A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
International Nuclear Information System (INIS)
Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon
2010-01-01
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
Energy Technology Data Exchange (ETDEWEB)
Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)
2010-08-07
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D
2010-04-01
The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.
Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina
2011-10-15
4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.
Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan
2018-01-01
Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ha, Ae Wha; Kim, Woo Kyoung
2017-06-01
Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.
Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D
2014-10-01
This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie
2017-09-01
Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata
2016-09-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.
Directory of Open Access Journals (Sweden)
Heung Bum Lee
2012-06-01
Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.
Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.
2016-01-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578
Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang
2018-04-18
Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018
Energy Technology Data Exchange (ETDEWEB)
Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca
2013-07-15
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
International Nuclear Information System (INIS)
Lo, Raymond; Matthews, Jason
2013-01-01
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
International Nuclear Information System (INIS)
Watanabe, T.; Oishi, M.
1987-01-01
A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed
International Nuclear Information System (INIS)
Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia
2016-01-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Energy Technology Data Exchange (ETDEWEB)
Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)
2016-08-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.
Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A
2004-10-01
A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
Energy Technology Data Exchange (ETDEWEB)
Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)
2009-12-11
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
International Nuclear Information System (INIS)
Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.
2009-01-01
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin
2018-01-01
Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.
Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong
2016-04-01
Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique
2017-07-11
Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alessandro Di Tullio
2017-07-01
Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Ma, Y F; Wu, Z H; Gao, M; Loor, J J
2018-03-21
The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2
MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral
Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J
2014-01-01
To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Anna Hammer
2017-12-01
Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.
Directory of Open Access Journals (Sweden)
Jian-Guo Ren
2010-09-01
Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel
Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami
2017-06-01
Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele
2014-01-01
Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang
2017-07-01
Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.
Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan
2016-01-01
Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.
Directory of Open Access Journals (Sweden)
Annalisa LoGerfo
2014-01-01
Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.
Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation
International Nuclear Information System (INIS)
Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella
2010-01-01
Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment
Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y
2016-04-01
The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.
Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali
2017-03-01
Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.
Enhancement of erythroid colony growth in culture by hemin
International Nuclear Information System (INIS)
Porter, P.N.; Meints, R.H.; Mesner, K.
1979-01-01
Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.
Directory of Open Access Journals (Sweden)
Abigail A Lamikanra
2009-12-01
Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that
Acute erythroid neoplastic proliferations. A biological study based on 62 patients.
Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad
2002-02-01
The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
DEFF Research Database (Denmark)
Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio
2015-01-01
Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K
2014-12-01
The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming
2017-05-01
Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.
Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C
2017-05-01
Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.
Directory of Open Access Journals (Sweden)
Deepti Jain
2015-06-01
Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.
Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.
2010-01-01
Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494
TMEM14C is required for erythroid mitochondrial heme metabolism.
Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H
2014-10-01
The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.
Age-related retinopathy in NRF2-deficient mice.
Directory of Open Access Journals (Sweden)
Zhenyang Zhao
2011-04-01
Full Text Available Cumulative oxidative damage is implicated in the pathogenesis of age-related macular degeneration (AMD. Nuclear factor erythroid 2-related factor 2 (NRF2 is a transcription factor that plays key roles in retinal antioxidant and detoxification responses. The purposes of this study were to determine whether NRF2-deficient mice would develop AMD-like retinal pathology with aging and to explore the underlying mechanisms.Eyes of both wild type and Nrf2(-/- mice were examined in vivo by fundus photography and electroretinography (ERG. Structural changes of the outer retina in aged animals were examined by light and electron microscopy, and immunofluorescence labeling. Our results showed that Nrf2(-/- mice developed age-dependent degenerative pathology in the retinal pigment epithelium (RPE. Drusen-like deposits, accumulation of lipofuscin, spontaneous choroidal neovascularization (CNV and sub-RPE deposition of inflammatory proteins were present in Nrf2(-/- mice after 12 months. Accumulation of autophagy-related vacuoles and multivesicular bodies was identified by electron microscopy both within the RPE and in Bruch's membrane of aged Nrf2(-/- mice.Our data suggest that disruption of Nfe2l2 gene increased the vulnerability of outer retina to age-related degeneration. NRF2-deficient mice developed ocular pathology similar to cardinal features of human AMD and deregulated autophagy is likely a mechanistic link between oxidative injury and inflammation. The Nrf2(-/- mice can provide a novel model for mechanistic and translational research on AMD.
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Energy Technology Data Exchange (ETDEWEB)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.
International Nuclear Information System (INIS)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-01-01
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation
Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm
2015-01-01
Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.
Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease
DEFF Research Database (Denmark)
de Zeeuw, Dick; Akizawa, Tadao; Audhya, Paul
2013-01-01
Although inhibitors of the renin-angiotensin-aldosterone system can slow the progression of diabetic kidney disease, the residual risk is high. Whether nuclear 1 factor (erythroid-derived 2)-related factor 2 activators further reduce this risk is unknown....
Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells
International Nuclear Information System (INIS)
Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)
Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells
Energy Technology Data Exchange (ETDEWEB)
Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna
2017-01-01
are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark
Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit
2015-01-01
We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632
Energy Technology Data Exchange (ETDEWEB)
Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu
2013-08-01
Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.
Directory of Open Access Journals (Sweden)
Gloria Bua
Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells
Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio
2016-01-01
The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771
MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
International Nuclear Information System (INIS)
Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.
1982-01-01
Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)
Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion
Directory of Open Access Journals (Sweden)
Sandra Capellera-Garcia
2016-06-01
Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
Erythroid cells in vitro: from developmental biology to blood transfusion products.
Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni
2009-07-01
Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.
FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia
International Nuclear Information System (INIS)
Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K
2011-01-01
The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6
DEFF Research Database (Denmark)
Lambers Heerspink, Hiddo J; Chertow, Glenn M; Akizawa, Tadao
2013-01-01
Type 2 diabetes mellitus (T2DM) is the most important contributing cause of end-stage renal disease (ESRD) worldwide. Bardoxolone methyl, a nuclear factor-erythroid-2-related factor 2 activator, augments estimated glomerular filtration. The Bardoxolone methyl EvAluation in patients with Chronic...
Czech Academy of Sciences Publication Activity Database
Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.
2007-01-01
Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007
Energy Technology Data Exchange (ETDEWEB)
Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others
2016-11-15
Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were
von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.
1999-01-01
Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors
Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki
2011-06-01
Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Directory of Open Access Journals (Sweden)
Schmidt Enrico K
2004-05-01
Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.
Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases
Directory of Open Access Journals (Sweden)
Marta Pajares
2017-04-01
Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.
Directory of Open Access Journals (Sweden)
Ryo Kurita
Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.
THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA
DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
1994-01-01
Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using
Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
Directory of Open Access Journals (Sweden)
Ibrahim Mansur
2016-01-01
Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.
Discerning the Mauve factor, Part 2.
McGinnis, Woody R; Audhya, Tapan; Walsh, William J; Jackson, James A; McLaren-Howard, John; Lewis, Allen; Lauda, Peter H; Bibus, Douglas M; Jurnak, Frances; Lietha, Roman; Hoffer, Abram
2008-01-01
"Mauve Factor" was once mistaken for kryptopyrrole but is the hydroxylactam of hemopyrrole, hydroxyhemopyrrolin-2-one (HPL). Treatment with nutrients--particularly vitamin B6 and zinc--reduces urinary excretion of HPL and improves diverse neurobehavioral symptoms in subjects with elevated urinary HPL. Heightened HPL excretion classically associates with emotional stress, which in turn is known to associate with oxidative stress. For this review, markers for nutritional status and for oxidative stress were examined in relationship to urinary HPL. In cohorts with mixed diagnoses, 24-hour urinary HPL correlated negatively with vitamin B6 activity and zinc concentration in red cells (P stress. HPL is known to cause non-erythroid heme depression, which lowers zinc, increases nitric oxide, and increases oxidative stress. Administration of prednisone reportedly provoked HPL excretion in animals. Since adrenocorticoid (and catecholamine) stress hormones mediate intestinal permeability, urinary HPL was examined in relationship to urinary indicans, presumptive marker for intestinal permeability. Urinary HPL associated with higher levels ofindicans (P role in production. Potentially, gut is reservoir for HPL or its precursor, and stress-related changes in intestinal permeability mediate systemic and urinary concentrations.
International Nuclear Information System (INIS)
Gardner, L.C.; Cox, T.M.
1988-01-01
Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation
International Nuclear Information System (INIS)
Porter, P.N.; Ogawa, M.
1982-01-01
Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture
Detection of trans-acting factors for hemoglobin switching by cell fusions
International Nuclear Information System (INIS)
Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.
1986-01-01
The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching
Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan
2015-12-01
Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway
Directory of Open Access Journals (Sweden)
Michelle R. Campbell
2013-01-01
Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.
Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage
Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.
2013-01-01
Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review
Directory of Open Access Journals (Sweden)
Pablo Manresa
2017-12-01
Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.
Directory of Open Access Journals (Sweden)
Shlomi Toobiak
Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.
Expression of assayable residual stem cell damage in erythroid differentiation
International Nuclear Information System (INIS)
Huebner, G.E.; Miller, M.E.; Cronkite, E.P.
1985-01-01
In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)
Directory of Open Access Journals (Sweden)
Zita Garate
2015-12-01
Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.
von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.
2001-01-01
Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal
Fusion of ZMYND8 and RELA genes in acute erythroid leukemia
DEFF Research Database (Denmark)
Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim
2013-01-01
Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...
International Nuclear Information System (INIS)
Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.
1986-01-01
Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells
Parvovirus B19 integration into human CD36+ erythroid progenitor cells.
Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik
2017-11-01
The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.
Human factor H-related protein 2 (CFHR2 regulates complement activation.
Directory of Open Access Journals (Sweden)
Hannes U Eberhardt
Full Text Available Mutations and deletions within the human CFHR gene cluster on chromosome 1 are associated with diseases, such as dense deposit disease, CFHR nephropathy or age-related macular degeneration. Resulting mutant CFHR proteins can affect complement regulation. Here we identify human CFHR2 as a novel alternative pathway complement regulator that inhibits the C3 alternative pathway convertase and terminal pathway assembly. CFHR2 is composed of four short consensus repeat domains (SCRs. Two CFHR2 molecules form a dimer through their N-terminal SCRs, and each of the two C-terminal ends can bind C3b. C3b bound CFHR2 still allows C3 convertase formation but the CFHR2 bound convertases do not cleave the substrate C3. Interestingly CFHR2 hardly competes off factor H from C3b. Thus CFHR2 likely acts in concert with factor H, as CFHR2 inhibits convertases while simultaneously allowing factor H assisted degradation by factor I.
Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9
Directory of Open Access Journals (Sweden)
So-Jung Kim
2017-03-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.
International Nuclear Information System (INIS)
Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.
1991-01-01
These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase
Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T
1987-02-01
The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.
Directory of Open Access Journals (Sweden)
Kei Kohno
Full Text Available Erythroid abnormalities including anemia and polycythemia are often observed in the general clinical setting. Because recent studies reported that adiponectin negatively affects hematopoiesis, we performed a prospective observational study to assess the relationship between anemia and adiponectin, as well as other parameters, in 1029 Japanese subjects (477 men and 552 women 40 years of age and older. Body measurements, blood tests, and nutrition intake studies were performed at baseline, and 5 to 7 years later (follow-up. Hemoglobin (Hb and hematocrit (Hct levels in men with high serum adiponectin levels were lower at follow-up than at baseline. Multiple regression analysis showed that age, body mass index, adiponectin, and glutamic-pyruvic transaminase were significantly associated with erythroid-related variables (red blood cells, Hb, and Hct in both men and women (P <0.05. In a logistic regression analysis, adiponectin, fasting blood glucose, and β-natriuretic peptide were significant risk factors for anemia in men, and blood urea nitrogen and amylase were significant risk factors in women. Physical features and nutrient intake were not risk factors for anemia. Our study demonstrates, both clinically and epidemiologically, that a high serum adiponectin level decreases the amounts of erythroid-related variables and is a risk factor for anemia in Japanese men.
Reduction of erythroid progenitors in protein-energy malnutrition.
Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio
2007-02-01
Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.
Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.
Sherazi, Syed Furqan Haider; Butt, Zeeshan
2012-09-01
AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.
Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu
2018-05-01
Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.
Qin, Jun; He, Yue; Duan, Ming; Luo, Meng
2017-05-01
We explored the effects of Nuclear Factor-E2-related factor 2 (Nrf2) and Heme Oxygenase 1 (HO-1) on splanchnic hemodynamics in portal hypertensive rats. Experimental cirrhosis with portal hypertension was induced by intraperitoneal injection of carbon tetrachloride. The expression of proteins was examined by immunoblotting. Hemodynamic studies were performed by radioactive microspheres. The vascular perfusion system was used to measure the contractile response of mesentery arterioles in rats. Nrf2 expression in the nucleus and HO-1 expression in cytoplasm was significantly enhanced in portal hypertensive rats. Portal pressure, as well as regional blood flow, increased significantly in portal hypertension and can be blocked by tin protoporphyrin IX. The expression of endogenous nitric oxide synthase and vascular endothelial growth factors increased significantly compared to normal rats, while HO-1 inhibition decreased the expression of these proteins significantly. The contractile response of mesenteric arteries decreased in portal hypertension, but can be partially recovered through tin protoporphyrin IX treatment. The expression of Nrf2/HO-1 increased in mesenteric arteries of portal hypertensive rats, which was related to oxidative stress. HO-1was involved in increased portal pressure and anomaly splanchnic hemodynamics in portal hypertensive rats. Copyright © 2016 Elsevier Inc. All rights reserved.
Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M
1981-01-01
Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Shaojie; Patel, Ananddeep; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu
2015-11-13
Activation of the aryl hydrocarbon receptor (AhR) transcriptionally induces phase I (cytochrome P450 (CYP) 1A1) and phase II (NAD(P)H quinone oxidoreductase 1 (NQO1) detoxifying enzymes. The effects of the classical and nonclassical AhR ligands on phase I and II enzymes are well studied in human hepatocytes. Additionally, we observed that the proton pump inhibitor, omeprazole (OM), transcriptionally induces CYP1A1 in the human adenocarcinoma cell line, H441 cells via AhR. Whether OM activates AhR and induces the phase II enzyme, NAD(P)H quinone oxidoreductase 1 (NQO1), in fetal primary human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce NQO1 in HPMEC via the AhR. The concentrations of OM used in our experiments did not result in cytotoxicity. OM activated AhR as evident by increased CYP1A1 mRNA expression. However, contrary to our hypothesis, OM increased NQO1 mRNA and protein via an AhR-independent mechanism as AhR knockdown failed to abrogate OM-mediated increase in NQO1 expression. Interestingly, OM activated Nrf2 as evident by increased phosphoNrf2 (S40) expression in OM-treated compared to vehicle-treated cells. Furthermore, Nrf2 knockdown abrogated OM-mediated increase in NQO1 expression. In conclusion, we provide evidence that OM induces NQO1 via AhR-independent, but Nrf2-dependent mechanisms. - Highlights: • We investigated whether omeprazole induces NQO1 in human fetal lung cells. • Omeprazole induces the phase II enzyme, NQO1, in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of NQO1. • Omeprazole increases phosphoNrf2 (S40) protein expression in human fetal lung cells. • Nrf2 knockdown abrogates the induction of NQO1 by omeprazole in human lung cells.
Directory of Open Access Journals (Sweden)
Ruth Merkle
2016-08-01
Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in
Directory of Open Access Journals (Sweden)
Sreoshi Chatterjee
Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.
Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.
Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem
2016-12-01
In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.
Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G
1996-01-01
Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.
Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.
Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired
The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice
International Nuclear Information System (INIS)
Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.
1981-01-01
The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Directory of Open Access Journals (Sweden)
Po-Yuan Wu
2017-10-01
Full Text Available Chronic ultraviolet (UV exposure may cause skin damage, disrupt skin barrier function, and promote wrinkle formation. UV induces oxidative stress and inflammation, which results in extracellular matrix degradation in the dermis and epidermal hyperplasia. Our previous study demonstrated that fisetin exerts photoprotective activity by inhibiting mitogen-activated protein kinase/activator protein-1/matrix metalloproteinases (MMPs activation. In this study, fisetin was applied topically to investigate its antiphotodamage effects in hairless mice. The erythema index (a* values and transepidermal water loss were evaluated to assess skin damage, and immunohistochemical staining was conducted to elucidate the photoprotective mechanism of fisetin. The results revealed that the topical application of fisetin reduced UVB-induced increase in the a* value and wrinkle formation. In addition, fisetin inhibited epidermal hyperplasia and increased the collagen content in the dermis. Fisetin exerted photoprotective activity by inhibiting the expression of MMP-1, MMP-2, and cyclooxygenase-2 and increasing the expression of nuclear factor erythroid 2-related factor. Furthermore, fisetin increased the expression of filaggrin to prevent UVB-induced barrier function disruption. Altogether, the present results provide evidence of the effects and mechanisms of fisetin’s antiphotodamage and antiphotoinflammation activities.
Wu, Po-Yuan; Lyu, Jia-Ling; Liu, Yi-Jung; Chien, Ting-Yi; Hsu, Hao-Cheng; Wen, Kuo-Ching; Chiang, Hsiu-Mei
2017-10-10
Chronic ultraviolet (UV) exposure may cause skin damage, disrupt skin barrier function, and promote wrinkle formation. UV induces oxidative stress and inflammation, which results in extracellular matrix degradation in the dermis and epidermal hyperplasia. Our previous study demonstrated that fisetin exerts photoprotective activity by inhibiting mitogen-activated protein kinase/activator protein-1/matrix metalloproteinases (MMPs) activation. In this study, fisetin was applied topically to investigate its antiphotodamage effects in hairless mice. The erythema index (a* values) and transepidermal water loss were evaluated to assess skin damage, and immunohistochemical staining was conducted to elucidate the photoprotective mechanism of fisetin. The results revealed that the topical application of fisetin reduced UVB-induced increase in the a* value and wrinkle formation. In addition, fisetin inhibited epidermal hyperplasia and increased the collagen content in the dermis. Fisetin exerted photoprotective activity by inhibiting the expression of MMP-1, MMP-2, and cyclooxygenase-2 and increasing the expression of nuclear factor erythroid 2-related factor. Furthermore, fisetin increased the expression of filaggrin to prevent UVB-induced barrier function disruption. Altogether, the present results provide evidence of the effects and mechanisms of fisetin's antiphotodamage and antiphotoinflammation activities.
Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun
2017-01-01
Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.
Directory of Open Access Journals (Sweden)
Ji Yeon Seo
2017-01-01
Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.
Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu
2018-04-01
During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.
Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases.
Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug
2014-01-01
Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury
Directory of Open Access Journals (Sweden)
Ravirajsinh N. Jadeja
2016-01-01
Full Text Available Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2, a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans.
Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun
2015-01-01
Background: We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. Methods: First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Results: Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Conclusions: Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. PMID
Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S
2015-07-01
Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.
Nrf2 and Redox Status in Prediabetic and Diabetic Patients
Directory of Open Access Journals (Sweden)
Angélica S. Jiménez-Osorio
2014-11-01
Full Text Available The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2 was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS in plasma and erythrocytes, glutathione (GSH and malondialdehyde (MDA content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC. Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients.
International Nuclear Information System (INIS)
Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.
2013-01-01
6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage
Cino, E.A.; Wong-ekkabut, J.; Karttunen, M.E.J.; Choy, W.-Y.
2011-01-01
Intrinsically disordered proteins (IDPs) are abundant in cells and have central roles in protein-protein interaction networks. Interactions between the IDP Prothymosin alpha (ProTa) and the Neh2 domain of Nuclear factor erythroid 2-related factor 2 (Nrf2), with a common binding partner, Kelch-like
Directory of Open Access Journals (Sweden)
Kibo Yoon
Full Text Available To evaluate the interobserver reproducibility of two-dimensional shear wave elastography (2D-SWE in measuring liver stiffness (LS and to investigate factors related to liver 2D-SWE.A prospective study was conducted between August 2011 and August 2012 in rheumatoid arthritis patients who had been treated with methotrexate. Interobserver reproducibility of 2D-SWE was evaluated, and the relationship between interobserver difference in LS and related factors was analyzed using linear regression analyses. We considered age, sex, alanine transaminase, cholesterol, body mass index (BMI, and waist circumference as clinical factors, and the mean value of standard deviation (SDM, its difference between two examiners, mean diameter of the regions of interest (ROIM, and its difference in the elasticity map as investigation factors. The cut-off value for significant factors to predict interobserver discrepancies in LS-based fibrosis stage was also inspected.In total, 176 patients were enrolled. The intraclass correlation coefficient between the two examiners was 0.784. In the univariate analysis, SDM and ROIM were independently associated with interobserver differences in LS as well as BMI, waist circumference, and the difference of ROI, but SDM and ROIM were the only ones significantly related in multivariate analysis (p<0.001 and p = 0.021, respectively. The best cut-off value for SDM in predicting interobserver discrepancy in LS-based fibrosis stage was 1.4.Interobserver reproducibility of 2D-SWE for measuring LS was good and SDM was the most significantly associated factor with interobserver differences in LS and interobserver discordance in LS-based fibrosis stage.
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Marco Gabbianelli
2009-11-01
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
Mechanism governing heme synthesis reveals a GATA factor/heme circuit that controls differentiation.
Tanimura, Nobuyuki; Miller, Eli; Igarashi, Kazuhiko; Yang, David; Burstyn, Judith N; Dewey, Colin N; Bresnick, Emery H
2016-02-01
Metal ion-containing macromolecules have fundamental roles in essentially all biological processes throughout the evolutionary tree. For example, iron-containing heme is a cofactor in enzyme catalysis and electron transfer and an essential hemoglobin constituent. To meet the intense demand for hemoglobin assembly in red blood cells, the cell type-specific factor GATA-1 activates transcription of Alas2, encoding the rate-limiting enzyme in heme biosynthesis, 5-aminolevulinic acid synthase-2 (ALAS-2). Using genetic editing to unravel mechanisms governing heme biosynthesis, we discovered a GATA factor- and heme-dependent circuit that establishes the erythroid cell transcriptome. CRISPR/Cas9-mediated ablation of two Alas2 intronic cis elements strongly reduces GATA-1-induced Alas2 transcription, heme biosynthesis, and surprisingly, GATA-1 regulation of other vital constituents of the erythroid cell transcriptome. Bypassing ALAS-2 function in Alas2 cis element-mutant cells by providing its catalytic product 5-aminolevulinic acid rescues heme biosynthesis and the GATA-1-dependent genetic network. Heme amplifies GATA-1 function by downregulating the heme-sensing transcriptional repressor Bach1 and via a Bach1-insensitive mechanism. Through this dual mechanism, heme and a master regulator collaborate to orchestrate a cell type-specific transcriptional program that promotes cellular differentiation. © 2015 The Authors.
Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle
International Nuclear Information System (INIS)
Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella
2012-01-01
Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.
PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia
DEFF Research Database (Denmark)
Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta
2004-01-01
markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...
