains questionable. The aims of this study were to investigate the activities of thrombomodulin, tissue factor and procoagulant phospholipids to assess endothelial cell injury in pregnant women with pre-eclampsia and to compare them with other classical markers of vascular injury and thrombotic risk. Using three new functional assays we studied the plasma levels of these new markers in 35 healthy women, 30 healthy pregnant women, and 35 women with pre-eclampsia. We found that plasma levels of thrombomodulin activity, tissue factor activity and procoagulant phospholipids were significantly elevated in women with pre-eclampsia versus normal pregnant and non-pregnant women. It is thus suggested that elevated levels of these parameters in pre-eclampsia may reflect vascular endothelium damage, and may be a more valuable biomarker than antigen for the assessment of endothelial damage in pre-eclampsia. The high increased levels of procoagulant phospholipids and tissue factor activities in pre-eclampsia could suggest that the procoagulant potential may be implicated in this complication and makes these markers very promising for the understanding, follow-up and therapeutic handling of complicated pregnancy.

  16. Krüppel-like factor 4, a novel transcription factor regulates microglial activation and subsequent neuroinflammation

    Directory of Open Access Journals (Sweden)

    Das Sulagna

    2010-10-01

    Full Text Available Abstract Background Activation of microglia, the resident macrophages of the central nervous system (CNS, is the hallmark of neuroinflammation in neurodegenerative diseases and other pathological conditions associated with CNS infection. The activation of microglia is often associated with bystander neuronal death. Nuclear factor-κB (NF-κB is one of the important transcription factors known to be associated with microglial activation which upregulates the expression of inducible nitric oxide synthase (iNOS, cyclooxygenase-2 (Cox-2 and other pro-inflammatory cytokines. Recent studies have focused on the role of Krüppel-like factor 4 (Klf4, one of the zinc-finger transcription factors, in mediating inflammation. However, these studies were limited to peripheral system and its role in CNS is not understood. Our studies focused on the possible role of Klf4 in mediating CNS inflammation. Methods For in vitro studies, mouse microglial BV-2 cell lines were treated with 500 ng/ml Salmonella enterica lipopolysacchride (LPS. Brain tissues were isolated from BALB/c mice administered with 5 mg/kg body weight of LPS. Expressions of Klf4, Cox-2, iNOS and pNF-κB were evaluated using western blotting, quantitative real time PCR, and reverse transcriptase polymerase chain reactions (RT-PCRs. Klf4 knockdown was carried out using SiRNA specific for Klf4 mRNA and luciferase assays and electromobility shift assay (EMSA were performed to study the interaction of Klf4 to iNOS promoter elements in vitro. Co-immunoprecipitation of Klf4 and pNF-κB was done in order to study a possible interaction between the two transcription factors. Results LPS stimulation increased Klf4 expression in microglial cells in a time- and dose-dependent manner. Knockdown of Klf4 resulted in decreased levels of the pro-inflammatory cytokines TNF-α, MCP-1 and IL-6, along with a significant decrease in iNOS and Cox-2 expression. NO production also decreased as a result of Klf4 knockdown

  17. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  18. Point mutation in activated c-Ha-ras gene of a chemically induced transplantable human pancreas carcinoma

    International Nuclear Information System (INIS)

    Maheshwari, K.K.; Parsa, I.

    1986-01-01

    The authors have reported a model of human pancreas carcinogenesis where repeated treatment with MNU of explants results in the development of transplantable carcinoma. This report compares the endonuclease digests of DNAs from normal human pancreas (HP) and MNU-induced transplantable tumor (HP-T1) analyzed with 32 P-labelled Ha-ras probe prepared from clone BS-9. The hybridization patterns of BamHI, BglII, EcoRI and HindIII digests of HP were significantly different from those of HP-T1. In EcoRI digests a 3.0 kb fragments of HP-T1 DNA hybridized with Ha-ras probe instead of a 4.3 kb fragments seen in HP DNA. The pattern for HindIII digests was similar to those of EcoRI. The BgIII digests of HP DNA revealed two hybridizing fragments of 8.0 and 4.3 kb whereas those of HP-T1 DNA fragments measured 8.5 and 4.0 kb. BamHI treated HP DNA showed only hybridizing fragments of 6.6 kb while the HP-T1 DNA showed to hybridizing fragments of 6.8 and 7.2 kb. The digested DNAs by HhaI, HinfI, KpnI, pstI, PvuII, SaII, SstI, TaqI and XbaI showed similar hybridization profiles. The point mutation in c-Ha-ras was examined in the HpaII and MspI double digests of both DNAs by 0.6 Kb SmaI fragments of pEJ. The hybridized fragments measured 412 and 355 bp in DNA digests from tumor and normal pancreas respectively

  19. Nutrition, Physical Activity, and Obesity - Behavioral Risk Factor Surveillance System

    Data.gov (United States)

    U.S. Department of Health & Human Services — This dataset includes data on adult's diet, physical activity, and weight status from Behavioral Risk Factor Surveillance System. This data is used for DNPAO's Data,...

  20. Factors of physical activity among Chinese children and adolescents: a systematic review.

    Science.gov (United States)

    Lu, Congchao; Stolk, Ronald P; Sauer, Pieter J J; Sijtsma, Anna; Wiersma, Rikstje; Huang, Guowei; Corpeleijn, Eva

    2017-03-21

    Lack of physical activity is a growing problem in China, due to the fast economic development and changing living environment over the past two decades. The aim of this review is to summarize the factors related to physical activity in Chinese children and adolescents during this distinct period of development. A systematic search was finished on Jan 10 th , 2017, and identified 2200 hits through PubMed and Web of Science. English-language published studies were included if they reported statistical associations between factors and physical activity. Adapted criteria from the Strengthening The Reporting of OBservational studies in Epidemiology (STROBE) statement and evaluation of the quality of prognosis studies in systematic reviews (QUIPS) were used to assess the risk of bias of the included studies. Related factors that were reported in at least three studies were summarized separately for children and adolescents using a semi-quantitative method. Forty two papers (published 2002-2016) were included. Most designs were cross-sectional (79%), and most studies used questionnaires to assess physical activity. Sample size was above 1000 in 18 papers (43%). Thirty seven studies (88%) showed acceptable quality by methodological quality assessment. Most studies reported a low level of physical activity. Boys were consistently more active than girls, the parental physical activity was positively associated with children and adolescents' physical activity, children in suburban/rural regions showed less activity than in urban regions, and, specifically in adolescents, self-efficacy was positively associated with physical activity. Family socioeconomic status and parental education were not associated with physical activity in children and adolescents. The studies included in this review were large but mostly of low quality in terms of study design (cross-sectional) and methods (questionnaires). Parental physical activity and self-efficacy are promising targets for future

  1. Increased active von Willebrand factor during disease development in the aging diabetic patient population.

    Science.gov (United States)

    Chen, Shuang Feng; Xia, Zuo Li; Han, Ji Ju; Wang, Yi Ting; Wang, Ji Yue; Pan, Shao Dong; Wu, Ya Ping; Zhang, Bin; Li, Guang Yao; Du, Jing Wei; Gao, Hen Qiang; de Groot, Philip G; de Laat, Bas; Hollestelle, Martine J

    2013-02-01

    Type 2 diabetes is known to cause endothelial activation resulting in the secretion of von Willebrand factor (VWF). We have shown that levels of VWF in a glycoprotein Ib-binding conformation are increased in specific clinical settings. The aim of the current study is to investigate whether active VWF levels increase during aging and the development of diabetes within the population of patients suffering from type 2 diabetes. Patients and controls were divided into two groups based on age: older and younger than 60 years of age. VWF antigen, VWF propeptide, VWF activation factor and total active VWF were measured. Patients older than 60 years of age had increased levels of total active VWF, VWF activation factor and VWF propeptide compared to younger patients and controls. All measured VWF parameters were associated with age in diabetic patients. Total active VWF and VWF propeptide correlated with the period of being diagnosed with diabetes. Regression analyses showed that especially the VWF activation factor was strongly associated with diabetes in patients older than 60 years of age. In conclusion, we found that the conformation of VWF could be involved in the disease process of diabetes and that the VWF in a glycoprotein Ib-binding conformation could play a role as risk marker during the development of diabetes in combination with an increase in age. Our study shows that the active quality of VWF was more important than the quantity.

  2. Physical activity as a health factor modifying heart rate variability (HRV

    Directory of Open Access Journals (Sweden)

    Nowosielska-Swadzba Danuta

    2015-03-01

    Full Text Available Purpose: The aim of the research was the evaluation of the selected HRV factors of the training volleyball players in two training periods and non-training people. Materials and methods : The study involved 8 leading volleyball players aged 20-23 and 13 non-training persons aged 19-26. The study of the training players was conducted twice: in the pre-competition and in the competition period. The study for the non-training persons was conducted once. The selected factors of the spectral analysis have been evaluated: TP [ms 2], share of LF and HF power [n.u], LF/HF indicator and time analysis factors: RR [ms], HR [1/min], RMSSD [ms]. Results : Statistically significant differences appeared only in the selected time analysis factors (RR, HR, between the group of the training and non-training persons. Other differences in the evaluated parameters were not statistically significant. Conclusions : Physical activity influences on the HRV growth. HRV measurement may serve for the control of the changes taking place in the AUN under the influence of the physical activity.

  3. Peripheral brain-derived neurotrophic factor is related to cardiovascular risk factors in active and inactive elderly men

    Directory of Open Access Journals (Sweden)

    A. Zembron-Lacny

    2016-01-01

    Full Text Available Regular exercise plays an important preventive and therapeutic role in heart and vascular diseases, and beneficially affects brain function. In blood, the effects of exercise appear to be very complex and could include protection of vascular endothelial cells via neurotrophic factors and decreased oxidative stress. The purpose of this study was to identify the age-related changes in peripheral brain-derived neurotrophic factor (BDNF and its relationship to oxidative damage and conventional cardiovascular disease (CVD biomarkers, such as atherogenic index, C-reactive protein (hsCRP and oxidized LDL (oxLDL, in active and inactive men. Seventeen elderly males (61-80 years and 17 young males (20-24 years participated in this study. According to the 6-min Åstrand-Rhyming bike test, the subjects were classified into active and inactive groups. The young and elderly active men had a significantly better lipoprotein profile and antioxidant status, as well as reduced oxidative damage and inflammatory state. The active young and elderly men had significantly higher plasma BDNF levels compared to their inactive peers. BDNF was correlated with VO2max (r=0.765, P<0.001. In addition, we observed a significant inverse correlation of BDNF with atherogenic index (TC/HDL, hsCRP and oxLDL. The findings demonstrate that a high level of cardiorespiratory fitness reflected in VO2max was associated with a higher level of circulating BDNF, which in turn was related to common CVD risk factors and oxidative damage markers in young and elderly men.

  4. Novel Platinum (Pt)-Vandetanib Hybrid Compounds: Design, Synthesis and Investigation of Anti-cancer Activity and Mechanism of Action

    Science.gov (United States)

    Fei, Rong

    Purpose: Lung cancer is one of the most common cancers and non-small cell lung cancer (NSCLC) accounts for 80-85% of lung cancers. 70% of individuals with NSCLC harboring somatic mutations in exons of the epidermal growth factor receptor (EGFR) gene that encode tyrosine kinase domain. EGFR tyrosine kinase inhibitors (TKIs) are promising molecular targeted therapy for NSCLC with sensitizing EGFR mutations. However, secondary mutation of EGFR after treatment of TKIs develops resistance. Vandetanib is introduced to overcome erlotinib resistance as a multi-targeted TKI. However, its anticancer effect is still compromised by EGFR T790M mutation. Therefore, new molecular anticancer strategies are necessarily needed. In this study, vandetanib is incorporated with Pt-based anticancer agents as hybrid compounds, aiming to circumvent TKI resistance. Furthermore, hybrid compounds are investigated in cisplatin resistant problem to expect to overcome resistance by introduction of vandetanib. Methods: Three novel Pt-vandetanib hybrid compounds were synthesized and its physicochemical properties were characterized. Anticancer activity and cytotoxicity were evaluated by sulforhodamine B assay and lactate dehydrogenase release. Docking simulation was performed to investigate the interaction of compounds with EGFR harboring different mutations. Inhibition efficacy of hybrids to kinases was evaluated by kinase inhibition profiling service and cell-free kinase inhibition assay. Mechanistic studies on cytotoxicity activity of the hybrid compounds were carried out. DNA damage response of hybrid compounds was further investigated in KB cells. The cytotoxicity of hybrids was tested in cisplatin resistant KB CP20 cells. Mechanistic of anticancer activity was studied to test inhibition on oncoprotein CIP2Aand DNA damage. Results: Platinum-vandetanib hybrid compounds were synthesized and test to be stable under extracellular condition. Hybrids reacted with 5'-GMP2- and glutathione, and both

  5. Activated platelet-derived growth factor β receptor and Ras-mitogen-activated protein kinase pathway in natural bovine urinary bladder carcinomas.

    Science.gov (United States)

    Corteggio, Annunziata; Di Geronimo, Ornella; Roperto, Sante; Roperto, Franco; Borzacchiello, Giuseppe

    2012-03-01

    Bovine papillomavirus types 1 or 2 (BPV-1/2) are involved in the aetiopathogenesis of bovine urinary bladder cancer. BPV-1/2 E5 activates the platelet-derived growth factor β receptor (PDGFβR). The aim of this study was to analyse the Ras/mitogen-activated protein kinase (MAPK) pathway in relation to activation of PDGFβR in natural bovine urinary bladder carcinomas. Co-immunoprecipitation and Western blot analysis demonstrated that recruitment of growth factor receptor bound protein 2 (GRB-2) and Sos-1 to the activated PDGFβR was increased in carcinomas compared to normal tissues. Higher grade bovine urinary bladder carcinomas were associated with activation of Ras, but not with activation of downstream mitogen-activated protein kinase/extracellular signal-regulated kinase (Mek 1/2) or extracellular signal-regulated kinase (Erk 1/2). Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Influence Of Dilution Factor For Activity Measurement Of 60CO

    International Nuclear Information System (INIS)

    Hermawan-Candra; Nazaroh; Ermi-Juita

    2003-01-01

    Influence of dilution factor for activity measurement of 60 Co has been studied. The aim of this research is to determine influence between activity measurement result of 60 Co before and after diluted. Measurement were done by using ionization chamber detectors system and gamma spectrometry system with NaI(TI) detector. Discrepancy within three ionization chambers measurements were 0.2% - 2.1% and NaI(Tl) were 3.5% - 6%. (author)

  7. Advance in the Study of the Mechanisms Regulated by Sphingosine-1-Phosphate

    Science.gov (United States)

    Ye, Fei; Kong, Xiangqian; Luo, Cheng

    2010-09-01

    Sphingosine-1-phosphate (S1P) is a bioactive lipid messenger in the cells that regulate gene expression and NF-KB signal pathway through unknown mechanisms. Recently, Cheng Luo, associate professor of DDDC in Shanghai Institute of Materia Medica, whose project was funded by the National Natural Science Foundation of China, joined in a research team led by Professor Sarah Spiegel of Virginia Commonwealth University. The team continuously made significant breakthroughs in understanding the regulation mechanism of Sphingosine-1-Phosphate. In September 2009, in a paper published on SCIENCE magazine (Science 2009, 325: 1254-7), they firstly demonstrated that S1P is a physiologically important regulator of histone deacetylases (HDACs), HDACs are direct intracellular targets of S1P. Furthermore, they identified the mechanism that S1P regulates gene expression through regulating the activity of HDACs. In June 24th, 2010, in another paper to be published on NATURE magazine (Nature 2010, June 24th, advance online publication) which reports the regulation of NF-KB signaling pathway by S1P. They demonstrate that S1P is the missing cofactor for TRAF2 (tumour-necrosis factor receptor-associated factor 2) and indicate a new paradigm for the regulation of lysine-63-linked poly-ubiquitination. The study also highlight the key role of SphK1 and its product S1P in TNF-α signalling and the canonical NF-KB activation pathway, and then play crucial role in inflammatory, antiapoptotic and immune processes. The identification of new mechanisms by which S1P regulates gene expression and TNF and NF-KB signaling pathway will light up the road to develop novel inhibitors that might be useful for treatment of cancer and inflammatory diseases.

  8. The ionization quench factor in liquid-scintillation counting standardizations

    CERN Document Server

    Grau-Malonda, A

    1999-01-01

    We present a new detailed analysis of the ionization quench function Q(E) used in calculating the counting efficiency in liquid-scintillation counting (LSC), which shows that Q(0)=1, and permits one to derive Q(E) as a function of the electron energy and the parameter kB. The coefficients are tabulated by applying a new empirical formula of Q(E) for kB values in the range between 0.001 and 0.20 gMeV sup - sup 1 cm sup - sup 2. We demonstrate the convenience of applying sup 3 H and sup 5 sup 4 Mn for beta-ray and electron capture standardizations, respectively.

