WorldWideScience

Sample records for factor forkhead box

  1. Forkhead box transcription factors in embryonic heart development and congenital heart disease.

    Science.gov (United States)

    Zhu, Hong

    2016-01-01

    Embryonic heart development is a very complicated process regulated precisely by a network composed of many genes and signaling pathways in time and space. Forkhead box (Fox, FOX) proteins are a family of transcription factors characterized by the presence of an evolutionary conserved "forkhead"or "winged-helix" DNA-binding domain and able to organize temporal and spatial gene expression during development. They are involved in a wide variety of cellular processes, such as cell cycle progression, proliferation, differentiation, migration, metabolism and DNA damage response. An abundance of studies in model organisms and systems has established that Foxa2, Foxc1/c2, Foxh1 and Foxm1, Foxos and Foxps are important components of the signaling pathways that instruct cardiogenesis and embryonic heart development, playing paramount roles in heart development. The previous studies also have demonstrated that mutations in some of the forkhead box genes and the aberrant expression of forkhead box gene are heavily implicated in the congenital heart disease (CHD) of humans. This review primarily focuses on the current understanding of heart development regulated by forkhead box transcription factors and molecular genetic mechanisms by which forkhead box factors modulate heart development during embryogenesis and organogenesis. This review also summarizes human CHD related mutations in forkhead box genes as well as the abnormal expression of forkhead box gene, and discusses additional possible regulatory mechanisms of the forkhead box genes during embryonic heart development that warrant further investigation. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. The regulation and function of the Forkhead transcription factor, Forkhead box O1, is dependent on the progesterone receptor in endometrial carcinoma

    NARCIS (Netherlands)

    E.C. Ward (Erin); A.V. Hoekstra (Anna); L.J. Blok (Leen); P. Hanifi-Moghaddam (Payman); J.R. Lurain (John); D.K. Singh (Diljeet); B.M. Buttin (Barbara); J.C. Schink (Julian); J.J. Kim (Julie)

    2008-01-01

    textabstractIn many type I endometrial cancers, the PTEN gene is inactivated, which ultimately leads to constitutively active Akt and the inhibition of Forkhead box O1 (FOXO1), a member of the FOXO subfamily of Forkhead/winged helix family of transcription factors. The expression, regulation, and

  3. Sp1 is an important transcriptional regulation factor for forkhead box ...

    Indian Academy of Sciences (India)

    DONG JIE ZHANG

    2018-02-08

    Feb 8, 2018 ... Abstract. The transcription factor forkhead box N1 (Foxn1) plays an important role in the development and function of thymic epithelial cells (TECs) in vertebrates. However, the transcriptional regulation of Foxn1 is still unknown. A series of dual luciferase report vectors were constructed and their relative ...

  4. Forkhead-box transcription factors and their role in the immune system

    NARCIS (Netherlands)

    Coffer, PJ; Burgering, BMT

    2004-01-01

    It is more than a decade since the discovery of the first forkhead-box (FOX) transcription factor in the fruit fly Drosophila melanogaster. In the intervening time, there has been an explosion in the identification and characterization of members of this family of proteins. Importantly, in the past

  5. Posttranslational modifications of Forkhead box O transcription factors

    NARCIS (Netherlands)

    Horst, Aart Arno van der

    2006-01-01

    FOXO transcription factors play an important role in essential biological processes such as differentiation, proliferation, apoptosis, DNA repair, metabolism and stress resistance. Phosphorylation is the modification that was first found on FOXOs and much of the subsequent studies focused on this

  6. Forkhead box transcription factors Foxa1 and Foxa2 are important regulators of Muc2 mucin expression in intestinal epithelial cells

    NARCIS (Netherlands)

    van der Sluis, Maria; Vincent, Audrey; Bouma, Janneke; Korteland-van Male, Anita; van Goudoever, Johannes B.; Renes, Ingrid B.; van Seuningen, Isabelle

    2008-01-01

    The mucin Muc2 is the main component of the intestinal mucus layer and thus plays important roles in intestinal protection. Therefore, it is important to understand its regulation during goblet cell differentiation. Foxa1 and Foxa2 forkhead box transcription factors (TFs) participate in

  7. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  8. Forkhead box protein O3 transcription factor negatively regulates autophagy in human cancer cells by inhibiting forkhead box protein O1 expression and cytosolic accumulation.

    Directory of Open Access Journals (Sweden)

    Wan Long Zhu

    Full Text Available FoxO proteins are important regulators in cellular metabolism and are recognized to be nodes in multiple signaling pathways, most notably those involving PI3K/AKT and mTOR. FoxO proteins primarily function as transcription factors, but recent study suggests that cytosolic FoxO1 participates in the regulation of autophagy. In the current study, we find that cytosolic FoxO1 indeed stimulates cellular autophagy in multiple cancer cell lines, and that it regulates not only basal autophagy but also that induced by rapamycin and that in response to nutrient deprivation. These findings illustrate the importance of FoxO1 in cell metabolism regulation independent of its transcription factor function. In contrast to FoxO1, we find the closely related FoxO3a is a negative regulator of autophagy in multiple cancer cell lines, a previously unrecognized function for this protein, different from its function in benign fibroblast and muscle cells. The induction of autophagy by the knockdown of FoxO3a was found not to be mediated through the suppression of mTORC1 signaling; rather, the regulatory role of FoxO3a on autophagy was determined to be through its ability to transcriptionally suppress FoxO1. This complicated interplay of FoxO1 and FoxO3a suggests a complex checks- and balances-relationship between FoxO3a and FoxO1 in regulating autophagy and cell metabolism.

  9. Autophagy and the hematopoietic niche: a regulatory role for the Forkhead-box transcription factors

    NARCIS (Netherlands)

    Gomez Puerto, MC

    2016-01-01

    Two main components of the hematopoietic niche are hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs). FOXO transcription factors play a fundamental role in the maintenance of these cells through the regulation of cell cycle and oxidative stress. Other gene expression programs

  10. Multiple modes of chromatin remodeling by Forkhead box proteins.

    Science.gov (United States)

    Lalmansingh, Avin S; Karmakar, Sudipan; Jin, Yetao; Nagaich, Akhilesh K

    2012-07-01

    Forkhead box (FOX) proteins represent a large family of transcriptional regulators unified by their DNA binding domain (DBD) known as a 'forkhead' or 'winged helix' domain. Over 40 FOX genes have been identified in the mammalian genome. FOX proteins share significant sequence similarities in the DBD which allow them to bind to a consensus DNA response element. However, their modes of action are quite diverse as they regulate gene expression by acting as pioneer factors, transcription factors, or both. This review focuses on the mechanisms of chromatin remodeling with an emphasis on three sub-classes-FOXA, FOXO, and FOXP members. FOXA proteins serve as pioneer factors to open up local chromatin structure and thereby increase accessibility of chromatin to factors regulating transcription. FOXP proteins, in contrast, function as classic transcription factors to recruit a variety of chromatin modifying enzymes to regulate gene expression. FOXO proteins represent a hybrid subclass having dual roles as pioneering factors and transcription factors. A subset of FOX proteins interacts with condensed mitotic chromatin and may function as 'bookmarking' agents to maintain transcriptional competence at specific genomic sites. The overall diversity in chromatin remodeling function by FOX proteins is related to unique structural motifs present within the DBD flanking regions that govern selective interactions with core histones and/or chromatin coregulatory proteins. This article is part of a Special Issue entitled: Chromatin in time and space. Published by Elsevier B.V.

  11. Role of Bone Marrow Maturity, Insulin-Like Growth Factor 1 Receptor, and Forkhead Box Protein N1 in Thymic Involution and Rejuvenation.

    Science.gov (United States)

    Tasaki, M; Villani, V; Shimizu, A; Sekijima, M; Yamada, R; Hanekamp, I M; Hanekamp, J S; Cormack, T A; Moran, S G; Kawai, A; Sachs, D H; Yamada, K

    2016-10-01

    Thymic involution is associated with age-related changes of the immune system. Utilizing our innovative technique of transplantation of a thymus as an isolated vascularized graft in MHC-inbred miniature swine, we have previously demonstrated that aged thymi are rejuvenated after transplantation into juvenile swine. Here we have studied the role of insulin-like growth factor (IGF) and forkhead-box protein-N1 (FOXN1) as well as bone marrow (BM) in thymic rejuvenation and involution. We examined thymic rejuvenation and involution by means of histology and flow cytometry. Thymic function was assessed by the ability to induce tolerance of allogeneic kidneys. Aged thymi were rejuvenated in a juvenile environment, and successfully induced organ tolerance, while juvenile thymi in aged recipients involuted and had a limited ability to induce tolerance. However, juvenile BM inhibited the involution process of juvenile thymi in aged recipients. An elevated expression of both FOXN1 and IGF1 receptors (IGF-1R) was observed in juvenile thymi and rejuvenated thymi. Juvenile BM plays a role in promoting the local thymic milieu as indicated by its ability to inhibit thymic involution in aged animals. The expression of FOXN1 and IGF-1R was noted to increase under conditions that stimulated rejuvenation, suggesting that these factors are involved in thymic recovery. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  12. The Forkhead box transcription factor FOXM1 is required for the maintenance of cell proliferation and protection against oxidative stress in human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    C.T.D. Kwok

    2016-05-01

    Full Text Available Human embryonic stem cells (hESCs exhibit unique cell cycle structure, self-renewal and pluripotency. The Forkhead box transcription factor M1 (FOXM1 is critically required for the maintenance of pluripotency in mouse embryonic stem cells and mouse embryonal carcinoma cells, but its role in hESCs remains unclear. Here, we show that FOXM1 expression was enriched in undifferentiated hESCs and was regulated in a cell cycle-dependent manner with peak levels detected at the G2/M phase. Expression of FOXM1 did not correlate with OCT4 and NANOG during in vitro differentiation of hESCs. Importantly, knockdown of FOXM1 expression led to aberrant cell cycle distribution with impairment in mitotic progression but showed no profound effect on the undifferentiated state. Interestingly, FOXM1 depletion sensitized hESCs to oxidative stress. Moreover, genome-wide analysis of FOXM1 targets by ChIP-seq identified genes important for M phase including CCNB1 and CDK1, which were subsequently confirmed by ChIP and RNA interference analyses. Further peak set comparison against a differentiating hESC line and a cancer cell line revealed a substantial difference in the genomic binding profile of FOXM1 in hESCs. Taken together, our findings provide the first evidence to support FOXM1 as an important regulator of cell cycle progression and defense against oxidative stress in hESCs.

  13. Regulation of the human lipoprotein lipase gene by the forkhead box transcription factor FOXA2/HNF-3β in hepatic cells.

    Science.gov (United States)

    Kanaki, Maria; Kardassis, Dimitris

    2017-03-01

    Lipoprotein lipase (LPL) plays a major role in the hydrolysis of triglycerides (TG) from circulating TG-rich lipoproteins. The role of LPL in the liver has been controversial but recent studies in mice with liver LPL overexpression or deficiency have revealed important new roles of the enzyme in glucose and lipid metabolism. The objective of this study was to identify regulatory elements and factors that control the transcription of the human LPL gene in hepatocytes. Deletion analysis of the human LPL promoter revealed that the proximal region which harbors a binding site for the forkhead box transcription factor FOXA2/HNF-3β at position -47/-40 is important for its hepatic cell activity. Silencing of FOXA2 in HepG2 cells reduced the LPL mRNA and protein levels. Direct binding of FOXA2 to the novel binding site was established in vitro and ex vivo. Mutagenesis of the FOXA2 site reduced the basal activity and abolished the FOXA2-mediated transactivation of the LPL promoter. Ιnsulin decreased LPL mRNA levels in HepG2 cells and this was associated with phosphorylation of AKT and nuclear export of FOXA2. In summary, the data of the present study combined with previous findings on the role of FOXA2 in HDL metabolism and gluconeogenesis, suggest that FOXA2 is a key regulator of lipid and glucose homeostasis in the adult liver. Understanding the mechanisms by which FOXA2 exerts its functions in hepatocytes may open the way to novel therapeutic strategies for patients with metabolic diseases such as dyslipidemia, diabetes and the metabolic syndrome. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. X-chromosome Forkhead Box P3 polymorphisms associate with atopy in girls in three Dutch birth cohorts.

    NARCIS (Netherlands)

    Bottema, R.W.B.; Kerkhof, M.; Reijmerink, N.E.; Koppelman, G.H.; Thijs, C.; Stelma, F.F.; Smit, H.A.; Brunekreef, B.|info:eu-repo/dai/nl/067548180

    2010-01-01

    BACKGROUND: The Forkhead Box P3 (FOXP3) gene, located on the X-chromosome, encodes a transcription factor that directs T cells toward a regulatory phenotype. Regulatory T cells may suppress development of atopy. We evaluated whether single-nucleotide polymorphisms (SNPs) of FOXP3 are associated with

  15. X-chromosome Forkhead Box P3 polymorphisms associate with atopy in girls in three Dutch birth cohorts

    NARCIS (Netherlands)

    Bottema, R. W. B.; Kerkhof, M.; Reijmerink, N. E.; Koppelman, G. H.; Thijs, C.; Stelma, F. F.; Smit, H. A.; Brunekreef, B.; van Schayck, C. P.; Postma, D. S.

    P>Background: The Forkhead Box P3 (FOXP3) gene, located on the X-chromosome, encodes a transcription factor that directs T cells toward a regulatory phenotype. Regulatory T cells may suppress development of atopy. We evaluated whether single-nucleotide polymorphisms (SNPs) of FOXP3 are associated

  16. Forkhead box A1 (FOXA1) is a key mediator of insulin-like growth factor I (IGF-I) activity.

    Science.gov (United States)

    Potter, Adam S; Casa, Angelo J; Lee, Adrian V

    2012-01-01

    The insulin-like growth factor receptor (IGF-IR) has been implicated in a number of human tumors, including breast cancer. Data from human breast tumors has demonstrated that IGF-IR is over-expressed and hyper-phosphorylated. Additionally, microarray analysis has shown that IGF-I treatment of MCF7 cells leads to a gene signature comprised of induced and repressed genes, which correlated with luminal B tumors. FOXA1, a forkhead family transcription factor, has been shown to be crucial for mammary ductal morphogenesis, similar to IGF-IR, and expressed at high levels in luminal subtype B breast tumors. Here, we investigated the relationship between FOXA1 and IGF-I action in breast cancer cells. We show that genes regulated by IGF-I are enriched for FOXA1 binding sites, and knock down of FOXA1 blocked the ability of IGF-I to regulate gene expression. IGF-I treatment of MCF7 cells increased the half-life of FOXA1 protein and this increase in half-life appeared to be dependent on canonical IGF-I signal transduction through both MAPK and AKT pathways. Finally, knock down of FOXA1 led to a decreased ability of IGF-I to induce proliferation and protect against apoptosis. Together, these results demonstrate that IGF-I can increase the stability of FOXA1 protein expression and place it as a critical mediator of IGF-I regulation of gene expression and IGF-I-mediated biological responses. Copyright © 2011 Wiley Periodicals, Inc.

  17. Conserved structural domains in FoxD4L1, a neural forkhead box transcription factor, are required to repress or activate target genes.

    Directory of Open Access Journals (Sweden)

    Steven L Klein

    Full Text Available FoxD4L1 is a forkhead transcription factor that expands the neural ectoderm by down-regulating genes that promote the onset of neural differentiation and up-regulating genes that maintain proliferative neural precursors in an immature state. We previously demonstrated that binding of Grg4 to an Eh-1 motif enhances the ability of FoxD4L1 to down-regulate target neural genes but does not account for all of its repressive activity. Herein we analyzed the protein sequence for additional interaction motifs and secondary structure. Eight conserved motifs were identified in the C-terminal region of fish and frog proteins. Extending the analysis to mammals identified a high scoring motif downstream of the Eh-1 domain that contains a tryptophan residue implicated in protein-protein interactions. In addition, secondary structure prediction programs predicted an α-helical structure overlapping with amphibian-specific Motif 6 in Xenopus, and similarly located α-helical structures in other vertebrate FoxD proteins. We tested functionality of this site by inducing a glutamine-to-proline substitution expected to break the predicted α-helical structure; this significantly reduced FoxD4L1's ability to repress zic3 and irx1. Because this mutation does not interfere with Grg4 binding, these results demonstrate that at least two regions, the Eh-1 motif and a more C-terminal predicted α-helical/Motif 6 site, additively contribute to repression. In the N-terminal region we previously identified a 14 amino acid motif that is required for the up-regulation of target genes. Secondary structure prediction programs predicted a short β-strand separating two acidic domains. Mutant constructs show that the β-strand itself is not required for transcriptional activation. Instead, activation depends upon a glycine residue that is predicted to provide sufficient flexibility to bring the two acidic domains into close proximity. These results identify conserved predicted

  18. Skin expression of mammalian target of rapamycin and forkhead box transcription factor O1, and serum insulin-like growth factor-1 in patients with acne vulgaris and their relationship with diet.

    Science.gov (United States)

    Agamia, N F; Abdallah, D M; Sorour, O; Mourad, B; Younan, D N

    2016-06-01

    Acne vulgaris is a multifactorial disorder of the pilosebaceous units. Several studies have reported that insulin-like growth factor (IGF)-1, forkhead box transcription factor (Fox)O1 and mammalian target of rapamycin (mTOR) interactions may be the key to understanding the links between genetic and environmental factors in acne vulgaris. To evaluate the immunohistochemical detection of mTOR and FoxO1 in the skin, and the serum level of IGF-1 in patients with acne vulgaris. This study was carried out on 60 participants, including 40 patients with acne and 20 controls. A diet questionnaire was administered to the patients and controls. Serum levels of IGF-1 were measured using enzyme-linked immunosorbent assay, and skin biopsies were taken from lesions on the backs of the patients and controls. FoxO1 and mTOR expression was detected using immunohistochemistry. A significantly higher serum IGF-1 level was found in the patients with acne than in the controls. The cytoplasmic expression of FoxO1 was found to be significantly greater in the acne group, whereas in the control subjects this expression was likely to be nuclear. Both the cytoplasmic expression and the nuclear expression of mTOR were significantly more intense in the patients with acne than in the controls. Excess consumption of a high-glycaemic-load diet was significantly associated with higher serum levels of IGF-1 and cytoplasmic expression of FoxO1 and mTOR. These results suggest that FoxO1, mTOR, serum IGF-1 and a high-glycaemic-load diet may play a role in acne pathogenesis. © 2016 British Association of Dermatologists.

  19. Immunosuppression during active tuberculosis is characterized by decreased interferon- gamma production and CD25 expression with elevated forkhead box P3, transforming growth factor- beta , and interleukin-4 mRNA levels.

    Science.gov (United States)

    Roberts, Teri; Beyers, Nulda; Aguirre, Ana; Walzl, Gerhard

    2007-03-15

    The balance between effector and regulatory responses after Mycobacterium tuberculosis infection may dictate outcome and progression to active disease. We investigated effector and regulatory T cell responses in bacille Calmette-Guerin (BCG)-stimulated peripheral blood mononuclear cells and whole blood cultures from persons with active tuberculosis (TB), persons with TB at the end of 6 months of treatment, and healthy control subjects with latent TB infection. All 3 groups displayed BCG-induced increases in effector and regulatory T cell phenotypes as defined by CD4(+)CD25(lo) and CD4(+)CD25(hi) T cells, respectively. In case patients with active disease, BCG stimulation induced the lowest increase of CD25, CD4(+)CD25(hi), CTLA-4, and interferon- gamma . However, these case patients expressed the highest mRNA levels of forkhead box P3, transforming growth factor (TGF)- beta , and interleukin (IL)-4 and a lower T-bet : GATA-3 ratio. There were no significant differences in IL-4 delta 2, IL-10, or TGF- beta receptor-II mRNA expression between groups. Together, these results suggest that immunosuppression seen after mycobacterial stimulation in case patients with active TB is associated with naturally occurring regulatory T cells.

  20. Forkhead box A3 attenuated the progression of fibrosis in a rat model of biliary atresia

    Science.gov (United States)

    Dong, Rui; Yang, Yifan; Shen, Zhen; Zheng, Chao; Jin, Zhu; Huang, Yanlei; Zhang, Zhien; Zheng, Shan; Chen, Gong

    2017-01-01

    Biliary atresia is a rare, devastating disease of infants where a fibroinflammatory process destroys the bile ducts, leading to fibrosis and biliary cirrhosis, and death if untreated. The cause and pathogenesis remain largely unknown. We tried to investigate factors involved in biliary atresia, especially forkhead box A3 (Foxa3), which might exert a role in the treatment of liver disease. We used RNA sequencing to sequence the whole transcriptomes of livers from six biliary atresia and six choledochal cysts patients. Then, we employed a rat disease model by bile duct ligation (BDL) and adenovirus transduction to address the function of Foxa3 in biliary atresia. We found that tight junction, adherence junction, cell cycle, apoptosis, chemokine singling, VEGF and MAPK signaling pathways were enriched in biliary atresia livers. We showed that Foxa3 expression was notably decreased in liver samples from biliary atresia patients. More importantly, we found that its lower expression predicted a poorer overall survival of biliary atresia patients. Rats that received BDL surgery and Foxa3 expression adenovirus resulted in a significant decrease in the deposition of collagen, and expression of profibrotic cytokines (transforming growth factor-β and connective tissue growth factor) and fibrosis markers (α-smooth muscle actin, collagen I and collagen III), as compared with rats that received BDL surgery and control adenovirus. Our data suggested a protection role for Foxa3 during the progression of liver fibrosis in biliary atresia, and thereby supported increasing Foxa3 as a targeted treatment strategy. PMID:28358366

  1. Forkhead Box Transcription Factor (FOXO3a) mediates the cytotoxic effect of vernodalin in vitro and inhibits the breast tumor growth in vivo.

    Science.gov (United States)

    Ananda Sadagopan, Suresh Kumar; Mohebali, Nooshin; Looi, Chung Yeng; Hasanpourghadi, Mohadeseh; Pandurangan, Ashok Kumar; Arya, Aditya; Karimian, Hamed; Mustafa, Mohd Rais

    2015-12-08

    Natural compounds have been demonstrated to lower breast cancer risk and sensitize tumor cells to anticancer therapies. Recently, we demonstrated that vernodalin (the active constituent of the medicinal herb Centratherum anthelminticum seeds) induces apoptosis in breast cancer cell-lines. The aim of this work was to gain an insight into the underlying anticancer mechanism of vernodalin using in vitro and in vivo model. Vernodalin was isolated through the bioassay guided fractionation from the seeds. The protein expression of p-Akt, PI3K, FOXO3a, Bim, p27kip1, cyclinD1, and cyclinE was examined by the Western blot analysis. Immunoprecipitation assays were performed to analyse Akt kinase activity. Small interfering RNA (siRNA) was used to study the role of FOXO3a upregulation and their targets during vernodalin treatment. Immunofluorescence, subcellular localisation of FOXO3a by Western blot was performed to analyse FOXO3a localisation in nucleus of breast cancer cells. Immunohistochemical analysis of PCNA, Ki67, p27kip1, FOXO3a and p-FOXO3a in the LA7-induced mammary gland tumor model was performed. Our results showed that vernodalin regulates cancer cell apoptosis through activation of FOXO transcription factors and its downstream targets (Bim, p27Kip1, p21Waf1/cip1, cyclin D1, cyclin E) as examined by Western blots. Furthermore, we showed that FOXO3a/PI3K-Akt played a significant role in vernodalin induced apoptosis in breast cancer cells. Immunoprecipitation assays showed Akt kinase activity was downregulated. Immunofluorescence, subcellular fractionation and Western blot showed FOXO3a accumulation in the nucleus of breast cancer cells after vernodalin treatment. Silencing of FOXO3a protected breast cancer cells against vernodalin induced apoptosis. The anti-tumor action of vernodalin was further confirmed by examining cell proliferative markers, PCNA and Ki67 in the LA7-induced mammary gland tumor model. We also corroborated our findings in vivo by showing

  2. Forkhead Box A2 (FOXA2) Inhibits Invasion and Tumorigenesis in Glioma Cells.

    Science.gov (United States)

    Ding, Bingqian; Liang, Huimin; Gao, Ming; Li, Zhenjiang; Xu, Chenyang; Fan, Shaokang; Chang, Na

    2017-05-24

    The forkhead box A2 (FOXA2) is the key transcriptional factor that plays an important role in tumorigenesis. However, until now the expression pattern and role of FOXA2 in glioma have yet to be elucidated. Therefore, the aim of this study was to evaluate the expression of FOXA2 in glioma and investigate its role in glioma cells. Our data showed that FOXA2 was significantly downregulated in human glioma cell lines. Forced expression of FOXA2 suppressed the ability of glioma cells to proliferate, migrate, and invade and influenced the expression level of EMT-associated proteins. In addition, forced expression of FOXA2 attenuated tumor growth of glioma in a nude mouse xenograft model. Mechanistically, we disclosed that forced expression of FOXA2 greatly downregulated the expression of β-catenin, cyclin D1, and c-Myc in glioma cells. Taken together, these results show that FOXA2 may play an important role in proliferation, invasion, and tumorigenesis in glioma cells. Thus, FOXA2 may be a potential therapeutic target for the treatment of glioma.

  3. Forkhead Box Protein A2 (FOXA2) Protein Stability and Activity Are Regulated by Sumoylation

    OpenAIRE

    Belaguli, Narasimhaswamy S.; Zhang, Mao; Brunicardi, F. Charles; Berger, David H.

    2012-01-01

    The forkhead box protein A2 (FOXA2) is an important regulator of glucose and lipid metabolism and organismal energy balance. Little is known about how FOXA2 protein expression and activity are regulated by post-translational modifications. We have identified that FOXA2 is post-translationally modified by covalent attachment of a small ubiquitin related modifier-1 (SUMO-1) and mapped the sumoylation site to the amino acid lysine 6 (K6). Preventing sumoylation by mutating the SUMO acceptor K6 t...

  4. Forkhead box a2 (FOXA2) is essential for uterine function and fertility.

    Science.gov (United States)

    Kelleher, Andrew M; Peng, Wang; Pru, James K; Pru, Cindy A; DeMayo, Francesco J; Spencer, Thomas E

    2017-02-07

    Establishment of pregnancy is a critical event, and failure of embryo implantation and stromal decidualization in the uterus contribute to significant numbers of pregnancy losses in women. Glands of the uterus are essential for establishment of pregnancy in mice and likely in humans. Forkhead box a2 (FOXA2) is a transcription factor expressed specifically in the glands of the uterus and is a critical regulator of postnatal uterine gland differentiation in mice. In this study, we conditionally deleted FOXA2 in the adult mouse uterus using the lactotransferrin Cre (Ltf-Cre) model and in the neonatal mouse uterus using the progesterone receptor Cre (Pgr-Cre) model. The uteri of adult FOXA2-deleted mice were morphologically normal and contained glands, whereas the uteri of neonatal FOXA2-deleted mice were completely aglandular. Notably, adult FOXA2-deleted mice are completely infertile because of defects in blastocyst implantation and stromal cell decidualization. Leukemia inhibitory factor (LIF), a critical implantation factor of uterine gland origin, was not expressed during early pregnancy in adult FOXA2-deleted mice. Intriguingly, i.p. injections of LIF initiated blastocyst implantation in the uteri of both gland-containing and glandless adult FOXA2-deleted mice. Although pregnancy was rescued by LIF and was maintained to term in uterine gland-containing adult FOXA2-deleted mice, pregnancy failed by day 10 in neonatal FOXA2-deleted mice lacking uterine glands. These studies reveal a previously unrecognized role for FOXA2 in regulation of adult uterine function and fertility and provide original evidence that uterine glands and, by inference, their secretions play important roles in blastocyst implantation and stromal cell decidualization.

  5. Successful immunotherapy of autoimmune cholangitis by adoptive transfer of forkhead box protein 3+ regulatory T cells

    Science.gov (United States)

    Tanaka, H; Zhang, W; Yang, G-X; Ando, Y; Tomiyama, T; Tsuneyama, K; Leung, P; Coppel, R L; Ansari, A A; Lian, Z X; Ridgway, W M; Joh, T; Gershwin, M E

    2014-01-01

    Treatment of primary biliary cirrhosis (PBC) has lagged behind that of other autoimmune diseases. In this study we have addressed the potential utility of immunotherapy using regulatory T cells (Treg) to treat murine autoimmune cholangitis. In particular, we have taken advantage of our ability to produce portal inflammation and bile duct cell loss by transfer of CD8+ T cells from the dominant negative form of transforming growth factor beta receptor type II (dnTGF-βRII) mice to recombination-activating gene (Rag)1–/– recipients. We then used this robust established adoptive transfer system and co-transferred CD8+ T cells from dnTGF-βRII mice with either C57BL/6 or dnTGF-βRII forkhead box protein 3 (FoxP3+) T cells. Recipient mice were monitored for histology, including portal inflammation and intralobular biliary cell damage, and also included a study of the phenotypical changes in recipient lymphoid populations and local and systemic cytokine production. Importantly, we report herein that adoptive transfer of Treg from C57BL/6 but not dnTGF-βRII mice significantly reduced the pathology of autoimmune cholangitis, including decreased portal inflammation and bile duct damage as well as down-regulation of the secondary inflammatory response. Further, to define the mechanism of action that explains the differential ability of C57BL/6 Treg versus dnTGF-βRII Treg on the ability to down-regulate autoimmune cholangitis, we noted significant differential expression of glycoprotein A repetitions predominant (GARP), CD73, CD101 and CD103 and a functionally significant increase in interleukin (IL)-10 in Treg from C57BL/6 compared to dnTGF-βRII mice. Our data reflect the therapeutic potential of wild-type CD4+ FoxP3+ Treg in reducing the excessive T cell responses of autoimmune cholangitis, which has significance for the potential immunotherapy of PBC. PMID:25041369

  6. Successful immunotherapy of autoimmune cholangitis by adoptive transfer of forkhead box protein 3(+) regulatory T cells.

    Science.gov (United States)

    Tanaka, H; Zhang, W; Yang, G-X; Ando, Y; Tomiyama, T; Tsuneyama, K; Leung, P; Coppel, R L; Ansari, A A; Lian, Z X; Ridgway, W M; Joh, T; Gershwin, M E

    2014-11-01

    Treatment of primary biliary cirrhosis (PBC) has lagged behind that of other autoimmune diseases. In this study we have addressed the potential utility of immunotherapy using regulatory T cells (Treg ) to treat murine autoimmune cholangitis. In particular, we have taken advantage of our ability to produce portal inflammation and bile duct cell loss by transfer of CD8(+) T cells from the dominant negative form of transforming growth factor beta receptor type II (dnTGF-βRII) mice to recombination-activating gene (Rag)1(-/-) recipients. We then used this robust established adoptive transfer system and co-transferred CD8(+) T cells from dnTGF-βRII mice with either C57BL/6 or dnTGF-βRII forkhead box protein 3 (FoxP3(+) ) T cells. Recipient mice were monitored for histology, including portal inflammation and intralobular biliary cell damage, and also included a study of the phenotypical changes in recipient lymphoid populations and local and systemic cytokine production. Importantly, we report herein that adoptive transfer of Treg from C57BL/6 but not dnTGF-βRII mice significantly reduced the pathology of autoimmune cholangitis, including decreased portal inflammation and bile duct damage as well as down-regulation of the secondary inflammatory response. Further, to define the mechanism of action that explains the differential ability of C57BL/6 Treg versus dnTGF-βRII Treg on the ability to down-regulate autoimmune cholangitis, we noted significant differential expression of glycoprotein A repetitions predominant (GARP), CD73, CD101 and CD103 and a functionally significant increase in interleukin (IL)-10 in Treg from C57BL/6 compared to dnTGF-βRII mice. Our data reflect the therapeutic potential of wild-type CD4(+) FoxP3(+) Treg in reducing the excessive T cell responses of autoimmune cholangitis, which has significance for the potential immunotherapy of PBC. © 2014 British Society for Immunology.

  7. Immunoregulatory Forkhead Box Protein p3-Positive Lymphocytes Are Associated with Overall Survival in Patients with Pancreatic Neuroendocrine Tumors

    NARCIS (Netherlands)

    Reuver, P.R.; Mehta, S.; Gill, P.; Andrici, J.; D'Urso, L.; Clarkson, A.; Mittal, A.; Hugh, T.J.; Samra, J.S.; Gill, A.J.

    2016-01-01

    BACKGROUND: Forkhead box protein p3-positive (FoxP3(+)) regulatory T cells (Tregs) suppress host T-cell-mediated immune responses, limit surveillance against cancers, and have been associated with a poor prognosis. STUDY DESIGN: This study aims to identify the prognostic significance of FoxP3(+)

  8. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    Science.gov (United States)

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Forkhead box protein A2 (FOXA2 protein stability and activity are regulated by sumoylation.

    Directory of Open Access Journals (Sweden)

    Narasimhaswamy S Belaguli

    Full Text Available The forkhead box protein A2 (FOXA2 is an important regulator of glucose and lipid metabolism and organismal energy balance. Little is known about how FOXA2 protein expression and activity are regulated by post-translational modifications. We have identified that FOXA2 is post-translationally modified by covalent attachment of a small ubiquitin related modifier-1 (SUMO-1 and mapped the sumoylation site to the amino acid lysine 6 (K6. Preventing sumoylation by mutating the SUMO acceptor K6 to arginine resulted in downregulation of FOXA2 protein but not RNA expression in INS-1E insulinoma cells. K6R mutation also downregulated FOXA2 protein levels in HepG2 hepatocellular carcinoma cells, HCT116 colon cancer cells and LNCaP and DU145 prostate cancer cells. Further, interfering with FOXA2 sumoylation through siRNA mediated knockdown of UBC9, an essential SUMO E2 conjugase, resulted in downregulation of FOXA2 protein levels. Stability of sumoylation deficient FOXA2K6R mutant protein was restored when SUMO-1 was fused in-frame. FOXA2 sumoylation and FOXA2 protein levels were increased by PIAS1 SUMO ligase but not a SUMO ligase activity deficient PIAS1 mutant. Although expressed at lower levels, sumoylation deficient FOXA2K6R mutant protein was detectable in the nucleus indicating that FOXA2 nuclear localization is independent of sumoylation. Sumoylation increased the transcriptional activity of FOXA2 on Pdx-1 area I enhancer. Together, our results show that sumoylation regulates FOXA2 protein expression and activity.

  10. Forkhead box protein A2 (FOXA2) protein stability and activity are regulated by sumoylation.

    Science.gov (United States)

    Belaguli, Narasimhaswamy S; Zhang, Mao; Brunicardi, F Charles; Berger, David H

    2012-01-01

    The forkhead box protein A2 (FOXA2) is an important regulator of glucose and lipid metabolism and organismal energy balance. Little is known about how FOXA2 protein expression and activity are regulated by post-translational modifications. We have identified that FOXA2 is post-translationally modified by covalent attachment of a small ubiquitin related modifier-1 (SUMO-1) and mapped the sumoylation site to the amino acid lysine 6 (K6). Preventing sumoylation by mutating the SUMO acceptor K6 to arginine resulted in downregulation of FOXA2 protein but not RNA expression in INS-1E insulinoma cells. K6R mutation also downregulated FOXA2 protein levels in HepG2 hepatocellular carcinoma cells, HCT116 colon cancer cells and LNCaP and DU145 prostate cancer cells. Further, interfering with FOXA2 sumoylation through siRNA mediated knockdown of UBC9, an essential SUMO E2 conjugase, resulted in downregulation of FOXA2 protein levels. Stability of sumoylation deficient FOXA2K6R mutant protein was restored when SUMO-1 was fused in-frame. FOXA2 sumoylation and FOXA2 protein levels were increased by PIAS1 SUMO ligase but not a SUMO ligase activity deficient PIAS1 mutant. Although expressed at lower levels, sumoylation deficient FOXA2K6R mutant protein was detectable in the nucleus indicating that FOXA2 nuclear localization is independent of sumoylation. Sumoylation increased the transcriptional activity of FOXA2 on Pdx-1 area I enhancer. Together, our results show that sumoylation regulates FOXA2 protein expression and activity.

  11. Effects of estrogen on the fibrosis process of intrauterine adhesions and the expression of forkhead box F2

    Directory of Open Access Journals (Sweden)

    Si-ping CHEN

    2017-06-01

    Full Text Available Objective To investigate the effect of estrogen on the fibrosis process of intrauterine adhesions and the expression of forkhead box F2 (FoxF2. Methods Primary human endometrial stromal cells (HESCs were obtained by separation with 0.2% collagenase Ι digestion-mesh filtration-differential adherence, and identified by immunocytochemistry. HESCs affected with 10ng/ml transforming growth factor β1 (TGF-β1 for 48 hours. HESCs in model group were affected with 0, 10–6, 10–8, 10–10 and 10–12mol/L estrogen, the expressions of smooth muscle actin alpha (α-SMA, Collagen I (COLⅠ and FoxF2 were detected by quantitative PCR (qPCR and Western blotting. Results HESCs with high purity and good activity were obtained by using 0.2% collagenase Ι digestion-mesh filtration-differential adherence separation method. Immunocytochemistry showed positive vimentin and negative cytokeratin 18 in HESCs. The results of qPCR and Western blotting showed that the mRNA and protein expression levels of α-SMA, COLⅠ and FoxF2 were higher in model group than in control group (P0.05 in 10–10mol/L estrogen group, P0.05. Compared with the model group, the protein expression levels of α-SMA, COLⅠ and FoxF2 in 10–6, 10–8 and 10–10mol/L estrogen groups decreased, but no significant difference was found (P0.05, and of COLⅠ and FoxF2 proteins decreased (P<0.05. Conclusions The expression of FoxF2 in intrauterine adhesions is increased. Estrogen can reverse the fibrosis process of intrauterine adhesions in a certain range and inhibit the expression of FoxF2. DOI: 10.11855/j.issn.0577-7402.2017.04.10

  12. Thymoma in Patient with Myasthenia Gravis Has Significantly Fewer Forkhead Box P3 Positive Lymphocytes than that without One.

    Science.gov (United States)

    Nishi, Tatsuya; Yokoyama, Shintaro; Takamori, Shinzo; Matsuo, Toshihiro; Murakami, Daigo; Akagi, Yoshito; Ohshima, Koichi

    2015-01-01

    Forkhead box P3 (FoxP3) is known as a pivotal and specific transcriptional factor of regulatory T cells, and are implicated in various immune diseases including myasthenia gravis (MG). The aim of this study was to investigate the relationships between FoxP3 expression of lymphocytes in thymoma and clinicopathological characteristics, particularly MG status in thymoma patients. We reviewed 83 thymoma specimens, including 22 from MG patients, and evaluated the FoxP3 expression of lymphocytes in thymoma using immunohistochemistry (IHC). Statistical association was evaluated using chi-square test and Fisher's exact test. Thirty-four cases (41.0%) were classified as FoxP3 positive. There were no statistical differences in sex (P=0.289), age (P=0.536), Masaoka stage (P=0.086), WHO histological classification (P=0.097), or Myasthenia Gravis Foundation of America (MGFA) Clinical Classification (P=0.117) between FoxP3 positive and negative cases. In contrast, thymoma in cases with MG showed significantly fewer FoxP3 positive lymphocytes than those in cases without MG (P=0.037). Moreover, cases with anti-acetylcholine receptor antibody titer equal to or greater than the normal limit also showed significantly fewer FoxP3 positive lymphocytes than cases within the normal limit (Pthymoma may lead to the development of MG and to an increase in anti-acetylcholine receptor antibodies. In addition, FoxP3 positive lymphocytes might be a useful biomarker for evaluation of the risk of MG onset, and could open the way to more effective therapeutic strategies in thymoma patients.

  13. Association between forkhead-box P2 gene polymorphism and clinical symptoms in chronic schizophrenia in a Chinese population.

    Science.gov (United States)

    Rao, Wenwang; Du, Xiangdong; Zhang, Yingyang; Yu, Qiong; Hui, Li; Yu, Yaqin; Kou, Changgui; Yin, Guangzhong; Zhu, Xiaomin; Man, Lijuan; Soares, Jair C; Zhang, Xiang Yang

    2017-07-01

    The forkhead-box P2 (FOXP2) gene polymorphism has been reported to be involved in the susceptibility to schizophrenia; however, few studies have investigated the association between FOXP2 gene polymorphism and clinical symptoms in schizophrenia. This study investigated whether the FOXP2 gene was associated with the development and symptoms of schizophrenia in relatively genetically homogeneous Chinese population. The FOXP2 rs10447760 polymorphism was genotyped in 1069 schizophrenia inpatients and 410 healthy controls using a case-control design. The patients' psychopathology was assessed by the Positive and Negative Syndrome Scale (PANSS). We found no significant differences in the genotype and allele distributions between the patient and control groups. Interestingly, we found significant differences in PANSS total, positive symptom, and general psychopathology scores between genotypic subgroups in patients, with the higher score in patients with CC genotype than those with CT genotype (all p schizophrenia, but may contribute to the clinical symptoms of schizophrenia among Han Chinese.

  14. Forkhead Box Protein 1 (Foxa1) and the Sumoylation Pathway that Regulates Foxa1 Stability are Potential Targets for Breast Cancer Treatment

    National Research Council Canada - National Science Library

    Belaguli, Narasimhaswamy S

    2007-01-01

    .... In contrast to the related forkhead box protein A2 (Foxa2) in which the K6R mutation induced protein destabilization, mutation of the conserved K6 sumoylation site did not strongly affect the stability of the Foxa1 protein...

  15. Forkhead box P3 regulates ARHGAP15 expression and affects migration of glioma cells through the Rac1 signaling pathway.

    Science.gov (United States)

    Sun, Zhen; Zhang, Biao; Wang, Chen; Fu, Tao; Li, Lianling; Wu, Qiaoli; Cai, Ying; Wang, Jinhuan

    2017-01-01

    Forkhead box P3 (FOXP3) plays a crucial role in the development and function of regulatory T cells and was recently identified as a tumor suppressor in different cancer types. Forkhead box P3 is expressed in normal brain tissues, but is strongly downregulated or absent in glioblastomas. In order to understand the FOXP3 adjustment mechanisms in glioma cells, we performed a DNA microarray in U87 cells overexpressing FOXP3 and validated the differences using quantitative real-time PCR, Western blot analysis, and immunohistochemistry in vitro and in vivo. We found that FOXP3 can regulate the expression of ARHGAP15. Expression of FOXP3 was also correlated with ARHGAP15 in glioma samples. Overexpression of FOXP3 inhibited glioma cell migration through ARHGAP15 upregulation and Rac1 inactivation. Silencing of FOXP3 promoted migration through ARHGAP15 downregulation and Rac1 activation. ARHGAP15, a GTPase-activating protein for Rac1, inhibits small GTPase signaling in a dual negative manner. We found that there is a correlation between expression of ARHGAP15 and glioma level. The small GTPase Rac1 plays an important role in cell migration. In addition, we found that FOXP3 regulates expression of epithelial-mesenchymal transition markers E-cadherin and N-cadherin, which is important given that epithelial-mesenchymal transition is critically involved in tumor spreading and dissemination. Thus, FOXP3 or ARHGAP15 may serve as a new molecular target for antimetastatic therapies in treating glioma. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  16. Tumor Necrosis Factor Receptor-associated Protein 1 (TRAP1) Mutation and TRAP1 Inhibitor Gamitrinib-triphenylphosphonium (G-TPP) Induce a Forkhead Box O (FOXO)-dependent Cell Protective Signal from Mitochondria.

    Science.gov (United States)

    Kim, Hyunjin; Yang, Jinsung; Kim, Min Ju; Choi, Sekyu; Chung, Ju-Ryung; Kim, Jong-Min; Yoo, Young Hyun; Chung, Jongkyeong; Koh, Hyongjong

    2016-01-22

    TRAP1 (tumor necrosis factor receptor-associated protein 1), a mitochondrial Hsp90 family chaperone, has been identified as a critical regulator of cell survival and bioenergetics in tumor cells. To discover novel signaling networks regulated by TRAP1, we generated Drosophila TRAP1 mutants. The mutants successfully developed into adults and produced fertile progeny, showing that TRAP1 is dispensable in development and reproduction. Surprisingly, mutation or knockdown of TRAP1 markedly enhanced Drosophila survival under oxidative stress. Moreover, TRAP1 mutation ameliorated mitochondrial dysfunction and dopaminergic (DA) neuron loss induced by deletion of a familial Parkinson disease gene PINK1 (Pten-induced kinase 1) in Drosophila. Gamitrinib-triphenylphosphonium, a mitochondria-targeted Hsp90 inhibitor that increases cell death in HeLa and MCF7 cells, consistently inhibited cell death induced by oxidative stress and mitochondrial dysfunction induced by PINK1 mutation in mouse embryonic fibroblast cells and DA cell models such as SH-SY5Y and SN4741 cells. Additionally, gamitrinib-triphenylphosphonium also suppressed the defective locomotive activity and DA neuron loss in Drosophila PINK1 null mutants. In further genetic analyses, we showed enhanced expression of Thor, a downstream target gene of transcription factor FOXO, in TRAP1 mutants. Furthermore, deletion of FOXO almost nullified the protective roles of TRAP1 mutation against oxidative stress and PINK1 mutation. These results strongly suggest that inhibition of the mitochondrial chaperone TRAP1 generates a retrograde cell protective signal from mitochondria to the nucleus in a FOXO-dependent manner. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Physical and functional interactions between nuclear receptor LXRα and the forkhead box transcription factor FOXA2 regulate the response of the human lipoprotein lipase gene to oxysterols in hepatic cells.

    Science.gov (United States)

    Kanaki, Maria; Tiniakou, Ioanna; Thymiakou, Efstathia; Kardassis, Dimitris

    2017-08-01

    Lipoprotein lipase (LPL) catalyzes the hydrolysis of triglycerides from triglyceride-rich lipoproteins such as VLDL and chylomicrons in the circulation. Mutations in LPL or its activator apolipoprotein C-II cause hypertriglyceridemia in humans and animal models. The levels of LPL in the liver are low but they can be strongly induced by a high cholesterol diet or by synthetic ligands of Liver X Receptors (LXRs). However, the mechanism by which LXRs activate the human LPL gene is unknown. In the present study we show that LXR agonists increased the mRNA and protein levels as well as the promoter activity of human LPL in HepG2 cells. A promoter deletion analysis defined the proximal -109/-28 region, which contains a functional FOXA2 element, as essential for transactivation by ligand-activated LXRα/RXRα heterodimers. Silencing of endogenous FOXA2 in HepG2 cells by siRNAs or by treatment with insulin compromised the induction of the LPL gene by LXR agonists whereas mutations in the FOXA2 site abolished the synergistic transactivation of the LPL promoter by LXRα/RXRα and FOXA2. Physical and functional interactions between LXRα and FOXA2 were established in vitro and ex vivo. In summary, the present study revealed a novel mechanism of human LPL gene induction by oxysterols in the liver with is based on physical and functional interactions between transcription factors LXRα and FOXA2. This mechanism, which may not be restricted to the LPL gene, is critically important for a better understanding of the regulation of cholesterol and triglyceride metabolism in the liver under healthy or pathological states. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Cell cycle inhibition by FoxO forkhead transcription factors involves downregulation of cyclin D

    NARCIS (Netherlands)

    Schmidt, M.; Fernandez de Mattos, S.; Horst, Armando van der; Klompmaker, R.; Kops, G.J.P.L.; Lam, E.W.-F.; Burgering, B.M.T.; Medema, R.H.

    2002-01-01

    The FoxO forkhead transcription factors FoxO4 (AFX), FoxO3a (FKHR.L1), and FoxO1a (FKHR) represent important physiological targets of phosphatidylinositol-3 kinase (PI3K)/protein kinase B (PKB) signaling. Overexpression or conditional activation of FoxO factors is able to antagonize many responses

  19. Forkhead box A1 (FOXA1) and A2 (FOXA2) oppositely regulate human type 1 iodothyronine deiodinase gene in liver.

    Science.gov (United States)

    Kanamoto, Naotetsu; Tagami, Tetsuya; Ueda-Sakane, Yoriko; Sone, Masakatsu; Miura, Masako; Yasoda, Akihiro; Tamura, Naohisa; Arai, Hiroshi; Nakao, Kazuwa

    2012-01-01

    Type 1 iodothyronine deiodinase (D1), a selenoenzyme that catalyzes the bioactivation of thyroid hormone, is expressed mainly in the liver. Its expression and activity are modulated by several factors, but the precise mechanism of its transcriptional regulation remains unclear. In the present study, we have analyzed the promoter of human D1 gene (hDIO1) to identify factors that prevalently increase D1 activity in the human liver. Deletion and mutation analyses demonstrated that a forkhead box (FOX)A binding site and an E-box site within the region between nucleotides -187 and -132 are important for hDIO1 promoter activity in the liver. EMSA demonstrated that FOXA1 and FOXA2 specifically bind to the FOXA binding site and that upstream stimulatory factor (USF) specifically binds to the E-box element. Overexpression of FOXA2 decreased hDIO1 promoter activity, and short interfering RNA-mediated knockdown of FOXA2 increased the expression of hDIO1 mRNA. In contrast, overexpression of USF1/2 increased hDIO1 promoter activity. Short interfering RNA-mediated knockdown of FOXA1 decreased the expression of hDIO1 mRNA, but knockdown of both FOXA1 and FOXA2 restored it. The response of the hDIO1 promoter to USF was greatly attenuated in the absence of FOXA1. Taken together, these results indicate that a balance of FOXA1 and FOXA2 expression modulates hDIO1 expression in the liver.

  20. ER stress and cancer: The FOXO forkhead transcription factor link.

    Science.gov (United States)

    Alasiri, Glowi; Fan, Lavender Yuen-Nam; Zona, Stefania; Goldsbrough, Isabella Galeno; Ke, Hui-Ling; Auner, Holger Werner; Lam, Eric Wing-Fai

    2018-02-15

    The endoplasmic reticulum (ER) is a cellular organelle with central roles in maintaining proteostasis due to its involvement in protein synthesis, folding, quality control, distribution and degradation. The accumulation of misfolded proteins in the ER lumen causes 'ER stress' and threatens overall cellular proteostasis. To restore ER homeostasis, cells evoke an evolutionarily conserved adaptive signalling and gene expression network collectively called the 'unfolded protein response (UPR)', a complex biological process which aims to restore proteostasis. When ER stress is overwhelming and beyond rectification, the normally pro-survival UPR can shift to induce cell termination. Emerging evidence from mammalian, fly and nematode worm systems reveals that the FOXO Forkhead proteins integrate upstream ER stress and UPR signals with the transcriptional machinery to decrease translation, promote cell survival/termination and increase the levels of ER-resident chaperones and of ER-associated degradation (ERAD) components to restore ER homeostasis. The high rates of protein synthesis/translation associated with cancer cell proliferation and metabolism, as well as mutations resulting in aberrant proteins, also induce ER stress and the UPR. While the pro-survival side of the UPR underlies its ability to sustain and promote cancers, its apoptotic functions can be exploited for cancer therapies by offering the chance to 'flick the proteostatic switch'. To this end, further studies are required to fully reevaluate the roles and regulation of these UPR signalling molecules, including FOXO proteins and their targets, in cancer initiation and progression as well as the effects on inhibiting their functions in cancer cells. This information will help to establish these UPR signalling molecules as possible therapeutic targets and putative biomarkers in cancers. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. FOXP1 forkhead transcription factor is associated with the pathogenesis of endometrial cancer

    Directory of Open Access Journals (Sweden)

    Makito Mizunuma

    2016-05-01

    Full Text Available Endometrial cancers are mostly estrogen-dependent. FOXP1 is a P subfamily of forkhead box (FOX, and known as an estrogen-responsive transcription factor. The aims of this study were to examine histological location of FOXP1 in normal and malignant endometrium, and to investigate a possible association between FOXP1 and other factors considered to be involved in pathogenesis of endometrial cancer. The levels of FOXP1, estrogen receptor (ERα, and ERβ expression were examined immunohistochemically in normal and malignant endometrium obtained from 75 women (8 normal, 8 atypical endometrial hyperplasia, and 59 endometrial cancers from grade 1 to 3. The effects of estrogen on ERα, FOXP1, KRAS, and PTEN expression were analyzed in telomerase-immortalized human endometrial stromal cells (T HESCs by Western blotting. Western blotting was also used to examine the effect of FOXP1 plasmid DNA or siRNA transfection on KRAS and PTEN expression in Ishikawa cells (well differentiated endometrioid adenocarcinoma, HEC-50B cells (poorly differentiated endometrioid adenocarcinoma, and T HESCs, respectively. FOXP1 was expressed in normal and malignant endometrium, but the rate of expression was different depending upon menstrual cycle and pathological grade of malignancy. FOXP1 expression in nucleus and cytoplasm of grade 3 endometrioid cancers was significantly lower than that of grade 1 and 2 ones. Estradiol increased levels of FOXP1 and KRAS expression in a dose- and time-dependent manner in T HESCs cells, and FOXP1 transfection or knockdown led to increase or decrease of KRAS expression but not PTEN. KRAS expression level was significantly related to FOXP1 and ERα levels in cancer tissues. Estradiol did not affect KRAS expression in T HESCs cells transfected with FOXP1 siRNA. These results suggest that FOXP1 is involved in estrogen dependent endometrial cancers through KRAS pathway.

  2. The solution structure of the forkhead box-O DNA binding domain of Brugia malayi DAF-16a.

    Science.gov (United States)

    Casper, Sarah K; Schoeller, Scott J; Zgoba, Danielle M; Phillips, Andrew J; Morien, Thomas J; Chaffee, Gary R; Sackett, Peter C; Peterson, Francis C; Crossgrove, Kirsten; Veldkamp, Christopher T

    2014-12-01

    Brugia malayi is a parasitic nematode that causes lymphatic filariasis in humans. Here the solution structure of the forkhead DNA binding domain of Brugia malayi DAF-16a, a putative ortholog of Caenorhabditis elegans DAF-16, is reported. It is believed to be the first structure of a forkhead or winged helix domain from an invertebrate. C. elegans DAF-16 is involved in the insulin/IGF-I signaling pathway and helps control metabolism, longevity, and development. Conservation of sequence and structure with human FOXO proteins suggests that B. malayi DAF-16a is a member of the FOXO family of forkhead proteins. © 2014 Wiley Periodicals, Inc.

  3. Splice variants of the forkhead box protein AFX exhibit dominant negative activity and inhibit AFXalpha-mediated tumor cell apoptosis.

    Directory of Open Access Journals (Sweden)

    Eun Jig Lee

    2008-07-01

    Full Text Available Loss-of-function in the apoptosis-inducing genes is known to facilitate tumorigenesis. AFX (FOXO4, a member of forkhead transcription factors functions as a tumor suppressor and has 2 isoforms, AFXalpha (505 a.a. and AFXzeta (450 a.a.. In human cancer cells, we identified an N-terminally deleted form of AFXalpha (alpha198-505, translated from a downstream start and 2 short N-terminal AFX proteins (90, and 101 a.a. produced by aberrant splicing.We investigated the expression and role of these AFX variants. Cell transduction study revealed that short N-terminal AFX proteins were not stable. Though alpha(198-505 protein expression was detected in the cytoplasm and nucleus, alpha(198-505 expressing cells did not show a nucleocytoplasmic shuttling mediated by PI3 kinase signaling. Whereas, we observed this shuttling in cells expressing either AFXalpha or AFXzeta protein. AFXzeta and alpha(198-505 lost the ability to transactivate BCL6 or suppress cyclin D2 gene expression. These variants did not induce cancer cell death whereas AFXalpha resulted in apoptosis. We found that AFXzeta and alpha(198-505 suppress the AFXalpha stimulation of BCL6 promoter in a dose dependent manner, indicating dominant negative activity. These variants also inhibited AFXalpha induction of apoptosis.Loss of function by aberrant splicing and the dominant negative activity of AFX variants may provide a mechanism for enhanced survival of neoplastic cells.

  4. Forkhead box C2 promoter variant c.-512C>T is associated with increased susceptibility to chronic venous diseases.

    Directory of Open Access Journals (Sweden)

    Sumi Surendran

    Full Text Available Chronic venous disease (CVD is one of the most prevalent yet underrated disorders worldwide. High heritability estimates of CVD indicate prominent genetic components in its etiology and pathology. Mutations in human forkhead box C2 (FoxC2 gene are strongly associated with valve failure in saphenous and deep veins of lower extremities. We explored the association of genetic variants of FoxC2 as well as FoxC2 mRNA and protein expression levels with CVD of lower limbs. We systematically sequenced the single coding exon, 5' and 3' flanking regions of FoxC2 gene in 754 study subjects which includes 382 patients with CVD and 372 healthy subjects. Four novel and three reported polymorphisms were identified in our cohort. Three variants in 5' flanking region and one in 3' flanking region of FoxC2 gene were significantly associated with CVD risk. FoxC2 mRNA in vein tissues from 22 patients was 4±1.42 fold increased compared to saphenous veins from 20 normal subjects (pT (rs34221221: C>T variant which is located in the FoxC2 putative promoter region was further analyzed. Functional analysis of c.-512C>T revealed increased mRNA and protein expression in patients with homozygous TT genotype compared to heterozygous CT and wild CC genotypes. Luciferase assay indicated higher transcriptional activity of mutant compared to wild genotype of this variant. These findings suggested that c.-512C>T variant of FoxC2 was strongly associated with susceptibility to CVD and also that this variant resulted in FoxC2 overexpression. To obtain a mechanistic insight into the role of upregulated FoxC2 in varicosities, we overexpressed FoxC2 in venous endothelial cells and observed elevated expression of arterial markers Dll4 and Hey2 and downregulation of venous marker COUP-TFII. Our study indicates altered FoxC2-Notch signaling in saphenous vein wall remodeling in patients with varicose veins.

  5. Role of Forkhead Transcription Factors in Diabetes-Induced Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Bhaskar Ponugoti

    2012-01-01

    Full Text Available Diabetes is a chronic metabolic disorder, characterized by hyperglycemia resulting from insulin deficiency and/or insulin resistance. Recent evidence suggests that high levels of reactive oxygen species (ROS and subsequent oxidative stress are key contributors in the development of diabetic complications. The FOXO family of forkhead transcription factors including FOXO1, FOXO3, FOXO4, and FOXO6 play important roles in the regulation of many cellular and biological processes and are critical regulators of cellular oxidative stress response pathways. FOXO1 transcription factors can affect a number of different tissues including liver, retina, bone, and cell types ranging from hepatocytes to microvascular endothelial cells and pericytes to osteoblasts. They are induced by oxidative stress and contribute to ROS-induced cell damage and apoptosis. In this paper, we discuss the role of FOXO transcription factors in mediating oxidative stress-induced cellular response.

  6. Inhibition of IkappaB kinase alpha (IKK{alpha}) or IKKbeta (IKK{beta}) plus forkhead box O (Foxo) abolishes skeletal muscle atrophy

    Energy Technology Data Exchange (ETDEWEB)

    Reed, S.A. [Department of Physical Therapy, University of Florida, 101 S. Newell Drive, Gainesville, FL 32610 (United States); Senf, S.M. [Department of Applied Physiology and Kinesiology, University of Florida, 25 Stadium Road, Gainesville, FL 32610 (United States); Cornwell, E.W.; Kandarian, S.C. [Department of Health Sciences, Boston University, 635 Commonwealth Avenue, Boston, MA 02215 (United States); Judge, A.R., E-mail: arjudge@phhp.ufl.edu [Department of Physical Therapy, University of Florida, 101 S. Newell Drive, Gainesville, FL 32610 (United States)

    2011-02-18

    Research highlights: {yields} Independent inhibition of Foxo, IKK{alpha} and IKK{beta} activities does not alter muscle fiber size in weight bearing muscles. {yields} Inhibition of Foxo activity plus IKK{alpha} or IKK{beta} activities increases muscle fiber size. {yields} Independent inhibition of Foxo and IKK{beta} activities attenuates cast immobilization-induced muscle fiber atrophy. {yields} Disuse muscle fiber atrophy is abolished by inhibition of Foxo activity plus IKK{alpha} or IKK{beta} activities. -- Abstract: Two transcription factor families that are activated during multiple conditions of skeletal muscle wasting are nuclear factor {kappa}B (NF-{kappa}B) and forkhead box O (Foxo). There is clear evidence that both NF-{kappa}B and Foxo activation are sufficient to cause muscle fiber atrophy and they are individually required for at least half of the fiber atrophy during muscle disuse, but there is no work determining the combined effect of inhibiting these factors during a physiological condition of muscle atrophy. Here, we determined whether inhibition of Foxo activation plus inhibition of NF-{kappa}B activation, the latter by blocking the upstream inhibitor of kappaB kinases (IKK{alpha} and IKK{beta}), would prevent muscle atrophy induced by 7 days of cast immobilization. Results were based on measurements of mean fiber cross-sectional area (CSA) from 72 muscles transfected with 5 different mutant expression plasmids or plasmid combinations. Immobilization caused a 47% decrease in fiber CSA in muscles injected with control plasmids. Fibers from immobilized muscles transfected with dominant negative (d.n.) IKK{alpha}-EGFP, d.n. IKK{beta}-EGFP or d.n. Foxo-DsRed showed a 22%, 57%, and 76% inhibition of atrophy, respectively. Co-expression of d.n. IKK{alpha}-EGFP and d.n. Foxo-DsRed significantly inhibited 89% of the immobilization-induced fiber atrophy. Similarly, co-expression of d.n. IKK{beta}-EGFP and d.n. Foxo-DsRed inhibited the immobilization

  7. Aberrant activation of hedgehog signaling promotes cell proliferation via the transcriptional activation of forkhead Box M1 in colorectal cancer cells.

    Science.gov (United States)

    Wang, DeJie; Hu, Guohui; Du, Ying; Zhang, Cheng; Lu, Quqin; Lv, Nonghua; Luo, Shiwen

    2017-02-02

    Recent evidence suggests that the aberrant activation of Hedgehog (Hh) signaling by Gli transcription factors is characteristic of a variety of aggressive human carcinomas, including colorectal cancer (CRC). Forkhead box M1 (FoxM1) controls the expression of a number of cell cycle regulatory proteins, and FoxM1 expression is elevated in a broad range of human malignancies, which suggests that it plays a crucial role in tumorigenesis. However, the mechanisms underlying FoxM1 expression are not fully understood. Here, we aim to further investigate the molecular mechanism by which Gli1 regulates FoxM1 in CRC. Western blotting and immunohistochemistry (IHC) were used to evaluate FoxM1 and Gli1 protein expression, respectively, in CRC tissues and matched adjacent normal mucosa. BrdU (5-bromo-2'-deoxyuridine) and clone formation assays were used to clarify the influence of FoxM1 on CRC cell growth and proliferation. Chromatin immunoprecipitation (ChIP) and luciferase experiments were performed to explore the potential mechanisms by which Gli1 regulates FoxM1. Additionally, the protein and mRNA expression levels of Gli1 and FoxM1 in six CRC cell lines were measured using Western blotting and real-time PCR. Finally, the effect of Hh signaling on the expression of FoxM1 was studied in cell biology experiments, and the effects of Hh signaling activation and FoxM1 inhibition on the distribution of CRC cells among cell cycle phases was assessed by flow cytometry. Gli1 and FoxM1 were abnormally elevated in human CRC tissues compared with matched adjacent normal mucosa samples, and FoxM1 is a downstream target gene of the transcription factor Gli1 in CRC and promoted CRC cell growth and proliferation. Moreover, the aberrant activation of Hh signaling promoted CRC cell proliferation by directly binding to the promoter of FoxM1 and transactivating the activity of FoxM1 in CRC cells. The dysregulation of the Hh-Gli1-FoxM1 axis is essential for the proliferation and growth of human

  8. Altered balance between self-reactive T helper (Th)17 cells and Th10 cells and between full-length forkhead box protein 3 (FoxP3) and FoxP3 splice variants in Hashimoto's thyroiditis

    DEFF Research Database (Denmark)

    Kristensen, B; Hegedüs, Laszlo; Madsen, H O

    2015-01-01

    T helper type 17 (Th17) cells play a pathogenic role in autoimmune disease, while interleukin (IL)-10-producing Th10 cells serve a protective role. The balance between the two subsets is regulated by the local cytokine milieu and by the relative expression of intact forkhead box protein 3 (FoxP3)...

  9. Associations between Forkhead Box O1 (FoxO1 Expression and Indicators of Hepatic Glucose Production in Transition Dairy Cows Supplemented with Dietary Nicotinic Acid.

    Directory of Open Access Journals (Sweden)

    Asako Kinoshita

    Full Text Available Forkhead box protein O1 (FoxO1 is a transcription factor which promotes hepatic glucose production (HGP by up-regulating the transcription of gluconeogenic enzymes in monogastric species. The activity of FoxO1 is inhibited by insulin-induced phosphorylation. The aims of the present study were to find associations between FoxO1 expression and variables associated with HGP as affected by feeding regimen in dairy cows during the transition period. Twenty one healthy German Holstein cows were allocated to four groups (LC-CON, HC-CON, LC-NA with 5 cows/group and HC-NA with 6 cows/group, respectively. Cows received 0 (LC-CON and HC-CON or 24 (LC-NA and HC-NA g/d nicotinic acid with high (HC or low (LC concentrate proportion from -42 days (-41.8 + 4.8; mean + standard deviation relative to expected calving date (d-42 to d24. Liver biopsy was taken at d-42, 1, 21, and 100. The total protein expression of FoxO1 (tFoxO1 and the extent of phosphorylation of FoxO1 at serine 256 (pFoxO1 were analysed semiquantitatively by Western Blotting. The expression of hepatic mRNA of FoxO1 and seven genes associated with HGP was measured by real-time RT-PCR. Mixed model and Pearson's correlation were used for statistical evaluation with the level of significance at P<0.05. No dietary effect was observed either on feed intake, energy balance, or on the concentration of blood metabolites. Neither time nor diet affected the expression of FoxO1 total protein and mRNA. A NA × concentrate interaction was found in pFoxO1. However, no corresponding dietary effect was found in the mRNA expression of investigated genes. Different patterns of correlations between FoxO1-related variables and investigated indicators for HGP were found at d21 and 100. The results indicated that the regulation of HGP did not take place on the levels of mRNA and protein expression and the phosphorylation of FoxO1 in dairy cows in early lactation.