Qin, Wenjuan; Guan, Dongfang; Ma, Rongji; Yang, Rentan; Xing, Guoqiang; Shi, Hongjuan; Tang, Guangyao; Li, Jiajie; Lv, Hailong; Jiang, Yufeng
2017-08-01
The aim of this study was to investigate the impact of trigonelline (TRG) on Echinococcus granulosus, and to explore the inhibition impact of nuclear factor erythroid-2-related factor 2 (Nrf2) signaling pathway on E. granulosus protoscoleces. Echinococcus granulosus protoscoleces were incubated with various concentrations of TRG, and then Nrf2 protein expression and its localization in protoscoleces were detected by western blot analysis and immunofluorescence assay, respectively. Reactive oxygen species (ROS) level in protoscoleces was measured using ROS detection kit. Caspase-3 activity was measured using a caspase-3 activity assay kit, and NAD(P)H quinone oxidoreductase (NQO)-1 and heme oxygenase (HO)-1 activities in protoscoleces were measured by ELISA. The effect of TRG on protoscoleces viability was investigated using 0.1% eosin staining, and ultrastructural alterations in protoscoleces were examined by scanning electron microscopy (SEM). Immunolocalization experiment clearly showed that Nrf2 protein was predominantly present in cells of protoscoleces. TRG treatment reduced NQO-1 and HO-1 activities in protoscoleces, but could increase ROS level at early time. Protoscoleces could not survive when treated with 250 μM TRG for 12 days. SEM results showed that TRG-treated protoscoleces presented damage in the protoscoleces region, including hook deformation, lesions, and digitiform protuberance. Nrf2 protein expression was significantly decreased and caspase-3 activity was clearly increased in protoscoleces treated with TRG for 24 and 48 h, respectively, when compared with that in controls (P granulosus protoscoleces. Nrf2 protein was mainly expressed in the cells and TRG could efficiently inhibit the Nrf2 signaling pathway in E. granulosus. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For
Factor Decomposition Analysis of Energy-Related CO2 Emissions in Tianjin, China
Directory of Open Access Journals (Sweden)
Zhe Wang
2015-07-01
Full Text Available Tianjin is the largest coastal city in northern China with rapid economic development and urbanization. Energy-related CO2 emissions from Tianjin’s production and household sectors during 1995–2012 were calculated according to the default carbon-emission coefficients provided by the Intergovernmental Panel on Climate Change. We decomposed the changes in CO2 emissions resulting from 12 causal factors based on the method of Logarithmic Mean Divisia Index. The examined factors were divided into four types of effects: energy intensity effect, structure effect, activity intensity effect, scale effect and the various influencing factors imposed differential impacts on CO2 emissions. The decomposition outcomes indicate that per capita GDP and population scale are the dominant positive driving factors behind the growth in CO2 emissions for all sectors, while the energy intensity of the production sector is the main contributor to dampen the CO2 emissions increment, and the contributions from industry structure and energy structure need further enhancement. The analysis results reveal the reasons for CO2 emission changes in Tianjin and provide a solid basis upon which policy makers may propose emission reduction measures and approaches for the implementation of sustainable development strategies.
Mondal, Nandan Kumar; Saha, Hirak; Mukherjee, Bidisha; Tyagi, Neetu; Ray, Manas Ranjan
2018-01-24
The study was carried out to examine whether chronic exposure to smoke during daily household cooking with biomass fuel (BMF) elicits changes in airway cytology and expressions of Nrf2 (nuclear factor erythroid 2 [NF-E2]-related factor 2 [Nrf2]), Keap1 (Kelch-like erythroid-cell-derived protein with CNC homology [ECH]-associated protein 1), and NQO1 (NAD(P)H:quinone oxidoreductase 1) proteins in the airways. For this, 282 BMF-using women (median age 34 year) and 236 age-matched women who cooked with liquefied petroleum gas (LPG) were enrolled. Particulate matter with diameters of LPG. Compared with LPG users, BMF users had 32% more leukocytes in circulation and their sputa were 1.4-times more cellular with significant increase in absolute number of neutrophils, lymphocytes, eosinophils, and alveolar macrophages, suggesting airway inflammation. ROS generation was 1.5-times higher in blood neutrophils and 34% higher in sputum cells of BMF users while erythrocyte SOD was 31% lower and plasma catalase was relatively unchanged, suggesting oxidative stress. In BMF users, Keap1 expression was reduced, the percentage of AEC with nuclear expression of Nrf2 was two- to three-times more, and NQO1 level in sputum cell lysate was two-times higher than that of LPG users. In conclusion, cooking with BMF was associated with Nrf2 activation and elevated NQO1 protein level in the airways. The changes may be adaptive cellular response to counteract biomass smoke-elicited oxidative stress and inflammation-related tissue injury in the airways.
Energy Technology Data Exchange (ETDEWEB)
Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)
2013-11-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS
International Nuclear Information System (INIS)
Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching
2013-01-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and
Yang, Chunzhang; Zhuang, Zhengping; Fliedner, Stephanie M J; Shankavaram, Uma; Sun, Michael G; Bullova, Petra; Zhu, Roland; Elkahloun, Abdel G; Kourlas, Peter J; Merino, Maria; Kebebew, Electron; Pacak, Karel
2015-01-01
We have investigated genetic/pathogenetic factors associated with a new clinical entity in patients presenting with pheochromocytoma/paraganglioma (PHEO/PGL) and polycythemia. Two patients without hypoxia-inducible factor 2α (HIF2A) mutations, who presented with similar clinical manifestations, were analyzed for other gene mutations, including prolyl hydroxylase (PHD) mutations. We have found for the first time a germ-line mutation in PHD1 in one patient and a novel germ-line PHD2 mutation in a second patient. Both mutants exhibited reduced protein stability with substantial quantitative protein loss and thus compromised catalytic activities. Due to the unique association of patients' polycythemia with borderline or mildly elevated erythropoietin (EPO) levels, we also performed an in vitro sensitivity assay of erythroid progenitors to EPO and for EPO receptor (EPOR) expression. The results show inappropriate hypersensitivity of erythroid progenitors to EPO in these patients, indicating increased EPOR expression/activity. In addition, the present study indicates that HIF dysregulation due to PHD mutations plays an important role in the pathogenesis of these tumors and associated polycythemia. The PHD1 mutation appears to be a new member contributing to the genetic landscape of this novel clinical entity. Our results support the existence of a specific PHD1- and PHD2-associated PHEO/PGL-polycythemia disorder. • A novel germ-l i n e PHD1 mutation causing heochromocytoma/paraganglioma and polycythemia. • Increased EPOR activity and inappropriate hypersensitivity of erythroid progenitors to EPO.
Perspectives of the Nrf-2 signaling pathway in cancer progression and therapy
Directory of Open Access Journals (Sweden)
Priyanka Basak
Full Text Available The Nuclear factor erythroid2-related factor2 (Nrf2, a master regulator of redox homoeostasis, is a key transcription factor regulating a wide array of genes for antioxidant and detoxification enzymes. It protects organs from various kinds of toxic insults. On the other hand, activation of Nrf2 is also correlated with cancer progression and chemoresistance. Downregulation of Nrf2 activity has attracted an increasing amount of attention as it may provide an alternative cancer therapy. In this review, we examine recent studies on roles of Nrf2 in several pathophysiological conditions emphasising cancer. We discuss elaborately the current knowledge on Nrf2 regulation including KEAP1-dependent and KEAP1-independent cascades. KEAP1/Nrf2 system is a master regulator of cellular response against a variety of environmental stresses. We also highlight several tightly controlled regulations of Nrf2 by numerous proteins, small molecules, toxic metals, etc. In addition, we evaluate the possible therapeutic approaches of increasing chemosensitivity via modulating Nrf2 signaling. Keywords: Nrf2, Transcription factor, KEAP1, Oxidative stress, Cell proliferation, Carcinogenesis, Chemoprevention
Prospective identification of erythroid elements in cultured peripheral blood.
Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P
1999-04-01
We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.
Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow
International Nuclear Information System (INIS)
Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.
1976-01-01
The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors
Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio
2016-07-15
Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.
[Update on the biology of heme synthesis in erythroid cells].
Fujiwara, Tohru; Harigae, Hideo
2015-02-01
Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.
[Identification of risk factors in relatives of type-2 diabetics].
Cuevas-Alvarez, Norma Angélica; Vela-Otero, Yolanda; Carrada-Brav, Teodoro
2006-01-01
To identify risk factors and warning signs in a sample of first-degree relatives of type-2 diabetics at the Family Medicine Unit 2 of the General Hospital in Irapuato, Guanajuato, Mexico. In a non-probabilistic sample of 360 relatives, a 14-item questionnaire was applied to measure abdominal perimeter and body mass index (obesity and overweight), eating habits, addictions and sedentarism. The questionnaire was made by general consent of experts, by applying Cronbach's alpha reliability coefficient. Specific rates of prevalence by sex and age groups were estimated. 233 (65%) relatives were females. As part of their family history background, arterial hypertension was recorded in 263 (73%) and acute myocardial infarction in 97 (27%). Among the dangerous food for health consumed by the relatives of diabetics are cola drinks in 94.7%, red meat in 83%, candies in 74.7% and chips in 65.8%; only half of them consumed fresh fruits and vegetables; a quarter of them ate prickly pears or whole wheat bread. There were 163 (45.3%) persons with high-risk abdominal perimeter, and sedentarism was present in 267 (74.2%). However, obesity was 3 times more frequent in females, but excessive drinking or smoking habits were 7 times more prevailing in males. A high-risk behavior was demonstrated among relativies of diabetic patients. Therefore, a public-health educational program is required to modify risky habits. A change towards prevention rather than cure is much needed in health staff.
Nrf2 mediates redox adaptations to exercise
Directory of Open Access Journals (Sweden)
Aaron J. Done
2016-12-01
Full Text Available The primary aim of this review is to summarize the current literature on the effects of acute exercise and regular exercise on nuclear factor erythroid 2-related factor 2 (Nrf2 activity and downstream targets of Nrf2 signaling. Nrf2 (encoded in humans by the NFE2L2 gene is the master regulator of antioxidant defenses, a transcription factor that regulates expression of more than 200 cytoprotective genes. Increasing evidence indicates that Nrf2 signaling plays a key role in how oxidative stress mediates the beneficial effects of exercise. Episodic increases in oxidative stress induced through bouts of acute exercise stimulate Nrf2 activation and when applied repeatedly, as with regular exercise, leads to upregulation of endogenous antioxidant defenses and overall greater ability to counteract the damaging effects of oxidative stress. The evidence of Nrf2 activation in response to exercise across variety of tissues may be an important mechanism of how exercise exerts its well-known systemic effects that are not limited to skeletal muscle and myocardium. Additionally there are emerging data that results from animal studies translate to humans.
Directory of Open Access Journals (Sweden)
Jingqi Fu
2015-01-01
Full Text Available Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2 is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2 and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF, and tert-butylhydroquinone (tBHQ, protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS are involved in regulating glucose-stimulated insulin secretion (GSIS and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes.
International Nuclear Information System (INIS)
Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir
2014-01-01
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway
Energy Technology Data Exchange (ETDEWEB)
Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)
2014-07-18
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.
International Nuclear Information System (INIS)
Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo
2012-01-01
Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs 3+ ) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs 3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs 3+ and monomethylarsonous acid (MMA 3+ )-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs 3+ -induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs 3+ . The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs 3+ in β-cells. ► Deficiency of Nrf2 in β-cells sensitized to iAs 3+ and MMA 3
Energy Technology Data Exchange (ETDEWEB)
Yang, Bei [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Department of Histology and Embryology, College of Basic Medical Sciences, China Medical University, Shenyang 110001 (China); Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)
2012-11-01
Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in
Directory of Open Access Journals (Sweden)
Jozef Madzo
2014-01-01
Full Text Available Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC during stem cell commitment and differentiation to the erythroid lineage. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2 mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage.
Directory of Open Access Journals (Sweden)
Sellamuthu S Gounder
Full Text Available Aging promotes accumulation of reactive oxygen/nitrogen species (ROS/RNS in cardiomyocytes, which leads to contractile dysfunction and cardiac abnormalities. These changes may contribute to increased cardiovascular disease in the elderly. Inducible antioxidant pathways are regulated by nuclear erythroid 2 p45-related factor 2 (Nrf2 through antioxidant response cis-elements (AREs and are impaired in the aging heart. Whereas acute exercise stress (AES activates Nrf2 signaling and promotes myocardial antioxidant function in young mice (~2 months, aging mouse (>23 months hearts exhibit significant oxidative stress as compared to those of the young. The purpose of this study was to investigate age-dependent regulation of Nrf2-antioxidant mechanisms and redox homeostasis in mouse hearts and the impact of exercise. Old mice were highly susceptible to oxidative stress following high endurance exercise stress (EES, but demonstrated increased adaptive redox homeostasis after moderate exercise training (MET; 10m/min, for 45 min/day for ~6 weeks. Following EES, transcription and protein levels for most of the ARE-antioxidants were increased in young mice but their induction was blunted in aging mice. In contrast, 6-weeks of chronic MET promoted nuclear levels of Nrf2 along with its target antioxidants in the aging heart to near normal levels as seen in young mice. These observations suggest that enhancing Nrf2 function and endogenous cytoprotective mechanisms by MET, may combat age-induced ROS/RNS and protect the myocardium from oxidative stress diseases.
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
von Lindern, Marieke; Schmidt, Uwe; Beug, Hartmut
2004-01-01
Erythropoietin (Epo) and stem cell factor (SCF) are essential factors in the control of survival, expansion and differentiation of erythroid progenitors. Upon activation, their receptors, the EpoR and c-Kit, initiate multiple signalling pathways that control many cellular processes. To control
DEFF Research Database (Denmark)
Järås, Marcus; Johnels, Petra; Agerstam, Helena
2009-01-01
OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...
Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.
Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio
2017-07-15
Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.
Productivity loss at work; health-related and work-related factors.
van den Heuvel, Swenne G; Geuskens, Goedele A; Hooftman, Wendela E; Koppes, Lando L J; van den Bossche, Seth N J
2010-09-01
Productivity loss is an increasing problem in an aging working population that is decreasing in numbers. The aim of this study is to identify work-related and health-related characteristics associated with productivity loss, due to either sickness absence or reduced performance at work. In this cross-sectional study, data of the Netherlands Working Conditions Survey of 2007 were used, which includes a national representative sample of 22,759 employees aged 15 to 64 years. Demographic characteristics, health-related and work-related factors were assessed with a questionnaire. Logistic regression analyses were carried out to study the relationship of work-related and health-related factors with low performance at work and sickness absence in the past 12 months. Poor general health, the number of longstanding health conditions, and most types of longstanding health conditions were associated with productivity loss. Health-related factors were in general stronger associated with sickness absence than with low performance at work. Performance: poor health OR 1.54 CI 1.38-1.71, >1 health conditions OR 1.21 CI 1.09-1.35; sickness absence: poor health OR 2.62 CI 2.33-2.93, >1 health conditions OR 2.47 CI 2.21-2.75. Of the different types of longstanding health conditions, only psychological complaints and to a small extent musculoskeletal symptoms, were associated with low performance (respectively OR 1.54 CI 1.27-1.87; OR 1.09 CI 1.00-1.18). Low performance at work was less likely among employees with high physically demanding work (shift work OR 0.70 CI 0.63-0.76, using force OR 0.78 CI 0.72-0.84, and repetitive movements OR 0.74 CI 0.70-0.79). Psychosocial factors were stronger associated with low performance at work than with sickness absence (performance: job autonomy OR 1.28 CI 1.21-1.37, job demands OR 1.23 CI 1.16-1.31, emotionally demanding work OR 1.73 CI 1.62-1.85; sickness absence: job autonomy ns, job demands OR 1.09 CI 1.03-1.17, emotionally demanding work OR
Directory of Open Access Journals (Sweden)
Shue Dong Chung
Full Text Available Exacerbated oxidative stress and inflammation may induce three types of programmed cell death, autophagy, apoptosis and pyroptosis in unilateral ureteral obstruction (UUO kidney. Sulforaphane activating NF-E2-related nuclear factor erythroid-2 (Nrf-2 signaling may ameliorate UUO-induced renal damage. UUO was induced in the left kidney of female Wistar rats. The level of renal blood flow, cortical and medullary oxygen tension and reactive oxygen species (ROS was evaluated. Fibrosis, ED-1 (macrophage/monocyte infiltration, oxidative stress, autophagy, apoptosis and pyroptosis were evaluated by immunohistochemistry and Western blot in UUO kidneys. Effects of sulforaphane, an Nrf-2 activator, on Nrf-2- and mitochondrial stress-related proteins and renal injury were examined. UUO decreased renal blood flow and oxygen tension and increased renal ROS, 3-nitrotyrosine stain, ED-1 infiltration and fibrosis. Enhanced renal tubular Beclin-1 expression started at 4 h UUO and further enhanced at 3d UUO, whereas increased Atg-5-Atg12 and LC3-II expression were found at 3d UUO. Increased renal Bax/Bcl-2 ratio, caspase 3 and PARP fragments, apoptosis formation associated with increased caspase 1 and IL-1β expression for pyroptosis formation were started from 3d UUO. UUO reduced nuclear Nrf-2 translocation, increased cytosolic and inhibitory Nrf-2 expression, increased cytosolic Bax translocation to mitochondrial and enhanced mitochondrial Cytochrome c release into cytosol of the UUO kidneys. Sulforaphane significantly increased nuclear Nrf-2 translocation and decreased mitochondrial Bax translocation and Cytochrome c release into cytosol resulting in decreased renal injury. In conclusion, sulforaphane via activating Nrf-2 signaling preserved mitochondrial function and suppressed UUO-induced renal oxidative stress, inflammation, fibrosis, autophagy, apoptosis and pyroptosis.
Directory of Open Access Journals (Sweden)
Josephine Wesely
2017-01-01
Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.
Brod, J M; Demasi, Ana Paula Dias; Montalli, V A; Teixeira, L N; Furuse, C; Aguiar, M C; Soares, A B; Sperandio, M; Araujo, V C
2017-12-01
Polymorphous adenocarcinoma (PAC) is a malignant epithelial neoplasm that affects almost exclusively the minor salivary glands, generally described as having a relatively good prognosis. Aberrant nuclear factor erythroid 2 (NF-E2)-related factor (Nrf2) activation in tumor cells has been associated with induction of antioxidant enzymes, such as peroxiredoxin I (Prx I) and increased matrix metalloproteinase (MMP) expression. In this context, the aim of the present study was to evaluate the expression of Nrf2 and correlate it with Prx I and MMP-2 secretion in PAC. Thirty-one cases of PAC from oral biopsies were selected and immunohistochemically analyzed for Nrf2 and Prx I. MMP-2 quantification was performed on primary cell cultures derived from PAC. Oral squamous cell carcinoma (OSCC) cell cultures were used as control. A high immunoexpression of Nrf2 was observed in both the cytoplasm and the nucleus of neoplastic cells from PAC. Nuclear staining for Nrf2 suggested its activation in the majority of the PAC cells, which was confirmed by the high expression of its target gene, Prx I. Quantification of MMP-2 secretion showed lower levels in PAC cell cultures when compared to OSCC cell cultures (p high-grade malignancies, such relationship is not infallible and, in fact, the opposite may occur in low-grade tumors, such as PAC of minor salivary glands.
DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model
Directory of Open Access Journals (Sweden)
Huimin eCao
2016-01-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.
Directory of Open Access Journals (Sweden)
Pascariello Caterina
2008-05-01
Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of
Aggarwal, Anshu; Hunter, William J.; Aggarwal, Himanshu; Silva, Edibaldo D.; Davey, Mary S.; Murphy, Richard F.; Agrawal, Devendra K.
2010-01-01
The POK family of proteins plays an important role in not only embryonic development and cell differentiation, but also in oncogenesis. Leukemia/lymphoma-related factor (LRF) belongs to the POK family of transcriptional repressors and is also known as POK erythroid myeloid ontogenic factor (POKEMON), which binds to short transcripts of HIV-1 (FBI-1) and TTF-1 interacting peptide (TIP21). Its oncogenic role is known only in lymphoma, non-small cell lung carcinoma, and malignant gliomas. The functional expression of LRF in human breast carcinoma has not yet been confirmed. The aim of this study was to investigate and compare the expression of LRF in human breast cancer tissues and other human tumors. The expression of LRF mRNA transcripts and protein was observed in twenty human benign and malignant breast biopsy tissues. Expression of LRF was observed in several formalin-fixed tissues by immunohistochemistry and immunofluorescence. All malignant breast tissues expressed mRNA transcripts and protein for LRF. However, 40% and 15% benign breast biopsy tissues expressed LRF mRNA transcripts and protein, respectively. The overall expression of LRF mRNA transcripts and total protein was significantly more in malignant breast tissues than the benign breast tissues. LRF expression was also observed in the nuclei of human colon, renal, lung, hepatocellular carcinomas and thymoma tumor cells. In general, a significantly higher expression of LRF was seen in malignant tissues than in the corresponding benign or normal tissue. Further studies are warranted to determine the malignant role of LRF in human breast carcinoma. PMID:20471975
Factors related to high and low levels of drug adherence according to patients with type 2 diabetes
Borgsteede, S.D.; Westerman, M.J.; Kok, I.L.; Meeuse, J.C.; de Vries, T.P.G.M.; Hugtenburg, J.G.
2011-01-01
Objective Adherence to medication in patients with type 2 diabetes varies widely, yet the factors that influence adherence according to patients are not fully known. The aim of this study is to explore both factors related to high and lower levels of adherence that patients with type 2 diabetes
Modulation of Nrf2 by Olive Oil and Wine Polyphenols and Neuroprotection
Directory of Open Access Journals (Sweden)
Miriam Martínez-Huélamo
2017-09-01
Full Text Available Strong adherence to a Mediterranean diet is associated with improved cognitive function and a lower prevalence of mild cognitive impairment. Olive oil and red wine are rich sources of polyphenols which are responsible in part for the beneficial effects on cognitive functioning. Polyphenols induce endogenous antioxidant defense mechanisms by modulating transcription factors such as the nuclear factor (erythroid-derived 2-like 2 (Nrf2. This review discusses the scientific data supporting the modulating effect of olive oil and red wine polyphenols on Nrf2 expression, and the potential health benefits associated with cognitive functioning.
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Ugo Testa
2009-06-01
Full Text Available
In humans the switch from fetal to adult hemoglobin (HbF→ HbA takes place in the perinatal and postnatal period, determining the progressive replacement of HbF with HbA synthesis ( i.e., the relative HbF content in red blood cells decreases from 80-90% to <1%. In spite of more than twenty years of intensive investigations on this classic model, the molecular mechanisms regulating the Hb switching, as well as HbF synthesis in adults, has been only in part elucidated. In adult life, the residual HbF, restricted to F cell compartment, may be reactivated up to 10-20% of total Hb synthesis in various conditions associated with “stress erythropoiesis”: this reactivation represented until now an interesting model of partial Hb switch reverse with important therapeutic implications in patients with hemoglobinopathies, and particularly in -thalassemia.
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF.