  9. Scaling factors for the activity determination of radioactive waste from nuclear power reactors

    International Nuclear Information System (INIS)

    Medici, Marcela A.; Piumetti, Elsa H.

    2007-01-01

    Specific information of the total activity and activity concentration of the radionuclides contained is required for conditioning, transporting and final disposal of radioactive waste. Due to the complexity associated to alpha and beta measurements for these emitters it is worldwide used, particularly in the case of heterogeneous radioactive waste, the Scaling Factor Method. As in other cases, inputs of the results of the analysis of waste samples taking from waste streams are necessary. The Scaling Factor Method is based on the determination of averaged correlations between the activity concentrations of Difficult to Measure (DTM) nuclides (i.e. alpha and beta emitters) and the activity concentration of easy to measure nuclides (i.e. strong gamma emitters) called Key Nuclides (KN). In the application of this method two phases may be identified: in the first one the degree of correlation between averaged activities of DTM and a given KN is verified, and specific Scaling Factors are derived for every DTM radionuclide. In the second stage the total activity and the activity concentration of the selected KN is determined in each waste item and, by applying the SFs obtained previously, the activities of DTM nuclides are calculated. It is concluded that this method is appropriate and cost-effective and it is stressed that it is only applicable while the Nuclear Power Reactor is in operation. (author)

  10. Survey of the Relationship Between Activity Energy Expenditure Metabolic Equivalents and Barrier Factors of Physical Activity in the Elderly in Kashan

    OpenAIRE

    Sadrollahi, Ali; Khalili, Zahra; Pour Nazari, Robab; Mohammadi, Majid; Ahmadi Khatir, Maryam; Mossadegh, Najima

    2016-01-01

    Background Physical activity in the elderly is influenced by aspects of aging that cause personal, mental, environmental, and social changes. Increases in factors that are barriers to activity cause physical energy expenditure to decrease. Objectives The aim of the present study was to survey the relationship between energy expenditure in metabolic equivalent units (MET) and factors that are barriers to physical activity in elderly people in Kashan, Iran Methods This is a descriptive analysis...

  11. Isolation of a Spodoptera exigua baculovirus recombinant with retained biological activity despite a 10.6 kb deletion

    NARCIS (Netherlands)

    Dai, X.; Hajos, J.P.; Joosten, N.N.; Oers, van M.M.; IJkel, W.F.J.; Zuidema, D.; Yi, P.

    2000-01-01

    When Spodoptera exigua multicapsid nucleopolyhedrovirus (SeMNPV) is grown in insect cell culture, defective viruses are generated. These viruses lack about 25 kbp of sequence information and are no longer infectious for insects. This makes the engineering of SeMNPV for improved insecticidal activity

  12. Prevalence and risk factors for Active Convulsive Epilepsy in ...

    African Journals Online (AJOL)

    Introduction: epilepsy is common in sub-Saharan Africa, but there is little data in West Africa, to develop public health measures for epilepsy in this region. Methods: we conducted a three-stage cross-sectional survey to determine the prevalence and risk factors for active convulsive epilepsy (ACE), and estimated the ...

  13. The Contribution of Home, Neighbourhood and School Environmental Factors in Explaining Physical Activity among Adolescents

    International Nuclear Information System (INIS)

    Haerens, L.; Deforche, B.; Cardon, G.; Bourdeaudhuij, I.D.; Craeynest, M.; Maes, L.

    2010-01-01

    The present study aimed at investigating the influence of home, neighbourhood and school environmental factors on adolescents' engagement in self-reported extracurricular physical activity and leisure time sports and on MVPA objectively measured by accelerometers. Environmental factors were assessed using questionnaires. Gender specific hierarchical regression analyses were conducted, with demographic variables entered in the first block, and environmental, psychosocial factors and interactions terms entered in the second block. Participation in extracurricular activities at school was positively related to the number of organized activities and the provision of supervision. Perceived accessibility of neighborhood facilities was not related to engagement in leisure time sports, whereas the availability of sedentary and physical activity equipment was. Findings were generally supportive of ecological theories stating that behaviors are influenced by personal and environmental factors that are constantly interacting.

  14. Shielding factors for gamma radiation from activity deposited on structures and ground surfaces

    International Nuclear Information System (INIS)

    Hedemann Jensen, P.

    1982-11-01

    This report describes a computer model that calculates shielding factors for indoor residence in multistorey and single-family houses for gamma radiation from activity despoited on roofs, outer walls, and ground surfaces. The dimensions of the buildings including window areas and the nearby surroundings has to be speficied in the calculations. Shielding factors can be calculated for different photon energies and for a uniform surface activity distribution as well as for separate activity on roof, outer wall, and ground surface achieved from decontamination or different deposition velocities. For a given area with a known distribution of different houses a weighted shielding factor can be calculated as well as a time-averaged one based on a given residence time distribution for work/school, home, outdoors, and transportation. Calculated shielding factors are shown for typical Danish houses. To give an impression of the sensitivity of the shielding factor on the parameters used in the model, variations were made in some of the most important parameters: wall thickness, road and ground width, percentage of outer wall covered by windows, photon energy, and decontamination percentage for outer walls, ground and roofs. The uncertainity of the calculations is discussed. (author)

  15. Thrombin generation by activated factor VII on platelet activated by different agonists. Extending the cell-based model of hemostasis

    Directory of Open Access Journals (Sweden)

    Herrera Maria

    2006-04-01

    Full Text Available Abstract Background Platelet activation is crucial in normal hemostasis. Using a clotting system free of external tissue factor, we investigated whether activated Factor VII in combination with platelet agonists increased thrombin generation (TG in vitro. Methods and results TG was quantified by time parameters: lag time (LT and time to peak (TTP, and by amount of TG: peak of TG (PTG and area under thrombin formation curve after 35 minutes (AUC→35min in plasma from 29 healthy volunteers using the calibrated automated thrombography (CAT technique. TG parameters were measured at basal conditions and after platelet stimulation by sodium arachidonate (AA, ADP, and collagen (Col. In addition, the effects of recombinant activated FVII (rFVIIa alone or combined with the other platelet agonists on TG parameters were investigated. We found that LT and TTP were significantly decreased (p 35min were significantly increased (p 35min (but not PTG when compared to platelet rich plasma activated with agonists in the absence of rFVIIa. Conclusion Platelets activated by AA, ADP, Col or rFVIIa triggered TG. This effect was increased by combining rFVIIa with other agonists. Our intrinsic coagulation system produced a burst in TG independent of external tissue factor activity an apparent hemostatic effect with little thrombotic capacity. Thus we suggest a modification in the cell-based model of hemostasis.

  16. Role of Bioavailable Iron in Coal Dust-Induced Activation of Activator Protein-1 and Nuclear Factor of Activated T Cells

    Science.gov (United States)

    Huang, Chuanshu; Li, Jingxia; Zhang, Qi; Huang, Xi

    2010-01-01

    Activator protein-1 (AP-1) and nuclear factor of activated T cells (NFAT) are two important transcription factors responsible for the regulation of cytokines, which are involved in cell proliferation and inflammation. Coal workers’ pneumoconiosis (CWP) is an occupational lung disease that may be related to chronic inflammation caused by coal dust exposure. In the present study, we demonstrate that coal from the Pennsylvania (PA) coalmine region, which has a high prevalence of CWP, can activate both AP-1 and NFAT in JB6 mouse epidermal cells. In contrast, coal from the Utah (UT) coalmine region, which has a low prevalence of CWP, has no such effects. The PA coal stimulates mitogen-activated protein kinase (MAPK) family members of extracellular signal-regulated kinases (ERKs) and p38 MAPK but not c-Jun-NH2-terminal kinases, as determined by the phosphorylation assay. The increase in AP-1 by the PA coal was completely eliminated by the pretreatment of cells with PD98059, a specific MAPK kinase inhibitor, and SB202190, a p38 kinase inhibitor, further confirming that the PA coal-induced AP-1 activation is mediated through ERKs and p38 MAPK pathways. Deferoxamine (DFO), an iron chelator, synergistically enhanced the PA coal-induced AP-1 activity, but inhibited NFAT activity. For comparison, cells were treated with ferrous sulfate and/or DFO. We have found that iron transactivated both AP-1 and NFAT, and DFO further enhanced iron-induced AP-1 activation but inhibited NFAT. These results indicate that activation of AP-1 and NFAT by the PA coal is through bioavailable iron present in the coal. These data are in agreement with our previous findings that the prevalence of CWP correlates well with levels of bioavailable iron in coals from various mining regions. PMID:12397016

  17. Newly diagnosed congenital factor VII deficiency and utilization of recombinant activated factor VII (NovoSeven®)

    Science.gov (United States)

    Bartosh, Nicole S; Tomlin, Tara; Cable, Christian; Halka, Kathleen

    2013-01-01

    This case report presents a newly diagnosed congenital factor VII deficiency treated with recombinant activated factor VII (rFVIIa). Congenital factor VII deficiency is a rare autosomal-recessive bleeding disorder that occurs in fewer than 1/500,000 persons. Its presentation can vary from epistaxis to hemarthroses and severe central nervous system bleeding, and correlates poorly with factor VII levels. Our patient had not had a significant hemostatic challenge prior to his presentation and therefore never had any symptomatology suggestive of this disease. He was treated with rFVIIa, and was able to undergo repair of his fractures without bleeding. Case report A 19-year-old African-American male presented to the emergency room after an altercation that resulted in significant trauma. He sustained bilateral mandibular angle fractures and orbital floor fractures, requiring urgent surgical correction. On initial evaluation, he was noted to have a prolonged prothrombin time of 40.1 seconds, with an International Normalized Ratio of 4.0, a normal activated partial thromboplastin time of 29.9 seconds, and a platelet count of 241. After receiving vitamin K and fresh frozen plasma, he was taken to the operating room for a temporary rigid maxillomandibular fixation. A 1:1 mixing study with normal plasma corrected the prothrombin time (decreasing from 40.7 to 14.7 seconds) and a factor VII assay revealed 5% of the normal factor VII level. The patient was diagnosed with congenital factor VII deficiency. Due to his coagulopathy and the extensive surgical correction needed, rFVIIa was administered and surgery was accomplished without hemorrhagic sequelae. Conclusion This case report and review describes a rare congenital disease, the history of rFVIIa use, and its mechanism. rFVIIA use in our patient provided a treatment option that allowed the necessary surgical correction, but further prospective studies on dose optimization would ensure adequate dosing with minimal risk of

  18. The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.

    Science.gov (United States)

    Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O

    1992-05-01

    Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.

  19. Platelet-Derived Short-Chain Polyphosphates Enhance the Inactivation of Tissue Factor Pathway Inhibitor by Activated Coagulation Factor XI.

    Directory of Open Access Journals (Sweden)

    Cristina Puy

    Full Text Available Factor (F XI supports both normal human hemostasis and pathological thrombosis. Activated FXI (FXIa promotes thrombin generation by enzymatic activation of FXI, FIX, FX, and FV, and inactivation of alpha tissue factor pathway inhibitor (TFPIα, in vitro. Some of these reactions are now known to be enhanced by short-chain polyphosphates (SCP derived from activated platelets. These SCPs act as a cofactor for the activation of FXI and FV by thrombin and FXIa, respectively. Since SCPs have been shown to inhibit the anticoagulant function of TFPIα, we herein investigated whether SCPs could serve as cofactors for the proteolytic inactivation of TFPIα by FXIa, further promoting the efficiency of the extrinsic pathway of coagulation to generate thrombin.Purified soluble SCP was prepared by size-fractionation of sodium polyphosphate. TFPIα proteolysis was analyzed by western blot. TFPIα activity was measured as inhibition of FX activation and activity in coagulation and chromogenic assays. SCPs significantly accelerated the rate of inactivation of TFPIα by FXIa in both purified systems and in recalcified plasma. Moreover, platelet-derived SCP accelerated the rate of inactivation of platelet-derived TFPIα by FXIa. TFPIα activity was not affected by SCP in recalcified FXI-depleted plasma.Our data suggest that SCP is a cofactor for TFPIα inactivation by FXIa, thus, expanding the range of hemostatic FXIa substrates that may be affected by the cofactor functions of platelet-derived SCP.

  20. Modulation of protein C activation by histones, platelet factor 4, and heparinoids: new insights into activated protein C formation.

    Science.gov (United States)

    Kowalska, M Anna; Zhao, Guohua; Zhai, Li; David, George; Marcus, Stephen; Krishnaswamy, Sriram; Poncz, Mortimer

    2014-01-01

    Histones are detrimental in late sepsis. Both activated protein C (aPC) and heparin can reverse their effect. Here, we investigated whether histones can modulate aPC generation in a manner similar to another positively charged molecule, platelet factor 4, and how heparinoids (unfractionated heparin or oxygen-desulfated unfractionated heparin with marked decrease anticoagulant activity) may modulate this effect. We measured in vitro and in vivo effects of histones, platelet factor 4, and heparinoids on aPC formation, activated partial thromboplastin time, and murine survival. In vitro, histones and platelet factor 4 both affect thrombin/thrombomodulin aPC generation following a bell-shaped curve, with a peak of >5-fold enhancement. Heparinoids shift these curves rightward. Murine aPC generation studies after infusions of histones, platelet factor 4, and heparinoids supported the in vitro data. Importantly, although unfractionated heparin and 2-O, 3-O desulfated heparin both reversed the lethality of high-dose histone infusions, only mice treated with 2-O, 3-O desulfated heparin demonstrated corrected activated partial thromboplastin times and had significant levels of aPC. Our data provide a new contextual model of how histones affect aPC generation, and how heparinoid therapy may be beneficial in sepsis. These studies provide new insights into the complex interactions controlling aPC formation and suggest a novel therapeutic interventional strategy.

  1. Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

    Directory of Open Access Journals (Sweden)

    Mary Dyszlewski

    2002-01-01

    Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

  2. Activation measurements for fast neutrons. Part E. Evaluation of fast neutron 63Ni transmission factors

    International Nuclear Information System (INIS)

    Egbert, Stephen D.

    2005-01-01

    The 63 Ni measurements for fast neutrons in copper samples are compared to the calculated free-in-air 63 Ni neutron activation given in Chapter 3 by use of transmission factors. Transmission factors were calculated to account for the modification of the fluence and activation at each sample's in situ location. For the purposes of this discussion, the transmission factor (TF) is defined as the ratio of the in situ sample activation divided by the untilted free-in-air (FIA) activation at a height of 1 m above ground at the same ground range. Examples of the application of TF's will be provided in this section. (author)

  3. The link between high-fat meals and postprandial activation of blood coagulation factor VII possibly involves kallikrein

    DEFF Research Database (Denmark)

    Larsen, L F; Marckmann, P; Bladbjerg, Else-Marie

    2000-01-01

    Contrary to low-fat meals, high-fat meals are known to cause postprandial factor VII (FVII) activation, but the mechanism is unknown. To study the postprandial FVII activation in detail, 18 young men consumed in randomized order high-fat or low-fat test meals. Fasting and non-fasting blood samples...... that triglyceride-rich lipoproteins may activate prokallikrein. Neither plasma triglycerides nor kallikrein and activated FVII were statistically associated. This may suggest that additional factors are involved in the postprandial FVII activation. No clear evidence for a role of tissue factor expression...... by monocytes, factor XII or insulin in postprandial FVII activation was observed. Tissue factor pathway inhibitor and prothrombin fragment 1+2, a marker of thrombin generation, were not affected postprandially after either the high-fat or the low-fat meals. Our findings indicate that triglyceride...

  4. Synthesis and characterization of (18)F-labeled active site inhibited factor VII (ASIS).

    Science.gov (United States)

    Erlandsson, Maria; Nielsen, Carsten H; Jeppesen, Troels E; Kristensen, Jesper B; Petersen, Lars C; Madsen, Jacob; Kjaer, Andreas

    2015-05-15

    Activated factor VII blocked in the active site with Phe-Phe-Arg-chloromethyl ketone (active site inhibited factor VII (ASIS)) is a 50-kDa protein that binds with high affinity to its receptor, tissue factor (TF). TF is a transmembrane glycoprotein that plays an important role in, for example, thrombosis, metastasis, tumor growth, and tumor angiogenesis. The aim of this study was to develop an (18)F-labeled ASIS derivative to assess TF expression in tumors. Active site inhibited factor VII was labeled using N-succinimidyl-4-[(18)F]fluorobenzoate, and the [(18)F]ASIS was purified on a PD-10 desalting column. The radiochemical yield was 25 ± 6%, the radiochemical purity was >97%, and the pseudospecific radioactivity was 35 ± 9 GBq/µmol. The binding efficacy was evaluated in pull-down experiments, which monitored the binding of unlabeled ASIS and [(18)F]ASIS to TF and to a specific anti-factor VII antibody (F1A2-mAb). No significant difference in binding efficacy between [(18)F]ASIS and ASIS could be detected. Furthermore, [(18)F]ASIS was relatively stable in vitro and in vivo in mice. In conclusion, [(18)F]ASIS has for the first time been successfully synthesized as a possible positron emission tomography tracer to image TF expression levels. In vivo positron emission tomography studies to evaluate the full potential of [(18)F]ASIS are in progress. Copyright © 2015 John Wiley & Sons, Ltd.