  10. Forkhead containing transcription factor Albino controls tetrapyrrole-based body pigmentation in planarian

    Science.gov (United States)

    Wang, Chen; Han, Xiao-Shuai; Li, Fang-Fang; Huang, Shuang; Qin, Yong-Wen; Zhao, Xian-Xian; Jing, Qing

    2016-01-01

    Pigmentation processes occur from invertebrates to mammals. Owing to the complexity of the pigmentary system, in vivo animal models for pigmentation study are limited. Planarians are capable of regenerating any missing part including the dark-brown pigments, providing a promising model for pigmentation study. However, the molecular mechanism of planarian body pigmentation is poorly understood. We found in an RNA interference screen that a forkhead containing transcription factor, Albino, was required for pigmentation without affecting survival or other regeneration processes. In addition, the body color recovered after termination of Albino double stranded RNA feeding owing to the robust stem cell system. Further expression analysis revealed a spatial and temporal correlation between Albino and pigmentation process. Gene expression arrays revealed that the expression of three tetrapyrrole biosynthesis enzymes, ALAD, ALAS and PBGD, was impaired upon Albino RNA interference. RNA interference of PBGD led to a similar albinism phenotype caused by Albino RNA interference. Moreover, PBGD was specifically expressed in pigment cells and can serve as a pigment cell molecular marker. Our results revealed that Albino controls planarian body color pigmentation dominantly via regulating tetrapyrrole biogenesis. These results identified Albino as the key regulator of the tetrapyrrole-based planarian body pigmentation, suggesting a role of Albino during stem cell-pigment cell fate decision and provided new insights into porphyria pathogenesis. PMID:27551436

  11. Forkhead Box Protein 1 (FoxO1) Inhibits Accelerated β Cell Aging in Pancreas-specific SMAD7 Mutant Mice.

    Science.gov (United States)

    Xiao, Xiangwei; Chen, Congde; Guo, Ping; Zhang, Ting; Fischbach, Shane; Fusco, Joseph; Shiota, Chiyo; Prasadan, Krishna; Dong, Henry; Gittes, George K

    2017-02-24

    The mechanisms underlying the effects of exocrine dysfunction on the development of diabetes remain largely unknown. Here we show that pancreatic depletion of SMAD7 resulted in age-dependent increases in β cell dysfunction with accelerated glucose intolerance, followed by overt diabetes. The accelerated β cell dysfunction and loss of proliferation capacity, two features of β cell aging, appeared to be non-cell-autonomous, secondary to the adjacent exocrine failure as a "bystander effect." Increased Forkhead box protein 1 (FoxO1) acetylation and nuclear retention was followed by progressive FoxO1 loss in β cells that marked the onset of diabetes. Moreover, forced FoxO1 expression in β cells prevented β cell dysfunction and loss in this model. Thus, we present a model of accelerated β cell aging that may be useful for studying the mechanisms underlying β cell failure in diabetes. Moreover, we provide evidence highlighting a critical role of FoxO1 in maintaining β cell identity in the context of SMAD7 failure. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Forkhead Box Protein 1 (FoxO1) Inhibits Accelerated β Cell Aging in Pancreas-specific SMAD7 Mutant Mice*

    Science.gov (United States)

    Xiao, Xiangwei; Chen, Congde; Guo, Ping; Zhang, Ting; Fischbach, Shane; Fusco, Joseph; Shiota, Chiyo; Prasadan, Krishna; Dong, Henry; Gittes, George K.

    2017-01-01

    The mechanisms underlying the effects of exocrine dysfunction on the development of diabetes remain largely unknown. Here we show that pancreatic depletion of SMAD7 resulted in age-dependent increases in β cell dysfunction with accelerated glucose intolerance, followed by overt diabetes. The accelerated β cell dysfunction and loss of proliferation capacity, two features of β cell aging, appeared to be non-cell-autonomous, secondary to the adjacent exocrine failure as a “bystander effect.” Increased Forkhead box protein 1 (FoxO1) acetylation and nuclear retention was followed by progressive FoxO1 loss in β cells that marked the onset of diabetes. Moreover, forced FoxO1 expression in β cells prevented β cell dysfunction and loss in this model. Thus, we present a model of accelerated β cell aging that may be useful for studying the mechanisms underlying β cell failure in diabetes. Moreover, we provide evidence highlighting a critical role of FoxO1 in maintaining β cell identity in the context of SMAD7 failure. PMID:28057752

  13. MicroRNA-122-3p inhibits tumor cell proliferation and induces apoptosis by targeting Forkhead box O in A549 cells.

    Science.gov (United States)

    Wang, Wen; Yang, Jinsong; Yu, Fenglei; Li, Wenjie; Wang, Li; Zou, Haoyu; Long, Xia

    2018-02-01

    The imbalance between cell proliferation and apoptosis was implicated to serve key roles in cancer pathogenesis. The characteristics of microRNAs (miRNAs/miRs) have attracted much attention in research focusing on cancer pathogenesis in recent years. miR-122-3p has been reported to be associated with a number of disease processes and pathogenesis, including lung cancer. The present study aimed to investigate the association of miR-122-3p expression level with cell proliferation and apoptosis in a lung cancer cell line. A549 cells were transfected with miR-122-3p to interrupt the expression of miR-122-3p. Subsequently, MTT and BrdU assay, and western blot were used to analyze the influence of miR-122-3p on lung cancer cell proliferation, cell viability and its underlying mechanism. The present study revealed that, by targeting p27, overexpression of miR-122-3p inhibited cell proliferation in lung cancer. Furthermore, the cell apoptosis analysis suggested that overexpression of miR-122-3p was able to inhibit cell apoptosis by targeting Forkhead box O. These findings suggest that miR-122-3p may be associated with the pathology and progression of lung cancer and be a new therapeutic target for this disease.

  14. The forkhead transcription factor, Foxd1, is necessary for pituitary luteinizing hormone expression in mice.

    Directory of Open Access Journals (Sweden)

    Jason H Gumbel

    Full Text Available The pituitary gland regulates numerous physiological functions including growth, reproduction, temperature and metabolic homeostasis, lactation, and response to stress. Pituitary organogenesis is dependent on signaling factors that are produced in and around the developing pituitary. The studies described in this report reveal that the forkhead transcription factor, Foxd1, is not expressed in the developing mouse pituitary gland, but rather in the mesenchyme surrounding the pituitary gland, which is an essential source of signaling factors that regulate pituitary organogenesis. Loss of Foxd1 causes a morphological defect in which the anterior lobe of the pituitary gland protrudes through the cartilage plate that is developing ventral to the pituitary at embryonic days (e14.5, e16.5, and e18.5. The number of proliferating pituitary cells is increased at e14.5 and e16.5. Loss of Foxd1 also results in significantly decreased levels of Lhb expression at e18.5. This decrease in Lhb expression does not appear to be due to a change in the number of gonadotrope cells in the pituitary gland. Previous studies have shown that loss of the LIM homeodomain factor, Lhx3, which is activated by the FGF signaling pathway, results in loss of LH production. Although there is a difference in Lhb expression in Foxd1 null mice, the expression pattern of LHX3 is not altered in Foxd1 null mice. These studies suggest that Foxd1 is indirectly required for normal Lhb expression and cartilage formation.

  15. Forkhead box O3 plays a role in skeletal muscle atrophy through expression of E3 ubiquitin ligases MuRF-1 and atrogin-1 in Cushing's syndrome.

    Science.gov (United States)

    Kang, Seol-Hee; Lee, Hae-Ahm; Kim, Mina; Lee, Eunjo; Sohn, Uy Dong; Kim, Inkyeom

    2017-06-01

    Cushing's syndrome is caused by overproduction of the adrenocorticotropic hormone (ACTH), which stimulates the adrenal grand to make cortisol. Skeletal muscle wasting occurs in pathophysiological response to Cushing's syndrome. The forkhead box (FOX) protein family has been implicated as a key regulator of muscle loss under conditions such as diabetes and sepsis. However, the mechanistic role of the FOXO family in ACTH-induced muscle atrophy is not understood. We hypothesized that FOXO3a plays a role in muscle atrophy through expression of the E3 ubiquitin ligases, muscle RING finger protein-1 (MuRF-1), and atrogin-1 in Cushing's syndrome. For establishment of a Cushing's syndrome animal model, Sprague-Dawley rats were implanted with osmotic minipumps containing ACTH (40 ng·kg -1 ·day -1 ). ACTH infusion significantly reduced muscle weight. In ACTH-infused rats, MuRF-1, atrogin-1, and FOXO3a were upregulated and the FOXO3a promoter was targeted by the glucocorticoid receptor (GR). Transcriptional activity and expression of FOXO3a were significantly decreased by the GR antagonist RU486. Treatment with RU486 reduced MuRF-1 and atrogin-1 expression in accordance with reduced enrichment of FOXO3a and Pol II on the promoters. Knockdown of FOXO3a prevented dexamethasone-induced MuRF-1 and atrogin-1 expression. These results indicate that FOXO3a plays a role in muscle atrophy through expression of MuRF-1 and atrogin-1 in Cushing's syndrome. Copyright © 2017 the American Physiological Society.

  16. Forkhead Box O1 is present in quiescent pituitary cells during development and is increased in the absence of p27 Kip1.

    Directory of Open Access Journals (Sweden)

    Sreeparna Majumdar

    Full Text Available Congenital pituitary hormone deficiencies have been reported in approximately one in 4,000 live births, however studies reporting mutations in some widely studied transcription factors account for only a fraction of congenital hormone deficiencies in humans. Anterior pituitary hormones are required for development and function of several glands including gonads, adrenals, and thyroid. In order to identify additional factors that contribute to human congenital hormone deficiencies, we are investigating the forkhead transcription factor, FOXO1, which has been implicated in development of several organs including ovary, testis, and brain. We find that FOXO1 is present in the nuclei of non-dividing pituitary cells during embryonic development, consistent with a role in limiting proliferation and/or promoting differentiation. FOXO1 is present in a subset of differentiated cells at e18.5 and in adult with highest level of expression in somatotrope cells. We detected FOXO1 in p27(Kip1-positive cells at e14.5. In the absence of p27(Kip1 the number of pituitary cells containing FOXO1 is significantly increased at e14.5 suggesting that a feedback loop regulates the interplay between FOXO1 and p27(Kip1.

  17. Expansion of CD25-Negative Forkhead Box P3-Positive T Cells during HIV and Mycobacterium tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Matías T. Angerami

    2017-05-01

    Full Text Available Tuberculosis (TB and HIV alter the immune system, and coinfected (HIV-TB individuals usually present deregulations of T-lymphocytic immune response. We previously observed an increased frequency of “unconventional” CD4+CD25−FoxP3+ Treg (uTreg population during HIV-TB disease. Therefore, we aimed to explore the phenotype and function of uTreg and conventional CD4+CD25+FoxP3+ Treg subsets (cTreg in this context. We evaluated the expression of CD39, programmed cell death protein 1 (PD1, glucocorticoid-induced tumor necrosis factor receptor (GITR, and the effector/memory distribution by flow cytometry in cTreg and uTreg. Also, IL-10, TGF-β, IFN-γ production, and the suppressor capacity of uTregs were analyzed in cocultures with effector lymphocytes and compared with the effect of regulatory T cells (Tregs. We found diminished expression of CD39 and higher levels of PD1 on uTreg compared to cTreg in both HIV-TB and healthy donors (HD. In addition, uTreg and cTreg showed differences in maturation status in both HIV-TB and HD groups, due to the expansion of effector memory uTregs. Interestingly, both HIV-TB and HD showed a pronounced production of IFN-γ in uTreg population, though no significant differences were observed for IL-10 and TGF-β production between uTreg and cTreg. Moreover, IFN-γ+ cells were restricted to the CD39− uTreg population. Finally, when the suppressor capacity was evaluated, both uTreg and cTreg inhibited polyclonal T cell-proliferation and IFN-γ production in a similar extent. These findings suggest that uTregs, which are expanded during HIV-TB coinfection, exert regulatory functions in a similar way to cTregs despite an altered surface expression of Treg characteristic markers and differences in cytokine production.

  18. Forkhead box protein P3 (Foxp3) expression serves as an early chronic inflammation marker of squamous cell differentiation and aggressive pathology of urothelial carcinomas in neurological patients.

    Science.gov (United States)

    Phé, Véronique; Rouprêt, Morgan; Cussenot, Olivier; Chartier-Kastler, Emmanuel; Gamé, Xavier; Compérat, Eva

    2015-04-01

    To establish whether the expression of forkhead box protein P3 (Foxp3) provides specific diagnostic information about neurological patients with urothelial carcinoma of the bladder (UCB). UCB tissue samples from neurological patients were retrieved and compared with control samples. The expression of Foxp3 was analysed via immunohistochemistry of microarray tissue sections. The correlation between Foxp3 expression, histological parameters and tumour stage was assessed. Overall, 20 UCB tissue samples and 20 others without UCB from neurological patients, and 46 UCB tissue samples from non-neurological patients were analysed. The distribution of pT of UCB in the neurological patients was as follows: one low-grade pTa (5%), three high-grade pTa (15%), three pT1(15%), one pT2(5%), seven pT3(35%) and five pT4(25%). Squamous cell differentiation was seen in nine UCB samples (45%). Foxp3 expression was detected in tumour tissues, including one pTa high grade, one pT1, one pT2, five pT3 and five pT4 tumours. Foxp3 was expressed in 11/13 muscle-invasive tumours. All tumours displaying squamous cell differentiation expressed Foxp3. Foxp3 was not expressed in the pT3 tumours that displayed sarcomatoid and micropapillary properties. Among the bladder samples without UCB from neurological patients, no expression of Foxp3 was observed. Among the UCB samples from the non-neurological patients, only seven displayed squamous cell differentiation. All tumours that displayed squamous cell differentiation expressed Foxp3, including one pTa high grade, four pT3 and two pT4 tumours. Other tumours displaying urothelial differentiation did not express Foxp3. The expression of Foxp3 correlated to squamous cell differentiation in neurological (P = 0.004) and non-neurological UCB tissue (P differentiation. Targeting Foxp3 may represent a novel strategy to improve anti-tumour immunotherapy for UCB. © 2015 The Authors. BJU International © 2015 BJU International.

  19. An epidemiological investigation of a Forkhead box protein E3 founder mutation underlying the high frequency of sclerocornea, aphakia, and microphthalmia in a Mexican village.

    Science.gov (United States)

    Pantoja-Melendez, Carlos; Ali, Manir; Zenteno, Juan C

    2013-01-01

    To investigate the molecular epidemiological basis for the unusually high incidence of sclerocornea, aphakia, and microphthalmia in a village in the Tlaxcala province of central Mexico. A population census was performed in a village to identify all sclerocornea, aphakia, and microphthalmia cases. Molecular analysis of the previously identified Forkhead box protein E3 (FOXE3) mutation, c.292T>C (p.Y98H), was performed with PCR amplification and direct DNA sequencing. In addition, DNA from 405 randomly selected unaffected villagers was analyzed to establish the carrier frequency of the causal mutation. To identify the number of generations since the mutation arose in the village, 17 polymorphic markers distributed in a region of 6 Mb around the mutated locus were genotyped in the affected individuals, followed by DMLE software analysis to calculate mutation age. A total of 22 patients with sclerocornea, aphakia, and microphthalmia were identified in the village, rendering a disease prevalence of 2.52 cases per 1,000 habitants (1 in 397). The FOXE3 homozygous mutation was identified in all 17 affected subjects who consented to molecular analysis. Haplotype analysis indicated that the mutation arose 5.0-6.5 generations ago (approximately 106-138 years). Among the 405 unaffected villagers who were genotyped, ten heterozygote carriers were identified, yielding a population carrier frequency of approximately 1 in 40 and a predicted incidence of affected of 1 in 6,400 based on random marriages between two carriers in the village. This study demonstrates that a cluster of patients with sclerocornea, aphakia, and microphthalmia in a small Mexican village is due to a FOXE3 p.Y98H founder mutation that arose in the village just over a century ago at a time when a population migrated from a nearby village because of land disputes. The actual disease incidence is higher than the calculated predicted value and suggests non-random marriages (i.e., consanguinity) within the

  20. Identification of Transmembrane Protease Serine 2 and Forkhead Box A1 As the Potential Bisphenol A Responsive Genes in the Neonatal Male Rat Brain

    Directory of Open Access Journals (Sweden)

    Takayoshi Ubuka

    2018-03-01

    Full Text Available Perinatal exposure of Bisphenol A (BPA to rodents modifies their behavior in later life. To understand how BPA modifies their neurodevelopmental process, we first searched for BPA responsive genes from androgen and estrogen receptor signaling target genes by polymerase chain reaction array in the neonatal male rat brain. We used a transgenic strain of Wistar rats carrying enhanced green fluorescent protein tagged to gonadotropin-inhibitory hormone (GnIH promoter to investigate the possible interaction of BPA responsive genes and GnIH neurons. We found upregulation of transmembrane protease serine 2 (Tmprss2, an androgen receptor signaling target gene, and downregulation of Forkhead box A1 (Foxa1, an ER signaling target gene, in the medial amygdala of male rats that were subcutaneously administered with BPA from day 1 to 3. Tmprss2-immunoreactive (ir cells were distributed in the olfactory bulb, cerebral cortex, hippocampus, amygdala, and hypothalamus in 3 days old but not in 1-month-old male rats. Density of Tmprss2-ir cells in the medial amygdala was increased by daily administration of BPA from day 1 to 3. Tmprss2 immunoreactivity was observed in 26.5% of GnIH neurons clustered from the ventral region of the ventromedial hypothalamic nucleus to the dorsal region of the arcuate nucleus of 3-day-old male rat hypothalamus. However, Tmprss2 mRNA expression significantly decreased in the amygdala and hypothalamus of 1-month-old male rats. Foxa1 mRNA expression was higher in the hypothalamus than the amygdala in 3 days old male rats. Intense Foxa1-ir cells were only found in the peduncular part of lateral hypothalamus of 3-day-old male rats. Density of Foxa1-ir cells in the hypothalamus was decreased by daily administration of BPA from day 1 to 3. Foxa1 mRNA expression in the hypothalamus also significantly decreased at 1 month. These results suggest that BPA disturbs the neurodevelopmental process and behavior of rats later in their life by

  1. A forkhead transcription factor is wound-induced at the planarian midline and required for anterior pole regeneration.

    Directory of Open Access Journals (Sweden)

    M Lucila Scimone

    2014-01-01

    Full Text Available Planarian regeneration requires positional information to specify the identity of tissues to be replaced as well as pluripotent neoblasts capable of differentiating into new cell types. We found that wounding elicits rapid expression of a gene encoding a Forkhead-family transcription factor, FoxD. Wound-induced FoxD expression is specific to the ventral midline, is regulated by Hedgehog signaling, and is neoblast-independent. FoxD is subsequently expressed within a medial subpopulation of neoblasts at wounds involving head regeneration. Ultimately, FoxD is co-expressed with multiple anterior markers at the anterior pole. Inhibition of FoxD with RNA interference (RNAi results in the failure to specify neoblasts expressing anterior markers (notum and prep and in anterior pole formation defects. FoxD(RNAi animals fail to regenerate a new midline and to properly pattern the anterior blastema, consistent with a role for the anterior pole in organizing pattern of the regenerating head. Our results suggest that wound signaling activates a forkhead transcription factor at the midline and, if the head is absent, FoxD promotes specification of neoblasts at the prior midline for anterior pole regeneration.

  2. Forkhead-Box-P3 Gene Transfer in Human CD4+ T Conventional Cells for the Generation of Stable and Efficient Regulatory T Cells, Suitable for Immune Modulatory Therapy

    Directory of Open Access Journals (Sweden)

    Laura Passerini

    2017-10-01

    Full Text Available The development of novel approaches to control immune responses to self- and allogenic tissues/organs represents an ambitious goal for the management of autoimmune diseases and in transplantation. Regulatory T cells (Tregs are recognized as key players in the maintenance of peripheral tolerance in physiological and pathological conditions, and Treg-based cell therapies to restore tolerance in T cell-mediated disorders have been designed. However, several hurdles, including insufficient number of Tregs, their stability, and their antigen specificity, have challenged Tregs clinical applicability. In the past decade, the ability to engineer T cells has proven a powerful tool to redirect specificity and function of different cell types for specific therapeutic purposes. By using lentivirus-mediated gene transfer of the thymic-derived Treg transcription factor forkhead-box-P3 (FOXP3 in conventional CD4+ T cells, we converted effector T cells into Treg-like cells, endowed with potent in vitro and in vivo suppressive activity. The resulting CD4FOXP3 T-cell population displays stable phenotype and suppressive function. We showed that this strategy restores Treg function in T lymphocytes from patients carrying mutations in FOXP3 [immune-dysregulation, polyendocrinopathy, enteropathy, X-linked (IPEX], in whom CD4FOXP3 T cell could be used as therapeutics to control autoimmunity. Here, we will discuss the potential advantages of using CD4FOXP3 T cells for in vivo application in inflammatory diseases, where tissue inflammation may undermine the function of natural Tregs. These findings pave the way for the use of engineered Tregs not only in IPEX syndrome but also in autoimmune disorders of different origin and in the context of stem cell and organ transplantation.

  3. The forkhead transcription factor Foxl2 is sumoylated in both human and mouse: sumoylation affects its stability, localization, and activity.

    Directory of Open Access Journals (Sweden)

    Mara Marongiu

    2010-03-01

    Full Text Available The FOXL2 forkhead transcription factor is expressed in ovarian granulosa cells, and mutated FOXL2 causes the blepharophimosis, ptosis and epicanthus inversus syndrome (BPES and predisposes to premature ovarian failure. Inactivation of Foxl2 in mice demonstrated its indispensability for female gonadal sex determination and ovary development and revealed its antagonism of Sox9, the effector of male testis development. To help to define the regulatory activities of FOXL2, we looked for interacting proteins. Based on yeast two-hybrid screening, we found that FOXL2 interacts with PIAS1 and UBC9, both parts of the sumoylation machinery. We showed that human FOXL2 is sumoylated in transfected cell lines, and that endogenous mouse Foxl2 is comparably sumoylated. This modification changes its cellular localization, stability and transcriptional activity. It is intriguing that similar sumoylation and regulatory consequences have also been reported for SOX9, the male counterpart of FOXL2 in somatic gonadal tissues.

  4. Stem cell-dependent formation of a functional anterior regeneration pole in planarians requires Zic and Forkhead transcription factors.

    Science.gov (United States)

    Vogg, Matthias C; Owlarn, Suthira; Pérez Rico, Yuvia A; Xie, Jianlei; Suzuki, Yoko; Gentile, Luca; Wu, Wei; Bartscherer, Kerstin

    2014-06-15

    Planarians can regenerate their head within days. This process depends on the direction of adult stem cells to wound sites and the orchestration of their progenitors to commit to appropriate lineages and to arrange into patterned tissues. We identified a zinc finger transcription factor, Smed-ZicA, as a downstream target of Smed-FoxD, a Forkhead transcription factor required for head regeneration. Smed-zicA and Smed-FoxD are co-expressed with the Wnt inhibitor notum and the Activin inhibitor follistatin in a cluster of cells at the anterior-most tip of the regenerating head - the anterior regeneration pole - and in surrounding stem cell progeny. Depletion of Smed-zicA and Smed-FoxD by RNAi abolishes notum and follistatin expression at the pole and inhibits head formation downstream of initial polarity decisions. We suggest a model in which ZicA and FoxD transcription factors synergize to control the formation of Notum- and Follistatin-producing anterior pole cells. Pole formation might constitute an early step in regeneration, resulting in a signaling center that orchestrates cellular events in the growing tissue. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Interaction of hookworm 14-3-3 with the forkhead transcription factor DAF-16 requires intact Akt phosphorylation sites

    Directory of Open Access Journals (Sweden)

    Hawdon John M

    2009-04-01

    Full Text Available Abstract Background Third-stage infective larvae (L3 of hookworms are in an obligatory state of developmental arrest that ends upon entering the definitive host, where they receive a signal that re-activates development. Recovery from the developmentally arrested dauer stage of Caenorhabditis elegans is analogous to the resumption of development during hookworm infection. Insulin-like signaling (ILS mediates recovery from arrest in C. elegans and activation of hookworm dauer L3. In C. elegans, phosphorylation of the forkhead transcription factor DAF-16 in response to ILS creates binding cites for the 14-3-3 protein Ce-FTT-2, which translocates DAF-16 out of the nucleus, resulting in resumption of reproductive development. Results To determine if hookworm 14-3-3 proteins play a similar role in L3 activation, hookworm FTT-2 was identified and tested for its ability to interact with A. caninum DAF-16 in vitro. The Ac-FTT-2 amino acid sequence was 91% identical to the Ce-FTT-2, and was most closely related to FTT-2 from other nematodes. Ac-FTT-2 was expressed in HEK 293T cells, and was recognized by an antibody against human 14-3-3β isoform. Reciprocal co-immunoprecipitations using anti-epitope tag antibodies indicated that Ac-FTT-2 interacts with Ac-DAF-16 when co-expressed in serum-stimulated HEK 293T cells. This interaction requires intact Akt consensus phosphorylation sites at serine107 and threonine312, but not serine381. Ac-FTT-2 was undetectable by Western blot in excretory/secretory products from serum-stimulated (activated L3 or adult A. caninum. Conclusion The results indicate that Ac-FTT-2 interacts with DAF-16 in a phosphorylation-site dependent manner, and suggests that Ac-FTT-2 mediates activation of L3 by binding Ac-DAF-16 during hookworm infection.

  6. Effects of oral Lactobacillus administration on antioxidant activities and CD4+CD25+forkhead box P3 (FoxP3)+ T cells in NZB/W F1 mice.

    Science.gov (United States)

    Tzang, Bor-Show; Liu, Chung-Hsien; Hsu, Kuo-Ching; Chen, Yi-Hsing; Huang, Chih-Yang; Hsu, Tsai-Ching

    2017-09-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease that is characterised by a dysregulation of the immune system, which causes inflammation responses, excessive oxidative stress and a reduction in the number of cluster of differentiation (CD)4+CD25+forkhead box P3 (FoxP3)+ T cells. Supplementation with certain Lactobacillus strains has been suggested to be beneficial in the comprehensive treatment of SLE. However, little is known about the effect and mechanism of certain Lactobacillus strains on SLE. To investigate the effects of Lactobacillus on SLE, NZB/W F1 mice were orally gavaged with Lactobacillus paracasei GMNL-32 (GMNL-32), Lactobacillus reuteri GMNL-89 (GMNL-89) and L. reuteri GMNL-263 (GMNL-263). Supplementation with GMNL-32, GMNL-89 and GMNL-263 significantly increased antioxidant activity, reduced IL-6 and TNF-α levels and significantly decreased the toll-like receptors/myeloid differentiation primary response gene 88 signalling in NZB/W F1 mice. Notably, supplementation with GMNL-263, but not GMNL-32 and GMNL-89, in NZB/W F1 mice significantly increased the differentiation of CD4+CD25+FoxP3+ T cells. These findings reveal beneficial effects of GMNL-32, GMNL-89 and GMNL-263 on NZB/W F1 mice and suggest that these specific Lactobacillus strains can be used as part of a comprehensive treatment of SLE patients.

  7. Transcription factors GATA/ELT-2 and forkhead/HNF-3/PHA-4 regulate the tropomyosin gene expression in the pharynx and intestine of Caenorhabditis elegans.

    Science.gov (United States)

    Anokye-Danso, Frederick; Anyanful, Akwasi; Sakube, Yasuji; Kagawa, Hiroaki

    2008-05-30

    Gene regulation during development is an important biological activity that leads to synthesis of biomolecules at specific locations and specific times. The single tropomyosin gene of Caenorhabditis elegans, tmy-1/lev-11, produces four isoforms of protein: two from the external promoter and two from the internal promoter. We investigated the internal promoter of tropomyosin to identify sequences that regulate expression of tmy-1 in the pharynx and intestine. By promoter deletion of tmy-1 reporters as well as by database analyses, a 100-bp fragment that contained binding sequences for a GATA factor, for a chicken CdxA homolog, and for a forkhead factor was identified. Both the forkhead and CdxA binding sequences contributed to pharyngeal and intestinal expression. In addition, the GATA site also influenced intestinal expression of tmy-1 reporter. We showed that ELT-2 and PHA-4 proteins interact directly with the GATA and forkhead binding sequences, respectively, in gel mobility shift assays. RNA interference knockdown of elt-2 diminished tmy-1::gfp expression in the intestine. In contrast to RNA interference knockdown of pha-4, expression of tmy-1::gfp in pha-4;smg-1 mutants was slightly weaker than that of the wild type. Ectopic expression of PHA-4 and ELT-2 by heat shock was sufficient to elicit widespread expression of tmy-1::lacZ reporter in embryos. We found no indication of a synergistic relation between ELT-2 and PHA-4. Based on our data, PHA-4 and CdxA function as general transcription factors for pharyngeal and intestinal regulation of tmy-1. We present models by which ELT-2, PHA-4, and CdxA orchestrate expression from the internal promoter of tmy-1.

  8. Two Lung Cancer Development-Related Genes, Forkhead Box M1 (FOXM1) and Apolipoprotein E (APOE), are overexpressed in Bronchial of Patients after Long-Term Exposure to Sulfur Mustard.

    Science.gov (United States)

    Tahmasbpour, Eisa; Ghanei, Mostafa; Panahi, Yunes

    2017-01-01

    Sulfur mustard (SM) is a strong alkylating and mutagenic compound that targets human airway system. We considered the expression of Forkhead box M1 ( FOXM1 ) and apolipoprotein E ( APOE ) genes, which are responsible for cell proliferation, differentiation, tumorigenesis, and increased risk of lung cancer, in the lung bronchial tissue of patients exposed to SM. After performing pulmonary functional tests (PFTs), 11 human subjects (five controls and six SM-exposed patients) were entered in this study. Total RNA were extracted from all biopsy samples and then cDNA was synthesised for each specimen using RT-PCR. Changes in gene expression were measured using a RT 2 Profiler ™PCR Array. PFTs have demonstrated more obstructive and restrictive spirometric patterns among patients compared to the controls. A higher expression was recorded for both examined genes in bronchial of SM-exposed patients. Expression of FOXM1 and APOE genes in bronchial of the patients was significantly ( p < 0.001) overexpressed by 14.8316 and 3.9504-folds, respectively. Mustard lungs were associated with increased expression of FOXM1 and APOE genes, which suggests an increased risk of lung cancer among these patients. Since FOXM1 and APOE are considered as oxidative stress responsive genes, we speculate that increased expression of these genes is more likely linked to overproduction of reactive oxygen species (ROS) and oxidative stress (OS) in mustard lungs. Further studies are required at protein level among SM-exposed patients with lung cancer to use these genes as lung cancer biomarkers among these patients.

  9. Antigen-specific over-expression of human cartilage glycoprotein 39 on CD4+ CD25+ forkhead box protein 3+ regulatory T cells in the generation of glucose-6-phosphate isomerase-induced arthritis.

    Science.gov (United States)

    Tanaka, Y; Matsumoto, I; Inoue, A; Umeda, N; Takai, C; Sumida, T

    2014-08-01

    Human cartilage gp-39 (HC gp-39) is a well-known autoantigen in rheumatoid arthritis (RA). However, the exact localization, fluctuation and function of HC gp-39 in RA are unknown. Therefore, using a glucose-6-phosphate isomerase (GPI)-induced model of arthritis, we investigated these aspects of HC gp-39 in arthritis. The rise in serum HC gp-39 levels was detected on the early phase of GPI-induced arthritis (day 7) and the HC gp-39 mRNA was increased significantly on splenic CD4(+) T cells on day7, but not on CD11b(+) cells. Moreover, to identify the characterization of HC gp-39(+) CD4(+) T cells, we assessed the analysis of T helper (Th) subsets. As a result, HC gp-39 was expressed dominantly in CD4(+) CD25(+) forkhead box protein 3 (FoxP3)(+) refulatory T cells (T(reg)), but not in Th1, Th2 or Th17 cells. Furthermore, to investigate the effect of HC gp-39 to CD4(+) T cells, T cell proliferation assay and cytokine production from CD4(+) T cells using recombinant HC gp-39 was assessed. We found that GPI-specific T cell proliferation and interferon (IFN)-γ or interleukin (IL)-17 production were clearly suppressed by addition of recombinant HC gp-39. Antigen-specific over-expression of HC gp-39 in splenic CD4(+) CD25(+) FoxP3(+) T(reg) cells occurs in the induction phase of GPI-induced arthritis, and addition of recombinant HC gp-39 suppresses antigen-specific T-cell proliferation and cytokine production, suggesting that HC gp-39 in CD4(+) T cells might play a regulatory role in arthritis. © 2014 British Society for Immunology.

  10. Inactivation of the forkhead transcription factor FoxO3 is essential for PKB-mediated survival of hematopoietic progenitor cells by kit ligand

    DEFF Research Database (Denmark)

    Engström, Maria; Karlsson, Richard; Jönsson, Jan-Ingvar

    2003-01-01

    OBJECTIVE: Kit ligand (KL) is a major survival factor for hematopoietic stem cells. Although anti-apoptotic bcl-2 family members are expressed in these cells, the survival effects by KL appear to involve other mechanisms. Survival signals can also be elicited by the activation of phosphatidylinos......OBJECTIVE: Kit ligand (KL) is a major survival factor for hematopoietic stem cells. Although anti-apoptotic bcl-2 family members are expressed in these cells, the survival effects by KL appear to involve other mechanisms. Survival signals can also be elicited by the activation......, immunofluorescence, and subcellular fractionation, we analyzed the effects of KL on PKB and different forkhead family members in two factor-dependent cell lines, FDCP-mix and FDC-P1, as well as primary mouse bone marrow-derived Lin(-) progenitors. Forced overexpression of triple mutated form of FoxO3 by retroviral...

  11. Tongxinluo Protects against Hypertensive Kidney Injury in Spontaneously-Hypertensive Rats by Inhibiting Oxidative Stress and Activating Forkhead Box O1 Signaling.

    Directory of Open Access Journals (Sweden)

    Wei-Min Luo

    Full Text Available Hypertension is an independent risk factor for the progression of chronic renal failure, and oxidative stress plays a critical role in hypertensive renal damage. Forkbox O1(FoxO1 signaling protects cells against oxidative stress and may be a useful target for treating oxidative stress-induced hypertension. Tongxinluo is a traditional Chinese medicine with cardioprotective and renoprotective functions. Therefore, this study aimed to determine the effects of Tongxinluo in hypertensive renal damage in spontaneously hypertensive rats(SHRsand elucidate the possible involvement of oxidative stress and FoxO1 signaling in its molecular mechanisms. SHRs treated with Tongxinluo for 12 weeks showed a reduction in systolic blood pressure. In addition to increasing creatinine clearance, Tongxinluo decreased urinary albumin excretion, oxidative stress injury markers including malondialdehyde and protein carbonyls, and expression of nicotinamide adenine dinucleotide phosphate oxidase subunits and its activity in SHR kidneys. While decreasing phosphorylation of FoxO1, Tongxinluo also inhibited the phosphorylation of extracellular signal-regulated kinase1/2 and p38 and enhanced manganese superoxide dismutase and catalase activities in SHR kidneys. Furthermore, histology revealed attenuation of glomerulosclerosis and renal podocyte injury, while Tongxinluo decreased the expression of α-smooth muscle actin, extracellular matrixprotein, transforming growth factor β1 and small mothers against decapentaplegic homolog 3,and improved tubulointerstitial fibrosis in SHR kidneys. Finally, Tongxinluo inhibited inflammatory cell infiltration as well as expression of tumor necrosis factor-α and interleukin-6. In conclusion, Tongxinluo protected SHRs against hypertension-induced renal injury by exerting antioxidant, antifibrotic, and anti-inflammatory activities. Moreover, the underlying mechanisms of these effects may involve inhibition of oxidative stress and functional

  12. Gata4 expression in lateral mesoderm is downstream of BMP4 and isactivated directly by Forkhead and GATA transcription factors through adistal enhancer element

    Energy Technology Data Exchange (ETDEWEB)

    Rojas, Anabel; De Val, Sarah; Heidt, Analeah B.; Xu, Shan-Mei; Bristow, James; Black, Brian L.

    2005-05-20

    The GATA family of zinc-finger transcription factors plays key roles in the specification and differentiation of multiple cell types during development. GATA4 is an early regulator of gene expression during the development of endoderm and mesoderm, and genetic studies in mice have demonstrated that GATA4 is required for embryonic development.Despite the importance of GATA4 in tissue specification and differentiation, the mechanisms by which Gata4 expression is activated and the transcription factor pathways upstream of GATA4 remain largely undefined. To identify transcriptional regulators of Gata4 in the mouse,we screened conserved noncoding sequences from the mouse Gata4 gene for enhancer activity in transgenic embryos. Here, we define the regulation of a distal enhancer element from Gata4 that is sufficient to direct expression throughout the lateral mesoderm, beginning at 7.5 days of mouse embryonic development. The activity of this enhancer is initially broad but eventually becomes restricted to the mesenchyme surrounding the liver. We demonstrate that the function of this enhancer in transgenic embryos is dependent upon highly conserved Forkhead and GATA transcription factor binding sites, which are bound by FOXF1 and GATA4,respectively. Furthermore, the activity of the Gata4 lateral mesoderm enhancer is attenuated by the BMP antagonist Noggin, and the enhancer is not activated in Bmp4-null embryos. Thus, these studies establish that Gata4 is a direct transcriptional target of Forkhead and GATA transcription factors in the lateral mesoderm, and demonstrate that Gata4lateral mesoderm enhancer activation requires BMP4, supporting a model in which GATA4 serves as a downstream effector of BMP signaling in the lateral mesoderm.

  13. Forkhead Box O6 (FoxO6) Depletion Attenuates Hepatic Gluconeogenesis and Protects against Fat-induced Glucose Disorder in Mice.

    Science.gov (United States)

    Calabuig-Navarro, Virtu; Yamauchi, Jun; Lee, Sojin; Zhang, Ting; Liu, Yun-Zi; Sadlek, Kelsey; Coudriet, Gina M; Piganelli, Jon D; Jiang, Chun-Lei; Miller, Rita; Lowe, Mark; Harashima, Hideyoshi; Dong, H Henry

    2015-06-19

    Excessive endogenous glucose production contributes to fasting hyperglycemia in diabetes. FoxO6 is a distinct member of the FoxO subfamily. To elucidate the role of FoxO6 in hepatic gluconeogenesis and assess its contribution to the pathogenesis of fasting hyperglycemia in diabetes, we generated FoxO6 knock-out (FoxO6-KO) mice followed by determining the effect of FoxO6 loss-of-function on hepatic gluconeogenesis under physiological and pathological conditions. FoxO6 depletion attenuated hepatic gluconeogenesis and lowered fasting glycemia in FoxO6-KO mice. FoxO6-deficient primary hepatocytes were associated with reduced capacities to produce glucose in response to glucagon. When fed a high fat diet, FoxO6-KO mice exhibited significantly enhanced glucose tolerance and reduced blood glucose levels accompanied by improved insulin sensitivity. These effects correlated with attenuated hepatic gluconeogenesis in FoxO6-KO mice. In contrast, wild-type littermates developed fat-induced glucose intolerance with a concomitant induction of fasting hyperinsulinemia and hyperglycemia. Furthermore, FoxO6-KO mice displayed significantly diminished macrophage infiltration into liver and adipose tissues, correlating with the reduction of macrophage expression of C-C chemokine receptor 2 (CCR2), a factor that is critical for regulating macrophage recruitment in peripheral tissues. Our data indicate that FoxO6 depletion protected against diet-induced glucose intolerance and insulin resistance by attenuating hepatic gluconeogenesis and curbing macrophage infiltration in liver and adipose tissues in mice. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Forkhead Box O6 (FoxO6) Depletion Attenuates Hepatic Gluconeogenesis and Protects against Fat-induced Glucose Disorder in Mice*

    Science.gov (United States)

    Calabuig-Navarro, Virtu; Yamauchi, Jun; Lee, Sojin; Zhang, Ting; Liu, Yun-Zi; Sadlek, Kelsey; Coudriet, Gina M.; Piganelli, Jon D.; Jiang, Chun-Lei; Miller, Rita; Lowe, Mark; Harashima, Hideyoshi; Dong, H. Henry

    2015-01-01

    Excessive endogenous glucose production contributes to fasting hyperglycemia in diabetes. FoxO6 is a distinct member of the FoxO subfamily. To elucidate the role of FoxO6 in hepatic gluconeogenesis and assess its contribution to the pathogenesis of fasting hyperglycemia in diabetes, we generated FoxO6 knock-out (FoxO6-KO) mice followed by determining the effect of FoxO6 loss-of-function on hepatic gluconeogenesis under physiological and pathological conditions. FoxO6 depletion attenuated hepatic gluconeogenesis and lowered fasting glycemia in FoxO6-KO mice. FoxO6-deficient primary hepatocytes were associated with reduced capacities to produce glucose in response to glucagon. When fed a high fat diet, FoxO6-KO mice exhibited significantly enhanced glucose tolerance and reduced blood glucose levels accompanied by improved insulin sensitivity. These effects correlated with attenuated hepatic gluconeogenesis in FoxO6-KO mice. In contrast, wild-type littermates developed fat-induced glucose intolerance with a concomitant induction of fasting hyperinsulinemia and hyperglycemia. Furthermore, FoxO6-KO mice displayed significantly diminished macrophage infiltration into liver and adipose tissues, correlating with the reduction of macrophage expression of C-C chemokine receptor 2 (CCR2), a factor that is critical for regulating macrophage recruitment in peripheral tissues. Our data indicate that FoxO6 depletion protected against diet-induced glucose intolerance and insulin resistance by attenuating hepatic gluconeogenesis and curbing macrophage infiltration in liver and adipose tissues in mice. PMID:25944898

  15. Sirtuin1-p53, forkhead box O3a, p38 and post-infarct cardiac remodeling in the spontaneously diabetic Goto-Kakizaki rat

    Directory of Open Access Journals (Sweden)

    Kytö Ville

    2010-01-01

    Full Text Available Abstract Background Diabetes is associated with changes in myocardial stress-response pathways and is recognized as an independent risk factor for cardiac remodeling. Using spontaneously diabetic Goto Kakizaki rats as a model of type 2 DM we investigated whether post-translational modifications in the Akt - FOXO3a pathway, Sirt1 - p53 pathway and the mitogen activated protein kinase p38 regulator are involved in post-infarct cardiac remodeling Methods Experimental myocardial infarction (MI was induced by left anterior descending coronary artery ligation in spontaneously diabetic Goto-Kakizaki rats and non-diabetic Wistar controls. Cardiac function was studied by echocardiography. Myocardial hypertrophy, cardiomyocyte apoptosis and cardiac fibrosis were determined histologically 12 weeks post MI or Sham operation. Western blotting was used to study Caspase-3, Bax, Sirt1, acetylation of p53 and phosphorylation of p38, Akt and FOXO3a. Electrophoretic mobility shift assay was used to assess FOXO3a activity and its nuclear localization. Results Post-infarct heart failure in diabetic GK rats was associated with pronounced cardiomyocyte hypertrophy, increased interstitial fibrosis and sustained cardiomyocyte apoptosis as compared with their non-diabetic Wistar controls. In the GK rat myocardium, Akt- and FOXO3a-phosphorylation was decreased and nuclear localization of FOXO3a was increased concomitantly with increased PTEN protein expression. Furthermore, increased Sirt1 protein expression was associated with decreased p53 acetylation, and phosphorylation of p38 was increased in diabetic rats with MI. Conclusions Post-infarct heart failure in diabetic GK rats was associated with more pronounced cardiac hypertrophy, interstitial fibrosis and sustained cardiomyocyte apoptosis as compared to their non-diabetic controls. The present study suggests important roles for Akt-FOXO3a, Sirt1 - p53 and p38 MAPK in the regulation of post-infarct cardiac remodeling

  16. Anticancer activity of eugenol is not related to regulation of the oncogenic transcription factor Forkhead Box M1

    Directory of Open Access Journals (Sweden)

    Luiz Alexandre Marques Wiirzler

    2016-09-01

    Full Text Available Genome-wide gene expression profiling of cancers has consistently identified the FOXM1 as one of the most commonly upregulated genes in cancer cells that plays an essential role in the regulation of a wide spectrum of biological processes, including inhibition of apoptosis. Since the anticancer activity of EUG reported in the literature is related to induction of apoptosis in cancer cells, we hypothesized that there is a correlation between the EUG-induced apoptosis effect and downregulation of FOXM1. A series of experiments were conducted to evaluate the effect of EUG on cellular viability of cancer cells (MTT and its potential regulatory effect on FOXM1 protein levels (western blots. Our findings confirm the anticancer effect of EUG on different human cancer cell lines as previously reported in the literature (SKBR3 LC50: 318.6; HT29 LC50: 525.5; and HepG2 LC50: 2090.0 µM. However, we demonstrated that EUG does not regulate the FOXM1. The results evidenced the anticancer effect of EUG on three cancer cell lines and showed that the EUG- apoptosis induced effect is not related to regulation of FOXM1 at the protein level. Further studies must be done to provide information on the mechanism of action of this agent.

  17. Functional characterization of MADS box transcription factors in Petunia hybrida

    NARCIS (Netherlands)

    Ferrario, S.I.T.

    2004-01-01

    Transcription factors play a central role in the regulation and integration of several developmental pathways in all organisms. MADS box proteins are, among transcription factors, key players in the regulation of flower induction, flower architecture and vegetative development and have been isolated

  18. SUMOylation of the Forkhead transcription factor FOXL2 promotes its stabilization/activation through transient recruitment to PML bodies.

    Directory of Open Access Journals (Sweden)

    Adrien Georges

    Full Text Available BACKGROUND: FOXL2 is a transcription factor essential for ovarian development and maintenance. It is mutated in the genetic condition called Blepharophimosis Ptosis Epicantus inversus Syndrome (BPES and in cases of isolated premature ovarian failure. We and others have previously shown that FOXL2 undergoes several post-translational modifications. METHODS AND PRINCIPAL FINDINGS: Here, using cells in culture, we show that interference with FOXL2 SUMOylation leads to a robust inhibition of its transactivation ability, which correlates with a decreased stability. Interestingly, FOXL2 SUMOylation promotes its transient recruitment to subnuclear structures that we demonstrate to be PML (Promyelocytic Leukemia Nuclear Bodies. Since PML bodies are known to be sites where post-translational modifications of nuclear factors take place, we used tandem mass spectrometry to identify new post-translational modifications of FOXL2. Specifically, we detected four phosphorylated, one sulfated and three acetylated sites. CONCLUSIONS: By analogy with other transcription factors, we propose that PML Nuclear Bodies might transiently recruit FOXL2 to the vicinity of locally concentrated enzymes that could be involved in the post-translational maturation of FOXL2. FOXL2 acetylation, sulfation, phosphorylation as well as other modifications yet to be discovered might alter the transactivation capacity of FOXL2 and/or its stability, thus modulating its global intracellular activity.

  19. Expression and significance of fat mass and obesity associated gene and forkhead transcription factor O1 in non-alcoholic fatty liver disease.

    Science.gov (United States)

    Zhang, Jielei; Li, Shan; Li, Jingyi; Han, Chao; Wang, Zhifang; Li, Chong; Wang, Xiaoman; Liu, Zhenzhen; Wen, Jianguo; Zheng, Lili

    2014-01-01

    Non-alcoholic fatty liver disease (NAFLD) is a complex disorder and has been closely linked to obesity. The fat mass and obesity-associated (FTO) gene is a newly discovered gene related to obesity, which enhances oxidative stress and lipogenesis in NAFLD. The forkhead transcription factor O1 (FoxO1) is another important gene involved in NAFLD, which causes lipid disorders when insulin resistance appears in the liver. However, the interactions between FTO and FoxO1 during the pathogenesis of NAFLD have not been fully elucidated. This study was designed to identify the relationship between these two factors that are involved in the development of NAFLD. This study includes two parts referred to as animal and cell experiments. Twelve female SPF C57BL/6 mice were fed a high-fat diet to serve as an NAFLD animal model. Aspartate aminotransferase (AST), alanine aminotransferase (ALT), total triglyceride (TG), total cholesterol (TC), alkaline phosphatase (ALP), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured. Immunohistochemical analysis was used to detect the expression and histological localization of FTO, FoxO1, and adenosine monophosphate (AMP)-activated protein kinase (AMPK). The L02 cells were exposed to high fat for 24, 48, or 72 hours. Oil red O staining was used to detect intracellular lipid droplets. Reverse transcription-polymerase chain reaction was used for analyzing the levels of FTO and FoxO1 mRNA. At the end of 10 weeks, ALP, ALT, AST, and LDL were significantly increased (P < 0.01), while TC and TG were also significantly higher (P < 0.05). In addition, HDL was significantly decreased (P < 0.05). The FTO and FoxO1 proteins were weakly expressed in the control group, but both FTO and FoxO1 were expressed significantly higher (P < 0.01) in the experimental group, and the expression of the two factors was significantly correlated. AMPK in the high-fat group showed a low level of correlation with FTO, but not with FoxO1. Oil Red

  20. Attenuation correction factors for cylindrical, disc and box geometry

    International Nuclear Information System (INIS)

    Agarwal, Chhavi; Poi, Sanhita; Mhatre, Amol; Goswami, A.; Gathibandhe, M.

    2009-01-01

    In the present study, attenuation correction factors have been experimentally determined for samples having cylindrical, disc and box geometry and compared with the attenuation correction factors calculated by Hybrid Monte Carlo (HMC) method [ C. Agarwal, S. Poi, A. Goswami, M. Gathibandhe, R.A. Agrawal, Nucl. Instr. and. Meth. A 597 (2008) 198] and with the near-field and far-field formulations available in literature. It has been observed that the near-field formulae, although said to be applicable at close sample-detector geometry, does not work at very close sample-detector configuration. The advantage of the HMC method is that it is found to be valid for all sample-detector geometries.

  1. Load Distribution Factors for Composite Multicell Box Girder Bridges

    Science.gov (United States)

    Tiwari, Sanjay; Bhargava, Pradeep

    2017-12-01

    Cellular steel section composite with a concrete deck is one of the most suitable superstructures in resisting torsional and warping effects induced by highway loading. This type of structure has inherently created new design problems for engineers in estimating its load distribution when subjected to moving vehicles. Indian Codes of Practice does not provide any specific guidelines for the design of straight composite concrete deck-steel multi-cell bridges. To meet the practical requirements arising during the design process, a simple design method is needed for straight composite multi-cell bridges in the form of load distribution factors for moment and shear. This work presents load distribution characteristics of straight composite multi-cell box girder bridges under IRC trains of loads.

  2. FOXO3a (Forkhead Transcription Factor O Subfamily Member 3a) Links Vascular Smooth Muscle Cell Apoptosis, Matrix Breakdown, Atherosclerosis, and Vascular Remodeling Through a Novel Pathway Involving MMP13 (Matrix Metalloproteinase 13).

    Science.gov (United States)

    Yu, Haixiang; Fellows, Adam; Foote, Kirsty; Yang, Zhaoqing; Figg, Nichola; Littlewood, Trevor; Bennett, Martin

    2018-03-01

    Vascular smooth muscle cell (VSMC) apoptosis accelerates atherosclerosis and promotes breakdown of the extracellular matrix, but the mechanistic links between these 2 processes are unknown. The forkhead protein FOXO3a (forkhead transcription factor O subfamily member 3a) is activated in human atherosclerosis and induces a range of proapoptotic and other transcriptional targets. We, therefore, determined the mechanisms and consequences of FOXO3a activation in atherosclerosis and arterial remodeling after injury. Expression of a conditional FOXO3a allele (FOXO3aA3ER) potently induced VSMC apoptosis, expression and activation of MMP13 (matrix metalloproteinase 13), and downregulation of endogenous TIMPs (tissue inhibitors of MMPs). mmp13 and mmp2 were direct FOXO3a transcriptional targets in VSMCs. Activation of endogenous FOXO3a also induced MMP13, extracellular matrix degradation, and apoptosis, and MMP13-specific inhibitors and fibronectin reduced FOXO3a-mediated apoptosis. FOXO3a activation in mice with VSMC-restricted FOXO3aA3ER induced MMP13 expression and activity and medial VSMC apoptosis. FOXO3a activation in FOXO3aA3ER/ApoE -/- (apolipoprotein E deficient) mice increased atherosclerosis, increased necrotic core and reduced fibrous cap areas, and induced features of medial degeneration. After carotid artery ligation, FOXO3a activation increased VSMC apoptosis, VSMC proliferation, and neointima formation, all of which were reduced by MMP13 inhibition. FOXO3a activation induces VSMC apoptosis and extracellular matrix breakdown, in part, because of transcriptional activation of MMP13. FOXO3a activation promotes atherosclerosis and medial degeneration and increases neointima after injury that is partly dependent on MMP13. FOXO3a-induced MMP activation represents a direct mechanistic link between VSMC apoptosis and matrix breakdown in vascular disease. © 2018 The Authors.

  3. Structure of the Forkhead Domain of FOXA2 Bound to a Complete DNA Consensus Site.

    Science.gov (United States)

    Li, Jun; Dantas Machado, Ana Carolina; Guo, Ming; Sagendorf, Jared M; Zhou, Zhan; Jiang, Longying; Chen, Xiaojuan; Wu, Daichao; Qu, Lingzhi; Chen, Zhuchu; Chen, Lin; Rohs, Remo; Chen, Yongheng

    2017-07-25

    FOXA2, a member of the forkhead family of transcription factors, plays essential roles in liver development and bile acid homeostasis. In this study, we report a 2.8 Å co-crystal structure of the FOXA2 DNA-binding domain (FOXA2-DBD) bound to a DNA duplex containing a forkhead consensus binding site (GTAAACA). The FOXA2-DBD adopts the canonical winged-helix fold, with helix H3 and wing 1 regions mainly mediating the DNA recognition. Although the wing 2 region was not defined in the structure, isothermal titration calorimetry assays suggested that this region was required for optimal DNA binding. Structure comparison with the FOXA3-DBD bound to DNA revealed more major groove contacts and fewer minor groove contacts in the FOXA2 structure than in the FOXA3 structure. Structure comparison with the FOXO1-DBD bound to DNA showed that different forkhead proteins could induce different DNA conformations upon binding to identical DNA sequences. Our findings provide the structural basis for FOXA2 protein binding to a consensus forkhead site and elucidate how members of the forkhead protein family bind different DNA sites.

  4. Protein interactions of MADS box transcription factors involved in flowering in Lolium perenne

    NARCIS (Netherlands)

    Ciannamea, S.; Kaufmann, K.; Frau, M.; Nougalli Tonaco, I.A.; Petersen, K.; Nielsen, K.K.; Angenent, G.C.; Immink, G.H.

    2006-01-01

    Regulation of flowering time is best understood in the dicot model species Arabidopsis thaliana. Molecular analyses revealed that genes belonging to the MADS box transcription factor family play pivotal regulatory roles in both the vernalization- and photoperiod-regulated flowering pathways. Here

  5. The T-box transcription factor Eomesodermin is essential for AVE induction in the mouse embryo.

    Science.gov (United States)

    Nowotschin, Sonja; Costello, Ita; Piliszek, Anna; Kwon, Gloria S; Mao, Chai-an; Klein, William H; Robertson, Elizabeth J; Hadjantonakis, Anna-Katerina

    2013-05-01

    Reciprocal inductive interactions between the embryonic and extraembryonic tissues establish the anterior-posterior (AP) axis of the early mouse embryo. The anterior visceral endoderm (AVE) signaling center emerges at the distal tip of the embryo at embryonic day 5.5 and translocates to the prospective anterior side of the embryo. The process of AVE induction and migration are poorly understood. Here we demonstrate that the T-box gene Eomesodermin (Eomes) plays an essential role in AVE recruitment, in part by directly activating the homeobox transcription factor Lhx1. Thus, Eomes function in the visceral endoderm (VE) initiates an instructive transcriptional program controlling AP identity.

  6. Changing MADS-Box Transcription Factor Protein-Protein Interactions as a Mechanism for Generating Floral Morphological Diversity.

    Science.gov (United States)

    Bartlett, Madelaine E

    2017-12-01

    Flowers display fantastic morphological diversity. Despite extreme variability in form, floral organ identity is specified by a core set of deeply conserved proteins-the floral MADS-box transcription factors. This indicates that while core gene function has been maintained, MADS-box transcription factors have evolved to regulate different downstream genes. Thus, the evolution of gene regulation downstream of the MADS-box transcription factors is likely central to the evolution of floral form. Gene regulation is determined by the combination of transcriptional regulators present at a particular cis-regulatory element at a particular time. Therefore, the interactions between transcription factors can be of profound importance in determining patterns of gene regulation. Here, after a short primer on flowers and floral morphology, I discuss the centrality of protein-protein interactions to MADS-box transcription factor function, and review the evidence that the evolution of MADS-box protein-protein interactions is a key driver in the evolution of gene regulation downstream of the MADS-box genes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  7. Cutting Edge: Divergent Requirement of T-Box Transcription Factors in Effector and Memory NK Cells.

    Science.gov (United States)

    Madera, Sharline; Geary, Clair D; Lau, Colleen M; Pikovskaya, Olga; Reiner, Steven L; Sun, Joseph C

    2018-03-15

    The T-box transcription factors T-bet and Eomesodermin (Eomes) instruct discrete stages in NK cell development. However, their role in the immune response of mature NK cells against pathogens remains unexplored. We used an inducible deletion system to elucidate the cell-intrinsic role of T-bet and Eomes in mature NK cells during the course of mouse CMV infection. We show both T-bet and Eomes to be necessary for the expansion of virus-specific NK cells, with T-bet upregulation induced by IL-12 signaling and STAT4 binding to a conserved enhancer region upstream of the Tbx21 loci. Interestingly, our data suggest maintenance of virus-specific memory NK cell numbers and phenotype was dependent on T-bet, but not Eomes. These findings uncover a nonredundant and stage-specific influence of T-box transcription factors in the antiviral NK cell response. Copyright © 2018 by The American Association of Immunologists, Inc.

  8. A DEAD box protein facilitates HIV-1 replication as a cellular co-factor of Rev

    International Nuclear Information System (INIS)

    HIV-1 Rev escorts unspliced viral mRNAs out of the nucleus of infected cells, which allows formation of infectious HIV-1 virions. We have identified a putative DEAD box (Asp-Glu-Ala-Asp) RNA helicase, DDX1, as a cellular co-factor of Rev, through yeast and mammalian two-hybrid systems using the N-terminal motif of Rev as 'bait'. DDX1 is not a functional homolog of HIV-1 Rev, but down-regulation of DDX1 resulted in an alternative splicing pattern of Rev-responsive element (RRE)-containing mRNA, and attenuation of Gag p24 antigen production from HLfb rev(-) cells rescued by exogenous Rev. Co-transfection of a DDX1 expression vector with HIV-1 significantly increased viral production. DDX1 binding to Rev, as well as to the RRE, strongly suggest that DDX1 affects Rev function through the Rev-RRE axis. Moreover, down-regulation of DDX1 altered the steady state subcellular distribution of Rev, from nuclear/nucleolar to cytoplasmic dominance. These findings indicate that DDX1 is a critical cellular co-factor for Rev function, which maintains the proper subcellular distribution of this lentiviral regulatory protein. Therefore, alterations in DDX1-Rev interactions could induce HIV-1 persistence and targeting DDX1 may lead to rationally designed and novel anti-HIV-1 strategies and therapeutics

  9. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment of p...

  10. T-box transcription factor 21 expression in breast cancer and its relationship with prognosis.

    Science.gov (United States)

    Yu, Haiming; Yang, Junlan; Jiao, Shunchang; Li, Ying; Zhang, Wei; Wang, Jiandong

    2014-01-01

    T-box transcription factor 21 (T-bet) is a key lineage-defining transcription factor. The purpose of this study was to verify the relationship between expression in primary tumors and prognosis of breast cancer. T-protein expression was immunohistochemically detected on surgically-obtained tumor samples of 130 (stage I-III) invasive breast carcinomas from Chinese subjects, who were followed up for a mean time of 112 months. T-bet was expressed in the nuclei and cytoplasm of both tumor cells and tumor-infiltrating lymphocytes. In LOG-RANK analysis, higher density of interstitial T-bet+ interstitial lymphocytes was related with longer distant disease-free survival (DDFS) (P = 0.047); higher tumor nuclei T-bet expression was related with shorter DFS (P = 0.021) and DDFS (P = 0.026). Cox multivariate analysis showed that density of interstitial T-bet+ interstitial lymphocytes was an independent positive prognostic factor for DFS (HR = 0.474, P = 0.051) and DDFS (HR = 0.414, P = 0.030); tumor nuclei CTLA-4 expression was an independent adverse prognostic factor for DFS (HR = 3.007, P = 0.003), DDFS (HR = 2.931, P = 0.005) and OS (HR = 2.352, P = 0.029). This study found that, high tumor nuclei T-bet expression in primary tumors of breast cancer was correlated with poor prognosis and high density of T-bet+ interstitial lymphocytes in primary tumors of breast cancer were correlated with favorable prognosis.

  11. Evaluation of Pre-marketing Factors to Predict Post-marketing Boxed Warnings and Safety Withdrawals.

    Science.gov (United States)

    Schick, Andreas; Miller, Kathleen L; Lanthier, Michael; Dal Pan, Gerald; Nardinelli, Clark

    2017-06-01

    An important goal in drug regulation is understanding serious safety issues with new drugs as soon as possible. Achieving this goal requires us to understand whether information provided during the Food and Drug Administration (FDA) drug review can predict serious safety issues that are usually identified after the product is approved. However, research on this topic remains understudied. In this paper, we examine whether any pre-marketing drug characteristics are associated with serious post-marketing safety actions. We study this question using an internal FDA database containing every new small molecule drug submitted to the FDA's Center for Drug Evaluation and Research (CDER) on or after November 21, 1997, and approved and commercially launched before December 31, 2009. Serious post-marketing safety actions include whether these drugs ever experienced either a post-marketing boxed warning or a withdrawal from the market due to safety concerns. A random effects logistic regression model was used to test whether any pre-marketing characteristics were associated with either post-marketing safety action. A total of 219 new molecular entities were analyzed. Among these drugs, 11 experienced a safety withdrawal and 30 received boxed warnings by July 31, 2016. Contrary to prevailing hypotheses, we find that neither clinical trial sample sizes nor review time windows are associated with the addition of a post-marketing boxed warning or safety withdrawal. However, we do find that new drugs approved with either a boxed warning or priority review are more likely to experience post-marketing boxed warnings. Furthermore, drugs approved with boxed warnings tend to receive post-marketing boxed warnings resulting from new safety information that are unrelated to the original warning. Drugs approved with a boxed warning are 3.88 times more likely to receive a post-marketing boxed warning, while drugs approved with a priority review are 3.51 times more likely to receive a post

  12. Unraveling the regulatory network of the MADS box transcription factor RIN in fruit ripening.

    Science.gov (United States)

    Qin, Guozheng; Wang, Yuying; Cao, Baohua; Wang, Weihao; Tian, Shiping

    2012-04-01

    The MADS box transcription factor RIN is a global regulator of fruit ripening. However, the direct targets modulated by RIN and the mechanisms underlying the transcriptional regulation remain largely unknown. Here we identified 41 protein spots representing 35 individual genes as potential targets of RIN by comparative proteomic analysis of a rin mutant in tomato fruits. Gene expression analysis showed that the mRNA level of 26 genes correlated well with the protein level. After examining the promoter regions of the candidate genes, a variable number of RIN binding sites were found. Five genes (E8, TomloxC, PNAE, PGK and ADH2) were identified as novel direct targets of RIN by chromatin immunoprecipitation. The results of a gel mobility shift assay confirmed the direct binding of RIN to the promoters of these genes. Of the direct target genes, TomloxC and ADH2, which encode lipoxygenase (LOX) and alcohol dehydrogenase, respectively, are critical for the production of characteristic tomato aromas derived from LOX pathway. Further study indicated that RIN also directly regulates the expression of HPL, which encodes hydroperoxide lyase, another rate-limiting enzyme in the LOX pathway. Loss of function of RIN causes de-regulation of the LOX pathway, leading to a specific defect in the generation of aroma compounds derived from this pathway. These results indicate that RIN modulates aroma formation by direct and rigorous regulation of expression of genes in the LOX pathway. Taken together, our findings suggest that the regulatory effect of RIN on fruit ripening is achieved by targeting specific molecular pathways. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  13. Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: New openings to the MADS World

    NARCIS (Netherlands)

    Parenicova, L.; Folter, de S.; Kieffer, M.; Horner, D.S.; Favalli, C.; Busscher, J.; Cook, H.E.; Ingram, R.M.; Kater, M.M.; Davies, B.; Angenent, G.C.; Colombo, L.

    2003-01-01

    MADS-box transcription factors are key regulators of several plant development processes. Analysis of the complete Arabidopsis genome sequence revealed 107 genes encoding MADS-box proteins, of which 84re of unknown function. Here, we provide a complete overview of this family, describing the gene

  14. Analysis and modeling of delamination factor in drilling of woven kenaf fiber reinforced epoxy using Box Behnken experimental design

    Science.gov (United States)

    Suhaily, M.; Che Hassan, C. H.; Jaharah, A. G.; Afifah, M. A.; Nor Khairusshima, M. K.

    2018-01-01

    In this research study, it presents a comprehensive mathematical model for correlating the influences of drilling parameters on the delamination factor during the drilling of woven kenaf fiber reinforced epoxy composite laminates using the Box Behnken experimental design. The purpose of this study is to investigate the influence of drilling parameters such as cutting speed, feed rate and drill sizes on the delamination produced when drilling woven kenaf reinforced epoxy composite using the non-coated HSS drill bits. The damage generated on the woven kenaf reinforced epoxy composite laminates were observed both at the entrance and exit surface during the drilling operation. The experiments were conducted according to the Box Behnken experimental designs.

  15. Factors affecting microcuttings of Stevia using a mist-chamber propagation box.

    Science.gov (United States)

    Osman, Mohamad; Samsudin, Nur Syamimi; Faruq, Golam; Nezhadahmadi, Arash

    2013-01-01

    Stevia rebaudiana Bertoni is a member of Compositae family. Stevia plant has zero calorie content and its leaves are estimated to be 300 times sweeter than sugar. This plant is believed to be the most ideal substitute for sugar and important to assist in medicinal value especially for diabetic patients. In this study, microcutting techniques using a mist-chamber propagation box were used as it was beneficial for propagation of Stevia and gave genetic uniformity to the plant. The effects of different treatments on root stimulation of Stevia in microcuttings technique were evaluated. Treatments studied were different sizes of shoot cuttings, plant growth regulators, lights, and shades. Data logger was used to record the mean value of humidity (>90% RH), light intensity (673-2045 lx), and temperature (28.6-30.1°C) inside the mist-chamber propagation box. From analysis of variance, there were significant differences between varieties and treatments in parameters studied (P Stevia.

  16. Virtual Box

    DEFF Research Database (Denmark)

    Davis, Hilary; Skov, Mikael B.; Stougaard, Malthe

    2007-01-01

    . This paper reports on the design, implementation and initial evaluation of Virtual Box. Virtual Box attempts to create a physical and engaging context in order to support reciprocal interactions with expressive content. An implemented version of Virtual Box is evaluated in a location-aware environment...