In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
Kluitenberg, Bas; van der Worp, Henk; Huisstede, Bionka M A; Hartgens, Fred; Diercks, Ron; Verhagen, Evert; van Middelkoop, Marienke
2016-01-01
Objectives: The incidence of running-related injuries is high. Some risk factors for injury were identified in novice runners, however, not much is known about the effect of training factors on injury risk. Therefore, the purpose of this study was to examine the associations between training factors
Kluitenberg, Bas; van der Worp, Henk; Huisstede, Bionka M. A.; Hartgens, Fred; Diercks, Ronald; Verhagen, Evert; van Middelkoop, Marienke
Objectives: The incidence of running-related injuries is high. Some risk factors for injury were identified in novice runners, however, not much is known about the effect of training factors on injury risk. Therefore, the purpose of this study was to examine the associations between training factors
de Oliveira, Marcos Roberto; da Costa Ferreira, Gustavo; Brasil, Flávia Bittencourt; Peres, Alessandra
2018-02-01
Mitochondria are susceptible to redox impairment, which has been associated with neurodegeneration. These organelles are both a source and target of reactive species. In that context, there is increasing interest in finding natural compounds that modulate mitochondrial function and mitochondria-related signaling in order to prevent or to treat diseases involving mitochondrial impairment. Herein, we investigated whether and how pinocembrin (PB) would prevent mitochondrial dysfunction elicited by the exposure of human neuroblastoma SH-SY5Y cells to hydrogen peroxide (H 2 O 2 ). PB (25 μM) was administrated for 4 h before H 2 O 2 treatment (300 μM for 24 h). PB prevented H 2 O 2 -induced loss of cell viability mitochondrial depolarization in SH-SY5Y cells. PB also attenuated redox impairment in mitochondrial membranes. The production of superoxide anion radical (O 2 -• ) and nitric oxide (NO • ) was alleviated by PB in cells exposed to H 2 O 2 . PB suppressed the H 2 O 2 -induced inhibition of the tricarboxylic acid (TCA) cycle enzymes aconitase, α-ketoglutarate dehydrogenase, and succinate dehydrogenase. Furthermore, PB induced anti-inflammatory effects by abolishing the H 2 O 2 -dependent activation of the nuclear factor-κB (NF-κB) and upregulation of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α). The PB-induced antioxidant and anti-inflammatory effects are dependent on the heme oxygenate-1 (HO-1) enzyme and on the activation of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), since HO-1 inhibition (with 0.5 μM ZnPP IX) or Nrf2 silencing (with small interfering RNA (siRNA)) abolished the effects of PB. Overall, PB afforded cytoprotection by the Nrf2/HO-1 axis in H 2 O 2 -treated SH-SY5Y cells.
Treatment, material, care, and patient-related factors in contact lens-related dry eye.
Ramamoorthy, Padmapriya; Sinnott, Loraine T; Nichols, Jason J
2008-08-01
To examine the effect of general contact lens and material characteristics, care solutions, treatment, and patient-related factors on contact lens-related dry eye. The data were derived from the Contact Lens and Dry Eye Study, designed as a cross-sectional and nested case-control study including 360 subjects. In separate statistical models, logistic regression was used to examine general contact lens characteristics, specific hydrogel lens materials, care solutions, and patient-related factors associated with dry eye status (controlled for age, gender, and current treatments). Several factors were significantly associated with dry eye, including treatment factors such as a recent contact lens refitting (odds ratios [OR] = 5.75, 95% confidence intervals [CI] = 2.14 to 15.46) and use of artificial tears/rewetting drops (OR = 1.09, 95% CI = 1.02 to 1.16), in addition, currently worn materials including Food and Drug Administration (FDA) group II (OR = 2.98, 95% CI = 1.14 to 6.19) and IV (OR = 1.87, 95% CI = 1.08 to 3.24). Significant patient-related factors included decreased overall satisfaction (OR = 3.57, 95% CI = 2.08 to 5.88,), dry eye in the absence of contact lens wear (OR = 6.54, 95% CI = 2.57 to 16.62), reduced daily lens wear duration (OR = 1.16, 95% CI = 1.06 to 1.26), and reduced ability to wear lenses as long as desired (OR = 2.44, 95% CI = 1.30 to 4.54). Care solutions were not associated with contact lens-related dry eye. The strong association of common treatment factors with dry eye status in contact lens wearers suggests that these treatments are not entirely effective. The use of high water content materials was strongly related to dry eye in lens wearers, whereas care solutions were not. Contact lens-related dry eye was also associated with several patient-related factors such as greater ocular discomfort (without lenses), dissatisfaction, and inability to wear lenses for desired durations.
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.
Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong
2017-02-03
Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.
International Nuclear Information System (INIS)
Takeshita, Kenji; Kitamoto, Asashi
1989-01-01
The separation factor for carbon isotope exchange reaction between CO 2 and amine in nonaqueous solvent was related to absorption reaction of CO 2 in a solution. The test solutions were mixtures of primary amine (such as butylamine and tert-butylamine) or secondary amine (such as diethylamine, dipropylamine and dibutylamine) diluted with nonpolar solvent (octane or triethyalmine) or polar solvent (methanol), respectively. The isotope exchange reaction consists of three steps related to chemical reaction of CO 2 in amine and nonaqueous solvent mixture, namely the reaction between CO 2 and carbamic acid, that between CO 2 and amine carbamate, and that between CO 2 and carbamic ion. Above all, the isotope separation factor between CO 2 and carbamic acid had the highest value. The overall separation factor can be higher in amine-nonaqueous solvent mixture where the concentration of carbamic acid becomes higher. (author)
Transcription factors: normal and malignant development of blood cells
National Research Council Canada - National Science Library
Ravid, Katya; Licht, Jonathan
2001-01-01
... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...
Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver
International Nuclear Information System (INIS)
Klaassen, Curtis D.; Reisman, Scott A.
2010-01-01
Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.
Jeremić, Branislav; Casas, Francesc; Dubinsky, Pavol; Gomez-Caamano, Antonio; Čihorić, Nikola; Videtic, Gregory; Igrutinovic, Ivan
2018-01-01
While there are no established pretreatment predictive and prognostic factors in patients with stage IIIA/pN2 non-small cell lung cancer (NSCLC) indicating a benefit to surgery as a part of trimodality approach, little is known about treatment-related predictive and prognostic factors in this setting. A literature search was conducted to identify possible treatment-related predictive and prognostic factors for patients for whom trimodality approach was reported on. Overall survival was the primary endpoint of this study. Of 30 identified studies, there were two phase II studies, 5 "prospective" studies, and 23 retrospective studies. No study was found which specifically looked at treatment-related predictive factors of improved outcomes in trimodality treatment. Of potential treatment-related prognostic factors, the least frequently analyzed factors among 30 available studies were overall pathologic stage after preoperative treatment and UICC downstaging. Evaluation of treatment response before surgery and by pathologic tumor stage after induction therapy were analyzed in slightly more than 40% of studies and found not to influence survival. More frequently studied factors-resection status, degree of tumor regression, and pathologic nodal stage after induction therapy as well as the most frequently studied factor, the treatment (in almost 75% studies)-showed no discernible impact on survival, due to conflicting results. Currently, it is impossible to identify any treatment-related predictive or prognostic factors for selecting surgery in the treatment of patients with stage IIIA/pN2 NSCLC.
Directory of Open Access Journals (Sweden)
Xia Wang
2015-07-01
Full Text Available Oxidative stress is a major risk factor in the onset and progression of type 2 diabetes mellitus (T2DM. NF-E2 related factor 2 (NRF2 is a pivotal transcription factor in oxidative stress related illnesses. This study included 2174 subjects with 879 cases of newly-diagnosed T2DM and 1295 healthy controls. Compared to individuals with the CC genotype, those with the AA genotype had lower total anti-oxidative capacity, superoxide dismutase, catalase, glutathione, glutathione peroxidase activity; and lower homeostasis model assessment of β-cell function index. Those with the AA genotype also had a higher malondialdehyde concentration and homeostasis model assessment of insulin resistance index values. The frequency of allele A was significantly higher in T2DM subjects (29.4%, compared to control subjects (26.1%; p = 0.019. Individuals with the AA genotype had a significantly higher risk of developing T2DM (OR 1.56; 95% CI 1.11, 2.20; p = 0.011, relative to those with the CC genotype, even after adjusting for known T2DM risk factors. Our results suggest that the NRF2 rs6721961 polymorphism was significantly associated with oxidative stress, anti-oxidative status, and risk of newly-diagnosed T2DM. This polymorphism may also contribute to impaired insulin secretory capacity and increased insulin resistance in a Chinese population.
Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling
2014-01-01
Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046
International Nuclear Information System (INIS)
Chen, Yanyan; Xu, Yuanyuan; Zheng, Hongzhi; Fu, Jingqi; Hou, Yongyong; Wang, Huihui; Zhang, Qiang; Yamamoto, Masayuki; Pi, Jingbo
2016-01-01
Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.
Energy Technology Data Exchange (ETDEWEB)
Chen, Yanyan [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Xu, Yuanyuan, E-mail: yyxu@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zheng, Hongzhi [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Fu, Jingqi; Hou, Yongyong; Wang, Huihui [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zhang, Qiang [Rollins School of Public Health, Emory University, Atlanta, GA (United States); Yamamoto, Masayuki [Graduate School of Medicine, Tohoku University, Sendai (Japan); Pi, Jingbo, E-mail: jbpi@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States)
2016-09-09
Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.
Energy Technology Data Exchange (ETDEWEB)
Yang, Bin [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Li, Wei [Department of Gerontology, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Zheng, Qichang [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Qin, Tao [Department of Hepatobiliary Pancreatic Surgery, People' s Hospital of Zhengzhou University, School of Medicine, Zhengzhou University, Zhengzhou 450003 (China); Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Liu, Sanguang, E-mail: sanguang1998@sina.com [Department of Hepatobiliary Surgery, The Second Hospital, Hebei Medical University, Shijiazhuang 050000 (China); Song, Zifang, E-mail: zsong@hust.edu.cn [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China)
2015-07-17
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.
International Nuclear Information System (INIS)
Yang, Bin; Li, Wei; Zheng, Qichang; Qin, Tao; Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen; Liu, Sanguang; Song, Zifang
2015-01-01
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation
Directory of Open Access Journals (Sweden)
Mohammad Fareed
2017-03-01
Full Text Available Aims: Role of life style related risk factors is very important in the pathogenesis and progression of Type 2 Diabetes Mellitus. The aim of this article is to review the disease burden of Type 2 diabetes mellitus (T2DM among the population of Saudi Arabia due to unhealthy life style. Methods: In this review, the information was collected from published literatures related to risk factors like unhealthy dietary pattern and sedentary life style leading to T2DM. Additionally, some epidemiological information for the prevalence of T2DM in Saudi Arabia was also collected. Results: Earlier studies have depicted that unhealthy life style and dietary patterns are risk factors involved in the development of insulin resistance in the body cells. In Saudi Arabia, rapid economic growth has provided a luxurious life style to the masses eventually leading to decrease in the physical activities and adoption of unhealthy dietary patterns. The increased prevalence of T2DM in Saudi Arabia is very much implicated to the life style related risk factors which needs to be improvise for the prevention of this disease. Conclusion: Since the increased prevalence of T2DM is associated with the sedentary life style and unhealthy dietary pattern, so it is recommended that creating awareness about the life style related risk factors for T2DM among general population and patients, will effectively contribute in lowering its incidence rate.
Directory of Open Access Journals (Sweden)
Mohammad Mohammadzadeh-Vardin
2015-06-01
Full Text Available Purpose: Recent developments in the field of cell therapy have led to a renewed interest in treatment of acute kidney injury (AKI. However, the early death of transplanted mesenchymal stem cells (MSCs in stressful microenvironment of a recipient tissue is a major problem with this kind of treatment. The objective of this study was to determine whether overexpression of a cytoprotective factor, nuclear factor erythroid-2 related factor 2 (Nrf2, in MSCs could protect rats against AKI. Methods: The Nrf2 was overexpressed in MSCs by recombinant adenoviruses, and the MSCs were implanted to rats suffering from cisplatin-induced AKI. Results: The obtained results showed that transplantation with the engineered MSCs ameliorates cisplatin-induced AKI. Morphologic features of the investigated kidneys showed that transplantation with the MSCs in which Nrf2 had been overexpressed significantly improved the complications of AKI. Conclusion: These findings suggested that the engineered MSCs might be a good candidate to be further evaluated in clinical trials. However, detailed studies must be performed to investigate the possible carcinogenic effect of Nrf2 overexpression.
Levels of 2,3-diphosphoglycerate in Friend leukaemic cells.
Yeoh, G C
1980-05-08
Most cells are thought to contain trace amounts of 2,3-diphosphoglycerate (DPG), as it acts as a cofactor in the interconversion of 2-phosphoglycerate and 3-phosphoglycerate by the glycolytic enzyme phosphoglyceromutase. DPG is synthesized from 1,3-diphosphoglycerate by the action of diphosphoglycerate mutase. Lowry et al. reported levels of 29 mumol DPG per kg wet weight brain tissue which is approximately 3 pmol per 10(8) cells, assuming that 1 g of brain tissue contains 10(9) cells. In contrast, erythroid cells contain 50-100 nmol DPG per 10(8) cells, depending on the species and the stage of development. This is of the order of a 1,000-fold more DPG compared with non-erythroid cells. In red cells DPG concentration modulates the binding of oxygen to haemoglobin. I show here that erythroid precurser cells also contain markedly raised levels of DPG.
An overview of the molecular mechanisms and novel roles of Nrf2 in neurodegenerative disorders.
Yang, Yang; Jiang, Shuai; Yan, Juanjuan; Li, Yue; Xin, Zhenlong; Lin, Yan; Qu, Yan
2015-02-01
Recently, growing evidence has demonstrated that nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal regulator of endogenous defense systems that function via the activation of a set of protective genes, and this is particularly clear in the central nervous system (CNS). Therefore, it is highly useful to summarize the current literature on the molecular mechanisms and role of Nrf2 in the CNS. In this review, we first briefly introduce the molecular features of Nrf2. We then discuss the regulation, cerebral actions, upstream modulators and downstream targets of Nrf2 pathway. Following this background, we expand our discussion to the role of Nrf2 in several major neurodegenerative disorders (NDDs) such as Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis and amyotrophic lateral sclerosis. Lastly, we discuss some potential future directions. The information reviewed here may be significant in the design of further experimental research and increase the potential of Nrf2 as a therapeutic target in the future. Copyright © 2014 Elsevier Ltd. All rights reserved.
Tepakhan, Wanicha; Yamsri, Supawadee; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan
2015-07-01
The basis for variability of hemoglobin (Hb) F in homozygous Hb E disease is not well understood. We have examined multiple mutations of the Krüppel-like factor 1 (KLF1) gene; an erythroid specific transcription factor and determined their associations with Hbs F and A2 expression in homozygous Hb E. Four KLF1 mutations including G176AfsX179, T334R, R238H, and -154 (C-T) were screened using specific PCR assays on 461 subjects with homozygous Hb E and 100 normal controls. None of these four mutations were observed in 100 normal controls. Among 461 subjects with homozygous Hb E, 306 had high (≥5 %) and 155 had low (<5 %) Hb F. DNA analysis identified the KLF1 mutations in 35 cases of the former group with high Hb F, including the G176AfsX179 mutation (17/306 = 5.6 %), T334R mutation (9/306 = 2.9 %), -154 (C-T) mutation (7/306 = 2.3 %), and R328H mutation (2/306 = 0.7 %). Only two subjects in the latter group with low Hb F carried the G176AfsX179 and -154 (C-T) mutations. Significant higher Hb A2 level was observed in those of homozygous Hb E with the G176AfsX179 mutation as compared to those without KLF1 mutations. These results indicate that KLF1 is among the genetic factors associated with increased Hbs F and A2, and in combination with other factors could explain the variabilities of these Hb expression in Hb E syndrome.
Mohammad Fareed; Nasir Salam; Abdullah T Khoja; Mahmoud Abdulrahman Mahmoud; Maqusood Ahamed
2017-01-01
Aims: Role of life style related risk factors is very important in the pathogenesis and progression of Type 2 Diabetes Mellitus. The aim of this article is to review the disease burden of Type 2 diabetes mellitus (T2DM) among the population of Saudi Arabia due to unhealthy life style. Methods: In this review, the information was collected from published literatures related to risk factors like unhealthy dietary pattern and sedentary life style leading to T2DM. Additionally, some e...
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
International Nuclear Information System (INIS)
Genrich, Geeske; Kruppa, Marcus; Lenk, Lennart; Helm, Ole; Broich, Anna; Freitag-Wolf, Sandra; Röcken, Christoph; Sipos, Bence; Schäfer, Heiner; Sebens, Susanne
2016-01-01
Nuclear factor E2 related factor-2 (Nrf2) is an oxidative stress inducible transcription factor being essential in regulating cell homeostasis. Thus, acute induction of Nrf2 in epithelial cells exposed to inflammation confers protection from oxidative cell damage and mutagenesis supporting an anti-tumorigenic role for Nrf2. However, pancreatic ductal adenocarcinoma (PDAC) is characterized by persistent Nrf2 activity conferring therapy resistance which points to a pro-tumorigenic role of Nrf2. A similar dichotomous role in tumorigenesis is described for the Transforming Growth Factor-beta 1 (TGF-β1). The present study therefore aimed at elucidating whether the switch of Nrf2 function towards a tumor promoting one relates to the modulation of TGF-β1 induced cell responses and whether this might occur early in PDAC development. In situ analysis comprised immunohistochemical stainings of activated (phosphorylated) Nrf2 and Ki67 in pancreatic tissues containing normal ducts and pancreatic intraepithelial neoplasia (PanINs). In vitro, Nrf2 levels in benign (H6c7-pBp), premalignant (H6c7-kras) and malignant (Colo357) pancreatic ductal epithelial cells were modulated by Nrf2 specific siRNA or Nrf2 overexpression. Then, the effect of Nrf2 alone and in combination with TGF-β1 on cell growth and survival was investigated by cell counting, Ki67 staining and apoptosis assays. The underlying cell signaling was investigated by western blotting. Statistical analysis was performed by Shapiro-Wilk test for normal distribution. Parametric data were analyzed by one-way ANOVA, while non-parametric data were analyzed by Kruskal-Wallis one-way ANOVA on ranks. Significantly elevated expression of activated Nrf2 and Ki67 could be detected in PanINs but not in normal pancreatic ductal epithelium. While the effect of Nrf2 on basal cell growth of H6c7-pBp, H6c7-kras and Colo357 cells was minor, it clearly attenuated the growth inhibiting effects of TGF-β1 in all cell lines. This enhanced
Kluitenberg, Bas; van der Worp, Henk; Huisstede, Bionka M A; Hartgens, Fred; Diercks, Ron; Verhagen, Evert; van Middelkoop, Marienke
2016-08-01
The incidence of running-related injuries is high. Some risk factors for injury were identified in novice runners, however, not much is known about the effect of training factors on injury risk. Therefore, the purpose of this study was to examine the associations between training factors and running-related injuries in novice runners, taking the time varying nature of these training-related factors into account. Prospective cohort study. 1696 participants completed weekly diaries on running exposure and injuries during a 6-week running program for novice runners. Total running volume (min), frequency and mean intensity (Rate of Perceived Exertion) were calculated for the seven days prior to each training session. The association of these time-varying variables with injury was determined in an extended Cox regression analysis. The results of the multivariable analysis showed that running with a higher intensity in the previous week was associated with a higher injury risk. Running frequency was not significantly associated with injury, however a trend towards running three times per week being more hazardous than two times could be observed. Finally, lower running volume was associated with a higher risk of sustaining an injury. These results suggest that running more than 60min at a lower intensity is least injurious. This finding is contrary to our expectations and is presumably the result of other factors. Therefore, the findings should not be used plainly as a guideline for novices. More research is needed to establish the person-specific training patterns that are associated with injury. Copyright © 2015 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.
2006-03-01
Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.
Jiang, Xu-Ping; Tang, Jing-Yuan; Xu, Zhen; Han, Peng; Qin, Zhi-Qiang; Yang, Cheng-di; Wang, Shang-Qian; Tang, Min; Wang, Wei; Qin, Chao; Xu, Yang; Shen, Bai-Xin; Zhou, Wei-Min; Zhang, Wei
2017-07-01
di-N-butylphthalate (DBP) is a ubiquitous environmental pollutant used for plastic coating and in the cosmetics industry. It has toxic effects on body health, especially the male reproductive system. Here, we investigated the effects of DBP on the male reproductive system of pubertal mice and explored the protective role of sulforaphane (SFN). The results showed that DBP significantly reduced the anogenital distance, testicular weight, sperm count and motility, and plasma and testicular testosterone levels and significantly increased the oxidative stress, sperm abnormalities, and testicular cell apoptosis. SFN supplementation ameliorated these effects. After DBP stimulation, the transcription factor nuclear factor erythroid-related factor 2 (Nrf2) was adaptively increased together with its target genes, such as HO-1 and NQO1. Upregulation of Nrf2 by SFN reduced the DBP-mediated intracellular oxidative toxicity and also increased testosterone secretion and spermatogenesis, which were decreased by DBP. These findings indicate that SFN can attenuate DBP-induced reproductive damage in pubertal mice via Nrf2-associated pathways. © 2017 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Ahn, Ji Yeon; Park, Sa Rah; Yun, Yeon Sook; Song, Jie Young [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2009-05-15
Lung cancer is the leading cause of cancer death in both men and women in the United States. Non-small cell lung cancer (NSCLC) accounts for more than 75% of all lung cancers and radiotherapy (RT) is the general treatment modality for these lung cancer patients. Nuclear factor erythroid-2. related factor 2 (Nrf2) is a redox-sensitive transcription factor that regulates the expression of genes encoding electrophiles and xenobiotic detoxification enzymes and efflux proteins, which confer cytoprotection against oxidative stress and xenobiotics in normal cells. Kelch-like ECH-associated protein (Keap1) sequesters Nrf2 and leads to proteasomal degradation of Nrf2 in non-stressed condition. Keap1 is often found with biallelic mutation in NSCLC cell lines and NSCLC patients, results in constitutive activation of Nrf2 function, and contributes to resistance of chemotherapy (CT) or RT (3, 4). We thus postulated that inhibition of Nrf2 in cancer cells could increase sensitivity to RT. Our primary results show that IM3829, a putative Nrf2 inhibitor, enhances the efficacy of RT and CT in H1299 lung cancer cell.
Sathibabu Uddandrao, V V; Brahmanaidu, Parim; Nivedha, P R; Vadivukkarasi, S; Saravanan, Ganapathy
2017-10-27
Diabetic cardiomyopathy, as one of the main cardiac complications in diabetic patients, is identified to connect with oxidative stress that is due to interruption in balance between reactive oxygen species or/and reactive nitrogen species generation and their clearance by antioxidant protection systems. Transcription factor the nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in maintaining the oxidative homeostasis by regulating multiple downstream antioxidants. The Nrf2 plays a significant role in ARE-mediated basal and inducible expression of more than 200 genes that can be grouped into numerous categories as well as antioxidant genes and phase II detoxifying enzymes. On the other hand, activation of Nrf2 by natural and synthetic therapeutics or antioxidants has been revealed effective for the prevention and treatment of toxicities and diseases connected with oxidative stress. Hence, recently focus has been shifted toward plants and plant-based medicines in curing such chronic diseases, as they are supposed to be less toxic. In this review, we focused on the role of some natural products on diabetic cardiomyopathy through Nrf2 pathway.
Marine Natural Product Honaucin A Attenuates Inflammation by Activating the Nrf2-ARE Pathway.
Mascuch, Samantha J; Boudreau, Paul D; Carland, Tristan M; Pierce, N Tessa; Olson, Joshua; Hensler, Mary E; Choi, Hyukjae; Campanale, Joseph; Hamdoun, Amro; Nizet, Victor; Gerwick, William H; Gaasterland, Teresa; Gerwick, Lena
2018-03-23
The cyanobacterial marine natural product honaucin A inhibits mammalian innate inflammation in vitro and in vivo. To decipher its mechanism of action, RNA sequencing was used to evaluate differences in gene expression of cultured macrophages following honaucin A treatment. This analysis led to the hypothesis that honaucin A exerts its anti-inflammatory activity through activation of the cytoprotective nuclear erythroid 2-related factor 2 (Nrf2)-antioxidant response element/electrophile response element (ARE/EpRE) signaling pathway. Activation of this pathway by honaucin A in cultured human MCF7 cells was confirmed using an Nrf2 luciferase reporter assay. In vitro alkylation experiments with the natural product and N-acetyl-l-cysteine suggest that honaucin A activates this pathway through covalent interaction with the sulfhydryl residues of the cytosolic repressor protein Keap1. Honaucin A presents a potential therapeutic lead for diseases with an inflammatory component modulated by Nrf2-ARE.
Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.
2016-01-01
The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
Piper betle Induced Cytoprotective Genes and Proteins via the Nrf2/ARE Pathway in Aging Mice.
Aliahmat, Nor Syahida; Abdul Sani, Nur Fathiah; Wan Hasan, Wan Nuraini; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum
2016-01-01
The objective of this study was to elucidate the underlying antioxidant mechanism of aqueous extract of Piper betle (PB) in aging rats. The nuclear factor erythroid 2-related factor 2 (Nrf2)/ARE pathway involving phase II detoxifying and antioxidant enzymes plays an important role in the antioxidant system by reducing electrophiles and reactive oxygen species through induction of phase II enzymes and proteins. Genes and proteins of phase II detoxifying antioxidant enzymes were analyzed by QuantiGenePlex 2.0 Assay and Western blot analysis. PB significantly induced genes and proteins of phase II and antioxidant enzymes, NAD(P)H quinone oxidoreductase 1, and catalase in aging mice (p < 0.05). The expression of these enzymes were stimulated via translocation of Nrf2 into the nucleus, indicating the involvement of ARE, a cis-acting motif located in the promoter region of nearly all phase II genes. PB was testified for the first time to induce cytoprotective genes through the Nrf2/ARE signaling pathway, thus unraveling the antioxidant mechanism of PB during the aging process. © 2016 S. Karger AG, Basel.
Best, Sarah A; De Souza, David P; Kersbergen, Ariena; Policheni, Antonia N; Dayalan, Saravanan; Tull, Dedreia; Rathi, Vivek; Gray, Daniel H; Ritchie, Matthew E; McConville, Malcolm J; Sutherland, Kate D
2018-04-03
The lung presents a highly oxidative environment, which is tolerated through engagement of tightly controlled stress response pathways. A critical stress response mediator is the transcription factor nuclear factor erythroid-2-related factor 2 (NFE2L2/NRF2), which is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1). Alterations in the KEAP1/NRF2 pathway have been identified in 23% of lung adenocarcinomas, suggesting that deregulation of the pathway is a major cancer driver. We demonstrate that inactivation of Keap1 and Pten in the mouse lung promotes adenocarcinoma formation. Notably, metabolites identified in the plasma of Keap1 f/f /Pten f/f tumor-bearing mice indicate that tumorigenesis is associated with reprogramming of the pentose phosphate pathway. Furthermore, the immune milieu was dramatically changed by Keap1 and Pten deletion, and tumor regression was achieved utilizing immune checkpoint inhibition. Thus, our study highlights the ability to exploit both metabolic and immune characteristics in the detection and treatment of lung tumors harboring KEAP1/NRF2 pathway alterations. Copyright © 2018 Elsevier Inc. All rights reserved.
Discerning the Mauve Factor, Part 1.
McGinnis, Woody R; Audhya, Tapan; Walsh, William J; Jackson, James A; McLaren-Howard, John; Lewis, Allen; Lauda, Peter H; Bibus, Douglas M; Jurnak, Frances; Lietha, Roman; Hoffer, Abram
2008-01-01
"Mauve Factor" was once mistaken for kryptopyrrole but is the hydroxylactam of hemopyrrole, hydroxyhemopyrrolin-2-one (HPL). Treatment with nutrients--particularly vitamin B6 and zinc--reduces urinary excretion of HPL and improves diverse neurobehavioral symptoms in subjects with elevated urinary HPL. Heightened HPL excretion classically associates with emotional stress, which in turn is known to associate with oxidative stress. For this review, markers for nutritional status and for oxidative stress were examined in relationship to urinary HPL. In cohorts with mixed diagnoses, 24-hour urinary HPL correlated negatively with vitamin B6 activity and zinc concentration in red cells (P stress. HPL is known to cause non-erythroid heme depression, which lowers zinc, increases nitric oxide, and increases oxidative stress. Administration of prednisone reportedly provoked HPL excretion in animals. Since adrenocorticoid (and catecholamine) stress hormones mediate intestinal permeability, urinary HPL examined in relationship to urinary indicans, presumptive marker for intestinal permeability. Urinary HPL associated with higher levels of indicans (P role in production. Potentially, gut is a reservoir for HPL or its precursor, and stress-related changes in intestinal permeability mediate systemic and urinary concentrations.
Translational control of Nrf2 within the open reading frame
International Nuclear Information System (INIS)
Perez-Leal, Oscar; Barrero, Carlos A.; Merali, Salim
2013-01-01
Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state
Directory of Open Access Journals (Sweden)
Shikha Prasad
2017-08-01
Full Text Available Cigarette smoking (CS is associated with vascular endothelial dysfunction in a causative way primarily related to the TS content of reactive oxygen species (ROS, nicotine, and inflammation. TS promotes glucose intolerance and increases the risk of developing type-2 diabetes mellitus (2DM with which it shares other pathogenic traits including the high risk of cerebrovascular and neurological disorders like stroke via ROS generation, inflammation, and blood-brain barrier (BBB impairment. Herein we provide evidence of the role played by nuclear factor erythroid 2-related factor (Nrf2 in CS-induced cerebrobvascular/BBB impairments and how these cerebrovascular harmful effects can be circumvented by the use of metformin (MF; a widely prescribed, firstline anti-diabetic drug treatment. Our data in fact revealed that MF activates counteractive mechanisms primarily associated with the Nrf2 pathway which drastically reduce CS toxicity at the cerebrovascular level. These include the suppression of tight junction (TJ protein downregulation and loss of BBB integrity induced by CS, reduction of inflammation and oxidative stress, renormalization of the expression levels of the major BBB glucose transporter Glut-1 and that of the anticoagulant factor thrombomodulin. Further, we provide additional insights on the controversial interplay between Nrf2 and AMPK. Keywords: Oxidative stress, Cigarette smoke, Metformin, Blood hemostasis, Blood brain barrier, Tight junctions, Nrf2, Glucose transporter
Directory of Open Access Journals (Sweden)
Christine A. Houghton
2016-01-01
Full Text Available The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2, comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements.
Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.
Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K
2011-10-01
Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Kirtan Nautiyal
2015-01-01
Full Text Available Refractoriness to growth factor therapy is commonly associated with inferior outcome in patients with low-risk myelodysplastic syndrome (LR-MDS who require treatment for cytopenias. However, the mechanisms leading to refractoriness are unknown. Here we describe a clinically depressed 74-year-old male with refractory cytopenia with multilineage dysplasia (RCMD and documented growth factor refractory anemia after erythropoeisis stimulating agent (ESA therapy, who attained transfusion and growth factor independence after the addition of sertraline to his medication regimen. Our case demonstrates hematological improvement-erythroid (HI-E in growth factor refractory, low risk MDS and highlights a potential mechanistic link between common inflammatory diseases and LR-MDS.
Esatbeyoglu, Tuba; Obermair, Betina; Dorn, Tabea; Siems, Karsten; Rimbach, Gerald; Birringer, Marc
2017-01-01
Taraxacum officinale, the common dandelion, is a plant of the Asteraceae family, which is used as a food and medical herb. Various secondary plant metabolites such as sesquiterpene lactones, triterpenoids, flavonoids, phenolic acids, coumarins, and steroids have been described to be present in T. officinale. Dandelion may exhibit various health benefits, including antioxidant, anti-inflammatory, and anticarcinogenic properties. We analyzed the leaves and roots of the common dandelion (T. officinale) using high-performance liquid chromatography/mass spectrometry to determine its sesquiterpene lactone composition. The main compound of the leaf extract taraxinic acid β-d-glucopyranosyl ester (1), a sesquiterpene lactone, was isolated and the structure elucidation was conducted by nuclear magnetic resonance spectrometry. The leaf extract and its main compound 1 activated the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) in human hepatocytes more significantly than the root extract. Furthermore, the leaf extract induced the Nrf2 target gene heme oxygenase 1. Overall, present data suggest that compound 1 may be one of the active principles of T. officinale.
Peripheral intravenous catheter-related phlebitis and related risk factors.
Nassaji-Zavareh, M; Ghorbani, R
2007-08-01
Peripheral intravenous catheter-related phlebitis is a common and significant problem in clinical practice. This study aims to investigate the incidence of phlebitis and to evaluate some important related factors. 300 patients admitted to medical and surgical wards of hospitals in Semnan, Iran from April 2003 to February 2004 were prospectively studied. Variables evaluated were age, gender, site and size of catheter, type of insertion and underlying conditions (diabetes mellitus, trauma, infectious disease and burns). Phlebitis was defined when at least four criteria were fulfilled (erythema, pain, tenderness, warmth, induration, palpable cord and swelling). Any patient who was discharged or their catheter removed before three days were excluded. Phlebitis occurred in 26 percent (95 percent confidence interval [CI] 21- 31 percent) of patients. There was no significant relationship between age, catheter bore size, trauma and phlebitis. Related risk factors were gender (odds-ratio [OR] 1.50, 95 percent CI 1.01-2.22), site (OR 3.25, 95 percent CI 2.26-4.67) and type of insertion (OR 2.04, 95 percent CI 1.36-3.05) of catheter, diabetes mellitus (OR 7.78, 95 percent CI 4.59-13.21), infectious disease (OR 6.21, 95 percent CI 4.27-9.03) and burns (OR 3.96, 95 percent CI 3.26-4.82). Phlebitis is still an important and ongoing problem in medical practice. In patients with diabetes mellitus and infectious diseases, more attention is needed.
DEFF Research Database (Denmark)
Andersen, Anette; Holstein, Bjørn E; Due, Pernille
2006-01-01
Purpose: To examine, separately for boys and girls, whether socio-economic differences in drunkenness exist in adolescence, whether the level of exposure to school-related risk factors differ between socio-economic groups, and whether the relative contribution of school-related risk factors......) was measured by parental occupation. RESULTS: Among girls, exposures to school-related risk factors were more prevalent in lower socio-economic groups. Poor school satisfaction was associated with drunkenness among girls from high SEP, odds ratio (OR) = 2.98 (0.73-12.16). Among boys from high SEP autonomy...
Directory of Open Access Journals (Sweden)
Jeffrey R Shearstone
Full Text Available Therapeutic intervention aimed at reactivation of fetal hemoglobin protein (HbF is a promising approach for ameliorating sickle cell disease (SCD and β-thalassemia. Previous studies showed genetic knockdown of histone deacetylase (HDAC 1 or 2 is sufficient to induce HbF. Here we show that ACY-957, a selective chemical inhibitor of HDAC1 and 2 (HDAC1/2, elicits a dose and time dependent induction of γ-globin mRNA (HBG and HbF in cultured primary cells derived from healthy individuals and sickle cell patients. Gene expression profiling of erythroid progenitors treated with ACY-957 identified global changes in gene expression that were significantly enriched in genes previously shown to be affected by HDAC1 or 2 knockdown. These genes included GATA2, which was induced greater than 3-fold. Lentiviral overexpression of GATA2 in primary erythroid progenitors increased HBG, and reduced adult β-globin mRNA (HBB. Furthermore, knockdown of GATA2 attenuated HBG induction by ACY-957. Chromatin immunoprecipitation and sequencing (ChIP-Seq of primary erythroid progenitors demonstrated that HDAC1 and 2 occupancy was highly correlated throughout the GATA2 locus and that HDAC1/2 inhibition led to elevated histone acetylation at well-known GATA2 autoregulatory regions. The GATA2 protein itself also showed increased binding at these regions in response to ACY-957 treatment. These data show that chemical inhibition of HDAC1/2 induces HBG and suggest that this effect is mediated, at least in part, by histone acetylation-induced activation of the GATA2 gene.
Talking about Relations : Factors Influencing the Production of Relational Descriptions
Baltaretu, Adriana-Alexandra; Krahmer, Emiel; van Wijk, Carel; Maes, Alfons
2016-01-01
In a production experiment (Experiment 1) and an acceptability rating one (Experiment 2), we assessed two factors, spatial position and salience, which may influence the production of relational descriptions (such as “the ball between the man and the drawer”). In Experiment 1, speakers were asked to
Zhou, Rui-Jun; Ye, Hua; Wang, Feng; Wang, Jun-Long; Xie, Mei-Lin
2017-11-04
Apigenin is a natural flavonoid compound widely distributed in a variety of vegetables, medicinal plants and health foods. This study aimed to examine the protective effect of apigenin against d-galactosamine (D-GalN)/lipopolysaccharide (LPS)-induced mouse liver injury and to investigate the potential biochemical mechanisms. The results showed that after oral administration of apigenin 100-200 mg/kg for 7 days, the levels of serum alanine aminotransferase and aspartate aminotransferase were decreased, and the severity of liver injury was alleviated. Importantly, apigenin pretreatment increased the levels of hepatic nuclear factor erythroid 2-related factor 2 (Nrf-2) and peroxisome proliferator-activated receptor γ (PPARγ) protein expressions as well as superoxide dismutase, catalase, glutathione S-transferase and glutathione reductase activities, decreased the levels of hepatic nuclear factor-κB (NF-κB) protein expression and tumor necrosis factor-α. These findings demonstrated that apigenin could prevent the D-GalN/LPS-induced liver injury in mice, and its mechanisms might be associated with the increments of Nrf-2-mediated antioxidative enzymes and modulation of PPARγ/NF-κB-mediated inflammation. Copyright © 2017 Elsevier Inc. All rights reserved.
Granado, Noelia; Lastres-Becker, Isabel; Ares-Santos, Sara; Oliva, Idaira; Martin, Eduardo; Cuadrado, Antonio; Moratalla, Rosario
2011-12-01
Oxidative stress that correlates with damage to nigrostriatal dopaminergic neurons and reactive gliosis in the basal ganglia is a hallmark of methamphetamine (METH) toxicity. In this study, we analyzed the protective role of the transcription factor Nrf2 (nuclear factor-erythroid 2-related factor 2), a master regulator of redox homeostasis, in METH-induced neurotoxicity. We found that Nrf2 deficiency exacerbated METH-induced damage to dopamine neurons, shown by an increase in loss of tyrosine hydroxylase (TH)- and dopamine transporter (DAT)-containing fibers in striatum. Consistent with these effects, Nrf2 deficiency potentiated glial activation, indicated by increased striatal expression of markers for microglia (Mac-1 and Iba-1) and astroglia (GFAP) one day after METH administration. At the same time, Nrf2 inactivation dramatically potentiated the increase in TNFα mRNA and IL-15 protein expression in GFAP+ cells in the striatum. In sharp contrast to the potentiation of striatal damage, Nrf2 deficiency did not affect METH-induced dopaminergic neuron death or expression of glial markers or proinflammatory molecules in the substantia nigra. This study uncovers a new role for Nrf2 in protection against METH-induced inflammatory and oxidative stress and striatal degeneration. Copyright © 2011 Wiley‐Liss, Inc.
Sandireddy, Reddemma; Yerra, Veera Ganesh; Komirishetti, Prashanth; Areti, Aparna; Kumar, Ashutosh
2016-08-01
The current study is aimed to assess the therapeutic potential of fisetin, a phytoflavonoid in streptozotocin (STZ)-induced experimental diabetic neuropathy (DN) in rats. Fisetin was administered (5 and 10 mg/kg) for 2 weeks (7th and 8th week) post STZ administration. Thermal and mechanical hyperalgesia were assessed by measuring tactile sensitivity to thermal and mechanical stimuli, respectively. Motor nerve conduction velocity (MNCV) was determined using power lab system and sciatic nerve blood flow (NBF) was determined using laser Doppler system. Nerve sections were processed for TUNEL assay and NF-κB, COX-2 immunohistochemical staining. Sciatic nerve homogenate was used for biochemical and Western blotting analysis. MNCV and sciatic NBF deficits associated with DN were ameliorated in fisetin administered rats. Fisetin treatment reduced the interleukin-6 and tumour necrosis factor-alpha in sciatic nerves of diabetic rats (p < 0.001). Protein expression studies have identified that the therapeutic benefit of fisetin might be through regulation of redox sensitive transcription factors such as nuclear erythroid 2-related factor 2 (Nrf2) and nuclear factor kappa B (NF-κB). Our study provides an evidence for the therapeutic potential of fisetin in DN through simultaneous targeting of NF-κB and Nrf2.
Liao, Hsiang; Chou, Liang-Mao; Chien, Yi-Wen; Wu, Chi-Hao; Chang, Jung-Su; Lin, Ching-I; Lin, Shyh-Hsiang
2017-05-01
Abnormal glucose metabolism in the brain is recognized to be associated with cognitive decline. Because grapes are rich in polyphenols that produce antioxidative and blood sugar-lowering effects, we investigated how grape consumption affects the expression and/or phosphorylation of neurodegeneration-related brain proteins in aged rats fed a high-fructose-high-fat (HFHF) diet. Wistar rats were maintained on the HFHF diet from the age of 8 weeks to 66 weeks, and then on an HFHF diet containing either 3% or 6% grape powder as an intervention for 12 weeks. Western blotting was performed to measure the expression/phosphorylation levels of several cortical and hippocampal proteins, including amyloid precursor protein (APP), tau, phosphatidylinositol-3-kinase (PI3K), extracellular signal-regulated kinase (ERK), receptor for advanced glycation end products (RAGEs), erythroid 2-related factor 2 (Nrf2) and brain-derived neurotrophic factor (BDNF). Inclusion of up to 6% grape powder in the diet markedly reduced RAGE expression and tau hyperphosphorylation, but upregulated the expression of Nrf2 and BDNF, as well as the phosphorylation of PI3K and ERK, in the brain tissues of aged rats fed the HFHF diet. Thus, grape powder consumption produced beneficial effects in HFHF-diet-fed rats, exhibiting the potential to ameliorate changes in neurodegeneration-related proteins in the brain. Copyright © 2017 Elsevier Inc. All rights reserved.
Ren, Xiang; Sun, Hong; Zhang, Chenghong; Li, Chen; Wang, Jinlei; Shen, Jie; Yu, Dong; Kong, Li
2016-07-01
The present study aimed to investigate the mechanisms that mediate the protective effects of pyridoxamine (PM) on light‑damaged retinal photoreceptor cells in diabetic mice. A high‑fat diet and streptozotocin were used to induce a mouse model of type II diabetes. During the experiment, mice were divided the mice into three types of group, as follows: Control groups (negative control and light‑damaged groups); experimental groups (diabetic and diabetic light‑damaged groups); and treatment groups (25, 50 and 100 mg/kg PM‑treated groups). Using hematoxylin‑eosin staining, the number of nuclear layer cells were counted. Western blotting and immunohistochemistry were performed to measure the levels of thioredoxin (Trx), phospho‑extracellular signal‑regulated kinase 1/2 (p‑Erk1/2), nuclear factor erythroid 2‑related factor 2 (Nrf2) and apoptosis signal‑regulating kinase 1 (ASK1). The photoreceptor cell count in the outer nuclear layer of the light‑damaged, diabetic control and diabetic light‑damaged groups were significantly reduced compared with the negative control group (PTrx, p‑Erk1/2 and Nrf2 expression levels (PTrx, p‑Erk1/2 and Nrf2 expression levels were significantly increased (PTrx, p‑Erk1/2 and Nrf2 expression, and the downregulation of ASK1 expression.
The Role of Nrf2-Mediated Pathway in Cardiac Remodeling and Heart Failure
Directory of Open Access Journals (Sweden)
Shanshan Zhou
2014-01-01
Full Text Available Heart failure (HF is frequently the consequence of sustained, abnormal neurohormonal, and mechanical stress and remains a leading cause of death worldwide. The key pathophysiological process leading to HF is cardiac remodeling, a term referring to maladaptation to cardiac stress at the molecular, cellular, tissue, and organ levels. HF and many of the conditions that predispose one to HF are associated with oxidative stress. Increased generation of reactive oxygen species (ROS in the heart can directly lead to increased necrosis and apoptosis of cardiomyocytes which subsequently induce cardiac remodeling and dysfunction. Nuclear factor-erythroid-2- (NF-E2- related factor 2 (Nrf2 is a transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes that are ubiquitously expressed in the cardiovascular system. Emerging evidence has revealed that Nrf2 and its target genes are critical regulators of cardiovascular homeostasis via the suppression of oxidative stress, which is the key player in the development and progression of HF. The purpose of this review is to summarize evidence that activation of Nrf2 enhances endogenous antioxidant defenses and counteracts oxidative stress-associated cardiac remodeling and HF.
Fisetin alleviates oxidative stress after traumatic brain injury via the Nrf2-ARE pathway.
Zhang, Li; Wang, Handong; Zhou, Yali; Zhu, Yihao; Fei, Maoxin
2018-05-22
Fisetin, a natural flavonoid, has neuroprotection properties in many brain injury models. However, its role in traumatic brain injury (TBI) has not been fully explained. In the present study, we aimed to explore the neuroprotective effects of fisetin in a mouse model of TBI. We found that fisetin improved neurological function, reduced cerebral edema, attenuated brain lesion and ameliorated blood-brain barrier (BBB) disruption after TBI. Moreover, the up-regulation of malondialdehyde (MDA) and the activity of glutathione peroxidase (GPx) were reversed by fisetin treatment. Furthermore, administration of fisetin suppressed neuron cell death and apoptosis, increased the expression of B-cell lymphoma 2 (Bcl-2), while decreased the expression of Bcl-2-associated X protein (Bax) and caspase-3 after TBI. In addition, fisetin activated the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway following TBI. However, fisetin only failed to suppress oxidative stress in Nrf2 -/- mice. In conclusion, our data provided the first evidence that fisetin played a critical role in neuroprotection after TBI partly through the activation of the Nrf2-ARE pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Bee Kee Ooi
2017-11-01
Full Text Available Oxidative stress is an important risk factor contributing to the pathogenesis of cardiovascular diseases. Oxidative stress that results from excessive reactive oxygen species (ROS production accounts for impaired endothelial function, a process which promotes atherosclerotic lesion or fatty streaks formation (foam cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a transcription factor involved in cellular redox homeostasis. Upon exposure to oxidative stress, Nrf2 is dissociated from its inhibitor Keap-1 and translocated into the nucleus, where it results in the transcriptional activation of cell defense genes. Nrf2 has been demonstrated to be involved in the protection against foam cells formation by regulating the expression of antioxidant proteins (HO-1, Prxs, and GPx1, ATP-binding cassette (ABC efflux transporters (ABCA1 and ABCG1 and scavenger receptors (scavenger receptor class B (CD36, scavenger receptor class A (SR-A and lectin-type oxidized LDL receptor (LOX-1. However, Nrf2 has also been reported to exhibit pro-atherogenic effects. A better understanding on the mechanism of Nrf2 in oxidative stress-induced cardiac injury, as well as the regulation of cholesterol uptake and efflux, are required before it can serve as a novel therapeutic target for cardiovascular diseases prevention and treatment.