  5. Seasonal distribution of active systemic lupus erythematosus and its correlation with meteorological factors

    Directory of Open Access Journals (Sweden)

    Zhang Hua-Li

    2011-01-01

    Full Text Available OBJECTIVE: To explore the characteristics of seasonal distribution of active systemic lupus erythematosus (SLE and the influences of meteorological factors including temperature and humidity on active systemic lupus erythematosus. METHODS: The characteristics of seasonal distribution of active SLE and its correlation with meteorological factors were retrospectively analyzed in 640 patients living in the city of Zhanjiang, China and had active SLE between January 1997 and December 2006. RESULTS: In winter, when there are weaker ultraviolet (UV rays, the ratio of patients with active SLE to total inpatients was 3.89 %o, which is significantly higher than in other seasons with stronger UV rays, including 2.17 %o in spring, 1.87 0 in summer and 2.12 0 in autumn. The number of patients with active SLE had significant negative correlation with mean temperature and was not significantly related to mean humidity. CONCLUSION: Active SLE has the characteristics of seasonal distribution and is associated with temperature. The mechanism remains to be further studied.

  6. Vitamin D inhibits the growth of and virulence factor gene expression by Porphyromonas gingivalis and blocks activation of the nuclear factor kappa B transcription factor in monocytes.

    Science.gov (United States)

    Grenier, D; Morin, M-P; Fournier-Larente, J; Chen, H

    2016-06-01

    Increasing evidence suggests that 1,25-dihydroxyvitamin D3 (1,25(OH)2 D3 ), a fat-soluble secosteroid hormone, has a positive impact on periodontal health through diverse mechanisms. The present study was aimed at investigating the effect of 1,25(OH)2 D3 on the growth of and virulence factor gene expression by the periodontopathogenic bacterium Porphyromonas gingivalis. The effect of 1,25(OH)2 D3 on P. gingivalis-mediated activation of nuclear factor kappa B (NF-κB) transcription factor in monocytes was also assessed. A broth microdilution assay was used to determine the antibacterial activity of 1,25(OH)2 D3 . The modulation of virulence factor gene expression in P. gingivalis was assessed by quantitative reverse transcription-polymerase chain reaction. NF-κB activation was assessed using a human monocytic cell line stably transfected with a luciferase reporter containing NF-κB binding sites. Minimal inhibitory concentrations of 1,25(OH)2 D3 against P. gingivalis ranged from 3.125 to 6.25 μg/mL. Moreover, a partial synergistic effect was observed when 1,25(OH)2 D3 was used in association with metronidazole. 1,25(OH)2 D3 attenuated the virulence of P. gingivalis by reducing the expression of genes coding for important virulence factors, including adhesins (fimA, hagA and hagB) and proteinases (rgpA, rgpB and kgp). 1,25(OH)2 D3 dose-dependently prevented P. gingivalis-induced NF-κB activation in a monocyte model. Our study suggested that 1,25(OH)2 D3 selectively inhibits the growth of and virulence factor gene expression by P. gingivalis, in addition to attenuating NF-κB activation by this periodontopathogen. This dual action on P. gingivalis and the inflammatory response of host cells may be of particular interest with a view to developing a novel and inexpensive preventive/therapeutic strategy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Murine inflammatory factor co-chromatographs with murine interleukin-2 activity

    International Nuclear Information System (INIS)

    Freitas, C.S.; Shinzato, T.O.; Maciel, C.M.M.; Rumjanek, V.M.

    1986-01-01

    In a study of the in vivo effects of semi-purified mouse interleukin-2 (IL-2), inflammatory activity indicated by edema and plasma protein extravasation (PPE) was detected in those fractions having IL-2 activity. The molecular weight of the inflammatory factor activity from conditioned medium was 30 to 48 kDal on the basis of gel filtration on Sephadex G75. The edema, characterized as maximum paw thickness, occurred at 4 h, whereas the PPE peak (measured with 125 I-albumin) occurred 1.5 to 3 h after injection. Both edema and PPE were inhibited by dexamethasone or indomethacin, suggesting the involvement of prostaglandins in the process. This inflammatory activity may be partly responsible for some of the in vivo activities ascribed to IL-2. (author) [pt

  8. Gender Similarities and Differences in Factors Associated with Adolescent Moderate-Vigorous Physical Activity

    Science.gov (United States)

    Wenthe, Phyllis J.; Janz, Kathleen F; Levy, Stephen M.

    2010-01-01

    This study investigated the relationship between predisposing, reinforcing, and enabling factors conceptualized within the Youth Physical Activity Promotion Model (YPAP) and moderate to vigorous physical activity (MVPA) of adolescent males and females. Specifically, self-efficacy to overcome barriers, enjoyment of physical activity; family support, peer support, perceived school climate, neighborhood safety and access to physical activity were examined. The Physical Activity Questionnaire for Adolescents (PAQ-A) and the Actigraph 7164 were used to obtain three different measures of MVPA in 205 adolescents (102 males, 103 females). Family support emerged as the most significant and consistent factor associated with the MVPA of both adolescent males and females. This relationship was noted even when different methods of measuring MVPA were employed. These findings should increase the confidence of public health officials that family support has the potential to positively alter the physical activity behavior of adolescents. PMID:19827453

  9. Activities concerning a re-evaluation of gamma-ray buildup factors in Japan

    International Nuclear Information System (INIS)

    Hirayama, Hideo

    2000-01-01

    Research related to gamma-ray buildup factors in Japan are continuing to improve in accuracy and usefulness after the publication of new standard buildup factors as NUREG/CR-5740. Buildup factors for homogeneous materials were studied by three different calculation methods. Several improvements were made to calculate buildup factors up to 40 mfp for various materials for a wide energy range at each code. Systematic data production of buildup factors for multilayer materials were performed by using the EGS4 Monte Carlo code, and were used to improve the fitting formula. These research activities related to gamma-ray buildup factors performed in Japan are presented together with discussions concerning re-evaluation of buildup factors. (author)

  10. Modifiable factors associated with active pulmonary tuberculosis in a Kenyan prison.

    Science.gov (United States)

    Amwayi, A S; Kikuvi, G M; Muchiri, E M

    2010-02-01

    To establish modifiable factors associated with active pulmonary tuberculosis (PTB) among prisoners. Retrospective matched case-control study. Nakuru GK prison in Kenya. A total of 144 subjects (48 cases and 96 controls) were recruited into the study. Cases were adult prisoners who had at least two initial sputum specimens being Acid Fast Bacilli-positive (AFB+) on direct smear microscopy and hence recruited to PTB WHO DOTS Programme. Controls were adults with no chronic cough and not on PTB treatment six months prior to the study. Independent factors significantly associated with active PTB disease were: self reported HIV+ status (OR=11; 95% CI = 2.42-47.77), evidence of BCG vaccination (OR = 0.20; 95% CI = 0.05-0.60), contact with PTB case (OR = 7.0; 95% CI = 1.17-38.23), unemployment (OR = 9.0; 95% CI = 1.84-43.97) and sharing linen (OR = 4.32; 95%CI = 1.08-17.29). Modifiable factors associated with active PTB in Nakuru G.K prison are: HIV status, BCG vaccination, PTB case contact, poverty and poor personal hygiene. We recommend HIV counselling and testing of all PTB patients, screening for TB upon prison entry and TB contact investigation and improving personal hygiene of prisoners.

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. Predicting Factors Associated with Regular Physical Activity among College Students: Applying BASNEF Model

    Directory of Open Access Journals (Sweden)

    B. Moeini

    2011-10-01

    Full Text Available Introduction & Objective: One of the important problems in modern society is people's sedentary life style. The aim of this study was to determine factors associated with regular physical activity among college students based on BASNEF model.Materials & Methods: This study was a cross-sectional study carried out on 400 students in Hamadan University of Medical Sciences. Based on the assignment among different schools, classified sampling method was chosen for data gathering using a questionnaire in three parts including: demographic information, constructs of BASNEF model, and standard international physical activity questionnaire (IPAQ. Data were analyzed by SPSS-13, and using appropriate statistical tests (Chi-square, T-test and regression. Results: Based on the results, 271 students(67.8 % had low, 124 (31% moderate ,and 5 (1.2% vigorous physical activity. There was a significant relationship (c2=6.739, df= 1, P= 0.034 between their residence and physical activity and students living in dormitory were reported to have higher level of physical activity. Behavioral intention and enabling factors from the constructs of BASNEF model were the best predictors for having physical activity in students (OR=1.215, P = 0.000 and (OR=1.119, P= 0.000 respectively.Conclusion: With regard to the fact that majority of the students did not engage in enough physical activity and enabling factors were the most effective predictors for having regular physical activity in them, it seems that providing sports facilities can promote physical activity among the students.(Sci J Hamadan Univ Med Sci 2011;18(3:70-76

  13. Factors associated with delay in trauma team activation and impact on patient outcomes.

    Science.gov (United States)

    Connolly, Rory; Woo, Michael Y; Lampron, Jacinthe; Perry, Jeffrey J

    2017-09-05

    Trauma code activation is initiated by emergency physicians using physiological and anatomical criteria, mechanism of injury, and patient demographic factors. Our objective was to identify factors associated with delayed trauma team activation. We assessed consecutive cases from a regional trauma database from January 2008 to March 2014. We defined a delay in trauma code activation as a time greater than 30 minutes from the time of arrival. We conducted univariate analysis for factors potentially influencing trauma team activation, and we subsequently used multiple logistic regression analysis models for delayed activation in relation to mortality, length of stay, and time to operative management. Patients totalling 846 were included for our analysis; 4.1% (35/846) of trauma codes were activated after 30 minutes. Mean age was 40.8 years in the early group versus 49.2 in the delayed group (p=0.01). Patients were over age 70 years in 7.6% in the early activation group versus 17.1% in the delayed group (p=0.04). There was no significant difference in sex, type of injury, injury severity, or time from injury between the two groups. There was no significant difference in mortality, median length of stay, or median time to operative management. Delayed activation is linked with increasing age with no clear link to increased mortality. Given the severe injuries in the delayed cohort that required activation of the trauma team, further emphasis on the older trauma patient and interventions to recognize this vulnerable population should be made.

  14. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  15. hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.

    Directory of Open Access Journals (Sweden)

    Shunsuke Ohnishi

    Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.

  16. Characterization of an Equine α-S2-Casein Variant Due to a 1.3 kb Deletion Spanning Two Coding Exons

    Science.gov (United States)

    Brinkmann, Julia; Koudelka, Tomas; Keppler, Julia K.; Tholey, Andreas; Schwarz, Karin; Thaller, Georg; Tetens, Jens

    2015-01-01

    The production and consumption of mare’s milk in Europe has gained importance, mainly based on positive health effects and a lower allergenic potential as compared to cows’ milk. The allergenicity of milk is to a certain extent affected by different genetic variants. In classical dairy species, much research has been conducted into the genetic variability of milk proteins, but the knowledge in horses is scarce. Here, we characterize two major forms of equine αS2-casein arising from genomic 1.3 kb in-frame deletion involving two coding exons, one of which represents an equid specific duplication. Findings at the DNA-level have been verified by cDNA sequencing from horse milk of mares with different genotypes. At the protein-level, we were able to show by SDS-page and in-gel digestion with subsequent LC-MS analysis that both proteins are actually expressed. The comparison with published sequences of other equids revealed that the deletion has probably occurred before the ancestor of present-day asses and zebras diverged from the horse lineage. PMID:26444874

  17. Workplace victimization risk and protective factors for suicidal behavior among active duty military personnel.

    Science.gov (United States)

    Hourani, Laurel L; Williams, Jason; Lattimore, Pamela K; Morgan, Jessica K; Hopkinson, Susan G; Jenkins, Linda; Cartwright, Joel

    2018-04-22

    Workplace victimization is a potential risk factor for suicidal behaviors (SB) among military personnel that has been largely overlooked. This paper examines both the impact of workplace victimization on reported SB and several potential protective factors associated with such suicidal behaviors in a large sample of active duty soldiers. A case-control study was conducted with 71 soldiers who reported SB in the past 12 months, each matched on sociodemographic characteristics to two others without reported suicidal behaviors. A multiple regression model was estimated to assess the effects of risk and protective factors while controlling for other variables. SB was associated with several aspects of victimization, mental health and substance abuse conditions, pain, impulsivity, stressors, negative life events, work-family conflict, active coping behaviors and positive military-related factors. Controlling for other variables, those with SB were more likely to have sought mental health or substance abuse services, to be depressed, anxious, impulsive, and less resilient than non-SB personnel. Study limitations included the use of retrospective self-report data, absence of some known SB predictors, and a population restricted to active duty Army personnel. SB among active duty personnel is associated with victimization since joining the military and is protected by resiliency. These findings suggest that in addition to the usual mental health factors, these additional predictors should be accounted for in SB intervention and prevention planning for active duty personnel. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Perceived influence of intrinsic/extrinsic factors on participation in life activities after spinal cord injury.

    Science.gov (United States)

    Cobb, John E; Leblond, Jean; Dumont, Frédéric S; Noreau, Luc

    2018-04-03

    Various types of limitations on community participation are experienced by people with spinal cord injury (SCI). To determine: 1) the perceived influence of six intrinsic/extrinsic factors (i.e. physical impairment, emotional condition, thinking skills, environment, lack of assistance, discrimination) on participation in 26 life activities, 2) if this influence varied based on extent of participation, and 3) if personal or environmental characteristics influenced perceptions. Secondary analysis of a cohort (SCI Community Survey, n = 1508) using the SCI Person-Perceived Participation in Daily Activities Questionnaire. Frequency tables, Fisher's exact tests and correspondence analyses. Respectively, 79.6% and 38.5% of respondents perceived that their physical impairment and the natural and/or built environment were the main factors that limited participation across all activities. Considering participation between three groups (no participation; less than wanted; as much as wanted), significant differences (p intrinsic/extrinsic factors on participation was not significantly influenced by other personal or environmental characteristics. A majority of people with SCI perceived that their participation is limited by one or more of intrinsic/extrinsic factors. Perceptions regarding which factors influence participation differ between activities and these perceptions appear related to the extent of participation suggesting that those who actively participate could be the most sensitive to limitations in certain activities. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Gc protein-derived macrophage activating factor (GcMAF): isoelectric focusing pattern and tumoricidal activity.

    Science.gov (United States)

    Mohamad, Saharuddin Bin; Nagasawa, Hideko; Sasaki, Hideyuki; Uto, Yoshihiro; Nakagawa, Yoshinori; Kawashima, Ken; Hori, Hitoshi

    2003-01-01

    Gc protein is the precursor for Gc protein-derived macrophage activating factor (GcMAF), with three phenotypes: Gc1f, Gc1s and Gc2, based on its electrophoretic mobility. The difference in electrophoretic mobility is because of the difference in its posttranslational sugar moiety composition. We compared the difference between Gc protein and GcMAF electrophoretic mobility using the isoelectric focusing (IEF) method. The tumoricidal activity of GcMAF-treated macrophage was evaluated after coculture with L-929 cell. The tumoricidal mechanism was investigated using TNF bioassay and nitric oxide (NO) release. The difference in Gc protein and GcMAF electrophoretic mobility was detected. The tumoricidal activity of GcMAF-treated macrophage was detected, but no release of TNF and NO was detected. The difference of isoelectric focusing mobility in Gc protein and GcMAF would be useful to develop a GcMAF detection method. GcMAF increased macrophage tumoricidal activity but TNF and NO release were not involved in the mechanism.

  20. Daboxin P, a Major Phospholipase A2 Enzyme from the Indian Daboia russelii russelii Venom Targets Factor X and Factor Xa for Its Anticoagulant Activity.

    Directory of Open Access Journals (Sweden)

    Maitreyee Sharma

    Full Text Available In the present study a major protein has been purified from the venom of Indian Daboia russelii russelii using gel filtration, ion exchange and Rp-HPLC techniques. The purified protein, named daboxin P accounts for ~24% of the total protein of the crude venom and has a molecular mass of 13.597 kDa. It exhibits strong anticoagulant and phospholipase A2 activity but is devoid of any cytotoxic effect on the tested normal or cancerous cell lines. Its primary structure was deduced by N-terminal sequencing and chemical cleavage using Edman degradation and tandem mass spectrometry. It is composed of 121 amino acids with 14 cysteine residues and catalytically active His48 -Asp49 pair. The secondary structure of daboxin P constitutes 42.73% of α-helix and 12.36% of β-sheet. It is found to be stable at acidic (pH 3.0 and neutral pH (pH 7.0 and has a Tm value of 71.59 ± 0.46°C. Daboxin P exhibits anticoagulant effect under in-vitro and in-vivo conditions. It does not inhibit the catalytic activity of the serine proteases but inhibits the activation of factor X to factor Xa by the tenase complexes both in the presence and absence of phospholipids. It also inhibits the tenase complexes when active site residue (His48 was alkylated suggesting its non-enzymatic mode of anticoagulant activity. Moreover, it also inhibits prothrombinase complex when pre-incubated with factor Xa prior to factor Va addition. Fluorescence emission spectroscopy and affinity chromatography suggest the probable interaction of daboxin P with factor X and factor Xa. Molecular docking analysis reveals the interaction of the Ca+2 binding loop; helix C; anticoagulant region and C-terminal region of daboxin P with the heavy chain of factor Xa. This is the first report of a phospholipase A2 enzyme from Indian viper venom which targets both factor X and factor Xa for its anticoagulant activity.