  17. Factors Affecting Microcuttings of Stevia Using a Mist-Chamber Propagation Box

    Science.gov (United States)

    Osman, Mohamad; Samsudin, Nur Syamimi; Faruq, Golam

    2013-01-01

    Stevia rebaudiana Bertoni is a member of Compositae family. Stevia plant has zero calorie content and its leaves are estimated to be 300 times sweeter than sugar. This plant is believed to be the most ideal substitute for sugar and important to assist in medicinal value especially for diabetic patients. In this study, microcutting techniques using a mist-chamber propagation box were used as it was beneficial for propagation of Stevia and gave genetic uniformity to the plant. The effects of different treatments on root stimulation of Stevia in microcuttings technique were evaluated. Treatments studied were different sizes of shoot cuttings, plant growth regulators, lights, and shades. Data logger was used to record the mean value of humidity (>90% RH), light intensity (673–2045 lx), and temperature (28.6–30.1°C) inside the mist-chamber propagation box. From analysis of variance, there were significant differences between varieties and treatments in parameters studied (P Stevia. PMID:24470797

  18. Arabidopsis MADS-Box Transcription Factor AGL21 Acts as Environmental Surveillance of Seed Germination by Regulating ABI5 Expression.

    Science.gov (United States)

    Yu, Lin-Hui; Wu, Jie; Zhang, Zi-Sheng; Miao, Zi-Qing; Zhao, Ping-Xia; Wang, Zhen; Xiang, Cheng-Bin

    2017-06-05

    Seed germination is a crucial checkpoint for plant survival under unfavorable environmental conditions. Abscisic acid (ABA) signaling plays a vital role in integrating environmental information to regulate seed germination. It has been well known that MCM1/AGAMOUS/DEFICIENS/SRF (MADS)-box transcription factors are key regulators of seed and flower development in Arabidopsis. However, little is known about their functions in seed germination. Here we report that MADS-box transcription factor AGL21 is a negative regulator of seed germination and post-germination growth by controlling the expression of ABA-INSENSITIVE 5 (ABI5) in Arabidopsis. The AGL21-overexpressing plants were hypersensitive to ABA, salt, and osmotic stresses during seed germination and early post-germination growth, whereas agl21 mutants were less sensitive. We found that AGL21 positively regulated ABI5 expression in seeds. Consistently, genetic analyses showed that AGL21 is epistatic to ABI5 in controlling seed germination. Chromatin immunoprecipitation assays further demonstrated that AGL21 could directly bind to the ABI5 promoter in plant cells. Moreover, we found that AGL21 responded to multiple environmental stresses and plant hormones during seed germination. Taken together, our results suggest that AGL21 acts as a surveillance integrator that incorporates environmental cues and endogenous hormonal signals into ABA signaling to regulate seed germination and early post-germination growth. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  19. Regulation of Forkhead BOX O tumor suppressors by Reactive Oxygen Species

    NARCIS (Netherlands)

    de Keizer, P.L.J.

    2009-01-01

    The risk on developing cancer increases with age. Moreover, many processes that affect the onset of aging, such as altered proliferation, metabolism and stress resistance, are also frequently deregulated in cancer. The molecular mechanisms that prevent the onset of aging may therefore be partially

  20. Bento Boxes

    Science.gov (United States)

    Hasio, Cindy

    2010-01-01

    Bento boxes are common objects in Japanese culture, designed to hold enough lunch for one person. They have individual compartments and sometimes multiple tiers for rice, vegetables, and other side dishes. They are made of materials ranging from wood, cloth, aluminum, or plastic. In general, the greater the number of foods, the better the box is…

  1. Aberrant over-expression of a forkhead family member, FOXO1A, in a brain tumor cell line

    International Nuclear Information System (INIS)

    Dallas, Peter B; Egli, Simone; Terry, Philippa A; Kees, Ursula R

    2007-01-01

    The mammalian FOXO (forkhead box, O subclass) proteins are a family of pleiotropic transcription factors involved in the regulation of a broad range of cellular processes critical for survival. Despite the essential and diverse roles of the FOXO family members in human cells and their involvement in tumor pathogenesis, the regulation of FOXO expression remains poorly understood. We have addressed the mechanisms underlying the high level of expression of the FOXO1A gene in a cell line, PER-453, derived from a primitive neuroectodermal tumor of the central nervous system (CNS-PNET). The status of the FOXO1A locus in the PER-453 CNS-PNET cell line was investigated by Southern blotting and DNA sequence analysis of the proximal promoter, 5'-UTR, open reading frame and 3'-UTR. FOXO1A expression was assessed by conventional and quantitative RT-PCR, Northern and Western blotting. Quantitative real-time RT-PCR (qRT-PCR) data indicated that after normalization to ACTB mRNA levels, canonical FOXO1A mRNA expression in the PER-453 cell line was 124-fold higher than the average level of five other CNS-PNET cell lines tested, 24-fold higher than the level in whole fetal brain, and 3.5-fold higher than the level in fetal brain germinal matrix cells. No mutations within the FOXO1A open reading frame or gross rearrangements of the FOXO1A locus were detected. However, a single nucleotide change within the proximal promoter and several nucleotide changes within the 3'-UTR were identified. In addition, two novel FOXO1A transcripts were isolated that differ from the canonical transcript by alternative splicing within the 3'-UTR. The CNS-PNET cell line, PER-453, expresses FOXO1A at very high levels relative to most normal and cancer cells from a broad range of tissues. The FOXO1A open reading frame is wild type in the PER-453 cell line and the abnormally high FOXO1A mRNA expression is not due to mutations affecting the 5'-UTR or proximal promoter. Over expression

  2. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor X (RFX) transcription factors through X-box promoter motifs.

    Science.gov (United States)

    Tammimies, Kristiina; Bieder, Andrea; Lauter, Gilbert; Sugiaman-Trapman, Debora; Torchet, Rachel; Hokkanen, Marie-Estelle; Burghoorn, Jan; Castrén, Eero; Kere, Juha; Tapia-Páez, Isabel; Swoboda, Peter

    2016-10-01

    DYX1C1, DCDC2, and KIAA0319 are three of the most replicated dyslexia candidate genes (DCGs). Recently, these DCGs were implicated in functions at the cilium. Here, we investigate the regulation of these DCGs by Regulatory Factor X transcription factors (RFX TFs), a gene family known for transcriptionally regulating ciliary genes. We identify conserved X-box motifs in the promoter regions of DYX1C1, DCDC2, and KIAA0319 and demonstrate their functionality, as well as the ability to recruit RFX TFs using reporter gene and electrophoretic mobility shift assays. Furthermore, we uncover a complex regulation pattern between RFX1, RFX2, and RFX3 and their significant effect on modifying the endogenous expression of DYX1C1 and DCDC2 in a human retinal pigmented epithelial cell line immortalized with hTERT (hTERT-RPE1). In addition, induction of ciliogenesis increases the expression of RFX TFs and DCGs. At the protein level, we show that endogenous DYX1C1 localizes to the base of the cilium, whereas DCDC2 localizes along the entire axoneme of the cilium, thereby validating earlier localization studies using overexpression models. Our results corroborate the emerging role of DCGs in ciliary function and characterize functional noncoding elements, X-box promoter motifs, in DCG promoter regions, which thus can be targeted for mutation screening in dyslexia and ciliopathies associated with these genes.-Tammimies, K., Bieder, A., Lauter, G., Sugiaman-Trapman, D., Torchet, R., Hokkanen, M.-E., Burghoorn, J., Castrén, E., Kere, J., Tapia-Páez, I., Swoboda, P. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor (RF) X transcription factors through X-box promoter motifs. © The Author(s).

  3. ICF and ICF-CY lessons learned: Pandora's box of personal factors.

    Science.gov (United States)

    Simeonsson, Rune J; Lollar, Don; Björck-Åkesson, Eva; Granlund, Mats; Brown, Scott C; Zhuoying, Qiu; Gray, David; Pan, Yi

    2014-01-01

    The aim of this article is to examine the component of "personal factors" described as a contextual factor in the ICF and ICF-CY. A critical examination of the construct of "personal factors" and description of the component was made with reference to conceptual and taxonomic criteria. The "personal factors" component in the ICF/ICF-CY is not defined, there is no taxonomy of codes, there is no explicit purpose stated for its use and no guidelines are provided for its application. In spite of these constraints, the component of "personal factors" is being applied as part of the classifications. Such uncontrolled applications constitute significant risks for the status of ICF/ICF-CY as the WHO reference classification in that: (a) the component is accepted for use by default simply by being applied; (b) component content is expanded with idiosyncratic exemplars by users; and (c) there is potential misuse of "personal factors" in documenting personal attributes, including "blaming the victim". In the absence of formal codes, any application of the component of "personal factors" lacks the legitimacy that documentation with a scientific taxonomy should provide. Given the growing use of the ICF/ICF-CY globally, a priority for the revision process should be to determine if there is in fact need for "personal" or any other factors in the ICF/ICF-CY. A central contribution of the ICF/ICF-CY is the universal language of codes for the components of body structure, body function, activities and participation and Environmental Factors. As such the codes provide taxonomical legitimacy and power for documenting dimensions of functioning and disability in clinical and rehabilitation contexts. As there are no codes of "personal factors", there is no basis for documentation of the component. Demographic information, if needed for identification, should be recorded in customary formats, independent of any component or codes of the ICF/ICF-CY.

  4. Determining the Molecular and Genetic Basis for Diabetes in Navy Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    2015-01-12

    compared to those from humans, mice, and rats. Targeted binding sites, including TATA boxes, included those for the transcription factors, forkhead box 01...CCTACTGATGATGCACCTTTGATCAATAGATTTTAGACAAAAGTGTTTTTTTGAGTCCAA ******* ******************** ************ * * ***** ******** TATA Box AGATCAGGGCTGGGTTGACCTGAATACTGGATACAGGGCA

  5. Increased expression of high mobility group box protein 1 and vascular endothelial growth factor in placenta previa.

    Science.gov (United States)

    Xie, Han; Qiao, Ping; Lu, Yi; Li, Ying; Tang, Yuping; Huang, Yiying; Bao, Yirong; Ying, Hao

    2017-12-01

    Placenta previa is often associated with preterm delivery, reduced birth weight, a higher frequency of placental accreta and postpartum haemorrhage, and increased likelihood of blood transfusion. The present study aimed to examine the expression of high mobility group box protein 1 (HMGB1) in the placenta of women with or without placenta previa. The study group consisted of placental tissues obtained from women with or without placenta previa. The expression levels of HMGB1 and vascular endothelial growth factor (VEGF) were evaluated in the placental tissues using reverse transcription‑quantitative polymerase chain reaction, western blotting and immunohistochemistry. The mRNA expression levels of HMGB1 and VEGF were significantly increased in the placenta previa group compared with in the normal group. In addition, the placenta previa group exhibited increased HMGB1 and VEGF staining in vascular endothelial cells and trophoblasts. There were no significant differences in the expression of HMGB1 or VEGF between groups with or without placenta accreta or postpartum haemorrhage. The present study hypothesised that the increased expression of HMGB1 in the placenta may be associated with the pathogenesis of placenta previa by regulating the expression of the proangiogenic factor VEGF.

  6. In Vivo Regulation of the Zebrafish Endoderm Progenitor Niche by T-Box Transcription Factors

    Directory of Open Access Journals (Sweden)

    Andrew C. Nelson

    2017-06-01

    Full Text Available T-box transcription factors T/Brachyury homolog A (Ta and Tbx16 are essential for correct mesoderm development in zebrafish. The downstream transcriptional networks guiding their functional activities are poorly understood. Additionally, important contributions elsewhere are likely masked due to redundancy. Here, we exploit functional genomic strategies to identify Ta and Tbx16 targets in early embryogenesis. Surprisingly, we discovered they not only activate mesodermal gene expression but also redundantly regulate key endodermal determinants, leading to substantial loss of endoderm in double mutants. To further explore the gene regulatory networks (GRNs governing endoderm formation, we identified targets of Ta/Tbx16-regulated homeodomain transcription factor Mixl1, which is absolutely required in zebrafish for endoderm formation. Interestingly, we find many endodermal determinants coordinately regulated through common genomic occupancy by Mixl1, Eomesa, Smad2, Nanog, Mxtx2, and Pou5f3. Collectively, these findings augment the endoderm GRN and reveal a panel of target genes underlying the Ta, Tbx16, and Mixl1 mutant phenotypes.

  7. Serum response factor MADS box serine -162 phosphorylation switches proliferation and myogenic gene programs

    Science.gov (United States)

    Iyer, Dinakar; Chang, David; Marx, Joe; Wei, Lei; Olson, Eric N.; Parmacek, Michael S.; Balasubramanyam, Ashok; Schwartz, Robert J.

    2006-01-01

    Phosphorylation of a cluster of amino acids in the serum response factor (SRF) “MADS box” αI coil DNA binding domain regulated the transcription of genes associated with proliferation or terminal muscle differentiation. Mimicking phosphorylation of serine-162, a target of protein kinase C-α, with an aspartic acid substitution (SRF-S162D) completely inhibited SRF–DNA binding and blocked α-actin gene transcription even in the presence of potent myogenic cofactors, while preserving c-fos promoter activity because of stabilization of the ternary complex via Elk-1. Introduction of SRF-S162D into SRF null ES cells permitted transcription of the c-fos gene but was unable to rescue expression of myogenic contractile genes. Transition of proliferating C2C12 myoblasts to postfusion myocytes after serum withdrawal was associated with a progressive decline in SRF-S162 phosphorylation and an increase in α-actin gene expression. Hence, the phosphorylation status of serine-162 in the αI coil may constitute a novel switch that directs target gene expression into proliferation or differentiation programs. PMID:16537394

  8. Suppressed expression of T-box transcription factors is involved in senescence in chronic obstructive pulmonary disease.

    Directory of Open Access Journals (Sweden)

    George K Acquaah-Mensah

    Full Text Available Chronic obstructive pulmonary disease (COPD is a major global health problem. The etiology of COPD has been associated with apoptosis, oxidative stress, and inflammation. However, understanding of the molecular interactions that modulate COPD pathogenesis remains only partly resolved. We conducted an exploratory study on COPD etiology to identify the key molecular participants. We used information-theoretic algorithms including Context Likelihood of Relatedness (CLR, Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNE, and Inferelator. We captured direct functional associations among genes, given a compendium of gene expression profiles of human lung epithelial cells. A set of genes differentially expressed in COPD, as reported in a previous study were superposed with the resulting transcriptional regulatory networks. After factoring in the properties of the networks, an established COPD susceptibility locus and domain-domain interactions involving protein products of genes in the generated networks, several molecular candidates were predicted to be involved in the etiology of COPD. These include COL4A3, CFLAR, GULP1, PDCD1, CASP10, PAX3, BOK, HSPD1, PITX2, and PML. Furthermore, T-box (TBX genes and cyclin-dependent kinase inhibitor 2A (CDKN2A, which are in a direct transcriptional regulatory relationship, emerged as preeminent participants in the etiology of COPD by means of senescence. Contrary to observations in neoplasms, our study reveals that the expression of genes and proteins in the lung samples from patients with COPD indicate an increased tendency towards cellular senescence. The expression of the anti-senescence mediators TBX transcription factors, chromatin modifiers histone deacetylases, and sirtuins was suppressed; while the expression of TBX-regulated cellular senescence markers such as CDKN2A, CDKN1A, and CAV1 was elevated in the peripheral lung tissue samples from patients with COPD. The critical balance

  9. Suppressed Expression of T-Box Transcription Factors is Involved in Senescence in Chronic Obstructive Pulmonary Disease

    Energy Technology Data Exchange (ETDEWEB)

    Acquaah-Mensah, George; Malhotra, Deepti; Vulimiri, Madhulika; McDermott, Jason E.; Biswal, Shyam

    2012-06-19

    Chronic obstructive pulmonary disease (COPD) is a major global health problem. The etiology of COPD has been associated with apoptosis, oxidative stress, and inflammation. However, understanding of the molecular interactions that modulate COPD pathogenesis remains only partly resolved. We conducted an exploratory study on COPD etiology to identify the key molecular participants. We used information-theoretic algorithms including Context Likelihood of Relatedness (CLR), Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNE), and Inferelator. We captured direct functional associations among genes, given a compendium of gene expression profiles of human lung epithelial cells. A set of genes differentially expressed in COPD, as reported in a previous study were superposed with the resulting transcriptional regulatory networks. After factoring in the properties of the networks, an established COPD susceptibility locus and domain-domain interactions involving protein products of genes in the generated networks, several molecular candidates were predicted to be involved in the etiology of COPD. These include COL4A3, CFLAR, GULP1, PDCD1, CASP10, PAX3, BOK, HSPD1, PITX2, and PML. Furthermore, T-box (TBX) genes and cyclin-dependent kinase inhibitor 2A (CDKN2A), which are in a direct transcriptional regulatory relationship, emerged as preeminent participants in the etiology of COPD by means of senescence. Contrary to observations in neoplasms, our study reveals that the expression of genes and proteins in the lung samples from patients with COPD indicate an increased tendency towards cellular senescence. The expression of the anti-senescence mediators TBX transcription factors, chromatin modifiers histone deacetylases, and sirtuins was suppressed; while the expression of TBX-regulated cellular senescence markers such as CDKN2A, CDKN1A, and CAV1 was elevated in the peripheral lung tissue samples from patients with COPD. The critical balance between senescence

  10. Glove box

    International Nuclear Information System (INIS)

    Morita, Atsushi

    1990-01-01

    Wire rope earthquake proof supports having sufficient vibration transmitting and attenuating property are disposed between a fixed floor and the bottom of a glove box in order to improve earthquake proofness of the glove box. The vertical weight of the glove box is supported by support legs slidable on the surface of the fixed floor. The wire rope earthquake-proof supports when undergoing a load, cause stretching and rolling against the external force such as earthquakes, and provide flexible spring support and cause a great damping due to friction with strands. Further, the vertical weight is always supported by the support legs and, when a horizontal weight is applied, the glove box slides on the fixed floor freely with slidable members. In this way, stress concentration generated at joint portions of columns and beams can be moderated greatly and earthquake proofness can be improved. Further, quality control and maintenance for the device is almost unnecessary owing to excellent fatigue-resistant characteristics of the wire rope earthquake proof supports. (N.H.)

  11. High-Mobility Group Box-1 Induces Decreased Brain-Derived Neurotrophic Factor-Mediated Neuroprotection in the Diabetic Retina

    Directory of Open Access Journals (Sweden)

    Ahmed M. Abu El-Asrar

    2013-01-01

    Full Text Available To test the hypothesis that brain-derived neurotrophic factor-(BDNF- mediated neuroprotection is reduced by high-mobility group box-1 (HMGB1 in diabetic retina, paired vitreous and serum samples from 46 proliferative diabetic retinopathy and 34 nondiabetic patients were assayed for BDNF, HMGB1, soluble receptor for advanced glycation end products (sRAGE, soluble intercellular adhesion molecule-1 (sICAM-1, monocyte chemoattractant protein-1 (MCP-1, and TBARS. We also examined retinas of diabetic and HMGB1 intravitreally injected rats. The effect of the HMGB1 inhibitor glycyrrhizin on diabetes-induced changes in retinal BDNF expressions was studied. Western blot, ELISA, and TBARS assays were used. BDNF was not detected in vitreous samples. BDNF levels were significantly lower in serum samples from diabetic patients compared with nondiabetics, whereas HMGB1, sRAGE, sICAM-1, and TBARS levels were significantly higher in diabetic serum samples. MCP-1 levels did not differ significantly. There was significant inverse correlation between serum levels of BDNF and HMGB1. Diabetes and intravitreal administration of HMGB1 induced significant upregulation of the expression of HMGB1, TBARS, and cleaved caspase-3, whereas the expression of BDNF and synaptophysin was significantly downregulated in rat retinas. Glycyrrhizin significantly attenuated diabetes-induced downregulation of BDNF. Our results suggest that HMGB1-induced downregulation of BDNF might be involved in pathogenesis of diabetic retinal neurodegeneration.

  12. Optimization of Paclitaxel Containing pH-Sensitive Liposomes By 3 Factor, 3 Level Box-Behnken Design.

    Science.gov (United States)

    Rane, Smita; Prabhakar, Bala

    2013-07-01

    The aim of this study was to investigate the combined influence of 3 independent variables in the preparation of paclitaxel containing pH-sensitive liposomes. A 3 factor, 3 levels Box-Behnken design was used to derive a second order polynomial equation and construct contour plots to predict responses. The independent variables selected were molar ratio phosphatidylcholine:diolylphosphatidylethanolamine (X1), molar concentration of cholesterylhemisuccinate (X2), and amount of drug (X3). Fifteen batches were prepared by thin film hydration method and evaluated for percent drug entrapment, vesicle size, and pH sensitivity. The transformed values of the independent variables and the percent drug entrapment were subjected to multiple regression to establish full model second order polynomial equation. F was calculated to confirm the omission of insignificant terms from the full model equation to derive a reduced model polynomial equation to predict the dependent variables. Contour plots were constructed to show the effects of X1, X2, and X3 on the percent drug entrapment. A model was validated for accurate prediction of the percent drug entrapment by performing checkpoint analysis. The computer optimization process and contour plots predicted the levels of independent variables X1, X2, and X3 (0.99, -0.06, 0, respectively), for maximized response of percent drug entrapment with constraints on vesicle size and pH sensitivity.

  13. The T-box transcription factors TBX2 and TBX3 in mammary gland development and breast cancer.

    Science.gov (United States)

    Douglas, Nataki C; Papaioannou, Virginia E

    2013-06-01

    TBX2 and TBX3, closely related members of the T-box family of transcription factor genes, are expressed in mammary tissue in both humans and mice. Ulnar mammary syndrome (UMS), an autosomal dominant disorder caused by mutations in TBX3, underscores the importance of TBX3 in human breast development, while abnormal mammary gland development in Tbx2 or Tbx3 mutant mice provides models for experimental investigation. In addition to their roles in mammary development, aberrant expression of TBX2 and TBX3 is associated with breast cancer. TBX2 is preferentially amplified in BRCA1/2-associated breast cancers and TBX3 overexpression has been associated with advanced stage disease and estrogen-receptor-positive breast tumors. The regulation of Tbx2 and Tbx3 and the downstream targets of these genes in development and disease are not as yet fully elucidated. However, it is clear that the two genes play unique, context-dependent roles both in mammary gland development and in mammary tumorigenesis.

  14. A new mode of DNA binding distinguishes Capicua from other HMG-box factors and explains its mutation patterns in cancer.

    Science.gov (United States)

    Forés, Marta; Simón-Carrasco, Lucía; Ajuria, Leiore; Samper, Núria; González-Crespo, Sergio; Drosten, Matthias; Barbacid, Mariano; Jiménez, Gerardo

    2017-03-01

    HMG-box proteins, including Sox/SRY (Sox) and TCF/LEF1 (TCF) family members, bind DNA via their HMG-box. This binding, however, is relatively weak and both Sox and TCF factors employ distinct mechanisms for enhancing their affinity and specificity for DNA. Here we report that Capicua (CIC), an HMG-box transcriptional repressor involved in Ras/MAPK signaling and cancer progression, employs an additional distinct mode of DNA binding that enables selective recognition of its targets. We find that, contrary to previous assumptions, the HMG-box of CIC does not bind DNA alone but instead requires a distant motif (referred to as C1) present at the C-terminus of all CIC proteins. The HMG-box and C1 domains are both necessary for binding specific TGAATGAA-like sites, do not function via dimerization, and are active in the absence of cofactors, suggesting that they form a bipartite structure for sequence-specific binding to DNA. We demonstrate that this binding mechanism operates throughout Drosophila development and in human cells, ensuring specific regulation of multiple CIC targets. It thus appears that HMG-box proteins generally depend on auxiliary DNA binding mechanisms for regulating their appropriate genomic targets, but that each sub-family has evolved unique strategies for this purpose. Finally, the key role of C1 in DNA binding also explains the fact that this domain is a hotspot for inactivating mutations in oligodendroglioma and other tumors, while being preserved in oncogenic CIC-DUX4 fusion chimeras associated to Ewing-like sarcomas.

  15. Dependence of Proximal GC Boxes and Binding Transcription Factors in the Regulation of Basal and Valproic Acid-Induced Expression of t-PA.

    Science.gov (United States)

    Ulfhammer, Erik; Larsson, Pia; Magnusson, Mia; Karlsson, Lena; Bergh, Niklas; Jern, Sverker

    2016-01-01

    Objective. Endothelial tissue-type plasminogen activator (t-PA) release is a pivotal response to protect the circulation from occluding thrombosis. We have shown that the t-PA gene is epigenetically regulated and greatly induced by the histone deacetylase (HDAC) inhibitor valproic acid (VPA). We now investigated involvement of known t-PA promoter regulatory elements and evaluated dependence of potential interacting transcription factors/cofactors. Methods. A reporter vector with an insert, separately mutated at either the t-PA promoter CRE or GC box II or GC box III elements, was transfected into HT-1080 and HUVECs and challenged with VPA. HUVECs were targeted with siRNA against histone acetyl transferases (HAT) and selected transcription factors from the Sp/KLF family. Results. An intact VPA-response was observed with CRE mutated constructs, whereas mutation of GC boxes II and III reduced the magnitude of the induction by 54 and 79% in HT-1080 and 49 and 50% in HUVECs, respectively. An attenuated induction of t-PA mRNA was observed after Sp2, Sp4, and KLF5 depletion. KLF2 and p300 (HAT) were identified as positive regulators of basal t-PA expression and Sp4 and KLF9 as repressors. Conclusion. VPA-induced t-PA expression is dependent on the proximal GC boxes in the t-PA promoter and may involve interactions with Sp2, Sp4, and KLF5.

  16. Glove boxes

    International Nuclear Information System (INIS)

    Eisert, G.A.

    1979-01-01

    An arrangement for effecting access for performing work within a glove box comprises an elongate arm-length impermeable flexible sleeve, a fitting having an aperture therethrough, adapted to be secured in sealing relation in a port, in a wall of the glove box, the fitting including an outwardly extending lip having at least one continuous groove extending around its outer periphery, one end of the sleeve extending through the aperture in fitting and being folded back against the outer periphery of the lip, a resilient fastening ring securing the sleeve in sealing engagement in the groove, clamping means securing the sleeves to the lip and a glove secured in sealing relation via a bushing to the other end of the sleeve. (author)

  17. [Rbf1 (RPG-box binding factor), a transcription factor involved in yeast-hyphal transition of Candida albicans].

    Science.gov (United States)

    Aoki, Y; Ishii, N; Watanabe, M; Yoshihara, F; Arisawa, M

    1998-01-01

    The major fungal pathogen for fungal diseases which have become a major medical problem in the last few years is Candida albicans, which can grow both in yeast and hyphae forms. This ability of C. albicans is thought to contribute to its colonization and dissemination within host tissues. In a recent few years, accompanying the introduction of molecular biological tools into C. albicans organism, several factors involved in the signal transduction pathway for yeast-hyphal transition have been identified. One MAP kinase pathway in C. albicans, similar to that leading to STE12 activation in Saccharomyces cerevisiae, has been reported. C. albicans strains mutant in these genes show retarded filamentous growth on a solid media but no impairment of filamentous growth in mice. These results suggest two scenarios that a kinase signaling cascade plays a part in stimulating the morphological transition in C. albicans, and that there would be another signaling pathway effective in animals. In this latter true hyphal pathway, although some candidate proteins, such as Efg1 (transcription factor), Int1 (integrin-like membrane protein), or Phr1 (pH-regulated membrane protein), have been identified, it is still too early to say that we understand the whole picture of that cascade. We have cloned a C. albicans gene encoding a novel DNA binding protein, Rbf1, that predominantly localizes in the nucleus, and shows transcriptional activation capability. Disruption of the functional RBF1 genes of C. albicans induced the filamentous growth on all solid and liquid media tested, suggesting that Rbf1 might be another candidate for the true hyphal pathway. Relationships with other factors described above, and the target (regulated) genes of Rbf1 is under investigation.

  18. Structure-function relationships in human testis-determining factor SRY: an aromatic buttress underlies the specific DNA-bending surface of a high mobility group (HMG) box.

    Science.gov (United States)

    Racca, Joseph D; Chen, Yen-Shan; Maloy, James D; Wickramasinghe, Nalinda; Phillips, Nelson B; Weiss, Michael A

    2014-11-21

    Human testis determination is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in SRY cause 46 XY gonadal dysgenesis with female somatic phenotype (Swyer syndrome) and confer a high risk of malignancy (gonadoblastoma). Such mutations cluster in the SRY high mobility group (HMG) box, a conserved motif of specific DNA binding and bending. To explore structure-function relationships, we constructed all possible substitutions at a site of clinical mutation (W70L). Our studies thus focused on a core aromatic residue (position 15 of the consensus HMG box) that is invariant among SRY-related HMG box transcription factors (the SOX family) and conserved as aromatic (Phe or Tyr) among other sequence-specific boxes. In a yeast one-hybrid system sensitive to specific SRY-DNA binding, the variant domains exhibited reduced (Phe and Tyr) or absent activity (the remaining 17 substitutions). Representative nonpolar variants with partial or absent activity (Tyr, Phe, Leu, and Ala in order of decreasing side-chain volume) were chosen for study in vitro and in mammalian cell culture. The clinical mutation (Leu) was found to markedly impair multiple biochemical and cellular activities as respectively probed through the following: (i) in vitro assays of specific DNA binding and protein stability, and (ii) cell culture-based assays of proteosomal degradation, nuclear import, enhancer DNA occupancy, and SRY-dependent transcriptional activation. Surprisingly, however, DNA bending is robust to this or the related Ala substitution that profoundly impairs box stability. Together, our findings demonstrate that the folding, trafficking, and gene-regulatory function of SRY requires an invariant aromatic "buttress" beneath its specific DNA-bending surface. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Neuronal expression of TATA box-binding protein containing expanded polyglutamine in knock-in mice reduces chaperone protein response by impairing the function of nuclear factor-Y transcription factor.

    Science.gov (United States)

    Huang, Shanshan; Ling, Joseph J; Yang, Su; Li, Xiao-Jiang; Li, Shihua

    2011-07-01

    The polyglutamine diseases consist of nine neurodegenerative disorders including spinocerebellar ataxia type 17 that is caused by a polyglutamine tract expansion in the TATA box-binding protein. In all polyglutamine diseases, polyglutamine-expanded proteins are ubiquitously expressed throughout the body but cause selective neurodegeneration. Understanding the specific effects of polyglutamine-expanded proteins, when expressed at the endogenous levels, in neurons is important for unravelling the pathogenesis of polyglutamine diseases. However, addressing this important issue using mouse models that either overly or ubiquitously express mutant polyglutamine proteins in the brain and body has proved difficult. To investigate the pathogenesis of spinocerebellar ataxia 17, we generated a conditional knock-in mouse model that expresses one copy of the mutant TATA box-binding protein gene, which encodes a 105-glutamine repeat, selectively in neuronal cells at the endogenous level. Neuronal expression of mutant TATA box-binding protein causes age-dependent neurological symptoms in mice and the degeneration of cerebellar Purkinje cells. Mutant TATA box-binding protein binds more tightly to the transcription factor nuclear factor-Y, inhibits its association with the chaperone protein promoter, as well as the promoter activity and reduces the expression of the chaperones Hsp70, Hsp25 and HspA5, and their response to stress. These findings demonstrate how mutant TATA box-binding protein at the endogenous level affects neuronal function, with important implications for the pathogenesis and treatment of polyglutamine diseases.

  20. Core promoter-specific gene regulation: TATA box selectivity and Initiator-dependent bi-directionality of serum response factor-activated transcription.

    Science.gov (United States)

    Xu, Muyu; Gonzalez-Hurtado, Elsie; Martinez, Ernest

    2016-04-01

    Gene-specific activation by enhancers involves their communication with the basal RNA polymerase II transcription machinery at the core promoter. Core promoters are diverse and may contain a variety of sequence elements such as the TATA box, the Initiator (INR), and the downstream promoter element (DPE) recognized, respectively, by the TATA-binding protein (TBP) and TBP-associated factors of the TFIID complex. Core promoter elements contribute to the gene selectivity of enhancers, and INR/DPE-specific enhancers and activators have been identified. Here, we identify a TATA box-selective activating sequence upstream of the human β-actin (ACTB) gene that mediates serum response factor (SRF)-induced transcription from TATA-dependent but not INR-dependent promoters and requires the TATA-binding/bending activity of TBP, which is otherwise dispensable for transcription from a TATA-less promoter. The SRF-dependent ACTB sequence is stereospecific on TATA promoters but activates in an orientation-independent manner a composite TATA/INR-containing promoter. More generally, we show that SRF-regulated genes of the actin/cytoskeleton/contractile family tend to have a TATA box. These results suggest distinct TATA-dependent and INR-dependent mechanisms of TFIID-mediated transcription in mammalian cells that are compatible with only certain stereospecific combinations of activators, and that a TBP-TATA binding mechanism is important for SRF activation of the actin/cytoskeleton-related gene family. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. FOXO Transcriptional Factors and Long-Term Living

    Directory of Open Access Journals (Sweden)

    Ghulam Murtaza

    2017-01-01

    Full Text Available Several pathologies such as neurodegeneration and cancer are associated with aging, which is affected by many genetic and environmental factors. Healthy aging conceives human longevity, possibly due to carrying the defensive genes. For instance, FOXO (forkhead box O genes determine human longevity. FOXO transcription factors are involved in the regulation of longevity phenomenon via insulin and insulin-like growth factor signaling. Only one FOXO gene (FOXO DAF-16 exists in invertebrates, while four FOXO genes, that is, FOXO1, FOXO3, FOXO4, and FOXO6 are found in mammals. These four transcription factors are involved in the multiple cellular pathways, which regulate growth, stress resistance, metabolism, cellular differentiation, and apoptosis in mammals. However, the accurate mode of longevity by FOXO factors is unclear until now. This article describes briefly the existing knowledge that is related to the role of FOXO factors in human longevity.

  2. Forkhead, a new cross regulator of metabolism and innate immunity downstream of TOR in Drosophila.

    Science.gov (United States)

    Varma, Disha; Bülow, Margret H; Pesch, Yanina-Yasmin; Loch, Gerrit; Hoch, Michael

    2014-10-01

    Antimicrobial peptides (AMPs) are conserved cationic peptides which act both as defense molecules of the host immune system and as regulators of the commensal microbiome. Expression of AMPs is induced in response to infection by the Toll and Imd pathway. Under non-infected conditions, the transcription factor dFOXO directly regulates a set of AMP expression at low levels when nutrients are limited. Here we have analyzed whether target of rapamycin (TOR), another major regulator of growth and metabolism, also modulates AMP responses in Drosophila. We found that downregulation of TOR by feeding the drug rapamycin or by overexpressing the negative TOR regulators TSC1/TSC2, resulted in a specific induction of the AMPs Diptericin (Dpt) and Metchnikowin (Mtk). In contrast, overexpression of Rheb, which positively regulates TOR led to a repression of the two AMPs. Genetic and pharmacological experiments indicate that Dpt and Mtk activation is controlled by the transcription factor Forkhead (FKH), the founding member of the FoxO family. Shuttling of FKH from the cytoplasm to the nucleus is induced in the fat body and in the posterior midgut in response to TOR downregulation. The FKH-dependent induction of Dpt and Mtk can be triggered in dFOXO null mutants and in immune-compromised Toll and IMD pathway mutants indicating that FKH acts in parallel to these regulators. Together, we have discovered that FKH is the second conserved member of the FoxO family cross-regulating metabolism and innate immunity. dFOXO and FKH, which are activated upon downregulation of insulin or TOR activities, respectively, act in parallel to induce different sets of AMPs, thereby modulating the immune status of metabolic tissues such as the fat body or the gut in response to the oscillating energy status of the organism. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Global MYCN transcription factor binding analysis in neuroblastoma reveals association with distinct E-box motifs and regions of DNA hypermethylation.

    LENUS (Irish Health Repository)

    Murphy, Derek M

    2009-01-01

    BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the

  4. A Novel Sucrose-Regulatory MADS-Box Transcription Factor GmNMHC5 Promotes Root Development and Nodulation in Soybean (Glycine max [L.] Merr.).

    Science.gov (United States)

    Liu, Wei; Han, Xiangdong; Zhan, Ge; Zhao, Zhenfang; Feng, Yongjun; Wu, Cunxiang

    2015-08-31

    The MADS-box protein family includes many transcription factors that have a conserved DNA-binding MADS-box domain. The proteins in this family were originally recognized to play prominent roles in floral development. Recent findings, especially with regard to the regulatory roles of the AGL17 subfamily in root development, have greatly broadened their known functions. In this study, a gene from soybean (Glycine max [L.] Merr.), GmNMHC5, was cloned from the Zigongdongdou cultivar and identified as a member of the AGL17 subfamily. Real-time fluorescence quantitative PCR analysis showed that GmNMHC5 was expressed at much higher levels in roots and nodules than in other organs. The activation of expression was first examined in leaves and roots, followed by shoot apexes. GmNMHC5 expression levels rose sharply when the plants were treated under short-day conditions (SD) and started to pod, whereas low levels were maintained in non-podding plants under long-day conditions (LD). Furthermore, overexpression of GmNMHC5 in transgenic soybean significantly promoted lateral root development and nodule building. Moreover, GmNMHC5 is upregulated by exogenous sucrose. These results indicate that GmNMHC5 can sense the sucrose signal and plays significant roles in lateral root development and nodule building.

  5. A Novel Sucrose-Regulatory MADS-Box Transcription Factor GmNMHC5 Promotes Root Development and Nodulation in Soybean (Glycine max [L.] Merr.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2015-08-01

    Full Text Available The MADS-box protein family includes many transcription factors that have a conserved DNA-binding MADS-box domain. The proteins in this family were originally recognized to play prominent roles in floral development. Recent findings, especially with regard to the regulatory roles of the AGL17 subfamily in root development, have greatly broadened their known functions. In this study, a gene from soybean (Glycine max [L.] Merr., GmNMHC5, was cloned from the Zigongdongdou cultivar and identified as a member of the AGL17 subfamily. Real-time fluorescence quantitative PCR analysis showed that GmNMHC5 was expressed at much higher levels in roots and nodules than in other organs. The activation of expression was first examined in leaves and roots, followed by shoot apexes. GmNMHC5 expression levels rose sharply when the plants were treated under short-day conditions (SD and started to pod, whereas low levels were maintained in non-podding plants under long-day conditions (LD. Furthermore, overexpression of GmNMHC5 in transgenic soybean significantly promoted lateral root development and nodule building. Moreover, GmNMHC5 is upregulated by exogenous sucrose. These results indicate that GmNMHC5 can sense the sucrose signal and plays significant roles in lateral root development and nodule building.

  6. Expression and Effects of High-Mobility Group Box 1 in Cervical Cancer

    Directory of Open Access Journals (Sweden)

    Xiaoao Pang

    2014-05-01

    Full Text Available We investigated the significance of high- mobility group box1 (HMGB1 and T-cell-mediated immunity and prognostic value in cervical cancer. HMGB1, forkhead/winged helix transcription factor p3 (Foxp3, IL-2, and IL-10 protein expression was analyzed in 100 cervical tissue samples including cervical cancer, cervical intraepithelial neoplasia (CIN, and healthy control samples using immunohistochemistry. Serum squamous cell carcinoma antigen (SCC-Ag was immunoradiometrically measured in 32 serum samples from 37 cases of squamous cervical cancer. HMGB1 and SCC-Ag were then correlated to clinicopathological characteristics. HMGB1 expression tends to increase as cervical cancer progresses and it was found to be significantly correlated to FIGO stage and lymph node metastasis. These findings suggest that HMGB1 may be a useful prognostic indicator of cervical carcinoma. In addition, there were significant positive relationships between HMGB1 and FOXP3 or IL-10 expression (both p < 0.05. In contrast, HMGB1 and IL-2 expression was negatively correlated (p < 0.05. HMGB1 expression may activate Tregs or facilitate Th2 polarization to promote immune evasion of cervical cancer. Elevated HMGB1 protein in cervical carcinoma samples was associated with a high recurrence of HPV infection in univariate analysis (p < 0.05. HMGB1 expression and levels of SCC-Ag were directly correlated in SCC (p < 0.05. Thus, HMGB1 may be a useful biomarker for patient prognosis and cervical cancer prediction and treatment.

  7. Differential utilization of TATA box-binding protein (TBP) and TBP-related factor 1 (TRF1) at different classes of RNA polymerase III promoters.

    Science.gov (United States)

    Verma, Neha; Hung, Ko-Hsuan; Kang, Jin Joo; Barakat, Nermeen H; Stumph, William E

    2013-09-20

    In the fruit fly Drosophila melanogaster, RNA polymerase III transcription was found to be dependent not upon the canonical TATA box-binding protein (TBP) but instead upon the TBP-related factor 1 (TRF1) (Takada, S., Lis, J. T., Zhou, S., and Tjian, R. (2000) Cell 101, 459-469). Here we confirm that transcription of fly tRNA genes requires TRF1. However, we unexpectedly find that U6 snRNA gene promoters are occupied primarily by TBP in cells and that knockdown of TBP, but not TRF1, inhibits U6 transcription in cells. Moreover, U6 transcription in vitro effectively utilizes TBP, whereas TBP cannot substitute for TRF1 to promote tRNA transcription in vitro. Thus, in fruit flies, different classes of RNA polymerase III promoters differentially utilize TBP and TRF1 for the initiation of transcription.

  8. Identifying competencies of boxing coaches

    Directory of Open Access Journals (Sweden)

    Ioannis Tasiopoulos

    2014-10-01

    Full Text Available The purpose of this study was to find out the management skills required by boxing coaches to administrate their clubs. For the purposes of this study a scale was constructed which was answered by 98 boxing coaches. Explanatory factor analysis revealed seven factors: Communication-public relations (5 items, event management (4 items, management techniques (4 items, new technologies (4 items, prevention-safety (2 items, sport (5 items and sports facilities (2 items. The Cronbach of the scale was 0.85. The five competencies that rated by the coaches were: Supervisors of the area of training, maintaining excellent communication with athletes, using new technologies (e-mail, internet, handling disciplinary matters, accidents, complaints and reports on some sporting games and promoted harmony among athletes. We concluded that boxing coaches understand that the competencies required for meeting their obligations, were related to sports, prevention, safety and communications-public relations.

  9. Laryngeal (Voice Box) Cancer

    Science.gov (United States)

    ... ENTCareers Marketplace Find an ENT Doctor Near You Voice Box (Laryngeal) Cancer Voice Box (Laryngeal) Cancer Patient Health Information News media ... laryngeal cancer can be severe with respect to voice, breathing, or swallowing. It is fundamentally a preventable ...

  10. The EH1 motif in metazoan transcription factors

    Directory of Open Access Journals (Sweden)

    Copley Richard R

    2005-11-01

    Full Text Available Abstract Background The Engrailed Homology 1 (EH1 motif is a small region, believed to have evolved convergently in homeobox and forkhead containing proteins, that interacts with the Drosophila protein groucho (C. elegans unc-37, Human Transducin-like Enhancers of Split. The small size of the motif makes its reliable identification by computational means difficult. I have systematically searched the predicted proteomes of Drosophila, C. elegans and human for further instances of the motif. Results Using motif identification methods and database searching techniques, I delimit which homeobox and forkhead domain containing proteins also have likely EH1 motifs. I show that despite low database search scores, there is a significant association of the motif with transcription factor function. I further show that likely EH1 motifs are found in combination with T-Box, Zinc Finger and Doublesex domains as well as discussing other plausible candidate associations. I identify strong candidate EH1 motifs in basal metazoan phyla. Conclusion Candidate EH1 motifs exist in combination with a variety of transcription factor domains, suggesting that these proteins have repressor functions. The distribution of the EH1 motif is suggestive of convergent evolution, although in many cases, the motif has been conserved throughout bilaterian orthologs. Groucho mediated repression was established prior to the evolution of bilateria.

  11. Y-box Binding Protein-1 Enhances Oncogenic Transforming Growth Factor β Signaling in Breast Cancer Cells via Triggering Phospho-Activation of Smad2.

    Science.gov (United States)

    Stope, Matthias B; Weiss, Martin; Koensgen, Dominique; Popp, Simone L; Joffroy, Christian; Mustea, Alexander; Buck, Miriam B; Knabbe, Cornelius

    2017-12-01

    Transforming growth factor β (TGFβ) plays a role in diverse oncogenic pathways including cell proliferation and cell motility and is regulated by the pleiotropic factor Y-box binding protein-1 (YB-1). In breast cancer, Sma/Mad related protein 2 (Smad2) represents the most common downstream transducer in TGFβ signaling. Here, YB-1's impact on Smad2 phospho-activation was characterized by incubation of the breast cancer cell line MCF-7 with or without TGFβ1 in the absence or presence of overexpressed YB-1 protein. The phospho-status of Smad2 was assessed via western blotting. Analysis of MCF-7 cells revealed no induction of total Smad2 neither in the presence of TGFβ1, nor during YB-1 overexpression. In contrast, incubation with TGFβ1 led to an increase of phosphorylated Smad2 forms which was significantly amplified by simultaneously overexpressed YB-1 (2.8±0.2-fold). Oncogenic YB-1 indirectly enhances TGFβ signaling cascades via Smad2 phospho-activation and may represent a promising factor for future diagnosis and therapy of breast cancer. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  12. Outside the box

    International Nuclear Information System (INIS)

    Pichon, Max

    2011-01-01

    be used independently or coupled in parallel. “As a rough guide, a small system costs from $100,000 all the way to the large system at roughly $2 million, providing multiple capabilities, depending on The Grey Box purchased,” said Balemi. The modular capacity reduces costs and makes maintenance easier. It also improves reliability since all engineering is replicable and quality control can be undertaken on the factory floor before shipping. Hydrasyst also provides online monitoring and maintenance support through its Brisbane-based command centre. The company is one of only two suppliers of greywater treatment technology to be granted Chief Executive Approval by the Queensland Government, meaning it can be used incommercial buildings. The company hopes the associated credibility will provide a competitive advantage. Hydrasyst also has ambitions for The Grey Box in the mining industry, where the ability of mines to discharge the excess water they produce to surrounding land is a limiting development factor. As a result, Hydrasyst has begun receiving enquiries from mining companies to provide units for large-scale on-site treatment of acid mine drainage, which if successful would allow them to reuse the treated water. More information at hydrasyst.com

  13. Shaping 3-D boxes

    DEFF Research Database (Denmark)

    Stenholt, Rasmus; Madsen, Claus B.

    2011-01-01

    Enabling users to shape 3-D boxes in immersive virtual environments is a non-trivial problem. In this paper, a new family of techniques for creating rectangular boxes of arbitrary position, orientation, and size is presented and evaluated. These new techniques are based solely on position data......F) docking experiment against an existing technique, which requires the user to perform the rotation and scaling of the box explicitly. The precision of the users' box construction is evaluated by a novel error metric measuring the difference between two boxes. The results of the experiment strongly indicate...

  14. The Box Turtle: Room with a View on Species Decline.

    Science.gov (United States)

    Belzer, Bill; Steisslinger, Mary Beth

    1999-01-01

    Surveys salient aspects of eastern box-turtle natural history. Explores the societal and ecological factors that have contributed to the decline of the box-turtle population. Contains 18 references. (WRM)

  15. Cell differentiation by interaction of two HMG-box proteins: Mat1-Mc activates M cell-specific genes in S.pombe by recruiting the ubiquitous transcription factor Ste11 to weak binding sites

    DEFF Research Database (Denmark)

    Kjaerulff, S; Dooijes, D; Clevers, H

    1997-01-01

    The Schizosaccharomyces pombe mfm1 gene is expressed in an M cell-specific fashion. This regulation requires two HMG-box proteins: the ubiquitous Ste11 transcription factor and the M cell-controlling protein Mat1-Mc. Here we report that the mfm1 promoter contains a single, weak Stell-binding site...... of a complex containing both Ste11 and Mat1-Mc. A single copy of this fragment was sufficient to activate a heterologous promoter in an M-specific fashion, suggesting that these two boxes act in a synergistic manner....

  16. Perinatal and lifestyle factors mediate the association between maternal education and preschool children's weight status: the ToyBox study.

    Science.gov (United States)

    Androutsos, Odysseas; Moschonis, George; Ierodiakonou, Despo; Karatzi, Kalliopi; De Bourdeaudhuij, Ilse; Iotova, Violeta; Zych, Kamila; Moreno, Luis A; Koletzko, Berthold; Manios, Yannis

    2018-04-01

    This study aimed to explore the associations among perinatal, sociodemographic, and behavioral factors and preschool overweight/obesity. Data were collected from 7541 European preschoolers in May/June 2012. Children's anthropometrics were measured, and parents self-reported all other data via questionnaires. Level of statistical significance was set at P ≤ 0.05. Certain perinatal factors (i.e., maternal prepregnancy overweight/obesity, maternal excess gestational weight gain, excess birth weight, and "rapid growth velocity"), children's energy balance-related behaviors (i.e., high sugar-sweetened beverage consumption, increased screen time, reduced active-play time), family sociodemographic characteristics (i.e., Eastern or Southern Europe, low maternal and paternal education), and parental overweight/obesity were identified as correlates of preschoolers' overweight/obesity. Furthermore, maternal prepregnancy overweight/obesity, children's "rapid growth velocity," and increased screen time mediated by 21.2%, 12.5%, and 5.7%, respectively, the association between maternal education and preschoolers' body mass index. This study highlighted positive associations of preschooler's overweight/obesity with excess maternal prepregnancy and gestational weight gain, excess birth weight and "rapid growth velocity," Southern or Eastern European region, and parental overweight/obesity. Moreover, maternal prepregnancy overweight/obesity, children's "rapid growth velocity," and increased screen time partially mediated the association between maternal education and preschoolers' body mass index. The findings of the present study may support childhood obesity prevention initiatives, because vulnerable population groups and most specifically low-educated families should be prioritized. Among other fields, these intervention initiatives should also focus on the importance of normal prepregnancy maternal weight status, normal growth velocity during infancy, and retaining

  17. Expression of SRY-related HMG Box Transcription Factors (Sox) 2 and 9 in Craniopharyngioma Subtypes and Surrounding Brain Tissue.

    Science.gov (United States)

    Thimsen, Vivian; John, Nora; Buchfelder, Michael; Flitsch, Jörg; Fahlbusch, Rudolf; Stefanits, Harald; Knosp, Engelbert; Losa, Marco; Buslei, Rolf; Hölsken, Annett

    2017-11-20

    Stem cells have been discovered as key players in the genesis of different neoplasms including craniopharyngioma (CP), a rare tumour entity in the sellar region. Sox2 and Sox9 are well-known stem cell markers involved in pituitary development. In this study we analysed the expression of both transcription factors using immunohistochemistry in a large cohort of 64 adamantinomatous (aCP) and 9 papillary CP (pCP) and quantitative PCR in 26 aCP and 7 pCP. Whereas immunohistochemically Sox2+ cells were verifiable in only five aCP (7.8%) and in 39.1% of the respective surrounding cerebral tissue, pCP specimens appeared always negative. In contrast, Sox9 was detectable in all tumours with a significantly higher expression in aCP compared to pCP (protein, p < 0.0001; mRNA p = 0.0484) This was also true for the respective tumour adjacent CNS where 63 aCP (98.4%) and six pCP (66.7%) showed Sox9+ cells. We further confirmed absence of Sox9 expression in nuclear β-catenin accumulating cells of aCP. Our results point to the conclusion that Sox2 and Sox9, seem to play essential roles not only in the specific formation of aCP, but also in processes involving the cerebral tumour environment, which needs to be illuminated in the future.

  18. The HMG-box transcription factor Sox4b is required for pituitary expression of gata2a and specification of thyrotrope and gonadotrope cells in zebrafish.

    Science.gov (United States)

    Quiroz, Yobhana; Lopez, Mauricio; Mavropoulos, Anastasia; Motte, Patrick; Martial, Joseph A; Hammerschmidt, Matthias; Muller, Marc

    2012-06-01

    The pituitary is a complex gland comprising different cell types each secreting specific hormones. The extensive network of signaling molecules and transcription factors required for determination and terminal differentiation of specific cell types is still not fully understood. The SRY-like HMG-box (SOX) transcription factor Sox4 plays important roles in many developmental processes and has two homologs in zebrafish, Sox4a and Sox4b. We show that the sox4b gene is expressed in the pituitary anlagen starting at 24 h after fertilization (hpf) and later in the entire head region including the pituitary. At 48 hpf, sox4b mRNA colocalizes with that for TSH (tshβ), glycoprotein subunit α (gsuα), and the Zn finger transcription factor Gata2a. Loss of Sox4b function, using morpholino knockdown or expression of a dominant-negative Sox4 mutant, leads to a drastic decrease in tshβ and gsuα expression and reduced levels of gh, whereas other anterior pituitary gland markers including prl, slβ, pomc, and lim3 are not affected. Sox4b is also required for expression of gata2a in the pituitary. Knockdown of gata2a leads to decreased tshβ and gsuα expression at 48 hpf, similar to sox4b morphants. Injection of gata2a mRNA into sox4b morphants rescued tshβ and gsuα expression in thyrotrope cells. Finally, sox4b or gata2a knockdown causes a significant decrease of gonadotropin expression (lhβ and fshβ) at 4 d after fertilization. In summary, our results indicate that Sox4b is expressed in zebrafish during pituitary development and plays a crucial role in the differentiation of thyrotrope and gonadotrope cells through induction of gata2a expression in the developing pituitary.

  19. Downregulation of NFAT3 Due to Lack of T-Box Transcription Factor TBX5 Is Crucial for Cytokine Expression in T Cells.

    Science.gov (United States)

    Kaminuma, Osamu; Kitamura, Noriko; Nishito, Yasumasa; Nemoto, Soichi; Tatsumi, Hideki; Mori, Akio; Hiroi, Takachika

    2018-01-01

    The NFAT family transcription factors play crucial roles in immunological and other biological activities. NFAT3 is rarely expressed in T cells, and the mechanisms and significance of the specific NFAT3 downregulation in T cells have been unknown. In human CD4 + T cells, overexpression of NFAT1 and NFAT3 enhanced and suppressed IL-2 expression, respectively. NFAT3 downregulation in Jurkat cells using RNA interference technology augmented IL-2 expression, whereas a knockdown of NFAT1, NFAT2, and NFAT4 suppressed it. The promoter/enhancer activity of the NFAT-binding site in the IL-2 gene was upregulated and downregulated by NFAT1 and NFAT3, respectively. A study employing NFAT1/NFAT3 chimeric molecules revealed that the region in NFAT3 responsible for NFAT promoter activity inhibition was located within its N-terminal transactivation domain, Ca 2+ -regulatory domain, and DNA-binding domain. Downregulation of NFAT3 expression in T cells is mediated by lower chromatin accessibility and enhancer activity in its promoter in comparison with aortic smooth muscle cells expressing endogenous NFAT3. The binding sites of T-box transcription factor TBX5 and NK-2 transcription factor-related locus 5 Nkx2.5, which were expressed at higher levels in aortic smooth muscle cells than in T cells, were located within the -387 to +97 NFAT3 promoter region, exhibiting the maximum enhancer activity. Mutating the binding site of TBX5 but not Nkx2.5 diminished the NFAT3 promoter activity, whereas the overexpression of TBX5 enhanced it. Introduction of TBX5 into CD4 + T cells enhanced the expression of NFAT3 and suppressed that of IL-2. TBX5 deficiency-mediated downregulation of NFAT3 is crucial for the high cytokine-producing activity of T cells. Copyright © 2017 by The American Association of Immunologists, Inc.

  20. Formulation and optimization of niosomes for topical diacerein delivery using 3-factor, 3-level Box-Behnken design for the management of psoriasis.

    Science.gov (United States)

    Moghddam, Seyedeh Raziyeh Mahdavi; Ahad, Abdul; Aqil, Mohd; Imam, Syed Sarim; Sultana, Yasmin

    2016-12-01

    This research aimed towards the design of preparations of diacerein loaded cholesterol rich niosomes by employing a 3-factor, 3-level Box-Behnken design. Results indicated that Span 60 (90mg) and cholesterol (10mg), and 45min of hydration time were found to be optimum for niosomes preparation. The prepared cholesterol rich niosomes were uniform and spherical in size. Optimized formulation F2 entrapped the drug with 83.02% efficiency in the cholesterol rich niosomes of the size 477.8nm, presented the flux of 2.820μg/cm(2)/h, followed Higuchi model and non Fickian transport mechanism. The confocal laser scanning microscopy showed that niosomes accentuated the penetration of diacerein in the epidermal and dermal layer of rat skin. Stability study confirmed that cholesterol rich niosomes were stable for 2months at 4°C. Concisely, the results showed that targeted diacerein delivery might be achieved using topically applied niosomes for enhanced treatment of psoriasis, which might eliminate adverse side effects associated with systemic exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. The Entamoeba histolytica TBP and TRF1 transcription factors are GAAC-box binding proteins, which display differential gene expression under different stress stimuli and during the interaction with mammalian cells.

    Science.gov (United States)

    Narayanasamy, Ravi Kumar; Castañón-Sanchez, Carlos Alberto; Luna-Arias, Juan Pedro; García-Rivera, Guillermina; Avendaño-Borromeo, Bartolo; Labra-Barrios, María Luisa; Valdés, Jesús; Herrera-Aguirre, María Esther; Orozco, Esther

    2018-03-07

    Entamoeba histolytica is the protozoan parasite responsible for human amebiasis. It causes up to 100,000 deaths worldwide each year. This parasite has two closely related basal transcription factors, the TATA-box binding protein (EhTBP) and the TBP-related factor 1 (EhTRF1). TBP binds to the canonical TATTTAAA-box, as well as to different TATA variants. TRF1 also binds to the TATTTAAA-box. However, their binding capacity to diverse core promoter elements, including the GAAC-element, and their role in gene regulation in this parasite remains unknown. EMSA experiments were performed to determine the binding capacity of recombinant TBP and TRF1 to TATA variants, GAAC and GAAC-like boxes. For the functional analysis under different stress stimuli (e.g. growth curve, serum depletion, heat-shock, and UV-irradiation) and during the interaction with mammalian cells (erythrocytes, MDCK cell monolayers, and hepatocytes of hamsters), RT-qPCR, and gene knockdown were performed. Both transcription factors bound to the different TATA variants tested, as well as to the GAAC-boxes, suggesting that they are GAAC-box-binding proteins. The K D values determined for TBP and TRF1 for the different TATA variants and GAAC-box were in the range of 10 -12  M to 10 -11  M. During the death phase of growth or in serum depletion, Ehtbp mRNA levels significantly increased, whereas the mRNA level of Ehtrf1 did not change under these conditions. Ehtrf1 gene expression was negatively regulated by UV-irradiation and heat-shock stress, with no changes in Ehtbp gene expression. Moreover, Ehtrf1 gene also showed a negative regulation during erythrophagocytosis, liver abscess formation, and a transient expression level increase at the initial phase of MDCK cell destruction. Finally, the Ehtbp gene knockdown displayed a drastic decrease in the efficiency of erythrophagocytosis in G3 trophozoites. To our knowledge, this study reveals that these basal transcription factors are able to bind multiple

  2. The ubiquitin-conjugating enzyme, Ubc1, indirectly regulates SNF1 kinase activity via Forkhead-dependent transcription

    Directory of Open Access Journals (Sweden)

    Rubin Jiao

    2016-11-01

    Full Text Available The SNF1 kinase in Saccharomyces cerevisiae is an excellent model to study the regulation and function of the AMP-dependent protein kinase (AMPK family of serine-threonine protein kinases. Yeast discoveries regarding the regulation of this non-hormonal sensor of metabolic/environmental stress are conserved in higher eukaryotes, including poly-ubiquitination of the α-subunit of yeast (Snf1 and human (AMPKα that ultimately effects subunit stability and enzyme activity. The ubiquitin-cascade enzymes responsible for targeting Snf1 remain unknown, leading us to screen for those that impact SNF1 kinase function. We identified the E2, Ubc1, as a regulator of SNF1 kinase function. The decreased Snf1 abundance found upon deletion of Ubc1 is not due to increased degradation, but instead is partly due to impaired SNF1 gene expression, arising from diminished abundance of the Forkhead 1/2 proteins, previously shown to contribute to SNF1 transcription. Ultimately, we report that the Fkh1/2 cognate transcription factor, Hcm1, fails to enter the nucleus in the absence of Ubc1. This implies that Ubc1 acts indirectly through transcriptional effects to modulate SNF1 kinase activity.

  3. Thinking outside the Box

    Science.gov (United States)

    Fanshawe, Simon; Sriskandarajah, Dhananjayan

    2010-01-01

    Britain is not only more diverse than ever before, but that diversity itself is growing more diverse. Britain's simplistic "tick-box" approach to identity is in danger of inhibiting the very equality it seeks to promote. To question the tick-box is not to accuse local authorities of "political correctness gone mad". The notion…

  4. ALUMINUM BOX BUNDLING PRESS

    Directory of Open Access Journals (Sweden)

    Iosif DUMITRESCU

    2015-05-01

    Full Text Available In municipal solid waste, aluminum is the main nonferrous metal, approximately 80- 85% of the total nonferrous metals. The income per ton gained from aluminum recuperation is 20 times higher than from glass, steel boxes or paper recuperation. The object of this paper is the design of a 300 kN press for aluminum box bundling.

  5. The T box transcription factor TBX2 promotes epithelial-mesenchymal transition and invasion of normal and malignant breast epithelial cells.

    Science.gov (United States)

    Wang, Bin; Lindley, Linsey E; Fernandez-Vega, Virneliz; Rieger, Megan E; Sims, Andrew H; Briegel, Karoline J

    2012-01-01

    The T box transcription factor TBX2, a master regulator of organogenesis, is aberrantly amplified in aggressive human epithelial cancers. While it has been shown that overexpression of TBX2 can bypass senescence, a failsafe mechanism against cancer, its potential role in tumor invasion has remained obscure. Here we demonstrate that TBX2 is a strong cell-autonomous inducer of the epithelial-mesenchymal transition (EMT), a latent morphogenetic program that is key to tumor progression from noninvasive to invasive malignant states. Ectopic expression of TBX2 in normal HC11 and MCF10A mammary epithelial cells was sufficient to induce morphological, molecular, and behavioral changes characteristic of EMT. These changes included loss of epithelial adhesion and polarity gene (E-cadherin, ß-catenin, ZO1) expression, and abnormal gain of mesenchymal markers (N-cadherin, Vimentin), as well as increased cell motility and invasion. Conversely, abrogation of endogenous TBX2 overexpression in the malignant human breast carcinoma cell lines MDA-MB-435 and MDA-MB-157 led to a restitution of epithelial characteristics with reciprocal loss of mesenchymal markers. Importantly, TBX2 inhibition abolished tumor cell invasion and the capacity to form lung metastases in a Xenograft mouse model. Meta-analysis of gene expression in over one thousand primary human breast tumors further showed that high TBX2 expression was significantly associated with reduced metastasis-free survival in patients, and with tumor subtypes enriched in EMT gene signatures, consistent with a role of TBX2 in oncogenic EMT. ChIP analysis and cell-based reporter assays further revealed that TBX2 directly represses transcription of E-cadherin, a tumor suppressor gene, whose loss is crucial for malignant tumor progression. Collectively, our results uncover an unanticipated link between TBX2 deregulation in cancer and the acquisition of EMT and invasive features of epithelial tumor cells.

  6. The T box transcription factor TBX2 promotes epithelial-mesenchymal transition and invasion of normal and malignant breast epithelial cells.

    Directory of Open Access Journals (Sweden)

    Bin Wang

    Full Text Available The T box transcription factor TBX2, a master regulator of organogenesis, is aberrantly amplified in aggressive human epithelial cancers. While it has been shown that overexpression of TBX2 can bypass senescence, a failsafe mechanism against cancer, its potential role in tumor invasion has remained obscure. Here we demonstrate that TBX2 is a strong cell-autonomous inducer of the epithelial-mesenchymal transition (EMT, a latent morphogenetic program that is key to tumor progression from noninvasive to invasive malignant states. Ectopic expression of TBX2 in normal HC11 and MCF10A mammary epithelial cells was sufficient to induce morphological, molecular, and behavioral changes characteristic of EMT. These changes included loss of epithelial adhesion and polarity gene (E-cadherin, ß-catenin, ZO1 expression, and abnormal gain of mesenchymal markers (N-cadherin, Vimentin, as well as increased cell motility and invasion. Conversely, abrogation of endogenous TBX2 overexpression in the malignant human breast carcinoma cell lines MDA-MB-435 and MDA-MB-157 led to a restitution of epithelial characteristics with reciprocal loss of mesenchymal markers. Importantly, TBX2 inhibition abolished tumor cell invasion and the capacity to form lung metastases in a Xenograft mouse model. Meta-analysis of gene expression in over one thousand primary human breast tumors further showed that high TBX2 expression was significantly associated with reduced metastasis-free survival in patients, and with tumor subtypes enriched in EMT gene signatures, consistent with a role of TBX2 in oncogenic EMT. ChIP analysis and cell-based reporter assays further revealed that TBX2 directly represses transcription of E-cadherin, a tumor suppressor gene, whose loss is crucial for malignant tumor progression. Collectively, our results uncover an unanticipated link between TBX2 deregulation in cancer and the acquisition of EMT and invasive features of epithelial tumor cells.

  7. Switchgrass SBP-box transcription factors PvSPL1 and 2 function redundantly to initiate side tillers and affect biomass yield of energy crop.

    Science.gov (United States)

    Wu, Zhenying; Cao, Yingping; Yang, Ruijuan; Qi, Tianxiong; Hang, Yuqing; Lin, Hao; Zhou, Gongke; Wang, Zeng-Yu; Fu, Chunxiang

    2016-01-01

    Switchgrass (Panicum virgatum L.) is a dedicated lignocellulosic feedstock for bioenergy production. The SQUAMOSA PROMOTER-BINDING PROTEIN (SBP-box)-LIKE transcription factors (SPLs) change plant architecture and vegetative-to-reproductive phase transition significantly, and as such, they are promising candidates for genetic improvement of switchgrass biomass yield. However, the genome-wide identification and functional characterization of SPL genes have yet to be investigated in herbaceous energy crops. We identified 35 full-length SPL genes in the switchgrass genome. The phylogenetic relationship and expression pattern of PvSPLs provided baseline information for their function characterization. Based on the global overview of PvSPLs, we explored the biological function of miR156-targeted PvSPL1 and PvSPL2, which are closely related members of SPL family in switchgrass. Our results showed that PvSPL1 and PvSPL2 acted redundantly to modulate side tiller initiation, whereas they did not affect phase transition and internode initiation. Consistently, overexpression of the miR156-resistant rPvSPL2 in the miR156-overexpressing transgenic plants greatly reduced tiller initiation, but did not rescue the delayed flowering and increased internode numbers. Furthermore, suppression of PvSPL2 activity in switchgrass increased biomass yield and reduced lignin accumulation, which thereby elevated the total amount of solubilized sugars. Our results indicate that different miR156-targeted PvSPL subfamily genes function predominantly in certain biological processes in switchgrass. We suggest that PvSPL2 and its paralogs can be utilized as the valuable targets in molecular breeding of energy crops for developing novel germplasms with high biofuel production.