Directory of Open Access Journals (Sweden)
Yasuhiko Izumi
2015-11-01
Full Text Available Oxidative stress and the ubiquitin–proteasome system play a key role in the pathogenesis of Parkinson disease. Although the herbicide paraquat is an environmental factor that is involved in the etiology of Parkinson disease, the role of 26S proteasome in paraquat toxicity remains to be determined. Using PC12 cells overexpressing a fluorescent protein fused to the proteasome degradation signal, we report here that paraquat yielded an inhibitory effect on 26S proteasome activity without an obvious decline in 20S proteasome activity. Relative low concentrations of proteasome inhibitors caused the accumulation of nuclear factor erythroid 2-related factor 2 (Nrf2, which is targeted to the ubiquitin–proteasome system, and activated the antioxidant response element (ARE-dependent transcription. Paraquat also upregulated the protein level of Nrf2 without increased expression of Nrf2 mRNA, and activated the Nrf2–ARE pathway. Consequently, paraquat induced expression of Nrf2-dependent ARE-driven genes, such as γ-glutamylcysteine synthetase, catalase, and hemeoxygenase-1. Knockdown of Nrf2 or inhibition of γ-glutamylcysteine synthetase and catalase exacerbated paraquat-induced toxicity, whereas suppression of hemeoxygenase-1 did not. These data indicate that the compensatory activation of the Nrf2–ARE pathway via inhibition of 26S proteasome serves as part of a cellular defense mechanism to protect against paraquat toxicity.
Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka
2015-10-01
Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.
Directory of Open Access Journals (Sweden)
Shu-Hua Yang
2016-10-01
Full Text Available Sulforaphane (SFN is a natural and highly effective antioxidant. Studies suggest that SFN protects cells and tissues against cadmium (Cd toxicity. This study investigated the protective effect of SFN against oxidative damage in the testes of Kunming mice exposed to cadmium, and explored the possible molecular mechanisms involved. Cadmium greatly reduced the serum testosterone levels in mice, reduced sperm motility, total sperm count, and increased the sperm deformity rate. Cadmium also reduces superoxide dismutase (T-SOD and glutathione (GSH levels and increases malondialdehyde (MDA concentrations. SFN intervention improved sperm quality, serum testosterone, and antioxidant levels. Both mRNA and protein expression of mouse testicular nuclear factor-erythroid 2-related factor 2 (Nrf2 was reduced in cadmium-treated group. Furthermore, the downstream genes of Nrf2, glutathione peroxidase (GSH-Px, γ-glutamyl cysteine synthetase (γ-GCS, heme oxygenase-1 (HO-1, and NAD(PH:quinone oxidoreductase-1 (NQO1 were also decreased in cadmium-treated group. SFN intervention increases the expression of these genes. Sulforaphane prevents cadmium-induced testicular damage, probably via activation of Nrf2/ARE signaling.
Relation between depression and sociodemographic factors
Directory of Open Access Journals (Sweden)
Akhtar-Danesh Noori
2007-09-01
Full Text Available Abstract Background Depression is one of the most common mental disorders in Western countries and is related to increased morbidity and mortality from medical conditions and decreased quality of life. The sociodemographic factors of age, gender, marital status, education, immigrant status, and income have consistently been identified as important factors in explaining the variability in depression prevalence rates. This study evaluates the relationship between depression and these sociodemographic factors in the province of Ontario in Canada using the Canadian Community Health Survey, Cycle 1.2 (CCHS-1.2 dataset. Methods The CCHS-1.2 survey classified depression into lifetime depression and 12-month depression. The data were collected based on unequal sampling probabilities to ensure adequate representation of young persons (15 to 24 and seniors (65 and over. The sampling weights were used to estimate the prevalence of depression in each subgroup of the population. The multiple logistic regression technique was used to estimate the odds ratio of depression for each sociodemographic factor. Results The odds ratio of depression for men compared with women is about 0.60. The lowest and highest rates of depression are seen among people living with their married partners and divorced individuals, respectively. Prevalence of depression among people who live with common-law partners is similar to rates of depression among separated and divorced individuals. The lowest and highest rates of depression based on the level of education is seen among individuals with less than secondary school and those with "other post-secondary" education, respectively. Prevalence of 12-month and lifetime depression among individuals who were born in Canada is higher compared to Canadian residents who immigrated to Canada irrespective of gender. There is an inverse relation between income and the prevalence of depression (p Conclusion The patterns uncovered in this
Kornblau, Steven M; Cohen, Aileen C; Soper, David; Huang, Ying-Wen; Cesano, Alessandra
2014-11-01
Single Cell Network Profiling (SCNP) is a multiparametric flow cytometry-based assay that quantifiably and simultaneously measures changes in intracellular signaling proteins in response to in vitro extracellular modulators at the single cell level. Myelodysplastic syndrome (MDS) is a heterogeneous clonal disorder of hematopoietic stem cells that occurs in elderly subjects and is characterized by dysplasia and ineffective hematopoiesis. The functional responsiveness of MDS bone marrow (BM) hematopoietic cells, including functionally distinct myeloid and erythroid precursor subsets, to hematopoietic growth factors (HGF) and the relationship of modulated signaling to disease characteristics is poorly understood. SCNP was used first to examine the effects of age on erythropoietin (EPO) and granulocyte colony stimulating factor (GCSF)-induced signaling in myeloid, nucleated red blood cells (nRBC), and CD34 expressing cell subsets in healthy BM (n = 15). SCNP was then used to map functional signaling profiles in low risk (LR) MDS (n = 7) for comparison to signaling in samples from healthy donors and to probe signaling associations within clinically defined subgroups. In healthy BM samples, signaling responses to HGF were quite homogeneous (i.e., tightly regulated) with age-dependent effects observed in response to EPO but not to GCSF. Despite the relatively small number of samples assayed in the study, LR MDS could be classified into distinct subgroups based on both cell subset frequency and signaling profiles. As a correlate of underlying genetic abnormalities, signal transduction analyses may provide a functional and potentially clinically relevant classification of MDS. Further evaluation in a larger cohort is warranted. © 2013 Clinical Cytometry Society.
New large-Nc relations for the electromagnetic nucleon-to-Δ form factors
International Nuclear Information System (INIS)
Vladimir Pascalutsa; Marc Vanderhaeghen
2006-01-01
We establish relations which express the three N → Δ transition form factors in terms of the nucleon form factors. These relations are based on the known large-N c relation between the N → Δ electric quadrupole moment and the neutron charge radius, and a newly derived large-N c relation between the electric quadrupole (E2) and Coulomb quadrupole (C2) transitions. Namely, in the large-N c limit we find C2=E2. We show that these relations provide predictions for the N → Δ electromagnetic form factors which are found to be in very good agreement with experiment for moderate momentum transfers. They also provide constraints for the N → Δ GPDs
Directory of Open Access Journals (Sweden)
Jong Hun Lee
2013-01-01
Full Text Available Excessive oxidative stress induced by reactive oxygen species (ROS, reactive nitrogen species (RNS, and reactive metabolites of carcinogens alters cellular homeostasis, leading to genetic/epigenetic changes, genomic instability, neoplastic transformation, and cancer initiation/progression. As a protective mechanism against oxidative stress, antioxidant/detoxifying enzymes reduce these reactive species and protect normal cells from endo-/exogenous oxidative damage. The transcription factor nuclear factor-erythroid 2 p45 (NF-E2-related factor 2 (Nrf2, a master regulator of the antioxidative stress response, plays a critical role in the expression of many cytoprotective enzymes, including NAD(PH:quinine oxidoreductase (NQO1, heme oxygenase-1 (HO-1, UDP-glucuronosyltransferase (UGT, and glutathione S-transferase (GST. Recent studies demonstrated that many dietary phytochemicals derived from various vegetables, fruits, spices, and herbal medicines induce Nrf2-mediated antioxidant/detoxifying enzymes, restore aberrant epigenetic alterations, and eliminate cancer stem cells (CSCs. The Nrf2-mediated antioxidant response prevents many age-related diseases, including cancer. Owing to their fundamental contribution to carcinogenesis, epigenetic modifications and CSCs are novel targets of dietary phytochemicals and traditional Chinese herbal medicine (TCHM. In this review, we summarize cancer chemoprevention by dietary phytochemicals, including TCHM, which have great potential as a safer and more effective strategy for preventing cancer.
Directory of Open Access Journals (Sweden)
Tiange Li
2017-01-01
Full Text Available Oxidative stress is considered as an important mediator in the progression of metabolic disorders. The objective of this study was to investigate the potential hepatoprotective effects and mechanisms of bovine casein glycomacropeptide hydrolysates (GHP on hydrogen peroxide (H2O2-induced oxidative damage in HepG2 cells. Results showed that GHP significantly blocked H2O2-induced intracellular reactive oxygen species (ROS generation and cell viability reduction in a dose-dependent manner. Further, GHP concentration-dependently induced heme oxygenase-1 (HO-1 expression and increased nuclear factor-erythroid 2-related factor 2 (Nrf2 nuclear translocation. Moreover, pretreatment of GHP increased the activation of p38 mitogen-activated protein kinase (p38 MAPK and extracellular signal-regulated protein kinase 1/2 (ERK1/2, which were shown to contribute to Nrf2-mediated HO-1 expression. Taken together, GHP protected HepG2 cells from oxidative stress by activation of Nrf2 and HO-1 via p38 MAPK and ERK1/2 signaling pathways. Our findings indicate that bovine casein glycomacropeptide hydrolysates might be a potential ingredient in the treatment of oxidative stress-related disorders and further studies are needed to investigate the protective effects in vivo.
Maurer, B; Busch, N; Jüngel, A; Pileckyte, M; Gay, R E; Michel, B A; Schett, G; Gay, S; Distler, J; Distler, O
2009-01-01
BACKGROUND: -Microvascular damage is one of the first pathological changes in systemic sclerosis. In this study, we investigated the role of Fos-related antigen-2 (Fra-2), a transcription factor of the activator protein-1 family, in the peripheral vasculopathy of systemic sclerosis and examined the underlying mechanisms. Methods and Results-Expression of Fra-2 protein was significantly increased in skin biopsies of systemic sclerosis patients compared with healthy controls, especially in endo...
Kenyhercz, Flóra; Nagy, Beáta
2017-01-01
The development of children born prematurely is an important aspect in public health, because preterm birth rates are not decreasing with the development of medical sciences. Description of psychomotor development of preterm children related to potentially influencing environmental factors. Children born below 2.500 grams at the age of two (n = 75). Psychomotor development, quality of home environment, socio-demographic background were measured. Lower birth weight was associated with lower development quotients. Psychomotor development was also negatively affected by child deprivation, low levels of cognitive stimulation and maternal empathy, regardless of birth weight. Increased performance loss was found related to lower sociodemographic variables, such as low maternal education or ethnicity. Psychomotor development of 2-year-old premature children is affected by the examined social-environmental factors. We recommend the screening and developmental interventions for premature children as early as possible, thus preventing difficulties in mental and motor development in the future. Orv. Hetil., 2017, 158(1), 31-38.
Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension.
Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei
2016-11-21
Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.
Directory of Open Access Journals (Sweden)
Qiong-Hui Huang
2017-01-01
Full Text Available Excessive alcohol consumption leads to serious liver injury, associating with oxidative stress and inflammatory response. Previous study has demonstrated that polydatin (PD exerted antioxidant and anti-inflammatory effects and attenuated ethanol-induced liver damage, but the research remained insufficient. Hence, this experiment aimed to evaluate the hepatoprotective effect and potential mechanisms of PD on ethanol-induced hepatotoxicity. Our results showed that PD pretreatment dramatically decreased the levels of alanine aminotransferase (ALT, aspartate aminotransferase (AST, alkaline phosphatase (ALP, and lactate dehydrogenase (LDH in the serum, suppressed the malonaldehyde (MDA and triglyceride (TG content and the production of reactive oxygen species (ROS, and enhanced the activities of superoxide dismutase (SOD, glutathione peroxidase (GSH-Px, catalase (CAT, andalcohol dehydrogenase (ADH, and aldehyde dehydrogenase (ALDH, paralleled by an improvement of histopathology alterations. The protective effect of PD against oxidative stress was probably associated with downregulation of cytochrome P450 2E1 (CYP2E1 and upregulation of nuclear factor erythroid 2-related factor 2 (Nrf2 and its target gene haem oxygenase-1 (HO-1. Moreover, PD inhibited the release of proinflammatory cytokines (TNF-α, IL-1β, and IL-6 via downregulating toll-like receptor 4 (TLR4 and nuclear factor kappa B (NF-κB p65. To conclude, PD pretreatment protects against ethanol-induced liver injury via suppressing oxidative stress and inflammation.
Ziros, Panos G; Habeos, Ioannis G; Chartoumpekis, Dionysios V; Ntalampyra, Eleni; Somm, Emmanuel; Renaud, Cédric O; Bongiovanni, Massimo; Trougakos, Ioannis P; Yamamoto, Masayuki; Kensler, Thomas W; Santisteban, Pilar; Carrasco, Nancy; Ris-Stalpers, Carrie; Amendola, Elena; Liao, Xiao-Hui; Rossich, Luciano; Thomasz, Lisa; Juvenal, Guillermo J; Refetoff, Samuel; Sykiotis, Gerasimos P
2018-06-01
The thyroid gland has a special relationship with oxidative stress. While generation of oxidative substances is part of normal iodide metabolism during thyroid hormone synthesis, the gland must also defend itself against excessive oxidation in order to maintain normal function. Antioxidant and detoxification enzymes aid thyroid cells to maintain homeostasis by ameliorating oxidative insults, including during exposure to excess iodide, but the factors that coordinate their expression with the cellular redox status are not known. The antioxidant response system comprising the ubiquitously expressed NFE2-related transcription factor 2 (Nrf2) and its redox-sensitive cytoplasmic inhibitor Kelch-like ECH-associated protein 1 (Keap1) defends tissues against oxidative stress, thereby protecting against pathologies that relate to DNA, protein, and/or lipid oxidative damage. Thus, it was hypothesized that Nrf2 should also have important roles in maintaining thyroid homeostasis. Ubiquitous and thyroid-specific male C57BL6J Nrf2 knockout (Nrf2-KO) mice were studied. Plasma and thyroids were harvested for evaluation of thyroid function tests by radioimmunoassays and of gene and protein expression by real-time polymerase chain reaction and immunoblotting, respectively. Nrf2-KO and Keap1-KO clones of the PCCL3 rat thyroid follicular cell line were generated using CRISPR/Cas9 technology and were used for gene and protein expression studies. Software-predicted Nrf2 binding sites on the thyroglobulin enhancer were validated by site-directed in vitro mutagenesis and chromatin immunoprecipitation. The study shows that Nrf2 mediates antioxidant transcriptional responses in thyroid cells and protects the thyroid from oxidation induced by iodide overload. Surprisingly, it was also found that Nrf2 has a dramatic impact on both the basal abundance and the thyrotropin-inducible intrathyroidal abundance of thyroglobulin (Tg), the precursor protein of thyroid hormones. This effect is mediated
Lee, Seung Eun; Yang, Hana; Son, Gun Woo; Park, Hye Rim; Park, Cheung-Seog; Jin, Young-Ho; Park, Yong Seek
2015-06-26
The pathophysiology of cardiovascular diseases is complex and may involve oxidative stress-related pathways. Eriodictyol is a flavonoid present in citrus fruits that demonstrates anti-inflammatory, anti-cancer, neurotrophic, and antioxidant effects in a range of pathophysiological conditions including vascular diseases. Because oxidative stress plays a key role in the pathogenesis of cardiovascular disease, the present study was designed to verify whether eriodictyol has therapeutic potential. Upregulation of heme oxygenase-1 (HO-1), a phase II detoxifying enzyme, in endothelial cells is considered to be helpful in cardiovascular disease. In this study, human umbilical vein endothelial cells (HUVECs) treated with eriodictyol showed the upregulation of HO-1 through extracellular-regulated kinase (ERK)/nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathways. Further, eriodictyol treatment provided protection against hydrogen peroxide-provoked cell death. This protective effect was eliminated by treatment with a specific inhibitor of HO-1 and RNA interference-mediated knockdown of HO-1 expression. These data demonstrate that eriodictyol induces ERK/Nrf2/ARE-mediated HO-1 upregulation in human endothelial cells, which is directly associated with its vascular protection against oxidative stress-related endothelial injury, and propose that targeting the upregulation of HO-1 is a promising approach for therapeutic intervention in cardiovascular disease.
Nrf2 protects against airway disorders
International Nuclear Information System (INIS)
Cho, Hye-Youn; Kleeberger, Steven R.
2010-01-01
Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.
Single-Cell Network Analysis Identifies DDIT3 as a Nodal Lineage Regulator in Hematopoiesis
Directory of Open Access Journals (Sweden)
Cristina Pina
2015-06-01
Full Text Available We explore cell heterogeneity during spontaneous and transcription-factor-driven commitment for network inference in hematopoiesis. Since individual genes display discrete OFF states or a distribution of ON levels, we compute and combine pairwise gene associations from binary and continuous components of gene expression in single cells. Ddit3 emerges as a regulatory node with positive linkage to erythroid regulators and negative association with myeloid determinants. Ddit3 loss impairs erythroid colony output from multipotent cells, while forcing Ddit3 in granulo-monocytic progenitors (GMPs enhances self-renewal and impedes differentiation. Network analysis of Ddit3-transduced GMPs reveals uncoupling of myeloid networks and strengthening of erythroid linkages. RNA sequencing suggests that Ddit3 acts through development or stabilization of a precursor upstream of GMPs with inherent Meg-E potential. The enrichment of Gata2 target genes in Ddit3-dependent transcriptional responses suggests that Ddit3 functions in an erythroid transcriptional network nucleated by Gata2.
Survey and evaluation of mutations in the human KLF1 transcription unit.
Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J
2018-04-26
Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.
Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A
2012-06-01
Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Chiou, Shyh-Shin, E-mail: chiouss@kmu.edu.tw [Division of Hematology-Oncology, Department of Pediatrics, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Department of Pediatrics, Faculty of Medicine, School of Medicine, Kaohsiung Medical University, 807 Kaohsiung 807, Taiwan (China); Wang, Sophie Sheng-Wen; Wu, Deng-Chyang [Department of Gastroenterology, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Lin, Ying-Chu [School of Dentistry, College of Dentistry, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Kao, Li-Pin [Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, 807 Kaohsiung 807, Taiwan (China)
2013-07-26
We report here that the Jun dimerization protein 2 (JDP2) plays a critical role as a cofactor for the transcription factors nuclear factor-erythroid 2-related factor 2 (Nrf2) and MafK in the regulation of the antioxidants and production of reactive oxygen species (ROS). JDP2 associates with Nrf2 and MafK (Nrf2-MafK) to increase the transcription of antioxidant response element-dependent genes. Oxidative-stress-inducing reagent led to an increase in the intracellular accumulation of ROS and cell proliferation in Jdp2 knock-out mouse embryonic fibroblasts. In Jdp2-Cre mice mated with reporter mice, the expression of JDP2 was restricted to granule cells in the brain cerebellum. The induced pluripotent stem cells (iPSC)-like cells were generated from DAOY medulloblastoma cell by introduction of JDP2, and the defined factor OCT4. iPSC-like cells expressed stem cell-like characteristics including alkaline phosphatase activity and some stem cell markers. However, such iPSC-like cells also proliferated rapidly, became neoplastic, and potentiated cell malignancy at a later stage in SCID mice. This study suggests that medulloblastoma cells can be reprogrammed successfully by JDP2 and OCT4 to become iPSC-like cells. These cells will be helpful for studying the generation of cancer stem cells and ROS homeostasis.
Directory of Open Access Journals (Sweden)
Naoto Yamaguchi
2013-07-01
Full Text Available We report here that the Jun dimerization protein 2 (JDP2 plays a critical role as a cofactor for the transcription factors nuclear factor-erythroid 2-related factor 2 (Nrf2 and MafK in the regulation of the antioxidants and production of reactive oxygen species (ROS. JDP2 associates with Nrf2 and MafK (Nrf2-MafK to increase the transcription of antioxidant response element-dependent genes. Oxidative-stress-inducing reagent led to an increase in the intracellular accumulation of ROS and cell proliferation in Jdp2 knock-out mouse embryonic fibroblasts. In Jdp2-Cre mice mated with reporter mice, the expression of JDP2 was restricted to granule cells in the brain cerebellum. The induced pluripotent stem cells (iPSC-like cells were generated from DAOY medulloblastoma cell by introduction of JDP2, and the defined factor OCT4. iPSC-like cells expressed stem cell-like characteristics including alkaline phosphatase activity and some stem cell markers. However, such iPSC-like cells also proliferated rapidly, became neoplastic, and potentiated cell malignancy at a later stage in SCID mice. This study suggests that medulloblastoma cells can be reprogrammed successfully by JDP2 and OCT4 to become iPSC-like cells. These cells will be helpful for studying the generation of cancer stem cells and ROS homeostasis.
De Franceschi, Lucia; Bertoldi, Mariarita; De Falco, Luigia; Santos Franco, Sara; Ronzoni, Luisa; Turrini, Franco; Colancecco, Alessandra; Camaschella, Clara; Cappellini, Maria Domenica; Iolascon, Achille
2011-11-01
β-thalassemic syndromes are inherited red cell disorders characterized by severe ineffective erythropoiesis and increased levels of reactive oxygen species whose contribution to β-thalassemic anemia is only partially understood. We studied erythroid precursors from normal and β-thalassemic peripheral CD34(+) cells in two-phase liquid culture by proteomic, reverse transcriptase polymerase chain reaction and immunoblot analyses. We measured intracellular reactive oxygen species, heme levels and the activity of δ-aminolevulinate-synthase-2. We exposed normal cells and K562 cells with silenced peroxiredoxin-2 to H(2)O(2) and generated a recombinant peroxiredoxin-2 for kinetic measurements in the presence of H(2)O(2) or hemin. In β-thalassemia the increased production of reactive oxygen species was associated with down-regulation of heme oxygenase-1 and biliverdin reductase and up-regulation of peroxiredoxin-2. In agreement with these observations in β-thalassemic cells we found decreased heme levels related to significantly reduced activity of the first enzyme of the heme pathway, δ-aminolevulinate synthase-2 without differences in its expression. We demonstrated that the activity of recombinant δ-aminolevulinate synthase-2 is inhibited by both reactive oxygen species and hemin as a protective mechanism in β-thalassemic cells. We then addressed the question of the protective role of peroxiredoxin-2 in erythropoiesis by exposing normal cells to oxidative stress and silencing peroxiredoxin-2 in human erythroleukemia K562 cells. We found that peroxiredoxin-2 expression is up-regulated in response to oxidative stress and required for K562 cells to survive oxidative stress. We then showed that peroxiredoxin-2 binds heme in erythroid precursors with high affinity, suggesting a possible multifunctional cytoprotective role of peroxiredoxin-2 in β-thalassemia. In β-thalassemic erythroid cells the reduction of δ-aminolevulinate synthase-2 activity and the increased
Factors related to falls among community dwelling elderly.
Kuhirunyaratn, Piyathida; Prasomrak, Prasert; Jindawong, Bangonsri
2013-09-01
Falls among the elderly can lead to disability, hospitalization and premature death. This study aimed to determine the factors related to falls among community dwelling elderly. This case-control study was conducted at the Samlium Primary Care Unit (SPCU), Khon Kaen, Thailand. Cases were elderly individuals who had fallen within the previous six months and controls were elderly who had not fallen during that same time period. Subjects were taken from elderly persons registered at the SPCU. The sample size was calculated to be 111 cases and 222 controls. Face to face interviews were conducted with subjects between May and June, 2011. The response rate was 100%. On bivariate analysis, the statistically significant factors related to falls were: regular medication use, co-morbidities, mobility, depression, cluttered rooms, slippery floors, unsupported toilets (without a hand rail), sufficient exercise, rapid posture change and wearing slippers. When controlling for others significant factors, multiple logistic regression revealed significant factors were: regular medication use (AOR: 2.22; 95%CI: 1.19 - 4.12), depression (AOR: 1.76, 95% CI: 1.03 - 2.99), sufficient exercise (AOR: 0.34; 95% CI: 0.19 - 0.58) and wearing slippery shoes (AOR: 2.31; 95% CI: 1.24 - 4.29). Interventions need to be considered to modify these significant factors associated with falls and education should be provided to these at risk.