  1. [Sedentary lifestyle is associated with metabolic and cardiovascular risk factors independent of physical activity].

    Science.gov (United States)

    Leiva, Ana María; Martínez, María Adela; Cristi-Montero, Carlos; Salas, Carlos; Ramírez-Campillo, Rodrigo; Díaz Martínez, Ximena; Aguilar-Farías, Nicolás; Celis-Morales, Carlos

    2017-04-01

    Sedentary behavior is a main risk factor for cardiovascular disease and mortality. To investigate the association between sedentary behavior and metabolic and cardiovascular risk factors. We assessed 322 participants aged between 18 to 65 years. Physical activity and sedentary behavior were measured with accelerometers (Actigraph®). Body mass index (BMI), waist circumference, percentage of body fat, diet and blood markers (glucose, lipid profile, insulin and HOMA-IR) were measured with standardized protocols. Thirty four percent of participants were physically inactive and spent on average 8.7 h/day on sedentary activities. Per one hour increase in sedentary behavior there were significant adverse changes in glucose (4.79 mg/dl), insulin (2.73 pmol/l), HOMA-IR (0.75), BMI (0.69 kg/m²), waist circumference (1.95 cm), fat mass (1.03%), total cholesterol (9.73 mg/dl), HDL-cholesterol (-3.50 mg/dl), LDL-cholesterol (10.7 mg/dl) and triglycerides (12.4 mg/dl). These findings were independent of main confounding factors including total physical activity, dietary factors, BMI and socio-demographics. The detrimental effect of sedentary behaviors on cardiometabolic and obesity-related traits is independent of physical activity levels. Therefore, reducing sedentary time should be targeted in the population apart from increasing their physical activity levels.

  2. Associations between Socio-Motivational Factors, Physical Education Activity Levels and Physical Activity Behavior among Youth

    Science.gov (United States)

    Ning, Weihong; Gao, Zan; Lodewyk, Ken

    2012-01-01

    This study examined the relationships between established socio-motivational factors and children's physical activity levels daily and during physical education classes. A total of 307 middle school students (149 boys, 158 girls) from a suburban public school in the Southern United States participated in this study. Participants completed…

  3. A novel assay system for macrophage-activating factor activity using a human U937 cell line.

    Science.gov (United States)

    Ishikawa, Mami; Inoue, Takahiro; Inui, Toshio; Kuchiike, Daisuke; Kubo, Kentaro; Uto, Yoshihiro; Nishikata, Takahito

    2014-08-01

    Macrophages play important roles in antitumor immunity, and immunotherapy with the group-specific component protein-derived macrophage-activating factor (GcMAF) has been reported to be effective in patients with various types of cancers. However, in macrophage research, it is important to properly evaluate macrophage activity. U937 macrophages were induced by 12-O-tetradecanoyl-13-phorbolacetate (TPA). The phagocytic activity of macrophages was evaluated as the internalized beads ratio. The MAF activity was assessed at 30 min after MAF addition as the activation ratio. We established a novel assay for phagocytic activities using differentiated U937 macrophages. The novel protocol was simple and rapid and was sensitive for GcMAF. This protocol should be useful not only for basic studies, such as those on molecular mechanisms underlying macrophage activation, but also for clinical studies, such as assessment of GcMAF activity prior to clinical use. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  4. Structural definition of a potent macrophage activating factor derived from vitamin D3-binding protein with adjuvant activity for antibody production.

    Science.gov (United States)

    Yamamoto, N

    1996-10-01

    Incubation of human vitamin D3-binding protein (Gc protein), with a mixture of immobilized beta-galactosidase and sialidase, efficiently generated a potent macrophage activating factor, a protein with N-acetylgalactosamine as the remaining sugar. Stepwise incubation of Gc protein with immobilized beta-galactosidase and sialidase, and isolation of the intermediates with immobilized lectins, revealed that either sequence of hydrolysis of Gc glycoprotein by these glycosidases yields the macrophage-activating factor, implying that Gc protein carries a trisaccharide composed of N-acetylgalactosamine and dibranched galactose and sialic acid termini. A 3 hr incubation of mouse peritoneal macrophages with picomolar amounts of the enzymatically generated macrophage-activating factor (GcMAF) resulted in a greatly enhanced phagocytic activity. Administration of a minute amount (10-50 pg/mouse) of GcMAF resulted in a seven- to nine-fold enhanced phagocytic activity of macrophages. Injection of sheep red blood cells (SRBC) along with GcMAF into mice produced a large number of anti-SRBC antibody secreting splenic cells in 2-4 days.

  5. CORRELATION BETWEEN PREEXPONENTIAL FACTOR AND ACTIVATION ENERGY OF ISOAMYLALCOHOL HYDROGENOLYSIS ON PLATINUM CATALYSTS

    Directory of Open Access Journals (Sweden)

    Triyono Triyono

    2010-06-01

    Full Text Available Arrhenius equation stated that reaction will proceed faster at higher temperature and with lower activation energy (Ea. Many literatures reported that preexponential factor (A is constant for certain reaction and there is no relation between A and Ea. Experiment on the reaction of isoamylalcohol hydrogenolysis showed that logarithm of A increased linearly with Ea. The result of this investigation suggests that the rate of a process is affected by the number of active centers on the surface of a catalysts, which influences the value of the pre-exponential term in the expression for the rate constant of a reaction. An increase in the number of active centers corresponds to a higher value of A, the active centers would be less effective and is attended by a growth in the value of Ea. Therefore, reaction with lower activation energy will not always has higher reaction rate due to decreasing of Ea.   Keywords: isoamylalcohol hydrogenolysis, preexponential factor, activation  energy.

  6. Factors associated with non-reimbursable activity on an inpatient pediatric consultation-liaison service.

    Science.gov (United States)

    Bierenbaum, Melanie L; Katsikas, Steven; Furr, Allen; Carter, Bryan D

    2013-12-01

    The aim of this study was to identify factors contributing to clinician time spent in non-reimbursable activity on an inpatient pediatric consultation-liaison (C-L) service. A retrospective study was conducted using inpatient C-L service data on 1,246 consecutive referrals. For this patient population, the strongest predictor of level of non-reimbursable clinical activity was illness chronicity and the number of contacts with C-L service clinicians during their hospital stay. Patients with acute life-threatening illnesses required the highest mean amount of non-reimbursable service activity. On average, 28 % of total clinician time in completing a hospital consultation was spent in non-reimbursable activity. Effective C-L services require a proportion of time spent in non-reimbursable clinical activity, such as liaison and coordinating care with other providers. Identifying referral and systemic factors contributing to non-reimbursable activity can provide insight into budgeting/negotiating for institutional support for essential clinical and non-clinical functions in providing competent quality patient care.

  7. Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

    1989-05-01

    Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

  8. Laterality of Brain Activation for Risk Factors of Addiction.

    Science.gov (United States)

    Gordon, Harold W

    2016-01-01

    Laterality of brain activation is reported for tests of risk factors of addiction- impulsivity and craving-but authors rarely address the potential significance of those asymmetries. The purpose of this study is to demonstrate this laterality and discuss its relevance to cognitive and neurophysiological asymmetries associated with drug abuse vulnerability in order to provide new insights for future research in drug abuse. From published reports, brain areas of activation for two tests of response inhibition or craving for drugs of abuse were compiled from fMRI activation peaks and were tabulated for eight sections (octants) in each hemisphere. Percent asymmetries were calculated (R-L/R+L) across studies for each area. For impulsivity, most activation peaks favored the right hemisphere. Overall, the percent difference was 32% (Χ2 = 16.026; p laterality into consideration is a missed opportunity in designing studies and gaining insight into the etiology of drug abuse and pathways for treatment.

  9. Factors of physical activity among Chinese children and adolescents : A systematic review

    NARCIS (Netherlands)

    Lu, Congchao; Stolk, Ronald P.; Sauer, Pieter J. J.; Sijtsma, Anna; Wiersma, Rikstje; Huang, Guowei; Corpeleijn, Eva

    2017-01-01

    Background: Lack of physical activity is a growing problem in China, due to the fast economic development and changing living environment over the past two decades. The aim of this review is to summarize the factors related to physical activity in Chinese children and adolescents during this

  10. Adolescent Physical Activity: Moderation of Individual Factors by Neighborhood Environment.

    Science.gov (United States)

    D'Angelo, Heather; Fowler, Stephanie L; Nebeling, Linda C; Oh, April Y

    2017-06-01

    Less than a third of U.S. adolescents meet federal physical activity (PA) guidelines. Understanding correlates of PA at multiple levels of the Social Ecological Model could improve PA interventions among youth. This study examines (1) associations between factors across the Social Ecological Model including psychosocial factors, perceived neighborhood physical and social environment characteristics, and adolescent moderate to vigorous PA (MVPA) and (2) whether perceived neighborhood characteristics moderate associations between psychosocial factors and MVPA. A national sample of adolescents (aged 12-17 years) in the 2014 Family Life, Activity, Sun, Health, and Eating Study was used to examine associations between psychosocial characteristics, perceived neighborhood social and physical characteristics, and self-reported weekly minutes of MVPA. Analyses were conducted in 2015. Interaction terms between psychosocial and neighborhood variables were added to multiple linear regression models to examine moderation hypotheses. Significant two-way interactions revealed that neighborhoods with features perceived as supportive of PA strengthened several psychosocial-MVPA associations. The positive associations between MVPA and friend norms, friend support, and attitudes were strengthened for adolescents living in neighborhoods with high versus low PA resource availability (all p<0.05). Furthermore, the association between controlled and autonomous motivation and MVPA was strengthened under conditions of shops/stores near (versus distant from) adolescents' homes (p<0.05). The association between some psychosocial factors and adolescent MVPA may be environment dependent. Neighborhood physical and social environments supportive of PA are important to consider when developing targeted PA interventions and may strengthen the association between psychosocial-level factors and adolescent MVPA. Copyright © 2017 American Journal of Preventive Medicine. All rights reserved.

  11. Single-chain vascular endothelial growth factor variant with antagonist activity

    DEFF Research Database (Denmark)

    Boesen, Thomas P; Soni, Bobby; Schwartz, Thue W

    2002-01-01

    receptor molecules and inducing dimerization. By mixing two vascular endothelial growth factor monomers, each with different substitutions, heterodimers with only one active receptor binding site have previously been prepared. These heterodimers bind the receptor molecule but are unable to induce...... dimerization and activation. However, preparation of heterodimers is cumbersome, involving separate expression of different monomers, refolding the mixture, and separating heterodimers from homodimers. Here we show that a fully functional ligand can efficiently be expressed as a single protein chain containing...

  12. MOTIVATIONAL FACTORS RELATED TO THE PRACTICE OF PHYSICAL ACTIVITIES OF THE ELDERLY

    Directory of Open Access Journals (Sweden)

    Agnes Navarro Cabral da Silva

    2017-01-01

    Full Text Available The aim of this study was to investigate the motivational factors for older adults to practice physical activities regularly. The sample consisted of 77 elderly of both genders, aged 55 to 90 years and who were practicing physical activities for at least a month in centers of sports and leisure in the city of Indaiatuba. The inventory IMPRAF-54 (Motivation for the Regular Practice of Physical Activity Inventory was used for data collection. This instrument covers 6 dimensions of motivation for the practice of physical activities: stress control, health, sociability, competitiveness, aesthetic and pleasure. The results showed that the main motivational factor for the elderly is health. After health, sociability, pleasure and control of stress appear tied and, finally, aesthetics and competitiveness. With these results, it is possible to know what encourages older adults to attend classes and to plan for them properly, including their interests and considering them holistically.

  13. Scintigraphic measurement of the contractile activity of the gastric antrum using factor analysis

    International Nuclear Information System (INIS)

    Bergmann, H.; Hoebart, J.; Kugi, A.; Stacher, G.; Granser, G.V.

    1990-01-01

    The motor activity of the gastric antrum is difficult to record by manometric means and scintigraphic methods have proved unsatisfactory so far as no consistent relationship between antral contractile activity and gastric emptying rate could be detected. We investigated, using data recorded in 16 healthy human subjects after the ingestion of a semisolid standard meal, whether a newly developed method employing factor analysis would yield more meaningful and reproducible results. Factor analysis was applied to sequential scintigraphic images (3-s frame time) of gastric antrum. The computed factor images and the respective factor curves are representative of distinct dynamic structures of the antrum. From the more or less sinusoidal excursions of the factor curves, which exhibited the 3 cycles per minute frequency characteristic for the stomach, amplitude, frequency and propagation velocity of antral contractions can be calculated. The amplitudes of the factor curves were used to calculate a contraction index. This contraction index was found to be correlated significantly negatively with the gastric half-emptying time of the ingested meal. The employed factor analytical approach thus seems a promising tool to further investigate the role of antral contractility in the process of gastric emptying. (Authors)

  14. Safety update on the use of recombinant activated factor VII in approved indications.

    Science.gov (United States)

    Neufeld, Ellis J; Négrier, Claude; Arkhammar, Per; Benchikh el Fegoun, Soraya; Simonsen, Mette Duelund; Rosholm, Anders; Seremetis, Stephanie

    2015-06-01

    This updated safety review summarises the large body of safety data available on the use of recombinant activated factor VII (rFVIIa) in approved indications: haemophilia with inhibitors, congenital factor VII (FVII) deficiency, acquired haemophilia and Glanzmann's thrombasthenia. Accumulated data up to 31 December 2013 from clinical trials as well as post-marketing data (registries, literature reports and spontaneous reports) were included. Overall, rFVIIa has shown a consistently favourable safety profile, with no unexpected safety concerns, in all approved indications. No confirmed cases of neutralising antibodies against rFVIIa have been reported in patients with congenital haemophilia, acquired haemophilia or Glanzmann's thrombasthenia. The favourable safety profile of rFVIIa can be attributed to the recombinant nature of rFVIIa and its localised mechanism of action at the site of vascular injury. Recombinant FVIIa activates factor X directly on the surface of activated platelets, which are present only at the site of injury, meaning that systemic activation of coagulation is avoided and the risk of thrombotic events (TEs) thus reduced. Nonetheless, close monitoring for signs and symptoms of TE is warranted in all patients treated with any pro-haemostatic agent, including rFVIIa, especially the elderly and any other patients with concomitant conditions and/or predisposing risk factors to thrombosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Essential Oil from Cryptomeria japonica Induces Apoptosis in Human Oral Epidermoid Carcinoma Cells via Mitochondrial Stress and Activation of Caspases

    OpenAIRE

    Cha, Jeong-Dan; Kim, Ji-Young

    2012-01-01

    Cryptomeria japonica D. Don (C. japonica) has been used in traditional medicines from Asia for a variety of indications, including liver ailments, and an antitussive, and for its antiulcer activities. We examined the cell viability and apoptosis of KB cells treated with C. japonica essential oil at several concentrations for 12 h by MTT assay, Hoechst-33258 dye staining, DNA fragmentation, flow cytometry (cell cycle), and Western blotting for mitochondria stress, activation of caspases, and p...

  16. Changes in antagonistic activity of lactic acid bacteria induced by their response to technological factors

    Directory of Open Access Journals (Sweden)

    Dovile Jonkuviene

    2015-12-01

    Full Text Available This study examined the changes in antagonistic activity of selected lactic acid bacteria (LAB in response to technological factors used in food production. The antimicrobial activity of 12 selected LAB strains was assessed against the bacterial and fungal strains using the agar well diffusion method. Sodium chloride (NaCl 6.5–8.0%, glucose 20-30% and pH 4.0, pH 8.0 and higher were the most crucial factors in reducing the spectra of the microorganisms antagonized. Heating at 80 °C or 100 °C had a greater negative impact than 63 °C on the antifungal activity of LAB. Freezing at –72 °C eliminated the antifungal activity, or it changed from fungicidal to fungistatic. Although each LAB demonstrated the ability to retain antimicrobial activity induced by various technological factors, Lactococcus lactis 768/5 was superior in retaining high antimicrobial activity against tested indicator strains.