  8. Evaluation of zinc finger E-box binding homeobox 1 and transforming growth factor-beta2 expression in bladder cancer tissue in comparison with healthy adjacent tissue

    Directory of Open Access Journals (Sweden)

    Ali Mahdavinezhad

    2017-03-01

    Full Text Available Purpose: The fifth most common cancer is allocated to bladder cancer (BC worldwide. Understanding the molecular mechanisms of BC invasion and metastasis to identify target therapeutic strategies will improve disease survival. So the aim of this study was to measure expression rate of zinc finger E-box binding homeobox 1 (ZEB1 and transforming growth factor-beta2 (TGF-β2 mRNA in tissue samples of patients with BC and its healthy adjacent tissue samples and their association with muscle invasion, size and grade of the tumor. Materials and Methods: Tissue samples were collected from 35 newly diagnosed untreated patients with BC from 2013 to 2014. Total RNA was extracted from about 50-mg tissue samples using TRIzol reagent. TAKARA SYBR Premix EX Tag II was applied to determine the rate of mRNA expression by real-time polymerase chain reaction (PCR. To obtain final validation, PCR product of ZEB1 and TGF-β2 were sequenced. STATA 11 software was used to analyze the data. Results: The expression level of ZEB1 in tumor samples was significantly more than of in healthy adjacent tissue samples. Up-regulation of TGF-β2 showed a strong association with muscle invasion (p=0.017. There was also demonstrated a relationship between over expression of ZEB1 with the tumor size (p=0.050. Conclusions: It looks ZEB1 and TGF-β2 had a role in BC patients. In this study ZEB1 expression was higher in BC tissues than that of in healthy control tissues. There was demonstrated a markedly association between overexpression of TGF-β2 and muscle invasion. Therefore, they are supposed to be candidate as potential biomarkers for early detection and progression of BC.

  9. Expression of T-box transcription factors 2, 4 and 5 is decreased in the branching airway mesenchyme of nitrofen-induced hypoplastic lungs.

    Science.gov (United States)

    Takahashi, Toshiaki; Friedmacher, Florian; Zimmer, Julia; Puri, Prem

    2017-02-01

    Pulmonary hypoplasia (PH), characterized by smaller lung size and reduced airway branching, remains a major therapeutic challenge in newborns with congenital diaphragmatic hernia (CDH). T-box transcription factors (Tbx) have been identified as key components of the gene network that regulates fetal lung development. Tbx2, Tbx4 and Tbx5 are expressed throughout the mesenchyme of the developing lung, regulating the process of lung branching morphogenesis. Furthermore, lungs of Tbx2-, Tbx4- and Tbx5-deficient mice are hypoplastic and exhibit decreased lung branching, similar to PH in human CDH. We hypothesized that the expression of Tbx2, Tbx4 and Tbx5 is decreased in the branching airway mesenchyme of hypoplastic rat lungs with nitrofen-induced CDH. Time-mated rats received either nitrofen or vehicle on gestational day 9 (D9). Fetuses were killed on D15, D18 and D21, and dissected lungs were divided into control and nitrofen-exposed specimens. Pulmonary gene expression of Tbx2, Tbx4 and Tbx5 was investigated by quantitative real-time polymerase chain reaction. Immunofluorescence double staining for Tbx2, Tbx4 and Tbx5 was combined with the mesenchymal marker Fgf10 to assess protein expression and localization in branching airway tissue. Relative mRNA levels of Tbx2, Tbx4 and Tbx5 were significantly reduced in lungs of nitrofen-exposed fetuses on D15, D18 and D21 compared to controls. Confocal laser scanning microscopy showed markedly diminished immunofluorescence of Tbx2, Tbx4 and Tbx5 in mesenchymal cells surrounding branching airways of nitrofen-exposed fetuses on D15, D18 and D21 compared to controls. Decreased expression of Tbx2, Tbx4 and Tbx5 in the pulmonary mesenchyme during fetal lung development may lead to a decrease or arrest of airway branching, thus contributing to PH in the nitrofen-induced CDH model.

  10. Digital gene expression analysis of male and female bud transition in Metasequoia reveals high activity of MADS-box transcription factors and hormone-mediated sugar pathways

    Directory of Open Access Journals (Sweden)

    Ying eZhao

    2015-06-01

    Full Text Available Metasequoiaglyptostroboidies is a famous redwood tree of ecological and economic importance, and requires more than 20 years of juvenile-to-adult transition before producing female and male cones. Previously, we induced reproductive buds using a hormone solution in juvenile Metasequoia trees as young as5-to-7years old. In the current study, hormone-treated shoots found in female and male buds were used to identify candidate genes involved in reproductive bud transition in Metasequoia. Samples from hormone-treated cone reproductive shoots and naturally occurring non-cone setting shoots were analyzed using 24 digital gene expression (DGE tag profiles using Illumina, generating a total of 69,520 putative transcripts. Next, 32 differentially and specifically expressed transcripts were determined using quantitative real-time polymerase chain reaction, including the upregulation of MADS-box transcription factors involved in male bud transition and flowering time control proteins involved in female bud transition. These differentially expressed transcripts were associated with 243 KEGG pathways. Among the significantly changed pathways, sugar pathways were mediated by hormone signals during the vegetative-to-reproductive phase transition, including glycolysis/gluconeogenesis and sucrose and starch metabolism pathways. Key enzymes were identified in these pathways, including alcohol dehydrogenase (NAD and glutathione dehydrogenase for the glycolysis/gluconeogenesis pathway, and glucanphosphorylase for sucrose and starch metabolism pathways. Our results increase our understanding of the reproductive bud transition in gymnosperms. In addition, these studies on hormone-mediated sugar pathways increase our understanding of the relationship between sugar and hormone signaling during female and male bud initiation in Metasequoia.

  11. Glove box shield

    Science.gov (United States)

    Brackenbush, L.W.; Hoenes, G.R.

    A shield for a glove box housing radioactive material is comprised of spaced apart clamping members which maintain three overlapping flaps in place therebetween. There is a central flap and two side flaps, the side flaps overlapping at the interior edges thereof and the central flap extending past the intersection of the side flaps in order to insure that the shield is always closed when the user wthdraws his hand from the glove box. Lead loaded neoprene rubber is the preferred material for the three flaps, the extent of lead loading depending upon the radiation levels within the glove box.

  12. Voice box (image)

    Science.gov (United States)

    The larynx, or voice box, is located in the neck and performs several important functions in the body. The larynx is involved in swallowing, breathing, and voice production. Sound is produced when the air which ...

  13. The POWHEG-BOX

    OpenAIRE

    Oleari, Carlo

    2010-01-01

    We review the key features of POWHEG, a method for interfacing parton-shower Monte Carlo generators to fixed next-to-leading order QCD computations. We describe a recently introduced framework, the POWHEG-BOX, that allows the automatic POWHEG implementation of any given NLO calculation. We present a few results for Higgs boson production via vector boson fusion and Z + 1 jet production, both processes available in the POWHEG-BOX.

  14. Boxes and Shelves

    OpenAIRE

    Hughes, Dean

    2008-01-01

    The Boxes and Shelves series from 2008 are are all made from the backing card from discarded writing pads. Boxes and Shelves extended my investigation of quotidian materials and their relationship to the origins of creative toil. Since 1996 my research has sought to identify and locate instances where the 'unmeasurable' meets the measurable. I have consistently employed a range of utilitarian materials such as bus seats, bus tickets, puddles, A4 writing paper, to present a series of 'problem ...

  15. The promoter for intestinal cell kinase is head-to-head with F-Box 9 and contains functional sites for TCF7L2 and FOXA factors

    Directory of Open Access Journals (Sweden)

    Cohn Steven M

    2010-05-01

    Full Text Available Abstract Background Intestinal cell kinase (ICK; GeneID 22858 is a conserved MAPK and CDK-like kinase that is widely expressed in human tissues. Data from the Cancer Genome Anatomy Project indicated ICK mRNA is increased in cancer, and that its expression correlated with expression of mRNA for an uncharacterized F-box protein, FBX9 (GeneID: 26268. ICK and FBX9 genes are arranged head-to-head on opposite strands, with start sites for transcription separated by ~3.3 kb. We hypothesized ICK and FBX9 are potentially important genes in cancer controlled by a bidirectional promoter. Results We assessed promoter activity of the intergenic region in both orientations in cancer cell lines derived from breast (AU565, SKBR3, colon (HCT-15, KM12, and stomach (AGS cancers, as well as in embryonic human kidney (HEK293T cells. The intergenic segment was active in both orientations in all of these lines, and ICK promoter activity was greater than FBX9 promoter activity. Results from deletions and truncations defined a minimal promoter for ICK, and revealed that repressors and enhancers differentially regulate ICK versus FBX9 promoter activity. The ICK promoter contains consensus motifs for several FOX-family transcription factors that align when mouse and human are compared using EMBOSS. FOXA1 and FOXA2 increase luciferase activity of a minimal promoter 10-20 fold in HEK293T cells. Consensus sites for TCF7L2 (TCF4 (Gene Id: 6934 are also present in both mouse and human. The expression of β-catenin increased activity of the minimal promoter ~10 fold. ICK reference mRNAs (NM_014920.3, NM_016513 are expressed in low copy number and increased in some breast cancers, using a ten base tag 5'-TCAACCTTAT-3' specific for both ICK transcripts. Conclusion ICK and FBX9 are divergently transcribed from a bidirectional promoter that is GC-rich and contains a CpG island. A minimal promoter for ICK contains functional sites for β-cateinin/TCF7L2 and FOXA. These data are

  16. Channel box compression device

    International Nuclear Information System (INIS)

    Nakamizo, Hiroshi; Tanaka, Yuki.

    1996-01-01

    The device of the present invention reduces the volume of spent fuel channel boxes of power plant facilities to eliminate secondary wastes, suppress generation of radiation sources and improve storage space efficiency. The device has a box-like shape. A support frame is disposed on the lateral side of the box for supporting spent channel boxes. A horizontal transferring unit and a vertical transferring compression unit driven by a driving mechanism are disposed in the support frame. Further, the compression unit may have a rotational compression roller so as to move freely in the transferring unit. In addition, the transferring unit and the driving mechanism may be disposed outside of pool water. With such a constitution, since spent channel boxes are compressed and bent by horizontal movement of the transferring unit and the vertical movement of the compression unit, no cut pieces or cut powders are generated. Further, if the transferring unit and the driving mechanism are disposed outside of the pool water, it is not necessary to make them waterproof, which facilitates the maintenance. (I.S.)

  17. The BOXES Methodology Black Box Dynamic Control

    CERN Document Server

    Russell, David W

    2012-01-01

    Robust control mechanisms customarily require knowledge of the system’s describing equations which may be of the high order differential type.  In order to produce these equations, mathematical models can often be derived and correlated with measured dynamic behavior.  There are two flaws in this approach one is the level of inexactness introduced by linearizations and the other when no model is apparent.  Several years ago a new genre of control systems came to light that are much less dependent on differential models such as fuzzy logic and genetic algorithms. Both of these soft computing solutions require quite considerable a priori system knowledge to create a control scheme and sometimes complicated training program before they can be implemented in a real world dynamic system. Michie and Chambers’ BOXES methodology created a black box system that was designed to control a mechanically unstable system with very little a priori system knowledge, linearization or approximation.  All the method need...

  18. Opto-Box

    CERN Document Server

    Bertsche, David; The ATLAS collaboration; Welch, Steven; Smith, Dale Shane; Che, Siinn; Gan, K.K.; Boyd, George Russell Jr

    2015-01-01

    The opto-box is a custom mini-crate for housing optical modules, which process and transfer optoelectronic data. The system tightly integrates electrical, mechanical, and thermal functionality into a small package of size 35x10x8 cm^3. Special attention was given to ensure proper shielding, grounding, cooling, high reliability, and environmental tolerance. The custom modules, which incorporate Application Specific Integrated Circuits (ASICs), were developed through a cycle of rigorous testing and redesign. In total, fourteen opto-boxes have been installed and loaded with modules on the ATLAS detector. They are currently in operation as part of the LHC run 2 data read-out chain.

  19. Teaching with Box Tops.

    Science.gov (United States)

    Raiser, Lynne; D'Zamko, Mary Elizabeth

    1984-01-01

    Using environmental materials (such as the phone book and placemats from fast food restaurants) can be a motivating way to teach learning disabled students skills and concepts, as shown in an approach to reading, math, science and nutrition, and social studies instruction using a JELL-O brand gelatin box. (CL)

  20. Glove box posting system

    International Nuclear Information System (INIS)

    McIntosh, A.E.

    1981-01-01

    A system for posting objects into closed containers, such as glove boxes, is described in which the bag used, preferably made of plastic, does not have to be fitted and sealed by the operator during each posting operation. (U.K.)

  1. Many-box locality

    Science.gov (United States)

    Zhou, Yuqian; Cai, Yu; Bancal, Jean-Daniel; Gao, Fei; Scarani, Valerio

    2017-11-01

    There is an ongoing search for a physical or operational definition for quantum mechanics. Several informational principles have been proposed which are satisfied by a theory less restrictive than quantum mechanics. Here, we introduce the principle of "many-box locality," which is a refined version of the previously proposed "macroscopic locality." These principles are based on coarse graining the statistics of several copies of a given box. The set of behaviors satisfying many-box locality for N boxes is denoted LNM B. We study these sets in the bipartite scenario with two binary measurements, in relation with the sets Q and Q1 +A B of quantum and "almost quantum" correlations, respectively. We find that the LNM B sets are, in general, not convex. For unbiased marginals, by working in the Fourier space we can prove analytically that LNM B⊈Q for any finite N , while L∞M B=Q . Then, with suitably developed numerical tools, we find an example of a point that belongs to L16M B but not to Q1 +A B. Among the problems that remain open is whether Q ⊂L∞M B .

  2. Mystery Box Marvels

    Science.gov (United States)

    Santos, Joel; Centurio, Tina

    2012-01-01

    What happens in the first week of school could very well set the stage for the rest of the school year. Setting high standards for science activities based in inquiry can start on the first day of science class and develop as the year unfolds. With the use of simple, readily available, inexpensive materials, an efficient mystery box lesson can be…

  3. IN-A-BOX

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 7; Issue 2. Claude Elwood Shannon. Priti Shankar. Article-in-a-Box Volume 7 Issue 2 February 2002 pp 2-3 ... Author Affiliations. Priti Shankar1. Department of Computer Science & Automation, Indian Institute of Science, Bangalore 560 012, India.

  4. IN-A-BOX

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 12. Vikram A Sarabhai. Mrinalini Sarabhai. Article-in-a-Box Volume 6 Issue 12 December 2001 pp 5-7. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/006/12/0005-0007. Author Affiliations. Mrinalini ...

  5. Computer program for calculating the resonant frequency, shunt impedance and quality factor of a pill-box cavity in a storage ring

    International Nuclear Information System (INIS)

    Aguero, V.M.; Ng, K.Y.

    1983-10-01

    Keil and Zotter have analyzed the electromagnetic fields excited by the longitudinal density fluctuations of an unbunched relativistic particle beam drifting in a corrugated vacuum chamber of circular cross section. At higher frequencies, these corrugations become resonant cavities. Zotter has written a computer program known as KN7C to compute the resonant frequencies. However, in the actual use of KN7C, some difficulties are encountered. To surmount these difficulties, the program known as CAVITY was written to analyze this pill-box shaped resonant cavity. Although there are many input variables to this program, only two are essential and need to be specified. They are BD = b/d = the ratio of the circular beampipe radius to that of the pill-box cavity and GD = g/d where g is the length of the cavity. When they are specified, CAVITY will print out the dimensionless normalized fundamental resonant frequency FD, shunt impedance Z and figure of merit Q. From these, the actual resonant frequency, shunt impedance and figure of merit can be deduced. The program is described and a listing is provided

  6. Opto-Box

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00377159; The ATLAS collaboration

    2015-01-01

    The opto-box is a custom mini-crate for housing optical modules, which process and transfer optoelectronic data. Many novel solutions were developed for the custom design and manufacturing. The system tightly integrates electrical, mechanical, and thermal functionality into a small package of size 35x10x8 cm$^{3}$. Special attention was given to ensure proper shielding, grounding, cooling, high reliability, and environmental tolerance. The custom modules, which incorporate Application Specific Integrated Circuits (ASICs), were developed through a cycle of rigorous testing and redesign. In total, fourteen opto-boxes have been installed and loaded with modules on the ATLAS detector. They are currently in operation as part of the LHC run 2 data read-out chain.

  7. Boxed Permutation Pattern Matching

    DEFF Research Database (Denmark)

    Amit, Mika; Bille, Philip; Cording, Patrick Hagge

    2016-01-01

    the goal is to only find the boxed subsequences of T that are order-isomorphic to P. This problem was introduced by Bruner and Lackner who showed that it can be solved in O(n3) time. Cho et al. [CPM 2015] gave an O(n2m) time algorithm and improved it to O(n2 logm). In this paper we present a solution...

  8. The Box Method

    DEFF Research Database (Denmark)

    Nielsen, Peter Vilhelm

    The velocity level in a room ventilated by jet ventilation is strongly influenced by the supply conditions. The momentum flow in the supply jets controls the air movement in the room and, therefore, it is very important that the inlet conditions and the numerical method can generate a satisfactor...... description of this momentum flow. The Box Method is a practical method for the description of an Air Terminal Device which will save grid points and ensure the right level of the momentum flow....

  9. MADS-box genes controlling inflorescence morphogenesis in sunflower

    NARCIS (Netherlands)

    Shulga, O.A.; Shchennikova, A.V.; Angenent, G.C.; Skryabin, K.G.

    2008-01-01

    MADS-box genes play an important role in plant ontogeny, particularly, in the regulation of floral organ induction and development. Eight full-length cDNAs of HAM genes (Helianthus annuus MADS) have been isolated from sunflower. They encode MADS-box transcription factors expressed in inflorescence

  10. Achieving peptide binding specificity and promiscuity by loops: case of the forkhead-associated domain.

    Science.gov (United States)

    Huang, Yu-Ming M; Chang, Chia-En A

    2014-01-01

    The regulation of a series of cellular events requires specific protein-protein interactions, which are usually mediated by modular domains to precisely select a particular sequence from diverse partners. However, most signaling domains can bind to more than one peptide sequence. How do proteins create promiscuity from precision? Moreover, these complex interactions typically occur at the interface of a well-defined secondary structure, α helix and β sheet. However, the molecular recognition primarily controlled by loop architecture is not fully understood. To gain a deep understanding of binding selectivity and promiscuity by the conformation of loops, we chose the forkhead-associated (FHA) domain as our model system. The domain can bind to diverse peptides via various loops but only interact with sequences containing phosphothreonine (pThr). We applied molecular dynamics (MD) simulations for multiple free and bound FHA domains to study the changes in conformations and dynamics. Generally, FHA domains share a similar folding structure whereby the backbone holds the overall geometry and the variety of sidechain atoms of multiple loops creates a binding surface to target a specific partner. FHA domains determine the specificity of pThr by well-organized binding loops, which are rigid to define a phospho recognition site. The broad range of peptide recognition can be attributed to different arrangements of the loop interaction network. The moderate flexibility of the loop conformation can help access or exclude binding partners. Our work provides insights into molecular recognition in terms of binding specificity and promiscuity and helpful clues for further peptide design.

  11. Evaluation of the factors influencing the resultant diameter of the electrospun gelatin/sodium alginate nanofibers via Box-Behnken design.

    Science.gov (United States)

    Gönen, Seza Özge; Erol Taygun, Melek; Küçükbayrak, Sadriye

    2016-01-01

    This article presented a study on the effects of solution properties (i.e., gelatin concentration, alginate concentration, content of alginate solution in the blend solution, and content of acetic acid in the solvent of gelatin solution) on the average diameter of electrospun gelatin/sodium alginate nanofibers, as well as its standard deviation. For this purpose, blend solutions of two natural polymers (gelatin and sodium alginate) were prepared both in the absence and presence of ethanol. Response surface methodology based on a three-level, four-variable Box-Benkhen design was employed to define quadratic relationships between the responses and the solution properties. The individual and interactive effects of the solution properties were determined. Moreover, the adequacy of the models was verified by the validation experiments. Results showed that the average diameters of the resultant nanofibers were 68-166 nm and 90-155 nm in the absence and presence of ethanol, respectively. The experimental results were in good agreement with the predicted response values. Hence, this study provides an overview on the fabrication of gelatin/sodium alginate nanofibers with targeted diameter, which may have potential to be used in the field of tissue engineering. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Surface reflectance drives nest box temperature profiles and thermal suitability for target wildlife.

    Directory of Open Access Journals (Sweden)

    Stephen R Griffiths

    Full Text Available Thermal properties of tree hollows play a major role in survival and reproduction of hollow-dependent fauna. Artificial hollows (nest boxes are increasingly being used to supplement the loss of natural hollows; however, the factors that drive nest box thermal profiles have received surprisingly little attention. We investigated how differences in surface reflectance influenced temperature profiles of nest boxes painted three different colors (dark-green, light-green, and white: total solar reflectance 5.9%, 64.4%, and 90.3% respectively using boxes designed for three groups of mammals: insectivorous bats, marsupial gliders and brushtail possums. Across the three different box designs, dark-green (low reflectance boxes experienced the highest average and maximum daytime temperatures, had the greatest magnitude of variation in daytime temperatures within the box, and were consistently substantially warmer than light-green boxes (medium reflectance, white boxes (high reflectance, and ambient air temperatures. Results from biophysical model simulations demonstrated that variation in diurnal temperature profiles generated by painting boxes either high or low reflectance colors could have significant ecophysiological consequences for animals occupying boxes, with animals in dark-green boxes at high risk of acute heat-stress and dehydration during extreme heat events. Conversely in cold weather, our modelling indicated that there are higher cumulative energy costs for mammals, particularly smaller animals, occupying light-green boxes. Given their widespread use as a conservation tool, we suggest that before boxes are installed, consideration should be given to the effect of color on nest box temperature profiles, and the resultant thermal suitability of boxes for wildlife, particularly during extremes in weather. Managers of nest box programs should consider using several different colors and installing boxes across a range of both orientations and

  13. Surface reflectance drives nest box temperature profiles and thermal suitability for target wildlife.

    Science.gov (United States)

    Griffiths, Stephen R; Rowland, Jessica A; Briscoe, Natalie J; Lentini, Pia E; Handasyde, Kathrine A; Lumsden, Linda F; Robert, Kylie A

    2017-01-01

    Thermal properties of tree hollows play a major role in survival and reproduction of hollow-dependent fauna. Artificial hollows (nest boxes) are increasingly being used to supplement the loss of natural hollows; however, the factors that drive nest box thermal profiles have received surprisingly little attention. We investigated how differences in surface reflectance influenced temperature profiles of nest boxes painted three different colors (dark-green, light-green, and white: total solar reflectance 5.9%, 64.4%, and 90.3% respectively) using boxes designed for three groups of mammals: insectivorous bats, marsupial gliders and brushtail possums. Across the three different box designs, dark-green (low reflectance) boxes experienced the highest average and maximum daytime temperatures, had the greatest magnitude of variation in daytime temperatures within the box, and were consistently substantially warmer than light-green boxes (medium reflectance), white boxes (high reflectance), and ambient air temperatures. Results from biophysical model simulations demonstrated that variation in diurnal temperature profiles generated by painting boxes either high or low reflectance colors could have significant ecophysiological consequences for animals occupying boxes, with animals in dark-green boxes at high risk of acute heat-stress and dehydration during extreme heat events. Conversely in cold weather, our modelling indicated that there are higher cumulative energy costs for mammals, particularly smaller animals, occupying light-green boxes. Given their widespread use as a conservation tool, we suggest that before boxes are installed, consideration should be given to the effect of color on nest box temperature profiles, and the resultant thermal suitability of boxes for wildlife, particularly during extremes in weather. Managers of nest box programs should consider using several different colors and installing boxes across a range of both orientations and shade profiles (i

  14. 46 CFR 111.81-1 - Outlet boxes and junction boxes; general.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Outlet boxes and junction boxes; general. 111.81-1... ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Outlet Boxes and Junction Boxes § 111.81-1 Outlet boxes and junction boxes; general. (a) The requirements of this subpart apply to each outlet box used with a lighting...

  15. The Classroom Animal: Box Turtles.

    Science.gov (United States)

    Kramer, David C.

    1986-01-01

    Provides basic information on the anatomy, physiology, behaviors, and distribution patterns of the box turtle. Offers suggestions for the turtle's care and maintenance in a classroom environment. (ML)

  16. Nuclear mobility and mitotic chromosome binding: similarities between pioneer transcription factor FoxA and linker histone H1.

    Science.gov (United States)

    Zaret, K S; Caravaca, J M; Tulin, A; Sekiya, T

    2010-01-01

    There exists a hierarchy by which transcription factors can engage their target sites in chromatin, in that a subset of factors can bind transcriptionally silent, nucleosomal DNA, whereas most factors cannot, and this hierarchy is reflected, at least in part, in the developmental function of the factors. For example, transcription factors possessing the Forkhead box (Fox) DNA-binding domain contain an overall fold resembling that of linker histone and thus are structured to bind DNA, site specifically, in a nucleosomal context. Where tested, Fox factors bind early in the developmental or physiological activation of target genes, thereby enabling the binding of other factors that cannot engage chromatin on their own. To investigate the basis for early chromatin binding, we have used fluorescence recovery after photobleaching (FRAP) to analyze the mobility, in the live cell nucleus, of FoxA factors in comparison to linker histone and other transcription factors. We have further analyzed the factors for their ability to bind to chromatin in mitosis and thereby serve as epigenetic marks. The results indicate that the "pioneer" features of FoxA factors involve various chromatin-binding parameters seen in linker histones and that distinguish the factors with respect to their regulatory and mechanistic functions.

  17. Nuclear detection of Y-box protein-1 (YB-1) closely associates with progesterone receptor negativity and is a strong adverse survival factor in human breast cancer

    International Nuclear Information System (INIS)

    Dahl, Edgar; Dunn, Sandra E; Mertens, Peter R; En-Nia, Abdelaziz; Wiesmann, Frank; Krings, Renate; Djudjaj, Sonja; Breuer, Elisabeth; Fuchs, Thomas; Wild, Peter J; Hartmann, Arndt

    2009-01-01

    Y-box binding protein-1 (YB-1) is the prototypic member of the cold shock protein family that fulfills numerous cellular functions. In the nucleus YB-1 protein orchestrates transcription of proliferation-related genes, whereas in the cytoplasm it associates with mRNA and directs translation. In human tumor entities, such as breast, lung and prostate cancer, cellular YB-1 expression indicates poor clinical outcome, suggesting that YB-1 is an attractive marker to predict patients' prognosis and, potentially, is suitable to individualize treatment protocols. Given these predictive qualities of YB-1 detection we sought to establish a highly specific monoclonal antibody (Mab) for diagnostic testing and its characterization towards outcome prediction (relapse-free and overall survival). Hybridoma cell generation was carried out with recombinant YB-1 protein as immunogen and Mab characterization was performed using immunoblotting and ELISA with recombinant and tagged YB-1 proteins, as well as immunohistochemistry of healthy and breast cancer specimens. Breast tumor tissue array staining results were analyzed for correlations with receptor expression and outcome parameters. YB-1-specific Mab F-E2G5 associates with conformational binding epitopes mapping to two domains within the N-terminal half of the protein and detects nuclear YB-1 protein by immunohistochemistry in paraffin-embedded breast cancer tissues. Prognostic evaluation of Mab F-E2G5 was performed by immunohistochemistry of a human breast cancer tissue microarray comprising 179 invasive breast cancers, 8 ductal carcinoma in situ and 37 normal breast tissue samples. Nuclear YB-1 detection in human breast cancer cells was associated with poor overall survival (p = 0.0046). We observed a close correlation between nuclear YB-1 detection and absence of progesterone receptor expression (p = 0.002), indicating that nuclear YB-1 detection marks a specific subgroup of breast cancer. Likely due to limitation of sample

  18. Nuclear detection of Y-box protein-1 (YB-1 closely associates with progesterone receptor negativity and is a strong adverse survival factor in human breast cancer

    Directory of Open Access Journals (Sweden)

    Wild Peter J

    2009-11-01

    Full Text Available Abstract Background Y-box binding protein-1 (YB-1 is the prototypic member of the cold shock protein family that fulfills numerous cellular functions. In the nucleus YB-1 protein orchestrates transcription of proliferation-related genes, whereas in the cytoplasm it associates with mRNA and directs translation. In human tumor entities, such as breast, lung and prostate cancer, cellular YB-1 expression indicates poor clinical outcome, suggesting that YB-1 is an attractive marker to predict patients' prognosis and, potentially, is suitable to individualize treatment protocols. Given these predictive qualities of YB-1 detection we sought to establish a highly specific monoclonal antibody (Mab for diagnostic testing and its characterization towards outcome prediction (relapse-free and overall survival. Methods Hybridoma cell generation was carried out with recombinant YB-1 protein as immunogen and Mab characterization was performed using immunoblotting and ELISA with recombinant and tagged YB-1 proteins, as well as immunohistochemistry of healthy and breast cancer specimens. Breast tumor tissue array staining results were analyzed for correlations with receptor expression and outcome parameters. Results YB-1-specific Mab F-E2G5 associates with conformational binding epitopes mapping to two domains within the N-terminal half of the protein and detects nuclear YB-1 protein by immunohistochemistry in paraffin-embedded breast cancer tissues. Prognostic evaluation of Mab F-E2G5 was performed by immunohistochemistry of a human breast cancer tissue microarray comprising 179 invasive breast cancers, 8 ductal carcinoma in situ and 37 normal breast tissue samples. Nuclear YB-1 detection in human breast cancer cells was associated with poor overall survival (p = 0.0046. We observed a close correlation between nuclear YB-1 detection and absence of progesterone receptor expression (p = 0.002, indicating that nuclear YB-1 detection marks a specific subgroup of

  19. Acsys in a box

    International Nuclear Information System (INIS)

    Briegel, C.; Finstrom, D.; Hendricks, B.; King, C.; Lackey, S.; Neswold, R.; Nicklaus, D.; Patrick, J.; Petrov, A.; Rechenmacher, R.; Schumann, C.; Smedinghoff, J.

    2012-01-01

    The Accelerator Control System (ACSYS) at Fermilab has evolved to enable this relatively large control system to be encapsulated into a 'box' such as a laptop. The goal was to provide a platform isolated from the 'online' control system. This platform can be used internally for making major upgrades and modifications without impacting operations. It also provides a stand-alone environment for research and development including a turnkey control system for collaborators. Over time, the code base running on Scientific Linux has enabled all the salient features of the Fermilab's control system to be captured in an off-the-shelf laptop. The anticipated additional benefits of packaging the system include improved maintenance, reliability, documentation, and future enhancements. (authors)

  20. ACYSYS in a box

    Energy Technology Data Exchange (ETDEWEB)

    Briegel, C.; Finstrom, D.; Hendricks, B.; King, C.; Lackey, S.; Neswold, R.; Nicklaus, D.; Patrick, J.; Petrov, A.; Rechenmacher, R.; Schumann, C.; /Fermilab

    2011-11-01

    The Accelerator Control System at Fermilab has evolved to enable this relatively large control system to be encapsulated into a 'box' such as a laptop. The goal was to provide a platform isolated from the 'online' control system. This platform can be used internally for making major upgrades and modifications without impacting operations. It also provides a standalone environment for research and development including a turnkey control system for collaborators. Over time, the code base running on Scientific Linux has enabled all the salient features of the Fermilab's control system to be captured in an off-the-shelf laptop. The anticipated additional benefits of packaging the system include improved maintenance, reliability, documentation, and future enhancements.

  1. Comparison of box-air-mass-factors and radiances for Multiple-Axis Differential Optical Absorption Spectroscopy (MAX-DOAS geometries calculated from different UV/visible radiative transfer models

    Directory of Open Access Journals (Sweden)

    T. Wagner

    2007-01-01

    Full Text Available The results of a comparison exercise of radiative transfer models (RTM of various international research groups for Multiple AXis Differential Optical Absorption Spectroscopy (MAX-DOAS viewing geometry are presented. Besides the assessment of the agreement between the different models, a second focus of the comparison was the systematic investigation of the sensitivity of the MAX-DOAS technique under various viewing geometries and aerosol conditions. In contrast to previous comparison exercises, box-air-mass-factors (box-AMFs for different atmospheric height layers were modelled, which describe the sensitivity of the measurements as a function of altitude. In addition, radiances were calculated allowing the identification of potential errors, which might be overlooked if only AMFs are compared. Accurate modelling of radiances is also a prerequisite for the correct interpretation of satellite observations, for which the received radiance can strongly vary across the large ground pixels, and might be also important for the retrieval of aerosol properties as a future application of MAX-DOAS. The comparison exercises included different wavelengths and atmospheric scenarios (with and without aerosols. The strong and systematic influence of aerosol scattering indicates that from MAX-DOAS observations also information on atmospheric aerosols can be retrieved. During the various iterations of the exercises, the results from all models showed a substantial convergence, and the final data sets agreed for most cases within about 5%. Larger deviations were found for cases with low atmospheric optical depth, for which the photon path lengths along the line of sight of the instrument can become very large. The differences occurred between models including full spherical geometry and those using only plane parallel approximation indicating that the correct treatment of the Earth's sphericity becomes indispensable. The modelled box-AMFs constitute an

  2. What Makes a Better Box?

    Science.gov (United States)

    Moyer, Richard; Everett, Susan

    2010-01-01

    Every morning, many Americans start their day with a bowl of cereal. Some spend time while they eat breakfast reading the back of the cereal box, but few consider its size, shape, and construction, or realize that it was designed by an engineer. This article describes a lesson in which students design, build, and critique cereal boxes. The lesson…

  3. Spirit Boxes: Expressions of Culture.

    Science.gov (United States)

    DeMuro, Ted

    1984-01-01

    After studying the culture and art of the ancient civilizations of South America, Mesopotamia, Greece, and Egypt, secondary level art students made spirit boxes as expressions of the various cultures. How to make the boxes and how to prepare the face molds are described. (RM)

  4. Thinking Inside the Box

    International Nuclear Information System (INIS)

    Boeheim, Charles T.

    2007-01-01

    In early 2007, SLAC was faced with a shortage of both electrical power and cooling in the main computer building, at the same time that the BaBar collaboration needed a new cluster of 250 batch machines installed. A number of different options were explored for the expansion. Provision of additional electrical power to the building was estimated to take one to two years, and cost several million dollars; additional cooling was even worse. Space in a Silicon Valley co-location facilities was reasonable on a one-year timescale, but broke even in costs by the end of three years, and were more expensive after that. There were also unresolved questions about the affects of additional latency from an offsite compute cluster to the onsite disk servers. The option of converting existing experimental hall space into computer space was estimated at one year, with uncertain availability. An option to aggressively replace several existing clusters with more power-efficient equipment was studied closely, but was disruptive to continued operations, expensive, and didn't provide any additional headroom. Finally, the installation of a Sun Project Blackbox (PBB) unit was selected as providing the capacity on a timescale of six months for a reasonable cost with minimal disruption to service. SLAC obtained and installed a beta unit and have been running it in production since September 2007. The experiences described are with the Early Access version of the PBB. The production version of the box has engineering changes based in part on our experiences

  5. Learning Intelligent Dialogs for Bounding Box Annotation

    OpenAIRE

    Konyushkova, Ksenia; Uijlings, Jasper; Lampert, Christoph; Ferrari, Vittorio

    2017-01-01

    We introduce Intelligent Annotation Dialogs for bounding box annotation. We train an agent to automatically choose a sequence of actions for a human annotator to produce a bounding box in a minimal amount of time. Specifically, we consider two actions: box verification [37], where the annotator verifies a box generated by an object detector, and manual box drawing. We explore two kinds of agents, one based on predicting the probability that a box will be positively verified, and the other bas...

  6. RNA helicase HEL-1 promotes longevity by specifically activating DAF-16/FOXO transcription factor signaling in Caenorhabditis elegans

    Science.gov (United States)

    Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V.

    2015-01-01

    The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans. PMID:26195740

  7. Microclimate boxes for panel paintings

    DEFF Research Database (Denmark)

    Wadum, Jørgen

    1998-01-01

    The use of microclimate boxes to protect vulnerable panel paintings is, therefore, not a new phenomenon of the past two or three decades. Rather, it has been a concern for conservators and curators to protect these objects of art at home and in transit since the end of the nineteenth century....... The increased number of travelling exhibitions in recent years has heightened the need to protect paintings during circulation (Thomson 1961; Mecklenburg 1991). The use and design of microclimate boxes have been evolving since 1892. These boxes may be divided into three broad groups: those using an active...

  8. A novel ethylene-responsive factor from Tamarix hispida, ThERF1, is a GCC-box- and DRE-motif binding protein that negatively modulates abiotic stress tolerance in Arabidopsis.

    Science.gov (United States)

    Wang, Liuqiang; Qin, Liping; Liu, Wenjin; Zhang, Daoyuan; Wang, Yucheng

    2014-09-01

    Ethylene-responsive factor (ERF) family is one of the largest families of plant-specific transcription factor that can positively or negatively regulate abiotic stress tolerance. However, their functions in regulating abiotic stress tolerance are still not fully understood. In this study, we characterized the functions of an ERF gene from Tamarix hispida, ThERF1, which can negatively regulate abiotic stress tolerance. The expression of ThERF1 was induced by salinity, PEG-simulated drought and abscisic acid (ABA) treatments. ThERF1 can specifically bind to GCC-box and DRE motifs. Overexpression of ThERF1 in transgenic Arabidopsis plants showed inhibited seed germination, and decreased fresh weight gain and root growth compared with wild-type (WT) plants. In addition, the transcript levels of several superoxide dismutase (SOD) and peroxidase (POD) genes in transgenic plants were significantly inhibited compared with in WT plants, resulting in decreased SOD and POD activities in transgenic plants under salt and drought stress conditions. Furthermore, the reactive oxygen species (ROS) levels, malondialdehyde (MDA) contents and cell membrane damage in ThERF1-transformed plants were all highly increased relative to WT plants. Our results suggest that ThERF1 negatively regulates abiotic stress tolerance by strongly inhibiting the expression of SOD and POD genes, leading to decreased ROS-scavenging ability. © 2014 Scandinavian Plant Physiology Society.

  9. Ultrasound Effect on Gene Expression of Sex Determining Region Y-box 9 (SOX9 and Transforming Growth Factor β Isoforms in Adipose Stem Cells

    Directory of Open Access Journals (Sweden)

    Hajar Shafaei

    2016-04-01

    Full Text Available Background Cartilage tissue engineering is a promising method for repair of cartilage defects. Induction of chondrogenesis in mesenchymal stem cells (MSC is currently used in cartilage tissue engineering. Among growth factors, transforming growth factor β (TGF-β is common chondrogenic inducer but toward hypertrophic chondrocyte. However, mechanical factors such as ultrasound could stimulate chondrogenesis. Objectives We aimed to investigate stimulation of endogenous TGF-β genes expression by low intensity pulsed ultrasound (LIPUS in MSC. Materials and Methods In this experimental study, adipose tissue stem cells (ASC cultures were treated with or without LIPUS (30 mW/cm2, 20 min/day and with or without TGF-β3 (10 ng/mL for 4 or 14 days. Chondrogenic gene expression of SOX9 and members of TGF-β family (β1, β2 and β3 was assessed in ASC cultures at day 4 and 14 by real time PCR. Results The gene expression of SOX9 significantly increased by LIPUS and TGF-β treatment versus control cultures. Exogenous TGF-β3 treatment stimulated endogenous TGF-β1 and β2 gene expressions more than LIPUS treated cultures at day 4. LIPUS, TGF-β and LIPUS plus TGF-β treated cultures expressed same TGF-β3 gene expression at day 4. The expression of TGF-β1 and β2 decreased by LIPUS in comparison to TGF-β treated cultures at day 14. Conclusions Our results suggest that LIPUS might initiate differentiation of ASC without enhancing endogenous TGF-β genes in in-vitro.

  10. DIRECT KICKS IN BOXING

    Directory of Open Access Journals (Sweden)

    Izet Kahrović

    2009-11-01

    Full Text Available Hit directly, giving any impact maximum muscle strength is skill, and it is neces- sary to the exercise and learning to make it perfect. Training begins with oral statement, so that students get to know with the techni- que that works. After oral exposure, it is necessary to create a good notion on technology that is adopted. The best way for the creation of good notion is a good demonstration. In direct training kicks in the box, you need patience and gradualness and there- fore uses a large number of additional exercises. In their work with beginners, in the first class, individual elements of technology, and also direct blow, it is necessary to separate the parts and run them on multiple commands, to later come to the confluence in one command. Direct wounds, with left and right hand, can be run from the towns, on the head and body, from the movement, to step forward, step back and step aside, the remedy to the left and right side. Left direct is taking out from a running protrusion hands, but kick, which is a pro- duct of the system, ankle-knee-pelvis and shoulder forward horizontaly. Set at the time of stripes, body weight over the left leg. Right direct from the place, starting ekscentrical reflecsive impuls of a extensor muscle in ankle, knee and joint of a hip.This kind of a sud- den movement is running simultaneously with the rotation of the body around vertical (longitudinal axis, with the transfer body weight on the left leg. Further movement to the hand which serves as a lever, which is transmitted through the power stroke

  11. Function and Diversification of MADS-Box Genes in Rice

    OpenAIRE

    Takahiro Yamaguchi; Hiro-Yuki Hirano

    2006-01-01

    MADS-box genes play critical roles in a number of developmental processes in flowering plants, such as specification of floral organ identity, control of flowering time, and regulation of fruit development. Because of their crucial functions in flower development, diversification of the MADS-box gene family has been suggested to be a major factor responsible for floral diversity during radiation of the flowering plants. Inflorescences and flowers in the grass species have unique structures th...

  12. The determinants of Polish movies’ box office performance in Poland

    OpenAIRE

    Natalia Gmerek

    2015-01-01

    This paper provides an empirical analysis of financial performance of movies produced in Poland between 2000 and 2011. To understand the reason for a motion picture’s success in the theatrical channel various factors concerning total domestic box office performance were regressed from the box office results of 207 movies. This study proposes that the success of a movie can be determined by three elements: product attributes, distribution-related variables and information sources. The results ...

  13. Article-in-a-Box

    Indian Academy of Sciences (India)

    Volume 1 Issue 5 May 1996 pp 2-2 Article-in-a-Box. Chief Editor's column / The First Electronic Computer · V Rajaraman · More Details Fulltext PDF. Volume 1 Issue 6 June 1996 pp 2-4 Article-in-a-Box. Konrad Lorenz · Raghavendra Gadagkar · More Details Fulltext PDF. Volume 1 Issue 8 August 1996 pp 3-4 Article-in-a- ...

  14. Fuel element box inspection device

    International Nuclear Information System (INIS)

    Ortmayer, R.M.; Pick, W.

    1985-01-01

    The invention concerns a device for inspecting the outer geometry of a long fuel element box by measuring the surface contours over its longitudinal crossection and along its length by sensors. These are kept in a sledge which can be moved along the fuel element guide in a slot guide. The measurement signals reach an evaluation device outside the longitudinal box. (orig./HP) [de

  15. Measuring Pu in a glove box using portable NaI and germanium detectors

    International Nuclear Information System (INIS)

    Hankins, D.E.

    1984-01-01

    A NaI crystal or germanium detector inside a portable lead shield can determine the amount of plutonium in a glove box. The number of counts required are defined and the locations outside the box where the detector needs to be positioned are given. The calculated accuracy for measuring the Pu when these locations are used is within +/-30% for most glove boxes. Other factors that may affect this accuracy, such as γ-ray absorption by glove-box materials, self-absorption by Pu, absorption by equipment in the glove box, and the limits of the counting equipment are also discussed

  16. miR156-Targeted SBP-Box Transcription Factors Interact with DWARF53 to Regulate TEOSINTE BRANCHED1 and BARREN STALK1 Expression in Bread Wheat.

    Science.gov (United States)

    Liu, Jie; Cheng, Xiliu; Liu, Pan; Sun, Jiaqiang

    2017-07-01

    Genetic and environmental factors affect bread wheat ( Triticum aestivum ) plant architecture, which determines grain yield. In this study, we demonstrate that miR156 controls bread wheat plant architecture. We show that overexpression of tae-miR156 in bread wheat cultivar Kenong199 leads to increased tiller number and severe defects in spikelet formation, probably due to the tae-miR156-mediated repression of a group of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE ( SPL ) genes. Furthermore, we found that the expression of two genes TEOSINTE BRANCHED1 ( TaTB1 ) and BARREN STALK1 ( TaBA1 ), whose orthologous genes in diverse plant species play conserved roles in regulating plant architecture, is markedly reduced in the tae-miR156-OE bread wheat plants. Significantly, we demonstrate that the strigolactone (SL) signaling repressor DWARF53 (TaD53), which physically associates with the transcriptional corepressor TOPLESS, can directly interact with the N-terminal domains of miR156-controlled TaSPL3/17. Most importantly, TaSPL3/17-mediated transcriptional activation of TaBA1 and TaTB1 can be largely repressed by TaD53 in the transient expression system. Our results reveal potential association between miR156-TaSPLs and SL signaling pathways during bread wheat tillering and spikelet development. © 2017 American Society of Plant Biologists. All Rights Reserved.

  17. A Novel Mutation in the Critical P-Box Residue of Steroidogenic Factor-1 Presenting with XY Sex Reversal and Transient Adrenal Failure.

    Science.gov (United States)

    Orekhova, Anna S; Kalinchenko, Natalia; Morozov, Ivan A; Vasilyev, Evgeny V; Rubtsov, Petr M; Dedov, Ivan I; Tiulpakov, Anatoly

    2017-11-17

    Although the importance of steroidogenic factor-1 (SF1, NR5A1) for adrenal development is supported by numerous in vitro and in vivo studies, cases of SF1 deficiency associated with adrenal failure are exceptionally rare. The first human NR5A1 mutation was a heterozygous de novo p.G35E variant identified in a patient with disorder of sex development (DSD) 46,XY and primary adrenal insufficiency. Here we describe another association of the "classic" SF1 phenotype with a novel NR5A1 mutation affecting G35 residue. We describe the clinical characteristics of a phenotypically female patient presenting at 2 months with signs of adrenal insufficiency. DSD 46,XY was diagnosed at 4 years. The NR5A1 gene was analyzed by Sanger sequencing. Minigene splicing and dual luciferase reporter assays were used to characterize effects of the novel mutation on splicing and transcription, respectively. Sequencing of the NR5A1 gene revealed a de novo heterozygous c.104G>A:p.G35D substitution. The minigene experiments demonstrated that c.104G>A substitution did not affect splicing. However, transactivation activity of the p.G35D mutant was clearly impaired, which was comparable with the effect of the p.G35E mutation. The findings stress the importance of G35 residue for adrenal development. The current observation also suggests that some patients with SF1 deficiency may present with transient adrenal failure. © 2017 S. Karger AG, Basel.

  18. HIV-1 Tat affects the programming and functionality of human CD8⁺ T cells by modulating the expression of T-box transcription factors.

    Science.gov (United States)

    Sforza, Fabio; Nicoli, Francesco; Gallerani, Eleonora; Finessi, Valentina; Reali, Eva; Cafaro, Aurelio; Caputo, Antonella; Ensoli, Barbara; Gavioli, Riccardo

    2014-07-31

    HIV infection is characterized by several immune dysfunctions of both CD8⁺ and CD4⁺ T cells as hyperactivation, impairment of functionality and expansion of memory T cells. CD8⁺ T-cell dysfunctions have been associated with increased expression of T-bet, Eomesdermin and pro-inflammatory cytokines, and with down-regulation of CD127. The HIV-1 trans-activator of transcription (Tat) protein, which is released by infected cells and detected in tissues of HIV-positive individuals, is known to contribute to the dysregulation of CD4⁺ T cells; however, its effects on CD8⁺ T cells have not been investigated. Thus, in this study, we sought to address whether Tat may affect CD8⁺ T-cell functionality and programming. CD8⁺ T cells were activated by T-cell receptor engagement in the presence or absence of Tat. Cytokine production, killing capacity, surface phenotype and expression of transcription factors important for T-cell programming were evaluated. Tat favors the secretion of interleukin-2, interferon-γ and granzyme B in CD8⁺ T cells. Behind this functional modulation we observed that Tat increases the expression of T-bet, Eomesdermin, Blimp-1, Bcl-6 and Bcl-2 in activated but not in unstimulated CD8⁺ T lymphocytes. This effect is associated with the down-regulation of CD127 and the up-regulation of CD27. Tat deeply alters the programming and functionality of CD8⁺ T lymphocytes.

  19. FOXO Transcription Factors: Their Clinical Significance and Regulation

    Directory of Open Access Journals (Sweden)

    Yu Wang

    2014-01-01

    Full Text Available Members of the class O of forkhead box transcription factors (FOXO have important roles in metabolism, cellular proliferation, stress resistance, and apoptosis. The activity of FOXOs is tightly regulated by posttranslational modification, including phosphorylation, acetylation, and ubiquitylation. Activation of cell survival pathways such as phosphoinositide-3-kinase/AKT/IKK or RAS/mitogen-activated protein kinase phosphorylates FOXOs at different sites which regulate FOXOs nuclear localization or degradation. FOXO transcription factors are upregulated in a number of cell types including hepatocytes, fibroblasts, osteoblasts, keratinocytes, endothelial cells, pericytes, and cardiac myocytes. They are involved in a number of pathologic and physiologic processes that include proliferation, apoptosis, autophagy, metabolism, inflammation, cytokine expression, immunity, differentiation, and resistance to oxidative stress. These processes impact a number of clinical conditions such as carcinogenesis, diabetes, diabetic complications, cardiovascular disease, host response, and wound healing. In this paper, we focus on the potential role of FOXOs in different disease models and the regulation of FOXOs by various stimuli.

  20. First-aid boxes - Reminder

    CERN Multimedia

    GS Department

    2010-01-01

    With a view to ensuring optimum use of the first-aid boxes on the CERN site, we should like to remind you of various changes introduced in March 2009: The TSO of the buildings concerned is responsible for the first-aid boxes, including checking their contents.   First-aid boxes may be restocked ONLY at the CERN stores (SCEM No. 54.99.80). This is no longer possible at the Infirmary. The associated cost is charged to the Departments.   First-aid boxes should be used only for mild injuries. All other cases should be referred to the Medical Service Infirmary (Bldg. 57 – ground-floor, tel. 73802) between 8.00 a.m. and 5.30 p.m. or to the Fire and Rescue Service (tel. 74444). N.B.: This information does not apply to the red emergency first-aid boxes in the underground areas or to the emergency kits for use in the event of being splashed with hydrofluoric acid.

  1. Box graphs and resolutions I

    Directory of Open Access Journals (Sweden)

    Andreas P. Braun

    2016-04-01

    Full Text Available Box graphs succinctly and comprehensively characterize singular fibers of elliptic fibrations in codimension two and three, as well as flop transitions connecting these, in terms of representation theoretic data. We develop a framework that provides a systematic map between a box graph and a crepant algebraic resolution of the singular elliptic fibration, thus allowing an explicit construction of the fibers from a singular Weierstrass or Tate model. The key tool is what we call a fiber face diagram, which shows the relevant information of a (partial toric triangulation and allows the inclusion of more general algebraic blowups. We shown that each such diagram defines a sequence of weighted algebraic blowups, thus providing a realization of the fiber defined by the box graph in terms of an explicit resolution. We show this correspondence explicitly for the case of SU(5 by providing a map between box graphs and fiber faces, and thereby a sequence of algebraic resolutions of the Tate model, which realizes each of the box graphs.

  2. Decontamination of TRU glove boxes

    International Nuclear Information System (INIS)

    Crawford, J.H.

    1978-03-01

    Two glove boxes that had been used for work with transuranic nuclides (TRU) for about 12 years were decontaminated in a test program to collect data for developing a decontamination facility for large equipment highly contaminated with alpha emitters. A simple chemical technique consisting of a cycle of water flushes and alkaline permanganate and oxalic acid washes was used for both boxes. The test showed that glove boxes and similar equipment that are grossly contaminated with transuranic nuclides can be decontaminated to the current DIE nonretrievable disposal guide of <10 nCi TRU/g with a moderate amount of decontamination solution and manpower. Decontamination of the first box from an estimated 1.3 Ci to about 5 mCi (6 nCi/g) required 1.3 gallons of decontamination solution and 0.03 man-hour of work for each square foot of surface area. The second box was decontaminated from an estimated 3.4 Ci to about 2.8 mCi (4.2 nCi/g) using 0.9 gallon of decontamination solution and 0.02 man-hour for each square foot of surface area. Further reductions in contamination were achieved by repetitive decontamination cycles, but the effectiveness of the technique decreased sharply after the initial cycle

  3. The Effects of Chicken Box, Chick Paper Type and Flock Age on Sound Level and Leg Abnormalities in One-Day Old Chicks in the Hatchery

    OpenAIRE

    SALAHI, Ahmad; ESMAILIZADEH, ALI K.

    2014-01-01

    Abstract: Chicken box and chick paper are two important factors affecting quality of delivered chicks after hatching and packaging until arrival in rearing farms. In this study, characteristics of 70 samples of chicken boxes collected during two years in four hatcheries in Iran were surveyed. Winter and summer types of chicken boxes each with seven replicates including five chicken boxes were studied. The capacity, length, width, height, weight, area, total ventilation ducts  of  the boxes in...

  4. Glove boxes and similar containments

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    According to the present invention a glove box or similar containment is provided with an exhaust system including a vortex amplifier venting into the system, the vortex amplifier also having its main inlet in fluid flow connection with the containment and a control inlet in fluid flow connection with the atmosphere outside the containment. (U.S.)

  5. The Bird Box Survey Project

    Science.gov (United States)

    Willis, Patrick

    2014-01-01

    When high school students are asked what's the best part of science class, many will say it's the field trips. Students enjoy engaging in authentic, community-based science outside the classroom. To capitalize on this, Patrick Willis created the Bird Box Survey Project for his introductory field biology class. The project takes students…

  6. On the Dirichlet's Box Principle

    Science.gov (United States)

    Poon, Kin-Keung; Shiu, Wai-Chee

    2008-01-01

    In this note, we will focus on several applications on the Dirichlet's box principle in Discrete Mathematics lesson and number theory lesson. In addition, the main result is an innovative game on a triangular board developed by the authors. The game has been used in teaching and learning mathematics in Discrete Mathematics and some high schools in…

  7. Tight correlation between expression of the Forkhead transcription factor FOXM1 and HER2 in human breast cancer

    International Nuclear Information System (INIS)

    Bektas, Nuran; Haaf, Anette ten; Veeck, Jürgen; Wild, Peter Johannes; Lüscher-Firzlaff, Juliane; Hartmann, Arndt; Knüchel, Ruth; Dahl, Edgar

    2008-01-01

    FOXM1 regulates expression of cell cycle related genes that are essential for progression into DNA replication and mitosis. Consistent with its role in proliferation, elevated expression of FOXM1 has been reported in a variety of human tumour entities. FOXM1 is a gene of interest because recently chemical inhibitors of FOXM1 were described to limit proliferation and induce apoptosis in cancer cells in vitro, indicating that FOXM1 inhibitors could represent useful anticancer therapeutics. Using immunohistochemistry (IHC) we systematically analysed FOXM1 expression in human invasive breast carcinomas (n = 204) and normal breast tissues (n = 46) on a tissue microarray. Additionally, using semiquantitative realtime PCR, a collection of paraffin embedded normal (n = 12) and cancerous (n = 25) breast tissue specimens as well as benign (n = 3) and malignant mammary cell lines (n = 8) were investigated for FOXM1 expression. SPSS version 14.0 was used for statistical analysis. FOXM1 was found to be overexpressed in breast cancer in comparison to normal breast tissue both on the RNA and protein level (e.g. 8.7 fold as measured by realtime PCR). We found a significant correlation between FOXM1 expression and the HER2 status determined by HER2 immunohistochemistry (P < 0.05). Univariate survival analysis showed a tendency between FOXM1 protein expression and unfavourable prognosis (P = 0.110). FOXM1 may represent a novel breast tumour marker with prognostic significance that could be included into multi-marker panels for breast cancer. Interestingly, we found a positive correlation between FOXM1 expression and HER2 status, pointing to a potential role of FOXM1 as a new drug target in HER2 resistant breast tumour, as FOXM1 inhibitors for cancer treatment were described recently. Further studies are underway to analyse the potential interaction between FOXM1 and HER2, especially whether FOXM1 directly activates the HER2 promoter

  8. Tight correlation between expression of the Forkhead transcription factor FOXM1 and HER2 in human breast cancer

    Directory of Open Access Journals (Sweden)

    Hartmann Arndt

    2008-02-01

    Full Text Available Abstract Background FOXM1 regulates expression of cell cycle related genes that are essential for progression into DNA replication and mitosis. Consistent with its role in proliferation, elevated expression of FOXM1 has been reported in a variety of human tumour entities. FOXM1 is a gene of interest because recently chemical inhibitors of FOXM1 were described to limit proliferation and induce apoptosis in cancer cells in vitro, indicating that FOXM1 inhibitors could represent useful anticancer therapeutics. Methods Using immunohistochemistry (IHC we systematically analysed FOXM1 expression in human invasive breast carcinomas (n = 204 and normal breast tissues (n = 46 on a tissue microarray. Additionally, using semiquantitative realtime PCR, a collection of paraffin embedded normal (n = 12 and cancerous (n = 25 breast tissue specimens as well as benign (n = 3 and malignant mammary cell lines (n = 8 were investigated for FOXM1 expression. SPSS version 14.0 was used for statistical analysis. Results FOXM1 was found to be overexpressed in breast cancer in comparison to normal breast tissue both on the RNA and protein level (e.g. 8.7 fold as measured by realtime PCR. We found a significant correlation between FOXM1 expression and the HER2 status determined by HER2 immunohistochemistry (P P = 0.110. Conclusion FOXM1 may represent a novel breast tumour marker with prognostic significance that could be included into multi-marker panels for breast cancer. Interestingly, we found a positive correlation between FOXM1 expression and HER2 status, pointing to a potential role of FOXM1 as a new drug target in HER2 resistant breast tumour, as FOXM1 inhibitors for cancer treatment were described recently. Further studies are underway to analyse the potential interaction between FOXM1 and HER2, especially whether FOXM1 directly activates the HER2 promoter.

  9. Regulation of Lysosomal Function by the DAF-16 Forkhead Transcription Factor Couples Reproduction to Aging in Caenorhabditis elegans.

    Science.gov (United States)

    Baxi, Kunal; Ghavidel, Ata; Waddell, Brandon; Harkness, Troy A; de Carvalho, Carlos E

    2017-09-01

    Aging in eukaryotes is accompanied by widespread deterioration of the somatic tissue. Yet, abolishing germ cells delays the age-dependent somatic decline in Caenorhabditis elegans In adult worms lacking germ cells, the activation of the DAF-9/DAF-12 steroid signaling pathway in the gonad recruits DAF-16 activity in the intestine to promote longevity-associated phenotypes. However, the impact of this pathway on the fitness of normally reproducing animals is less clear. Here, we explore the link between progeny production and somatic aging and identify the loss of lysosomal acidity-a critical regulator of the proteolytic output of these organelles-as a novel biomarker of aging in C. elegans The increase in lysosomal pH in older worms is not a passive consequence of aging, but instead is timed with the cessation of reproduction, and correlates with the reduction in proteostasis in early adult life. Our results further implicate the steroid signaling pathway and DAF-16 in dynamically regulating lysosomal pH in the intestine of wild-type worms in response to the reproductive cycle. In the intestine of reproducing worms, DAF-16 promotes acidic lysosomes by upregulating the expression of v-ATPase genes. These findings support a model in which protein clearance in the soma is linked to reproduction in the gonad via the active regulation of lysosomal acidification. Copyright © 2017 by the Genetics Society of America.

  10. Cloning and Characterization of a Forkhead Transcription Factor Gene, FoxOla From Thirteen-Lined Ground Squirrel

    National Research Council Canada - National Science Library

    Cai, Decheng; McCarron, Richard M; Hallenbeck, John

    2004-01-01

    ... (Spermophilus tridecemlineatus). Hibernation is studied because it represents a unique state of reversible suspended animation associated with tolerance to an otherwise lethal reduction of core body temperature and metabolism...

  11. Evaluation of bike boxes at signalized intersections.

    Science.gov (United States)

    Dill, Jennifer; Monsere, Christopher M; McNeil, Nathan

    2012-01-01

    This paper presents a before-after study of bike boxes at 10 signalized intersections in Portland, Oregon. The bike boxes, also known as advanced stop lines or advanced stop boxes, were installed to increase visibility of cyclists and reduce conflicts between motor vehicles and cyclists, particularly in potential "right-hook" situations. Before and after video were analyzed for seven intersections with green bike boxes, three intersections with uncolored bike boxes, and two control intersections. User perceptions were measured through surveys of cyclists passing through five of the bike box intersections and of motorists working downtown, where the boxes were concentrated. Both the observations and survey of motorists found a high rate of compliance and understanding of the markings. Overall, 73% of the stopping motor vehicles did not encroach at all into the bike box. Both motor vehicle and bicycle encroachment in the pedestrian crosswalk fell significantly at the bike box locations compared to the control intersections. The bike boxes had mixed effects on the motorists' encroachment in the bicycle lane. The number of observed conflicts at the bike box locations decreased, while the total number of cyclists and motor vehicles turning right increased. Negative-binomial models based upon the data predict fewer conflicts with the boxes, particularly as right-turning motor vehicle volumes increase. Observations of yielding behavior at two bike box and one control intersection found an improvement in motorists yielding to cyclists at the bike box locations. Differences in the traffic volumes and location contexts make firm conclusions about the effects of green coloring of the boxes difficult. Higher shares of surveyed motorists felt that the bike boxes made driving safer rather than more dangerous, even when the sample was narrowed to respondents who were not also cyclists. Over three-quarters of the surveyed cyclists thought that the boxes made the intersection safer

  12. Structural and Functional Insights into WRKY3 and WRKY4 Transcription Factors to Unravel the WRKY–DNA (W-Box Complex Interaction in Tomato (Solanum lycopersicum L.. A Computational Approach

    Directory of Open Access Journals (Sweden)

    Mohd Aamir

    2017-05-01

    Full Text Available The WRKY transcription factors (TFs, play crucial role in plant defense response against various abiotic and biotic stresses. The role of WRKY3 and WRKY4 genes in plant defense response against necrotrophic pathogens is well-reported. However, their functional annotation in tomato is largely unknown. In the present work, we have characterized the structural and functional attributes of the two identified tomato WRKY transcription factors, WRKY3 (SlWRKY3, and WRKY4 (SlWRKY4 using computational approaches. Arabidopsis WRKY3 (AtWRKY3: NP_178433 and WRKY4 (AtWRKY4: NP_172849 protein sequences were retrieved from TAIR database and protein BLAST was done for finding their sequential homologs in tomato. Sequence alignment, phylogenetic classification, and motif composition analysis revealed the remarkable sequential variation between, these two WRKYs. The tomato WRKY3 and WRKY4 clusters with Solanum pennellii showing the monophyletic origin and evolution from their wild homolog. The functional domain region responsible for sequence specific DNA-binding occupied in both proteins were modeled [using AtWRKY4 (PDB ID:1WJ2 and AtWRKY1 (PDBID:2AYD as template protein structures] through homology modeling using Discovery Studio 3.0. The generated models were further evaluated for their accuracy and reliability based on qualitative and quantitative parameters. The modeled proteins were found to satisfy all the crucial energy parameters and showed acceptable Ramachandran statistics when compared to the experimentally resolved NMR solution structures and/or X-Ray diffracted crystal structures (templates. The superimposition of the functional WRKY domains from SlWRKY3 and SlWRKY4 revealed remarkable structural similarity. The sequence specific DNA binding for two WRKYs was explored through DNA-protein interaction using Hex Docking server. The interaction studies found that SlWRKY4 binds with the W-box DNA through WRKYGQK with Tyr408, Arg409, and Lys419 with the

  13. Evaluation for rigidity of box construction of nuclear reactor building

    International Nuclear Information System (INIS)

    Yamakawa, Tetsuo

    1979-01-01

    A huge box-shaped structure (hereafter, called box construction) of reinforced concrete is presently utilized as the reactor building structure in nuclear power plants. Evaluation of the rigidity of the huge box construction is required for making a vibration analysis model of nuclear reactor buildings. It is necessary to handle the box construction as the plates to which the force in plane is applied. This paper describes that the bending theory in elementary beam theory is equivalent to a peculiar, orthogonally anisotropic plate, the shearing rigidity and film rigidity in y direction of which are put to infinity and the Poisson's ratio is put to zero, viewed from the two-dimensional theory of elasticity. The form factor of 1.2 for shearing deformation in rectangular cross section was calculated from the parabolic distribution of shearing stress intensity, and it is the maximum value. The factor is equal to 1.2 for slender beams, but smaller than 1.2 for short and thick beams, having tendency to converge to 1.0. The non-conformity of boundary conditions regarding the shearing force at the both ends of cantilevers does not affect very seriously the evaluation of shearing rigidity. From the above results, it was found that the application of the theory to the box construction was able to give the rigidity evaluation with sufficient engineering accuracy. The theory can also be applied to the evaluation of tube type ultrahigh buildings. (Wakatsuki, Y.)

  14. Imbalances in T Cell-Related Transcription Factors Among Patients with Hashimoto’s Thyroiditis

    Directory of Open Access Journals (Sweden)

    Vahid Safdari

    2017-06-01

    Full Text Available Objectives: Imbalances in effector T cell functioning have been associated with a number of autoimmune diseases, including Hashimoto’s thyroiditis (HT. Differentiation of effector T helper (Th 1, Th2, Th17 and regulatory T cell (Treg lymphocytes is regulated by transcription factors, including Th1-specific T box (T-bet, GATA binding protein-3 (GATA3, retinoid-related orphan receptor (ROR-α and forkhead box P3 (FOXP3. This study aimed to investigate Th1/Th2, Th1/Treg, Th2/Treg and Th17/Treg balances at the level of these transcription factors. Methods: This study took place between October 2015 and August 2016. Peripheral blood mononuclear cells were collected from a control group of 40 healthy women recruited from the Zahedan University of Medical Sciences, Zahedan, Iran, and a patient group of 40 women with HT referred to the Hazrat Ali Asghar Hospital, Zahedan. Total ribonucleic acid extraction was performed and the gene expression of transcription factors was quantitated using a real-time polymerase chain reaction technique. Results: Expression of T-bet and GATA3 was significantly elevated, while FOXP3 expression was significantly diminished among HT patients in comparison with the controls (P = 0.03, 0.01 and 0.05, respectively. Expression of RORα was higher among HT patients, although this difference was not significant (P = 0.15. Expression of T-bet/FOXP3, GATA3/FOXP3 and RORα/FOXP3 ratios were increased among HT patients in comparison with the controls (P <0.02, <0.01 and <0.01, respectively. Conclusion: These results indicate that HT patients have imbalances in Th1/Treg, Th2/Treg and Th17/Treg lymphocytes at the level of the transcription factors, deviating towards Th1, Th2 and Th17 cells. Correction of these imbalances may therefore be therapeutic.