Zhu, Wei; Ding, Yuexia; Kong, Wei; Li, Tuo; Chen, Hongguang
2018-04-16
In this study, we explored the neuroprotective effects of docosahexaenoic acid (DHA) in traumatic brain injury (TBI) models. In this study, we first confirmed that DHA was neuroprotective against TBI via the NSS test and Morris water maze experiment. Western blot was conducted to identify the expression of Bax, caspase-3, and Bcl-2. And the cell apoptosis of the TBI models was validated by TUNEL staining. Relationships between nuclear factor erythroid 2-related factor 2-antioxidant response element (Nrf2-ARE) pathway-related genes and DHA were explored by RT-PCR and Western blot. Rats of the DHA group performed remarkably better than those of the TBI group in both NSS test and water maze experiment. DHA conspicuously promoted the expression of Bcl-2 and diminished that of cleaved caspase-3 and Bax, indicating the anti-apoptotic role of DHA. Superoxide dismutase (SOD) activity and cortical malondialdehyde content, glutathione peroxidase (GPx) activity were renovated in rats receiving DHA treatment, implying that the neuroprotective influence of DHA was derived from lightening the oxidative stress caused by TBI. Moreover, immunofluorescence and Western blot experiments revealed that DHA facilitated the translocation of Nrf2 to the nucleus. DHA administration also notably increased the expression of the downstream factors NAD(P)H:quinone oxidoreductase (NQO-1) and heme oxygenase 1(HO-1). DHA exerted neuroprotective influence on the TBI models, potentially through activating the Nrf2- ARE pathway.
Nrf2, the Master Regulator of Anti-Oxidative Responses
Directory of Open Access Journals (Sweden)
Sandra Vomund
2017-12-01
Full Text Available Tight regulation of inflammation is very important to guarantee a balanced immune response without developing chronic inflammation. One of the major mediators of the resolution of inflammation is the transcription factor: the nuclear factor erythroid 2-like 2 (Nrf2. Stabilized following oxidative stress, Nrf2 induces the expression of antioxidants as well as cytoprotective genes, which provoke an anti-inflammatory expression profile, and is crucial for the initiation of healing. In view of this fundamental modulatory role, it is clear that both hyper- or hypoactivation of Nrf2 contribute to the onset of chronic diseases. Understanding the tight regulation of Nrf2 expression/activation and its interaction with signaling pathways, known to affect inflammatory processes, will facilitate development of therapeutic approaches to prevent Nrf2 dysregulation and ameliorate chronic inflammatory diseases. We discuss in this review the principle mechanisms of Nrf2 regulation with a focus on inflammation and autophagy, extending the role of dysregulated Nrf2 to chronic diseases and tumor development.
Ji, Qiong; Gao, Jianbo; Zheng, Yan; Liu, Xueli; Zhou, Qiangqiang; Shi, Canxia; Yao, Meng; Chen, Xia
2017-07-01
MicroRNAs are emerging as critical regulators in cerebral ischemia/reperfusion injury; however, their exact roles remain poorly understood. miR-153 is reported to be a neuron-related miRNA involved in neuroprotection. In this study, we aimed to investigate the precise role of miR-153 in regulating neuron survival during cerebral ischemia/reperfusion injury using an oxygen-glucose deprivation and reoxygenation (OGD/R) cellular model. We found that miR-153 was significantly upregulated in neurons subjected to OGD/R treatment. Inhibition of miR-153 significantly attenuated OGD/R-induced injury and oxidative stress in neurons. Nuclear factor erythroid 2-related factor 2 (Nrf2) was identified as a target gene of miR-153. Inhibition of miR-153 significantly promoted the expression of Nrf2 and heme oxygenase-1 (HO-1). However, silencing of Nrf2 significantly blocked the protective effects of miR-153 inhibition. Our study indicates that the inhibition of miR-153 protects neurons against OGD/R-induced injury by regulating Nrf2/HO-1 signaling and suggests a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.
Risk factors of age-related macular degeneration in Argentina
Directory of Open Access Journals (Sweden)
María Eugenia Nano
2013-04-01
Full Text Available PURPOSES: To assess the risk factors of age-related macular degeneration in Argentina using a case-control study. METHODS: Surveys were used for subjects' antioxidant intake, age/gender, race, body mass index, hypertension, diabetes (and type of treatment, smoking, sunlight exposure, red meat consumption, fish consumption, presence of age-related macular degeneration and family history of age-related macular degeneration. Main effects models for logistic regression and ordinal logistic regression were used to analyze the results. RESULTS: There were 175 cases and 175 controls with a mean age of 75.4 years and 75.5 years, respectively, of whom 236 (67.4% were female. Of the cases with age-related macular degeneration, 159 (45.4% had age-related macular degeneration in their left eyes, 154 (44.0% in their right eyes, and 138 (39.4% in both eyes. Of the cases with age-related macular degeneration in their left eyes, 47.8% had the dry type, 40.3% had the wet type, and the type was unknown for 11.9%. The comparable figures for right eyes were: 51.9%, 34.4%, and 13.7%, respectively. The main effects model was dominated by higher sunlight exposure (OR [odds ratio]: 3.3 and a family history of age-related macular degeneration (OR: 4.3. Other factors included hypertension (OR: 2.1, smoking (OR: 2.2, and being of the Mestizo race, which lowered the risk of age-related macular degeneration (OR: 0.40. Red meat/fish consumption, body mass index, and iris color did not have an effect. Higher age was associated with progression to more severe age-related macular degeneration. CONCLUSION: Sunlight exposure, family history of age-related macular degeneration, and an older age were the significant risk factors. There may be other variables, as the risk was not explained very well by the existing factors. A larger sample may produce different and better results.
MDM2 controls NRF2 antioxidant activity in prevention of diabetic kidney disease.
Guo, Weiying; Tian, Dan; Jia, Ye; Huang, Wenlin; Jiang, Mengnan; Wang, Junnan; Sun, Weixia; Wu, Hao
2018-04-26
Oxidative stress and P53 contribute to the pathogenesis of diabetic kidney disease (DKD). Nuclear factor erythroid 2-related factor 2 (NRF2) is a master regulator of cellular antioxidant defense system, is negatively regulated by P53 and prevents DKD. Recent findings revealed an important role of mouse double minute 2 (MDM2) in protection against DKD. However, the mechanism remained unclear. We hypothesized that MDM2 enhances NRF2 antioxidant signaling in DKD given that MDM2 is a key negative regulator of P53. The MDM2 inhibitor nutlin3a elevated renal P53, inhibited NRF2 signaling and induced oxidative stress, inflammation, fibrosis, DKD-like renal pathology and albuminuria in the wild-type (WT) non-diabetic mice. These effects exhibited more prominently in nutlin3a-treated WT diabetic mice. Interestingly, nutlin3a failed to induce greater renal injuries in the Nrf2 knockout (KO) mice under both the diabetic and non-diabetic conditions, indicating that NRF2 predominantly mediates MDM2's action. On the contrary, P53 inhibition by pifithrin-α activated renal NRF2 signaling and the expression of Mdm2, and attenuated DKD in the WT diabetic mice, but not in the Nrf2 KO diabetic mice. In high glucose-treated mouse mesangial cells, P53 gene silencing completely abolished nutlin3a's inhibitory effect on NRF2 signaling. The present study demonstrates for the first time that MDM2 controls renal NRF2 antioxidant activity in DKD via inhibition of P53, providing MDM2 activation and P53 inhibition as novel strategies in the management of DKD. Copyright © 2018 Elsevier B.V. All rights reserved.
Nathania, J.; Soetikno, V.
2017-08-01
Chronic kidney disease (CKD) is increasingly prevalent in Indonesia and worldwide. One of the major causes of morbidity and mortality in CKD is the complication of cardiovascular disease. Mastin® is a supplement that is locally produced in Indonesia and is made from extract of mangosteen pericarp, which is reported to have antioxidative, anti-inflammatory, and antitumor properties. The present study aimed to investigate whether Mastin® could improve antioxidant responses in the rat heart during CKD by measuring the expression of nuclear factor erythroid-2-related factor (Nrf)2, a master regulator of antioxidant response elements. RNA was extracted from the heart tissue of three groups of rats: a normal group, a nephrectomy group, and a nephrectomy with Mastin® group. Two-step real-time RT-PCR was then conducted to calculate the relative expression of the Nrf2 gene. Nrf2 expression was markedly decreased in the nephrectomy group vs the normal group, but slightly increas ed in the nephrectomy with Mastin® group vs the nephrectomy group. CKD resulted in impaired activation of the Nrf2 pathway in the rat heart. Although the administration of Mastin® slightly increased Nrf2 expression, it was not enough to confer cardioprotective effects through the Nrf2 pathway.
Pak, Jhang Ho; Son, Woo Chan; Seo, Sang-Beom; Hong, Sung-Jong; Sohn, Woon-Mok; Na, Byoung-Kuk; Kim, Tong-Soo
2016-10-01
Clonorchis sinensis is a carcinogenic human liver fluke. Its infection promotes persistent oxidative stress and chronic inflammation environments in the bile duct and surrounding liver tissues owing to direct contact with worms and their excretory-secretory products (ESPs), provoking epithelial hyperplasia, periductal fibrosis, and cholangiocarcinogenesis. We examined the reciprocal regulation of two ESP-induced redox-active proteins, NF-κB and peroxiredoxin 6 (Prdx6), during C. sinensis infection. Prdx6 overexpression suppressed intracellular free-radical generation by inhibiting NADPH oxidase2 and inducible nitric oxide synthase activation in the ESP-treated cholangiocarcinoma cells, substantially attenuating NF-κB-mediated inflammation. NF-κB overexpression decreased Prdx6 transcription levels by binding to two κB sites within the promoter. This transcriptional repression was compensated for by other ESP-induced redox-active transcription factors, including erythroid 2-related factor 2 (Nrf2), hypoxia inducible factor 1α (HIF1α), and CCAAT/enhancer-binding protein β (C/EBPβ). Distribution of immunoreactive Prdx6 and NF-κB was distinct in the early stages of infection in mouse livers but shared concomitant localization in the later stages. The intensity and extent of their immunoreactive staining in infected mouse livers are proportional to lesion severity and infection duration. The constitutive elevations of Prdx6 and NF-κB during C. sinensis infection may be associated with more severe persistent hepatobiliary abnormalities mediated by clonorchiasis. Copyright © 2016 Elsevier Inc. All rights reserved.
Niu, Linpeng; Shao, Mengjiao; Liu, Yuan; Hu, Jinfeng; Li, Ruofan; Xie, Heran; Zhou, Lixiao; Shi, Lei; Zhang, Rong; Niu, Yujie
2017-09-25
Titanium dioxide nanoparticles (TiO 2 NPs) are widely used to additives in cosmetics, pharmaceuticals, paints and foods. Recent studies have demonstrated that TiO 2 NPs increased the risk of cancer and the mechanism might relate with oxidative stress. Grape seed procyanidin extract (GSPE) is a natural compound which has been demonstrated to possess a wide array of pharmacological and biochemical actions, including anti-inflammatory, anti-carcinogenic, and antioxidant properties. Our data show that GSPE prevents the changes of histopathology and biomarkers in heart, liver and kidney that occur in mice exposed to TiO 2 NPs. After pretreatment with GSPE, the DNA damage, reactive oxygen species (ROS) generation and malondialdehyde (MDA) content in mice exposed to TiO 2 NPs had statistically significant decreases in dose dependent manners. GSPE increased the expression of nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), NAD(P)H dehydrogenase[quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC). We conclude that grape seed procyanidin extract prevents the majority of tissue and molecular damage resulting from nanoparticle treatment. The protective effect of GSPE may be due to its strong antioxidative activities which related with the activated Nrf2 and its down-regulated genes including NQO1, HO-1 and GCLC. Copyright © 2017 Elsevier B.V. All rights reserved.
Factors related to job satisfaction among South Korean dentists.
Jeong, Seong-Hwa; Chung, Jae-Kyun; Choi, Youn-Hee; Sohn, Woosung; Song, Keun-Bae
2006-12-01
The purposes of this study were to investigate the level and distribution of job satisfaction and to explore work environment factors associated with job satisfaction of South Korean dentists. A stratified systematic random sample of 1029 dentists was selected from the 10 357 registered dentists in the Korean Dental Association. They were surveyed via a self-administered mail questionnaire. Job satisfaction was measured by a modified version of the Dentist Satisfaction Survey. The response rate was 62.2%. The mean score of overall job satisfaction among South Korean dentists was 3.2 out of 5. In terms of work environment factors, the most satisfying aspect was patient relations (3.7) and the least satisfying aspect was personal time (2.8). Multiple regression analysis identified a model including patient relations, perception of income, personal time, staff, and specialty training that accounted for 35% of variation in overall job satisfaction. The majority of the variance was explained by patient relations. This study suggests that patient relations, perception of income, personal time, staff, and specialty training are important work environment factors for job satisfaction among South Korean dentists. The findings of this study will be helpful to policy makers to design plans to increase the level of job satisfaction among South Korean dentists.
Effects of Nrf2 Deficiency on Bone Microarchitecture in an Experimental Model of Osteoporosis
Directory of Open Access Journals (Sweden)
Lidia Ibáñez
2014-01-01
Full Text Available Objective. Redox imbalance contributes to bone fragility. We have evaluated the in vivo role of nuclear factor erythroid derived 2-related factor-2 (Nrf2, an important regulator of cellular responses to oxidative stress, in bone metabolism using a model of postmenopausal osteoporosis. Methods. Ovariectomy was performed in both wild-type and mice deficient in Nrf2 (Nrf2−/−. Bone microarchitecture was analyzed by μCT. Serum markers of bone metabolism were also measured. Reactive oxygen species production was determined using dihydrorhodamine 123. Results. Sham-operated or ovariectomized Nrf2−/− mice exhibit a loss in trabecular bone mineral density in femur, accompanied by a reduction in cortical area in vertebrae. Nrf2 deficiency tended to increase osteoblastic markers and significantly enhanced osteoclastic markers in sham-operated animals indicating an increased bone turnover with a main effect on bone resorption. We have also shown an increased production of oxidative stress in bone marrow-derived cells from sham-operated or ovariectomized Nrf2−/− mice and a higher responsiveness of bone marrow-derived cells to osteoclastogenic stimuli in vitro. Conclusion. We have demonstrated in vivo a key role of Nrf2 in the maintenance of bone microarchitecture.
Li, Ying-Na; Guo, Yu; Xi, Miao-Miao; Yang, Pei; Zhou, Xue-Ying; Yin, Shuang; Hai, Chun-Xu; Li, Jin-Gang; Qin, Xu-Jun
2014-01-01
Reactive oxygen species (ROS) are closely related to the aging process. In our previous studies, we found that the saponins from Aralia taibaiensis have potent antioxidant activity, suggesting the potential protective activity on the aging. However, the protective effect of the saponins and the possible underlying molecular mechanism remain unknown. In the present study, we employed a D-galactose-induced aging rat model to investigate the protective effect of the saponins. We found that D-galactose treatment induced obvious aging-related changes such as the decreased thymus and spleen coefficients, the increased advanced glycation end products (AGEs) level, senescence-associated β-galactosidase (SAβ-gal) activity, and malondialdehyde (MDA) level. Further results showed that Forkhead box O3a (FOXO3a), nuclear factor-erythroid 2-related factor 2 (Nrf2), and their targeted antioxidants such as superoxide dismutase 2 (SOD2), catalase (CAT), glutathione reductase (GR), glutathione (GSH), glutamate-cysteine ligase (GCL), and heme oxygenase 1 (HO-1) were all inhibited in the aging rats induced by D-galactose treatment. Saponins supplementation showed effective protection on these changes. These results demonstrate that saponins from Aralia taibaiensis attenuate the D-galactose-induced rat aging. By activating FOXO3a and Nrf2 pathways, saponins increase their downstream multiple antioxidants expression and function, at least in part contributing to the protection on the D-galactose-induced aging in rats. PMID:24669284
Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress
International Nuclear Information System (INIS)
Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.
2011-01-01
Research highlights: → Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. → HDAC inhibition decreases Nrf2 protein stability. → HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. → HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H 2 O 2 ) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H 2 O 2 -induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.
Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress
Energy Technology Data Exchange (ETDEWEB)
Mercado, Nicolas [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Thimmulappa, Rajesh [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E. [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Biswal, Shyam [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Ito, Kazuhiro [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Barnes, Peter J., E-mail: p.j.barnes@imperial.ac.uk [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom)
2011-03-11
Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.
Building-related risk factors and work-related lower respiratory symptoms in 80 office buildings
Energy Technology Data Exchange (ETDEWEB)
Mendell, M.J.; Naco, G.M.; Wilcox, T.G.; Sieber, W.K.
2002-01-01
We assessed building-related risk factors for lower respiratory symptoms in office workers. The National Institute for Occupational Safety and Health in 1993 collected data during indoor environmental health investigations of workplaces. We used multivariate logistic regression analyses to assess relationships between lower respiratory symptoms in office workers and risk factors plausibly related to microbiologic contamination. Among 2,435 occupants in 80 office buildings, frequent, work-related multiple lower respiratory symptoms were strongly associated, in multivariate models, with two risk factors for microbiologic contamination: poor pan drainage under cooling coils and debris in outside air intake. Associations tended to be stronger among those with a history of physician-diagnosed asthma. These findings suggest that adverse lower respiratory health effects from indoor work environments, although unusual, may occur in relation to poorly designed or maintained ventilation systems, particularly among previously diagnosed asthmatics. These findings require confirmation in more representative buildings.
Building-related risk factors and work-related lower respiratory symptoms in 80 office buildings
International Nuclear Information System (INIS)
Mendell, M.J.; Naco, G.M.; Wilcox, T.G.; Sieber, W.K.
2002-01-01
We assessed building-related risk factors for lower respiratory symptoms in office workers. The National Institute for Occupational Safety and Health in 1993 collected data during indoor environmental health investigations of workplaces. We used multivariate logistic regression analyses to assess relationships between lower respiratory symptoms in office workers and risk factors plausibly related to microbiologic contamination. Among 2,435 occupants in 80 office buildings, frequent, work-related multiple lower respiratory symptoms were strongly associated, in multivariate models, with two risk factors for microbiologic contamination: poor pan drainage under cooling coils and debris in outside air intake. Associations tended to be stronger among those with a history of physician-diagnosed asthma. These findings suggest that adverse lower respiratory health effects from indoor work environments, although unusual, may occur in relation to poorly designed or maintained ventilation systems, particularly among previously diagnosed asthmatics. These findings require confirmation in more representative buildings
Directory of Open Access Journals (Sweden)
Sílvia S. Chambel
2015-01-01
Full Text Available Nonalcoholic fatty liver disease (NAFLD is a progressive liver disease with ever-growing incidence in the industrialized world. It starts with the simple accumulation of lipids in the hepatocyte and can progress to the more severe nonalcoholic steatohepatitis (NASH, which is associated with inflammation, fibrosis, and cirrhosis. There is increasing awareness that reactive oxygen species and electrophiles are implicated in the pathogenesis of NASH. Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2 is a positive regulator of the expression of a battery of genes involved in the protection against oxidative/electrophilic stress. In rodents, Nrf2 is also known to participate in hepatic fatty acid metabolism, as a negative regulator of genes that promote hepatosteatosis. We review relevant evidence in the literature that these two mechanisms may contribute to the protective role of Nrf2 in the development of hepatic steatosis and in the progression to steatohepatitis, particularly in young animals. We propose that age may be a key to explain contradictory findings in the literature. In summary, Nrf2 mediates the crosstalk between lipid metabolism and antioxidant defense mechanisms in experimental models of NAFLD, and the nutritional or pharmacological induction of Nrf2 represents a promising potential new strategy for its prevention and treatment.
Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication
Energy Technology Data Exchange (ETDEWEB)
Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Food and Drug Administration, Silver Spring, MD (United States)
2017-03-15
We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.
Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication
International Nuclear Information System (INIS)
Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash
2017-01-01
We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.
Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela
2017-07-01
Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Yamamoto, Tetsuya; Sawada, Akira; Mayama, Chihiro; Araie, Makoto; Ohkubo, Shinji; Sugiyama, Kazuhisa; Kuwayama, Yasuaki
2014-05-01
To report the 5-year incidence of bleb-related infection after mitomycin C-augmented glaucoma filtering surgery and to investigate the risk factors for infections. Prospective, observational cohort study. A total of 1098 eyes of 1098 glaucoma patients who had undergone mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation performed at 34 clinical centers. Patients were followed up at 6-month intervals for 5 years, with special attention given to bleb-related infections. The follow-up data were analyzed via Kaplan-Meier survival analysis and the Cox proportional hazards model. Incidence of bleb-related infection over 5 years and risk factors for infections. Of the 1098 eyes, a bleb-related infection developed in 21 eyes. Kaplan-Meier survival analysis revealed that the incidence of bleb-related infection was 2.2±0.5% (cumulative incidence ± standard error) at the 5-year follow-up for all cases, whereas it was 7.9±3.1% and 1.7±0.4% for cases with and without a history of bleb leakage, respectively (P = 0.000, log-rank test). When only eyes with a well-functioning bleb were counted, it was 3.9±1.0%. No differences were found between the trabeculectomy cases and the combined surgery cases (P = 0.398, log-rank test) or between cases with a fornix-based flap and those with a limbal-based flap (P = 0.651, log-rank test). The Cox model revealed that a history of bleb leakage and younger age were risk factors for infections. The 5-year cumulative incidence of bleb-related infection was 2.2±0.5% in eyes treated with mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation in our prospective, multicenter study. Bleb leakage and younger age were the main risk factors for infections. Copyright © 2014 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
LEARNERS SATISFACTION FACTORS IN NEUROLOGY RELATED MOOCs
Directory of Open Access Journals (Sweden)
Ionela MANIU
2017-12-01
Full Text Available The aim of this article is to investigate the factors that are influencing student satisfaction in case of neurology related massive open online courses (MOOCs. We analyzed data collected from learners enrolled in 40 neurology related MOOCs, by manually looking for information in these courses reviews. The main identified satisfaction factors can be grouped into the following categories: content related factors: course content, additional materials, assignments, external research and teaching - learning related factors (teacher presentation techniques / style: engaging, clear, coherent, knowledgeable, sharing / explanation, interactive, excitement, considering student’s needs, inspiring, sense of humor. Competences, skills and objectives pursued by neurology related MOOCs are also discussed. Analyzing these factors can be useful in new courses management (design and implementation and also in understanding the needs (motivation, behaviors, perception of 21st century learners interested in neurology related fields.
Tu, Zhi-Shan; Wang, Qi; Sun, Dan-Dan; Dai, Fang; Zhou, Bo
2017-07-07
Activation of nuclear factor erythroid-2-related factor 2 (Nrf2) has been proven to be an effective means to prevent the development of cancer, and natural curcumin stands out as a potent Nrf2 activator and cancer chemopreventive agent. In this study, we synthesized a series of curcumin analogs by introducing the geminal dimethyl substituents on the active methylene group to find more potent Nrf2 activators and cytoprotectors against oxidative death. The geminally dimethylated and catechol-type curcumin analog (compound 3) was identified as a promising lead molecule in terms of its increased stability and cytoprotective activity against the tert-butyl hydroperoxide (t-BHP)-induced death of HepG2 cells. Mechanism studies indicate that its cytoprotective effects are mediated by activating the Nrf2 signaling pathway in the Michael acceptor- and catechol-dependent manners. Additionally, we verified by using copper and iron ion chelators that the two metal ion-mediated oxidations of compound 3 to its corresponding electrophilic o-quinone, contribute significantly to its Nrf2-dependent cytoprotection. This work provides an example of successfully designing natural curcumin-directed Nrf2 activators by a stability-increasing and proelectrophilic strategy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y
2016-01-01
Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.