  17. Is sunspot activity a factor in influenza pandemics?

    Science.gov (United States)

    Qu, Jiangwen

    2016-09-01

    The 2009 AH1N1 pandemic became a global health concern, although fortunately, its worst anticipated effects were not realised. While the origins of such outbreaks remain poorly understood, it is very important to identify the precipitating factors in their emergence so that future pandemics can be detected as quickly as possible. Methords: Descriptive epidemiology was used to analyse the association between influenza pandemics and possible pandemics and relative number of sunspots. Non-conditional logistic regression was performed to analyse the statistical association between sunspot extremes and influenza pandemics to within plus or minus 1 year. Almost all recorded influenza/possible pandemics have occurred in time frames corresponding to sunspot extremes, or +/- 1 year within such extremes. These periods were identified as important risk factors in both possible and confirmed influenza pandemics (odds ratio: 3.87; 95% confidence interval: 1.08 to 13.85). Extremes of sunspot activity to within plus or minus 1 year may precipitate influenza pandemics. Mechanisms of epidemic initiation and early spread are discussed including primary causation by externally derived viral variants (from space via cometary dust). Efforts to construct a comprehensive early warning system for potential influenza and other viral pandemics that include analysis of sunspot activity and stratospheric sampling for viral variants should be supported. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  18. An approach to build knowledge base for reactor accident diagnostic system using statistical method

    International Nuclear Information System (INIS)

    Kohsaka, Atsuo; Yokobayashi, Masao; Matsumoto, Kiyoshi; Fujii, Minoru

    1988-01-01

    In the development of a rule based expert system, one of key issues is how to build a knowledge base (KB). A systematic approach has been attempted for building an objective KB efficiently. The approach is based on the concept that a prototype KB should first be generated in a systematic way and then it is to be modified and/or improved by expert for practical use. The statistical method, Factor Analysis, was applied to build a prototype KB for the JAERI expert system DISKET using source information obtained from a PWR simulator. The prototype KB was obtained and the inference with this KB was performed against several types of transients. In each diagnosis, the transient type was well identified. From this study, it is concluded that the statistical method used is useful for building a prototype knowledge base. (author)

  19. Athlete and Coach Relationship as a Factor of the Success in Sports Activities

    Directory of Open Access Journals (Sweden)

    Svetlova A.A.,

    2014-11-01

    Full Text Available We present the results of a theoretical analysis of the psychological bases of success of athletes. We provide an overview of studies of the factors influencing the success of the activities in the sport. Sports activities are considered as a joint activity of athlete and coach, the success of which is affected by the personal qualities and characteristics of the relationship of its members. We summarize the main approaches to the study of personality and social psychological aspects of successful athletes and coaches. As the main factors in the success of sports activities, we considered individual psychological characteristics of athletes (motives, attitudes, modes of behavior and response, and socio-psychological characteristics of the interaction of coach and athlete (leadership style, the nature of interpersonal relationships and role expectations. We emphasize the importance of mutual role expectations of athlete and coach to achieve high results of sports activity.

  20. Transcription Factor NF-IL6 (C/EBPbeta) Activates the Expression of the Mouse MHC Class I H2-Kb Gene in Response to TNF-alpha via the Intragenic Downstream Regulatory Element

    Czech Academy of Sciences Publication Activity Database

    Hatina, J.; Jansa, Petr; Reischig, J.

    2002-01-01

    Roč. 22, - (2002), s. 741-749 ISSN 1079-9907 R&D Projects: GA MŠk(CZ) LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : Mouse MHC Class I Gene, Intragenic Downstream Regulatory Element Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.885, year: 2002

  1. Possible mechanisms for arsenic-induced proliferative diseases

    Energy Technology Data Exchange (ETDEWEB)

    Wetterhahn, K.E.; Dudek, E.J.; Shumilla, J.A. [Dartmouth College and Medical School, Hanover, NH (United States)] [and others

    1996-12-31

    Possible mechanisms for cardiovascular diseases and cancers which have been observed on chronic exposure to arsenic have been investigated. We tested the hypothesis that nonlethal levels of arsenic are mitogenic, cause oxidative stress, increase nuclear translocation of trans-acting factors, and increase expression of genes involved in proliferation. Cultured porcine vascular (from aorta) endothelial cells were used as a model cell system to study the effects of arsenic on the target cells for cardiovascular diseases. Treatment of postconfluent cell cultures with nonovertly toxic concentrations of arsenite increased DNA synthesis, similar to the mitogenic response observed with hydrogen peroxide. Within 1 hour of adding noncytotoxic concentrations of arsenite, cellular levels of oxidants increased relative to control levels, indicating that arsenite promotes cellular oxidations. Arsenite treatment increased nuclear translocation of NF-{kappa}B, an oxidative stress-responsive transcription factor, in a manner similar to that observed with hydrogen peroxide. Pretreatment of intact cells with the antioxidants N-acetylcysteine and dimethylfumarate prevented the arsenite-induced increases in cellular oxidant formation and NF-KB translocation. Arsenite had little or no effect on binding of NF-KB to its DNA recognition sequence in vitro, indicating that it is unlikely that arsenite directly affects NF-KB. The steady-state mRNA levels of intracellular adhesion molecule and urokinase-like plasminogen activator, genes associated with the active endothelial phenotype in arteriosclerosis and cancer metastasis, were increased by nontoxic concentrations of arsenite. These data suggest that arsenite promotes proliferative diseases like heart disease and cancer by activating oxidant-sensitive endothelial cell signaling and gene expression. It is possible that antioxidant therapy would be useful in preventing arsenic-induced cardiovascular disease and cancer.

  2. Factor IX gene haplotypes in Amerindians.

    Science.gov (United States)

    Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

    1997-02-01

    We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

  3. Barriers and motivational factors towards physical activity in COPD - an interview based pilot study

    DEFF Research Database (Denmark)

    Østergaard, Elisabeth Bomholt; Sritharan, Sophia Sajitha; Thomsen, Pernille Maja

    2018-01-01

    Title Barriers and motivational factors towards physical activity in COPD - an interview based pilot study Authors Elisabeth Bomholt Østergaard, Sophia Sajitha Sritharan, Pernille Maja Thomsen, Anne Dal Kristiansen, Anders Løkke Background: Surprisingly few people in Denmark with Chronic...... Obstructive Pulmonary Disease (COPD) engage in physical activity even though it is evident that pulmonary rehabilitation has positive effects on activity level, dyspnea, anxiety, fatigue and quality of life. Aims: To explore why people with COPD do not engage in physical activity and their motivational...... factors for being physically active. Methods: Fieldwork among five people with COPD in Jutland, Denmark 2013-2016 using qualitative semi-structured interviews. Supplementary short semistructured interviews with three general practitioners, and participation in a closed Facebook-group for people with COPD...

  4. The impact of physical activity on cumulative cardiovascular disease risk factors among Malaysian adults.

    Science.gov (United States)

    Rasiah, Rajah; Thangiah, Govindamal; Yusoff, Khalid; Manikam, Rishya; Chandrasekaran, Sankara Kumar; Mustafa, Rujhan; Bakar, Najmin Binti Abu

    2015-12-16

    Numerous studies have shown the importance of physical activity in reducing the morbidity and mortality rates caused by cardiovascular disease (CVD). However, most of these studies emphasise little on the cumulative effect of CVD risk factors. Hence, this study investigates the association between physical exercise and cumulative CVD risk factors among adults in three different age groups. Using a sample of 7276 respondents drawn from community centers, the REDISCOVER team gathered information on physical activity, CVD risk factors (obesity, diabetes, hypertension, hypercholesterolemia, tobacco use) and socioeconomic and demographic variables in Malaysia. Because the study required medical examination, a convenience sampling frame was preferred in which all volunteers were included in the study. Fasting blood samples and anthropometric (height, weight and more) measurements were collected by trained staffs. Socio-demographic and physical activity variables were recorded through questionnaires. A Chi-square test was performed to identify the bivariate association between the covariates (socioeconomic variables, demographic variables and physical activity) and outcome variable. The association between the main exposure, physical activity, and the outcome variable, cumulative CVD risk factors, was assessed using an ordinal logistic regression model, controlling for socioeconomic status and demographic influences in three different age groups, 35-49, 50-64 and 65 and above. The mean age of participants is 51.8 (SD = 9.4). Respondents in the age groups of 35-49 (aORmoderate = 0.12; 95 % CI: 0.02 - 0.53 ) and 65 and above (aORhigh = 0.58; 95 % CI: 0.24, 0.78) showed a statistically significant inverse relationship between physical activity and cumulative CVD risk factors. However, this relationship was not significant among respondents in the 50-64 age group suggesting the possible influence of other variables, such as stress and environment. The

  5. Nitric oxide mediates angiogenesis induced in vivo by platelet-activating factor and tumor necrosis factor-alpha.

    Science.gov (United States)

    Montrucchio, G.; Lupia, E.; de Martino, A.; Battaglia, E.; Arese, M.; Tizzani, A.; Bussolino, F.; Camussi, G.

    1997-01-01

    We evaluated the role of an endogenous production of nitric oxide (NO) in the in vitro migration of endothelial cells and in the in vivo angiogenic response elicited by platelet-activating factor (PAF), tumor necrosis factor-alpha (TNF), and basic fibroblast growth factor (bFGF). The NO synthase inhibitor, N omega-nitro-L-arginine-methyl ester (L-NAME), but not its enantiomer D-NAME, prevented chemotaxis of endothelial cells induced in vitro by PAF and by TNF. The motogenic activity of TNF was also inhibited by WEB 2170, a specific PAF-receptor antagonist. In contrast, chemotaxis induced by bFGF was not prevented by L-NAME or by WEB 2170. Angiogenesis was studied in vivo in a murine model in which Matrigel was used as a vehicle for the delivery of mediators. In this model, the angiogenesis induced by PAF and TNF was inhibited by WEB 2170 and L-NAME but not by D-NAME. In contrast, angiogenesis induced by bFGF was not affected by L-NAME or by WEB 2170. TNF, but not bFGF, induced PAF synthesis within Matrigel. These results suggest that NO mediates the angiogenesis induced by PAF as well as that induced by TNF, which is dependent on the production of PAF. In contrast, the angiogenic effect of bFGF appears to be both PAF and NO independent. Images Figure 3 Figure 4 PMID:9250168

  6. The contribution of ketone bodies to basal and activity-dependent neuronal oxidation in vivo.

    Science.gov (United States)

    Chowdhury, Golam M I; Jiang, Lihong; Rothman, Douglas L; Behar, Kevin L

    2014-07-01

    The capacity of ketone bodies to replace glucose in support of neuronal function is unresolved. Here, we determined the contributions of glucose and ketone bodies to neocortical oxidative metabolism over a large range of brain activity in rats fasted 36 hours and infused intravenously with [2,4-(13)C₂]-D-β-hydroxybutyrate (BHB). Three animal groups and conditions were studied: awake ex vivo, pentobarbital-induced isoelectricity ex vivo, and halothane-anesthetized in vivo, the latter data reanalyzed from a recent study. Rates of neuronal acetyl-CoA oxidation from ketone bodies (V(acCoA-kbN)) and pyruvate (V(pdhN)), and the glutamate-glutamine cycle (V(cyc)) were determined by metabolic modeling of (13)C label trapped in major brain amino acid pools. V(acCoA-kbN) increased gradually with increasing activity, as compared with the steeper change in tricarboxylic acid (TCA) cycle rate (V(tcaN)), supporting a decreasing percentage of neuronal ketone oxidation: ∼100% (isoelectricity), 56% (halothane anesthesia), 36% (awake) with the BHB plasma levels achieved in our experiments (6 to 13 mM). In awake animals ketone oxidation reached saturation for blood levels >17 mM, accounting for 62% of neuronal substrate oxidation, the remainder (38%) provided by glucose. We conclude that ketone bodies present at sufficient concentration to saturate metabolism provides full support of basal (housekeeping) energy needs and up to approximately half of the activity-dependent oxidative needs of neurons.

  7. Factors predicting physical activity among children with special needs.

    Science.gov (United States)

    Yazdani, Shahram; Yee, Chu Tang; Chung, Paul J

    2013-07-18

    Obesity is especially prevalent among children with special needs. Both lack of physical activity and unhealthful eating are major contributing factors. The objective of our study was to investigate barriers to physical activity among these children. We surveyed parents of the 171 children attending Vista Del Mar School in Los Angeles, a nonprofit school serving a socioeconomically diverse group of children with special needs from kindergarten through 12th grade. Parents were asked about their child's and their own physical activity habits, barriers to their child's exercise, and demographics. The response rate was 67%. Multivariate logistic regression was used to examine predictors of children being physically active at least 3 hours per week. Parents reported that 45% of the children were diagnosed with attention deficit hyperactivity disorder, 38% with autism, and 34% with learning disabilities; 47% of children and 56% of parents were physically active less than 3 hours per week. The top barriers to physical activity were reported as child's lack of interest (43%), lack of developmentally appropriate programs (33%), too many behavioral problems (32%), and parents' lack of time (29%). However, child's lack of interest was the only parent-reported barrier independently associated with children's physical activity. Meanwhile, children whose parents were physically active at least 3 hours per week were 4.2 times as likely to be physically active as children whose parents were less physically active (P = .01). In this group of students with special needs, children's physical activity was strongly associated with parental physical activity; parent-reported barriers may have had less direct effect. Further studies should examine the importance of parental physical activity among children with special needs.

  8. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    Science.gov (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  9. New Insights into Butyrylcholinesterase Activity Assay: Serum Dilution Factor as a Crucial Parameter.

    Directory of Open Access Journals (Sweden)

    Joanna Jońca

    Full Text Available Butyrylcholinesterase (BChE activity assay and inhibitor phenotyping can help to identify patients at risk of prolonged paralysis following the administration of neuromuscular blocking agents. The assay plays an important role in clinical chemistry as a good diagnostic marker for intoxication with pesticides and nerve agents. Furthermore, the assay is also commonly used for in vitro characterization of cholinesterases, their toxins and drugs. There is still lack of standardized procedure for measurement of BChE activity and many laboratories use different substrates at various concentrations. The purpose of this study was to validate the BChE activity assay to determine the best dilution of human serum and the most optimal concentration of substrates and inhibitors. Serum BChE activity was measured using modified Ellman's method applicable for a microplate reader. We present our experience and new insights into the protocol for high-throughput routine assays of human plasma cholinesterase activities adapted to a microplate reader. During our routine assays used for the determination of BChE activity, we have observed that serum dilution factor influences the results obtained. We show that a 400-fold dilution of serum and 5mM S-butyrylthiocholine iodide can be successfully used for the accurate measurement of BChE activity in human serum. We also discuss usage of various concentrations of dibucaine and fluoride in BChE phenotyping. This study indicates that some factors of such a multicomponent clinical material like serum can influence kinetic parameters of the BChE. The observed inhibitory effect is dependent on serum dilution factor used in the assay.

  10. WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma

    NARCIS (Netherlands)

    Stec, I.; Wright, T. J.; van Ommen, G. J.; de Boer, P. A.; van Haeringen, A.; Moorman, A. F.; Altherr, M. R.; den Dunnen, J. T.

    1998-01-01

    Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4 (4p16.3). The smallest region of overlap between WHS patients, the WHS critical region, has been confined to 165 kb, of which the complete sequence is known. We

  11. Quantitative PET Imaging of Tissue Factor Expression Using 18F-labled Active Site Inhibited Factor VII

    DEFF Research Database (Denmark)

    Nielsen, Carsten H; Erlandsson, Maria; Jeppesen, Troels E

    2016-01-01

    Tissue factor (TF) is up regulated in many solid tumors and its expression is linked to tumor angiogenesis, invasion, metastasis and prognosis. A non-invasive assessment of tumor TF expression status is therefore of obvious clinical relevance. Factor VII (FVII) is the natural ligand to TF. Here we...... report the development of a new PET tracer for specific imaging of TF using an (18)F-labeled derivative of FVII. METHODS: Active site inhibited factor VIIa (FVIIai) was obtained by inactivation with phenylalanine-phenylalanine-arginine-chloromethyl ketone. FVIIai was radiolabeled with N-succinimidyl 4......-[(18)F]-fluorobenzoate ([(18)F]SFB) and purified. The corresponding product, [(18)F]FVIIai, was injected into nude mice with subcutaneous human pancreatic xenograft tumors (BxPC-3) and investigated using small animal PET/CT imaging 1, 2 and 4 hours after injection. Ex vivo biodistribution was performed...