  15. El factor transcripcional Hcm1 en la regulación del metabolismo oxidativo en Saccharomyces cerevisiae

    OpenAIRE

    Rodríguez Colman, Maria José

    2013-01-01

    Hcm1, es un factor transcripcional de la familia de los forkhead en Saccharomyces cerevisiae. Los factores forkhead se encuentran evolutivamente conservados, desde levaduras hasta humanos. En mamíferos estos factores regulan diversos procesos, entre ellos el ciclo celular, la supervivencia y la proliferación en respuesta a factores de crecimiento. Además, los factores FoxM, FoxO y sus ortólogos, participan en procesos como el envejecimiento y en enfermedades como el cáncer. Los estudios sobre...

  16. The Heuristic Interpretation of Box Plots

    Science.gov (United States)

    Lem, Stephanie; Onghena, Patrick; Verschaffel, Lieven; Van Dooren, Wim

    2013-01-01

    Box plots are frequently used, but are often misinterpreted by students. Especially the area of the box in box plots is often misinterpreted as representing number or proportion of observations, while it actually represents their density. In a first study, reaction time evidence was used to test whether heuristic reasoning underlies this…

  17. Water box for steam generator

    International Nuclear Information System (INIS)

    Lecomte, Robert; Viaud, Michel.

    1975-01-01

    This invention relates to a water box for connecting an assembly composed of a vertical steam generator and a vertical pump to the vessel of the nuclear reactor, the assembly forming the primary cooling system of a pressurised water reactor. This invention makes it easy to dismantle the pump on the water box without significant loss of water in the primary cooling system of the reactor and particularly without it being necessary to drain the water contained in the steam generator beforehand. It makes it possible to shorten the time required for dismantling the primary pump in order to service or repair it and makes dismantling safer in that the dismantling does not involve draining the steam generator and therefore the critical storage of a large amount of cooling water that has been in contact with the fuel assemblies of the nuclear reactor core [fr

  18. Autoantibodies to box A of high mobility group box 1 in systemic lupus erythematosus

    NARCIS (Netherlands)

    Schaper, F.; de Leeuw, K.; Horst, G.; Maas, F.; Bootsma, H.; Heeringa, P.; Limburg, P. C.; Westra, J.

    Autoantibodies to nuclear structures are a hallmark of systemic lupus erythematosus (SLE), including autoantibodies to nuclear protein high mobility group box 1 (HMGB1). HMGB1 consists of three separate domains: box A, box B and an acidic tail. Recombinant box A acts as a competitive antagonist for

  19. Autoantibodies to box A of high mobility group box 1 in systemic lupus erythematosus

    NARCIS (Netherlands)

    Schaper, F.; Leeuw, K. de; Horst, G. ter; Maas, F.; Bootsma, H.; Heeringa, P.; Limburg, P.C.; Westra, J.

    2017-01-01

    Autoantibodies to nuclear structures are a hallmark of systemic lupus erythematosus (SLE), including autoantibodies to nuclear protein high mobility group box 1 (HMGB1). HMGB1 consists of three separate domains: box A, box B and an acidic tail. Recombinant box A acts as a competitive antagonist for

  20. Numerical analysis of biological clogging in two-dimensional sand box experiments

    DEFF Research Database (Denmark)

    Kildsgaard, J.; Engesgaard, Peter Knudegaard

    2001-01-01

    with the assumed linear constant Kd behaviour. It is demonstrated that the dimensionality of sand box experiments in comparison to column experiments results in a much lower reduction in hydraulic conductivity Žfactor of 100. and that the bulk hydraulic conductivity of the sand box decreased only slightly. However......Two-dimensional models for biological clogging and sorptive tracer transport were used to study the progress of clogging in a sand box experiment. The sand box had been inoculated with a strip of bacteria and exposed to a continuous injection of nitrate and acetate. Brilliant Blue was regularly...

  1. Box-shaped halophilic bacteria.

    OpenAIRE

    Javor, B; Requadt, C; Stoeckenius, W

    1982-01-01

    Three morphologically similar strains of halophilic, box-shaped procaryotes have been isolated from brines collected in the Sinai, Baja California (Mexico), and southern California (United States). Although the isolates in their morphology resemble Walsby's square bacteria, which are a dominant morphological type in the Red Sea and Baja California brines, they are probably not identical to them. The cells show the general characteristics of extreme halophiles and archaebacteria. They contain ...

  2. The Design of the Orthogonal Box Cavity

    Energy Technology Data Exchange (ETDEWEB)

    Moretti, Alfred; /Fermilab

    2010-09-15

    The muon collider and/or the neutrino factory require large accelerating electric field gradients immersed in large (3 to 6 T) solenoidal magnetic fields for ionization cooling of muon beams. Our original vacuum breakdown study demonstrated a loss of achievable peak accelerating gradient in solenoidal magnetic fields by a factor 2 or greater. The Muon Collaboration has developed a theory of a method to suppress high electric field breakdown in vacuum cavities needed for a Muon collider or neutrino factory. It has been shown in our studies and by others that high gradient electric field emitted electrons (dark current) are the primary cause of breakdown. A DC magnetic field orthogonal to the RF electric accelerating field prevents dark current high field emitted electrons from traveling across the accelerating gap and then will prevent breakdown. We have decided to test this theory by building a special cavity in the shape of vacuum box. Figure 1 is a simplified view of the cavity design. The design is based on an 805 MHz WR975 waveguide cavity resonating in the TE{sub 101} mode. For the TE{sub 101} mode the resonant frequency f{sub 0} is given by the relationship f{sub 0} = c[(I/a){sup 2} + (m/b){sup 2} + (n/d){sup 2}]{sup 0.5}/2 where a and d are the lengths of the base sides and b is the height of the box in MKS units and c is the velocity of light.

  3. Functional and evolutionary studies of type I MADS box genes in Petunia hybrida and arabidopsis thaliana

    NARCIS (Netherlands)

    Bemer, Marian

    2008-01-01

    MADS-box genes are very important for plant development and especially for the formation of the flower. The MADS box family of transcription factors in plants can be subdivided into two classes: the MIKC-type genes, which play essential roles in flower formation, and the type I genes, which are

  4. Computational Fluid Dynamics Analysis of Flexible Duct Junction Box Design

    Energy Technology Data Exchange (ETDEWEB)

    Beach, Robert [IBACOS Inc., Pittsburgh, PA (United States); Prahl, Duncan [IBACOS Inc., Pittsburgh, PA (United States); Lange, Rich [IBACOS Inc., Pittsburgh, PA (United States)

    2013-12-01

    IBACOS explored the relationships between pressure and physical configurations of flexible duct junction boxes by using computational fluid dynamics (CFD) simulations to predict individual box parameters and total system pressure, thereby ensuring improved HVAC performance. Current Air Conditioning Contractors of America (ACCA) guidance (Group 11, Appendix 3, ACCA Manual D, Rutkowski 2009) allows for unconstrained variation in the number of takeoffs, box sizes, and takeoff locations. The only variables currently used in selecting an equivalent length (EL) are velocity of air in the duct and friction rate, given the first takeoff is located at least twice its diameter away from the inlet. This condition does not account for other factors impacting pressure loss across these types of fittings. For each simulation, the IBACOS team converted pressure loss within a box to an EL to compare variation in ACCA Manual D guidance to the simulated variation. IBACOS chose cases to represent flows reasonably correlating to flows typically encountered in the field and analyzed differences in total pressure due to increases in number and location of takeoffs, box dimensions, and velocity of air, and whether an entrance fitting is included. The team also calculated additional balancing losses for all cases due to discrepancies between intended outlet flows and natural flow splits created by the fitting. In certain asymmetrical cases, the balancing losses were significantly higher than symmetrical cases where the natural splits were close to the targets. Thus, IBACOS has shown additional design constraints that can ensure better system performance.

  5. Chromatin remodeling mediated by the FOXA1/A2 transcription factors activates CFTR expression in intestinal epithelial cells.

    Science.gov (United States)

    Kerschner, Jenny L; Gosalia, Nehal; Leir, Shih-Hsing; Harris, Ann

    2014-04-01

    The forkhead box A transcription factors, FOXA1 and FOXA2, function as pioneer factors to open condensed chromatin and facilitate binding of other proteins. We showed previously that these factors are key components of a transcriptional network that drives enhancer function at the cystic fibrosis transmembrane conductance regulator (CFTR) locus in intestinal epithelial cells. The CFTR promoter apparently lacks tissue-specific regulatory elements and expression of the gene is controlled by multiple cis-acting elements, which coordinate gene expression in different cell types. Here we show that concurrent depletion of FOXA1 and FOXA2 represses CFTR expression and alters the three-dimensional architecture of the active locus by diminishing interactions between the promoter and intronic cis-acting elements. Reduction of FOXA1/A2 also modifies the enrichment profile of the active enhancer marks H3K27ac and H3K4me2 across the CFTR locus and alters chromatin accessibility at individual cis-elements. Moreover, loss of FOXA1/A2 suppresses the recruitment of other members of the transcriptional network including HNF1 and CDX2, to multiple cis-elements. These data reveal a complex molecular mechanism underlying the role of FOXA1/A2 in achieving high levels of CFTR expression in intestinal epithelial cells.

  6. Osteo-articular, mammographic and thoracic films: clinical evaluation of digital view box versus conventional view box.

    Science.gov (United States)

    Magarelli, N; Guglielmi, G; Savastano, M A; Toro, V; Mattei, P A; Bonomo, L

    2002-01-01

    To compare in a clinical setting a conventional view box with a digital view box (Smart Light 2000 Digital Film Viewer System, Smart Light, Israel) in the identification of osteo-articular, mammographic and thoracic lesions. Six radiologists (two for each imaging procedure), experts in osteo-articular, mammographic and thoracic diseases, independently, compared 600 plain films (100 patient with two projections for each imaging procedure). The radiologists evaluated the films by filling-out a multiple choice questionnaire containing questions concerning the type of pathology seen and the technical quality of the radiography in terms of exposure along with specific questions concerning each of the imaging procedures. We observed a higher sensitivity of the digital view box for lesion identification (p 0.75). The better lesion perception derived from the increase luminance of the digital view box in the evaluation of higher film densities, such as in overexposed films. DISCUSSION. The technical characteristics of the digital view box reduce or eliminate negative factors that reduce perceptional performance, and often permit the recovery of films that would have otherwise been considered technically unreadable.

  7. Voronoi Diagrams Without Bounding Boxes

    Science.gov (United States)

    Sang, E. T. K.

    2015-10-01

    We present a technique for presenting geographic data in Voronoi diagrams without having to specify a bounding box. The method restricts Voronoi cells to points within a user-defined distance of the data points. The mathematical foundation of the approach is presented as well. The cell clipping method is particularly useful for presenting geographic data that is spread in an irregular way over a map, as for example the Dutch dialect data displayed in Figure 2. The automatic generation of reasonable cell boundaries also makes redundant a frequently used solution to this problem that requires data owners to specify region boundaries, as in Goebl (2010) and Nerbonne et al (2011).

  8. Hot cells and glove boxes

    International Nuclear Information System (INIS)

    1992-05-01

    Hot cells and glove boxes have been designed and developed to conduct operations involving radioactive materials which require some degree of manipulation. Glove boxes were developed to manipulate alpha emitters. As their name indicates, these are airtight boxes usually constructed with transparent, see-through walls. Operations are conducted inside by means of gloves or mechanic manipulators. These boxes are also used for biological-protection purposes, e.g., manipulation of viruses or similar applications. Basically, hot cells are used for: - radioisotope fractionning and purification; - post-irradiation studies, and - tests or sundry operations involving radiological or biological protection. These shielded cells are constructed on a supporting structure made out of steel and antimonious Pb bricks with airtight inner enclosures and lead-glass windows. Operations are conducted by means of remote telemanipulators. Airtight enclosures are made out of a stainless steel structure forming an Omega-shaped profile on the openings which are fitted with acrylic panels. Tight-proof insulation is achieved by means of appropriate joints placed between the structure and acrylic plates. Electric passage ducts for fluids or electrical conductors also preserve absolute hermeticity. The partition enclosures are placed on supporting tables made out of normalized sections and steel plates. If needed, enclosures, may be removed and replaced by others. For materials-transference purposes, these cells are provided with shielded doors, air-tight doors and a connecting duct between the tight-proof enclosures with a guillotine-type gate and a pneumatic remote-control coupling/uncoupling system. Each work post is provided with an operations console and a control cabinet with depression indicating manometers, input inlet valves and electrical interconnecting boards. A desk-type console centralizes operation commands which will take place inside the enclosures. Appropriate lighting has been

  9. Two high-mobility group box domains act together to underwind and kink DNA

    International Nuclear Information System (INIS)

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.

    2015-01-01

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA

  10. USING TEXT MINING TECHNIQUES TO ANALYZE HOW MOVIE FORUMS AFFECT THE BOX OFFICE

    OpenAIRE

    I-ping Chiang; Yean-Fu Wen; Yu-Chun Luo; Ming-Chien Li; Chiao-Ying Hsu

    2014-01-01

    As a forecasting tool, audience movie reviews provide a guide for film companies. This study uses a text mining technique to analyze the American film market. It explores movie reviews including word of mouth (WOM) factors (i.e., movie content, positive, negative, and promotion) and related factors (i.e., time, rating, and the number of ratings) for the box office. According to the relationship between the keyword clusters, the major factors that affect the box office are determined. The find...

  11. Enhancer-binding proteins with a forkhead-associated domain and the sigma(54) regulon in Myxococcus xanthus fruiting body development

    DEFF Research Database (Denmark)

    Jelsbak, Lars; Givskov, Michael Christian; Kaiser, D.

    2005-01-01

    In response to starvation, Myxococcus xanthus initiates a developmental program that results in the formation of spore-filled, multicellular fruiting bodies. Many developmentally regulated genes in M. xanthus are transcribed from sigma(54) promoters, and these genes require enhancer......-binding proteins. Here we report the finding of an unusual group of 12 genes encoding sigma(54)-dependent enhancer-binding proteins containing a forkhead-associated (FHA) domain as their N-terminal sensory domain. FHA domains in other proteins recognize phosphothreonine residues. An insertion mutation in one...

  12. Box graphs and singular fibers

    International Nuclear Information System (INIS)

    Hayashi, Hirotaka; Lawrie, Craig; Morrison, David R.; Schäfer-Nameki, Sakura

    2014-01-01

    We determine the higher codimension fibers of elliptically fibered Calabi-Yau fourfolds with section by studying the three-dimensional N=2 supersymmetric gauge theory with matter which describes the low energy effective theory of M-theory compactified on the associated Weierstrass model, a singular model of the fourfold. Each phase of the Coulomb branch of this theory corresponds to a particular resolution of the Weierstrass model, and we show that these have a concise description in terms of decorated box graphs based on the representation graph of the matter multiplets, or alternatively by a class of convex paths on said graph. Transitions between phases have a simple interpretation as “flopping' of the path, and in the geometry correspond to actual flop transitions. This description of the phases enables us to enumerate and determine the entire network between them, with various matter representations for all reductive Lie groups. Furthermore, we observe that each network of phases carries the structure of a (quasi-)minuscule representation of a specific Lie algebra. Interpreted from a geometric point of view, this analysis determines the generators of the cone of effective curves as well as the network of flop transitions between crepant resolutions of singular elliptic Calabi-Yau fourfolds. From the box graphs we determine all fiber types in codimensions two and three, and we find new, non-Kodaira, fiber types for E 6 , E 7 and E 8

  13. A holistic review on the autoimmune disease vitiligo with emphasis on the causal factors.

    Science.gov (United States)

    Patel, Seema; Rauf, Abdur; Khan, Haroon; Meher, Biswa Ranjan; Hassan, Syed Shams Ul

    2017-08-01

    Vitiligo is an idiopathic systemic autoimmune disease affecting skin, hair and oral mucosa. This genetic yet acquired disease characterized by melanin loss is a cause of morbidity across all races. Though thyroid disturbance has been recognized as a key trigger of this pathology, an array of other factors plays critical role in its manifestation. Multiple hormones (corticotropin-releasing hormone, adrenocorticotropic hormone, α-melanocyte-stimulating hormone, melatonin, calcitriol, testosterone, estrogen), genes (Human leukocyte antigen (HLA), Cytotoxic T lymphocyte-associated antigen 4 (CTLA-4), Forkhead box D3 (FOXD3), Cluster of differentiation 117 (CD117), Estrogen receptor (ESR) 1, Cyclooxygenase-2 (COX2), Vitiligo-associated protein 1 (VIT1)), and lifestyle choices (stress, diet, cosmetic products, and medications) have been suspected as drivers of this disorder. The pathological mechanisms have been understood in recent times, with the aid of genomic studies; however a universally-effective therapy is yet to be achieved. This review discusses these under-investigated facets of vitiligo onset and progression; hence, it is expected to enrich vitiligo research. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Lessons from the light-cone box

    CERN Document Server

    Leibbrandt, G

    2000-01-01

    Working in the noncovariant light-cone gauge, we discuss the explicit computation of the 1PI four-point function ("box diagram") in Yang- Mills theory. The complete box diagram which consists of 16 box subdiagrams, 8 lynx subdiagrams and 4 fish subdiagrams, yields both local and nonlocal UV divergent terms. The nonlocal terms are consistent with gauge symmetry and correspond to a nonlocal renormalization of the wave function. (14 refs).

  15. Repackaging SRS Black Box TRU Waste

    International Nuclear Information System (INIS)

    Swale, D. J.; Stone, K.A.; Milner, T. N.

    2006-01-01

    Historically, large items of TRU Waste, which were too large to be packaged in drums for disposal have been packaged in various sizes of custom made plywood boxes at the Savannah River Site (SRS), for many years. These boxes were subsequently packaged into large steel ''Black Boxes'' for storage at SRS, pending availability of Characterization and Certification capability, to facilitate disposal of larger items of TRU Waste. There are approximately 107 Black Boxes in inventory at SRS, each measuring some 18' x 12' x 7', and weighing up to 45,000 lbs. These Black Boxes have been stored since the early 1980s. The project to repackage this waste into Standard Large Boxes (SLBs), Standard Waste Boxes (SWB) and Ten Drum Overpacks (TDOP), for subsequent characterization and WIPP disposal, commenced in FY04. To date, 10 Black Boxes have been repackaged, resulting in 40 SLB-2's, and 37 B25 overpack boxes, these B25's will be overpacked in SLB-2's prior to shipping to WIPP. This paper will describe experience to date from this project

  16. The three-box paradox revisited

    International Nuclear Information System (INIS)

    Ravon, Tamar; Vaidman, Lev

    2007-01-01

    The classical three-box paradox of Kirkpatrick (2003 J. Phys. A: Math. Gen. 36 4891) is compared to the original quantum three-box paradox of Aharonov and Vaidman (1991 J. Phys. A: Math. Gen. 24 2315). It is argued that the quantum three-box experiment is a 'quantum paradox' in the sense that it is an example of a classical task which cannot be accomplished using classical means, but can be accomplished using quantum devices. It is shown that Kirkpatrick's card game is analogous to a different game with a particle in three boxes which does not contain paradoxical features

  17. IMPROVED, FAVORABLE FOR ENVIRONMENT POLYURETHANE COLD-BOX-PROCESS (COLD BOX «HUTTENES-ALBERTUS» .

    Directory of Open Access Journals (Sweden)

    A. Sergini

    2005-01-01

    Full Text Available The results of the laboratory and industrial investigations, the purpose of which is improvement of the classical Cold-box-process, i.e. the process of the slugs hardening in cold boxes, are presented.

  18. VORONOI DIAGRAMS WITHOUT BOUNDING BOXES

    Directory of Open Access Journals (Sweden)

    E. T. K. Sang

    2015-10-01

    Full Text Available We present a technique for presenting geographic data in Voronoi diagrams without having to specify a bounding box. The method restricts Voronoi cells to points within a user-defined distance of the data points. The mathematical foundation of the approach is presented as well. The cell clipping method is particularly useful for presenting geographic data that is spread in an irregular way over a map, as for example the Dutch dialect data displayed in Figure 2. The automatic generation of reasonable cell boundaries also makes redundant a frequently used solution to this problem that requires data owners to specify region boundaries, as in Goebl (2010 and Nerbonne et al (2011.

  19. MADS goes genomic in conifers: towards determining the ancestral set of MADS-box genes in seed plants.

    Science.gov (United States)

    Gramzow, Lydia; Weilandt, Lisa; Theißen, Günter

    2014-11-01

    MADS-box genes comprise a gene family coding for transcription factors. This gene family expanded greatly during land plant evolution such that the number of MADS-box genes ranges from one or two in green algae to around 100 in angiosperms. Given the crucial functions of MADS-box genes for nearly all aspects of plant development, the expansion of this gene family probably contributed to the increasing complexity of plants. However, the expansion of MADS-box genes during one important step of land plant evolution, namely the origin of seed plants, remains poorly understood due to the previous lack of whole-genome data for gymnosperms. The newly available genome sequences of Picea abies, Picea glauca and Pinus taeda were used to identify the complete set of MADS-box genes in these conifers. In addition, MADS-box genes were identified in the growing number of transcriptomes available for gymnosperms. With these datasets, phylogenies were constructed to determine the ancestral set of MADS-box genes of seed plants and to infer the ancestral functions of these genes. Type I MADS-box genes are under-represented in gymnosperms and only a minimum of two Type I MADS-box genes have been present in the most recent common ancestor (MRCA) of seed plants. In contrast, a large number of Type II MADS-box genes were found in gymnosperms. The MRCA of extant seed plants probably possessed at least 11-14 Type II MADS-box genes. In gymnosperms two duplications of Type II MADS-box genes were found, such that the MRCA of extant gymnosperms had at least 14-16 Type II MADS-box genes. The implied ancestral set of MADS-box genes for seed plants shows simplicity for Type I MADS-box genes and remarkable complexity for Type II MADS-box genes in terms of phylogeny and putative functions. The analysis of transcriptome data reveals that gymnosperm MADS-box genes are expressed in a great variety of tissues, indicating diverse roles of MADS-box genes for the development of gymnosperms. This study is

  20. Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

    Science.gov (United States)

    Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

    2015-11-01

    The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

  1. Electrical requirements for unshielded glove boxes

    International Nuclear Information System (INIS)

    1978-02-01

    The specification relates to the general design and installation of electrical services required in unshielded glove boxes in which atmospheres of air, argon or nitrogen etc. may exist either temporarily or permanently. The specification does not apply to electrical services for glove boxes with flammable explosive atmospheres. (author)

  2. A boxing procedure for corrected cast impressions.

    Science.gov (United States)

    Ansari, I H

    1994-01-01

    This new method for boxing a corrected cast impression for a distal extension removable partial denture improves the procedure. The framework with its impression is seated on the remainder of the cast after anatomic ridges have been removed and luted with sticky wax, and the assembly is inserted into a previously formed thermoplastic box and poured to make a new corrected cast.

  3. The Roles of T-Box Genes in Vertebrate Limb Development.

    Science.gov (United States)

    Sheeba, C J; Logan, M P O

    2017-01-01

    Members of the T-box gene family have diverse roles during embryogenesis and many play critical roles in the developing limb. This is exemplified by the fact that, in humans, mutations in T-box genes are associated with several congenital syndromes that include limb defects as part of their characteristic spectrum of abnormalities. T-box genes encode for evolutionary conserved transcription factors that include both transcriptional activators and repressors. The hallmark of T-box gene members is the presence of the eponymous DNA-binding T-box domain. There are 17 mammalian T-box genes, which based on the sequence homology of the T-box domain, are grouped into five subfamilies, namely, T, Tbx1, Tbx2, Tbx6, and Tbr1. At least nine T-box genes are expressed during limb development with distinct and dynamic expression patterns. All four members of Tbx2 subfamily (Tbx2, Tbx3, Tbx4, Tbx5) and three members of Tbx1 (Tbx1, Tbx15, Tbx18), Brachyury (T) and Eomes (Tbr2) are expressed in the developing limb. © 2017 Elsevier Inc. All rights reserved.

  4. 49 CFR 178.515 - Standards for reconstituted wood boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Standards for reconstituted wood boxes. 178.515... wood boxes. (a) The identification code for a reconstituted wood box is 4F. (b) Construction requirements for reconstituted wood boxes are as follows: (1) The walls of boxes must be made of water...

  5. North American box turtles: A natural history

    Science.gov (United States)

    Dodd, C. Kenneth

    2002-01-01

    Once a familiar backyard visitor in many parts of the United States and Mexico, the box turtle is losing the battle against extinction. In North American Box Turtles, C. Kenneth Dodd, Jr., has written the first book-length natural history of the twelve species and subspecies of this endangered animal. This volume includes comprehensive information on the species’ evolution, behavior, courtship and reproduction, habitat use, diet, population structure, systematics, and disease. Special features include color photos of all species, subspecies, and their habitats; a simple identification guide to both living and fossil species; and a summary of information on fossil Terrapene and Native uses of box turtles. End-of-chapter sections highlight future research directions, including the need for long-term monitoring and observation of box turtles within their natural habitat and conservation applications. A glossary and a bibliography of literature on box turtles accompany the text.

  6. Gamma-ray boxes from axion-mediated dark matter

    International Nuclear Information System (INIS)

    Ibarra, Alejandro; Gehler, Sergio López; Pato, Miguel; Lee, Hyun Min; Park, Wan-Il

    2013-01-01

    We compute the gamma-ray output of axion-mediated dark matter and derive the corresponding constraints set by recent data. In such scenarios the dark matter candidate is a Dirac fermion that pair-annihilates into axions and/or scalars. Provided that the axion decays (at least partly) into photons, these models naturally give rise to a box-shaped gamma-ray spectrum that may present two distinct phenomenological behaviours: a narrow box, resembling a line at half the dark matter mass, or a wide box, spanning an extensive energy range up to the dark matter mass. Remarkably, we find that in both cases a sizable gamma-ray flux is predicted for a thermal relic without fine-tuning the model parameters nor invoking boost factors. This large output is in line with recent Fermi-LAT observations towards the galactic centre region and is on the verge of being excluded. We then make use of the Fermi-LAT and H.E.S.S. data to derive robust, model-independent upper limits on the dark matter annihilation cross section for the narrow and wide box scenarios. H.E.S.S. constraints, in particular, turn out to match the ones from Fermi-LAT at hundreds of GeV and extend to multi-TeV masses. Future Čerenkov telescopes will likely probe gamma-ray boxes from thermal dark matter relics in the whole multi-TeV range, a region hardly accessible to direct detection, collider searches and other indirect detection strategies

  7. Regulating the ethylene response of a plant by modulation of F-box proteins

    Science.gov (United States)

    Guo, Hongwei [Beijing, CN; Ecker, Joseph R [Carlsbad, CA

    2014-01-07

    The relationship between F-box proteins and proteins invovled in the ethylene response in plants is described. In particular, F-box proteins may bind to proteins involved in the ethylene response and target them for degradation by the ubiquitin/proteasome pathway. The transcription factor EIN3 is a key transcription factor mediating ethylne-regulated gene expression and morphological responses. EIN3 is degraded through a ubiquitin/proteasome pathway mediated by F-box proteins EBF1 and EBF2. The link between F-box proteins and the ethylene response is a key step in modulating or regulating the response of a plant to ethylene. Described herein are transgenic plants having an altered sensitivity to ethylene, and methods for making transgenic plant haing an althered sensitivity to ethylene by modulating the level of activity of F-box proteins. Methods of altering the ethylene response in a plant by modulating the activity or expression of an F-box protein are described. Also described are methods of identifying compounds that modulate the ethylene response in plants by modulating the level of F-box protein expression or activity.

  8. Epidemiologic determinants of aural abscessation in free-living eastern box turtles (Terrapene carolina) in Virginia.

    Science.gov (United States)

    Brown, Justin D; Sleeman, Jonathan M; Elvinger, François

    2003-10-01

    Epidemiologic determinants of 46 cases of aural abscessation in free-living eastern box turtles (Terrapene carolina) admitted to the Wildlife Center of Virginia (Virginia, USA) from 1991 to 2000 were evaluated. County human population density, year and season of admission, weight, and sex did not affect the risk for box turtles to develop aural abscessation. Counties with cases of aural abscessation were not randomly distributed, but rather were clustered into two multi-county regions. Geographic location was the only risk factor associated with aural abscessation in box turtles found in this study. Possible etiologies could include chronic infectious disease, malnutrition, or chronic exposure to environmental contamination with organochlorine compounds.

  9. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  10. Enhancer-binding proteins with a forkhead-associated domain and the sigma(54) regulon in Myxococcus xanthus fruiting body development

    DEFF Research Database (Denmark)

    Jelsbak, Lars; Givskov, Michael Christian; Kaiser, D.

    2005-01-01

    of these genes, Mx4885, caused a cell autonomous aggregation and sporulation defect. In-frame deletion mutants showed that the FHA domain is necessary for proper Mx4885 function. The altered pattern of developmental gene expression in the mutant implied that Mx4885 is on the pathway of response...... donor cell. Because FHA domains respond to phosphothreonine-containing proteins, these results suggest a regulatory link to the abundant Ser/Thr protein kinases in M. xanthus.......-binding proteins. Here we report the finding of an unusual group of 12 genes encoding sigma(54)-dependent enhancer-binding proteins containing a forkhead-associated (FHA) domain as their N-terminal sensory domain. FHA domains in other proteins recognize phosphothreonine residues. An insertion mutation in one...

  11. An Introduction to Plum Blossom Boxing: History, Culture and Practice

    Directory of Open Access Journals (Sweden)

    Guodong Zhang

    2012-07-01

    Full Text Available Meihuaquan (“Plum Blossom Fist [Boxing]” has traditionally been practiced as vernacular (folk art practiced among the Han ethnic group residing in the Shandong, Henan and Hebei Provinces of China. Historical documentation dates Plum Blossom Boxing to the seventeenth century. The classic Chinese novel, Shuǐhǔ Zhuàn (Marsh Chronicles recounts the martial exploits of Shandong’s twelfth century outlaw heroes who may have been Mei Boxers, also. Thus, for perhaps a millennium, the region has been noted for vernacular martial arts and social banditry. The region’s rampant lawlessness promoted highly-developed martial prowess among both lawbreakers and those who were required to protect themselves against the brigands. Cultural, economic, and environmental factors in the region gave rise to heterodox political and religious beliefs that frequently served as a catalyst for martial sects, most notably the “Boxers” who at the turn of the twentieth century, came into conflict with the imperial government. These factors laid the groundwork for the “character traits” of the art while Taoism, the Five Elements theory, and a concept of predictable change shaped Plum Boxing’s strategic and mechanical principles. In the past decade, there have been efforts to globalize this vernacular martial art. Rather than driving Plum Boxing to extinction it is likely that the folk and the “larger than local” will co-exist.

  12. Study of plutonium fire extinction in glove-boxes

    International Nuclear Information System (INIS)

    Boisson, H.; Chappellier, A.; Debiar, A.; Savornin, J.

    1965-01-01

    The report concerns attempts to extinguish fire in uranium - chosen as a basis for comparison - and in plutonium, these being contained in glove boxes. The extinguishing powders TEC and MG 10 were tried and compared. The operator used in plastic bags. The metal was dealt with respectively in the form of billets, compact chips and finally thin shavings. In each case fire control was without difficulty. One must allow a certain time for cooling. The powder MG 10 showed very good results. Moreover, the trials proved that densely packed shavings are a very real security factor. The interior lay-out of the glove boxes ought, in order to facilitate further manipulations, be such as to render extinction as easy as possible should the need arise. (authors) [fr

  13. Packing a cake into a box

    KAUST Repository

    Skopenkov, Mikhail

    2011-05-01

    Given a triangular cake and a box in the shape of its mirror image, how can the cake be cut into a minimal number of pieces so that it can be put into the box? The cake has icing, so we are not allowed to put it into the box upside down. V. G. Boltyansky asked this question in 1977 and showed that three pieces always suffice. In this paper we provide examples of cakes that cannot be cut into two pieces to be put into the box. This shows that three is the answer to Boltyansky\\'s question. We also give examples of cakes which can be cut into two pieces. © THE MATHEMATICAL ASSOCIATION OF AMERICA.

  14. Spacer for supporting fuel element boxes

    International Nuclear Information System (INIS)

    Wild, E.

    1979-01-01

    A spacer plate unit arranged externally on each side and at a predetermined level of a polygonal fuel element box for mutually supporting, with respect to one another, a plurality of the fuel element boxes forming a fuel element bundle, is formed of a first and a second spacer plate part each having the same length and the same width and being constituted of unlike first and second materials, respectively. The first and second spacer plate parts of the several spacer plate units situated at the predetermined level are arranged in an alternating continuous series when viewed in the peripheral direction of the fuel element box, so that any two spacer plate units belonging to face-to-face oriented sides of two adjoining fuel element boxes in the fuel element bundle define interfaces of unlike materials

  15. Glove boxes. Dimensions and requirements. Draft

    International Nuclear Information System (INIS)

    1985-07-01

    The standard is to be applied to work done in glove-boxes, whereby either the personnel need to be protected from the damaging effects of the materials being handled, or the materials from the effects of the environment. It is to be applied to glove-boxes in which substances are handled which emit ionising radiation (radioactive substances). This norm is not restricted to glove-boxes in which processes are carried out on a technique scale. In accordance with this norm, only those pressures and temperatures are allowed to be present in the glove-boxes, that do not offer significantly from the work areas. Alongside the stipulations of this standard regard is also always to be taken of the regulations in the radiation protection ordinance. (orig./HP) [de

  16. Cosmetic Foot Surgery: Fashion's Pandora's Box

    Science.gov (United States)

    ... A A A | Print | Share Cosmetic Foot Surgery: Fashion’s Pandora’s Box? Foot and ankle surgeons warn against ... a "face lift" and fit them into high-fashion shoes. But physician members of the American College ...

  17. Black-Box Search by Unbiased Variation

    DEFF Research Database (Denmark)

    Lehre, Per Kristian; Witt, Carsten

    2012-01-01

    The complexity theory for black-box algorithms, introduced by Droste, Jansen, and Wegener (Theory Comput. Syst. 39:525–544, 2006), describes common limits on the efficiency of a broad class of randomised search heuristics. There is an obvious trade-off between the generality of the black-box model...... and the strength of the bounds that can be proven in such a model. In particular, the original black-box model provides for well-known benchmark problems relatively small lower bounds, which seem unrealistic in certain cases and are typically not met by popular search heuristics.In this paper, we introduce a more...... restricted black-box model for optimisation of pseudo-Boolean functions which we claim captures the working principles of many randomised search heuristics including simulated annealing, evolutionary algorithms, randomised local search, and others. The key concept worked out is an unbiased variation operator...

  18. ENERGY STAR Certified Set Top Boxes

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 5.1 ENERGY STAR Program Requirements for Set-top Boxes that are effective as of January...

  19. A Lithium Vapor Box Divertor Similarity Experiment

    Science.gov (United States)

    Cohen, Robert A.; Emdee, Eric D.; Goldston, Robert J.; Jaworski, Michael A.; Schwartz, Jacob A.

    2017-10-01

    A lithium vapor box divertor offers an alternate means of managing the extreme power density of divertor plasmas by leveraging gaseous lithium to volumetrically extract power. The vapor box divertor is a baffled slot with liquid lithium coated walls held at temperatures which increase toward the divertor floor. The resulting vapor pressure differential drives gaseous lithium from hotter chambers into cooler ones, where the lithium condenses and returns. A similarity experiment was devised to investigate the advantages offered by a vapor box divertor design. We discuss the design, construction, and early findings of the vapor box divertor experiment including vapor can construction, power transfer calculations, joint integrity tests, and thermocouple data logging. Heat redistribution of an incident plasma-based heat flux from a typical linear plasma device is also presented. This work supported by DOE Contract No. DE-AC02-09CH11466 and The Princeton Environmental Institute.

  20. Weld Residual Stress in Corner Boxing Joints

    OpenAIRE

    Kazuyoshi, Matsuoka; Tokuharu, Yoshii; Ship Research Institute, Ministry of Transport; Ship Research Institute, Ministry of Transport

    1998-01-01

    Fatigue damage often occurs in corner boxing welded joints because of stress concentration and residual stress. The hot spot stress approach is applicable to stress concentration. However, the number of suitable methods for estimating residual stress in welded joints is limited. The purpose of this paper is to clarify the residual stress in corner boxing joints. The method of estimating residual stresses based on the inherent stress technique is presented. Residual stress measurements are per...

  1. HYDROGEN AND VOC RETENTION IN WASTE BOXES

    Energy Technology Data Exchange (ETDEWEB)

    PACE ME; MARUSICH RM

    2008-11-21

    The Hanford Waste Management Project Master Documented Safety Analysis (MDSA) (HNF-14741, 2003) identifies derived safety controls to prevent or mitigate the risks of a single-container deflagration during operations requiring moving, venting or opening transuranic (TRU)-waste containers. The issue is whether these safety controls are necessary for operations involving TRU-waste boxes that are being retrieved from burial at the Hanford Site. This paper investigates the potential for a deflagration hazard within these boxes and whether safety controls identified for drum deflagration hazards should be applied to operations involving these boxes. The study evaluates the accumulation of hydrogen and VOCs within the waste box and the transport of these gases and vapors out of the waste box. To perform the analysis, there were numerous and major assumptions made regarding the generation rate and the transport pathway dimensions and their number. Since there is little actual data with regards to these assumptions, analyses of three potential configurations were performed to obtain some indication of the bounds of the issue (the concentration of hydrogen or flammable VOCs within a waste box). A brief description of each of the three cases along with the results of the analysis is summarized.

  2. Dynamic Analysis of Horizontally Curved Thin-Walled Box-Girder Bridge due to Moving Vehicle

    Directory of Open Access Journals (Sweden)

    K. Nallasivam

    2007-01-01

    Full Text Available The impact on curved box-girder bridges due to vehicle moving across rough bridge deck have been analyzed using bridge-vehicle coupled dynamics. The bridge deck unevenness has been assumed to be a homogeneous random process in space specified by a PSD function. The analysis incorporates the effect of centrifugal forces due to vehicle moving on curved bridge. The curved box-girder bridge has been numerically modeled using computationally efficient thin-walled box-beam finite elements which take into account the torsional warping, distortion and distortional warping, that are important features of thin-walled box girders. Rigid vehicle with longitudinal and transverse input to the wheels giving rise to heave-pitch-roll degrees of freedom has been considered. The theoretical bridge model used in simulation study has been validated by a free vibration experiment using impact excitation. The impact factors for several response parameters such as bending moment, shear force, torsional moment, torsional bi-moment, distortional moment, distortional bi-moment and vertical deflections have been obtained for various bridge-vehicle parameters. Both constant velocity and forward acceleration of the vehicle have been considered to examine impact factor. The results highlighted that the impact factors of a curved box girder bridge corresponding to torsion, distortion and their corresponding bimoments have been observed to be generally very high, while those of the other responses are also relatively higher than that of corresponding straight box girder bridge.

  3. Barriers and facilitators to implementing Decision Boxes in primary healthcare teams to facilitate shared decisionmaking: a study protocol

    Directory of Open Access Journals (Sweden)

    Giguere Anik

    2012-08-01

    Full Text Available Abstract Background Decision Boxes are summaries of the most important benefits and harms of health interventions provided to clinicians before they meet the patient, to prepare them to help patients make informed and value-based decisions. Our objective is to explore the barriers and facilitators to using Decision Boxes in clinical practice, more precisely factors stemming from (1 the Decision Boxes themselves, (2 the primary healthcare team (PHT, and (3 the primary care practice environment. Methods/design A two-phase mixed methods study will be conducted. Eight Decision Boxes relevant to primary care, and written in both English and in French, will be hosted on a website together with a tutorial to introduce the Decision Box. The Decision Boxes will be delivered as weekly emails over a span of eight weeks to clinicians of PHTs (family physicians, residents and nurses in five primary care clinics located across two Canadian provinces. Using a web-questionnaire, clinicians will rate each Decision Box with the Information Assessment Method (cognitive impacts, relevance, usefulness, expected benefits and with a questionnaire based on the Theory of Planned Behavior to study the determinants of clinicians’ intention to use what they learned from that Decision Box in their patient encounter (attitude, social norm, perceived behavioral control. Web-log data will be used to monitor clinicians’ access to the website. Following the 8-week intervention, we will conduct semi-structured group interviews with clinicians and individual interviews with clinic administrators to explore contextual factors influencing the use of the Decision Boxes. Data collected from questionnaires, focus groups and individual interviews will be combined to identify factors potentially influencing implementation of Decision Boxes in clinical practice by clinicians of PHTs. Conclusions This project will allow tailoring of Decision Boxes and their delivery to overcome the

  4. 49 CFR 230.101 - Steam locomotive driving journal boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Steam locomotive driving journal boxes. 230.101... Locomotives and Tenders Running Gear § 230.101 Steam locomotive driving journal boxes. (a) Driving journal boxes. Driving journal boxes shall be maintained in a safe and suitable condition for service. Not more...

  5. 49 CFR 178.517 - Standards for plastic boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Standards for plastic boxes. 178.517 Section 178... PACKAGINGS Non-bulk Performance-Oriented Packaging Standards § 178.517 Standards for plastic boxes. (a) The following are identification codes for plastic boxes: (1) 4H1 for an expanded plastic box; and (2) 4H2 for a...

  6. Principal Investigator-in-a-Box

    Science.gov (United States)

    Young, Laurence R.

    1999-01-01

    Human performance in orbit is currently limited by several factors beyond the intrinsic awkwardness of motor control in weightlessness. Cognitive functioning can be affected by such factors as cumulative sleep loss, stress and the psychological effects of long-duration small-group isolation. When an astronaut operates a scientific experiment, the performance decrement associated with such factors can lead to lost or poor quality data and even the total loss of a scientific objective, at great cost to the sponsors and to the dismay of the Principal Investigator. In long-duration flights, as anticipated on the International Space Station and on any planetary exploration, the experimental model is further complicated by long delays between training and experiment, and the large number of experiments each crew member must perform. Although no documented studies have been published on the subject, astronauts report that an unusually large number of simple errors are made in space. Whether a result of the effects of microgravity, accumulated fatigue, stress or other factors, this pattern of increased error supports the need for a computerized decision-making aid for astronauts performing experiments. Artificial intelligence and expert systems might serve as powerful tools for assisting experiments in space. Those conducting space experiments typically need assistance exactly when the planned checklist does not apply. Expert systems, which use bits of human knowledge and human methods to respond appropriately to unusual situations, have a flexibility that is highly desirable in circumstances where an invariably predictable course of action/response does not exist. Frequently the human expert on the ground is unavailable, lacking the latest information, or not consulted by the astronaut conducting the experiment. In response to these issues, we have developed "Principal Investigator-in-a-Box," or [PI], to capture the reasoning process of the real expert, the Principal

  7. GREEN SUPERCOMPUTING IN A DESKTOP BOX

    Energy Technology Data Exchange (ETDEWEB)

    HSU, CHUNG-HSING [Los Alamos National Laboratory; FENG, WU-CHUN [NON LANL; CHING, AVERY [NON LANL

    2007-01-17

    The computer workstation, introduced by Sun Microsystems in 1982, was the tool of choice for scientists and engineers as an interactive computing environment for the development of scientific codes. However, by the mid-1990s, the performance of workstations began to lag behind high-end commodity PCs. This, coupled with the disappearance of BSD-based operating systems in workstations and the emergence of Linux as an open-source operating system for PCs, arguably led to the demise of the workstation as we knew it. Around the same time, computational scientists started to leverage PCs running Linux to create a commodity-based (Beowulf) cluster that provided dedicated computer cycles, i.e., supercomputing for the rest of us, as a cost-effective alternative to large supercomputers, i.e., supercomputing for the few. However, as the cluster movement has matured, with respect to cluster hardware and open-source software, these clusters have become much more like their large-scale supercomputing brethren - a shared (and power-hungry) datacenter resource that must reside in a machine-cooled room in order to operate properly. Consequently, the above observations, when coupled with the ever-increasing performance gap between the PC and cluster supercomputer, provide the motivation for a 'green' desktop supercomputer - a turnkey solution that provides an interactive and parallel computing environment with the approximate form factor of a Sun SPARCstation 1 'pizza box' workstation. In this paper, they present the hardware and software architecture of such a solution as well as its prowess as a developmental platform for parallel codes. In short, imagine a 12-node personal desktop supercomputer that achieves 14 Gflops on Linpack but sips only 185 watts of power at load, resulting in a performance-power ratio that is over 300% better than their reference SMP platform.

  8. Changes in position and quality of preferred nest box: effects on nest box use by laying hens

    DEFF Research Database (Denmark)

    Riber, Anja Brinch; Nielsen, Birte L.

    2013-01-01

    Using laying hens, we investigated whether position of a nest box, both within the pen and relative to other nest boxes, influenced the preference for a nest box, and how a sudden and marked change to the preferred box influenced the use of nest boxes by the hens. Groups (n=12) of 15 Isa Warren...... hens were housed in pens, each with five identical nest boxes in different positions: Two single (in a corner or not) and a triplet of nest boxes (one of which in a corner). The use of nest boxes was determined by the number of eggs laid daily in each box. Three experiments, each lasting 10 days, were...... carried out. First, the undisturbed use of each of the nest box types was investigated, and a strong preference (Peggs laid there. Second, each of the hen groups was moved to another pen allocated at random, and where...

  9. Advances in the theory of box integrals

    Energy Technology Data Exchange (ETDEWEB)

    Bailey, David H.; Borwein, J.M.; Crandall, R.E.

    2009-06-25

    Box integrals - expectations <|{rvec r}|{sup s}> or <|{rvec r}-{rvec q}|{sup s}> over the unit n-cube (or n-box) - have over three decades been occasionally given closed forms for isolated n,s. By employing experimental mathematics together with a new, global analytic strategy, we prove that for n {le} 4 dimensions the box integrals are for any integer s hypergeometrically closed in a sense we clarify herein. For n = 5 dimensions, we show that a single unresolved integral we call K{sub 5} stands in the way of such hyperclosure proofs. We supply a compendium of exemplary closed forms that naturally arise algorithmically from this theory.

  10. Grey Box Modelling of Hydrological Systems

    DEFF Research Database (Denmark)

    Thordarson, Fannar Ørn

    The main topic of the thesis is grey box modelling of hydrologic systems, as well as formulation and assessment of their embedded uncertainties. Grey box model is a combination of a white box model, a physically-based model that is traditionally formulated using deterministic ordinary differential...... the lack of fit in state space formulation, and further support decisions for a model expansion. By using stochastic differential equations to formulate the dynamics of the hydrological system, either the complexity of the model can be increased by including the necessary hydrological processes...... in the model, or formulation of process noise can be considered so that it meets the physical limits of the hydrological system and give an adequate description of the embedded uncertainty in model structure. The thesis consists of two parts: a summary report and a part which contains six scientific papers...

  11. CASAS: A Smart Home in a Box.

    Science.gov (United States)

    Cook, Diane J; Crandall, Aaron S; Thomas, Brian L; Krishnan, Narayanan C

    2013-07-01

    While the potential benefits of smart home technology are widely recognized, a lightweight design is needed for the benefits to be realized at a large scale. We introduce the CASAS "smart home in a box", a lightweight smart home design that is easy to install and provides smart home capabilities out of the box with no customization or training. We discuss types of data analysis that have been performed by the CASAS group and can be pursued in the future by using this approach to designing and implementing smart home technologies.

  12. Characterization of an AGAMOUS-like MADS box protein, a probable constituent of flowering and fruit ripening regulatory system in banana.

    Directory of Open Access Journals (Sweden)

    Swarup Roy Choudhury

    Full Text Available The MADS-box family of genes has been shown to play a significant role in the development of reproductive organs, including dry and fleshy fruits. In this study, the molecular properties of an AGAMOUS like MADS box transcription factor in banana cultivar Giant governor (Musa sp, AAA group, subgroup Cavendish has been elucidated. We have detected a CArG-box sequence binding AGAMOUS MADS-box protein in banana flower and fruit nuclear extracts in DNA-protein interaction assays. The protein fraction in the DNA-protein complex was analyzed by mass spectrometry and using this information we have obtained the full length cDNA of the corresponding protein. The deduced protein sequence showed ~95% amino acid sequence homology with MA-MADS5, a MADS-box protein described previously from banana. We have characterized the domains of the identified AGAMOUS MADS-box protein involved in DNA binding and homodimer formation in vitro using full-length and truncated versions of affinity purified recombinant proteins. Furthermore, in order to gain insight about how DNA bending is achieved by this MADS-box factor, we performed circular permutation and phasing analysis using the wild type recombinant protein. The AGAMOUS MADS-box protein identified in this study has been found to predominantly accumulate in the climacteric fruit pulp and also in female flower ovary. In vivo and in vitro assays have revealed specific binding of the identified AGAMOUS MADS-box protein to CArG-box sequence in the promoters of major ripening genes in banana fruit. Overall, the expression patterns of this MADS-box protein in banana female flower ovary and during various phases of fruit ripening along with the interaction of the protein to the CArG-box sequence in the promoters of major ripening genes lead to interesting assumption about the possible involvement of this AGAMOUS MADS-box factor in banana fruit ripening and floral reproductive organ development.

  13. Characterization of an AGAMOUS-like MADS box protein, a probable constituent of flowering and fruit ripening regulatory system in banana.

    Science.gov (United States)

    Roy Choudhury, Swarup; Roy, Sujit; Nag, Anish; Singh, Sanjay Kumar; Sengupta, Dibyendu N

    2012-01-01

    The MADS-box family of genes has been shown to play a significant role in the development of reproductive organs, including dry and fleshy fruits. In this study, the molecular properties of an AGAMOUS like MADS box transcription factor in banana cultivar Giant governor (Musa sp, AAA group, subgroup Cavendish) has been elucidated. We have detected a CArG-box sequence binding AGAMOUS MADS-box protein in banana flower and fruit nuclear extracts in DNA-protein interaction assays. The protein fraction in the DNA-protein complex was analyzed by mass spectrometry and using this information we have obtained the full length cDNA of the corresponding protein. The deduced protein sequence showed ~95% amino acid sequence homology with MA-MADS5, a MADS-box protein described previously from banana. We have characterized the domains of the identified AGAMOUS MADS-box protein involved in DNA binding and homodimer formation in vitro using full-length and truncated versions of affinity purified recombinant proteins. Furthermore, in order to gain insight about how DNA bending is achieved by this MADS-box factor, we performed circular permutation and phasing analysis using the wild type recombinant protein. The AGAMOUS MADS-box protein identified in this study has been found to predominantly accumulate in the climacteric fruit pulp and also in female flower ovary. In vivo and in vitro assays have revealed specific binding of the identified AGAMOUS MADS-box protein to CArG-box sequence in the promoters of major ripening genes in banana fruit. Overall, the expression patterns of this MADS-box protein in banana female flower ovary and during various phases of fruit ripening along with the interaction of the protein to the CArG-box sequence in the promoters of major ripening genes lead to interesting assumption about the possible involvement of this AGAMOUS MADS-box factor in banana fruit ripening and floral reproductive organ development.

  14. Characterization of an AGAMOUS-like MADS Box Protein, a Probable Constituent of Flowering and Fruit Ripening Regulatory System in Banana

    Science.gov (United States)

    Roy Choudhury, Swarup; Roy, Sujit; Nag, Anish; Singh, Sanjay Kumar; Sengupta, Dibyendu N.

    2012-01-01

    The MADS-box family of genes has been shown to play a significant role in the development of reproductive organs, including dry and fleshy fruits. In this study, the molecular properties of an AGAMOUS like MADS box transcription factor in banana cultivar Giant governor (Musa sp, AAA group, subgroup Cavendish) has been elucidated. We have detected a CArG-box sequence binding AGAMOUS MADS-box protein in banana flower and fruit nuclear extracts in DNA-protein interaction assays. The protein fraction in the DNA-protein complex was analyzed by mass spectrometry and using this information we have obtained the full length cDNA of the corresponding protein. The deduced protein sequence showed ∼95% amino acid sequence homology with MA-MADS5, a MADS-box protein described previously from banana. We have characterized the domains of the identified AGAMOUS MADS-box protein involved in DNA binding and homodimer formation in vitro using full-length and truncated versions of affinity purified recombinant proteins. Furthermore, in order to gain insight about how DNA bending is achieved by this MADS-box factor, we performed circular permutation and phasing analysis using the wild type recombinant protein. The AGAMOUS MADS-box protein identified in this study has been found to predominantly accumulate in the climacteric fruit pulp and also in female flower ovary. In vivo and in vitro assays have revealed specific binding of the identified AGAMOUS MADS-box protein to CArG-box sequence in the promoters of major ripening genes in banana fruit. Overall, the expression patterns of this MADS-box protein in banana female flower ovary and during various phases of fruit ripening along with the interaction of the protein to the CArG-box sequence in the promoters of major ripening genes lead to interesting assumption about the possible involvement of this AGAMOUS MADS-box factor in banana fruit ripening and floral reproductive organ development. PMID:22984496

  15. Construction of anatase/rutile TiO2 hollow boxes for highly efficient photocatalytic performance

    Science.gov (United States)

    Jia, Changchao; Zhang, Xiao; Yang, Ping

    2018-02-01

    Hollow TiO2 hierarchical boxes with suitable anatase and rutile ratios were designed for photocatalysis. The unique hierarchical structure was fabricated via a Topotactic synthetic method. CaTiO3 cubes were acted as the sacrificial templates to create TiO2 hollow hierarchical boxes with well-defined phase distribution. The phase composition of the hollow TiO2 hierarchical boxes is similar to that of TiO2 P25 nanoparticles (∼80% anatase, and 20% rutile). Compared with nanaoparticles, TiO2 hollow boxes with hierarchical structures exhibited an excellent performance in the photocatalytic degradation of methylene blue organic pollutant. Quantificationally, the degradation rate of the hollow boxes is higher than that of TiO2 P25 nanoparticles by a factor of 2.7. This is ascribed that hollow structure provide an opportunity for using incident light more efficiently. The surface hierarchical and well-organized porous structures are beneficial to supply more active sites and enough transport channels for reactant molecules. The boxes consist of single crystal anatase and rutile combined well with each other, which gives photon-generated carriers transfer efficiently.

  16. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  17. Interaction Buckling Experiments of Box columns

    OpenAIRE

    永藤, 寿宮

    1988-01-01

    Box sections present very interesting properties in the field of compressed elements. The purpose of this experiment is to supply experimental data of interaction buckling (overall and local buckling). Test columns are classified into 4 types according to those columns length. Support conditions are pin-ended type by using new developed bowl shoe.

  18. Cereal Box Design: An Interdisciplinary Graphics Activity

    Science.gov (United States)

    Fitzgerald, Mike; Tsosie, Teri

    2012-01-01

    The cereal box design activity is intriguing both for its simplicity and the resourcefulness that it can generate in young people. Also, it lends itself to a variety of curriculums. It covers both consumerism and Design for the Environment (DfE) concepts broadly and in depth. The activity introduces a wide range of topics. They include graphic…

  19. Study of WATCH GRB error boxes

    DEFF Research Database (Denmark)

    Gorosabel, J.; Castro-Tirado, A. J.; Lund, Niels

    1995-01-01

    We have studied the first WATCH GRB Catalogue ofγ-ray Bursts in order to find correlations between WATCH GRB error boxes and a great variety of celestial objects present in 33 different catalogues. No particular class of objects has been found to be significantly correlated with the WATCH GRBs....

  20. Reflective Cracking between Precast Prestressed Box Girders

    Science.gov (United States)

    2017-06-30

    The adjacent precast prestressed concrete box-beam bridge is the bridge of choice for short and short-to-medium span bridges. This choice is because of the ease of construction, favorable span-to-depth ratios, aesthetic appeal, and high torsional sti...

  1. Crystal structure of Arabidopsis thaliana Dawdle forkhead-associated domain reveals a conserved phospho-threonine recognition cleft for dicer-like 1 binding.

    Science.gov (United States)

    Machida, Satoru; Yuan, Y Adam

    2013-07-01

    Dawdle (DDL) is a microRNA processing protein essential for the development of Arabidopsis. DDL contains a putative nuclear localization signal at its amino-terminus and forkhead-associated (FHA) domain at the carboxyl-terminus. Here, we report the crystal structure of the FHA domain of Arabidopsis Dawdle, determined by multiple-wavelength anomalous dispersion method at 1.7-Å resolution. DDL FHA structure displays a seven-stranded β-sandwich architecture that contains a unique structural motif comprising two long anti-parallel strands. Strikingly, crystal packing of the DDL FHA domain reveals that a glutamate residue from the symmetry-related DDL FHA domain, a structural mimic of the phospho-threonine, is specifically recognized by the structurally conserved phospho-threonine binding cleft. Consistently with the structural observations, co-immuno-precipitation experiments performed in Nicotiana benthamiana show that the DDL FHA domain co-immuno-precipitates with DCL1 fragments containing the predicted pThr+3(Ile/Val/Leu/Asp) motif. Taken together, we count the recognition of the target residue by the canonical binding cleft of the DDL FHA domain as the key molecular event to instate FHA domain-mediated protein-protein interaction in plant miRNA processing.

  2. Structural Correlation of the Neck Coil with the Coiled-coil (CC1)-Forkhead-associated (FHA) Tandem for Active Kinesin-3 KIF13A.

    Science.gov (United States)

    Ren, Jinqi; Huo, Lin; Wang, Wenjuan; Zhang, Yong; Li, Wei; Lou, Jizhong; Xu, Tao; Feng, Wei

    2016-02-12

    Processive kinesin motors often contain a coiled-coil neck that controls the directionality and processivity. However, the neck coil (NC) of kinesin-3 is too short to form a stable coiled-coil dimer. Here, we found that the coiled-coil (CC1)-forkhead-associated (FHA) tandem (that is connected to NC by Pro-390) of kinesin-3 KIF13A assembles as an extended dimer. With the removal of Pro-390, the NC-CC1 tandem of KIF13A unexpectedly forms a continuous coiled-coil dimer that can be well aligned into the CC1-FHA dimer. The reverse introduction of Pro-390 breaks the NC-CC1 coiled-coil dimer but provides the intrinsic flexibility to couple NC with the CC1-FHA tandem. Mutations of either NC, CC1, or the FHA domain all significantly impaired the motor activity. Thus, the three elements within the NC-CC1-FHA tandem of KIF13A are structurally interrelated to form a stable dimer for activating the motor. This work also provides the first direct structural evidence to support the formation of a coiled-coil neck by the short characteristic neck domain of kinesin-3. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Structural Correlation of the Neck Coil with the Coiled-coil (CC1)-Forkhead-associated (FHA) Tandem for Active Kinesin-3 KIF13A*

    Science.gov (United States)

    Ren, Jinqi; Huo, Lin; Wang, Wenjuan; Zhang, Yong; Li, Wei; Lou, Jizhong; Xu, Tao; Feng, Wei

    2016-01-01

    Processive kinesin motors often contain a coiled-coil neck that controls the directionality and processivity. However, the neck coil (NC) of kinesin-3 is too short to form a stable coiled-coil dimer. Here, we found that the coiled-coil (CC1)-forkhead-associated (FHA) tandem (that is connected to NC by Pro-390) of kinesin-3 KIF13A assembles as an extended dimer. With the removal of Pro-390, the NC-CC1 tandem of KIF13A unexpectedly forms a continuous coiled-coil dimer that can be well aligned into the CC1-FHA dimer. The reverse introduction of Pro-390 breaks the NC-CC1 coiled-coil dimer but provides the intrinsic flexibility to couple NC with the CC1-FHA tandem. Mutations of either NC, CC1, or the FHA domain all significantly impaired the motor activity. Thus, the three elements within the NC-CC1-FHA tandem of KIF13A are structurally interrelated to form a stable dimer for activating the motor. This work also provides the first direct structural evidence to support the formation of a coiled-coil neck by the short characteristic neck domain of kinesin-3. PMID:26680000

  4. Motivating crowding theory - opening the black box of intrinsic motivation

    DEFF Research Database (Denmark)

    Jacobsen, Christian Bøtcher

    2010-01-01

    Public employees work for many other reasons than because they are paid for it. In other words, intrinsic motivation is an important determinant for their performance. Nonetheless, public sector organizations increasingly rely on extrinsic motivation factors such as monetary incentives to motivate...... employees. Motivation crowding theory claims that this may be at the expense of intrinsic motivation, if the extrinsic motivation factor is perceived to be controlling. On the other hand, intrinsic motivation will be enhanced (crowded in), if the extrinsic motivation factor is perceived to be supportive....... Studies have found support for the motivation crowding claim, but have neglected intrinsic motivation. This study opens the black box of intrinsic motivation and finds a meaningful distinction between task motivation and public service motivation. Among 2,772 physiotherapists in the Danish public sector...

  5. Repeated Glucose Deprivation/Reperfusion Induced PC-12 Cell Death through the Involvement of FOXO Transcription Factor

    Directory of Open Access Journals (Sweden)

    Na Han

    2016-09-01

    Full Text Available BackgroundCognitive impairment and brain damage in diabetes is suggested to be associated with hypoglycemia. The mechanisms of hypoglycemia-induced neural death and apoptosis are not clear and reperfusion injury may be involved. Recent studies show that glucose deprivation/reperfusion induced more neuronal cell death than glucose deprivation itself. The forkhead box O (FOXO transcription factors are implicated in the regulation of cell apoptosis and survival, but their role in neuronal cells remains unclear. We examined the role of FOXO transcription factors and the involvement of the phosphatidylinositol 3-kinase (PI3K/Akt and apoptosis-related signaling pathways in PC-12 cells exposed to repeated glucose deprivation/reperfusion.MethodsPC-12 cells were exposed to control (Dulbecco's Modified Eagle Medium [DMEM] containing 25 mM glucose or glucose deprivation/reperfusion (DMEM with 0 mM glucose for 6 hours and then DMEM with 25 mM glucose for 18 hours for 5 days. MTT assay and Western blot analysis were performed for cell viability, apoptosis, and the expression of survival signaling pathways. FOXO3/4',6-diamidino-2-phenylindole staining was done to ascertain the involvement of FOXO transcription factors in glucose deprivation/reperfusion conditions.ResultsCompared to PC-12 cells not exposed to hypoglycemia, cells exposed to glucose deprivation/reperfusion showed a reduction of cell viability, decreased expression of phosphorylated Akt and Bcl-2, and an increase of cleaved caspase-3 expression. Of note, FOXO3 protein was localized in the nuclei of glucose deprivation/reperfusion cells but not in the control cells.ConclusionRepeated glucose deprivation/reperfusion caused the neuronal cell death. Activated FOXO3 via the PI3K/Akt pathway in repeated glucose deprivation/reperfusion was involved in genes related to apoptosis.

  6. Dynamics of TBP binding to the TATA box

    Science.gov (United States)

    Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

    2008-02-01

    Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

  7. Seal boxes from the Viminacium site

    Directory of Open Access Journals (Sweden)

    Milovanović Bebina

    2013-01-01

    Full Text Available Bronze seal boxes that had the function of holding the wax seal on the Viminacium site - Upper Moesia (Stari Kostolac, Serbia, mainly from the area of the necropolis (ten were found in the graves and ten at the cemetery between the graves. Six are from buildings that had a storage function, five are from public facilities - an amphitheatre, and only one find is from the military fort of the legion VII Claudia, which was stationed in Viminacium in the second half of the 1st century. Thirty-two seal boxes have been processed: nine whole, six with fragmented upper and lower parts, seven bases and ten covers. Seal boxes consist of two parts: the cover and the base. The cover is decorated with figural images, concentric rings and especially with applied ornaments. Some of the motifs are filled with enamel. The base always has three to five circular perforations at the bottom, the side walls are a height of 4 to 5 mm with two opposed notches or slots which are thought to have facilitated the tying of the seal box to a package or a document. The lock mechanism is operated using the hinges principle. Some specimens have a circular extension on the cover with a thorn on the bottom. This fits the hollow in the base, through which passes a thorn for the additional fixing of the cover. Based on shape and decoration, seal boxes were classified into five types: I - elliptical or oval shaped with a figural representation on the cover derived in relief; II/1 - leaf or heart-shaped with a special, riveted ornament; II/2 - leaf or heart-shaped with enamel on the cover; III/1 - circular showing a form in relief; III/2 - circular with cast concentric rings, with no enamel; III/3 - circular with concentric rings with enamel on the cover; IV - diamond shaped with enamel on the cover and V - square with enamel on the cover. The seal boxes dominate chronologically from the first half of the 2nd and throughout the 3rd century.

  8. Ballast system for maintaining constant pressure in a glove box

    Science.gov (United States)

    Shlichta, Paul J.

    1989-09-01

    A ballast system is disclosed for a glove box including a fixed platform on which is mounted an inflatable bag on top of which resides a cover and a weight. The variable gas volume of the inflatable bag communicates with that of the glove box via a valved tube. The weight and the gas volume are selected to maintain a relatively constant pressure in the glove box despite variations in the glove box volume while avoiding the use of complicated valving apparatus.

  9. 47 CFR 90.241 - Radio call box operations.

    Science.gov (United States)

    2010-10-01

    ... box installations in areas where such frequencies are available for fixed system use subject to the... 47 Telecommunication 5 2010-10-01 2010-10-01 false Radio call box operations. 90.241 Section 90... PRIVATE LAND MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.241 Radio call box...

  10. Grey-Box Modelling of Pharmacokinetic /Pharmacodynamic Systems

    DEFF Research Database (Denmark)

    Tornøe, Christoffer Wenzel; Jacobsen, Judith L.; Pedersen, Oluf

    2004-01-01

    Grey-box pharmacokinetic/pharmacodynamic (PK/PD) modelling is presented as a promising way of modelling PK/PD systems. The concept behind grey-box modelling is based on combining physiological knowledge along with information from data in the estimation of model parameters. Grey-box modelling...

  11. 30 CFR 18.49 - Connection boxes on machines.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Connection boxes on machines. 18.49 Section 18... Design Requirements § 18.49 Connection boxes on machines. Connection boxes used to facilitate replacement of cables or machine components shall be explosion-proof. Portable-cable terminals on cable reels...

  12. 31 CFR 515.326 - Custody of safe deposit boxes.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Custody of safe deposit boxes. 515... Definitions § 515.326 Custody of safe deposit boxes. Safe deposit boxes shall be deemed to be in the custody... upon the meaning of the term custody. ...