NFE2L2 pathway polymorphisms and lung function decline in chronic obstructive pulmonary disease.
Sandford, Andrew J; Malhotra, Deepti; Boezen, H Marike; Siedlinski, Mateusz; Postma, Dirkje S; Wong, Vivien; Akhabir, Loubna; He, Jian-Qing; Connett, John E; Anthonisen, Nicholas R; Paré, Peter D; Biswal, Shyam
2012-08-01
An oxidant-antioxidant imbalance in the lung contributes to the development of chronic obstructive pulmonary disease (COPD) that is caused by a complex interaction of genetic and environmental risk factors. Nuclear erythroid 2-related factor 2 (NFE2L2 or NRF2) is a critical molecule in the lung's defense mechanism against oxidants. We investigated whether polymorphisms in the NFE2L2 pathway affected the rate of decline of lung function in smokers from the Lung Health Study (LHS)(n = 547) and in a replication set, the Vlagtwedde-Vlaardingen cohort (n = 533). We selected polymorphisms in NFE2L2 in genes that positively or negatively regulate NFE2L2 transcriptional activity and in genes that are regulated by NFE2L2. Polymorphisms in 11 genes were significantly associated with rate of lung function decline in the LHS. One of these polymorphisms, rs11085735 in the KEAP1 gene, was previously shown to be associated with the level of lung function in the Vlagtwedde-Vlaardingen cohort but not with decline of lung function. Of the 23 associated polymorphisms in the LHS, only rs634534 in the FOSL1 gene showed a significant association in the Vlagtwedde-Vlaardingen cohort with rate of lung function decline, but the direction of the association was not consistent with that in the LHS. In summary, despite finding several nominally significant polymorphisms in the LHS, none of these associations were replicated in the Vlagtwedde-Vlaardingen cohort, indicating lack of effect of polymorphisms in the NFE2L2 pathway on the rate of decline of lung function.
Age-related changes in factor VII proteolysis in vivo.
Ofosu, F A; Craven, S; Dewar, L; Anvari, N; Andrew, M; Blajchman, M A
1996-08-01
Previous studies have reported that pre-operative plasmas of patients over the age of 40 years who developed post-operative deep vein thrombosis (DVT) had approximately twice the amount of proteolysed factor VII found in plasmas of patients in whom prophylaxis with heparin or low M(r) heparin was successful. These and other studies also reported higher concentrations of thrombin-antithrombin III in pre- and post-operative plasmas of patients who developed post-operative thrombosis than in plasmas of patients in whom prophylaxis was successful. Whether the extent of factor VII proteolysis seen in the patients who developed post-operative DVT is related to the severity of their disease or age is not known. This report investigated age-related changes in the concentrations of total factor VII protein, factor VII zymogen, factor VIIa, tissue factor pathway inhibitor, thrombin-antithrombin III, and prothrombin fragment 1 + 2 in normal plasmas and the relationships between these parameters. With the exception of thrombin-antithrombin III, statistically significant increases in the concentrations of these parameters with age were found. Additionally, the differences between the concentrations of total factor VII protein and factor VII zymogen, an index factor VII proteolysis in vivo, were statistically significant only for individuals over age 40. Using linear regression analysis, a significant correlation was found to exist between the concentrations of plasma factor VIIa and prothrombin fragment 1 + 2. Since factor VIIa-tissue factor probably initiates coagulation in vivo, we hypothesize that the elevated plasma factor VIIa (reflecting a less tightly regulated tissue factor activity and therefore increased thrombin production in vivo) accounts for the high risk for post-operative thrombosis seen in individuals over the age of 40.
Directory of Open Access Journals (Sweden)
Elena Mariani
2017-05-01
Full Text Available To counteract oxidative stress cells developed several mechanisms, including the transcription factor Nuclear Factor E2-related factor 2 (Nrf2. The aim of the study was to evaluate the activation of Nrf2 in transgenic mice fed saturated or polyunsaturated fatty acids and the anti-inflammatory effect of estrogens on organism. Forty-eight ARE CRE OMO reporter mice were divided into 3 groups, consisting of 16 animals, based on presence/absence of estrogens (ovariectomized or sham female, OVX - SH; male, MA. Each group was further split in 4 subgroups of 4 animals each and fed different diets (7.5% lard, 7.5% tuna oil, 20.0 % lard and 20.0% tuna oil. Two times a week animals were anaesthetized and injected i.p. with 100µL luciferin 15 min before the imaging session. Using the Living Image Software, photon emission was mapped for selected body areas. On day 70, animals were sacrificed after a challenge with Sodium Arsenite. Specific organs were dissected and immediately subjected to ex vivo imaging session. MIXED and GLM procedures of SAS software were used for statistical analysis. Dietary treatments did not affect body weight and feed intake as well as Nrf2 expression in both pre- and post-challenge phases, with the exception of the abdominal region (P=0.031 pre-challenge; in this area, during the pre-challenge phase, OVX showed lower Nrf2 activation (P<0.001. Ex vivo results outlined a significant effect of the challenge on all the considered organs (P<0.001, while OVX subjects had higher Nrf2 expression on urinary bladder and kidney (P<0.05 and high fat diet increased Nrf2 in urinary bladder (P<0.05. The present trial shows how saturated or polyunsaturated fatty acids supplementation in the diet do not exert significant effects on oxidative stress in mice, but confirms the protective role of estrogens under physiological condition.
The NLstart2run study: Incidence and risk factors of running-related injuries in novice runners.
Kluitenberg, B; van Middelkoop, M; Smits, D W; Verhagen, E; Hartgens, F; Diercks, R; van der Worp, H
2015-10-01
Running is a popular form of physical activity, despite of the high incidence of running-related injuries (RRIs). Because of methodological issues, the etiology of RRIs remains unclear. Therefore, the purposes of the study were to assess the incidence of RRIs and to identify risk factors for RRIs in a large group of novice runners. In total, 1696 runners of a 6-week supervised "Start to Run" program were included in the NLstart2run study. All participants were aged between 18 and 65, completed a baseline questionnaire that covered potential risk factors, and completed at least one running diary. RRIs were registered during the program with a weekly running log. An RRI was defined as a musculo-skeletal complaint of the lower extremity or back attributed to running and hampering running ability for three consecutive training sessions. During the running program, 10.9% of the runners sustained an RRI. The multivariable Cox regression analysis showed that a higher age, higher BMI, previous musculo-skeletal complaints not attributed to sports and no previous running experience were related to RRI. These findings indicate that many novice runners participating in a short-term running program suffer from RRIs. Therefore, the identified risk factors should be considered for screening and prevention purposes. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Bicycling-related accidents and factors contributing to injury
Energy Technology Data Exchange (ETDEWEB)
Gonzalez Perez, L.M.; Wideberg, J.; Gonzalez Perez-Somarriba, B.
2016-07-01
Objective: This study was conducted to find the epidemiological characteristics of bicycling-related maxillofacial fractures in a defined population, and identify factors contributing to injury. Methodology: A prospective study was carried out involving patients presenting with maxillofacial fractures sustained in bicycling-related accidents. Results: Between 908 of all cycling accidents attending for medical treatment, 122 patients (13% of all cycling accidents) were admitted with facial fractures between 2007 and 2014. Male and female ratio was 2.6:1, and the mean age was 29.4 years (standard deviation: 12.8, range: 12-79 years). Causes of injury included collisions (63%) and accidental falls (37%). The fracture patterns seen were mandibular (49%), zygomatic (32%), orbital (13%), nasal (7%), maxillary (2%), and frontal (2%). Condylar fractures were the most common of the mandibular fractures (63%). The most frequently observed concomitant lesions were orthopedic injuries. Conclusions: Bicycling-related maxillofacial injuries are common and therefore important to identify in order to design a sustainable transport system and for units that provide assistance to traffic accident victims. Missed diagnosis or delayed treatment can lead to facial deformities and functional problems. Wearing protective helmets and the improvement of the helmets design is one aspect that would be of interest for the prevention of injuries. Keywords: Cycling; bicycle-related trauma; maxillofacial fractures; risk factors; helmets. (Author)
Myelodysplastic syndromes: histopathology as prognostic factor
Directory of Open Access Journals (Sweden)
Romeo Maura
2001-01-01
Full Text Available Bone marrow biopsy allows evaluation of cellularity, abnormal localization of immature precursors and fibrosis in myelodysplastic syndrome. It has been considered important to make diagnosis and prognosis of this disorder. The object of this study evaluated the influence of histopathological parameters, such as cellularity, erythroid/myeloid ratio, abnormal localization of immature precursors and marrow fibrosis, on survival of myelodysplastic syndrome patients. Forty-six patients, admitted from April 1985 to June 1998, and diagnosed as being myelodysplastic syndrome according to French-American-British criteria, were selected. There were 20 males and 26 females, with median age of 61 years. Forty-six bone marrow smears and 36 trephine biopsies were reviewed. Mean survival of hypocellular cases was 64.8 months and of hyper and normocellular cases was 31.8 months. Patients with predominance of erythroid hyperplasia had mean survival of 50.8 months, greater than those with predominance of myeloid hyperplasia (20.3 months. There was no statistical difference in survival of patients with or without abnormal localization of immature precursors and with or without marrow fibrosis. Bone marrow biopsy is a useful tool for the identification of parameters that influence prognosis in myelodysplastic syndrome. Hypocellularity and erythroid hyperplasia were correlated with longer survival while myeloid hyperplasia with poorer survival.
Directory of Open Access Journals (Sweden)
Wei Xu
2017-12-01
Full Text Available Background/Aims: Parkinson’s disease (PD is a common neurodegenerative disease in the old population, characterized by dopaminergic neuron loss, inflammation and oxidative stress injury in the substantia nigra. Glaucocalyxin B (GLB, an ent-kauranoid diterpenoid isolated from Rabdosia japonica, has anti-inflammation and anti-tumor effects. However, its effects on PD remain unclear. Methods: PD was introduced in rats via injection of lipopolysaccharide (LPS into cerebral corpus striatum, and GLB was given intracerebroventricularly to these rats. Their walking, climbing and sensory states were detected by Stepping, Whisker and Cylinder Tests. The expression of tyrosine hydroxylase (TH, glial fibrillary acidic protein (GFAP, CD11b and ionized calcium binding adaptor molecule (IBA-1 were detected by immunohischemical staining. The levels of a series of inflammatory factors, oxidative stress-related factors and apoptosis-related factors were measured by real-time PCR, immunoblotting and ELISA. In addition, Toll-like receptor (TLR/nuclear factor kappa B (NF-κB and nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase (HO-1 pathways were investigated to illustrate the underlying mechanism. In vitro, microglial cells exposed to LPS were treated with GLB. Results: The injection of LPS caused walking, climbing and sensory disturbances in rats, induced inflammation, oxidative stress response and apoptosis, and activated TLR/NF-κB and Nrf2/ HO-1 pathways in the cerebral tissue. GLB administration attenuated LPS-induced alterations. The TLR/NF-κB pathway was deactivated and Nrf2/HO-1 was activated after application of GLB. In vitro, cytotoxic effects induced by the conditioned medium derived from microglial cells exposed to LPS in PC12 cells were attenuated by GLB. Conclusion: GLB suppresses LPS-induced PD symptoms by modification of TLR/NF-κB and Nrf2/HO-1 pathways in vivo and in vitro.
Aayadi, Hoda; Mittal, Smriti P K; Deshpande, Anjali; Gore, Makarand; Ghaskadbi, Saroj S
2017-11-01
Geraniin, a hydrolysable tannin, used in traditional medicine in Southeast Asia, is known to exhibit various biological activities. As an antioxidant it is known to up-regulate phase II enzyme Heme oxygenase-1 (HO-1). However its mechanism is not clearly understood. Nuclear factor erythroid-derived 2 related factor 2 (Nrf-2) is transcriptionally up-regulated by Extracellular signal-regulated kinase (ERK) 1/2 and retained in nucleus due to inactivated Glycogen synthase kinase 3 beta (GSK-3β). Geraniin additionally down-regulates expression of microRNA 217 and 377 (miR-217 and miR-377) which target HO-1 mRNA. Expression of BTB and CNC homolog 1 (BACH-1), another regulator of HO-1, is also down-regulated by up-regulating microRNA 98 (miR-98), a negative regulator of BACH-1. Thus, geraniin up-regulates HO-1 expression both through activating its positive regulator Nrf-2 and by down-regulating its negative regulator BACH-1. Up-regulation of HO-1 also confers protection to HepG2 cells from tertiary butyl hydroperoxide (TBH) induced cytotoxicity. [BMB Reports 2017; 50(11): 560-565].
Park, Hae-Ryung; Loch-Caruso, Rita
2014-11-15
Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20μM BDE-47 for 24h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20μM BDE-47 for 24h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. Copyright © 2014 Elsevier Inc. All rights reserved.
Pyrrolidine dithiocarbamate activates the Nrf2 pathway in astrocytes.
Liddell, Jeffrey R; Lehtonen, Sarka; Duncan, Clare; Keksa-Goldsteine, Velta; Levonen, Anna-Liisa; Goldsteins, Gundars; Malm, Tarja; White, Anthony R; Koistinaho, Jari; Kanninen, Katja M
2016-02-26
Endogenous defense against oxidative stress is controlled by nuclear factor erythroid 2-related factor 2 (Nrf2). The normal compensatory mechanisms to combat oxidative stress appear to be insufficient to protect against the prolonged exposure to reactive oxygen species during disease. Counterbalancing the effects of oxidative stress by up-regulation of Nrf2 signaling has been shown to be effective in various disease models where oxidative stress is implicated, including Alzheimer's disease. Stimulation of Nrf2 signaling by small-molecule activators is an appealing strategy to up-regulate the endogenous defense mechanisms of cells. Here, we investigate Nrf2 induction by the metal chelator and known nuclear factor-κB inhibitor pyrrolidine dithiocarbamate (PDTC) in cultured astrocytes and neurons, and mouse brain. Nrf2 induction is further examined in cultures co-treated with PDTC and kinase inhibitors or amyloid-beta, and in Nrf2-deficient cultures. We show that PDTC is a potent inducer of Nrf2 signaling specifically in astrocytes and demonstrate the critical role of Nrf2 in PDTC-mediated protection against oxidative stress. This induction appears to be regulated by both Keap1 and glycogen synthase kinase 3β. Furthermore, the presence of amyloid-beta magnifies PDTC-mediated induction of endogenous protective mechanisms, therefore suggesting that PDTC may be an effective Nrf2 inducer in the context of Alzheimer's disease. Finally, we show that PDTC increases brain copper content and glial expression of heme oxygenase-1, and decreases lipid peroxidation in vivo, promoting a more antioxidative environment. PDTC activates Nrf2 and its antioxidative targets in astrocytes but not neurons. These effects may contribute to the neuroprotection observed for PDTC in models of Alzheimer's disease.
A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice
International Nuclear Information System (INIS)
Nakagami, Yasuhiro; Masuda, Kayoko
2016-01-01
Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis.
Pathogenetic Role of JAK2 V617F Mutation in Chronic Myeloproliferative Disorders
Directory of Open Access Journals (Sweden)
Hui-Chi Hsu
2007-03-01
Full Text Available The molecular pathogenesis of chronic myeloproliferative disorders (MPDs is poorly understood. The hematopoietic progenitor cells of patients with polycythemia vera (PV or essential thrombocythemia (ET are characterized by hypersensitiv-ity to hematopoietic growth factors and formation of endogenous erythroid colonies. Recently, 4 groups reported almost simultaneously Janus kinase 2 (JAK2 V617F mutation in more than 80% of PV patients, 30% of patients with ET and in about 50% of patients with idiopathic myelofibrosis. The identification of the JAK2 mutation represents a major advance in the understanding of the molecular pathogenesis of MPDs that will likely permit a new classification and the development of novel therapeutic strategies for these diseases.
The LXCXE Retinoblastoma Protein-Binding Motif of FOG-2 Regulates Adipogenesis.
Goupille, Olivier; Penglong, Tipparat; Kadri, Zahra; Granger-Locatelli, Marine; Denis, Raphaël; Luquet, Serge; Badoual, Cécile; Fucharoen, Suthat; Maouche-Chrétien, Leila; Leboulch, Philippe; Chrétien, Stany
2017-12-19
GATA transcription factors and their FOG cofactors play a key role in tissue-specific development and differentiation, from worms to humans. Mammals have six GATA and two FOG factors. We recently demonstrated that interactions between retinoblastoma protein (pRb) and GATA-1 are crucial for erythroid proliferation and differentiation. We show here that the LXCXE pRb-binding site of FOG-2 is involved in adipogenesis. Unlike GATA-1, which inhibits cell division, FOG-2 promotes proliferation. Mice with a knockin of a Fog2 gene bearing a mutated LXCXE pRb-binding site are resistant to obesity and display higher rates of white-to-brown fat conversion. Thus, each component of the GATA/FOG complex (GATA-1 and FOG-2) is involved in pRb/E2F regulation, but these molecules have markedly different roles in the control of tissue homeostasis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Analysis of factors related to arm weakness in patients with breast cancer-related lymphedema.
Lee, Daegu; Hwang, Ji Hye; Chu, Inho; Chang, Hyun Ju; Shim, Young Hun; Kim, Jung Hyun
2015-08-01
The aim of this study was to evaluate the ratio of significant weakness in the affected arm of breast cancer-related lymphedema patients to their unaffected side. Another purpose was to identify factors related to arm weakness and physical function in patients with breast cancer-related lymphedema. Consecutive patients (n = 80) attended a single evaluation session following their outpatient lymphedema clinic visit. Possible independent factors (i.e., lymphedema, pain, psychological, educational, and behavioral) were evaluated. Handgrip strength was used to assess upper extremity muscle strength and the disabilities of arm, shoulder, and hand (DASH) questionnaire was used to assess upper extremity physical function. Multivariate logistic regression was performed using factors that had significant differences between the handgrip weakness and non-weakness groups. Out of the 80 patients with breast cancer-related lymphedema, 29 patients (36.3 %) had significant weakness in the affected arm. Weakness of the arm with lymphedema was not related to lymphedema itself, but was related to the fear of using the affected limb (odds ratio = 1.76, 95 % confidence interval = 1.30-2.37). Fears of using the affected limb and depression significantly contributed to the variance in DASH scores. Appropriate physical and psychological interventions, including providing accurate information and reassurance of physical activity safety, are necessary to prevent arm weakness and physical dysfunction in patients with breast cancer-related lymphedema.
Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway
Directory of Open Access Journals (Sweden)
W. Rungratanawanich
2018-01-01
Full Text Available γ-Oryzanol (ORY is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293. The 24 h ORY exposure significantly prevented hydrogen peroxide- (H2O2- induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD and glutathione peroxidase (GPX. Interestingly, ORY induced the nuclear factor (erythroid-derived 2-like 2 (Nrf2 nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(PH quinone reductase (NQO1, heme oxygenase-1 (HO-1, and glutathione synthetase (GSS at mRNA and protein levels in both basal condition and after H2O2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.
Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway.
Rungratanawanich, W; Abate, G; Serafini, M M; Guarienti, M; Catanzaro, M; Marziano, M; Memo, M; Lanni, C; Uberti, D
2018-01-01
γ -Oryzanol (ORY) is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS) scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293). The 24 h ORY exposure significantly prevented hydrogen peroxide- (H 2 O 2 -) induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD) and glutathione peroxidase (GPX). Interestingly, ORY induced the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(P)H quinone reductase (NQO1), heme oxygenase-1 (HO-1), and glutathione synthetase (GSS) at mRNA and protein levels in both basal condition and after H 2 O 2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.
DEFF Research Database (Denmark)
Schiødt, I; Jensen, Charlotte Harken; Kjaersgaard, E
2000-01-01
In order to improve prediction of hematopoietic recovery, we conducted a pilot study, analyzing the significance of growth factor receptor expression in autografts as well as endogenous growth factor levels in blood before, during and after stem cell transplantation. Three early acting (stem cell......-CSF receptor positive, CD34+ progenitor cells were measured by flow cytometry in the leukapheresis product used for transplantation in a subgroup of 15 patients (NHL, n = 8, MM, n = 7). Three factors were identified as having a significant impact on platelet recovery. First, the level of Tpo in blood...... at the time of the nadir (day +7). Second, the percentage of re-infused thrombopoietin receptor positive progenitors and finally, the percentage of Flt3 receptor positive progenitors. On the other hand, none of the analyzed factors significantly predicted myeloid or erythroid recovery. These findings need...
Factors Related to Suicide in LGBT Populations.
Skerrett, Delaney Michael; Kõlves, Kairi; De Leo, Diego
2016-09-01
There is evidence of heightened vulnerability to nonfatal suicidal behaviors among LGBT populations yet a paucity of studies into fatal behaviors. The specific aim of this article was to identify factors related to suicide in LGBT individuals in Australia. The psychological autopsy (PA) method with a matched case-control study design was used. PA interviews were conducted with 27 next-of-kin of an LGBT person that had died by suicide. Three living LGBT controls per suicide case, matched by age and gender, were also interviewed. The key factors relating to suicide in LGBT people were a lack of acceptance by family and self (reflected in higher internalized homophobia and shame), negative feelings about own sexuality/gender, and dissatisfaction with appearance. LGBT people who died by suicide also tended to go through coming out milestones 2 years earlier than controls. There was a higher prevalence of aggressive behaviors and a more predominant history of physical and sexual abuse. Additionally, there was greater incidence of depression and anxiety and alcohol and substance use disorders. Specific predictive factors for suicide in LGBT populations in Australia were identified, including significantly poorer mental health outcomes and more violence across an array of measures.
International Nuclear Information System (INIS)
Park, Hae-Ryung; Loch-Caruso, Rita
2014-01-01
Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential
Energy Technology Data Exchange (ETDEWEB)
Park, Hae-Ryung, E-mail: heaven@umich.edu; Loch-Caruso, Rita
2014-11-15
Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential
Im, Young Bin; Shim, Soojin; Park, Woo Bin; Kim, Suk; Yoo, Han Sang
2017-09-01
Brucellosis is an important zoonotic disease caused by Brucella species. The disease is difficult to control due to the intracellular survival of the bacterium and the lack of precise understanding of pathogenesis. Despite of continuous researches on the pathogenesis of Brucella spp. infection, there is still question on the pathogenesis, especially earlier immune response in the bacterial infection. Malate dehydrogenase (MDH), elongation factor (Tsf), and arginase (RocF), which showed serological reactivity, were purified after gene cloning, and their immune modulating activities were then analyzed in a murine model. Cytokine production profiles were investigated by stimulating RAW 264.7 cells and naïve splenocytes with the three recombinant proteins. Also, immune responses were analyzed by ELISA and an ELIspot assay after immunizing mice with the three proteins. Only TNF-α was produced in stimulated RAW 264.7 cells, whereas Th1-related cytokines, IFN-γ and IL-2, were induced in naïve splenocytes. In contrast, Th2-type immune response was more strongly induced in antigen-secreting cells in the splenocytes obtained 28 days after immunizing mice with the three proteins, as were IgM and IgG. The induction of Th2-related antibody, IgG1, was higher than the Th1-related antibody, IgG2a, in immunized mice. These results suggest that the three proteins strongly induce Th2-type immune response in vivo, even though Th1-related cytokines were produced in vitro. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing
2016-08-01
Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid.