  12. Prevalence of factors related to active reproductive health behavior: a cross-sectional study Indonesian adolescent

    Directory of Open Access Journals (Sweden)

    Tantut Susanto

    2016-09-01

    Full Text Available OBJECTIVES Complex and diverse factors are related to reproductive health (RH behavior among adolescents according to the social and cultural context of each countries. This study examined the prevalence of active RH and factors related to active RH behavior among Indonesian adolescents. METHODS A cross-sectional study was conducted among 1,040 of students who were selected through a multi-stage random sampling technique. A self-administered questionnaire was developed, including the World Health Organization Illustrative Questionnaire for Interview-Surveys with Young People, pubertal development scale, and sexual activity scale, modified in accordance to the Indonesian context. The data were analyzed using descriptive and comparative statistics, as well as logistic regression analyses. RESULTS The prevalence of active RH behavior were more higher in boys (56.6%; 95% confidence interval [CI], 50.6% to 62.6% than in girls (43.7%; 95% CI, 37.6% to 49.8%. Negative attitudes towards RH were a factor related to active RH behavior in both boys and girls. Smoking and kind relationship envisioned before marriage (pacaran [courtship] and nikah siri [non-registered marriage] were factors related to active RH behavior in boys; whereas the absence of access to information on substance abuse was an additional factor in girls. Moreover, an interaction was found between access to information on development and smoking (boys and attitudes on RH (girls as independent variables associated with active RH behavior. CONCLUSIONS Sex education for adolescents in Indonesia, particularly in the context of a health promotion program, should be developed based on prevalent social, cultural, and religious values to prevent active RH behavior. Such programs should focus on the kind of relationship envisioned before marriage and smoking for boys and access to information on subtance abuse for girls.

  13. Chronic intermittent hypoxia activates nuclear factor-κB in cardiovascular tissues in vivo

    International Nuclear Information System (INIS)

    Greenberg, Harly; Ye Xiaobing; Wilson, David; Htoo, Aung K.; Hendersen, Todd; Liu Shufang

    2006-01-01

    Obstructive sleep apnea (OSA) is an important risk factor for cardiovascular morbidity and mortality. The mechanisms through which OSA promotes the development of cardiovascular disease are poorly understood. In this study, we tested the hypotheses that chronic exposure to intermittent hypoxia and reoxygenation (CIH) is a major pathologic factor causing cardiovascular inflammation, and that CIH-induces cardiovascular inflammation and pathology by activating the NF-κB pathway. We demonstrated that exposure of mice to CIH activated NF-κB in cardiovascular tissues, and that OSA patients had markedly elevated monocyte NF-κB activity, which was significantly decreased when obstructive apneas and their resultant CIH were eliminated by nocturnal CPAP therapy. The elevated NF-κB activity induced by CIH is accompanied by and temporally correlated to the increased expression of iNOS protein, a putative and important NF-κB-dependent gene product. Thus, CIH-mediated NF-κB activation may be a molecular mechanism linking OSA and cardiovascular pathologies seen in OSA patients

  14. [Determinants of the elevated factor VIII activity in patients following venous thromboembolism].

    Science.gov (United States)

    Lech, Monika; Kościelniak, Barbara; Bryk, Agata; Undas, Anetta

    2016-01-01

    Activity of factor VIII (FVIII) increased above 150% of reference range predisposes to venous thromboembolism (VTE). The aim of this study was to identify predictors of increased FVIII activity in patients following VTE. 241 (38% men) patients presented due to objectively documented VTE episode at least 3 months ago were included in this study. FVIII activity was measured using a clotting assay on the analyzer BCS XP. Among 241 patients with VTE, activity of FVIII above 150% (FVIII ≥ 150%) was observed in 96 (40%). These patients were older (p = 0.035) and their concentrations of fibrinogen and C-reactive protein (CRP) were higher by 12% and 88% (p 200%) and this group was also older (p = 0.015), more patients in that group had obesity (p = 0.015), idiopathic VTE (p = 0.043), less of them had positive family history (p = 0.010) and they were characterized by fibrinogen and CRP increased by 28% (p 200% (p = 0.016). The activity of FVIII in patients after VTE episode is influenced by age, concentration of fibrinogen, bilirubin, hemoglobin, glucose, CRP and homocysteine. Our results suggest the role of environmental factors, mainly inflammatory response in maintaining elevated FVIII activity following VTE.

  15. Phenobarbital indirectly activates the constitutive active androstane receptor (CAR) by inhibition of epidermal growth factor receptor signaling.

    Science.gov (United States)

    Mutoh, Shingo; Sobhany, Mack; Moore, Rick; Perera, Lalith; Pedersen, Lee; Sueyoshi, Tatsuya; Negishi, Masahiko

    2013-05-07

    Phenobarbital is a central nervous system depressant that also indirectly activates nuclear receptor constitutive active androstane receptor (CAR), which promotes drug and energy metabolism, as well as cell growth (and death), in the liver. We found that phenobarbital activated CAR by inhibiting epidermal growth factor receptor (EGFR) signaling. Phenobarbital bound to EGFR and potently inhibited the binding of EGF, which prevented the activation of EGFR. This abrogation of EGFR signaling induced the dephosphorylation of receptor for activated C kinase 1 (RACK1) at Tyr(52), which then promoted the dephosphorylation of CAR at Thr(38) by the catalytic core subunit of protein phosphatase 2A. The findings demonstrated that the phenobarbital-induced mechanism of CAR dephosphorylation and activation is mediated through its direct interaction with and inhibition of EGFR.

  16. Fibroblast Activation Protein-Alpha, a Serine Protease that Facilitates Metastasis by Modification of Diverse Microenvironments

    Science.gov (United States)

    2011-10-01

    diabetes and hematopoietic stem cell engraftment [21]. Sitagliptin is a DPPIV inhibitor already approved for type 2 diabetes because it has...activation protein (FAP) in hepatitis C virus infection. Adv Exp Med Biol 524:235–243 12. Levy MT, McCaughan GW, Abbott CA, Park JE, Cunningham AM...kb ( Abbott et al., 1994). Three different splice variants of FAP have been observed in mouse embryonic tissues, with all three predicted to encode

  17. Esculetin attenuates receptor activator of nuclear factor kappa-B ligand-mediated osteoclast differentiation through c-Fos/nuclear factor of activated T-cells c1 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Baek, Jong Min; Park, Sun-Hyang; Cheon, Yoon-Hee; Ahn, Sung-Jun [Department of Anatomy, School of Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Lee, Myeung Su [Division of Rheumatology, Department of Internal Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Institute for Skeletal Disease, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Oh, Jaemin, E-mail: jmoh@wku.ac.kr [Department of Anatomy, School of Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Institute for Skeletal Disease, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Kim, Ju-Young, E-mail: kimjy1014@gmail.com [Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of)

    2015-05-29

    Esculetin exerts various biological effects on anti-oxidation, anti-tumors, and anti-inflammation. However, the involvement of esculetin in the bone metabolism process, particularly osteoclast differentiation has not yet been investigated. In the present study, we first confirmed the inhibitory effect of esculetin on receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast formation. We then revealed the relationship between esculetin and the expression of osteoclast-specific molecules to elucidate its underlying mechanisms. Esculetin interfered with the expression of c-Fos and nuclear factor of activated T cell c1 (NFATc1) both at the mRNA and protein level with no involvement in osteoclast-associated early signaling pathways, suppressing the expression of various transcription factors exclusively expressed in osteoclasts such as tartrate-resistant acid phosphatase (Trap), osteoclast-associated receptor (Oscar), dendritic cell-specific transmembrane protein (Dcstamp), osteoclast stimulatory transmembrane protein (Ocstamp), cathepsin K, αvβ3 integrin, and calcitonin receptor (Ctr). Additionally, esculetin inhibited the formation of filamentous actin (F-actin) ring-positive osteoclasts during osteoclast differentiation. However, the development of F-actin structures and subsequent bone resorbing activity of mature osteoclasts, which are observed in osteoclast/osteoblast co-culture systems were not affected by esculetin. Taken together, our results indicate for the first time that esculetin inhibits RANKL-mediated osteoclastogenesis via direct suppression of c-Fos and NFATc1 expression and exerts an inhibitory effect on actin ring formation during osteoclastogenesis. - Highlights: • We first investigated the effects of esculetin on osteoclast differentiation and function. • Our data demonstrate for the first time that esculetin can suppress osteoclastogenesis in vitro. • Esculetin acts as an inhibitor of c-Fos and NFATc1 activation.

  18. Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer

    Directory of Open Access Journals (Sweden)

    Philippe Daubas

    2015-12-01

    Full Text Available Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development.

  19. Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer

    Science.gov (United States)

    Daubas, Philippe; Duval, Nathalie; Bajard, Lola; Langa Vives, Francina; Robert, Benoît; Mankoo, Baljinder S.; Buckingham, Margaret

    2015-01-01

    ABSTRACT Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development. PMID:26538636

  20. KELUARGA BERENCANA DALAM RANGKA MEWUJUDKAN KELUARGA SAKINAH DI MUNGKID, MAGELANG, JAWA TENGAH

    Directory of Open Access Journals (Sweden)

    Yunika Isma Setyaningsih

    2016-09-01

    Full Text Available In 1970 the family planning program (KB became popular, then disseminated to various regions in Indonesia. When the demand is still relatively small due to stumble to the problem of whether its allowed or not allowed to run this program by the law of Islam. In addition, Lack of public awareness of KB regarding the usefulness or importance of family planning. This paper presents an overview of the implementation of KB from Islamic law perspective in the village of Ngrajek in order to  consummate the harmonious family. Basically, the determining or primary factor of the realization of the harmonious family is the awareness and responsibility of husband and wife in their functions and roles, as well as the rights and obligations of conjugal supported by the family economy. Thus, the use of KB contraceptives is only a secondary factor. Therefore, harmonious family phasing criteria set by the Ministry of Religion, highlights from the viewpoint of religious life and the family economy. Implementation of KB on the family in accordance with Islamic law, because their motivation in family planning(KB Program is for the welfare of the family and to adjust the spacing of birth, and do not cause madlarat for each family.   [Pada tahun 1970 Keluarga Berencana mulai populer, kemudian disosialisasikan ke berbagai daerah di Indonesia. Saat itu peminatnya masih relatif sedikit karena terbentur dengan masalah boleh atau tidaknya ber-KB menurut agama. Selain itu, kesadaran masyarakat juga masih kurang mengenai kegunaan atau pentingnya ber-KB. Tulisan ini memaparkan pandangan Hukum Islam mengenai pelaksanaan KB di Desa Ngrajek dalam rangka mewujudkan keluarga sakinah. Pada dasarnya, penentu atau faktor primer terwujudnya keluarga sakinah adalah kesadaran dan tanggung jawab suami isteri dalam menjalankan peran dan fungsinya, serta menjalankan hak dan kewajiban suami isteri yang didukung oleh perekonomian keluarga. Jadi, memakai alat kontrasepsi KB hanya faktor

  1. Growth factors related to the activation of primordial follicles in cattle

    Directory of Open Access Journals (Sweden)

    Lidy Viviana Castillo Barón

    2011-10-01

    Full Text Available This article analyzes the presence and expression of molecules, called growth factors that act to control follicular dynamics in early stages; It also describes the nature and mechanism of action of the major growth factors involved in the activation of the paramount follicles in cattle. This is to show the importance of these molecules in developing follicle and oocyte quality, which can become fertilized on the way to increase the reproductive potential of domestic animals.

  2. Alcohol consumption, physical activity, and chronic disease risk factors: a population-based cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Djoussé Luc

    2006-05-01

    Full Text Available Abstract Background Whether the association of alcohol consumption and cardiovascular disease is the product of confounding and the degree to which this concern applies to other behaviors are unclear. Methods Using the 2003 Behavioral Risk Factor Surveillance System, a population-based telephone survey of adults in the US, we compared chronic disease risk factors between 123,359 abstainers and 126,674 moderate drinkers, defined as intake of ≤ 2 drinks per day among men and ≤ 1 drink per day among women, using age- and sex- and multivariable-adjusted models. We also compared sedentary and active individuals, defined as moderate physical activity ≥ 30 minutes per day for ≥ 5 days per week, or vigorous activity for ≥ 20 minutes per day on ≥ 3 days. Results Chronic disease risk factors and features of unhealthy lifestyle were generally more prevalent among abstainers than drinkers in age- and sex-adjusted analyses, but these differences were generally attenuated or eliminated by additional adjustment for race and education. For low fruit and vegetable intake, divorced marital status, and absence of a personal physician, adjustment for race and education reversed initially positive age- and sex-adjusted associations with abstention. Comparison of sedentary and active individuals produced similar findings, with generally lower levels of risk factors among more physical active individuals. Conclusion The differences between abstainers and drinkers are attenuated after adjustment for limited sociodemographic features, and sedentary and active individuals share a similar pattern. Although observational studies of both factors may be susceptible to uncontrolled confounding, our results provide no evidence that moderate drinking is unique in this regard. Ultimately, randomized trials of all such lifestyle factors will be needed to answer these questions definitively.

  3. Associations of Weight Status, Social Factors, and Active Travel among College Students

    Science.gov (United States)

    Bopp, Melissa; Behrens, Timothy K.; Velecina, Rachel

    2014-01-01

    Background: Active travel (AT) is associated with various health benefits and may help prevent the decline in physical activity during college years. Purpose: The purpose of this study was to examine the relationship of several factors with AT to campus by weight status. Methods: Students at a large northeastern US campus completed an online…

  4. Predictive factors of unfavorable prostate cancer in patients who underwent prostatectomy but eligible for active surveillance

    Directory of Open Access Journals (Sweden)

    Seol Ho Choo

    2014-06-01

    Conclusions: A significant proportion of patients who were candidates for active surveillance had unfavorable prostate cancer. Age, PSA density, and two positive cores were independent significant predictive factors for unfavorable prostate cancer. These factors should be considered when performing active surveillance.

  5. Specific inhibition of hypoxia-inducible factor (HIF)-1 alpha activation and of vascular endothelial growth factor (VEGF) production by flavonoids.

    Science.gov (United States)

    Hasebe, Yuki; Egawa, Kiyoshi; Yamazaki, Yoko; Kunimoto, Setsuko; Hirai, Yasuaki; Ida, Yoshiteru; Nose, Kiyoshi

    2003-10-01

    Screening using a reporter under the control of the hypoxia-response element (HRE) identified several flavonoids and homoisoflavonoids that inhibit the activation of HRE under hypoxic conditions. Among various compounds, isorhamnetin, luteolin, quercetin, and methyl ophiopogonanone B (MOB) were effective at 3 to 9 microg/ml in inhibiting the reporter activity. The expression of vascular endothelial growth factor (VEGF) mRNA during hypoxia was also inhibited by MOB in HepG2 cells, but the effective doses were 10 to 20 microg/ml. MOB caused destabilization of hypoxia-inducible factor (HIF)-1alpha, as revealed by Western blotting, that was dependent on proteasome activity and the tumor suppressor, p53. The tubular formation and migration of human umbilical vein endothelial cells was also inhibited by MOB. MOB is expected to act as an inhibitor of angiogenesis.

  6. Hypoxia-Inducible Factor 1 Is an Inductor of Transcription Factor Activating Protein 2 Epsilon Expression during Chondrogenic Differentiation

    Directory of Open Access Journals (Sweden)

    Stephan Niebler

    2015-01-01

    Full Text Available The transcription factor AP-2ε (activating enhancer-binding protein epsilon is expressed in cartilage of humans and mice. However, knowledge about regulatory mechanisms influencing AP-2ε expression is limited. Using quantitative real time PCR, we detected a significant increase in AP-2ε mRNA expression comparing initial and late stages of chondrogenic differentiation processes in vitro and in vivo. Interestingly, in these samples the expression pattern of the prominent hypoxia marker gene angiopoietin-like 4 (Angptl4 strongly correlated with that of AP-2ε suggesting that hypoxia might represent an external regulator of AP-2ε expression in mammals. In order to show this, experiments directly targeting the activity of hypoxia-inducible factor-1 (HIF1, the complex mediating responses to oxygen deprivation, were performed. While the HIF1-activating compounds 2,2′-dipyridyl and desferrioxamine resulted in significantly enhanced mRNA concentration of AP-2ε, siRNA against HIF1α led to a significantly reduced expression rate of AP-2ε. Additionally, we detected a significant upregulation of the AP-2ε mRNA level after oxygen deprivation. In sum, these different experimental approaches revealed a novel role for the HIF1 complex in the regulation of the AP-2ε gene in cartilaginous cells and underlined the important role of hypoxia as an important external regulatory stimulus during chondrogenic differentiation modulating the expression of downstream transcription factors.

  7. Factor XI Deficiency Alters the Cytokine Response and Activation of Contact Proteases during Polymicrobial Sepsis in Mice.

    Directory of Open Access Journals (Sweden)

    Charles E Bane

    Full Text Available Sepsis, a systemic inflammatory response to infection, is often accompanied by abnormalities of blood coagulation. Prior work with a mouse model of sepsis induced by cecal ligation and puncture (CLP suggested that the protease factor XIa contributed to disseminated intravascular coagulation (DIC and to the cytokine response during sepsis. We investigated the importance of factor XI to cytokine and coagulation responses during the first 24 hours after CLP. Compared to wild type littermates, factor XI-deficient (FXI-/- mice had a survival advantage after CLP, with smaller increases in plasma levels of TNF-α and IL-10 and delayed IL-1β and IL-6 responses. Plasma levels of serum amyloid P, an acute phase protein, were increased in wild type mice 24 hours post-CLP, but not in FXI-/- mice, supporting the impression of a reduced inflammatory response in the absence of factor XI. Surprisingly, there was little evidence of DIC in mice of either genotype. Plasma levels of the contact factors factor XII and prekallikrein were reduced in WT mice after CLP, consistent with induction of contact activation. However, factor XII and PK levels were not reduced in FXI-/- animals, indicating factor XI deficiency blunted contact activation. Intravenous infusion of polyphosphate into WT mice also induced changes in factor XII, but had much less effect in FXI deficient mice. In vitro analysis revealed that factor XIa activates factor XII, and that this reaction is enhanced by polyanions such polyphosphate and nucleic acids. These data suggest that factor XI deficiency confers a survival advantage in the CLP sepsis model by altering the cytokine response to infection and blunting activation of the contact (kallikrein-kinin system. The findings support the hypothesis that factor XI functions as a bidirectional interface between contact activation and thrombin generation, allowing the two processes to influence each other.