  13. 31 CFR 500.326 - Custody of safe deposit boxes.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Custody of safe deposit boxes. 500... Definitions § 500.326 Custody of safe deposit boxes. Safe deposit boxes shall be deemed to be in the custody... upon the meaning of the term custody. ...

  14. 49 CFR 230.103 - Tender roller bearing journal boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Tender roller bearing journal boxes. 230.103... Locomotives and Tenders Running Gear § 230.103 Tender roller bearing journal boxes. Tender roller bearing journal boxes shall be maintained in a safe and suitable condition. ...

  15. 49 CFR 230.102 - Tender plain bearing journal boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Tender plain bearing journal boxes. 230.102... Locomotives and Tenders Running Gear § 230.102 Tender plain bearing journal boxes. Plain bearing journal boxes... expected to damage the bearing; or have a detrimental effect on the lubrication of the journal and bearing...

  16. Using Origami Boxes to Explore Concepts of Geometry and Calculus

    Science.gov (United States)

    Wares, Arsalan

    2011-01-01

    The purpose of this classroom note is to provide an example of how a simple origami box can be used to explore important concepts of geometry and calculus. This article describes how an origami box can be folded, then it goes on to describe how its volume and surface area can be calculated. Finally, it describes how the box could be folded to…

  17. 77 FR 74513 - Folding Gift Boxes From China

    Science.gov (United States)

    2012-12-14

    ... COMMISSION Folding Gift Boxes From China Determination On the basis of the record \\1\\ developed in the... antidumping duty order on folding gift boxes from China would be likely to lead to continuation or recurrence... Commission are contained in USITC Publication 4365 (November 2012), entitled Folding Gift Boxes from China...

  18. A white box perspective on behavioural adaptation

    DEFF Research Database (Denmark)

    Bruni, Roberto; Corradini, Andrea; Gadducci, Fabio

    2015-01-01

    We present a white-box conceptual framework for adaptation developed in the context of the EU Project ASCENS coordinated by Martin Wirsing. We called it CoDA, for Control Data Adaptation, since it is based on the notion of control data. CoDA promotes a neat separation between application and adap......We present a white-box conceptual framework for adaptation developed in the context of the EU Project ASCENS coordinated by Martin Wirsing. We called it CoDA, for Control Data Adaptation, since it is based on the notion of control data. CoDA promotes a neat separation between application...... and adaptation logic through a clear identification of the set of data that is relevant for the latter. The framework provides an original perspective from which we survey a representative set of approaches to adaptation, ranging from programming languages and paradigms to computational models and architectural...

  19. The Central Nervous System of Box Jellyfish

    DEFF Research Database (Denmark)

    Garm, Anders Lydik; Ekström, Peter

    2008-01-01

    of behaviors in the box jellyfish such as obstacle avoidance and navigation. The need to process the visual information and turn it into the appropriate behavior puts strong demands on the nervous system of box jellyfish, which appears more elaborate than in other cnidarians. Here, the central part...... of this nervous system is described. Each rhopalium holds a separate part of the CNS with 1,000 nerve cells and a large amount of neuropil. The rhopalial nervous system has several subsystems defined by the anatomy, location, and immunocytochemistry of the cells. Most of the subsystems connect to one or more...... of the eye types, and it is likely that the rhopalial nervous system accounts for most of the visual processing. The major part of the CNS is made up of a ring nerve encircling the bell shaped body. The ring nerve holds around 10,000 cells and is directly connected to all four rhopalial nervous systems...

  20. Fatal exit the automotive black box debate

    CERN Document Server

    Kowalick, Tom

    2005-01-01

    "Fatal Exit: The Automotive Black Box Debate cuts through thirty years of political wrangling and institutional biases to provide an argument for the Motor Vehicle Event Data Recorder (MVEDR). This automotive equivalent of an airplane's flight recorder or black box is intended to solve the mysteries of car crashes and improve the safety of our roads. The reader is taken inside the automotive industry and the government highway safety establishment to foster an understanding of the politics and the positions on all sides of this safety debate. The author takes an unbiased approach, chronologically presenting each argument and uncovering the agendas and mandates of each of the stakeholders." "This publication is essential reading for all consumers who need to have their voices heard on this critical issue, as well as for attorneys, public safety advocates, public policy administrators, engineers, automotive professionals, journalists, and insurance executives."--Jacket.

  1. Monitoring Instrument for X-Ray Box

    CERN Document Server

    Cifuentes Ospina, Alberto; Kuehn, Susanne; Schaepe, Steffen; CERN. Geneva. EP Department

    2017-01-01

    A humidity and temperature readout instrument has been designed and implemented in order to monitor the X-Ray Box used for testing the silicon detectors prototypes of the ITk. The sensors are connected to an Arduino Mega board equipped with 16 analog inputs and a serial port to a computer. A user-friendly software has been also designed in order to give an easy access to all measurements.

  2. Removable glove for a glove box

    International Nuclear Information System (INIS)

    Lucas, J.M.

    1982-01-01

    The glove includes one part forming a cuff and another part forming the glove. These two parts are joined in a leak-tight manner by a rigid ring. The glove part is interchangeable without breaking the seal through two neighbouring grooves formed on the ring to receive a bead made on the open end of the glove. The grooves are visible when the glove is placed outside the glove box, thereby enabling the glove part to be changed in this position [fr

  3. The future of grey-box fuzzing

    OpenAIRE

    Hjelt, Isak

    2017-01-01

    Society are becoming more dependent on software, and more artifacts are being connected to the Internet each day [31]. This makes the work of tracking down vulnerabilities in software a moral obligation for software developers. Since manual testing is expensive [7], automated bug finding techniques are attractive within the quality assurance field, since it can save companies a lot of money. This thesis summarizes the research of an automated bug finding technique called grey-box fuzzing, wit...

  4. PCB-Based Break-Out Box

    Science.gov (United States)

    Lee, Jason H.

    2011-01-01

    Break-out boxes (BOBs) are necessary for all electrical integration/cable checkouts and troubleshooting. Because the price of a BOB is high, and no work can be done without one, often the procedure stops, simply waiting for a BOB. A less expensive BOB would take less time in the integration, testing, and troubleshooting process. The PCB-based BOB works and looks the same as a standard JPL BOB, called Gold Boxes. The only differences between the old BOB and the new PCB-based BOB is that the new one has 80 percent of its circuitry in a printed circuit board. This process reduces the time for fabrication, thus making the BOBs less expensive. Moreover, because of its unique design, the new BOBs can be easily assembled and fixed. About 80 percent of the new PCB-based BOB is in a $22 (at the time of this reporting) custom-designed, yet commercially available PCB. This device has been used successfully to verify that BOB cables were properly made. Also, upon completion, the BOB was beeped out via a multimeter to ensure that all sockets on the connectors were properly connected to the respective banana jack. When compared to the Gold Box BOBs, the new BOB has many advantages. It is much more cost efficient, it delivers equal usability at substantially lower cost of the BOB, and the Gold Box is much heavier when compared to the new BOB. The new BOB is also a bit longer and much more versatile in that connectors are easily changeable and if a banana jack is broken, it can be replaced instead of throwing away an entire BOB.

  5. Dry boxes and inert atmosphere techniques

    International Nuclear Information System (INIS)

    Bartak, D.E.

    1987-01-01

    Practitioners need to conduct experiments with molten salts in an inert atmosphere owing to the chemical reactivity of these media. Most fused salt solvent systems show reactivity to water and/or oxygen, which results in significant chemical changes in the properties of these solvents. Although several studies on the nature of an oxygen/oxide electrode in this melt have been reported, the reactions have not been fully understood because of apparent water contamination in many cases. Nitrate melt systems are also hygroscopic; for example, the LiNO 3 -KNO 3 eutectic (177 0 C) absorbs water to at least 0.2% by weight. The result is that the electrochemistry of heavier, electropositive metal ions has been significantly altered. In addition, trace amounts of water have been shown to significantly affect the oxygen-oxide redox chemistry in NaNO 3 -KNO 3 melts (250 0 C). The haloaluminates, which include AlCl 3 -NaCl (175 0 C), as well as AlCl 3 -organic salt binaries are particularly sensitive to the presence of both oxygen and moisture. Oxygen is a strong oxidant in the fused hydroxide systems with formation of superoxide ion from either oxide or water. This chapter describes general, inert atmosphere techniques which can be used by the molten salt experimentalist. Because of the limitations of volatility, vacuum manipulations are not considered. Rather, the use of glove boxes, glove bags, and inert bench-top techniques are discussed. The areas covered are: glove box and bag equipment, operation and maintenance of glove boxes and glove bags, and common operations conducted inside glove boxes

  6. High Mobility Group Box Protein-1 in Wound Repair

    Directory of Open Access Journals (Sweden)

    Mauro Patrone

    2012-09-01

    Full Text Available High-mobility group box 1 protein (HMGB1, a member of highly conserved non-histone DNA binding protein family, has been studied as transcription factor and growth factor. Secreted extracellularly by activated monocytes and macrophages or passively released by necrotic or damaged cells, extracellular HMGB1 is a potent mediator of inflammation. Extracellular HMGB1 has apparently contrasting biological actions: it sustains inflammation (with the possible establishment of autoimmunity or of self-maintaining tissue damage, but it also activates and recruits stem cells, boosting tissue repair. Here, we focus on the role of HMGB1 in physiological and pathological responses, the mechanisms by which it contributes to tissue repair and therapeutic strategies base on targeting HMGB1.

  7. The transcription factor FOXA2 suppresses gastric tumorigenesis in vitro and in vivo.

    Science.gov (United States)

    Zhu, Chang-Peng; Wang, Jian; Shi, Bin; Hu, Ping-Fang; Ning, Bei-Fang; Zhang, Qing; Chen, Fei; Chen, Wan-Sheng; Zhang, Xin; Xie, Wei-Fen

    2015-01-01

    The transcription factor forkhead box A2 (FOXA2) plays a central role in the development of endoderm-derived organs. It has been reported that FOXA2 acts as a suppressor in many kinds of tumor. However, little is known about the role of FOXA2 in gastric cancer. The expression of FOXA2 in gastric cancer tissue samples from 89 patients was assessed by immunohistochemistry, and the clinicopathological characteristics of the samples were analyzed. The human gastric cancer cell line, BGC-823, was used to investigate the effects of FOXA2 in gastric cancer in vitro and in vivo and the potential mechanism involved was explored. FOXA2 expression in human gastric cancer cell lines and human gastric cancer tissues was lower compared with the normal gastric epithelium cell line GES1 and normal adult gastric tissues, respectively. Patients with high FOXA2 expression level had longer 5-year overall survival than those with low FOXA2 expression level. FOXA2 markedly inhibited growth of BGC-823 cells accompanied with the cell cycle arrest and apoptosis. Infection of BGC-823 cells by FOXA2 lentivirus resulted in reduced cell tumorigenesis in vitro and in vivo. Moreover, expression of Mucin 5AC was up-regulated along with increased expression of exogenous FOXA2 in BGC-823 cells; in contrast, dedifferentiation markers, BMI, CD54 and CD24, were down-regulated. These results suggest that FOXA2 induces the differentiation of gastric cancer and highlight FOXA2 as a novel therapeutic target and prognostic marker for human gastric cancer.

  8. MicroRNA-214 suppresses gluconeogenesis by targeting activating transcriptional factor 4.

    Science.gov (United States)

    Li, Kai; Zhang, Jin; Yu, Junjie; Liu, Bin; Guo, Yajie; Deng, Jiali; Chen, Shanghai; Wang, Chunxia; Guo, Feifan

    2015-03-27

    Although the gluconeogenesis pathway is already a target for the treatment of type 2 diabetes, the potential role of microRNAs (miRNAs) in gluconeogenesis remains unclear. Here, we investigated the physiological functions of miR-214 in gluconeogenesis. The expression of miR-214 was suppressed by glucagon via protein kinase A signaling in primary hepatocytes, and miR-214 was down-regulated in the livers of fasted, high fat diet-induced diabetic and leptin receptor-mutated (db/db) mice. The overexpression of miR-214 in primary hepatocytes suppressed glucose production, and silencing miR-214 reversed this effect. Gluconeogenesis was suppressed in the livers of mice injected with an adenovirus expressing miR-214 (Ad-miR-214). Additionally, Ad-miR-214 alleviated high fat diet-induced elevation of gluconeogenesis and hyperglycemia. Furthermore, we found that activating transcription factor 4 (ATF4), a reported target of miR-214, can reverse the suppressive effect of miR-214 on gluconeogenesis in primary hepatocytes, and this suppressive effect was blocked in liver-specific ATF4 knock-out mice. ATF4 regulated gluconeogenesis via affecting forkhead box protein O1 (FOXO1) transcriptional activity. Finally, liver-specific miR-214 transgenic mice exhibited suppressed gluconeogenesis and reduced expression of ATF4, phosphoenolpyruvate carboxykinase, and glucose-6-phosphatase in liver. Taken together, our results suggest that the miR-214-ATF4 axis is a novel pathway for the regulation of hepatic gluconeogenesis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. MicroRNA-214 Suppresses Gluconeogenesis by Targeting Activating Transcriptional Factor 4*

    Science.gov (United States)

    Li, Kai; Zhang, Jin; Yu, Junjie; Liu, Bin; Guo, Yajie; Deng, Jiali; Chen, Shanghai; Wang, Chunxia; Guo, Feifan

    2015-01-01

    Although the gluconeogenesis pathway is already a target for the treatment of type 2 diabetes, the potential role of microRNAs (miRNAs) in gluconeogenesis remains unclear. Here, we investigated the physiological functions of miR-214 in gluconeogenesis. The expression of miR-214 was suppressed by glucagon via protein kinase A signaling in primary hepatocytes, and miR-214 was down-regulated in the livers of fasted, high fat diet-induced diabetic and leptin receptor-mutated (db/db) mice. The overexpression of miR-214 in primary hepatocytes suppressed glucose production, and silencing miR-214 reversed this effect. Gluconeogenesis was suppressed in the livers of mice injected with an adenovirus expressing miR-214 (Ad-miR-214). Additionally, Ad-miR-214 alleviated high fat diet-induced elevation of gluconeogenesis and hyperglycemia. Furthermore, we found that activating transcription factor 4 (ATF4), a reported target of miR-214, can reverse the suppressive effect of miR-214 on gluconeogenesis in primary hepatocytes, and this suppressive effect was blocked in liver-specific ATF4 knock-out mice. ATF4 regulated gluconeogenesis via affecting forkhead box protein O1 (FOXO1) transcriptional activity. Finally, liver-specific miR-214 transgenic mice exhibited suppressed gluconeogenesis and reduced expression of ATF4, phosphoenolpyruvate carboxykinase, and glucose-6-phosphatase in liver. Taken together, our results suggest that the miR-214-ATF4 axis is a novel pathway for the regulation of hepatic gluconeogenesis. PMID:25657009

  10. SMRT has tissue-specific isoform profiles that include a form containing one CoRNR box

    International Nuclear Information System (INIS)

    Short, Stephen; Malartre, Marianne; Sharpe, Colin

    2005-01-01

    SMRT acts as a corepressor for a range of transcription factors. The amino-terminal part of the protein includes domains that mainly mediate transcriptional repression whilst the carboxy-terminal part includes domains that interact with nuclear receptors using up to three motifs called CoRNR boxes. The region of the SMRT primary transcript encoding the interaction domains is subject to alternative splicing that varies the inclusion of the third CoRNR box. The profile in mice includes an abundant, novel SMRT isoform that possesses just one CoRNR box. Mouse tissues therefore express SMRT isoforms containing one, two or three CoRNR boxes. In frogs, the SMRT isoform profile is tissue-specific. The mouse also shows distinct profiles generated by differential expression levels of the SMRT transcript isoforms. The formation of multiple SMRT isoforms and their tissue-specific regulation indicates a mechanism, whereby cells can define the repertoire of transcription factors regulated by SMRT

  11. Conserved regulatory modules in the Sox9 testis-specific enhancer predict roles for SOX, TCF/LEF, Forkhead, DMRT, and GATA proteins in vertebrate sex determination.

    Science.gov (United States)

    Bagheri-Fam, Stefan; Sinclair, Andrew H; Koopman, Peter; Harley, Vincent R

    2010-03-01

    While the primary sex determining switch varies between vertebrate species, a key downstream event in testicular development, namely the male-specific up-regulation of Sox9, is conserved. To date, only two sex determining switch genes have been identified, Sry in mammals and the Dmrt1-related gene Dmy (Dmrt1bY) in the medaka fish Oryzias latipes. In mice, Sox9 expression is evidently up-regulated by SRY and maintained by SOX9 both of which directly activate the core 1.3 kb testis-specific enhancer of Sox9 (TESCO). How Sox9 expression is up-regulated and maintained in species without Sry (i.e. non-mammalian species) is not understood. In this study, we have undertaken an in-depth comparative genomics approach and show that TESCO contains an evolutionarily conserved region (ECR) of 180 bp which is present in marsupials, monotremes, birds, reptiles and amphibians. The ECR contains highly conserved modules that predict regulatory roles for SOX, TCF/LEF, Forkhead, DMRT, and GATA proteins in vertebrate sex determination/differentiation. Our data suggest that tetrapods share common aspects of Sox9 regulation in the testis, despite having different sex determining switch mechanisms. They also suggest that Sox9 autoregulation is an ancient mechanism shared by all tetrapods, raising the possibility that in mammals, SRY evolved by mimicking this regulation. The validation of ECR regulatory sequences conserved from human to frogs will provide new insights into vertebrate sex determination. Copyright 2009 Elsevier Ltd. All rights reserved.

  12. [Forkhead domain inhibitor-6 (FDI-6) increases apoptosis and inhibits invasion and migration of laryngeal carcinoma cells by down-regulating nuclear FoxM1].

    Science.gov (United States)

    Liu, Yanan; Zhu, Lin; Wen, Taoyu; Wan, Jie; Lei, Yue; Chen, Hongyan

    2017-05-01

    Objective To study the effects of new small molecular inhibitor, forkhead domain inhibitor-6 (FDI-6), on proliferation, apoptosis, invasion and migration in human laryngeal carcinoma Hep-2 cell line and the related mechanism. Methods MTT assay was used to test the proliferation rate of Hep-2 cells before and 12, 24 hours after treated with (5, 10, 20, 40, 80) μmol/L of FDI-6. Flow cytometry (FCM) and Transwell TM chamber assay were respectively carried out to detect the apoptosis rate, cell invasion and migration in Hep-2 cells after treated by 10, 20 μmol/L FDI-6 for 24 hours. Real-time quantitative PCR (qRT-PCR) and Western blotting were performed to determine the mRNA and protein levels of FoxM1, Bcl-2 and BAX, respectively. Results Cell proliferation rate was inhibited by FDI-6 in a dose- and time-dependent manner. Twenty-four hours after 10, 20 μmol/L FDI-6 treatment, the apoptosis rate in Hep-2 cells was elevated and the ability of cell invasion and migration was inhibited in a dose-dependent manner. The qRT-PCR showed that there was no significant change in FoxM1 mRNA expression with or without FDI-6 treatment. Western blotting showed that the total protein level of FoxM1 was not obviously changed, but Bcl-2 was down-regulated, BAX was up-regulated. However, in the nuclear FoxM1 protein level decreased along with the ascent of FDI-6 concentration. Conclusion FDI-6 could induce cell apoptosis and inhibit cell proliferation, invasion and migration in Hep-2 cells. This may be related to the down-regulation of FoxM1 in the nucleus.

  13. Cricket body size is altered by systemic RNAi against insulin signaling components and epidermal growth factor receptor.

    Science.gov (United States)

    Dabour, Noha; Bando, Tetsuya; Nakamura, Taro; Miyawaki, Katsuyuki; Mito, Taro; Ohuchi, Hideyo; Noji, Sumihare

    2011-09-01

    A long-standing problem of developmental biology is how body size is determined. In Drosophila melanogaster, the insulin/insulin-like growth factor (I/IGF) and target of rapamycin (TOR) signaling pathways play important roles in this process. However, the detailed mechanisms by which insect body growth is regulated are not known. Therefore, we have attempted to utilize systemic nymphal RNA interference (nyRNAi) to knockdown expression of insulin signaling components including Insulin receptor (InR), Insulin receptor substrate (chico), Phosphatase and tensin homologue (Pten), Target of rapamycin (Tor), RPS6-p70-protein kinase (S6k), Forkhead box O (FoxO) and Epidermal growth factor receptor (Egfr) and observed the effects on body size in the Gryllus bimaculatus cricket. We found that crickets treated with double-stranded RNA (dsRNA) against Gryllus InR, chico, Tor, S6k and Egfr displayed smaller body sizes, while Gryllus FoxO nyRNAi-ed crickets exhibited larger than normal body sizes. Furthermore, RNAi against Gryllus chico and Tor displayed slow growth and RNAi against Gryllus chico displayed longer lifespan than control crickets. Since no significant difference in ability of food uptake was observed between the Gryllus chico(nyRNAi) nymphs and controls, we conclude that the adult cricket body size can be altered by knockdown of expressions of Gryllus InR, chico, Tor, S6k, FoxO and Egfr by systemic RNAi. Our results suggest that the cricket is a promising model to study mechanisms underlying controls of body size and life span with RNAi methods. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.

  14. FLOWERING LOCUS C in monocots and the tandem origin of angiosperm specific MADS-box genes

    NARCIS (Netherlands)

    Ruelens, P.; Maagd, de R.A.; Proost, S.; Theissen, G.; Geuten, K.; Kaufmann, K.

    2013-01-01

    MADS-domain transcription factors have been shown to act as key repressors or activators of the transition to flowering and as master regulators of reproductive organ identities. Despite their important roles in plant development, the origin of several MADS-box subfamilies has remained enigmatic so

  15. The archaeal TFIIE homologue facilitates transcription initiation by enhancing TATA-box recognition

    NARCIS (Netherlands)

    Bell, S.D.; Brinkman, A.B.; Oost, van der J.; Jackson, S.P.

    2001-01-01

    Transcription from many archaeal promoters can be reconstituted in vitro using recombinant TATA-box binding protein (TBP) and transcription factor B (TFB)—homologues of eukaryal TBP and TFIIB—together with purified RNA polymerase (RNAP). However, all archaeal genomes sequenced to date reveal the

  16. Effectiveness of box trainers in laparoscopic training

    Directory of Open Access Journals (Sweden)

    Dhariwal Anender

    2007-01-01

    Full Text Available Rationale and Objectives: Various devices are used to aid in the education of laparoscopic skills ranging from simple box trainers to sophisticated virtual reality trainers. Virtual reality system is an advanced and effective training method, however it is yet to be adopted in India due to its cost and the advanced technology required for it. Therefore, box trainers are being used to train laparoscopic skills. Hence this study was undertaken to assess the overall effectiveness of the box-training course. Study Procedure: The study was conducted during six-day laparoscopic skills training workshops held during 2006. Twenty five surgeons; age range of 26 to 45 years, of either sex, who had not performed laparoscopic surgery before; attending the workshop were evaluated. Each participant was given a list of tasks to perform before beginning the box-training course on day one and was evaluated quantitatively by rating the successful completion of each test. Evaluation began when the subject placed the first tool into the cannula and ended with task completion. Two evaluation methods used to score the subject, including a global rating scale and a task-specific checklist. After the subject completed all sessions of the workshop, they were asked to perform the same tasks and were evaluated in the same manner. For each task completed by the subjects, the difference in the scores between the second and first runs were calculated and interpreted as an improvement as a percentage of the initial score. Statistical Analysis: Wilcoxon matched-paired signed-ranks test was applied to find out the statistical significance of the results obtained. Results: The mean percentage improvement in scores for both the tasks, using global rating scale, was 44.5% + 6.930 (Mean + SD. For task 1, using the global rating scale mean percentage improvement was 49.4% + 7.948 (Mean + SD. For task 2, mean percentage improvement using global rating scale was 39.6% + 10.4 (Mean

  17. Pothole Detection System Using a Black-box Camera

    Directory of Open Access Journals (Sweden)

    Youngtae Jo

    2015-11-01

    Full Text Available Aging roads and poor road-maintenance systems result a large number of potholes, whose numbers increase over time. Potholes jeopardize road safety and transportation efficiency. Moreover, they are often a contributing factor to car accidents. To address the problems associated with potholes, the locations and size of potholes must be determined quickly. Sophisticated road-maintenance strategies can be developed using a pothole database, which requires a specific pothole-detection system that can collect pothole information at low cost and over a wide area. However, pothole repair has long relied on manual detection efforts. Recent automatic detection systems, such as those based on vibrations or laser scanning, are insufficient to detect potholes correctly and inexpensively owing to the unstable detection of vibration-based methods and high costs of laser scanning-based methods. Thus, in this paper, we introduce a new pothole-detection system using a commercial black-box camera. The proposed system detects potholes over a wide area and at low cost. We have developed a novel pothole-detection algorithm specifically designed to work with the embedded computing environments of black-box cameras. Experimental results are presented with our proposed system, showing that potholes can be detected accurately in real-time.

  18. Grey-box Modeling for System Identification of Household Refrigerators: a Step Toward Smart Appliances

    DEFF Research Database (Denmark)

    Costanzo, Giuseppe Tommaso; Sossan, Fabrizio; Marinelli, Mattia

    2013-01-01

    This paper presents the grey-box modeling of a vapor-compression refrigeration system for residential applications based on maximum likelihood estimation of parameters in stochastic differential equations. Models obtained are useful in the view of controlling refrigerators as flexible consumption......, such as heat pumps for space heating, in order to smooth the load factor during peak hours, enhance reliability and efficiency in power networks and reduce operational costs.......This paper presents the grey-box modeling of a vapor-compression refrigeration system for residential applications based on maximum likelihood estimation of parameters in stochastic differential equations. Models obtained are useful in the view of controlling refrigerators as flexible consumption...

  19. Prohibiting Headgear for Safety in Amateur Boxing? Opinion of the Canadian Boxing Community: an Online Poll.

    Science.gov (United States)

    Dickinson, Philip; Rempel, Philip

    In 2013, the Amateur International Boxing Association (AIBA) introduced a rule banning headgear for male-senior open class boxers during competition. The AIBA has defended the rule change as motivated by safety and supported by internal unpublished studies. As a result, in 2018, the AIBA plans to universally prohibit headgear in competition: for all competitors (male and female), all ages and all levels. Within Canada, this ruling has generated controversy in the boxing community, yet there has been no overall measure of opinion. To address this, we instituted a voluntary, anonymous, online open-access poll to allow members of the boxing community to express their stance on headgear use in competition. In total, 636 responses were received. A total of 71.5 % of Canadian respondents believed headgear should be mandatory at all levels. Only 5.8 % agreed that headgear should be prohibited, as planned for 2018. Estimating results on a representative breakdown of boxing membership in Canada, a similar pattern emerged, whereby 68.2 % concurred with mandatory headgear while only 4.95 % supported its prohibition. Parents of boxers were almost unanimously against banning headgear, stating they would change sports as a result. Similarly, only 1.7 % of women believed headgear should be prohibited. The consensus of the Canadian boxing community largely opposes the rule changes that the AIBA has implemented. The results highlight risks posed to the long-term viability of the sport, if significant grassroots safety concerns are disregarded.

  20. Simplified method for the transverse bending analysis of twin celled concrete box girder bridges

    Science.gov (United States)

    Chithra, J.; Nagarajan, Praveen; S, Sajith A.

    2018-03-01

    Box girder bridges are one of the best options for bridges with span more than 25 m. For the study of these bridges, three-dimensional finite element analysis is the best suited method. However, performing three-dimensional analysis for routine design is difficult as well as time consuming. Also, software used for the three-dimensional analysis are very expensive. Hence designers resort to simplified analysis for predicting longitudinal and transverse bending moments. Among the many analytical methods used to find the transverse bending moments, SFA is the simplest and widely used in design offices. Results from simplified frame analysis can be used for the preliminary analysis of the concrete box girder bridges.From the review of literatures, it is found that majority of the work done using SFA is restricted to the analysis of single cell box girder bridges. Not much work has been done on the analysis multi-cell concrete box girder bridges. In this present study, a double cell concrete box girder bridge is chosen. The bridge is modelled using three- dimensional finite element software and the results are then compared with the simplified frame analysis. The study mainly focuses on establishing correction factors for transverse bending moment values obtained from SFA.

  1. 49 CFR 178.512 - Standards for steel or aluminum boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Standards for steel or aluminum boxes. 178.512... aluminum boxes. (a) The following are identification codes for steel or aluminum boxes: (1) 4A for a steel box; and (2) 4B for an aluminum box. (b) Construction requirements for steel or aluminum boxes are as...

  2. Demographic consequences of nest box use for Red-footed Falcons Falco vespertinus in Central Asia

    Science.gov (United States)

    Bragin, Evgeny A.; Bragin, Alexander E.; Katzner, Todd

    2017-01-01

    Nest box programs are frequently implemented for the conservation of cavity-nesting birds, but their effectiveness is rarely evaluated in comparison to birds not using nest boxes. In the European Palearctic, Red-footed Falcon Falco vespertinus populations are both of high conservation concern and are strongly associated with nest box programs in heavily managed landscapes. We used a 21-year monitoring dataset collected on 753 nesting attempts by Red-footed Falcons in unmanaged natural or semi-natural habitats to provide basic information on this poorly known species; to evaluate long-term demographic trends; and to evaluate response of demographic parameters of Red-footed Falcons to environmental factors including use of nest boxes. We observed significant differences among years in laying date, offspring loss, and numbers of fledglings produced, but not in egg production. Of these four parameters, offspring loss and, to a lesser extent, number of fledglings exhibited directional trends over time. Variation in laying date and in numbers of eggs were not well explained by any one model, but instead by combinations of models, each with informative terms for nest type. Nevertheless, laying in nest boxes occurred 2.10 ± 0.70 days earlier than in natural nests. In contrast, variation in both offspring loss and numbers of fledglings produced were fairly well explained by a single model including terms for nest type, nest location, and an interaction between the two parameters (65% and 81% model weights respectively), with highest offspring loss in nest boxes on forest edges. Because, for other species, earlier laying dates are associated with more fit individuals, this interaction highlighted a possible ecological trap, whereby birds using nest boxes on forest edges lay eggs earlier but suffer greater offspring loss and produce lower numbers of fledglings than do those in other nesting settings. If nest boxes increase offspring loss for Red-footed Falcons in heavily

  3. Boxing headguard performance in punch machine tests.

    Science.gov (United States)

    McIntosh, Andrew S; Patton, Declan A

    2015-09-01

    The paper presents a novel laboratory method for assessing boxing headguard impact performance. The method is applied to examine the effects of headguards on head impact dynamics and injury risk. A linear impactor was developed, and a range of impacts was delivered to an instrumented Hybrid III head and neck system both with and without an AIBA (Association Internationale de Boxe Amateur)-approved headguard. Impacts at selected speeds between 4.1 and 8.3 m/s were undertaken. The impactor mass was approximately 4 kg and an interface comprising a semirigid 'fist' with a glove was used. The peak contact forces were in the range 1.9-5.9 kN. Differences in head impact responses between the Top Ten AIBA-approved headguard and bare headform in the lateral and forehead tests were large and/or significant. In the 8.3 m/s fist-glove impacts, the mean peak resultant headform accelerations for bare headform tests was approximately 130 g compared with approximately 85 g in the forehead impacts. In the 6.85 m/s bare headform impacts, mean peak resultant angular head accelerations were in the range of 5200-5600 rad/s(2) and almost halved by the headguard. Linear and angular accelerations in 45° forehead and 60° jaw impacts were reduced by the headguard. The data support the opinion that current AIBA headguards can play an important role in reducing the risk of concussion and superficial injury in boxing competition and training. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  4. Design Research: Six Views in a Box

    DEFF Research Database (Denmark)

    2011-01-01

    ways to better understand the consequences of the disease, spread the knowledge to more people and diagnosis the disease as soon as possible. The class was partly sponsored by Johnson & Johnson, an international pharmaceutical company. The students also collaborated with the Danish Alzheimer...... Association. Future designers need competence in co-design. Just as important is the need to establish various formats for how to maintain the research results and make these a valuable asset for further inquiry. Thus, the outcome of the class is a box that can be used by Johnson & Johnson and other...

  5. Development of blanket box structure fabrication technology

    International Nuclear Information System (INIS)

    Mohri, K.; Sato, S.; Kawaguchi, I.; Sato, K.; Kuroda, T.; Hashimoto, T.; Sato, S.; Takatsu, H.

    1995-01-01

    Fabrication studies have been performed for the first wall and blanket box structure in the fusion experimental reactor designed in Japan. The hot isostatic pressing technique has been proposed as one of the most promising candidate methods for fabricating the first wall. This paper describes the trial fabrication of a half-scale mock-up for part of an outboard module near the midplane, without the internal structure of a breeding region, to investigate its feasibility and to clarify technological issues associated with the proposed fabrication technologies. (orig.)

  6. Piracy and Box Office Movie Revenues

    DEFF Research Database (Denmark)

    Peukert, Christian; Claussen, Jörg; Kretschmer, Tobias

    2017-01-01

    In this paper we evaluate the heterogeneous effects of online copyright enforcement. We ask whether the unexpected shutdown of the popular file hosting platform Megaupload had a differential effect on box office revenues of wide-release vs. niche movies. Identification comes from a comparison...... of movies that were available on Megaupload to those that were not. We show that only movies that premiere in a relatively large number of theaters benefitted from the shutdown of Megaupload. The average effect, however, is negative. We provide suggestive evidence that this result is driven by information...

  7. Keller-box method and its application

    CERN Document Server

    Prasad, Kerehalli V

    2014-01-01

    Most of the problems arising in science and engineering are nonlinear. They are inherently difficult to solve. Traditional analytical approximations are valid only for weakly nonlinear problems, and often break down for problems with strong nonlinearity. This book presents the current theoretical developments and applications of Keller-Box method to nonlinear problems. The first half of the bookaddresses basic concepts to understand the theoretical framework for the method. In the second half of the book, the authorsgive a number of examples of coupled nonlinear problems that have been solved

  8. Design Research: Six Views in a Box

    DEFF Research Database (Denmark)

    2011-01-01

    and close relations, and professional caretakers. Alzheimer's destroys brain cells, causing memory loss and problems with thinking and behavior severe enough to affect work, lifelong hobbies and social life. As Alzheimer’s is a fatal disease that affects many people, there is a strong interest in finding...... professional organizations in a user-driven approach to explore and learn what it means to identify and admit that a person has Alzheimer’s. Apart from making contributions to the common box, the students have written reports in which they reflect on their work both in relation to the design research process...

  9. Do Biomimetic Students Think Outside the Box?

    DEFF Research Database (Denmark)

    Lenau, Torben Anker

    2017-01-01

    Biomimetics is a recognized method in ideation for getting access to new and – for the designer – novel knowledge, which hopefully will result in more novel and useful products. But do designers actually find new knowledge, i.e. think outside the box or do they stick to well-known biological...... phenomena? If they concentrate on animals and plants, which they beforehand have knowledge about, it could be expected that solutions will remind of what they would have found without using biomimetics. To investigate this question, the empirical results from a university course in biomimetics have been...

  10. Test procedure for boxed waste assay system

    International Nuclear Information System (INIS)

    Wachter, J.

    1994-01-01

    This document, prepared by Los Alamos National Laboratory's NMT-4 group, details the test methodology and requirements for Acceptance/Qualification testing of a Boxed Waste Assay System (BWAS) designed and constructed by Pajarito Scientific Corporation. Testing of the BWAS at the Plutonium Facility (TA55) at Los Alamos National Laboratory will be performed to ascertain system adherence to procurement specification requirements. The test program shall include demonstration of conveyor handling capabilities, gamma ray energy analysis, and imaging passive/active neutron accuracy and sensitivity. Integral to these functions is the system's embedded operating and data reduction software

  11. Seismic stability of a standalone glove box structure

    International Nuclear Information System (INIS)

    Saraswat, A.; Reddy, G.R.; Ghosh, S.; Ghosh, A.K.; Kumar, Arun

    2014-01-01

    Highlights: • Glove box is a leak tight, safety related structure used for handling radiotoxic materials. • To study the seismic performance of a freestanding glove box, extensive shake table testing has been carried out. • Glove box maintained structural integrity and leak tightness up to design basis earthquake loading. • Detailed three-dimensional finite element model of the structure is developed and analyzed by using direct time integration methods. • Simplified numerical method is proposed and successfully applied, to quickly estimate sliding displacement and determine upper bounds for it. - Abstract: In a nuclear fuel cycle facility, radiotoxic materials are being handled in freestanding leak tight enclosures called glove boxes (GBs). These glove boxes act as a primary confinement for the radiotoxic materials. Glove boxes are designed as per codal requirements for class I component. They are designed to withstand extreme level of earthquake loading with a return period of 10,000 years. To evaluate seismic performance of the glove box, there is a need to check the stability (sliding and overturning), structural integrity (stresses and strains) and leak tightness under earthquake loading. Extensive shake table experiments were conducted on a single standalone glove box. Actual laboratory conditions were simulated during testing to check the response. After extensive shake table testing, glove box structure was also analyzed using finite element (FE) software. Detailed three-dimensional model of glove box structure was developed and analyzed using nonlinear time history method. It was observed that finite element methods could be utilized to accurately predict dynamic response of glove box structure. This paper discusses the details and results of shake table testing and methodology used for modelling and analysing freestanding glove box structure under seismic loading. In addition, simplified numerical procedure, developed using energy conservation

  12. Seismic stability of a standalone glove box structure

    Energy Technology Data Exchange (ETDEWEB)

    Saraswat, A., E-mail: anupams@barc.gov.in [Bhabha Atomic Research Centre, Mumbai (India); Reddy, G.R. [Bhabha Atomic Research Centre, Mumbai (India); Ghosh, S. [Indian Institute of Technology Bombay, Mumbai (India); Ghosh, A.K.; Kumar, Arun [Bhabha Atomic Research Centre, Mumbai (India)

    2014-09-15

    Highlights: • Glove box is a leak tight, safety related structure used for handling radiotoxic materials. • To study the seismic performance of a freestanding glove box, extensive shake table testing has been carried out. • Glove box maintained structural integrity and leak tightness up to design basis earthquake loading. • Detailed three-dimensional finite element model of the structure is developed and analyzed by using direct time integration methods. • Simplified numerical method is proposed and successfully applied, to quickly estimate sliding displacement and determine upper bounds for it. - Abstract: In a nuclear fuel cycle facility, radiotoxic materials are being handled in freestanding leak tight enclosures called glove boxes (GBs). These glove boxes act as a primary confinement for the radiotoxic materials. Glove boxes are designed as per codal requirements for class I component. They are designed to withstand extreme level of earthquake loading with a return period of 10,000 years. To evaluate seismic performance of the glove box, there is a need to check the stability (sliding and overturning), structural integrity (stresses and strains) and leak tightness under earthquake loading. Extensive shake table experiments were conducted on a single standalone glove box. Actual laboratory conditions were simulated during testing to check the response. After extensive shake table testing, glove box structure was also analyzed using finite element (FE) software. Detailed three-dimensional model of glove box structure was developed and analyzed using nonlinear time history method. It was observed that finite element methods could be utilized to accurately predict dynamic response of glove box structure. This paper discusses the details and results of shake table testing and methodology used for modelling and analysing freestanding glove box structure under seismic loading. In addition, simplified numerical procedure, developed using energy conservation

  13. [Optimization of Polysaccharide Extraction from Spirodela polyrrhiza by Plackett-Burman Design Combined with Box-Behnken Response Surface Methodology].

    Science.gov (United States)

    Jiang, Zheng; Wang, Hong; Wu, Qi-nan

    2015-06-01

    To optimize the processing of polysaccharide extraction from Spirodela polyrrhiza. Five factors related to extraction rate of polysaccharide were optimized by the Plackett-Burman design. Based on this study, three factors, including alcohol volume fraction, extraction temperature and ratio of material to liquid, were regarded as investigation factors by Box-Behnken response surface methodology. The effect order of three factors on the extraction rate of polysaccharide from Spirodela polyrrhiza were as follows: extraction temperature, alcohol volume fraction,ratio of material to liquid. According to Box-Behnken response, the best extraction conditions were: alcohol volume fraction of 81%, ratio of material to liquid of 1:42, extraction temperature of 100 degrees C, extraction time of 60 min for four times. Plackett-Burman design and Box-Behnken response surface methodology used to optimize the extraction process for the polysaccharide in this study is effective and stable.

  14. Reconciling White-Box and Black-Box Perspectives on Behavioral Self-adaptation

    DEFF Research Database (Denmark)

    Bruni, Roberto; Corradini, Andrea; Gadducci, Fabio

    2015-01-01

    This paper proposes to reconcile two perspectives on behavioral adaptation commonly taken at different stages of the engineering of autonomic computing systems. Requirements engineering activities often take a black-box perspective: A system is considered to be adaptive with respect to an environ...

  15. Flexible bulb large storage box hydrogen maser

    Science.gov (United States)

    Reinhardt, V.

    1973-01-01

    The principal limitation on the accuracy of the hydrogen maser as a primary frequency standard has been the irreproducibility of the frequency shift caused by collisions of the radiating atoms with the walls of the vessel containing them. The flexible bulb-large storage box hydrogen maser allows correction for this wall shift within a single device, sidestepping the reproducibility problem, and reducing the frequency error from the wall shift to the level imposed by the device's stability. The principles of the device are discussed including the flexible bulb technique and the complications caused by a multiple region storage bulb. The stability of the device is discussed including a comparison with an ordinary hydrogen maser. Data is presented from a working flexible bulb-large storage box hydrogen maser demonstrating the feasibility of the device and showing some of its operating characteristics. The flexibility of the device is demonstrated by showing how the device's added degrees of freedom allow measurement of parameters unmeasurable in an ordinary hydrogen maser.

  16. Hairy black holes in a box

    Energy Technology Data Exchange (ETDEWEB)

    Basu, Pallab [International Center for Theoretical Sciences,IISc Campus, Bangalore 560012 (India); Krishnan, Chethan; Subramanian, P.N. Bala [Center for High Energy Physics, Indian Institute of Science,Bangalore 560012 (India)

    2016-11-08

    We do a systematic study of the phases of gravity coupled to an electromagnetic field and charged scalar in flat space, with box boundary conditions. The scalar-less box has previously been investigated by Braden, Brown, Whiting and York (and others) before AdS/CFT and we elaborate and extend their results in a language more familiar from holography. The phase diagram of the system is analogous to that of AdS black holes, but we emphasize the differences and explain their origin. Once the scalar is added, we show that the system admits both boson stars as well as hairy black holes as solutions, providing yet another way to evade flat space no-hair theorems. Furthermore both these solutions can exist as stable phases in regions of the phase diagram. The final picture of the phases that emerges is strikingly similar to that found recently for holographic superconductors in global AdS, http://arxiv.org/abs/1602.07211. Our construction lays bare certain previously unnoticed subtleties associated to the definition quasi-local charges for gravitating scalar fields in finite regions.

  17. The FOXO transcription factor controls insect growth and development by regulating juvenile hormone degradation in the silkworm, Bombyx mori.

    Science.gov (United States)

    Zeng, Baosheng; Huang, Yuping; Xu, Jun; Shiotsuki, Takahiro; Bai, Hua; Palli, Subba Reddy; Huang, Yongping; Tan, Anjiang

    2017-07-14

    Forkhead box O (FOXO) functions as the terminal transcription factor of the insulin signaling pathway and regulates multiple physiological processes in many organisms, including lifespan in insects. However, how FOXO interacts with hormone signaling to modulate insect growth and development is largely unknown. Here, using the transgene-based CRISPR/Cas9 system, we generated and characterized mutants of the silkworm Bombyx mori FOXO ( BmFOXO ) to elucidate its physiological functions during development of this lepidopteran insect. The BmFOXO mutant (FOXO-M) exhibited growth delays from the first larval stage and showed precocious metamorphosis, pupating at the end of the fourth instar (trimolter) rather than at the end of the fifth instar as in the wild-type (WT) animals. However, different from previous reports on precocious metamorphosis caused by juvenile hormone (JH) deficiency in silkworm mutants, the total developmental time of the larval period in the FOXO-M was comparable with that of the WT. Exogenous application of 20-hydroxyecdysone (20E) or of the JH analog rescued the trimolter phenotype. RNA-seq and gene expression analyses indicated that genes involved in JH degradation but not in JH biosynthesis were up-regulated in the FOXO-M compared with the WT animals. Moreover, we identified several FOXO-binding sites in the promoter of genes coding for JH-degradation enzymes. These results suggest that FOXO regulates JH degradation rather than its biosynthesis, which further modulates hormone homeostasis to control growth and development in B. mori In conclusion, we have uncovered a pivotal role for FOXO in regulating JH signaling to control insect development. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Tumor necrosis factor induces tumor promoting and anti-tumoral effects on pancreatic cancer via TNFR1.

    Directory of Open Access Journals (Sweden)

    Martin Chopra

    Full Text Available Multiple activities are ascribed to the cytokine tumor necrosis factor (TNF in health and disease. In particular, TNF was shown to affect carcinogenesis in multiple ways. This cytokine acts via the activation of two cell surface receptors, TNFR1, which is associated with inflammation, and TNFR2, which was shown to cause anti-inflammatory signaling. We assessed the effects of TNF and its two receptors on the progression of pancreatic cancer by in vivo bioluminescence imaging in a syngeneic orthotopic tumor mouse model with Panc02 cells. Mice deficient for TNFR1 were unable to spontaneously reject Panc02 tumors and furthermore displayed enhanced tumor progression. In contrast, a fraction of wild type (37.5%, TNF deficient (12.5%, and TNFR2 deficient mice (22.2% were able to fully reject the tumor within two weeks. Pancreatic tumors in TNFR1 deficient mice displayed increased vascular density, enhanced infiltration of CD4(+ T cells and CD4(+ forkhead box P3 (FoxP3(+ regulatory T cells (Treg but reduced numbers of CD8(+ T cells. These alterations were further accompanied by transcriptional upregulation of IL4. Thus, TNF and TNFR1 are required in pancreatic ductal carcinoma to ensure optimal CD8(+ T cell-mediated immunosurveillance and tumor rejection. Exogenous systemic administration of human TNF, however, which only interacts with murine TNFR1, accelerated tumor progression. This suggests that TNFR1 has basically the capability in the Panc02 model to trigger pro-and anti-tumoral effects but the spatiotemporal availability of TNF seems to determine finally the overall outcome.

  19. A Group Action Method for Construction of Strong Substitution Box

    Science.gov (United States)

    Jamal, Sajjad Shaukat; Shah, Tariq; Attaullah, Atta

    2017-06-01

    In this paper, the method to develop cryptographically strong substitution box is presented which can be used in multimedia security and data hiding techniques. The algorithm of construction depends on the action of a projective general linear group over the set of units of the finite commutative ring. The strength of substitution box and ability to create confusion is assessed with different available analyses. Moreover, the ability of resistance against malicious attacks is also evaluated. The substitution box is examined by bit independent criterion, strict avalanche criterion, nonlinearity test, linear approximation probability test and differential approximation probability test. This substitution box is equated with well-recognized substitution boxes such as AES, Gray, APA, S8, prime of residue, Xyi and Skipjack. The comparison shows encouraging results about the strength of the proposed box. The majority logic criterion is also calculated to analyze the strength and its practical implementation.

  20. [Design and application of hand-wrist caring moxibustion box].

    Science.gov (United States)

    Gao, Xi-Yan; Wang, Xin; Xu, Cui-Xiang; Gao, Ling; Ma, Qiao-Lin

    2013-11-01

    A hand-wrist moxibustion box is designed to effectively solve difficulty to have moxibustion at handwrist joint and problem of bad moxibustion effect as well as improve heat efficiency of moxibustion. The device is consisted of a box and protective screening. The box is hollow with opening on top and bottom. A reversible cover is fixed on the top of the box and support frames are put in the inner-middle. On the side wall there is a hole that is at the same horizontal level of support frames, and horizontal protective screening is put on the bottom. The design of this moxibustion box is novel and unique, simple and reasonable, which could give moxibustion on hand and wrist at the same time. Also it is easily made with low cost, easy to use and favorable effect. It is an innovation on moxibustion box.

  1. TATA Box Insertion Provides a Selection Mechanism Underpinning Adaptations to Fe Deficiency.

    Science.gov (United States)

    Zhang, Meiling; Lv, Yuanda; Wang, Yi; Rose, Jocelyn K C; Shen, Fei; Han, Zhenyun; Zhang, Xinzhong; Xu, Xuefeng; Wu, Ting; Han, Zhenhai

    2017-01-01

    Intraspecific genetic variation is essential for the responses and adaption of plants to evolutionary challenges, such as changing environmental conditions. The development of the Earth's aerobic atmosphere has increased the demand for iron (Fe) in organisms, and Fe deficiency has become a limiting environmental factor for plant growth. Here, we demonstrate that genus Malus adapt to Fe deficiency through modification of the Iron-Regulated Transporter1 (IRT1) promoter. Specifically, an IRT1 mutant allele with a TATA-box insertion in the promoter region upstream of the coding region exhibited increased IRT1 expression. The altered IRT1 promoter is responsible for enhancing Fe uptake. Increasing the number of synthetic repeat TATA-boxes correlates with increased promoter activity. Furthermore, we demonstrate that the insertion of the TATA-box correlates with an increase in transcriptional activation via specific binding of the transcription factor IID (MDP0000939369). Taken together, these results indicate that an allelic insertion of a TATA-box in a gene promoter has allowed apple to adapt to the selective pressure posed by Fe deficiency. More broadly, this study reveals a new mechanism for enhancing gene expression to help plants adapt to different environments, providing new insights into molecular genetic divergence in plants. © 2017 American Society of Plant Biologists. All Rights Reserved.

  2. Role of hypoxia and growth and differentiation factor-5 on differentiation of human mesenchymal stem cells towards intervertebral nucleus pulposus-like cells

    Directory of Open Access Journals (Sweden)

    JV Stoyanov

    2011-06-01

    Full Text Available There is evidence that mesenchymal stem cells (MSCs can differentiate towards an intervertebral disc (IVD-like phenotype. We compared the standard chondrogenic protocol using transforming growth factor beta-1 (TGFß to the effects of hypoxia, growth and differentiation factor-5 (GDF5, and coculture with bovine nucleus pulposus cells (bNPC. The efficacy of molecules recently discovered as possible nucleus pulposus (NP markers to differentiate between chondrogenic and IVD-like differentiation was evaluated. MSCs were isolated from human bone marrow and encapsulated in alginate beads. Beads were cultured in DMEM (control supplemented with TGFß or GDF5 or under indirect coculture with bNPC. All groups were incubated at low (2 % or normal (20 % oxygen tension for 28 days. Hypoxia increased aggrecan and collagen II gene expression in all groups. The hypoxic GDF5 and TGFß groups demonstrated most increased aggrecan and collagen II mRNA levels and glycosaminoglycan accumulation. Collagen I and X were most up-regulated in the TGFß groups. From the NP markers, cytokeratin-19 was expressed to highest extent in the hypoxic GDF5 groups; lowest expression was observed in the TGFß group. Levels of forkhead box F1 were down-regulated by TGFß and up-regulated by coculture with bNPC. Carbonic anhydrase 12 was also down-regulated in the TGFß group and showed highest expression in the GDF5 group cocultured with bNPC under hypoxia. Trends in gene expression regulation were confirmed on the protein level using immunohistochemistry. We conclude that hypoxia and GDF5 may be suitable for directing MSCs towards the IVD-like phenotype.

  3. Action mechanism of bis(allixinato)oxovanadium(IV) as a novel potent insulin-mimetic complex: regulation of GLUT4 translocation and FoxO1 transcription factor.

    Science.gov (United States)

    Hiromura, Makoto; Nakayama, Akihiro; Adachi, Yusuke; Doi, Miyuki; Sakurai, Hiromu

    2007-11-01

    Bis(allixinato)oxovanadium(IV), VO(alx)(2) (alx is 3-hydroxy-5-methoxy-6-methyl-2-pentyl-4-pyrone), has been reported to act as an antidiabetic agent in streptozotocin-induced type-1-like and obesity-linked KKA(y) type 2 diabetic model mice. VO(alx)(2) is also proposed as a candidate agent for treating metabolic syndromes in animals. However, its functional mechanism is yet to be clarified. In this study, we examined whether VO(alx)(2) contributes to both the activation of the insulin signaling cascade that activates glucose transporter 4 (GLUT4) translocation and the regulation of the forkhead box O1 (FoxO1) transcription factor that controls the gene transcription of gluconeogenesis genes. The following three important results were obtained: (1) intracellular vanadium concentration in 3T3-L1 adipocytes is higher after treatment with VO(alx)(2) than with VOSO(4); (2) VO(alx)(2) stimulates the translocation of GLUT4 to the plasma membrane following activation of the tyrosine phosphorylation of the insulin receptor beta-subunit (IRbeta) and insulin receptor substrate (IRS) as well as Akt kinase in 3T3-L1 adipocytes; and (3) the mechanism of inhibition of glucose-6-phosphatase (G6Pase) catalytic subunit gene expression by vanadium is due to disruption of FoxO1 binding with the G6Pase promoter, which indicates that FoxO1 is phosphorylated by VO(alx)(2)-stimulated Akt in HepG2 cells. On the basis of these results, we propose that the critical functions of VO(alx)(2) involve the activation of phosphatidylinositol 3-kinase-Akt signaling through the enhancement of tyrosine phosphorylation of IRbeta and IRS, which in turn transmits the signal to activate GLUT4 translocation, and the regulation of the DNA binding activity of the FoxO1 transcription factor.

  4. ChIP-on-chip analysis identifies IL-22 as direct target gene of ectopically expressed FOXP3 transcription factor in human T cells

    Directory of Open Access Journals (Sweden)

    Jeron Andreas

    2012-12-01

    Full Text Available Abstract Background The transcription factor (TF forkhead box P3 (FOXP3 is constitutively expressed at high levels in naturally occurring CD4+CD25+ regulatory T cells (nTregs. It is not only the most accepted marker for that cell population but is also considered lineage determinative. Chromatin immunoprecipitation (ChIP of TFs in combination with genomic tiling microarray analysis (ChIP-on-chip has been shown to be an appropriate tool for identifying FOXP3 transcription factor binding sites (TFBSs on a genome-wide scale. In combination with microarray expression analysis, the ChIP-on-chip technique allows identification of direct FOXP3 target genes. Results ChIP-on-chip analysis of the human FOXP3 expressed in resting and PMA/ionomycin–stimulated Jurkat T cells revealed several thousand putative FOXP3 binding sites and demonstrated the importance of intronic regions for FOXP3 binding. The analysis of expression data showed that the stimulation-dependent down-regulation of IL-22 was correlated with direct FOXP3 binding in the IL-22 promoter region. This association was confirmed by real-time PCR analysis of ChIP-DNA. The corresponding ChIP-region also contained a matching FOXP3 consensus sequence. Conclusions Knowledge of the general distribution patterns of FOXP3 TFBSs in the human genome under resting and activated conditions will contribute to a better understanding of this TF and its influence on direct target genes, as well as its importance for the phenotype and function of Tregs. Moreover, FOXP3-dependent repression of Th17-related IL-22 may be relevant to an understanding of the phenomenon of Treg/Th17 cell plasticity.

  5. Deep Cropping via Attention Box Prediction and Aesthetics Assessment

    OpenAIRE

    Wang, Wenguan; Shen, Jianbing

    2017-01-01

    We model the photo cropping problem as a cascade of attention box regression and aesthetic quality classification, based on deep learning. A neural network is designed that has two branches for predicting attention bounding box and analyzing aesthetics, respectively. The predicted attention box is treated as an initial crop window where a set of cropping candidates are generated around it, without missing important information. Then, aesthetics assessment is employed to select the final crop ...

  6. Grey-box modelling of pharmacokinetic/pharmacodynamic systems

    DEFF Research Database (Denmark)

    Tornøe, Christoffer Wenzel; Jacobsen, Judith L; Pedersen, Oluf

    2004-01-01

    Grey-box pharmacokinetic/pharmacodynamic (PK/PD) modelling is presented as a promising way of modelling PK/PD systems. The concept behind grey-box modelling is based on combining physiological knowledge along with information from data in the estimation of model parameters. Grey-box modelling con...... in order to describe the complicated in vivo system of insulin and glucose following an IVGTT....

  7. Construction and properties of Box-Behnken designs

    OpenAIRE

    Jo, Jinnam

    1992-01-01

    Box-Behnken designs are used to estimate parameters in a second-order response surface model (Box and Behnken, 1960). These designs are formed by combining ideas from incomplete block designs (BIBD or PBIBD) and factorial experiments, specifically 2k full or 2k-1 fractional factorials. In this dissertation, a more general mathematical formulation of the Box-Behnken method is provided, a general expression for the coefficient matrix in the least squares analysis for estimatin...

  8. Evolution and divergence of SBP-box genes in land plants.

    Science.gov (United States)

    Zhang, Shu-Dong; Ling, Li-Zhen; Yi, Ting-Shuang

    2015-10-14

    Squamosa promoter binding protein (SBP)-box family genes encode plant-specific transcription factors that control many important biological functions, including phase transition, inflorescence branching, fruit ripening, and copper homeostasis. Nevertheless, the evolutionary patterns of SBP-box genes and evolutionary forces driving them are still not well understood. 104 SBP-box gene candidates of five representative land plants were obtained from Phytozome database (v10.3). Phylogenetic combined with gene structure analyses were used to identify SBP-box gene lineages in land plants. Gene copy number and the sequence and structure features were then compared among these different SBP-box lineages. Selection analysis, relative rate tests and expression divergence were finally used to interpret the evolutionary relationships and divergence of SBP-box genes in land plants. We investigated 104 SBP-box genes from moss, Arabidopsis, poplar, rice, and maize. These genes are divided into group I and II, and the latter is further divided into two subgroups (subgroup II-1 and II-2) based on phylogenetic analysis. Interestingly, subgroup II-1 genes have similar sequence and structural features to group I genes, whereas subgroup II-2 genes exhibit intrinsic differences on these features, including high copy numbers and the presence of miR156/miR529 regulation. Further analyses indicate that subgroup II-1 genes are constrained by stronger purifying selection and evolve at a lower substitution rate than II-2 genes, just as group I genes do when compared to II genes. Among subgroup II-2 genes, miR156 targets evolve more rapidly than miR529 targets and experience comparatively relaxed purifying selection. These results suggest that group I and subgroup II-1 genes under strong selective constraint are conserved. By contrast, subgroup II-2 genes evolve under relaxed purifying selection and have diversified through gene copy duplications and changes in miR156/529 regulation, which

  9. Estimation of the Box Correction for Degrees of Freedom from Sample Data in Randomized Block and Split-Plot Designs

    Science.gov (United States)

    Huynh, Huynh; Feldt, Leonard S.

    1976-01-01

    When the variance assumptions of a repeated measures ANOVA are not met, the F distribution of the mean square ratio should be adjusted by the sample estimate of the Box correction factor. An alternative is proposed which is shown by Monte Carlo methods to be less biased for a moderately large factor. (RC)

  10. Choreographies with Secure Boxes and Compromised Principals

    DEFF Research Database (Denmark)

    Carbone, Marco; Guttman, Joshua

    2009-01-01

      We equip choreography-level session descriptions with a simple abstraction of a security infrastruc- ture. Message components may be enclosed within (possibly nested) ”boxes” annotated with the intended source and destination of those components. The boxes are to be implemented with cryp......- tography. Strand spaces provide a semantics for these choreographies, in which some roles may be played by compromised principals. A skeleton is a partially ordered structure containing local behaviors (strands) executed by regular (non-compromised) principals. A skeleton is realized if it contains enough...... it embeds. Second, if no step is possible from a skeleton A, then A is DG realized. Finally, if a DG realized A′ is accessible from A, then A′ is minimal. Thus, the transition system provides a systematic way to construct the possible behaviors of the choreography, in the presence of compromised principals.  ...

  11. The conformational state of the nucleosome entry–exit site modulates TATA box-specific TBP binding

    Science.gov (United States)

    Hieb, Aaron R.; Gansen, Alexander; Böhm, Vera; Langowski, Jörg

    2014-01-01

    The TATA binding protein (TBP) is a critical transcription factor used for nucleating assembly of the RNA polymerase II machinery. TBP binds TATA box elements with high affinity and kinetic stability and in vivo is correlated with high levels of transcription activation. However, since most promoters use less stable TATA-less or TATA-like elements, while also competing with nucleosome occupancy, further mechanistic insight into TBP's DNA binding properties and ability to access chromatin is needed. Using bulk and single-molecule FRET, we find that TBP binds a minimal consensus TATA box as a two-state equilibrium process, showing no evidence for intermediate states. However, upon addition of flanking DNA sequence, we observe non-specific cooperative binding to multiple DNA sites that compete for TATA-box specificity. Thus, we conclude that TBP binding is defined by a branched pathway, wherein TBP initially binds with little sequence specificity and is thermodynamically positioned by its kinetic stability to the TATA box. Furthermore, we observed the real-time access of TBP binding to TATA box DNA located within the DNA entry–exit site of the nucleosome. From these data, we determined salt-dependent changes in the nucleosome conformation regulate TBP's access to the TATA box, where access is highly constrained under physiological conditions, but is alleviated by histone acetylation and TFIIA. PMID:24829456

  12. The conformational state of the nucleosome entry-exit site modulates TATA box-specific TBP binding.

    Science.gov (United States)

    Hieb, Aaron R; Gansen, Alexander; Böhm, Vera; Langowski, Jörg

    2014-07-01

    The TATA binding protein (TBP) is a critical transcription factor used for nucleating assembly of the RNA polymerase II machinery. TBP binds TATA box elements with high affinity and kinetic stability and in vivo is correlated with high levels of transcription activation. However, since most promoters use less stable TATA-less or TATA-like elements, while also competing with nucleosome occupancy, further mechanistic insight into TBP's DNA binding properties and ability to access chromatin is needed. Using bulk and single-molecule FRET, we find that TBP binds a minimal consensus TATA box as a two-state equilibrium process, showing no evidence for intermediate states. However, upon addition of flanking DNA sequence, we observe non-specific cooperative binding to multiple DNA sites that compete for TATA-box specificity. Thus, we conclude that TBP binding is defined by a branched pathway, wherein TBP initially binds with little sequence specificity and is thermodynamically positioned by its kinetic stability to the TATA box. Furthermore, we observed the real-time access of TBP binding to TATA box DNA located within the DNA entry-exit site of the nucleosome. From these data, we determined salt-dependent changes in the nucleosome conformation regulate TBP's access to the TATA box, where access is highly constrained under physiological conditions, but is alleviated by histone acetylation and TFIIA. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. A Comparison of Energy Expenditure During "Wii Boxing" Versus Heavy Bag Boxing in Young Adults.

    Science.gov (United States)

    Perusek, Kristen; Sparks, Kenneth; Little, Kathleen; Motley, Mary; Patterson, Sheila; Wieand, Jennifer

    2014-02-01

    Traditional computer videogames are sedentary, whereas new computer videogames, such as the Nintendo(®) (Redmond, WA) "Wii™ Sports" games, allow users to physically interact while playing the sport. Energy expenditure (EE), heart rate (HR), and rating of perceived exertion (RPE) during heavy bag boxing versus the Nintendo "Wii Boxing" game were compared. Fifteen males and 14 females (mean age, 25.6 years; height, 171.3 cm; weight, 71.8 kg) randomly selected (by a coin toss) heavy bag boxing or "Wii Boxing" for their first test session and completed the other protocol at their second session at least 2 days later. Each session lasted for a total duration of 30 minutes and consisted of 10 3-minute exercise bouts with measurements of HR, RPE, and EE obtained from indirect calorimetry. A paired-samples t test was used to analyze the results. Significant differences were found for HR (bag, 156 beats per minute; Wii, 138 beats per minute; P=0.001) and RPE (bag, 13.8; Wii, 11.4; P=0.0001) but not for EE (bag, 8.0 kcal/minute; Wii, 7.1 kcal/minute; bag, 241 total kcal; Wii, 213 total kcal; P=0.078). The results suggest that computer active videogames, such as the Nintendo Wii, have the potential to provide similar EE as their traditional forms of exercise and may be a sufficient replacement for traditional target HR zone activities, especially in less fit individuals. Further research is needed to compare EE for different "Wii Sports" games with those for their traditional forms of exercise.

  14. Effect of material uncertainties on dynamic response of segmental box girder bridge

    Directory of Open Access Journals (Sweden)

    Suchart Limkatanyu

    2007-11-01

    Full Text Available The main objective of this paper was to investigate the effect of material uncertainties on dynamic response of segmental box girder bridge subjected to a moving load, in this case a rapid passing trains. Literatures concerned with the design of segmental box girder bridge, the application of finite element analysis to model the segmental box girder bridge, and the minimum requirement for structural conditions of the bridge were described and discussed in detail. A series of finite element analysis was carried out using SAP2000 Nonlinear software. The effect was investigated by varying the Modulus of Elasticity by 5%, 10% and 15%. The results were then compared with the case of assumed uniform property which had already been checked for model accuracy using the Standard prEN 1991-2. The results showed that, for the uniform case, the dynamic responses of the bridge gave the highest response at the resonance speed. When considering the non-uniform material properties (non-uniform case, the effect of material uncertainties appeared to have an effect on both displacement and acceleration responses. Nonetheless, the dynamic factor provided in the design code was sufficient for designing the segmental box girder bridge with either uniform or non-uniform material properties for the train speeds considered in this study.

  15. Crystal structure of human PCNA in complex with the PIP box of DVC1

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); University of Chinese Academy of Sciences, 19A Yuquan Road, Shijingshan District, Beijing 100049 (China); Xu, Min [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Jiang, Tao, E-mail: tjiang@ibp.ac.cn [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2016-05-27

    In higher eukaryotes, DVC1 (SPRTN, Spartan or C1orf124) is implicated in the translesion synthesis (TLS) pathway. DVC1 localizes to sites of DNA damage, binds to the proliferating cell nuclear antigen (PCNA) via its conserved PCNA-interacting motif (PIP box), and associates with ubiquitin selective segregase p97 and other factors, thus regulating translesion synthesis polymerases. Here, we report the crystal structure of human PCNA in complex with a peptide ({sup 321}SNSHQNVLSNYFPRVS{sup 336}) derived from human DVC1 that contains a unique YF type PIP box. Structural analysis reveals the detailed PIP box-PCNA interaction. Interestingly, substitution of Y331 with Phe severely reduces its PCNA binding affinity. These findings offer new insights into the determinants of PIP box for PCNA binding. -- Highlights: •Crystal structure of PCNA in complex with DVC1{sup PIP} peptide was determined. •The Y331{sup P7}F mutation severely impairs DVC1's PCNA binding affinity. •The intramolecular hydrogen bond N326−Y331 in the 3{sub 10} helix affects DVC1's PCNA binding affinity.

  16. Sharp asymptotics for Kawasaki dynamics on a finite box with open boundary

    CERN Document Server

    Bovier, A; Nardi, F

    2004-01-01

    In this paper we study the metastable behavior of the lattice gas in two and three dimensions subject to Kawasaki dynamics in the limit of low temperature and low density. We consider the local version of the model, where particles live on a finite box and are created, respectively, annihilated at the boundary of the box in a way that reflects an infinite gas reservoir. We are interested in how the system nucleates, i.e., how it reaches a full box when it starts from an empty box. Our approach combines geometric and potential theoretic arguments. In two dimensions, we identify the full geometry of the set of critical droplets for the nucleation, compute the average nucleation time up to a multiplicative factor that tends to one in the limit of low temperature and low density, express the proportionality constant in terms of certain capacities associated with simple random walk, and compute the asymptotic behavior of this constant as the system size tends to infinity. In three dimensions, we obtain similar res...

  17. A System for Cooling inside a Glove Box

    Science.gov (United States)

    Sanz, Martial

    2010-01-01

    An easy, efficient, reliable, and low-cost method of constructing a cooling system using a simple circulating pump is described. The system is employed in conjunction with an inert atmosphere glove box to achieve the synthesis of air- and moisture-sensitive compounds inside the glove box at controlled, low temperatures without contaminating the…

  18. Decontamination and dismantling of large plutonium-contamined glove boxes

    International Nuclear Information System (INIS)

    Draulans, J.

    1991-01-01

    This report describes the work performed in the frame of two C.E.C. - Contracts FI1D-002400-B Decommissioning of very large glove boxes and FI1D-0058 Decommissioning of a complex glove box structure to be dismounted partially on place. Detailed information is given about each glove box. The selection of the solution Transportation of the glove boxes to a specialized dismantling plant is justified. The necessary contacts inside the BELGONUCLEAIRE MOX plant and between the latter and other organizations are explained. The problems of manipulating large gloves are listed and the retained solution of building a so called Stiffening frame around each glove box is described. Furthermore information is given concerning required operators time for cleaning, manipulating, packing and dismantling together with received doses and quantities of waste produced. Concerning the glove box unit partially to be dismounted on place, detailed information is given about the way the glove boxes have been treated prior to this partial dismantling on place and about the way this partial dismantling has been performed. From these results one can conclude that such a delicate task can be performed without major difficulties. Finally information is given of the decontamination test of a highly Pu contaminated glove box with freon with rather poor results and of the preliminary CO 2 blasting tests on non active samples

  19. Getting started with Oracle VM VirtualBox

    CERN Document Server

    Dash, Pradyumna

    2013-01-01

    A step-by-step guide that will show you how to install, configure, and manage VirtualBox.This book is for system administrators, technical architects, and virtualization enthusiasts who want to learn how to set up a virtual machine. Knowledge of the Linux environment is expected. Prior experience with VirtualBox or knowledge of virtualization is not required.

  20. Current implementation of advance encryption standard (AES) S-Box

    African Journals Online (AJOL)

    Although the attack on cryptosystem is still not severe, the development of the scheme is still ongoing especially for the design of S-Box. Two main approach has beenused, which are heuristic method and algebraic method. Algebraic method as in current AES implementation has been proven to be the most secure S-Box ...

  1. A sealed enclosure of the glove box type

    International Nuclear Information System (INIS)

    Moreels, Pierre.

    1974-01-01

    The invention relates to a sealed enclosure of the glove-box type. According to the invention, the box-frame comprises: angle-bars having a right-angled cross-section, sealing joints, tightening bars and fastening means [fr

  2. Modelling of Box Type Solar Cooker Performance in a Tropical ...

    African Journals Online (AJOL)

    Thermal performance model of box type solar cooker with loaded water is presented. The model was developed using the method of Funk to estimate cooking power in terms of climatic and design parameters for box type solar cooker in a tropical environment. Coefficients for each term used in the model were determined ...

  3. Lightweight S-Box Architecture for Secure Internet of Things

    Directory of Open Access Journals (Sweden)

    A. Prathiba

    2018-01-01

    Full Text Available Lightweight cryptographic solutions are required to guarantee the security of Internet of Things (IoT pervasiveness. Cryptographic primitives mandate a non-linear operation. The design of a lightweight, secure, non-linear 4 × 4 substitution box (S-box suited to Internet of Things (IoT applications is proposed in this work. The structure of the 4 × 4 S-box is devised in the finite fields GF (24 and GF ((222. The finite field S-box is realized by multiplicative inversion followed by an affine transformation. The multiplicative inverse architecture employs Euclidean algorithm for inversion in the composite field GF ((222. The affine transformation is carried out in the field GF (24. The isomorphic mapping between the fields GF (24 and GF ((222 is based on the primitive element in the higher order field GF (24. The recommended finite field S-box architecture is combinational and enables sub-pipelining. The linear and differential cryptanalysis validates that the proposed S-box is within the maximal security bound. It is observed that there is 86.5% lesser gate count for the realization of sub field operations in the composite field GF ((222 compared to the GF (24 field. In the PRESENT lightweight cipher structure with the basic loop architecture, the proposed S-box demonstrates 5% reduction in the gate equivalent area over the look-up-table-based S-box with TSMC 180 nm technology.

  4. Dream Box Learning. What Works Clearinghouse Intervention Report

    Science.gov (United States)

    What Works Clearinghouse, 2013

    2013-01-01

    "DreamBox Learning" is a supplemental online mathematics program that provides adaptive instruction for students in grades K-5 and focuses on number and operations, place value, and number sense. The What Works Clearinghouse (WWC) identified one study of "DreamBox Learning" that both falls within the scope of the Elementary…

  5. Using Willie's Acid-Base Box for Blood Gas Analysis

    Science.gov (United States)

    Dietz, John R.

    2011-01-01

    In this article, the author describes a method developed by Dr. William T. Lipscomb for teaching blood gas analysis of acid-base status and provides three examples using Willie's acid-base box. Willie's acid-base box is constructed using three of the parameters of standard arterial blood gas analysis: (1) pH; (2) bicarbonate; and (3) CO[subscript…

  6. Heart Rate and Liking During "Kinect Boxing" Versus "Wii Boxing": The Potential for Enjoyable Vigorous Physical Activity Videogames.

    Science.gov (United States)

    Sanders, Gabriel J; Peacock, Corey A; Barkley, Jacob E; Gish, Brian; Brock, Scott; Volpenhein, Josh

    2015-08-01

    Nintendo(®) (Kyoto, Japan) "Wii™ Sports Boxing" ("Wii Boxing") and Xbox(®) (Microsoft, Redmond, WA) "Kinect(®) Sports Boxing" ("Kinect Boxing") are both boxing simulation videogames that are available for two different active videogame (AVG) systems. Although these AVGs are similar, the style of gameplay required is different (i.e., upper body only versus total body movements) and may alter physical activity intensity and one's preference for playing one game over the other. AVGs that elicit the greatest physiologic challenge and are preferred by users should be identified in an effort to enhance the efficacy of physical activity interventions and programs that include AVGs. The mean heart rate (HRmean) and peak heart rate (HRpeak) for 27 adults (22.7±4.2 years old) were recorded during four 10-minute conditions: seated rest, treadmill walking at 3 miles/hour, "Wii Boxing," and "Kinect Boxing." Upon completion of all four conditions, participants indicated which condition they preferred, and HRmean and HRpeak were calculated as a percentage of age-predicted maximum heart rate to classify physical activity intensity for the three activity conditions (treadmill, "Wii Boxing," and "Kinect Boxing"). "Kinect Boxing" significantly (P<0.001) increased percentage HRmean (64.1±1.6 percent of age-predicted maximum) and percentage HRpeak (76.5±1.9 percent) above all other conditions: Wii HRmean, 53.0±1.2 percent; Wii HRpeak, 61.8±1.5 percent; treadmill HRmean, 52.4±1.2 percent; treadmill HRpeak, 55.2±2.2 percent. Percentage HRpeak for "Kinect Boxing" was great enough to be considered a vigorous-intensity physical activity. There was no difference (P=0.55) in percentage HRmean between "Wii Boxing" and treadmill walking. Participants also preferred "Kinect Boxing" (P<0.001; n=26) to all other conditions ("Wii Boxing," n=1; treadmill n=0). "Kinect Boxing" was the most preferred and the only condition that was physiologically challenging enough to be classified as a

  7. Determination of a Source in a Box with Two Detectors

    International Nuclear Information System (INIS)

    Presler, O.; Alfassi, Z. B.; Peled, O.; German, U.; Leichter, Y.

    2002-01-01

    Many measurements of radioactivity involve counting of gamma rays emitted by bulky samples, to which we refer in the general term a box . While it is simple experimentally, in the case of point source, to transform the measurements of counts per unit time to activity (disintegration per unit time) and hence to number of radioactive atoms, the problem can be quite inaccurate in the case of a bulky source. The inaccuracy is due to three factors. (1) The varying efficiency of counting of different parts of the bulky samples due to the different distances from the detector. (2) The self-absorption of the photons in the sample. (3) The unknown distribution of the radionuclides in the sample. The varying efficiency of different parts of the sample can be measured by mapping with standardized point sources and the self-absorption can be corrected if the composition of the sample is known (in other words the linear absorption coefficient is known). The various efficiencies together with absorption coefficients can be used to obtain by integration (either analytically or numerically) the absolute efficiency of the bulk samples, assuming the distribution of the radioactivity in the sample is homogenous. In many cases as e.g. in total body counting this assumption is made although the radionuclides might be concentrated only in a small part of the body. One method that is used in several total body counting systems to overcome this drawback is to use two detectors from both sides of the body. However, no study was done how to treat the count rates from the two detectors. It was found that for a relatively non-absorbing media a radioactive point source (hot spot) in a large box containing low absorbing material can be measured accurately using two NaI(Tl) gamma-ray detectors at opposite side of box i.e. at 180 degrees one to another. The harmonic mean of the count-rates square roots measured with the two detectors was found to be independent of the hot spot position and

  8. Getting started with Citrix VDI-in-a-Box

    CERN Document Server

    Brown, Stuart Arthur

    2013-01-01

    A practical and fast-paced guide that gives you all the information you need to simplify and streamline virtual desktops so you get a production-quality solution while instantly lowering your costs and improving security.Getting Started with Citrix VDI-in-a-Box is great for IT professionals who are new to VDI-in-a-Box and who are looking for a good grounding in the product. You may be planning to research VDI-in-a-Box in more detail, or you may be tasked with researching how VDI-in-a-Box could improve the productivity of your organization. No prior knowledge of VDI-in-a-Box is required, just a

  9. Structural testing of the technology integration box beam

    Science.gov (United States)

    Griffin, C. F.

    1992-01-01

    A full-scale section of a transport aircraft wing box was designed, analyzed, fabricated, and tested. The wing box section, which was called the technology integration box beam, contained blade stiffened covers and T-stiffened channel spars constructed using graphite/epoxy materials. Covers, spars, and the aluminum ribs were assembled using mechanical fasteners. The box beam was statically tested for several loading conditions to verify the stiffness and strength characteristics of the composite wing design. Failure of the box beam occurred at 125 percent of design limit load during the combined upbending and torsion ultimate design load test. It appears that the failure initiated at a stiffener runout location in the upper cover which resulted in rupture of the upper cover and portions of both spars.

  10. Software sensors based on the grey-box modelling approach

    DEFF Research Database (Denmark)

    Carstensen, J.; Harremoës, P.; Strube, Rune

    1996-01-01

    In recent years the grey-box modelling approach has been applied to wastewater transportation and treatment Grey-box models are characterized by the combination of deterministic and stochastic terms to form a model where all the parameters are statistically identifiable from the on......-line measurements. With respect to the development of software sensors, the grey-box models possess two important features. Firstly, the on-line measurements can be filtered according to the grey-box model in order to remove noise deriving from the measuring equipment and controlling devices. Secondly, the grey......-box models may contain terms which can be estimated on-line by use of the models and measurements. In this paper, it is demonstrated that many storage basins in sewer systems can be used as an on-line flow measurement provided that the basin is monitored on-line with a level transmitter and that a grey...

  11. Tworty Box to Improve the Equipment Logistics of Container Lines

    Directory of Open Access Journals (Sweden)

    Ulrich Malchow

    2016-07-01

    Full Text Available A major share of all empty container positioning (deadheading is resulting from imbalances with regard to container sizes (20ft/40ft. In order to reduce the shipments of 'containerised air' a new type of container has been developed by the author: The Tworty Boxes can either be used as a standard 20ft or in coupled condition as a 40ft container. The outside appearance resembles any standard 20ft container. However the Tworty Box is unique in that it has an additional door at the front side that opens to the inside. This door can be fixed to the ceiling and by using of bonding elements another Tworty Box can be joined up, thereby creating the full 40ft inside space. Operated as a single 20ft box the additional door remains locked, access is only through the existing standard door. Tworty Boxes do not require any additional components and fulfil all ISO and CSC requirements.

  12. Removal of the nonconformities in the drug boxes packaging industry

    Directory of Open Access Journals (Sweden)

    Bălan Emilia

    2017-01-01

    Full Text Available The paper presents the specific quality aspects of cardboard drug boxes (folding boxes used as packaging in pharmaceutical industry. The types of defects and nonconformities that occur during offset printing and finishing of the packaging products are being identified and analyzed, such as: differences in color printing, scratches on the printed sheets, cracks during creasing, unparalleled gluing in respect to the closing flaps, ungluing, successive drug boxes stick to each other. The paper also focuses on aspects regarding the nonconformities removal of the drug boxes by establishing a control plan and preventive and corrective methods applicable in different technological stages of the production flow. Monitoring and analyzing activities for quality improvement of the drug boxes, in accordance with the quality specifications required by customers were performed for 20 months on a production line with Heidelberg machines. Nonconformities considered in this paper are also encountered in advertising printing.

  13. Crystal structure of Methanococcus jannaschii TATA box-binding protein.

    Science.gov (United States)

    Adachi, Naruhiko; Senda, Miki; Natsume, Ryo; Senda, Toshiya; Horikoshi, Masami

    2008-11-01

    As the archaeal transcription system consists of a eukaryotic-type transcription apparatus and bacterial-type regulatory transcription factors, analyses of the molecular interface between the transcription apparatus and regulatory transcription factors are critical to reveal the evolutionary change of the transcription system. TATA box-binding protein (TBP), the central components of the transcription apparatus are classified into three groups: eukaryotic, archaeal-I and archaeal-II TBPs. Thus, comparative functional analysis of these three groups of TBP is important for the study of the evolution of the transcription system. Here, we present the first crystal structure of an archaeal-II TBP from Methanococcus jannaschii. The highly conserved and group-specific conserved surfaces of TBP bind to DNA and TFIIB/TFB, respectively. The phylogenetic trees of TBP and TFIIB/TFB revealed that they evolved in a coupled manner. The diversified surface of TBP is negatively charged in the archaeal-II TBP, which is completely different from the case of eukaryotic and archaeal-I TBPs, which are positively charged and biphasic, respectively. This difference is responsible for the diversification of the regulatory functions of TBP during evolution.

  14. Hypervalent silicon versus carbon: ball-in-a-box model.

    Science.gov (United States)

    Pierrefixe, Simon C A H; Fonseca Guerra, Célia; Bickelhaupt, F Matthias

    2008-01-01

    Why is silicon hypervalent and carbon not? Or why is [Cl-CH(3)-Cl](-) labile with a tendency to localize one of its axial C-Cl bonds and to largely break the other one, while the isostructural and isoelectronic [Cl-SiH(3)-Cl](-) forms a stable pentavalent species with a delocalized structure featuring two equivalent Si-Cl bonds? Various hypotheses have been developed over the years focusing on electronic and steric factors. Here, we present the so-called ball-in-a-box model, which tackles hypervalence from a new perspective. This model reveals the key role of steric factors and provides a simple way of understanding the above phenomena in terms of different atom sizes. Our bonding analyses are supported by computation experiments in which we probe, among other things, the shape of the S(N)2 potential-energy surface of Cl(-) attacking a carbon atom in the series of substrates CH(3)Cl, (.)CH(2)Cl, (..)CHCl, and (...)CCl. Our findings for ClCH(3)Cl(-) and ClSiH(3)Cl(-) are generalized to other Group 14 central atoms (Ge, Sn, and Pb) and axial substituents (F).

  15. Bioactive L acidissima protein hydrolysates using Box-Behnken design.

    Science.gov (United States)

    Sonawane, Sachin K; Arya, Shalini S

    2017-07-01

    This study examines the extraction and hydrolysis of proteins using single factor and Box-Behnken Design (BBD). From single factor tests, optimised extraction parameters were 1% alkali concentration, 40 °C temperature, 60 min time, and 1:20 solid to alkali ratio. Under these conditions; 924.31 mg/g of total protein was obtained from Limonia acidissima (L acidissima). The maximum degree of hydrolysis was 39.82% at pH 2, enzyme to substrate ratio 2.5% (w/w), and hydrolysis time was 42.41 min using BBD design. L acidissima seed protein hydrolysate showed 32.94% DPPH and 88.18% of ABTS activity at concentration of 100 µg/ml and 1 mg/ml, respectively. Reducing power of 0.16 and metal chelating activity of 87.39% was obtained from 5 mg/ml protein hydrolysates. This implied that L acidissima seed protein hydrolysate could be utilised in protein rich product or as protein supplements.

  16. Reinvestigating nanoprecipitation via Box-Behnken design: a systematic approach.

    Science.gov (United States)

    Singh, Yuvraj; Ojha, Preeti; Srivastava, Mukesh; Chourasia, Manish K

    2015-01-01

    This work demonstrates Box-Behnken design (BBD)'s capability in exploring scientific principles governing a process, different from its use in process optimisation. We have investigated nanoprecipitation (NP) of temozolomide with polycaprolactone. Five factors, surfactant, stirring speed (SS), dropping rate (DR), phase-volume ratio (PVR) and drug-polymer ratio (DPR) were varied over three levels. Corresponding particle size (238.9 ± 42.24 nm), zeta potential (ZP, -5.92 ± 3.15 mV), poly dispersity index (PDI, 0.176 ± 0.06) and entrapment efficiency (EE, 65.74 ± 9.83%) were put into different polynomial equations. Analysis of variance, lack of fit tests and regression analysis was applied on these equations to determine the one with best fit. This selected equation was subsequently adapted as the model to describe influence of factors on NP. 3D response surface plots corresponding to models and diagnostic plots relatable to normality of residuals were also constructed. In conclusion, application of BBD efficiently strategised experimental foray conducted to elucidate NP.

  17. Thermal performances of a "black box" heat exchanger in district heating system

    Science.gov (United States)

    Genić, Srbislav B.; Jaćimović, Branislav M.; Milovančević, Uroš M.; Ivošević, Miloš M.; Otović, Milena M.; Antić, Milan I.

    2018-03-01

    The procedure for field testing of plate heat exchanger, considered as a black box, is presented in the paper. After the field measurements have been conducted, simple but unambiguous procedure has been used to establish heat performance parameters including the heat duty and fouling factor. Advantage of hereby presented method is that it can be used for analysis of any other similar heat transfer equipment.

  18. Search for rare muon and pion decay modes with the Crystal Box detector

    International Nuclear Information System (INIS)

    Hoffman, C.M.; Bolton, R.D.; Bowman, J.D.

    1986-01-01

    New experimental upper limits for the branching ratios of the lepton-family-number nonconserving decays μ + → e + γ and μ + → e + γγ are presented. A new determination of γ, the ratio of pion axial-vector to vector form factors, from radiative pion decay is also reported. These results are from data taken with the Crystal Box detector at LAMPF

  19. Search for rare muon and pion decay modes with the crystal box detector

    International Nuclear Information System (INIS)

    Piilonen, L.E.; Bolton, R.D.; Bowman, J.D.

    1986-01-01

    New experiental upper limits for the branching ratios of the lepton-family-number nonconserving decays μ + → e + γ and μ + → e + γγ are presented. A new determination of γ, the ratio of pion axial vector to vector form factors, from radiative pion decay is also reported. These results are from data taken with the Crystal Box detector at LAMPF. 11 refs., 7 figs

  20. Genetics Home Reference: factor V Leiden thrombophilia

    Science.gov (United States)

    ... Twitter Home Health Conditions Factor V Leiden thrombophilia Factor V Leiden thrombophilia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Factor V Leiden thrombophilia is an inherited disorder of blood clotting . ...

  1. Design of strong wooden box coated with fiberglass reinforced resin for shipping and burial of contaminated glove boxes. Final report

    International Nuclear Information System (INIS)

    1982-01-01

    The project scope of work included the complete decontamination and decommissioning (D and D) of the Westinghouse ARD Fuel Laboratories at the Cheswick Site in the shortest possible time. This has been accomplished in the following four phases: (1) preparation of documents and necessary paperwork; packaging and shipping of all special nuclear materials in an acceptable form to a reprocessing agency; (2) decontamination of all facilities, glove boxes and equipment; loading of generated waste into bins, barrels and strong wooden boxes; (3) shipping of al bins, barrels and boxes containing waste to the designated burial site; removal of all utility services from the laboratories; and (4) final survey of remaining facilities and certification for nonrestricted use; preparation of final report. This attachment contains design of strong wooden box coated with fiberglass reinforced resin for shipping and burial of contaminated glove boxes

  2. The Association between Prolonged Jaundice and TATA Box Dinucleotide Repeats in Gilbert's Syndrome.

    Science.gov (United States)

    Pasha, Yadollah Zahed; Kacho, Mousa Ahmadpor; Niaki, Haleh Akhavan; Tarighati, Mehdi; Alaee, Ehsan

    2017-09-01

    Jaundice is a common condition during the neonatal period. Prolonged jaundice occurs in a large number of breastfed infants, considering the impact of genetic factors on the incidence of jaundice. To determine the association between prolonged jaundice and TATA box dinucleotide repeats in Gilbert's Syndrome (GS). In this case-control study, the case group consisted of 51 neonates with jaundice, aged more than two weeks with indirect bilirubin level higher than 10 mg/dl. Acute diseases, mother's use of phenobarbital and other medications were the exclusion criteria. The control group consisted of 54 newborns without jaundice. The two groups were matched in terms of age and sex. TATA box polymorphisms in the promoter region of UGT1A1 gene were evaluated using Polymerase Chain Reaction (PCR) in order to determine TATA box dinucleotide repeats. Overall, 64.7% and 50% of subjects in the case and control groups were male, respectively (p=0.168). The mean age of neonates in the case and control groups was 20.1±7.1days and 18.8±4.1 days, respectively. The distribution of Gilbert genome was not significantly different between the two groups. In the case group, 13.7% of the subjects were homozygous, 37.3% were heterozygous and 49% were normal. In the control group, 7.4% of the participants were homozygous, 35.2% were heterozygous and 57.4% were normal. The results of this study showed an association between TATA box polymorphism and prolonged jaundice in neonates which revealed that TATA box polymorphism is an important risk to increase and extend icterus.

  3. Technology integration box beam failure study

    Science.gov (United States)

    Shuart, M. J.; Ambur, Damodar R.; Davis, D. D., Jr.; Davis, R. C.; Farley, G. L.; Lotts, C. G.; Wang, J. T.

    1993-01-01

    Composite structures have the potential to be cost-effective, structurally efficient primary aircraft structures. The Advanced Composites Technology (ACT) Program has the goal to develop the technology to exploit this potential for heavily loaded aircraft structures. As part of the ACT Program, Lockheed Aeronautical Systems Company completed the design and fabrication of the Technology Integration Box Beam (TIBB). The TIBB is an advanced composite prototype structure for the center wing section of the C-130 aircraft. Lockheed subjected the TIBB to downbending, upbending, torsion and combined upbending and torsion load conditions to verify the design. The TIBB failed at 83 percent of design ultimate load for the combined upbending and torsion load condition. The objective of this paper is to describe the mechanisms that led to the failure of the TIBB. The results of a comprehensive analytical and experimental study are presented. Analytical results include strain and deflection results from both a global analysis of the TIBB and a local analysis of the failure region. These analytical results are validated by experimental results from the TIBB tests. The analytical and experimental results from the TIBB tests are used to determine a sequence of events that resulted in failure of the TIBB. A potential cause of failure is high stresses in a stiffener runout region. Analytical and experimental results are also presented for a stiffener runout specimen that was used to simulate the TIBB failure mechanisms.

  4. Rethinking sanitation: panacea or Pandora's box.

    Science.gov (United States)

    Esrey, S A

    2000-01-01

    In the 19th century, sanitation solutions were designed and built on the premises that human excreta was a waste suitable only for disposal and that the environment was capable of assimilating the waste. The prevailing view last century was that vapors from smells caused disease, and the best way to deal with excreta was to convey it to rivers and streams where it could be diluted and cleansed. Times have changed, the premises are outdated, and current solutions contribute, either directly or indirectly, to many of the problems faced by society today: water pollution, scarcity of fresh water, food insecurity, destruction and loss of soil fertility, loss of biodiversity, depletion of the ozone layer, and global warming. A common denominator of all these problems is how society deals with its wastes, specifically how it deals with human excrement. We have to rethink past premises, design and build new systems, and contribute to the solving of society's most pressing problems. The panacea of the 19th century is turning out to be the pandora's box of the 21st century.

  5. Boxes of Model Building and Visualization.

    Science.gov (United States)

    Turk, Dušan

    2017-01-01

    Macromolecular crystallography and electron microscopy (single-particle and in situ tomography) are merging into a single approach used by the two coalescing scientific communities. The merger is a consequence of technical developments that enabled determination of atomic structures of macromolecules by electron microscopy. Technological progress in experimental methods of macromolecular structure determination, computer hardware, and software changed and continues to change the nature of model building and visualization of molecular structures. However, the increase in automation and availability of structure validation are reducing interactive manual model building to fiddling with details. On the other hand, interactive modeling tools increasingly rely on search and complex energy calculation procedures, which make manually driven changes in geometry increasingly powerful and at the same time less demanding. Thus, the need for accurate manual positioning of a model is decreasing. The user's push only needs to be sufficient to bring the model within the increasing convergence radius of the computing tools. It seems that we can now better than ever determine an average single structure. The tools work better, requirements for engagement of human brain are lowered, and the frontier of intellectual and scientific challenges has moved on. The quest for resolution of new challenges requires out-of-the-box thinking. A few issues such as model bias and correctness of structure, ongoing developments in parameters defining geometric restraints, limitations of the ideal average single structure, and limitations of Bragg spot data are discussed here, together with the challenges that lie ahead.

  6. Non-signaling boxes and quantum logics

    International Nuclear Information System (INIS)

    Tylec, T I; Kuś, M

    2015-01-01

    Using a quantum logic approach we analyze the structure of the so-called non-signaling theories respecting relativistic causality, but allowing correlations violating bounds imposed by quantum mechanics such as CHSH inequality. We discuss the relations among such theories, quantum mechanics, and classical physics. Our main result is the construction of a probability theory adequate for the simplest instance of a non-signaling theory—the two non-signaling boxes world—in which we exhibit its differences in comparison with classical and quantum probabilities. We show that the question of whether such a theory can be treated as a kind of ‘generalization’ of the quantum theory of the two-qubit system cannot be answered positively. Some of its features put it closer to the quantum world—on the one hand, for example, the measurements are destructive, though on the other hand the Heisenberg uncertainty relations are not satisfied. Another interesting property contrasting it from quantum mechanics is that the subset of ‘classically correlated states’, i.e. the states with only classical correlations, does not reproduce the classical world of the two two-state systems. Our results establish a new link between quantum information theory and the well-developed theory of quantum logics. (paper)

  7. Opening up a Colourful Cosmic Jewel Box

    Science.gov (United States)

    2009-10-01

    The combination of images taken by three exceptional telescopes, the ESO Very Large Telescope on Cerro Paranal , the MPG/ESO 2.2-metre telescope at ESO's La Silla observatory and the NASA/ESA Hubble Space Telescope, has allowed the stunning Jewel Box star cluster to be seen in a whole new light. Star clusters are among the most visually alluring and astrophysically fascinating objects in the sky. One of the most spectacular nestles deep in the southern skies near the Southern Cross in the constellation of Crux. The Kappa Crucis Cluster, also known as NGC 4755 or simply the "Jewel Box" is just bright enough to be seen with the unaided eye. It was given its nickname by the English astronomer John Herschel in the 1830s because the striking colour contrasts of its pale blue and orange stars seen through a telescope reminded Herschel of a piece of exotic jewellery. Open clusters [1] such as NGC 4755 typically contain anything from a few to thousands of stars that are loosely bound together by gravity. Because the stars all formed together from the same cloud of gas and dust their ages and chemical makeup are similar, which makes them ideal laboratories for studying how stars evolve. The position of the cluster amongst the rich star fields and dust clouds of the southern Milky Way is shown in the very wide field view generated from the Digitized Sky Survey 2 data. This image also includes one of the stars of the Southern Cross as well as part of the huge dark cloud of the Coal Sack [2]. A new image taken with the Wide Field Imager (WFI) on the MPG/ESO 2.2-metre telescope at ESO's La Silla Observatory in Chile shows the cluster and its rich surroundings in all their multicoloured glory. The large field of view of the WFI shows a vast number of stars. Many are located behind the dusty clouds of the Milky Way and therefore appear red [3]. The FORS1 instrument on the ESO Very Large Telescope (VLT) allows a much closer look at the cluster itself. The telescope's huge mirror

  8. Real-Time Interaction between TBP and the TATA Box of the Human Triosephosphate Isomerase Gene Promoter in the Norm and Pathology.

    Science.gov (United States)

    Arkova, O V; Kuznetsov, N A; Fedorova, O S; Kolchanov, N A; Savinkova, L K

    2014-04-01

    The TATA-binding protein (TBP) is a key part of the transcription complex of RNA polymerase II. Alone or as a part of the basal transcription factor TFIID, TBP binds the TATA box located in the core region of the TATA-containing promoters of class II genes. Previously, we studied the effects of single nucleotide polymorphisms (SNPs) on TBP/TATA-box interactions using gel retardation assay. It was demonstrated that most SNPs in the TATA boxes of some human gene promoters cause a 2- to 4-fold decrease in TBP/TATA affinity, which is associated with an increased risk of hereditary diseases, such as β thalassemias of diverse severity, hemophilia B Leyden, myocardial infarction, thrombophlebitis, lung cancer, etc. In this work, the process of TBP/TATA complex formation has been studied in real time by a stopped-flow technique using recombinant human TBP and duplexes, which were identical to the TATA box of the wild-type and a SNP-containing triosephosphate isomerase gene promoter and were fluorescently labeled by the Cy3/Cy5 FRET pair. It has been demonstrated for the first time that real-time binding of TBP to the TATA box of the TPI gene promoter is complete within 10 s and is described by a single-stage kinetic model. The complex formation of TBP with the wild-type TATA box occurs 5.5 times faster and the complex dissociation occurs 31 times slower compared with the SNPcontaining TATA box. Within the first seconds of the interaction, TBP binds to and simultaneously bends the TATA box. Importantly, the TATA box of the wild-type TPI gene promoter requires lower TBP concentrations compared to the TATA box containing the -24T → G SNP, which is associated with neurological and muscular disorders, cardiomyopathy, and other diseases.

  9. Transverse load distribution of skew cast-in-place concrete multicell box - girder bridges subjected to traffic condition

    Directory of Open Access Journals (Sweden)

    Iman Mohseni

    Full Text Available Concrete multicell box-girder bridges are a common choice among the designers for various ranges of bridges. In order to provide safer and greater speed of traffic, the roadway is built as straight as possible. The use of skewed bridges has increased considerably in the recent years for roadway. The skewed bridges have quite different mechanical behavior from the straight bridges, although for skew angles less than 20 degrees, it is reasonably safe to ignore the effect of skew angles and analyze that at the straight bridge. In this study, in developing an analytical solution, an extensive parametric study was carried out to determine the maximum positive and negative stress distribution factors and to calculate the maximum distribution factor of deflection along the mid-span of skewed multicell box-girder bridges. A total of 240 representative bridges numerical models were selected and analyzed using SAP2000 finite element software. It was found that the span length, number of boxes, number of lanes and skew angles significantly affected the distribution factors of stress and deflection. Finally, several equations were proposed for stress and deflection distribution factors of multicell box-girder bridges for the application of American Association of State Highway and Transportation officials load and resistance factor design live loads.

  10. DNA Radiation Environments Program: Fall 1989 2-meter box experiments and analysis

    International Nuclear Information System (INIS)

    Santoro, R.T.

    1991-05-01

    This effort, sponsored by the Defense Nuclear Agency under the Radiation Environments Program, was carried out to obtain measured data for benchmarking MASH, the Monte Carlo Adjoint Code System. MASH was developed to replace the Vehicle Code System, VCS, that has been used by the Department of Defense and NATO for calculating neutron and gamma-ray radiation fields and shielding protection factors inside armored vehicles and structures from nuclear weapon radiation. Free-field data were obtained at distances of 170- and 400-meters from the APR while in-box measurements were made at 400 meters only. The box, included to obtain neutron and gamma-ray reduction factors, was a 2-meter cube configuration having 0.1016-m-thick steel walls. Calculated data were obtained using MASH by analysts from the Oak Ridge National Laboratory and Science Applications International Corporation. Calculated (C) results were compared with experimental (E) data in terms of C/E ratios. Free-field and in-box neutron kerma generally agreed within ±20%, although some C/E comparisons fell outside this range depending upon the detector against which the calculated data were compared. For those cases where the C/E ratio is marginal or unacceptable, problems in the detector systems were acknowledged to be principal cause of the discrepancy. Generally poor agreement (∼25-35%) was achieved among the C/E ratios for the free-field gamma-ray kerma at the 170- and 400-m locations while excellent (10%, or better) C/E values were obtained for the in-box conditions. The discrepancy for the free-field comparison was attributed to the failure by the analysts to include a tree line adjacent to the measurement site in the calculational geometry. C/E values for the neutron and gamma-ray reduction factors ranged from 1% to 23% depending on the detector. 4 refs., 2 figs., 14 tabs

  11. Assembly and trafficking of box C/D and H/ACA snoRNPs.

    Science.gov (United States)

    Massenet, Séverine; Bertrand, Edouard; Verheggen, Céline

    2017-06-03

    Box C/D and box H/ACA snoRNAs are abundant non-coding RNAs that localize in the nucleolus and mostly function as guides for nucleotide modifications. While a large pool of snoRNAs modifies rRNAs, an increasing number of snoRNAs could also potentially target mRNAs. ScaRNAs belong to a family of specific RNAs that localize in Cajal bodies and that are structurally similar to snoRNAs. Most scaRNAs are involved in snRNA modification, while telomerase RNA, which contains H/ACA motifs, functions in telomeric DNA synthesis. In this review, we describe how box C/D and H/ACA snoRNAs are processed and assembled with core proteins to form functional RNP particles. Their biogenesis involve several transport factors that first direct pre-snoRNPs to Cajal bodies, where some processing steps are believed to take place, and then to nucleoli. Assembly of core proteins involves the HSP90/R2TP chaperone-cochaperone system for both box C/D and H/ACA RNAs, but also several factors specific for each family. These assembly factors chaperone unassembled core proteins, regulate the formation and disassembly of pre-snoRNP intermediates, and control the activity of immature particles. The AAA+ ATPase RUVBL1 and RUVBL2 belong to the R2TP co-chaperones and play essential roles in snoRNP biogenesis, as well as in the formation of other macro-molecular complexes. Despite intensive research, their mechanisms of action are still incompletely understood.

  12. Utilization of Boxes for Pesticide Storage in Sri Lanka

    DEFF Research Database (Denmark)

    Pieris, Ravi; Weerasinghe, Manjula; Abeywickrama, Tharaka

    2017-01-01

    Pesticide self-poisoning is now considered one of the two most common methods of suicide worldwide. Encouraging safe storage of pesticides is one particular approach aimed at reducing pesticide self-poisoning. CropLife Sri Lanka (the local association of pesticide manufacturers), with the aid...... of the Department of Agriculture, distributed lockable in-house pesticide storage boxes free of charge to a farming community in a rural district of Sri Lanka. Padlocks were not provided with the boxes. These storage boxes were distributed to the farmers without prior education. The authors carried out a cross...

  13. Optimal Black-Box Secret Sharing over Arbitrary Abelian Groups

    DEFF Research Database (Denmark)

    Cramer, Ronald; Fehr, Serge

    2002-01-01

    are defined over ℤ and are designed independently of the group G from which the secret and the shares are sampled. This means that perfect completeness and perfect privacy are guaranteed regardless of which group G is chosen. We define the black-box secret sharing problem as the problem of devising....... A recent example is secure general multi-party computation over black-box rings. In 1994 Desmedt and Frankel have proposed an elegant approach to the black-box secret sharing problem based in part on polynomial interpolation over cyclotomic number fields. For arbitrary given T t,n with 0

  14. Security of the AES with a Secret S-Box

    DEFF Research Database (Denmark)

    Tiessen, Tyge; Knudsen, Lars Ramkilde; Kölbl, Stefan

    2015-01-01

    How does the security of the AES change when the S-box is replaced by a secret S-box, about which the adversary has no knowledge? Would it be safe to reduce the number of encryption rounds? In this paper, we demonstrate attacks based on integral cryptanalysis which allow to recover both the secret...... key and the secret S-box for respectively four, five, and six rounds of the AES. Despite the significantly larger amount of secret information which an adversary needs to recover, the attacks are very efficient with time/data complexities of 217/216, 238/240 and 290/264, respectively. Another...

  15. Scattering phaseshift formulas for mesons and baryons in elongated boxes

    Science.gov (United States)

    Lee, Frank X.; Alexandru, Andrei

    2018-03-01

    We derive Lüscher phaseshift formulas for two-particle states in boxes elongated in one of the dimensions. Such boxes offer a cost-effective way of varying the relative momentum of the particles. Boosted states in the elongated direction, which allow wider access to energies, are also considered. The formulas for the various scenarios (moving and zero-momentum states in cubic and elongated boxes) are compared and relations between them are clarified. The results are applicable to a wide set of meson-meson and meson-baryon elastic scattering processes, with the two-particle system having equal or unequal masses.

  16. Visual pigments of the box jellyfish species Chiropsella bronzie

    DEFF Research Database (Denmark)

    O*Connor, Megan; Garm, Anders Lydik; Marshall, Justin

    2010-01-01

    Box jellyfish (Cubomedusae) possess a unique visual system comprising 24 eyes of four morphological types. Moreover, box jellyfish display several visually guided behaviours, including obstacle avoidance and light-shaft attractance. It is largely unknown what kind of visual information box jellyf...... results strongly indicate that only one type of visual pigment is present in the upper and lower lens eyes with a peak absorbance of approximately 510 nm. Additionally, the visual pigment appears to undergo bleaching, similar to that of vertebrate visual pigments....

  17. Two-electron atomic systems confined within spheroidal boxes

    Energy Technology Data Exchange (ETDEWEB)

    Corella-Madueno, A.; Rosas, R.A.; Marin, J.L.; Riera, R.

    2000-03-15

    The direct variational method is used to estimate some interesting physical properties of the He atom and the Li{sup +} ion confined within impenetrable spheroidal boxes. A comparative investigation f the ground=state energy, pressure, polarizability, dipole, and quadrupole moments with those of the He atom inside boxes with paraboloidal walls is made. The overall results show a similar qualitative behavior. However, for Li{sup +} there are quantitative differences on such properties due to its major nuclear charge, as expected. The trial wave function is constructed as a product of two hydrogenic wave functions adapted to the geometry of the confining boxes.

  18. Faster Black-Box Algorithms Through Higher Arity Operators

    DEFF Research Database (Denmark)

    Doerr, Benjamin; Johannsen, Daniel; Kötzing, Timo

    2011-01-01

    We extend the work of Lehre and Witt (GECCO 2010) on the unbiased black-box model by considering higher arity variation operators. In particular, we show that already for binary operators the black-box complexity of LeadingOnes drops from (n2) for unary operators to O(n log n). For OneMax, the (n...... log n) unary black-box complexity drops to O(n) in the binary case. For k-ary operators, k n, the OneMax-complexity further decreases to O(n= log k)....

  19. Deep Cuboid Detection: Beyond 2D Bounding Boxes

    OpenAIRE

    Dwibedi, Debidatta; Malisiewicz, Tomasz; Badrinarayanan, Vijay; Rabinovich, Andrew

    2016-01-01

    We present a Deep Cuboid Detector which takes a consumer-quality RGB image of a cluttered scene and localizes all 3D cuboids (box-like objects). Contrary to classical approaches which fit a 3D model from low-level cues like corners, edges, and vanishing points, we propose an end-to-end deep learning system to detect cuboids across many semantic categories (e.g., ovens, shipping boxes, and furniture). We localize cuboids with a 2D bounding box, and simultaneously localize the cuboid's corners,...

  20. Design of housing file box of fire academy based on RFID

    Science.gov (United States)

    Li, Huaiyi

    2018-04-01

    This paper presents a design scheme of intelligent file box based on RFID. The advantages of RFID file box and traditional file box are compared and analyzed, and the feasibility of RFID file box design is analyzed based on the actual situation of our university. After introducing the shape and structure design of the intelligent file box, the paper discusses the working process of the file box, and explains in detail the internal communication principle of the RFID file box and the realization of the control system. The application of the RFID based file box will greatly improve the efficiency of our school's archives management.

  1. The AirQuality SenseBox

    Science.gov (United States)

    Demuth, Dustin; Nuest, Daniel; Bröring, Arne; Pebesma, Edzer

    2013-04-01

    In the past year, a group of open hardware enthusiasts and citizen scientists had large success in the crowd-funding of an open hardware-based sensor platform for air quality monitoring, called the Air Quality Egg. Via the kickstarter platform, the group was able to collect triple the amount of money than needed to fulfill their goals. Data generated by the Air Quality Egg is pushed to the data logging platform cosm.com, which makes the devices a part of the Internet of Things. The project aims at increasing the participation of citizens in the collection of data, the development of sensors, the operation of sensor stations, and, as data on cosm is publicly available, the sharing, visualization and analysis of data. Air Quality Eggs can measure NO2 and CO concentrations, as well as relative humidity and temperature. The chosen sensors are low-cost and have limited precision and accurracy. The Air Quality Egg consists of a stationary outdoor and a stationary indoor unit. Each outdoor unit will wirelessly transmit air quality measurements to the indoor unit, which forwards the data to cosm. Most recent versions of the Air Quality Egg allow a rough calibration of the gas sensors and on-the-fly conversion from raw sensor readings (impedance) to meaningful air quality data expressed in units of parts per billion. Data generated by these low-cost platforms are not intended to replace well-calibrated official monitoring stations, but rather augment the density of the total monitoring network with citizen sensors. To improve the usability of the Air Quality Egg, we present a new and more advanced concept, called the AirQuality SenseBox. We made the outdoor platform more autonomous and location-aware by adding solarpanels and rechargeable batteries as a power source. The AirQuality SenseBox knows its own position from a GPS device attached to the platform. As a mobile sensor platform, it can for instance be attached to vehicles. A low-cost and low-power wireless chipset

  2. Pitx2-dependent occupancy by histone deacetylases is associated with T-box gene regulation in mammalian abdominal tissue.

    Science.gov (United States)

    Hilton, Traci; Gross, Michael K; Kioussi, Chrissa

    2010-04-09

    The homeodomain transcription factor Pitx2 and the T-box transcription factors are essential for organogenesis. Pitx2 and T-box genes are induced by growth factors and function as transcriptional activators or repressors. Gene expression analyses on abdominal tissue were used to identify seven of the T-box genes of the genome as Pitx2 target genes in the abdomen at embryonic day.10.5. Pitx2 activated Tbx4, Tbx15, and Mga and repressed Tbx1, Tbx2, Tbx5, and Tbx6 expression. As expected, activated genes showed reduced expression patterns, and repressed T-box genes showed increased expression patterns in the abdomen of Pitx2 mutants. Pitx2 occupied chromatin sites near all of these T-box genes. Co-occupancy by coactivators, corepressors, and histone acetylation at these sites was frequently Pitx2-dependent. Genes repressed by Pitx2 generally showed increased histone acetylation and decreased histone deacetylase (HDAC)/corepressor occupancy in Pitx2 mutants. The lower N-CoR, HDAC1, and HDAC3 occupancy observed at multiple sites along Tbx1 chromatin in mutants is consistent with the model that increased histone acetylation and gene expression of Tbx1 may result from a loss of recruitment of corepressors by Pitx2. Genes activated by Pitx2 showed less consistent patterns in chromatin analyses. Reduced H4 acetylation and increased HDAC1/nuclear receptor corepressor (N-CoR) occupancy at some Tbx4 sites were accompanied by increased H3 acetylation and reduced HDAC3 occupancy at the same or other more distal chromatin sites in mutants. Pitx2-dependent occupancy by corepressors resulted in alteration of the acetylation levels of several T-box genes, whereas Pitx2-dependent occupancy by coactivators was more site-localized. These studies will provide the basic scientific underpinning to understand abdominal wall syndromes.

  3. Intercomparison of Chemical Multiphase Box Models

    Science.gov (United States)

    Ervens, B.; Barth, M. C.; Herrmann, H.; McNeill, V. F.; Carlton, A. G.; Lance, S.; Morichetti, M.; Tilgner, A.

    2017-12-01

    It has been recognized for several decades that chemical processes in clouds and fogs can substantially alter atmospheric oxidant budgets and lead to aerosol mass formation. However, many current regional and global models do not include detailed aqueous-phase chemical mechanisms due to the lack of complete understanding of the underlying chemical processes, but also due to the computational burden of adding more constituents. The cloud chemistry community has begun an effort in connection with the Whiteface Mountain Observatory in New York to sample a suite of chemical compounds in cloud water and to evaluate and compare the state of knowledge of current gas-aqueous chemistry 0-dimensional models. Using the 17-18 September 2016 cloud event at Whiteface Mountain Observatory for input data, a cloud chemistry box model intercomparison was conducted. The focus of the intercomparison was on the predicted oxidant levels in both the gas and aqueous phases and on the formation of sulfate and secondary organic aerosol mass via aqueous-phase chemistry. We will present model results from the model intercomparison participants and discuss commonalities and reasons for differences in predicted concentrations of various chemical species in both phases. The conclusions of this workshop include a ranking of the importance of chemical (e.g., number of chemical species and processes), microphysical (e.g., cloud parameters) and meteorological (e.g., vertical mixing) parameters. An outlook will be given with recommendations on the most suitable multiphase chemical mechanism and essential parameters that should be derived from field measurements in order to improve the current state of chemical multiphase modules in models of various scales.

  4. A Role for the F-Box Protein HAWAIIAN SKIRT in Plant microRNA Function.

    Science.gov (United States)

    Lang, Patricia L M; Christie, Michael D; Dogan, Ezgi S; Schwab, Rebecca; Hagmann, Jörg; van de Weyer, Anna-Lena; Scacchi, Emanuele; Weigel, Detlef

    2018-01-01

    As regulators of gene expression in multicellular organisms, microRNAs (miRNAs) are crucial for growth and development. Although a plethora of factors involved in their biogenesis and action in Arabidopsis ( Arabidopsis thaliana ) has been described, these processes and their fine-tuning are not fully understood. Here, we used plants expressing an artificial miRNA target mimic (MIM) to screen for negative regulators of miR156. We identified a new mutant allele of the F-box gene HAWAIIAN SKIRT ( HWS ; At3G61590), hws - 5 , as a suppressor of the MIM156 -induced developmental and molecular phenotypes. In hws plants, levels of some endogenous miRNAs are increased and their mRNA targets decreased. Plants constitutively expressing full-length HWS-but not a truncated version lacking the F-box domain-display morphological and molecular phenotypes resembling those of mutants defective in miRNA biogenesis and activity. In combination with such mutants, hws loses its delayed floral organ abscission ("skirt") phenotype, suggesting epistasis. Also, the hws transcriptome profile partially resembles those of well-known miRNA mutants hyl1 - 2 , se - 3 , and ago1 - 27 , pointing to a role in a common pathway. We thus propose HWS as a novel, F-box dependent factor involved in miRNA function. © 2018 American Society of Plant Biologists. All Rights Reserved.

  5. Trial manufacture of portable type `WISH BOX`; Kahangata WISH BOX no shisaku kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    Ushiyama, I.; Sakuma, H.; Qin, W. [Ashikaga Institute of Technology, Tochigi (Japan); Onai, Y.

    1996-10-27

    This paper proposes the small portable type power source `WISH BOX` (wind and solar hybrid) composed of a small wind power generator and solar cell panels. Since solar radiation and wind power are complementary to each other in seasons, day and night, and fine and cloudy weather, WISH BOX is useful for standalone power source in non-power areas of developing countries, life spot in disasters, and outdoor leisure. The most small light-weight high-performance AIR303 produced by Southwest Windpower Co., USA is used as wind power generator, and two 50W solar cell panels HSC-5010-S produced by Daido Hokusan Co. is used. Sealed lead storage batteries (12V, 20Ah each) are also connected to cope with load fluctuation. In comparison with conventional portable gasoline engine generators, this environment-friendly generator is featured by fuel-free, no emission of gases, no noises and no fire occurrence, and can also supply stable power with small batteries even in the nighttime and cloudy weather by combining wind power. The generator of 400,000 yen is now in field experiment. 2 refs., 5 figs.

  6. Seismic response of skewed RC box-girder bridges

    Science.gov (United States)

    Abdel-Mohti, Ahmed; Pekcan, Gokhan

    2008-12-01

    It is critical to ensure the functionality of highway bridges after earthquakes to provide access to important facilities. Since the 1971 San Fernando earthquake, there has been a better understanding of the seismic performance of bridges. Nonetheless, there are no detailed guidelines addressing the performance of skewed highway bridges. Several parameters affect the response of skewed highway bridges under both service and seismic loads which makes their behavior complex. Therefore, there is a need for more research to study the effect of skew angle and other related factors on the performance of highway bridges. This paper examines the seismic performance of a three-span continuous concrete box girder bridge with skew angles from 0 to 60 degrees, analytically. Finite element (FE) and simplified beam-stick (BS) models of the bridge were developed using SAP2000. Different types of analysis were considered on both models such as: nonlinear static pushover, and linear and nonlinear time history analyses. A comparison was conducted between FE and BS, different skew angles, abutment support conditions, and time history and pushover analysis. It is shown that the BS model has the capability to capture the coupling due to skew and the significant modes for moderate skew angles. Boundary conditions and pushover load profile are determined to have a major effect on pushover analysis. Pushover analysis may be used to predict the maximum deformation and hinge formation adequately.

  7. The parameters effect on the structural performance of damaged steel box beam using Taguchi method

    Science.gov (United States)

    El-taly, Boshra A.; Abd El Hameed, Mohamed F.

    2018-01-01

    In the current study, the influence of notch or opening parameters and the positions of the applied load on the structural performance of steel box beams up to failure was investigated using Finite Element analysis program, ANSYS. The Taguchi-based design of experiments technique was used to plan the current study. The plan included 12 box steel beams; three intact beams, and nine damaged beams (with opening) in the beams web. The numerical studies were conducted under varying the spacing between the two concentrated point loads (location of applied loads), the notch (opening) position, and the ratio between depth and width of the notch with a constant notch area. According to Taguchi analysis, factor X (location of the applied loads) was found the highest contributing parameters for the variation of the ultimate load, vertical deformation, shear stresses, and the compressive normal stresses.

  8. The Research of Doubly-fed Wind Turbine Gear Box of the Status of the Comprehensive Evaluation Method

    Science.gov (United States)

    Jiang, Xiuchen; Sheng, Gehao; Wang, Zhijie; Liu, Sanming; Sun, Congcong

    2017-05-01

    Multiple indexes and multiple level comprehensive evaluations for wind power gear box focus more attention in recent days. Through the analysis of the state of wind turbine gearbox, fault hazard degree and other factors that is related with the internal temperature in gear box, environment temperature and the characteristics of wind speed, state evaluation index system of health indicators that is based on the current state of the age and the fault hazard health degree is established in this paper. Combined with the hazard matrix, current hazard degree is obtained. The effectiveness of adding health indicators is proved by examples.

  9. Earthquake resistance test of full-scale glove box

    International Nuclear Information System (INIS)

    Fujita, T.; Ohtani, K.; Hayashi, M.; Kozeki, M.; Ide, T.; Sakuno, K.

    1989-01-01

    A glove box used at nuclear facilities must confine radioactive materials. High airtightness and negative internal pressure are used to prevent leaks. The allowable leakage rate of air is 0.1% vol/hr or less at the pre-service inspection. The negative pressure value is kept at - 30 mm H 2 O in normal operation. The glove box structural strength and its confinement reliability during an earthquake are major concerns. The verification of aseismic analysis methods and assumptions for a glove box are thus of great importance. Data on the dynamic behavior of giant glove boxes was recently obtained in large shaker experiments. This paper describes these experimental results and the appropriateness of aseismic analysis methods used in current design

  10. Injury and injury rates in Muay Thai kick boxing

    OpenAIRE

    Gartland, S; Malik, M; Lovell, M

    2001-01-01

    Objective—To determine the type and number of injuries that occur during the training and practice of Muay Thai kick boxing and to compare the data obtained with those from previous studies of karate and taekwondo.

  11. EPA EcoBox Tools by Stressors - Biological

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  12. Design and development of a freezer and chiller delivery box

    Science.gov (United States)

    Zakaria, Mohd Zakimi; Hung, Goh Chung; Dawi, Mohd Syedi Imran Mohd; Hussin, Radhwan; Khalil, Ahmad Nabil Mohd; Naim, Muhammad Khairy Md; Hilmi, Ahmad Humaizi

    2017-09-01

    This paper presents an action research of designed and fabricated using well insulating materials in order to ensure the coolness inside the freezer and chiller delivery box is as good minimize temperature raised. The main purpose of this study is to develop freeze and chiller delivery box that will be able to keep fresh meat during travelling long delivery. A range of freeze and chill solutions exists for that must be kept within a specific temperature range throughout the supply-and-distribution chain. This will help to minimize the activeness of bacteria to spoil the meats, at the same time it can linger the duration for meats to spoil. All affecting parameter such as temperature inside the delivery box, heat transfer rate, and natural convection flow pattern has been studied to design and development of the delivery box. Finally, temperature distribution analysis has been conducted which showed that in operating condition inside temperature are suitable to keep the fresh meats condition.

  13. EPA EcoBox Tools by Effects - Aquatic

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  14. Confirmation test on confinement performance of improved glove box

    International Nuclear Information System (INIS)

    Miura, S.; Kanazawa, J.; Nakajima, M.; Sakuno, K.; Miyata, H.

    1995-01-01

    Glove boxes are used at nuclear facilities to confine radioactive materials by ensuring a high level of airtightness and negative internal pressure. The allowable rate of air leakage is 0.1% vol/hr or less at the pre-service inspection. The negative pressure value is normally maintained at about -30 mm H 2 O. Structural strength and confinement reliability of glove boxes during earthquake are major concerns, and most important glove boxes are designed to withstand seismic class A events is Japan. This paper describes vibration tests done to confirm that improve large-sized glove boxes maintain their confinement performance and structural strength even during earthquake and that the design analysis methods used are appropriate. (author). 1 ref., 6 figs., 3 tabs

  15. Cryogenic distribution box for Fermi National Accelerator Laboratory

    Science.gov (United States)

    Svehla, M. R.; Bonnema, E. C.; Cunningham, E. K.

    2017-12-01

    Meyer Tool & Mfg., Inc (Meyer Tool) of Oak Lawn, Illinois is manufacturing a cryogenic distribution box for Fermi National Accelerator Laboratory (FNAL). The distribution box will be used for the Muon-to-electron conversion (Mu2e) experiment. The box includes twenty-seven cryogenic valves, two heat exchangers, a thermal shield, and an internal nitrogen separator vessel, all contained within a six-foot diameter ASME coded vacuum vessel. This paper discusses the design and manufacturing processes that were implemented to meet the unique fabrication requirements of this distribution box. Design and manufacturing features discussed include: 1) Thermal strap design and fabrication, 2) Evolution of piping connections to heat exchangers, 3) Nitrogen phase separator design, 4) ASME code design of vacuum vessel, and 5) Cryogenic valve installation.

  16. Experts’ Misinterpretation of Box Plots – a Dual Processing Approach

    Directory of Open Access Journals (Sweden)

    Stephanie Lem

    2014-11-01

    Full Text Available Recent studies have shown that students often misinterpret the area of the box in box plots as representing the frequency or proportion of observations in that interval, while it actually represents density. This misinterpretation has been shown to be based on the saliency of this area and can be explained by heuristic reasoning as defined by dual process theories. In this study we tested whether expert users of box plots also display this misinterpretation and show signs of the same heuristic reasoning as found in students. Using a reaction time test, we found signs of heuristic reasoning in experts, both with respect to accuracy and reaction times. If even experts have difficulty interpreting box plots, one can question whether these are an appropriate form of representation to use when reporting data and deserve the prominent place they currently have in the statistics curriculum.

  17. Fusion welded fabrication of unshielded steel glove boxes

    International Nuclear Information System (INIS)

    1981-04-01

    This Specification deals with the manufacture, testing, inspection and delivery of fabricated glove boxes, including such internal and/or external fittings as are shown on the relevant drawings. (author)

  18. Radiotheraphy of tumors of osseus box of encephalos

    International Nuclear Information System (INIS)

    Cintra e Oliveira, V.; Morales, F.C.

    1984-01-01

    A revision of malignant pathology involving the osseous box of encephalos (and base of skull), their peculiarities, histological patterns and used treatment plans are made. The frequency of pathology and the clinical behaviour are showed. (Author) [pt

  19. Box photosynthesis modeling results for WRF/CMAQ LSM

    Data.gov (United States)

    U.S. Environmental Protection Agency — Box Photosynthesis model simulations for latent heat and ozone at 6 different FLUXNET sites. This dataset is associated with the following publication: Ran, L., J....

  20. EPA EcoBox Tools by Stressors - Physical

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  1. EPA EcoBox Tools by Exposure Pathways

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  2. EPA EcoBox Tools by Exposure Pathways - Air

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  3. EPA EcoBox Tools by Exposure Pathways - Soil

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  4. Cistern and planter box monitoring in Camden, NJ revisited

    Science.gov (United States)

    The Camden County Municipal Utilities Authority installed green infrastructure Stormwater Control Measures at multiple locations around the city of Camden, NJ. The Stormwater Control Measures include raised downspout planter boxes and cisterns. EPA is monitoring a subset of the ...

  5. Design, analysis, and fabrication of the technology integration box beam

    Science.gov (United States)

    Griffin, C. F.; Meade, L. E.

    1991-01-01

    Numerous design concepts, materials, and manufacturing methods were investigated analytically and empirically for the covers and spars of a transport wing box. This information was applied to the design, analysis, and fabrication of a full-scale section of a transport wing box. A blade-stiffened design was selected for the upper and lower covers of the box. These covers have been constructed using three styles of AS4/974 prepreg fabrics. The front and rear T-stiffened channel spars were filament wound using AS4/1806 towpreg. Covers, ribs, and spars were assembled using mechanical fasteners. When they are completed later this year, the tests on the technology integration box beam will demonstrate the structural integrity of an advanced composite wing design which is 25 percent lighter than the metal baseline.

  6. Nopaline-type Ti plasmid of Agrobacterium encodes a VirF-like functional F-box protein.

    Science.gov (United States)

    Lacroix, Benoît; Citovsky, Vitaly

    2015-11-20

    During Agrobacterium-mediated genetic transformation of plants, several bacterial virulence (Vir) proteins are translocated into the host cell to facilitate infection. One of the most important of such translocated factors is VirF, an F-box protein produced by octopine strains of Agrobacterium, which presumably facilitates proteasomal uncoating of the invading T-DNA from its associated proteins. The presence of VirF also is thought to be involved in differences in host specificity between octopine and nopaline strains of Agrobacterium, with the current dogma being that no functional VirF is encoded by nopaline strains. Here, we show that a protein with homology to octopine VirF is encoded by the Ti plasmid of the nopaline C58 strain of Agrobacterium. This protein, C58VirF, possesses the hallmarks of functional F-box proteins: it contains an active F-box domain and specifically interacts, via its F-box domain, with SKP1-like (ASK) protein components of the plant ubiquitin/proteasome system. Thus, our data suggest that nopaline strains of Agrobacterium have evolved to encode a functional F-box protein VirF.

  7. Molecular cloning and characterization of an F-box family gene CarF-box1 from chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Jia, Yuying; Gu, Hanyan; Wang, Xiansheng; Chen, Quanjia; Shi, Shubing; Zhang, Jusong; Ma, Lin; Zhang, Hua; Ma, Hao

    2012-03-01

    F-box protein family has been found to play important roles in plant development and abiotic stress responses via the ubiquitin pathway. In this study, an F-box gene CarF-box1 (for Cicer arietinum F-box gene 1, Genbank accession no. GU247510) was isolated based on a cDNA library constructed with chickpea seedling leaves treated by polyethylene glycol. CarF-box1 encoded a putative protein with 345 amino acids and contained no intron within genomic DNA sequence. CarF-box1 is a KFB-type F-box protein, having a conserved F-box domain in the N-terminus and a Kelch repeat domain in the C-terminus. CarF-box1 was localized in the nucleus. CarF-box1 exhibited organ-specific expression and showed different expression patterns during seed development and germination processes, especially strongly expressed in the blooming flowers. In the leaves, CarF-box1 could be significantly induced by drought stress and slightly induced by IAA treatment, while in the roots, CarF-box1 could be strongly induced by drought, salinity and methyl jasmonate stresses. Our results suggest that CarF-box1 encodes an F-box protein and may be involved in various plant developmental processes and abiotic stress responses.

  8. Safety evaluation for packaging (onsite) depleted uranium waste boxes

    Energy Technology Data Exchange (ETDEWEB)

    McCormick, W.A.

    1997-08-27

    This safety evaluation for packaging (SEP) allows the one-time shipment of ten metal boxes and one wooden box containing depleted uranium material from the Fast Flux Test Facility to the burial grounds in the 200 West Area for disposal. This SEP provides the analyses and operational controls necessary to demonstrate that the shipment will be safe for the onsite worker and the public.

  9. Safety evaluation for packaging (onsite) depleted uranium waste boxes

    International Nuclear Information System (INIS)

    McCormick, W.A.

    1997-01-01

    This safety evaluation for packaging (SEP) allows the one-time shipment of ten metal boxes and one wooden box containing depleted uranium material from the Fast Flux Test Facility to the burial grounds in the 200 West Area for disposal. This SEP provides the analyses and operational controls necessary to demonstrate that the shipment will be safe for the onsite worker and the public

  10. Accounting for latent classes in movie box office modeling

    OpenAIRE

    Antipov, Evgeny; Pokryshevskaya, Elena

    2010-01-01

    This paper addresses the issue of unobserved heterogeneity in film characteristics influence on box-office. We argue that the analysis of pooled samples, most common among researchers, does not shed light on underlying segmentations and leads to significantly different estimates obtained by researchers running similar regressions for movie success modeling. For instance, it may be expected that a restrictive MPAA rating is a box office poison for a family comedy, while it insignificantly infl...

  11. Dynamics underlying Box-office: Movie Competition on Recommender Systems

    OpenAIRE

    Yeung, C. H.; Cimini, G.; Jin, C. -H.

    2010-01-01

    We introduce a simple model to study movie competition in the recommender systems. Movies of heterogeneous quality compete against each other through viewers' reviews and generate interesting dynamics of box-office. By assuming mean-field interactions between the competing movies, we show that run-away effect of popularity spreading is triggered by defeating the average review score, leading to hits in box-office. The average review score thus characterizes the critical movie quality necessar...

  12. Boxing training for patients with Parkinson disease: a case series.

    Science.gov (United States)

    Combs, Stephanie A; Diehl, M Dyer; Staples, William H; Conn, Lindsay; Davis, Kendra; Lewis, Nicole; Schaneman, Katie

    2011-01-01

    A nontraditional form of exercise recently applied for patients with Parkinson disease (PD) is boxing training. The primary purpose of this case series is to describe the effects of disease severity and duration of boxing training (short term and long term) on changes in balance, mobility, and quality of life for patients with mild or moderate to severe PD. The feasibility and safety of the boxing training program also were assessed. Six patients with idiopathic PD attended 24 to 36 boxing training sessions for 12 weeks, with the option of continuing the training for an additional 24 weeks (a seventh patient attended sessions for only 4 weeks). The 90-minute sessions included boxing drills and traditional stretching, strengthening, and endurance exercises. Outcomes were tested at the baseline and after 12, 24, and 36 weeks of boxing sessions (12-, 24-, and 36-week tests). The outcome measures were the Functional Reach Test, Berg Balance Scale, Activities-specific Balance Confidence Scale, Timed "Up & Go" Test, Six-Minute Walk Test, gait speed, cadence, stride length, step width, activities of daily living and motor examination subscales of the Unified Parkinson Disease Rating Scale, and Parkinson Disease Quality of Life Scale. Six patients completed all phases of the case series, showed improvements on at least 5 of the 12 outcome measures over the baseline at the 12-week test, and showed continued improvements at the 24- and 36-week tests. Patients with mild PD typically showed improvements earlier than those with moderate to severe PD. Despite the progressive nature of PD, the patients in this case series showed short-term and long-term improvements in balance, gait, activities of daily living, and quality of life after the boxing training program. A longer duration of training was necessary for patients with moderate to severe PD to show maximal training outcomes. The boxing training program was feasible and safe for these patients with PD.

  13. Gray-box modelling approach for description of storage tunnel

    DEFF Research Database (Denmark)

    Harremoës, Poul; Carstensen, Jacob

    1999-01-01

    The dynamics of a storage tunnel is examined using a model based on on-line measured data and a combination of simple deterministic and black-box stochastic elements. This approach, called gray-box modeling, is a new promising methodology for giving an on-line state description of sewer systems. ...... in a SCADA system because the most important information on the specific system is provided on-line...

  14. Gold sales forecasting: The Box-Jenkins methodology

    OpenAIRE

    Johannes Tshepiso Tsoku; Nonofo Phukuntsi; Daniel Metsileng

    2017-01-01

    The study employs the Box-Jenkins Methodology to forecast South African gold sales. For a resource economy like South Africa where metals and minerals account for a high proportion of GDP and export earnings, the decline in gold sales is very disturbing. Box-Jenkins time series technique was used to perform time series analysis of monthly gold sales for the period January 2000 to June 2013 with the following steps: model identification, model estimation, diagnostic checking and forecasting. F...