  8. Antagonistic Activity of Trichoderma ISolates against Sclerotium rolfsii : Screening of Efficient Isolates from Morocco Soils for Biological Control

    Directory of Open Access Journals (Sweden)

    N. Khattabi

    2004-12-01

    Full Text Available Seventy Trichoderma spp. isolates collected from different regions of Morocco were tested for their capacity to inhibit in vitro mycelial growth of Sclerotium rolfsii, and for their effect on the viability of S. rolfsii sclerotia in the soil. The Trichoderma spp. isolates inhibited mycelial growth of S. rolfsii to various degrees, with 52% of isolates expressing an average inhibition, varying between 45 and 55%. The effect on the viability of sclerotia in the soil also varied between isolates of Trichoderma, with the majority (84% having a slight effect. A group of twenty isolates identified as Trichoderma harzianum when tested in sterilized soil, significantly reduced sclerotial viability though not in natural soil. Four of these isolates (Nz, Kb2, Kb3 and Kf1 showed good antagonistic activity against S. rolfsii and were also highly competitive in natural soil. These isolates would therefore be candidates for development in biological control program.

  9. Post-Materialism as a Cultural Factor Influencing Entrepreneurial Activity across Nations

    OpenAIRE

    Uhlaner, L.M.; Thurik, A.R.; Hutjes, J.

    2002-01-01

    textabstractThe study of the determinants of entrepreneurship at the country level has been dominated by economic influences. The relative stability of differences in levels of entrepreneurship across coun-tries suggests that other forces such as certain institutional and/or cultural factors are at play. The objective of this paper is to explore how post-materialism explains differences in entrepreneurial activity across countries. Entrepreneurial activity is defined as the percent of a count...

  10. Female reproductive factors are associated with objectively measured physical activity in middle-aged women

    Science.gov (United States)

    Kulmala, Janne; Aukee, Pauliina; Hakonen, Harto; Kujala, Urho M.; Lowe, Dawn A.; Kovanen, Vuokko; Tammelin, Tuija; Sipilä, Sarianna

    2017-01-01

    Physical activity improves health and may delay the onset of several chronic diseases. For women in particular, the rate of these diseases accelerates at middle age; therefore it is important to identify the determinants of health-enhancing physical activity during midlife in this population. In this study, we focused on determinants that are unique to the female sex, such as childbearing and menopause. The main objective was to characterize the level of physical activity and differences between active and inactive middle-aged Finnish women. In addition, we examined the association of physical activity with female reproductive factors at midlife. The study population consisted of 647 women aged 48 to 55 years who participated in our Estrogenic Regulation of Muscle Apoptosis (ERMA) study during the period from 2015 to 2016. Physical activity was measured objectively using hip-worn accelerometers for seven consecutive days. The outcome measures included the amounts of light intensity physical activity and moderate to vigorous intensity physical activity accumulated in bouts of at least 10 minutes (MVPA10). MVPA10 was used to determine whether women were placed in the active (≥150 min/week) or inactive (physical activity measures as dependent variables and cumulative reproductive history index, menopausal symptoms, and pelvic floor dysfunction as independent variables. We found that a large portion (61%) of Finnish middle-aged women did not meet the physical activity recommendations of 150 minutes of MVPA10 per week. In the studied cohort, 78% of women experienced menopausal symptoms, and 54% exhibited pelvic floor dysfunction. Perceived menopausal symptoms were associated with greater light physical activity. Perceived pelvic floor dysfunction was associated with lower MVPA10. According to the fully adjusted multiple linear regression models, reproductive factors explained 6.0% of the variation of MVPA10 and 7.5% of the variation of light physical activity. The

  11. DMPD: Nuclear factor-kappaB: activation and regulation during toll-like receptorsignaling. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17349209 Nuclear factor-kappaB: activation and regulation during toll-like receptorsignaling. Carmody...uclear factor-kappaB: activation and regulation during toll-like receptorsignaling. Authors Carmody

  12. Active Power Factor Correction Using a Sliding Mode Controller

    Directory of Open Access Journals (Sweden)

    Korhan KAYIŞLI

    2008-03-01

    Full Text Available In this paper, a sliding mode controller is designed for active shaping of the input current in the boost converter. Robustness of the designed controller is tested with variable output voltage references, different loads and network voltage variations. For the simulations, MATLAB/Simulink programme is used. From simulation results, the same phase was provided between input current and input voltage and nearly unity power factor was obtained.

  13. The Relevant Factors in Promoting Reading Activities in Elementary Schools

    Science.gov (United States)

    Huang, Han-Chen; Tsai, Yao-Hsu; Huang, Shih-Hsiang

    2015-01-01

    In order to help students absorb knowledge, schools often conduct reading activities. Thorough planning and strategies, however, are needed to insure the effect of reading promotions, and make them a deeply-rooted part of life. This study adopted the analytic hierarchy process (AHP) to discuss the relevant factors in promoting reading activities…

  14. Angiocrine factors from Akt-activated endothelial cells balance self-renewal and differentiation of haematopoietic stem cells

    Science.gov (United States)

    Kobayashi, Hideki; Butler, Jason M.; O'Donnell, Rebekah; Kobayashi, Mariko; Ding, Bi-Sen; Bonner, Bryant; Chiu, Vi K.; Nolan, Daniel J.; Shido, Koji; Benjamin, Laura; Rafii, Shahin

    2010-01-01

    Endothelial cells establish an instructive vascular niche that reconstitutes haematopoietic stem and progenitor cells (HSPCs) through release of specific paracrine growth factors, known as angiocrine factors. However, the mechanism by which endothelial cells balance the rate of proliferation and lineage-specific differentiation of HSPCs is unknown. Here, we demonstrate that Akt activation in endothelial cells, through recruitment of mTOR, but not the FoxO pathway, upregulates specific angiocrine factors that support expansion of CD34−Flt3− KLS HSPCs with long-term haematopoietic stem cell (LT-HSC) repopulation capacity. Conversely, co-activation of Akt-stimulated endothelial cells with p42/44 MAPK shifts the balance towards maintenance and differentiation of the HSPCs. Selective activation of Akt1 in the endothelial cells of adult mice increased the number of colony forming units in the spleen and CD34−Flt3− KLS HSPCs with LT-HSC activity in the bone marrow, accelerating haematopoietic recovery. Therefore, the activation state of endothelial cells modulates reconstitution of HSPCs through the upregulation of angiocrine factors, with Akt–mTOR-activated endothelial cells supporting the self-renewal of LT-HSCs and expansion of HSPCs, whereas MAPK co-activation favours maintenance and lineage-specific differentiation of HSPCs. PMID:20972423

  15. Leisure-time physical activity and associated factors in fitness zones

    Directory of Open Access Journals (Sweden)

    Marcelo Cozzensa da Silva

    2017-05-01

    Full Text Available DOI: http://dx.doi.org/10.5007/1980-0037.2017v19n2p185   Fitness zones (FZ are a great alternative to physical activity practice. The aim of this study was verify physical activity practice and associated factors among FZ users of Pelotas. Participants answered a questionnaire containing demographic, socioeconomic, behavioral, health and on the use of FZs. A long version of the International Physical Activity Questionnaire was used to determine the level of physical activity and those who reported at least 150 minutes / week of PA in the leisure time were considered sufficiently active. The study included 323 subjects (65.3% women, mean age 52.5 years, 83.6% white skin color and 61.9% married. Almost half of respondents were overweight (48.0%, 45.8% had high blood pressure, 10.5% had diabetes and 64.4% used medications. About 77.7% of respondents were classified as sufficiently active. Health perception was associated to leisure physical activity, and the better the health perception, the higher the prevalence of sufficient physical activity. Collective programs with participation of Physical Education teacher can contribute to interaction of practitione with the use of fitness zones and increase the level of physical activity of individuals.

  16. Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase

    NARCIS (Netherlands)

    Spaargaren, M.; Defize, L. H.; Boonstra, J.; de Laat, S. W.

    1991-01-01

    The relationship between epidermal growth factor receptor (EGF-R) protein tyrosine kinase activation and ligand-induced receptor dimerization was investigated using several bivalent anti-EGF-R antibodies directed against various receptor epitopes. In A431 membrane preparations and permeabilized

  17. Identities of P2 and P3 Residues of H-2Kb-Bound Peptides Determine Mouse Ly49C Recognition.

    Directory of Open Access Journals (Sweden)

    Elsa A Marquez

    Full Text Available Ly49 receptors can be peptide selective in their recognition of MHC-I-peptide complexes, affording them a level of discrimination beyond detecting the presence or absence of specific MHC-I allele products. Despite this ability, little is understood regarding the properties that enable some peptides, when bound to MHC-I molecules, to support Ly49 recognition, but not others. Using RMA-S target cells expressing MHC-I molecules loaded with individual peptides and effector cells expressing the ectodomain of the inhibitory Ly49C receptor, we found that two adjacent amino acid residues, P2 and P3, both buried in the peptide binding groove of H-2Kb, determine mouse Ly49C specificity. If both are aliphatic residues, this is supportive. Whereas, small amino acids at P2 and aromatic amino acids at the P3 auxiliary anchor residue are detrimental to Ly49C recognition. These results resemble those with a rat Ly49 where the identity of a peptide anchor residue determines recognition, suggesting that dependence on specific peptide residues buried in the MHC-I peptide-binding groove may be fundamental to Ly49 peptide selectivity and recognition.

  18. Sex differences in social cognitive factors and physical activity in Korean college students

    OpenAIRE

    Choi, Jin Yi; Chang, Ae Kyung; Choi, Eun-Ju

    2015-01-01

    [Purpose] This study examined sex differences in physical activity and social cognitive theory factors in Korean college students. [Subjects and Methods] A cross-sectional survey of 688 college students (285 men and 403 women) in Korea was conducted using a self-reported questionnaire. [Results] There was a significant difference in the level of physical activity between male and female students. The significant predictors of physical activity for male students were physical activity goals, p...

  19. Isolation and characterization of the Jatropha curcas APETALA1 (JcAP1) promoter conferring preferential expression in inflorescence buds.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Longjian; Xu, Zeng-Fu

    2016-08-01

    The 1.5 kb JcAP1 promoter from the biofuel plant Jatropha curcas is predominantly active in the inflorescence buds of transgenic plants, in which the -1313/-1057 region is essential for maintaining the activity. Arabidopsis thaliana APETALA1 (AP1) is a MADS-domain transcription factor gene that functions primarily in flower development. We isolated a homolog of AP1 from Jatropha curcas (designated JcAP1), which was shown to exhibit flower-specific expression in Jatropha. JcAP1 is first expressed in inflorescence buds and continues to be primarily expressed in the sepals. We isolated a 1.5 kb JcAP1 promoter and evaluated its activity in transgenic Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. In transgenic Arabidopsis and Jatropha, the inflorescence buds exhibited notable GUS activity, whereas the sepals did not. Against expectations, the JcAP1 promoter was active in the anthers of Arabidopsis and Jatropha and was highly expressed in Jatropha seeds. An analysis of promoter deletions in transgenic Arabidopsis revealed that deletion of the -1313/-1057 region resulted in loss of JcAP1 promoter activity in the inflorescence buds and increased activity in the anthers. These results suggested that some regulatory sequences in the -1313/-1057 region are essential for maintaining promoter activity in inflorescence buds and can partly suppress activity in the anthers. Based on these findings, we hypothesized that other elements located upstream of the 1.5 kb JcAP1 promoter may be required for flower-specific activation. The JcAP1 promoter characterized in this study can be used to drive transgene expression in both the inflorescence buds and seeds of Jatropha.

  20. Interpersonal and Intrapersonal Factors Associated with Autonomous Motivation in Adolescents' After-School Activities

    Science.gov (United States)

    Beiswenger, Krista L.; Grolnick, Wendy S.

    2010-01-01

    This study explored interpersonal and intrapersonal factors associated with the level of autonomous motivation adolescents experience for their after-school activities. A total of 142 seventh-grade adolescents completed measures of peer relatedness, autonomy within friendships, mother and father autonomy support, perceived activity competence,…

  1. risk factors of active tuberculosis in people living with hiv/aids

    African Journals Online (AJOL)

    Abrham

    2011-07-02

    Jul 2, 2011 ... The objective of this study was to assess distal ... KEYWORDS: Active TB, HIV, risk factors, case control study, Southwest Ethiopia ... and Khat (stimulant plant from Chata Edulis), .... to live in a house made of a cement floor.

  2. Increased volume of distribution for recombinant activated factor VII and longer plasma-derived factor VII half-life may explain their long lasting prophylactic effect

    NARCIS (Netherlands)

    Mathijssen, N.C.J.; Masereeuw, R.; Holme, P.A.; Kraaij, M.G.J. van; Laros, B.A.P.; Peyvandi, F.; Heerde, W.L. van

    2013-01-01

    INTRODUCTION: Prophylaxis with plasma-derived or recombinant activated factor VII is beneficial in severe factor VII deficiency. To understand why prophylactic treatment with both products is efficacious, we conducted a pharmacokinetic study. MATERIALS AND METHODS: Ten factor VII deficient patients

  3. Pharmacodynamics of recombinant activated factor VII and plasma-derived factor VII in a cohort of severe FVII deficient patients.

    Science.gov (United States)

    van Geffen, Mark; Mathijssen, Natascha C J; Holme, Pål A; Laros-van Gorkom, Britta A P; van Kraaij, Marian G J; Masereeuw, Roselinde; Peyvandi, Flora; van Heerde, Waander L

    2013-07-01

    Recombinant activated factor VII (rFVIIa) and plasma-derived factor VII (pdFVII) are used to prevent bleedings in severe FVII deficient patients, despite their short half-lifes. It is suggested that FVII levels of 15-20 IU/dL are sufficient to maintain hemostasis. We analyzed the pharmacodynamic effects of FVII substitution therapy in the Nijmegen Hemostasis Assay (NHA) that simultaneously measures thrombin and plasmin generation. Ten severe FVII deficient patients were treated with 20 μg/kg rFVIIa or 25 IU/kg pdFVII in a cross-over design. Thrombin generation lag-time (TG-LT) was identified as an effect-response parameter. Pharmacodynamic analysis using a maximum effect model showed 50% reduction of the TG-LT effect at ~2 IU/dL FVII activity for both rFVIIa and pdFVII. The FVII activity to obtain TG-LT comparable to the upper limit of normal range in healthy controls (4 min) was given by the effective concentration (ECnormal), showing sufficient hemostasis at 3-4 IU/dL FVII activity. No association was seen between FVII activity and other thrombin or plasmin generation parameters as measured by NHA. In conclusion, 3-4 IU/dL FVII activity seems sufficient to maintain hemostasis in patients with severe FVII deficiency during prophylaxis. These data may suggest a potential value for measurement of TG-LT in the monitoring of FVII(a) therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Canine lymphocyte activating factor (LAF)

    International Nuclear Information System (INIS)

    Shifrine, M.; Whaley, C.B.; Wilson, F.D.; Taylor, N.J.