  15. Aberrant DNA methylation and expression of SPDEF and FOXA2 in airway epithelium of patients with COPD

    NARCIS (Netherlands)

    Song, J; Heijink, I H; Kistemaker, L E M; Reinders-Luinge, M; Kooistra, W; Noordhoek, J A; Gosens, R; Brandsma, C A; Timens, W; Hiemstra, P S; Rots, M G; Hylkema, M N

    2017-01-01

    Background: Goblet cell metaplasia, a common feature of chronic obstructive pulmonary disease (COPD), is associated with mucus hypersecretion which contributes to the morbidity and mortality among patients. Transcription factors SAM-pointed domain-containing Ets-like factor (SPDEF) and forkhead box

  16. Striking dynamics and kinetic properties of boxing and MMA gloves

    Directory of Open Access Journals (Sweden)

    Benjamin Lee

    2014-08-01

    Full Text Available With the growing popularity of Mixed Martial Arts (MMA as a competitive sport, questions regarding the dynamic response and properties of MMA gloves arise. High-energy impacts from punches are very similar to boxing yet MMA competition requires the use of 4 oz fingerless glove, compared to the larger full enclosure boxing glove. This work assessed the kinetic properties and strike dynamics of MMA gloves and compared findings with traditional boxing gloves. Gloves mounted on a molded fist were impacted repetitively on an instrumental anvil designed for impact, over a 5 hour period resulting in 10,000 continuous and consistent strikes. Kinetic data from impacts were sampled at the beginning of the data collection and subsequently every 30 minutes (every 1,000 strikes. MMA gloves produced 4-5 times greater peak force and 5 times faster load rate compared to the boxing glove. However, MMA gloves also showed signs of material fatigue, with peak force increasing by 35% and rate of loading increasing by 60% over the duration of the test. Boxing glove characteristics did deteriorate but to a lesser extent. In summary, the kinetic properties of MMA glove differed substantially from the boxing glove resulting in impacts characterized by higher peak forces and more rapid development of force. Material properties including stiffness and thickness play a role in the kinetic characteristics upon impact, and can be inferred to alter injury mechanisms of blunt force trauma.

  17. Unconventional Bearing Capacity Analysis and Optimization of Multicell Box Girders

    Directory of Open Access Journals (Sweden)

    Jovan Tepic

    2014-01-01

    Full Text Available This study deals with unconventional bearing capacity analysis and the procedure of optimizing a two-cell box girder. The generalized model which enables the local stress-strain analysis of multicell girders was developed based on the principle of cross-sectional decomposition. The applied methodology is verified using the experimental data (Djelosevic et al., 2012 for traditionally formed box girders. The qualitative and quantitative evaluation of results obtained for the two-cell box girder is realized based on comparative analysis using the finite element method (FEM and the ANSYS v12 software. The deflection function obtained by analytical and numerical methods was found consistent provided that the maximum deviation does not exceed 4%. Multicell box girders are rationally designed support structures characterized by much lower susceptibility of their cross-sectional elements to buckling and higher specific capacity than traditionally formed box girders. The developed local stress model is applied for optimizing the cross section of a two-cell box carrier. The author points to the advantages of implementing the model of local stresses in the optimization process and concludes that the technological reserve of bearing capacity amounts to 20% at the same girder weight and constant load conditions.

  18. Construction of dry-boxes for plutonium metallurgy

    International Nuclear Information System (INIS)

    Grison, E.; Pascard, R.

    1958-01-01

    The dry-boxes used at Chatillon are of two main types: a) boxes with a metal frame work of welded angle-pieces, panels of plexiglass, bakelite, duralumin, etc... They include a standard panel which enables them to be connected up to the contaminated repairs workshop; b) boxes made entirely of welded plastic. The working face only is of plexiglas held by screw clamps to a pure rubber joint. These boxes, which cannot be connected to the contaminated workshop, are generally reserved for small pieces of chemical apparatus. None has yet been used for working under argon, although their airtightness is excellent. After an interval of several hours, in fact, no decrease in the pressure inside the box can be detected. Several means can be adopted to ensure that the joints between panels and mountings are absolutely air-tight. Up to the present we are using three types of box with metal framework at the same time, without being able to make a definitive choice. (author) [fr

  19. RNAa Induced by TATA Box-Targeting MicroRNAs.

    Science.gov (United States)

    Zhang, Yijun; Zhang, Hui

    2017-01-01

    Recent studies reveal that some nuclear microRNAs (miRNA) and synthesized siRNAs target gene promoters to activate gene transcription (RNAa). Interestingly, our group identified a novel HIV-1-encoded miRNA, miR-H3, which targets specifically the core promoter TATA box of HIV-1 and activates viral gene expression. Depletion of miR-H3 significantly impaired the replication of HIV-1. miR-H3 mimics could activate viruses from CD4 + T cells isolated from patients receiving suppressive highly active antiretroviral therapy, which is very intriguing for reducing HIV-1 latent reservoir. Further study revealed that many cellular miRNAs also function like miR-H3. For instance, let-7i targets the TATA box of the interleukin-2 (IL-2) promoter and upregulates IL-2 expression in T-lymphocytes. In RNAa induced by TATA box-targeting miRNAs, Argonaute (AGO) proteins are needed, but there is no evidence for the involvement of promoter-associated transcripts or epigenetic modifications. We propose that the binding of small RNA-AGO complex to TATA box could facilitate the assembly of RNA Polymerase II transcription preinitiation complex. In addition, synthesized small RNAs targeting TATA box can also efficiently activate transcription of interested genes, such as insulin, IL-2, and c-Myc. The discovery of RNAa induced by TATA box-targeting miRNA provides an easy-to-use tool for activating gene expression.

  20. Closure of an analytical chemistry glove box in alpha laboratory

    International Nuclear Information System (INIS)

    Adelfang, P.; Aparicio, G.; Cassaniti, P.

    1990-01-01

    The works with plutonium are performed in gloves box, operated below atmospheric pressure, to protect the experimenters from this alpha-active material. After 12 years of continual processes, it was necessary the decommissioning of the chemistry glove box in our alpha-laboratory. A great deal of our attention was devoted to the working techniques because of extreme care needed to avoid activity release. The decommissioning includes the following main operations: a) Planning and documentation for the regulatory authority. b) Internal decontamination with surface cleaning and chelating agents. c) Measurement of the remainder internal radioactivity. d) Sealing of the glove ports and nozzles. e) Disconnection of the glove box from the exhaust duct. f) Design and construction of a container for the glove box. g) Transportation of the glove box from alpha-laboratory, to a transitory storage until its final disposal. The above mentioned operations are described in this paper including too: data of personal doses during the operations, characteristics and volumes of radioactive wastes and a description of the instrument used for the measurement of inside glove box activity. (Author) [es

  1. Meal box schemes a convenient way to avoid convenience food? Uses and understandings of meal box schemes among Danish consumers.

    Science.gov (United States)

    Hertz, Frej Daniel; Halkier, Bente

    2017-07-01

    The term convenience food is subject to diversification, lack of clarity and moral ambiguity. In this paper we address these issues and critically discuss convenience food by using empirical findings from a Danish study that deals with practitioners' uses of meal box schemes. The methodological design consists of thirteen individual interviews, four focus groups and some observations of cooking practices. We combine the empirical findings with a particular definition of convenience food by Brunner et al. (2010) and selected practice theoretical concepts. This particular combination enables us to categorize meal box schemes as a new form of convenience food called convenient food. In addition, results suggest that meal box schemes reduce leftovers from dinner. Meal boxes also influence dinner related activities such as planning ahead in time and grocery shopping, which require less physical and mental effort. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Arabidopsis AtbHLH112 regulates the expression of genes involved in abiotic stress tolerance by binding to their E-box and GCG-box motifs.

    Science.gov (United States)

    Liu, Yujia; Ji, Xiaoyu; Nie, Xianguang; Qu, Min; Zheng, Lei; Tan, Zilong; Zhao, Huimin; Huo, Lin; Liu, Shengnan; Zhang, Bing; Wang, Yucheng

    2015-08-01

    Plant basic helix-loop-helix (bHLH) transcription factors play essential roles in abiotic stress tolerance. However, most bHLHs have not been functionally characterized. Here, we characterized the functional role of a bHLH transcription factor from Arabidopsis, AtbHLH112, in response to abiotic stress. AtbHLH112 is a nuclear-localized protein, and its nuclear localization is induced by salt, drought and abscisic acid (ABA). In addition, AtbHLH112 serves as a transcriptional activator, with the activation domain located at its N-terminus. In addition to binding to the E-box motifs of stress-responsive genes, AtbHLH112 binds to a novel motif with the sequence 'GG[GT]CC[GT][GA][TA]C' (GCG-box). Gain- and loss-of-function analyses showed that the transcript level of AtbHLH112 is positively correlated with salt and drought tolerance. AtbHLH112 mediates stress tolerance by increasing the expression of P5CS genes and reducing the expression of P5CDH and ProDH genes to increase proline levels. AtbHLH112 also increases the expression of POD and SOD genes to improve reactive oxygen species (ROS) scavenging ability. We present a model suggesting that AtbHLH112 is a transcriptional activator that regulates the expression of genes via binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  3. Comparative Human and Automatic Evaluation of Glass-Box and Black-Box Approaches to Interactive Translation Prediction

    Directory of Open Access Journals (Sweden)

    Torregrosa Daniel

    2017-06-01

    Full Text Available Interactive translation prediction (ITP is a modality of computer-aided translation that assists professional translators by offering context-based computer-generated continuation suggestions as they type. While most state-of-the-art ITP systems follow a glass-box approach, meaning that they are tightly coupled to an adapted machine translation system, a black-box approach which does not need access to the inner workings of the bilingual resources used to generate the suggestions has been recently proposed in the literature: this new approach allows new sources of bilingual information to be included almost seamlessly. In this paper, we compare for the first time the glass-box and the black-box approaches by means of an automatic evaluation of translation tasks between related languages such as English–Spanish and unrelated ones such as Arabic–English and English–Chinese, showing that, with our setup, 20%–50% of keystrokes could be saved using either method and that the black-box approach outperformed the glass-box one in five out of six scenarios operating under similar conditions. We also performed a preliminary human evaluation of English to Spanish translation for both approaches. On average, the evaluators saved 10% keystrokes and were 4% faster with the black-box approach, and saved 15% keystrokes and were 12% slower with the glass-box one; but they could have saved 51% and 69% keystrokes respectively if they had used all the compatible suggestions. Users felt the suggestions helped them to translate faster and easier. All the tools used to perform the evaluation are available as free/open–source software.

  4. Influence of dimension box differences and time differences during operations of red box for motorcycles at signalized intersection

    Science.gov (United States)

    Mulyadi, Agah Muhammad

    2017-11-01

    Performance of signalized intersection has declined due to a large number of motorcycles. The number of motorcycles reached 98.2 million units and the composition of motorcycles has reached around 81.7% of the total composition of vehicles in Indonesia (AISI, 2017). To solve that problem, the red box for motorcycles are provided at the signalized intersection. Red box for the motorcycle at signalized intersections was developed from the concept of Advance Stop Line (ASL) for bicycles. The Red Box was developed to split the queue between motorcycles and other vehicles when waiting at red light. This paper aims to evaluate the influence of the red box dimension and red time operation differences. The survey was conducted as many as 30 cycles of traffic signals per day. The data were analyzed using software IBM SPSS Statistics 20 by using Analysis of Variance (ANOVA) to obtain p-value (significant). The analysis shows that there are insignificant influences between the occupancy rates to the dimension of Red Box. Furthermore, that there is a significant difference that shows the dependency of only motorcycles in the Red Box Area towards red time operation.

  5. Nuclear factor E2-related factor 2 knockdown enhances glucose uptake and alters glucose metabolism in AML12 hepatocytes.

    Science.gov (United States)

    Yuan, Xiaoyang; Huang, Huijing; Huang, Yi; Wang, Jinli; Yan, Jinhua; Ding, Ling; Zhang, Cuntai; Zhang, Le

    2017-05-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor known to induce the expression of a variety of antioxidant and detoxification genes. Recently, increasing evidence has revealed roles for Nrf2 in glucose, lipid, and energy metabolism; however, the exact functions of Nrf2 in hepatocyte biology are largely unclear. In the current study, the transient knockdown of Nrf2 via siRNA transfection enhanced the glucose uptake of fasting AML12 hepatocytes to 325.3 ± 11.1% ( P glucose metabolism were then examined in AML12 cells under both high-glucose (33 mmol/L) and low-glucose (4.5 mmol/L) conditions. NK lowered the gene and protein expression of the anti-oxidases heme oxygenase-1 and NAD(P)H: quinone oxidoreductase 1 and increased p-eukaryotic initiation factor-2α S51 , p-nuclear factor-κB p65 S276 , and its downstream proinflammatory factors, including interleukin-1 beta, tumor necrosis factor-α, matrix metalloproteinase 2, and matrix metalloproteinase 9, at the protein level. NK also altered the protein expression of fibroblast growth factor 21, glucose transporter type 4, insulin-like growth factor 1, forkhead box protein O1, p-AKT S473 , and p-GSK3α/β Y279/Y216 , which are involved in glucose uptake, glycogenesis, and gluconeogenesis in AML12 cells. Our results provide a comprehensive understanding of the central role of Nrf2 in the regulation of glucose metabolism in AML12 hepatocytes, in addition to its classical roles in the regulation of redox signaling, endoplasmic reticulum stress and proinflammatory responses, and support the potential of Nrf2 as a therapeutic target for the prevention and treatment of obesity and other associated metabolic syndromes. Impact statement Increasing evidence supports the complexity of Nrf2 functions beyond the antioxidant and detoxification response. Previous in vivo studies employing either Nrf2-knockout or Nrf2-activated mice have achieved a similar endpoint: protection against an obese and

  6. Evaluation of T Regulatory Lymphocytes Transcription Factors in HTLV-1-Associated Myelopathy/Tropical Spastic Paraparesis (HAM/TSP) Patients.

    Science.gov (United States)

    Ghezeldasht, Sanaz Ahmadi; Sadeghian, Hamed; Azarpazhooh, Mahmoud Reza; Shamsian, Seyyed Ali Akbar; Rafatpanah, Houshang; Mahmoodi, Mahmood; Rezaee, Seyyed Abdolrahim

    2017-08-01

    HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) is an aggressive neurological disease. The CD4 + CD25 + T cell population plays pivotal roles in the maintenance of immunological tolerance and prevention of such autoimmune diseases. In the current study, proviral load (PVL), factor forkhead box p3 (Foxp3), and glucocorticoid-induced tumor necrosis factor receptor-related protein (GITR) gene expression and regulatory T cells (Tregs) counts of 21 HAM/TSP patients and 16 HTLV-1 healthy carriers (ACs) were measured using real-time PCR, TaqMan method, and flow cytometry. The demographic, history of disease, and severity of myelopathy were assessed by a checklist and the Osame motor disability score (OMDS). The mean OMDS for HAM/TSP was 4.82 ± 2.37 which had no significant correlation with Treg count or the expression of Foxp3, GITR, and PVL. The CD4 + CD25 + cell counts had no significant differences between HAM/TSP and ACs. Findings revealed a higher PVL in HAM/TSPs (313.36 copies/10 4 ) compared to ACs (144.93 copies/10 4 , p = 0.035). The Foxp3 and GITR mRNA levels were lower in HAM/TSP patients (11.78 and 13.80, respectively) than those in healthy carriers (18.44 and 21.00, p = 0.041 and 0.03, respectively). There was a significant correlation between Treg frequency and Foxp3 gene expression (R = 0.67, p = 0.006) and GITR and Foxp3 (R = 0.84, p = 0.042) in HAM/TSP patients. Furthermore, the transcription factors have strong correlations with CD4 + CD25 + T cell frequencies. These findings suggest that HTLV-1 infection can modify the expression of main functional transcription factors, FOXP3 and GITR, which may lead to immune response deterioration of Tregs and consequently HAM/TSP manifestation.

  7. 76 FR 54931 - Post Office (PO) Box Fee Groups for Merged Locations

    Science.gov (United States)

    2011-09-06

    ... 111 Post Office (PO) Box Fee Groups for Merged Locations AGENCY: Postal Service TM . ACTION: Final..., Domestic Mail Manual (DMM ) 508.4 to allow Post Office Box TM (PO Box TM ) fee groups to be merged due to... lower, and only once per calendar year. Absent this change, where a box section is merged with a...

  8. Epithelial–mesenchymal transition-related factors in solid tumor and hematological malignancy

    Directory of Open Access Journals (Sweden)

    Yi-Sheng Chou

    2015-08-01

    Full Text Available The epithelial–mesenchymal transition (EMT process plays pivotal roles in regulatory mechanisms of embryogenesis and wound healing physiologically, and organ fibrosis, cancer progression, and metastasis pathologically. EMT is classified as primary, secondary, and tertiary during embryonic development. EMT contributes to repair of tissue injury and fibrogenesis by re-epithelialization and regeneration of fibroblasts, respectively. The hallmarks of EMT include loss of contact inhibition, remodeling of extracellular matrix, and reorganization of cytoskeleton, along with expression of mesenchymal markers and reduction of epithelial markers. Cancer cells acquire stemness, migration and invasive capability, evade apoptosis, and initiate metastasis to distant organs. Several EMT regulators including Snail, Zeb1, Zeb2, and Twist in solid tumor and Sox4, distal-less homeobox gene 4 (DLX4, Prdm14, Bmi1, and the forkhead box family in hematological malignancy are reviewed with regard to their signaling pathways, regulatory mechanisms, and clinical interactions.

  9. Using rap music to promote adolescent health: pilot study of VoxBox.

    Science.gov (United States)

    Paukste, Ernesta; Harris, Neil

    2015-04-01

    Alcohol, tobacco and other drugs (ATODs) usage among adolescents, particularly those living in lower socioeconomic communities, is a population health problem in Australia that requires innovative health promotion strategies. There is a growing recognition of the potential of arts-based approaches to engage youth in health promoting activities. This paper presents the process evaluation of the pilot VoxBox intervention that used rap to build adolescents' awareness of risks associated with ATODs. The VoxBox intervention was piloted in Logan, Queensland, at five high schools with 18 adolescents completing the intervention. Data collection methods included observation, focus groups, semi-structured interviews and a survey of adolescent participants. The intervention was well received by participants and stakeholders. Three factors characterising the project's successful engagement of adolescents were: participate - go with the flow, learning from the real deal and resourced to make some noise. In VoxBox, the emphasis on engaging adolescents in an activity of real interest that was appropriately resourced and delivered was central to credibility and success. SO WHAT?: The findings highlight the importance of interventions matching the interests of the targeted population group.

  10. A novel method to design S-box based on chaotic map and genetic algorithm

    International Nuclear Information System (INIS)

    Wang, Yong; Wong, Kwok-Wo; Li, Changbing; Li, Yang

    2012-01-01

    The substitution box (S-box) is an important component in block encryption algorithms. In this Letter, the problem of constructing S-box is transformed to a Traveling Salesman Problem and a method for designing S-box based on chaos and genetic algorithm is proposed. Since the proposed method makes full use of the traits of chaotic map and evolution process, stronger S-box is obtained. The results of performance test show that the presented S-box has good cryptographic properties, which justify that the proposed algorithm is effective in generating strong S-boxes. -- Highlights: ► The problem of constructing S-box is transformed to a Traveling Salesman Problem. ► We present a new method for designing S-box based on chaos and genetic algorithm. ► The proposed algorithm is effective in generating strong S-boxes.

  11. A novel method to design S-box based on chaotic map and genetic algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yong, E-mail: wangyong_cqupt@163.com [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Key Laboratory of Electronic Commerce and Logistics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Wong, Kwok-Wo [Department of Electronic Engineering, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon Tong (Hong Kong); Li, Changbing [Key Laboratory of Electronic Commerce and Logistics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Li, Yang [Department of Automatic Control and Systems Engineering, The University of Sheffield, Mapping Street, S1 3DJ (United Kingdom)

    2012-01-30

    The substitution box (S-box) is an important component in block encryption algorithms. In this Letter, the problem of constructing S-box is transformed to a Traveling Salesman Problem and a method for designing S-box based on chaos and genetic algorithm is proposed. Since the proposed method makes full use of the traits of chaotic map and evolution process, stronger S-box is obtained. The results of performance test show that the presented S-box has good cryptographic properties, which justify that the proposed algorithm is effective in generating strong S-boxes. -- Highlights: ► The problem of constructing S-box is transformed to a Traveling Salesman Problem. ► We present a new method for designing S-box based on chaos and genetic algorithm. ► The proposed algorithm is effective in generating strong S-boxes.

  12. A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

    Science.gov (United States)

    Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

    1997-02-01

    Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

  13. Flower development in Coffea arabica L.: new insights into MADS-box genes.

    Science.gov (United States)

    de Oliveira, Raphael Ricon; Cesarino, Igor; Mazzafera, Paulo; Dornelas, Marcelo Carnier

    2014-06-01

    Coffea arabica L. shows peculiar characteristics during reproductive development, such as flowering asynchrony, periods of floral bud dormancy, mucilage secretion and epipetalous stamens. The MADS-box transcription factors are known to control several developmental processes in plants, including flower and fruit development. Significant differences are found among plant species regarding reproductive development and little is known about the role of MADS-box genes in Coffea reproductive development. Thus, we used anatomical and comparative molecular analyses to explore the flowering process in coffee. The main morphological changes during flower development in coffee were observed by optical and scanning electron microscopy. Flowering asynchrony seems to be related to two independent processes: the asynchronous development of distinct buds before the reproductive induction and the asynchronous development of floral meristems within each bud after the reproductive induction. A total of 23 C. arabica MADS-box genes were characterized by sequence comparison with putative Arabidopsis orthologs and their expression profiles were analyzed by RT-PCR in different tissues. The expression of the ABC model orthologs in Coffea during floral development was determined by in situ hybridization. The APETALA1 (AP1) ortholog is expressed only late in the perianth, which is also observed for the APETALA3 and TM6 orthologs. Conversely, the PISTILLATA ortholog is widely expressed in early stages, but restrict to stamens and carpels in later stages of flower development, while the expression of the AGAMOUS ortholog is always restricted to fertile organs. The AP1 and PISTILLATA orthologs are also expressed at specific floral organs, such as bracts and colleters, respectively, suggesting a potential role in the development of such structures. Altogether, the results from our comprehensive expression analyses showed significant differences between the spatiotemporal expression profiles of

  14. Boxing participation by children and adolescents: A joint statement with the American Academy of Pediatrics

    OpenAIRE

    Purcell, Laura K; LeBlanc, Claire MA

    2012-01-01

    Thousands of boys and girls younger than 19 years of age participate in boxing in North America. Although boxing provides benefits for participants, including exercise, self-discipline and self-confidence, the sport of boxing encourages and rewards deliberate blows to the head and face. Participants in boxing are at risk of head, face and neck injuries, including chronic and even fatal neurological injuries. Concussions are one of the most common injuries occurring in boxing. Because of the r...

  15. Integrated Box Interrogation System (IBIS) Preliminary Design Study

    Energy Technology Data Exchange (ETDEWEB)

    DR. Stephen Croft; Mr. David Martancik; Dr. Brian Young; Dr. Patrick MJ Chard; Dr. Robert J Estop; Sheila Melton; Gaetano J. Arnone

    2003-01-13

    Canberra Industries has won the tendered solicitation, INEEL/EST-99-00121 for boxed waste Nondestructive Assay Development and Demonstration. Canberra will provide the Integrated Box Interrogation System (IBIS) which is a suite of assay instrumentation and a data reduction system that addresses the measurement needs for Boxed Wastes identified in the solicitation and facilitates the associated experimental program and demonstration of system capability. The IBIS system will consist of the next generation CWAM system, i.e. CWAM II, which is a Scanning Passive/Active Neutron interrogation system which we will call a Box Segmented Neutron Scanner (BSNS), combined with a physically separate Box Segmented Gamma-ray Scanning (BSGS) system. These systems are based on existing hardware designs but will be tailored to the large sample size and enhanced to allow the program to evaluate the following measurement criteria:Characterization and correction for matrix heterogeneity Characterization of non-uniform radio-nuclide and isotopic compositions Assay of high density matrices (both high-Z and high moderator contents)Correction for radioactive material physical form - such as self shielding or multiplication effects due to large accumulations of radioactive materials.Calibration with a minimal set of reference standards and representative matrices.THis document summarizes the conceptual design parameters of the IBIS and indicates areas key to the success of the project where development is to be centered. The work presented here is a collaborative effort between scientific staff within Canberra and within the NIS-6 group at LANL.

  16. Analysis of MADS-Box Gene Family Reveals Conservation in Floral Organ ABCDE Model of Moso Bamboo (Phyllostachys edulis).

    Science.gov (United States)

    Cheng, Zhanchao; Ge, Wei; Li, Long; Hou, Dan; Ma, Yanjun; Liu, Jun; Bai, Qingsong; Li, Xueping; Mu, Shaohua; Gao, Jian

    2017-01-01

    Mini chromosome maintenance 1, agamous, deficiens, and serum response factor (MADS)-box genes are transcription factors which play fundamental roles in flower development and regulation of floral organ identity. However, till date, identification and functions of MADS-box genes remain largely unclear in Phyllostachys edulis . In view of this, we performed a whole-genome survey and identified 34 MADS-box genes in P. edulis , and based on phylogeny, they were classified as MIKC C , MIKC ∗ , Mα, and Mβ. The detailed analysis about gene structure and motifs, phylogenetic classification, comparison of gene divergence and duplication are provided. Interestingly, expression patterns for most genes were found similar to those of Arabidopsis and rice, indicating that the well-established ABCDE model can be applied to P. edulis . Moreover, we overexpressed PheMADS15 , an AP1 -like gene, in Arabidopsis , and found that the transgenic plants have early flowering phenotype, suggesting that PheMADS15 might be a regulator of flowering transition in P. edulis . Taken together, this study provides not only insightful comprehension but also useful information for understanding the functions of MADS-box genes in P. edulis .

  17. Analysis of MADS-Box Gene Family Reveals Conservation in Floral Organ ABCDE Model of Moso Bamboo (Phyllostachys edulis

    Directory of Open Access Journals (Sweden)

    Zhanchao Cheng

    2017-05-01

    Full Text Available Mini chromosome maintenance 1, agamous, deficiens, and serum response factor (MADS-box genes are transcription factors which play fundamental roles in flower development and regulation of floral organ identity. However, till date, identification and functions of MADS-box genes remain largely unclear in Phyllostachys edulis. In view of this, we performed a whole-genome survey and identified 34 MADS-box genes in P. edulis, and based on phylogeny, they were classified as MIKCC, MIKC∗, Mα, and Mβ. The detailed analysis about gene structure and motifs, phylogenetic classification, comparison of gene divergence and duplication are provided. Interestingly, expression patterns for most genes were found similar to those of Arabidopsis and rice, indicating that the well-established ABCDE model can be applied to P. edulis. Moreover, we overexpressed PheMADS15, an AP1-like gene, in Arabidopsis, and found that the transgenic plants have early flowering phenotype, suggesting that PheMADS15 might be a regulator of flowering transition in P. edulis. Taken together, this study provides not only insightful comprehension but also useful information for understanding the functions of MADS-box genes in P. edulis.

  18. Bayesian molecular dating: opening up the black box.

    Science.gov (United States)

    Bromham, Lindell; Duchêne, Sebastián; Hua, Xia; Ritchie, Andrew M; Duchêne, David A; Ho, Simon Y W

    2018-05-01

    Molecular dating analyses allow evolutionary timescales to be estimated from genetic data, offering an unprecedented capacity for investigating the evolutionary past of all species. These methods require us to make assumptions about the relationship between genetic change and evolutionary time, often referred to as a 'molecular clock'. Although initially regarded with scepticism, molecular dating has now been adopted in many areas of biology. This broad uptake has been due partly to the development of Bayesian methods that allow complex aspects of molecular evolution, such as variation in rates of change across lineages, to be taken into account. But in order to do this, Bayesian dating methods rely on a range of assumptions about the evolutionary process, which vary in their degree of biological realism and empirical support. These assumptions can have substantial impacts on the estimates produced by molecular dating analyses. The aim of this review is to open the 'black box' of Bayesian molecular dating and have a look at the machinery inside. We explain the components of these dating methods, the important decisions that researchers must make in their analyses, and the factors that need to be considered when interpreting results. We illustrate the effects that the choices of different models and priors can have on the outcome of the analysis, and suggest ways to explore these impacts. We describe some major research directions that may improve the reliability of Bayesian dating. The goal of our review is to help researchers to make informed choices when using Bayesian phylogenetic methods to estimate evolutionary rates and timescales. © 2017 Cambridge Philosophical Society.

  19. Recent advances towards a lithium vapor box divertor

    Directory of Open Access Journals (Sweden)

    R.J. Goldston

    2017-08-01

    Full Text Available Fusion power plants are likely to require near complete detachment of the divertor plasma from the divertor target plates, in order to have both acceptable heat flux at the target to avoid prompt damage and also acceptable plasma temperature at the target surface, to minimize long-term erosion. However hydrogenic and impurity puffing experiments show that detached operation leads easily to x-point MARFEs, impure plasmas, degradation in confinement, and lower helium pressure at the exhaust. The concept of the Lithium Vapor Box Divertor is to use local evaporation and strong differential pumping through condensation to localize low-Z gas-phase material that absorbs the plasma heat flux and so achieve detachment while avoiding these difficulties. The vapor localization has been confirmed using preliminary Navier–Stokes calculations. We use ADAS calculations of εcool, the plasma energy lost per injected lithium atom, to estimate the lithium vapor pressure, and so temperature, required for detachment, taking into account power balance. We also develop a simple model of detachment to evaluate the required upstream density, based on further taking into account dynamic pressure balance. A remarkable general result is found, not just for lithium-vapor-induced detachment, that the upstream density divided by the Greenwald-limit density scales as nup/nGW ∝ (P5/8/B3/8 Tdet1/2/(εcool+γTdet, with no explicit size scaling. Tdet is the temperature just before strong pressure loss, assumed to be ∼ ½ of the ionization potential of the dominant recycling species, and γ is the sheath heat transmission factor.

  20. Qualification of box HEPA filters for nuclear applications

    International Nuclear Information System (INIS)

    Bergman, W.; Larsen, G.; Wilson, K.; Rainer, F.

    1995-03-01

    We have successfully completed qualification tests on high efficiency particulate air (HEPA) filters that are encapsulated within a box and manufactured by American Air Filters. The qualification tests are required by the American Society of Mechanical Engineers Standard ASME N509 and the U.S. Military Standard MIL-F-51068 for HEPA filters to be used in nuclear applications. The qualification tests specify minimum filter efficiencies following exposure to heated air, overpressure, and rough handling. Prior to this study, no box HEPA filters from any manufacturer had been qualified despite their wide-spread use in Department of Energy (DOE) facilities. Box HEPA filters are not addressed in any of the existing HEPA standards and only briefly discussed in the Nuclear Air Cleaning Handbook

  1. A Finite Segment Method for Skewed Box Girder Analysis

    Directory of Open Access Journals (Sweden)

    Xingwei Xue

    2018-01-01

    Full Text Available A finite segment method is presented to analyze the mechanical behavior of skewed box girders. By modeling the top and bottom plates of the segments with skew plate beam element under an inclined coordinate system and the webs with normal plate beam element, a spatial elastic displacement model for skewed box girder is constructed, which can satisfy the compatibility condition at the corners of the cross section for box girders. The formulation of the finite segment is developed based on the variational principle. The major advantage of the proposed approach, in comparison with the finite element method, is that it can simplify a three-dimensional structure into a one-dimensional structure for structural analysis, which results in significant saving in computational times. At last, the accuracy and efficiency of the proposed finite segment method are verified by a model test.

  2. BOX-COX REGRESSION METHOD IN TIME SCALING

    Directory of Open Access Journals (Sweden)

    ATİLLA GÖKTAŞ

    2013-06-01

    Full Text Available Box-Cox regression method with λj, for j = 1, 2, ..., k, power transformation can be used when dependent variable and error term of the linear regression model do not satisfy the continuity and normality assumptions. The situation obtaining the smallest mean square error  when optimum power λj, transformation for j = 1, 2, ..., k, of Y has been discussed. Box-Cox regression method is especially appropriate to adjust existence skewness or heteroscedasticity of error terms for a nonlinear functional relationship between dependent and explanatory variables. In this study, the advantage and disadvantage use of Box-Cox regression method have been discussed in differentiation and differantial analysis of time scale concept.

  3. Ber analysis of the box relaxation for BPSK signal recovery

    KAUST Repository

    Thrampoulidis, Christos

    2016-06-24

    We study the problem of recovering an n-dimensional BPSK signal from m linear noise-corrupted measurements using the box relaxation method which relaxes the discrete set {±1}n to the convex set [-1,1]n to obtain a convex optimization algorithm followed by hard thresholding. When the noise and measurement matrix have iid standard normal entries, we obtain an exact expression for the bit-wise probability of error Pe in the limit of n and m growing and m/n fixed. At high SNR our result shows that the Pe of box relaxation is within 3dB of the matched filter bound (MFB) for square systems, and that it approaches the (MFB) as m grows large compared to n. Our results also indicate that as m, n → ∞, for any fixed set of size k, the error events of the corresponding k bits in the box relaxation method are independent.

  4. Publishing Outside the Box: Unforeseen Dividends of Talking to Strangers.

    Science.gov (United States)

    Schlinger, Henry D

    2014-10-01

    This article describes publishing outside behavior analysis, letters to editors, and columns, as well as communicating outside the box with editors, authors, and journalists. Publishing can occur in a wide range of journals (e.g., Consciousness and Cognition), in-house publications of professional associations (e.g., Association for Psychological Science's Observer), general science publications (e.g., American Scientist, The Scientist), publications in service to professions (e.g., The Chronicle of Higher Education), general interest and specialized magazines (e.g., Atlantic Monthly, Skeptical Inquirer), and newspapers (e.g., Los Angeles Times). Communicating with editors, authors, and journalists includes, for instance, formal correspondence with editors and personal correspondence with authors and journalists outside the box about misunderstandings, commonalities, and complementarities of their work with respect to ours. The consequences of publishing and communicating are often unforeseen and fortuitous, many of which can never occur by remaining in the box.

  5. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. DONG JIE ZHANG. Articles written in Journal of Genetics. Volume 97 Issue 1 March 2018 pp 319-322 RESEARCH NOTE. Sp1 is an important transcriptional regulation factor for forkhead box N1 in pig · DONG JIE ZHANG LIANG WANG ZHONG QIU LI BO FU GUO WEI YANG DI LIU.

  6. Activated protein synthesis and suppressed protein breakdown signaling in skeletal muscle of critically ill patients

    DEFF Research Database (Denmark)

    Jespersen, Jakob G; Nedergaard, Anders; Reitelseder, Søren

    2011-01-01

    Skeletal muscle mass is controlled by myostatin and Akt-dependent signaling on mammalian target of rapamycin (mTOR), glycogen synthase kinase 3ß (GSK3ß) and forkhead box O (FoxO) pathways, but it is unknown how these pathways are regulated in critically ill human muscle. To describe factors...

  7. Activated protein synthesis and suppressed protein breakdown signaling in skeletal muscle of critically ill patients

    DEFF Research Database (Denmark)

    Jespersen, Jakob G; Nedergaard, Anders; Reitelseder, Søren

    2011-01-01

    Skeletal muscle mass is controlled by myostatin and Akt-dependent signaling on mammalian target of rapamycin (mTOR), glycogen synthase kinase 3β (GSK3β) and forkhead box O (FoxO) pathways, but it is unknown how these pathways are regulated in critically ill human muscle. To describe factors...

  8. Differential roles of epigenetic changes and Foxp3 expression in regulatory T cell-specific transcriptional regulation

    NARCIS (Netherlands)

    Morikawa, Hiromasa; Ohkura, Naganari; Vandenbon, Alexis; Itoh, Masayoshi; Nagao-Sato, Sayaka; Kawaji, Hideya; Lassmann, Timo; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Standley, Daron M.; Date, Hiroshi; Sakaguchi, Shimon; Rehli, Michael; Baillie, J. Kenneth; de Hoon, Michiel J. L.; Haberle, Vanja; Kulakovskiy, Ivan V.; Lizio, Marina; Andersson, Robin; Mungall, Christopher J.; Meehan, Terrence F.; Schmeier, Sebastian; Bertin, Nicolas; Jørgensen, Mette; Dimont, Emmanuel; Arner, Erik; Schmidl, Christian; Schaefer, Ulf; Medvedeva, Yulia A.; Plessy, Charles; Vitezic, Morana; Severin, Jessica; Semple, Colin A.; Ishizu, Yuri; Francescatto, Margherita; Alam, Intikhab; Albanese, Davide; Altschuler, Gabriel M.; Archer, John A. C.; Arner, Peter; Babina, Magda; Baker, Sarah; Balwierz, Piotr J.; Beckhouse, Anthony G.; Pradhan-Bhatt, Swati; Blake, Judith A.; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James; Brombacher, Frank; Burroughs, A. Maxwell; Califano, Andrea; Cannistraci, Carlo V.; Carbajo, Daniel; Chen, Yun; Chierici, Marco; Ciani, Yari; Clevers, Hans C.; Dalla, Emiliano; Davis, Carrie A.; Deplancke, Bart; Detmar, Michael; Diehl, Alexander D.; Dohi, Taeko; Drabløs, Finn; Edge, Albert S. B.; Edinger, Matthias; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Fagiolini, Michela; Fairbairn, Lynsey; Fang, Hai; Farach-Carson, Mary C.; Faulkner, Geoffrey J.; Favorov, Alexander V.; Fisher, Malcolm E.; Frith, Martin C.; Fujita, Rie; Fukuda, Shiro; Furlanello, Cesare; Furuno, Masaaki; Furusawa, Jun-ichi; Geijtenbeek, Teunis B.; Gibson, Andrew; Gingeras, Thomas; Goldowitz, Daniel; Gough, Julian; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas J.; Hamaguchi, Masahide; Hara, Mitsuko; Harbers, Matthias; Harshbarger, Jayson; Hasegawa, Akira; Hasegawa, Yuki; Hashimoto, Takehiro; Herlyn, Meenhard; Hitchens, Kelly J.; Ho Sui, Shannan J.; Hofmann, Oliver M.; Hoof, Ilka; Hori, Fumi; Huminiecki, Lukasz; Iida, Kei; Ikawa, Tomokatsu; Jankovic, Boris R.; Jia, Hui; Joshi, Anagha; Jurman, Giuseppe; Kaczkowski, Bogumil; Kai, Chieko; Kaida, Kaoru; Kaiho, Ai; Kajiyama, Kazuhiro; Kanamori-Katayama, Mutsumi; Kasianov, Artem S.; Kasukawa, Takeya; Katayama, Shintaro; Kato, Sachi; Kawaguchi, Shuji; Kawamoto, Hiroshi; Kawamura, Yuki I.; Kawashima, Tsugumi; Kempfle, Judith S.; Kenna, Tony J.; Kere, Juha; Khachigian, Levon M.; Kitamura, Toshio; Klinken, S. Peter; Knox, Alan J.; Kojima, Miki; Kojima, Soichi; Kondo, Naoto; Koseki, Haruhiko; Koyasu, Shigeo; Krampitz, Sarah; Kubosaki, Atsutaka; Kwon, Andrew T.; Laros, Jeroen F. J.; Lee, Weonju; Lennartsson, Andreas; Li, Kang; Lilje, Berit; Lipovich, Leonard; Mackay-sim, Alan; Manabe, Ri-ichiroh; Mar, Jessica C.; Marchand, Benoit; Mathelier, Anthony; Mejhert, Niklas; Meynert, Alison; Mizuno, Yosuke; Morais, David A. de Lima; Morimoto, Mitsuru; Moro, Kazuyo; Motakis, Efthymios; Motohashi, Hozumi; Mummery, Christine L.; Murata, Mitsuyoshi; Nakachi, Yutaka; Nakahara, Fumio; Nakamura, Toshiyuki; Nakamura, Yukio; Nakazato, Kenichi; van Nimwegen, Erik; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Nozaki, Tadasuke; Ogishima, Soichi; Ohmiya, Hiroko; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A.; Pain, Arnab; Passier, Robert; Patrikakis, Margaret; Persson, Helena; Piazza, Silvano; Prendergast, James G. D.; Rackham, Owen J. L.; Ramilowski, Jordan A.; Rashid, Mamoon; Ravasi, Timothy; Rizzu, Patrizia; Roncador, Marco; Roy, Sugata; Rye, Morten B.; Saijyo, Eri; Sajantila, Antti; Saka, Akiko; Sakai, Mizuho; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Schneider, Claudio; Schultes, Erik A.; Schulze-Tanzil, Gundula G.; Schwegmann, Anita; Sengstag, Thierry; Sheng, Guojun; Shimoji, Hisashi; Shimoni, Yishai; Shin, Jay W.; Simon, Christophe; Sugiyama, Daisuke; Sugiyama, Takaaki; Suzuki, Masanori; Swoboda, Rolf K.; 't Hoen, Peter A. C.; Tagami, Michihira; Takahashi, Naoko; Takai, Jun; Tanaka, Hiroshi; Tatsukawa, Hideki; Tatum, Zuotian; Thompson, Mark; Toyoda, Hiroo; Toyoda, Tetsuro; Valen, Eivind; van de Wetering, Marc; van den Berg, Linda M.; Verardo, Roberto; Vijayan, Dipti; Vorontsov, Ilya E.; Wasserman, Wyeth W.; Watanabe, Shoko; Wells, Christine A.; Winteringham, Louise N.; Wolvetang, Ernst; Wood, Emily J.; Yamaguchi, Yoko; Yamamoto, Masayuki; Yoneda, Misako; Yonekura, Yohei; Yoshida, Shigehiro; Zabierowski, Suzan E.; Zhang, Peter G.; Zhao, Xiaobei; Zucchelli, Silvia; Summers, Kim M.; Suzuki, Harukazu; Daub, Carsten O.; Kawai, Jun; Heutink, Peter; Hide, Winston; Freeman, Tom C.; Lenhard, Boris; Bajic, Vladimir B.; Taylor, Martin S.; Makeev, Vsevolod J.; Sandelin, Albin; Hume, David A.

    2014-01-01

    Naturally occurring regulatory T (Treg) cells, which specifically express the transcription factor forkhead box P3 (Foxp3), are engaged in the maintenance of immunological self-tolerance and homeostasis. By transcriptional start site cluster analysis, we assessed here how genome-wide patterns of DNA

  9. DONG JIE Zhang, LIANG Wang, ZHON

    Indian Academy of Sciences (India)

    User

    of the immune system. Transcription factor forkhead box N1 (Foxn1) is an epithelial cell-autonomous gene that predominantly regulates the development of thymic epithelial cells (TECs) and skin keratinocytes (Palamaro et al., 2014). Mutations in the Foxn1 gene result in failure in thymus development, hairless nude skin, ...

  10. DONG JIE Zhang, LIANG Wang, ZHON

    Indian Academy of Sciences (India)

    User

    Title: Sp1 was an important transcriptional regulation factor of Forkhead box N1 in pig. Author: DONG JIE Zhang, LIANG Wang, ZHONG QIU LI, BO FU, GUO WEI YANG and DI LIU**. Address: Xuefu road 368#, Nangang district, Harbin, Heilongjiang province, China. Correspondence e-mail:nkyliudi2016@163.com. Running ...

  11. Direct Downregulation of CNTNAP2 by STOX1A is Associated with Alzheimer's Disease

    NARCIS (Netherlands)

    van Abel, D.; Michel, O.; Veerhuis, R.; Jacobs, M.; van Dijk, M.; Oudejans, C.B.M.

    2012-01-01

    STOX1A is a transcription factor which is functionally and structurally similar to the forkhead box protein family. STOX1A has been shown to be associated with pre-eclampsia, a pregnancy associated disease, and to have potential implications in late onset Alzheimer's disease. However, the exact

  12. The number of regulatory T cells in transbronchial lung allograft biopsies is related to FoxP3 mRNA levels in bronchoalveolar lavage fluid and to the degree of acute cellular rejection

    DEFF Research Database (Denmark)

    Krustrup, Dorrit; Madsen, Caroline B; Iversen, Martin

    2013-01-01

    The transcription factor Forkhead Box P3 (FoxP3) is a marker of regulatory T cells (Tregs) - a subset of T cells known to suppress a wide range of immune responses. These cells are considered to be pivotal for the induction of tolerance to donor antigens in human allografts. We aimed to correlate...

  13. Expression of FOXP3 mRNA is not confined to CD4+CD25+ T regulatory cells in humans.

    NARCIS (Netherlands)

    Morgan, M.E.; Bilsen, J.H. van; Bakker, A.M.; Heemskerk, B.; Schilham, M.W.; Hartgers, F.C.; Elferink, B.G.; Zanden, L.F.M. van der; Vries, R.R.P. de; Huizinga, T.W.J.; Ottenhoff, T.H.; Toes, R.E.

    2005-01-01

    Expression of the transcription factor Foxp3 (forkhead box P3) has been implicated as a key element for CD25(+) T regulatory cell function in mice. However, literature over similar involvement of FOXP3 expression in human T regulatory cells is limited. We found that, unlike murine cells, FOXP3 mRNA

  14. Stress analysis of the NET outboard first wall box

    International Nuclear Information System (INIS)

    Cardella, A.; Gorenflo, H.

    1986-01-01

    A very important topic related to the F.W. designs in form of a tight box that envelopes the breeding blanket is the overall behaviour under the severe operating conditions of NET fusion reactor. In this paper the results of the 3-D stress analysis of the NET outboard F.W. box is presented. These results have been incorporated in the preliminary evaluation of the thermal fatigue limits for the F.W. of NET. (Paper presented in the same Technical Committee Meeting by G. Vieider). (author)

  15. Low-profile self-sealing sample transfer flexure box.

    Science.gov (United States)

    Simon, Kevin; Porz, Lukas; Swamy, Tushar; Chiang, Yet-Ming; Slocum, Alexander

    2017-08-01

    A flexural bearing mechanism has enabled the development of a self-sealing box for protecting air sensitive samples during transfer between glove boxes, micro-machining equipment, and microscopy equipment. The simplicity and self-actuating feature of this design makes it applicable to many devices that operate under vacuum conditions. The models used to design the flexural mechanism are presented in detail. The device has been tested in a Zeiss Merlin GEMINI II scanning electron microscope with Li 3 PS 4 samples, showing effective isolation from air and corrosion prevention.

  16. Tworty Box to Improve the Equipment Logistics of Container Lines

    OpenAIRE

    Ulrich Malchow

    2016-01-01

    A major share of all empty container positioning (deadheading) is resulting from imbalances with regard to container sizes (20ft/40ft). In order to reduce the shipments of 'containerised air' a new type of container has been developed by the author: The Tworty Boxes can either be used as a standard 20ft or in coupled condition as a 40ft container. The outside appearance resembles any standard 20ft container. However the Tworty Box is unique in that it has an additional door at the front side ...

  17. Tests of CMS Hadron Forward Calorimeter Upgrade Readout Box Prototype

    CERN Document Server

    Chatrchyan, Sergey; Sirunyan, Albert; Tumasyan, Armen; Mossolov, Vladimir; Shumeiko, Nikolai; Cornelis, Tom; Ochesanu, Silvia; Roland, Benoit Florent; Staykova, Zlatka; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Spilbeeck, Alex; Alves, Gilvan Augusto; Martins, Thiago Dos Reis; Pol, Maria Elena; Vaz Da Silva Filho, Mario; Alda Junior, Walter Luiz; Carvalho, Wagner De Paula; Chinellato, Jose Augusto; De Oliveira Martins, Carley Pedro; Figueiredo, Diego Matos; Tonelli Manganote, Edmilson Jose; Molina Insfran, Jorge Andres; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Rosa Lopes Zachi, Alessandro; Finger, Miroslav; Finger, Michael; Tsamalaidze, Zviad; Borras, Kerstin; Gunnellini, Paolo; Jung, Hannes; Knutsson, Albert Hans; Lutz, Benjamin; Ribeiro Cipriano, Pedro Miguel; Sen, Niladri; Baus, Colin; Katkov, Igor; Ulrich, Ralf Matthias; Wohrmann, H; Panagiotou, Apostolos; Bencze, Gyorgy; Horvath, D; Bala, Suman; Gupta, Ruchi; Jindal, M; Lal, Manjit Kaur; Nishu, Nishu; Saini, Lovedeep Kaur; Banerjee, Sunanda; Bhattacharya, S; Gomber, Bhawna; Jain, Shilpi; Khurana, Raman; Sharan, Manoj Kumar; Aziz, Tariq; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Katta, Sudhakar; Banerjee, Sudeshna; Dugad, Shashikant Raichand; Etesami, Seyed Mohsen; Fahim, Ali; Jafari, Abideh; Paktinat Mehdiabadi, Saeid; Zeinali, Maryam; Penzo, Aldo; Afanasyev, A; Bunin, Pavel; Ershov, Yuri; Fedoseev, Oleg; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Konoplynikov, V; Malakhov, Alexander; Moisenz, Petr; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoly; Andreev, Yuri; Dermenev, Alexander; Krasnikov, Nikolay; Pashenkov, Anatoli; Tlisov, Danila; Toropin, A; Epshteyn, Vladimir; Erofeeva, Maria; Gavrilov, Vladimir; Kosov, Mikhail Vladimirovich; Kudinov, Ilya; Lychkovskaya, Natalia; Popov, V; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlassov, Evgueni; Zhokin, Alexander; Belyaev, A; Boos, Eduard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Korotkikh, Vladimir; Lokhtin, Igor; Markina, Anastasia; Obraztsov, Stepan; Perfilov, Maxim; Petrushanko, Sergey; Popov, Andrey; Savrin, Victor; Snigirev, Alexander; Vardanyan, Irina; Andreev, V; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Vinogradov, Alexey; Bayshev, Igor; Bityukov, Sergey; Grishin, Viatcheslav; Kryshkin, Victor; Petrov, V; Ryutin, Roman; Sobol, Andrey; Turchanovich, Leonid; Troshin, Sergey; Uzunyan, Andrey; Volkov, Alexey; Santanastasio, Francesco; Adiguzel, Aytul; Bakirci, Numan Mustafa; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; G�kbulut, Gul; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karapinar, Guler; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Latife Nukhet; Vergili, Mehmet; Aliyev, Takhmasib; Deniz, Muhammed; Guler, Ali Murat; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Gulmez, Erhan; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Cankocak, Kerem; Levchuk, Leonid; Hatakeyama, Kenichi; Liu, H; Scarborough, Tara Ann; Rumerio, Paolo; Heister, Arno; Hill, C; Lawson, Philip Daniel; Lazic, Dragoslav; Rohlf, James; St. John, Jason; Sulak, Lawrence; Gennadiy, G; Laird, Edward; Landsberg, Greg; Narain, Meenakshi; Sinthuprasith, Tutanon; Tsang, Ka Vang; Long, Owen Rosser; Nguyen, Harold; Paramesvaran, Sudarshan; Sturdy, Jared; Stuart, David; To, Wing; West, Christopher Alan; Apresyan, Artur; Chen, Y; Mott, Alexander Robert; Spiropulu, Maria; Winn, David; Abdoulline, Salavat; Anderson, J; Chlebana, Frank; Freeman, James; Green, Daniel; Hanlon, J; Hirschauer, James Francis; Joshi, Umeshwar; Kunori, Shuichi; Musienko, Yuri; Sharma, Seema; Spalding, William Jeffrey; Tkaczyk, Slawomir; Vidal, Richard; Whitmore, Juliana; Wu, W; Gaultney, Vanessa; Linn, Stephan; Markowitz, Pete Edward; Martinez, German Ruben; Gleyzer, Sergei; Hagopian, Sharon Lee; Hagopian, Vasken; Jenkins, Charles Merrill; Baarmand, Marc M; Dorney, Brian L; Vodopiyanov, Igor; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Clarida, Warren James; Duru, Firdevs; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony Richard; Nachtman, Jane; Newsom, Charles Ray; Norbeck, John Edwin; Olson, Jonathan Edward; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Schmidt, Ianos; Tiras, Emrah; Yetkin, Taylan; Yi, Kai; Kenny, Raymond Patrick; Murray, Michael Joseph; Wood, Jeffrey Scott; Baden, Andrew; Calvert, Brian Michael; Eno, Sarah Catherine; Gomez, Jaime Arturo; Grassi, Tullio; Hadley, Nicholas John; Kellogg, Richard; Kolberg, Ted; Lu, Y; Marionneau, Matthieu; Mignerey, Alice Louise Cox; Peterman, Alison Marie; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite Belt; Kao, Shih-Chuan; Klapoetke, Kevin Humphrey; Mans, Jeremiah Michael; Pastika, Nathaniel Joseph; Kroeger, Robert; Rahmat, Rahmat; Sanders, David; Cremaldi, Lucien Marcus; Jain, S; Anastassov, Anton; Velasco, Mayda Marie; Won, Steven; Heering, Adriaan; Karmgard, Daniel; Pearson, Tessa Jae; Ruchti, Randal; Berry, Edmund A; Halyo, Valerie; Hebda, Philip; Hunt, Adam Paul; Lujan, Paul Joseph; Marlow, Daniel; Medvedeva, Tatiana; Saka, Halil; Tully, Christopher; Zuranski, Andrzej Maciej; Barnes, Virgil Everett; Laasanen, Alvin; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel Jan; Eshaq, Yossof; Garcia-bellido, Aran Angel; Goldenzweig, Pablo David; Han, Ji Yeon; Harel, Amnon; Miner, Daniel Carl; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert Adam; Flanagan, Will Hogan; Kamon, Teruki; Montalvo, Roy Joaquin; Sakuma, Tai; Akchurin, Nural; Damgov, Jordan; Dudero, Phillip Russell; Kovitanggoon, Kittikul; Lee, Sung Won; Libeiro, Terence; Volobouev, Igor; Gurrola, Alfredo; Milstene, Caroline

    2012-01-01

    A readout box prototype for CMS Hadron Forward calorimeter upgrade is built and tested in CERN H2 beamline. The prototype is designed to enable simultaneous tests of different readout options for the four anode upgrade PMTs, new front-end electronics design and new cabling. The response of the PMTs with different readout options is uniform and the background response is minimal. Multi-channel readout options further enhance the background elimination. Passing all the electronics, mechanical and physics tests, the readout box proves to be capable of providing the forward hadron calorimeter operations requirements in the upgrade era.

  18. Well-Defined Coverage Metrics for the Glass Box Test

    OpenAIRE

    Schmidberger, Rainer

    2014-01-01

    Part 2: Tools and Frameworks; International audience; The Glass Box Test (GBT), also known as White Box Test or Structural Test, shows which parts of the program under test have, or have not, been executed. Many GBT tools are available for almost any programming language. Industry standards for safety-critical software require a very high or even complete coverage. At first glance, the GBT seems to be a well-established and mature testing technique that is based on standardized metrics. But o...

  19. Smart Remote for the Setup Box Using Gesture Control

    OpenAIRE

    Surepally Uday Kumar; K. Shamini

    2016-01-01

    The basic purpose of this project is to provide a means to control a set top box (capable of infrared communication), in this case Hathway using hand gestures. Thus, this system will act like a remote control for operating set top box, but this will be achieved through hand gestures instead of pushing buttons. To send and receive remote control signals, this project uses an infrared LED as Transmitter. Using an infrared receiver, an Arduino can detect the bits being sent by a remo...

  20. Molecular Basis for the Association of Human E4B U Box Ubiquitin Ligase with E2-Conjugating Enzymes UbcH5c and Ubc4

    Energy Technology Data Exchange (ETDEWEB)

    Benirschke, Robert C.; Thompson, James R.; Nominé, Yves; Wasielewski, Emeric; Jurani& #263; , Nenad; Macura, Slobodan; Hatakeyama, Shigetsugu; Nakayama, Keiichi I.; Botuyan, Maria Victoria; Mer, Georges (Hokkaido); (Mayo); (Kyushu)

    2010-09-07

    Human E4B, also called UFD2a, is a U box-containing protein that functions as an E3 ubiquitin ligase and an E4 polyubiquitin chain elongation factor. E4B is thought to participate in the proteasomal degradation of misfolded or damaged proteins through association with chaperones. The U box domain is an anchor site for E2 ubiquitin-conjugating enzymes, but little is known of the binding mechanism. Using X-ray crystallography and NMR spectroscopy, we determined the structures of E4B U box free and bound to UbcH5c and Ubc4 E2s. Whereas previously characterized U box domains are homodimeric, we show that E4B U box is a monomer stabilized by a network of hydrogen bonds identified from scalar coupling measurements. These structural studies, complemented by calorimetry- and NMR-based binding assays, suggest an allosteric regulation of UbcH5c and Ubc4 by E4B U box and provide a molecular basis to understand how the ubiquitylation machinery involving E4B assembles.

  1. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    Science.gov (United States)

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Influence of core box vents distribution on flow dynamics of core shooting process based on experiment and numerical simulation

    Directory of Open Access Journals (Sweden)

    Chang-jiang Ni

    2016-01-01

    Full Text Available Core shooting process plays a decisive role in the quality of sand cores, and core box vents distribution is one of the most important factor determining the effectiveness of core shooting process. In this paper, the influence of core box vents distribution on the flow dynamics of core shooting process was investigated based on in situ experimental observations with transparent core box, high-speed camera and pressure measuring system. Attention was focused on the variation of both the flow behavior of sand and pressure curves due to different vents distribution. Taking both kinetic and frictional stress into account, a kinetic-frictional constitutive model was established to describe the internal momentum transfer in the solid phase. Two-fluid model (TFM simulation was then performed and good agreement was achieved between the experimental and simulated results on both the flow behavior of sand and the pressure curves. It was found that vents distribution has direct effect on the pressure difference of different locations in the core box, which determines the buoyancy force exerting on the sand particles and significantly influences the filling process of core sand.

  3. Certification of the DOT-19B100 box per 49 CFR 178. 191

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.B.; Cogan, J.D.

    1992-03-12

    A Lot of 40 DOT-19B100 plywood boxes was evaluated per 49 CFR 178.191 (Appendix A) to determine if the boxes can be certified and marked as DOT-19B100 boxes. The boxes will be identified with the Corporate symbol and logotype for EG G Mound Applied Technologies. Evaluation of the drop test data and attribute measurements resulted in the boxes being certified per 49 CFR 178.191 as DOT-19B100 boxes and marked per 49 CFR 178.191-9.

  4. Certification of the DOT-19B100 box per 49 CFR 178.191

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.B.; Cogan, J.D.

    1992-03-12

    A Lot of 40 DOT-19B100 plywood boxes was evaluated per 49 CFR 178.191 (Appendix A) to determine if the boxes can be certified and marked as DOT-19B100 boxes. The boxes will be identified with the Corporate symbol and logotype for EG & G Mound Applied Technologies. Evaluation of the drop test data and attribute measurements resulted in the boxes being certified per 49 CFR 178.191 as DOT-19B100 boxes and marked per 49 CFR 178.191-9.

  5. Efficient approximation of black-box functions and Pareto sets

    NARCIS (Netherlands)

    Rennen, G.

    2009-01-01

    In the case of time-consuming simulation models or other so-called black-box functions, we determine a metamodel which approximates the relation between the input- and output-variables of the simulation model. To solve multi-objective optimization problems, we approximate the Pareto set, i.e. the

  6. Box-and-Whisker Plots Applied to Food Chemistry

    Science.gov (United States)

    Ferreira, Joao E. V.; Miranda, Ricardo M.; Figueiredo, Antonio F.; Barbosa, Jardel P.; Brasil, Edykarlos M.

    2016-01-01

    Box-and-whisker plots or simply boxplots are powerful graphical representations that give an overview of a data set. In this work five different examples illustrate the applications of boxplots in food chemistry. The examples involve relative sweetness of sugars and sugar alcohols with respect to sucrose, the potassium content of fruits and…

  7. Constructing probability boxes and Dempster-Shafer structures

    Energy Technology Data Exchange (ETDEWEB)

    Ferson, Scott [Applied Biomathematics, Setauket, NY (United States); Kreinovich, Vladik [Applied Biomathematics, Setauket, NY (United States); Grinzburg, Lev [Applied Biomathematics, Setauket, NY (United States); Myers, Davis [Applied Biomathematics, Setauket, NY (United States); Sentz, Kari [Binghamton Univ., NY (United States). Thomas J. Watson School of Engineering and Applied Science, Systems Science and Industrial Engineering Dept.

    2015-05-01

    This report summarizes a variety of the most useful and commonly applied methods for obtaining Dempster-Shafer structures, and their mathematical kin probability boxes, from empirical information or theoretical knowledge. The report includes a review of the aggregation methods for handling agreement and conflict when multiple such objects are obtained from different sources.

  8. Review of Elastic Analysis of Box Girder Bridges | Ezeokpube ...

    African Journals Online (AJOL)

    The importance of thin-walled box girder bridges has attracted the attention of researchers since the last five decades. A lot of literature has dealt with the analytical formulations as well as experimental investigations. Field studies have increased tremendously in the last decade. So far the agreement between the analytical ...

  9. Fitting boxes to Manhattan scenes using linear integer programming

    KAUST Repository

    Li, Minglei

    2016-02-19

    We propose an approach for automatic generation of building models by assembling a set of boxes using a Manhattan-world assumption. The method first aligns the point cloud with a per-building local coordinate system, and then fits axis-aligned planes to the point cloud through an iterative regularization process. The refined planes partition the space of the data into a series of compact cubic cells (candidate boxes) spanning the entire 3D space of the input data. We then choose to approximate the target building by the assembly of a subset of these candidate boxes using a binary linear programming formulation. The objective function is designed to maximize the point cloud coverage and the compactness of the final model. Finally, all selected boxes are merged into a lightweight polygonal mesh model, which is suitable for interactive visualization of large scale urban scenes. Experimental results and a comparison with state-of-the-art methods demonstrate the effectiveness of the proposed framework.

  10. Box jellyfish use terrestrial visual cues for navigation

    DEFF Research Database (Denmark)

    Garm, Anders; Oskarsson, Magnus; Nilsson, Dan-Eric

    2011-01-01

    Box jellyfish have an impressive set of 24 eyes of four different types, including eyes structurally similar to those of vertebrates and cephalopods [1, 2]. However, the known visual responses are restricted to simple phototaxis, shadow responses, and object avoidance responses [3-8], and it has...

  11. Induction of Liquid Crystallinity by Self-Assembled Molecular Boxes

    NARCIS (Netherlands)

    Piermattei, A.; Giesbers, M.; Marcelis, A.T.M.; Mendes, E.; Picken, S.J.; Crego-Calama, M.; Reinhoudt, D.N.

    2006-01-01

    In a hierarchical process, three molecules of a calix[4]arene (blue) and six of barbituric or cyanuric acid (green) assemble into double-rosette boxes, which assemble into columns, which in turn assemble into columnar liquid-crystalline phases (see picture). The resulting mesophases have a

  12. Evaluating degradation at railway crossings using axle box acceleration measurements

    NARCIS (Netherlands)

    Wei, Z.; Nunez Vicencio, Alfredo; Li, Z.; Dollevoet, R.P.B.J.

    2017-01-01

    In this paper, we investigate the capability of an axle box acceleration (ABA) system to evaluate the degradation at railway crossings. For this purpose, information from multiple sensors, namely, ABA signals, 3D rail profiles, Global Positioning System (GPS) and tachometer recordings, was

  13. Detection of early squats by axle box acceleration

    NARCIS (Netherlands)

    Molodova, M.

    2013-01-01

    This thesis discusses a new method for detection of short track irregularities, particularly squats, with axle box acceleration (ABA) measurements. A squat is a surface initiated short track defect, associated with high frequency vibrations of the wheel-rail system. High stresses in the contact

  14. The Popcorn Box Activity and Reasoning about Optimization

    Science.gov (United States)

    Whiteley, Walter J.; Mamolo, Ami

    2012-01-01

    A well-known optimization problem is the Popcorn Box investigation, which involves a movie theater snack container. The problem has been tailored for classroom investigations by the Ontario Association for Mathematics Education. The exploration was designed for students in grades 9 through 12. A common strategy proposed for algebra students is to…

  15. 76 FR 41411 - Group E Post Office Box Service

    Science.gov (United States)

    2011-07-14

    ... summarized later in this notice. Group E PO Box service is provided free, with restrictions, to customers... eligibility. The Postal Service agrees about the importance of Group E in the context of its universal service... customer. The Postal Service adopts the following changes to the Mailing Standards of the United States...

  16. Multidisciplinary Design and Optimization Framework for Aircraft Box Structures

    NARCIS (Netherlands)

    Van Dijk, R.E.C.; Zhao, X.; Wang, H.; Van Dalen, F.

    2012-01-01

    Competitive aircraft box structures are a perfect compromise between weight and price. The conceptual design process of these structures is a typical Multidisciplinary Design and Optimization effort, normally conducted by human engineers. The iterative nature of MDO turns development into a long and

  17. Testing the Box-Cox Parameter for an Integrated Process

    NARCIS (Netherlands)

    J. Huang (Jian); M. Kobayashi (Masahito); M.J. McAleer (Michael)

    2011-01-01

    textabstractThis paper analyses the constant elasticity of volatility (CEV) model suggested by Chan et al. (1992). The CEV model without mean reversion is shown to be the inverse Box-Cox transformation of integrated processes asymptotically. It is demonstrated that the maximum likelihood estimator

  18. The Box Model and the Acoustic Sounder, a Case Study

    DEFF Research Database (Denmark)

    Jensen, Niels Otto; Lundtang Petersen, Erik

    1979-01-01

    Concentrations of SO2 in a large city during a subsidence situation are predicted as a function of time by means of a simple box model and the predictions are compared to actual SO2 concentration measurements. The agreement between model results and measurements is found to be excellent. The model...

  19. Energy Savings Assessment for Digital-to-Analog Converter Boxes

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Hoi Ying Iris; Meier, Alan; Brown, Richard

    2011-01-18

    The Digital Television (DTV) Converter Box Coupon Program was administered by the U.S. government to subsidize purchases of digital-to-analog converter boxes, with up to two $40 coupons for each eligible household. In order to qualify as Coupon Eligible Converter Boxes (CECBs), these devices had to meet a number of minimum performance specifications, including energy efficiency standards. The Energy Star Program also established voluntary energy efficiency specifications that are more stringent than the CECB requirements. In this study, we measured the power and energy consumptions for a sample of 12 CECBs (including 6 Energy Star labeled models) in-use in homes and estimated aggregate energy savings produced by the energy efficiency policies. Based on the 35 million coupons redeemed through the end of the program, our analysis indicates that between 2500 and 3700 GWh per year are saved as a result of the energy efficiency policies implemented on digital-to-analog converter boxes. The energy savings generated are equivalent to the annual electricity use of 280,000 average US homes.

  20. How Users Search the Library from a Single Search Box

    Science.gov (United States)

    Lown, Cory; Sierra, Tito; Boyer, Josh

    2013-01-01

    Academic libraries are turning increasingly to unified search solutions to simplify search and discovery of library resources. Unfortunately, very little research has been published on library user search behavior in single search box environments. This study examines how users search a large public university library using a prominent, single…