    1979-01-01

    The immune response of an animal is the sum of the result of the interaction of various cells mainly through soluble mediators. It is not enough to look at specific cell populations, it is also necessary to study the interactions between purified cell population. The effect of one subpopulation on another is via soluble mediators. We have been studying one (of several) such mediators in its relation to radiation effects on the immune response. Lymphocyte activating factor (LAF) is defined functionally as a potentiator of the response of thymocytes to phytohemagglutinin (PHA) or concanavalin (con-A). It can also elicit response of unstimulated subpopulations separated from the thymus. It is a product of adherent populations, presumably macrophages. It has been shown to be produced by human, rabbit, and mouse cells, but has not been reported in the dog. It also was shown to be present in higher concentrations in irradiated mice than in comparable unirradiated mice. We have shown that LAF is produced by plastic-adherent populations derived from peripheral blood. Currently we are working to determine the lymphocyte subpopulations with which LAF interacts

  5. Risk factors of falls in community dwelling active elderly.

    Science.gov (United States)

    Tuunainen, Eeva; Rasku, Jyrki; Jäntti, Pirkko; Pyykkö, Ilmari

    2014-02-01

    To search for measures to describe and relate to accidental falls in community dwelling elderly. A EuroQol EQ-5D questionnaire based on a patient's otoneurological case history provided a general health related quality of life measure, a fall history for the last 3 months and force platform measures for 96 active elderly from a pensioner organization. On average, the elderly experienced 0.3 falls over the preceding three months. A fall was seen to cause a significant deterioration in the quality of life and vertigo and caused fear of falling. The postural instability correlated with falls. Vertigo was present among 42% and was most commonly characterized as episodic and rotatory in factorial analysis items relating to vertigo correlated to falls and balance complaints. Four factors were identified and three of these correlated with falls. Vestibular failure correlated to a fall occurring when a person was rising up; Movement intolerance correlated with falls due to slips and trips, and Near-syncope factor correlated to falls for other reasons. In posturography, the variable measuring critical time describing the memory based "closed loop" control of postural stability carried a risk for accidental fall with an odds ratio of 6. The variable measuring zero crossing velocity showed a high rate of velocity change around the neutral position of stance. Vertigo and poor postural stability were the major reasons for falls in the active elderly. In ageing, postural control is shifted towards open loop control (visual, proprioception, exteroception and vestibular) instead of closed loop control and is a factor that contributes to a fall. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Impact of detector-element active-area shape and fill factor on super-resolution

    Directory of Open Access Journals (Sweden)

    Russell Craig Hardie

    2015-05-01

    Full Text Available In many undersampled imaging systems, spatial integration from the individual detector elements is the dominant component of the system point spread function (PSF. Conventional focal plane arrays (FPAs utilize square detector elements with a nearly 100% fill factor, where fill factor is defined as the fraction of the detector element area that is active in light detection. A large fill factor is generally considered to be desirable because more photons are collected for a given pitch, and this leads to a higher signal-to-noise-ratio (SNR. However, the large active area works against super-resolution (SR image restoration by acting as an additional low pass filter in the overall PSF when modeled on the SR sampling grid. A high fill factor also tends to increase blurring from pixel cross-talk. In this paper, we study the impact of FPA detector-element shape and fill factor on SR. A detailed modulation transfer function analysis is provided along with a number of experimental results with both simulated data and real data acquired with a midwave infrared (MWIR imaging system. We demonstrate the potential advantage of low fill factor detector elements when combined with SR image restoration. Our results suggest that low fill factor circular detector elements may be the best choice. New video results are presented using robust adaptive Wiener filter SR processing applied to data from a commercial MWIR imaging system with both high and low detector element fill factors.

  7. Synthesis and activity of novel analogs of hemiasterlin as inhibitors of tubulin polymerization: modification of the A segment.

    Science.gov (United States)

    Yamashita, Ayako; Norton, Emily B; Kaplan, Joshua A; Niu, Chuan; Loganzo, Frank; Hernandez, Richard; Beyer, Carl F; Annable, Tami; Musto, Sylvia; Discafani, Carolyn; Zask, Arie; Ayral-Kaloustian, Semiramis

    2004-11-01

    Analogs of hemiasterlin (1) and HTI-286 (2), which contain various aromatic rings in the A segment, were synthesized as potential inhibitors of tubulin polymerization. The structure-activity relationships related to stereo- and regio-chemical effects of substituents on the aromatic ring in the A segment were studied. Analogs, which carry a meta-substituted phenyl ring in the A segment show comparable activity for inhibition of tubulin polymerization to 2, as well as in the cell proliferation assay using KB cells containing P-glycoprotein, compared to those of 1 and 2.

  8. The environment and physical activity: The influence of psychosocial, perceived and built environmental factors

    Directory of Open Access Journals (Sweden)

    Bullen Chris

    2009-03-01

    Full Text Available Abstract This study sought to integrate perceived and built environmental and individual factors into the Theory of Planned Behavior (TPB model to better understand adolescents' physical activity. Methods Participants (n = 110 aged 12 to 17 years (M = 14.6 ± 1.55 were recruited from two large metropolitan high schools in Auckland, New Zealand, were included in the analysis. Participants completed measures of the revised TPB and the perceived environment. Individual factors such as ethnicity and level of deprivation were also collected. Geographical Information Systems (GIS software was used to measure the physical environment (walkability, access to physical activity facilities. Physical activity was assessed using the ActiGraph accelerometer and the Physical Activity Questionnaire for Adolescents (PAQ-A. Data from the various sources were combined to develop an integrated model integrated for statistical analysis using structural equation modeling. Results The TPB model variables (intention and perceived behavioral control explained 43% of the variance of PAQ-A. Unique and individual contributions were made by intention and PBC and home ownership of home equipment. The model explained 13% of time spent in moderate and vigorous physical activity (Actigraph. Unique and individual contribution was made by intention. Conclusion Social cognitive variables were better predictors of both subjective and objective physical activity compared to perceived environmental and built environment factors. Implications of these findings are discussed.

  9. Platelet-activating factor (PAF) receptor-binding antagonist activity of Malaysian medicinal plants.

    Science.gov (United States)

    Jantan, I; Rafi, I A A; Jalil, J

    2005-01-01

    Forty-nine methanol extracts of 37 species of Malaysian medicinal plants were investigated for their inhibitory effects on platelet-activating factor (PAF) binding to rabbit platelets, using 3H-PAF as a ligand. Among them, the extracts of six Zingiberaceae species (Alpinia galanga Swartz., Boesenbergia pandurata Roxb., Curcuma ochorrhiza Val., C. aeruginosa Roxb., Zingiber officinale Rosc. and Z. zerumbet Koenig.), two Cinnamomum species (C. altissimum Kosterm. and C. pubescens Kochummen.), Goniothalamus malayanus Hook. f. Momordica charantia Linn. and Piper aduncum L. are potential sources of new PAF antagonists, as they showed significant inhibitory effects with IC50 values ranging from 1.2 to 18.4 microg ml(-1).

  10. Intrapersonal, behavioral, and environmental factors associated with meeting recommended physical activity among rural Latino youth.

    Science.gov (United States)

    Perry, Cynthia K; Saelens, Brian E; Thompson, Beti

    2011-11-01

    This study aimed to identify intrapersonal, behavioral, and environmental factors associated with engaging in recommended levels of physical activity among rural Latino middle school youth. Data were from an anonymous survey of 773 Latino youth (51% female) about level of and barriers and motivators to physical activity, risk behaviors, and park use. Logistic regression models identified factors correlated with meeting recommended levels of physical activity (5 days or more 3 60 min/day). Thirty-four percent of girls and 41% of boys reported meeting this physical activity recommendation. Participation in an organized after school activity (p < .001) and in physical education (PE) classes 5 days a week (p < .001) were strongly associated with meeting recommended physical activity level. Making PE available 5 days a week and creating opportunities for organized after school physical activity programs may increase the number of rural Latino middle school youth who meet recommended physical activity level.

  11. Characterization of the past and current duplication activities in the human 22q11.2 region

    Directory of Open Access Journals (Sweden)

    Morrow Bernice

    2011-01-01

    Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.

  12. Daytime activity and risk factors for late-life insomnia.

    Science.gov (United States)

    Morgan, Kevin

    2003-09-01

    Laboratory evidence linking exercise with improved sleep quality raises the possibility that the lower levels of physical activity characteristic of older age groups may contribute to late-life insomnia. While support for this hypothesis appears to come from epidemiological surveys, few such studies have distinguished satisfactorily between social and physical activities which differ widely in terms of energy cost and theoretical significance. The present analyses were, therefore, designed to assess the independent influence of physical and social activity levels on the prevalence and natural history of late-life insomnia. Survivors from a nationally representative UK sample (n = 1042) of elderly people originally interviewed in 1985 were reassessed in 1989 (n = 690) and 1993 (n = 410). Detailed assessments of physical and social activities, mental and physical health status, and sleep quality were made at each survey wave. Logistic regression models, adjusted for age, sex and health status, were used to assess relationships between activity levels and the prevalence, remission/persistence, and incidence of late-life insomnia. Lower physical health, depressed mood and lower physical (but not social) activity levels consistently emerged as significant risk factors for prevalent, persistent and incident insomnia. Age was unrelated to insomnia variables in all the cross-sectional models, but did emerge as a significant risk for cumulative 4-8-year insomnia incidence. These findings suggest that, independent of those activities more closely associated with social engagement, higher levels of customary physical activity per se appear to be protective against incident and chronic late-life insomnia.

  13. Characterization and performances of cobalt-tungsten and molybdenum-tungsten carbides as anode catalyst for PEFC

    International Nuclear Information System (INIS)

    Izhar, Shamsul; Yoshida, Michiko; Nagai, Masatoshi

    2009-01-01

    The preparation of carbon-supported cobalt-tungsten and molybdenum-tungsten carbides and their activity as an anode catalyst for a polymer electrolyte fuel cell were investigated. The electrocatalytic activity for the hydrogen oxidation reaction over the catalysts was evaluated using a single-stack fuel cell and a rotating disk electrode. The characterization of the catalysts was performed by XRD, temperature-programmed carburization, temperature-programmed reduction and X-ray photoelectron spectroscopy. The maximum power densities of the 30 wt% 873 K-carburized cobalt-tungsten and molybdenum-tungsten mixed with Ketjen carbon (cobalt-tungsten carbide (CoWC)/Ketjen black (KB) and molybdenum-tungsten carbide (MoWC)/KB) were 15.7 and 12.0 mW cm -2 , respectively, which were 14 and 11%, compared to the in-house membrane electrode assembly (MEA) prepared from a 20 wt% Pt/C catalyst. The CoWC/KB catalyst exhibited the highest maximum power density compared to the MoWC/KB and WC/KB catalysts. The 873 K-carburized CoW/KB catalyst formed the oxycarbided and/or carbided CoW that are responsible for the excellent hydrogen oxygen reaction

  14. The Murine Factor H-Related Protein FHR-B Promotes Complement Activation

    Directory of Open Access Journals (Sweden)

    Marcell Cserhalmi

    2017-09-01

    Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.

  15. Telomerase activity and its association with psychological stress, mental disorders, lifestyle factors and interventions: A systematic review.

    Science.gov (United States)

    Deng, W; Cheung, S T; Tsao, S W; Wang, X M; Tiwari, A F Y

    2016-02-01

    To summarise and discuss the association between telomerase activity and psychological stress, mental disorders and lifestyle factors. A systematic review was carried out to identify prospective or retrospective studies and interventions published up to June 2015 that reported associations between telomerase activity and psychological stress, mental disorders and lifestyle factors. Electronic data bases of PubMed, ProQuest, CINAHL and Google Scholar were searched. Twenty six studies on humans measured telomerase activity in peripheral blood mononuclear cells (PBMCs) or leukocytes and examined its association with psychological stress, mental disorders and lifestyle factors. Of those studies, three reported significantly decreased telomerase activity in individuals under chronic psychological stress. Interestingly, one of the three studies found that acute laboratory psychological stress significantly increased telomerase activity. Nine studies reported mixed results on association between mental disorders and telomerase activity. Of the nine studies, five reported that major depressive disorder (MDD) was associated with significantly increased telomerase activity. In thirteen out of fourteen studies on lifestyle factors, it was reported that physical exercise, diet micronutrient supplementation, mindfulness meditation, Qigong practice or yoga mediation resulted in increase in telomerase activity. In addition, two studies on animal models showed that depression-like behaviour was associated with decreased hippocampus telomerase activity. Five animal studies showed that physical exercise increased telomerase activity by cell-type-specific and genotype-specific manners. Although multi-facet results were reported on the association between telomerase activity and psychological stress, mental disorders and lifestyle factors, there were some consistent findings in humans such as (1) decreased telomerase activity in individuals under chronic stress, (2) increased

  16. Risk factors for negative impacts on sexual activity and function in younger breast cancer survivors.

    Science.gov (United States)

    Lee, Maria; Kim, Yun Hwan; Jeon, Myung Jae

    2015-09-01

    We aim to examine changes in sexual activity and function among younger breast cancer survivors who were sexually active before diagnosis and to investigate risk factors for negative impacts on them. An observational cohort study enrolled 304 premenopausal and sexually active women diagnosed with early stage breast cancer. Questionnaires were completed, and sexual activity was measured at two time points: after surgery, to assess sexual activity and function before diagnosis, and then at least 12 months after the completion of chemotherapy or endocrine therapy. For each domain of the Female Sexual Function Index, a score below 3 was classified as indicative of a sexual problem. Each sexual problem was considered to be dysfunctional if it was associated with distress. The median age at the last survey was 46.0 years (range: 23-57). Of the participants, 35 (11.5%) became sexually inactive after treatment. Among the 269 women who remained sexually active, 31.6% were currently experiencing sexual dysfunction, which was significantly higher compared with the frequency before diagnosis. In the multivariate logistic regression model, chemo-related menopause, thyroid dysfunction, and depression were independent risk factors for sexual inactivity. Chemo-related menopause was a significant risk factor for sexual dysfunction. Chemo-related menopause was significantly associated with both sexual inactivity and dysfunction after treatment. Thyroid dysfunction and depression were risk factors for sexual inactivity in younger breast cancer survivors. Copyright © 2015 John Wiley & Sons, Ltd.

  17. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  18. Effects of vitamin D(3)-binding protein-derived macrophage activating factor (GcMAF) on angiogenesis.

    Science.gov (United States)

    Kanda, Shigeru; Mochizuki, Yasushi; Miyata, Yasuyoshi; Kanetake, Hiroshi; Yamamoto, Nobuto

    2002-09-04

    The vitamin D(3)-binding protein (Gc protein)-derived macrophage activating factor (GcMAF) activates tumoricidal macrophages against a variety of cancers indiscriminately. We investigated whether GcMAF also acts as an antiangiogenic factor on endothelial cells. The effects of GcMAF on angiogenic growth factor-induced cell proliferation, chemotaxis, and tube formation were examined in vitro by using cultured endothelial cells (murine IBE cells, porcine PAE cells, and human umbilical vein endothelial cells [HUVECs]) and in vivo by using a mouse cornea micropocket assay. Blocking monoclonal antibodies to CD36, a receptor for the antiangiogenic factor thrombospondin-1, which is also a possible receptor for GcMAF, were used to investigate the mechanism of GcMAF action. GcMAF inhibited the endothelial cell proliferation, chemotaxis, and tube formation that were all stimulated by fibroblast growth factor-2 (FGF-2), vascular endothelial growth factor-A, or angiopoietin 2. FGF-2-induced neovascularization in murine cornea was also inhibited by GcMAF. Monoclonal antibodies against murine and human CD36 receptor blocked the antiangiogenic action of GcMAF on the angiogenic factor stimulation of endothelial cell chemotaxis. In addition to its ability to activate tumoricidal macrophages, GcMAF has direct antiangiogenic effects on endothelial cells independent of tissue origin. The antiangiogenic effects of GcMAF may be mediated through the CD36 receptor.

  19. Saturation of ionization signal in TMP and TMS at different angles and electric fields

    International Nuclear Information System (INIS)

    Aubert, B.; Colas, J.; Ghez, Ph.; Lacotte, J.C.; Mansoulie, B.; Teiger, J.

    1989-09-01

    The saturation of ionization signal is measured for various electric fields and incidence angles in a double gap TMP chamber and a single gap TMS chamber with ionizing particles in the range 1.5 - 12 MeV/cm. Birks' constant Kb in TMP is found to be high (greater than 0.1 cm/MeV) for normal incidence for electric fields in the range 4.8 to 12 kV/cm but decreases by almost a factor 3 at 50 0 . The same behaviour (large Kb and variation with incidence angle) is observed in TMS which exhibits also a Kb decrease of about a factor 2 when the electric field is increased from 10 to 40 kV/cm

  20. Activation of transcriptional activities of AP-1 and SRE by a new zinc-finger protein ZNF641

    International Nuclear Information System (INIS)

    Qi Xingzhu; Li Yongqing; Xiao Jing; Yuan Wuzhou; Yan Yan; Wang Yuequn; Liang Shuyuan; Zhu Chuanbing; Chen Yingduan; Liu Mingyao; Wu Xiushan

    2006-01-01

    Mitogen-activated protein kinases (MAPKs) are evolutionarily conserved enzymes in cell signal transduction connecting cell-surface receptors to critical regulatory targets within cells and control cell survival, adaptation, and proliferation. Previous studies revealed that zinc-finger proteins are involved in the regulation of the MAPK signaling pathways. Here, we report the identification and characterization of a novel human zinc-finger protein, ZNF641. The cDNA of ZNF641 is 4.9 kb, encoding 438 amino acids in the nucleus. The protein is highly conserved in evolution across different vertebrate species from mouse to human. Northern blot analysis indicates that ZNF641 is expressed in most of the examined human tissues, with a high level in skeletal muscle. Overexpression of pCMV-Tag2B-ZNF641 in the COS-7 cells activates the transcriptional activities of AP-1 and SRE. Deletion analysis indicates that the linker between KRAB box and C 2 H 2 -type zinc-fingers represents the basal activation domain. These results suggest that ZNF641 may be a positive regulator in MAPK-mediated signaling pathways that lead to the activation of AP-1 and SRE