Relation Between Demographic Factors And Hospitalization In ...
African Journals Online (AJOL)
Relation Between Demographic Factors And Hospitalization In Patients With Gastrointestinal Disorders, Using Quantail Regression Analysis. ... East African Journal of Public Health ... Objective: The aim of this study is to investigate relation between demographic factors and hospitalization in gastrointestinal disorders.
Analysis of regional difference on impact factors of China’s energy – Related CO2 emissions
International Nuclear Information System (INIS)
Li, Huanan; Mu, Hailin; Zhang, Ming; Gui, Shusen
2012-01-01
With the intensification of global warming, the issue of carbon emissions causes more and more attention in recent years. In this paper, China’s 30 provincial-level administrative units are divided into five emission regions according to the annual average value of provincial CO 2 emissions per capita during 1990 and 2010. The regional differences in impact factors on CO 2 emissions are discussed using STIRPAT (stochastic impacts by regression on population, affluence, and technology) model. The results indicate that although GDP (Gross domestic product) per capita, industrial structure, population, urbanization and technology level have different impacts on CO 2 emissions in different emission regions, they are almost always the main factors in all emission regions. In most emission regions, urbanization and GDP per capita has a bigger impact on CO 2 emissions than other factors. Improving technology level produces a small reduction in CO 2 emissions in most emission regions, but it is still a primary way for CO 2 reduction in China. It’s noteworthy that industrial structure isn’t the main factor and improving technology level increases CO 2 emissions in high emission region. Different measures should be adopted for CO 2 reductions according to local conditions in different regions. -- Highlights: ► Regional differences of the impact factors on China’s CO 2 emissions are analyzed. ► Five macro factors like GDP per capita are almost always main influence factors in all regions. ► The impacts of different factors are different. ► Improving technology has no significant reduction on CO 2 emission in most regions. ► Policy on CO 2 reduction should be adapted to local conditions.
Neuroprotection by curcumin in ischemic brain injury involves the Akt/Nrf2 pathway.
Directory of Open Access Journals (Sweden)
Jingxian Wu
Full Text Available Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(PH: quinone oxidoreductase1 (NQO1 induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2 to antioxidant response element (ARE were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage.
Neuroprotection by Curcumin in Ischemic Brain Injury Involves the Akt/Nrf2 Pathway
Wu, Jingxian; Li, Qiong; Wang, Xiaoyan; Yu, Shanshan; Li, Lan; Wu, Xuemei; Chen, Yanlin; Zhao, Jing; Zhao, Yong
2013-01-01
Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R) was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(P)H: quinone oxidoreductase1 (NQO1) induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2) to antioxidant response element (ARE) were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO) rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage. PMID:23555802
Directory of Open Access Journals (Sweden)
Qin Wang
2015-06-01
Full Text Available Multiple sclerosis (MS is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS. Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12 is an oral formulation of the fumaric acid esters (FAE, containing the active metabolite dimethyl fumarate (DMF. Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF on mouse and rat neural stem/progenitor cells (NPCs and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2 treatment. In addition, utilizing the reactive oxygen species (ROS assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2 at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1. Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS.
Transcriptional control of megakaryocyte development.
Goldfarb, A N
2007-10-15
Megakaryocytes are highly specialized cells that arise from a bipotent megakaryocytic-erythroid progenitor (MEP). This developmental leap requires coordinated activation of megakaryocyte-specific genes, radical changes in cell cycle properties, and active prevention of erythroid differentiation. These programs result from upregulation of megakaryocyte-selective transcription factors, downregulation of erythroid-selective transcription factors and ongoing mediation of common erythro-megakaryocytic transcription factors. Unlike most developmental programs, no single lineage-unique family of master regulators exerts executive control over the megakaryocytic plan. Rather, an assemblage of non-unique factors and signals converge to determine lineage and differentiation. In human megakaryopoiesis, hereditary disorders of platelet production have confirmed contributions from three distinct transcription factor families. Murine models have extended this repertoire to include multiple additional factors. At a mechanistic level, the means by which these non-unique factors collaborate in the establishment of a perfectly unique cell type remains a central question.
Directory of Open Access Journals (Sweden)
Marco Malavolta
2018-01-01
Full Text Available The reactivation of senescence in cancer and the subsequent clearance of senescent cells are suggested as therapeutic intervention in the eradication of cancer. Several natural compounds that activate Nrf2 (nuclear factor erythroid-derived 2-related factor 2 pathway, which is involved in complex cytoprotective responses, have been paradoxically shown to induce cell death or senescence in cancer. Promoting the cytoprotective Nrf2 pathway may be desirable for chemoprevention, but it might be detrimental in later stages and advanced cancers. However, senolytic activity shown by some Nrf2-activating compounds could be used to target senescent cancer cells (particularly in aged immune-depressed organisms that escape immunosurveillance. We herein describe in vitro and in vivo effects of fifteen Nrf2-interacting natural compounds (tocotrienols, curcumin, epigallocatechin gallate, quercetin, genistein, resveratrol, silybin, phenethyl isothiocyanate, sulforaphane, triptolide, allicin, berberine, piperlongumine, fisetin, and phloretin on cellular senescence and discuss their use in adjuvant cancer therapy. In light of available literature, it can be concluded that the meaning and the potential of adjuvant therapy with natural compounds in humans remain unclear, also taking into account the existence of few clinical trials mostly characterized by uncertain results. Further studies are needed to investigate the therapeutic potential of those compounds that display senolytic activity.
Directory of Open Access Journals (Sweden)
Kai-Hsin Chang
2011-01-01
Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.
Directory of Open Access Journals (Sweden)
Hongming Lv
2018-03-01
Full Text Available Acetaminophen (APAP overdose-induced fatal hepatotoxicity is majorly characterized by overwhelmingly increased oxidative stress while enhanced nuclear factor-erythroid 2-related factor 2 (Nrf2 is involved in prevention of hepatotoxicity. Although Licochalcone A (Lico A upregulates Nrf2 signaling pathway against oxidative stress-triggered cell injury, whether it could protect from APAP-induced hepatotoxicity by directly inducing Nrf2 activation is still poorly elucidated. This study aims to explore the protective effect of Lico A against APAP-induced hepatotoxicity and its underlying molecular mechanisms. Our findings indicated that Lico A effectively decreased tert-butyl hydroperoxide (t-BHP- and APAP-stimulated cell apoptosis, mitochondrial dysfunction and reactive oxygen species generation and increased various anti-oxidative enzymes expression, which is largely dependent on upregulating Nrf2 nuclear translocation, reducing the Keap1 protein expression, and strengthening the antioxidant response element promoter activity. Meanwhile, Lico A dramatically protected against APAP-induced acute liver failure by lessening the lethality; alleviating histopathological liver changes; decreasing the alanine transaminase and aspartate aminotransferase levels, malondialdehyde formation, myeloperoxidase level and superoxide dismutase depletion, and increasing the GSH-to-GSSG ratio. Furthermore, Lico A not only significantly modulated apoptosis-related protein by increasing Bcl-2 expression, and decreasing Bax and caspase-3 cleavage expression, but also efficiently alleviated mitochondrial dysfunction by reducing c-jun N-terminal kinase phosphorylation and translocation, inhibiting Bax mitochondrial translocation, apoptosis-inducing factor and cytochrome c release. However, Lico A-inhibited APAP-induced the lethality, histopathological changes, hepatic apoptosis, and mitochondrial dysfunction in WT mice were evidently abrogated in Nrf2-/- mice. These
Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation
International Nuclear Information System (INIS)
Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han
2015-01-01
Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death
Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)
2015-09-25
Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.
Clinical factors related to schizophrenia relapse.
Porcelli, Stefano; Bianchini, Oriana; De Girolamo, Giovanni; Aguglia, Eugenio; Crea, Luciana; Serretti, Alessandro
2016-01-01
Relapses represent one of the main problems of schizophrenia management. This article reviews the clinical factors associated with schizophrenia relapse. A research of the last 22 years of literature data was performed. Two-hundred nineteen studies have been included. Three main groups of factors are related to relapse: factors associated with pharmacological treatment, add-on psychotherapeutic treatments and general risk factors. Overall, the absence of a maintenance therapy and treatment with first generation antipsychotics has been associated with higher risk of relapse. Further, psychotherapy add-on, particularly with cognitive behaviour therapy and psycho-education for both patients and relatives, has shown a good efficacy for reducing the relapse rate. Among general risk factors, some could be modified, such as the duration of untreated psychosis or the substance misuse, while others could not be modified as male gender or low pre-morbid level of functioning. Several classes of risk factors have been proved to be relevant in the risk of relapse. Thus, a careful assessment of the risk factors here identified should be performed in daily clinical practice in order to individualise the relapse risk for each patient and to provide a targeted treatment in high-risk subjects.
Zgleszewski, Steven E; Graham, Dionne A; Hickey, Paul R; Brustowicz, Robert M; Odegard, Kirsten C; Koka, Rahul; Seefelder, Christian; Navedo, Andres T; Randolph, Adrienne G
2016-02-01
Pediatric anesthesia-related cardiac arrest (ARCA) is an uncommon but potentially preventable adverse event. Infants and children with more severe underlying disease are at highest risk. We aimed to identify system- and anesthesiologist-related risk factors for ARCA. We analyzed a prospectively collected patient cohort data set of anesthetics administered from 2000 to 2011 to children at a large tertiary pediatric hospital. Pre-procedure systemic disease level was characterized by ASA physical status (ASA-PS). Two reviewers independently reviewed cardiac arrests and categorized their anesthesia relatedness. Factors associated with ARCA in the univariate analyses were identified for reevaluation after adjustment for patient age and ASA-PS. Cardiac arrest occurred in 142 of 276,209 anesthetics (incidence 5.1/10,000 anesthetics); 72 (2.6/10,000 anesthetics) were classified as anesthesia-related. In the univariate analyses, risk of ARCA was much higher in cardiac patients and for anesthesiologists with lower annual caseload and/or fewer annual days delivering anesthetics (all P risk adjustment for ASA-PS ≥ III and age ≤ 6 months, however, the association with lower annual days delivering anesthetics remained (P = 0.03), but the other factors were no longer significant. Case-mix explained most associations between higher risk of pediatric ARCA and anesthesiologist-related variables at our institution, but the association with fewer annual days delivering anesthetics remained. Our findings highlight the need for rigorous adjustment for patient risk factors in anesthesia patient safety studies.
Directory of Open Access Journals (Sweden)
Tamotsu Irino
Full Text Available Myeloproliferative neoplasms (MPN are multiple disease entities characterized by clonal expansion of one or more of the myeloid lineages (i.e. granulocytic, erythroid, megakaryocytic and mast cell. JAK2 mutations, such as the common V617F substitution and the less common exon 12 mutations, are frequently detected in such tumor cells and have been incorporated into the diagnostic criteria published by the World Health Organization since 2008. However, the mechanism by which these mutations contribute to MPN development is poorly understood. We examined gene expression profiles of MPN patients focusing on genes in the JAK-STAT signaling pathway using low-density real-time PCR arrays. We identified the following 2 upregulated genes in MPN patients: a known target of the JAK-STAT axis, SOCS3, and a potentially novel target, SPI1, encoding PU.1. Induction of PU.1 expression by JAK2 V617F in JAK2-wildtype K562 cells and its downregulation by JAK2 siRNA transfection in JAK2 V617F-positive HEL cells supported this possibility. We also found that the ABL1 kinase inhibitor imatinib was very effective in suppressing PU.1 expression in BCR-ABL1-positive K562 cells but not in HEL cells. This suggests that PU.1 expression is regulated by both JAK2 and ABL1. The contribution of the two kinases in driving PU.1 expression was dominant for JAK2 and ABL1 in HEL and K562 cells, respectively. Therefore, PU.1 may be a common transcription factor upregulated in MPN. PU.1 is a transcription factor required for myeloid differentiation and is implicated in erythroid leukemia. Therefore, expression of PU.1 downstream of activated JAK2 may explain why JAK2 mutations are frequently observed in MPN patients.
Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin
Directory of Open Access Journals (Sweden)
Montserrat Rojo de la Vega
2018-03-01
Full Text Available Environmental exposure to solar ultraviolet (UV radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana. Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches.
Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin
Rojo de la Vega, Montserrat; Zhang, Donna D.; Wondrak, Georg T.
2018-01-01
Environmental exposure to solar ultraviolet (UV) radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2)-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana). Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-)]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA)-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches. PMID:29636694
Chen, Yu-Wen; Chiu, Wen-Chin; Chou, Shah-Hwa; Su, Yu-Han; Huang, Ying-Fong; Lee, Yen-Lung; Yuan, Shyng-Shiou F; Lee, Yi-Chen
2017-10-01
Recurrent primary spontaneous pneumothorax (PSP) is a troublesome problem and a major concern for the patients. This study examined whether nuclear factor erythroid 2-related factor 2 (Nrf2) expression in alveolar type I pneumocytes was associated with the clinical manifestations of PSP patients including disease recurrence. Eighty-eight PSP patients who were managed with needlescopic video-assisted thoracoscopic surgery (NVATS) were included in this study. Immunohistochemistry (IHC) was assessed to determine Nrf2 expression in resected lung tissues and the results were correlated with clinicopathological characteristics by the chi-square or the Fisher's exact test. The prognostic value of Nrf2 for overall recurrence was evaluated by univariate and multivariable Cox regression model. The expression of Nrf2 was observed in type I pneumocytes of lung tissues from PSP patients by IHC. We found that low Nrf2 expression in PSP patients, especially in young (age ≤ 20, p = 0.033) and body mass index (BMI) ≥18 kg/m 2 (p = 0.019) groups, was significantly correlated with PSP recurrence. In the univariate and multivariate analyses, high Nrf2 expression was a significant protective factor for overall recurrence in PSP patients (univariate: p = 0.026; multivariate: p = 0.004). The expression level of Nrf2 in alveolar type I pneumocytes was a potential factor involved in PSP recurrence. Our findings suggest that elevated Nrf2 expression in PSP patients may be a promising way for reducing PSP recurrence. Copyright © 2017. Published by Elsevier Taiwan.
Nrf2 regulates cellular behaviors and Notch signaling in oral squamous cell carcinoma cells.
Fan, Hong; Paiboonrungruan, Chorlada; Zhang, Xinyan; Prigge, Justin R; Schmidt, Edward E; Sun, Zheng; Chen, Xiaoxin
2017-11-04
Oxidative stress is known to play a pivotal role in the development of oral squamous cell carcinoma (OSCC). We have demonstrated that activation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway has chemopreventive effects against oxidative stress-associated OSCC. However, Nrf2 have dual roles in cancer development; while it prevents carcinogenesis of normal cells, hyperactive Nrf2 also promotes the survival of cancer cells. This study is aimed to understand the function of Nrf2 in regulating cellular behaviors of OSCC cells, and the potential mechanisms through which Nrf2 facilitates OSCC. We established the Nrf2-overexpressing and Nrf2-knockdown OSCC cell lines, and examined the function of Nrf2 in regulating cell proliferation, migration, invasion, cell cycle and colony formation. Our data showed that Nrf2 overexpression promoted cancer phenotypes in OSCC cells, whereas Nrf2 silencing inhibited these phenotypes. In addition, Nrf2 positively regulated Notch signaling pathway in OSCC cells in vitro. Consistent with this observation, Nrf2 activation in Keap1 -/- mice resulted in not only hyperproliferation of squamous epithelial cells in mouse tongue as evidenced by increased expression of PCNA, but also activation of Notch signaling in these cells as evidenced by increased expression of NICD1 and Hes1. In conclusion, Nrf2 regulates cancer behaviors and Notch signaling in OSCC cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hogan David B
2009-09-01
Full Text Available Abstract Background The heterogeneity evident among home care clients highlights the need for greater understanding of the clinical and social determinants of multi-dimensional health-related quality of life (HRQL indices and of potential sex-differences in these determinants. We examined the relative contribution of social and clinical factors to HRQL among older home care clients and explored whether any of the observed associations varied by sex. Methods The Canadian-US sample included 514 clients. Self-reported HRQL was measured during in-home interviews (2002-04 using the Health Utilities Index Mark 2 (HUI2. Data on clients' sociodemographic, health and clinical characteristics were obtained with the Minimum Data Set for Home Care. The relative associations between clients' characteristics and HUI2 scores were examined using multivariable linear regression models. Results Women had a significantly lower mean HUI2 score than men (0.48, 95%CI 0.46-0.50 vs. 0.52, 0.49-0.55. Clients with distressed caregivers and poor self-rated health exhibited significantly lower HRQL scores after adjustment for a comprehensive list of clinical conditions. Several other factors remained statistically significant (arthritis, psychiatric illness, bladder incontinence, urinary tract infection or clinically important (reported loneliness, congestive heart failure, pressure ulcers correlates of lower HUI2 scores in adjusted analyses. These associations generally did not vary significantly by sex. Conclusion For females and males, HRQL scores were negatively associated with conditions predictive or indicative of disability and with markers of psychosocial stress. Despite sex differences in the prevalence of social and clinical factors likely to affect HRQL, few varied significantly by sex in their relative impact on HUI2 scores. Further exploration of differences in the relative importance of clinical and psychosocial well-being (e.g., loneliness to HRQL among
International Nuclear Information System (INIS)
Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.
1987-01-01
To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)
Medical residents' job satisfaction and their related factors.
Chung, Eun-Kyung; Han, Eui-Ryoung; Woo, Young-Jong
2013-03-01
This study was conducted to investigate medical residents' job satisfaction and their related factors to improve the quality of residency program. The study subjects were 159 medical residents being trained at Chonnam National University Hospital, South Korea, in 2011. The participants were asked to complete a short form Minnesota satisfaction questionnaire (MSQ). The mean score for 20 items on the short form MSQ varied between 2.91 and 3.64 on a 5-point Likert scale. The assessment of related factors with job satisfaction revealed that medical residents had higher levels for job satisfaction, particularly those who were women (beta=0.200, p=0.022), and those who had mentorship experience (beta=0.219, p=0.008). This study results indicate that we should expand and support the mentorship program during medical residency to promote job satisfaction.
Directory of Open Access Journals (Sweden)
Jung-Sheng Yu
Full Text Available Hepatitis C virus (HCV infection-induced oxidative stress is a major risk factor for the development of HCV-associated liver disease. Sulforaphane (SFN is an antioxidant phytocompound that acts against cellular oxidative stress and tumorigenesis. However, there is little known about its anti-viral activity. In this study, we demonstrated that SFN significantly suppressed HCV protein and RNA levels in HCV replicon cells and infectious system, with an IC50 value of 5.7 ± 0.2 μM. Moreover, combination of SFN with anti-viral drugs displayed synergistic effects in the suppression of HCV replication. In addition, we found nuclear factor erythroid 2-related factor 2 (Nrf2/HO-1 induction in response to SFN and determined the signaling pathways involved in this process, including inhibition of NS3 protease activity and induction of IFN response. In contrast, the anti-viral activities were attenuated by knockdown of HO-1 with specific inhibitor (SnPP and shRNA, suggesting that anti-HCV activity of SFN is dependent on HO-1 expression. Otherwise, SFN stimulated the phosphorylation of phosphoinositide 3-kinase (PI3K leading Nrf2-mediated HO-1 expression against HCV replication. Overall, our results indicated that HO-1 is essential in SFN-mediated anti-HCV activity and provide new insights in the molecular mechanism of SFN in HCV replication.
Directory of Open Access Journals (Sweden)
Ting Xia
2018-06-01
Full Text Available Shanxi aged vinegar (SAV is a typical fermented and antioxidant food, which has various health-promoting effects. This work aimed to explore the effects of SAV on alcohol-induced liver injury. A mice model of alcoholic liver injury was established to illuminate its potential mechanisms. All mice pretreated with SAV and then received an ethanol solution (50% w/v, 4.8 g/kg b.w.. The results showed that SAV ameliorated alcohol-induced histological changes and elevation of liver enzymes. SAV attenuated alcohol-induced oxidative stress by declining levels of hepatic oxidants, and restoring depletion of antioxidant enzyme activities in mice livers. Moreover, SAV alleviated alcohol-induced oxidative damage by activating nuclear factor erythroid-2-related factor 2 (Nrf2-mediated signal pathway. In addition, SAV prevented alcohol-induced inflammation by suppressing lipopolysaccharide (LPS level and activities of pro-inflammatory enzymes, and regulating inflammatory cytokines. SAV inhibited alcohol-induced inflammation through down-regulating the expression of Toll-like receptor 4 (TLR4-mediated inflammatory response. The findings provide crucial evidence for elucidating the hepatoprotective mechanisms of SAV and encourage the future application of SAV as a functional food for liver protection.
Directory of Open Access Journals (Sweden)
Prasuna Paluru
2014-03-01
Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.
The Relationship between Musculoskeletal Symptoms and Work-related Risk Factors in Hotel Workers.
Lee, Jin Woo; Lee, Ju Jong; Mun, Hyeon Je; Lee, Kyung-Jae; Kim, Joo Ja
2013-10-11
To identify work-related musculoskeletal symptoms and any associated work-related risk factors, focusing on structural labor factors among hotel workers. A total of 1,016 hotel workers (620 men and 396 women) were analyzed. The questionnaire surveyed participants' socio-demographics, health-related behaviors, job-related factors, and work-related musculoskeletal symptoms. Work-related musculoskeletal symptoms were assessed using the Nordic musculoskeletal questionnaire. All analyses were stratified by gender, and multiple logistic regression modeling was used to determine associations between work-related musculoskeletal symptoms and work-related risk factors. The risk of developing work-related musculoskeletal symptoms was 1.9 times higher among male workers in the kitchen department than males in the room department (OR = 1.92, 95% CI = 1.03-3.79), and 2.5 times higher among male workers with lower sleep satisfaction than those with higher sleep satisfaction (OR = 2.52, 95% CI = 1.57-4.04). All of the aforementioned cases demonstrated a statistically significant association with work-related musculoskeletal symptoms. Moreover, the risk of developing work-related musculoskeletal symptoms was 3.3 times higher among female workers aged between 30 and 34 than those aged 24 or younger (OR = 3.32, 95% CI = 1.56-7.04); 0.3 times higher among females in the back office department than those in the room department (OR = 0.34, 95% CI = 0.12-0.91); 1.6 times higher among females on shift schedules than those who were not (OR = 1.60, 95% CI = 1.02-2.59); 1.8 times higher among females who performed more intensive work than those who performed less intensive work (OR = 1.88, 95% CI = 1.17-3.02), and; 2.1 times higher among females with lower sleep satisfaction than those with higher sleep satisfaction (OR = 2.17, 95% CI = 1.34-3.50). All of the aforementioned cases also displayed a statistically significant association with work-related musculoskeletal symptoms. This study
Modeling the factors associating with health-related habits among Japanese students.
Mato, Mie; Tsukasaki, Keiko
2017-11-23
The aim of the present study was to clarify the structural relationship between health-related habits and psychosocial factors during adolescence/early adulthood. An anonymous, self-administered questionnaire was provided to 1141 third- and fourth-year students at eight academic departments from six universities in regional Japanese cities. Surveys included items addressing participants' demographic characteristics, psychosocial factors (individual-level social capital, self-efficacy, mental health (from health-related quality of life SF-36v2), and sense of coherence (SOC)), and health-related habits. A multiple indicator analysis based on structural equation modeling was conducted to examine the structural relationship between health-related habits and these factors. Valid responses were obtained from 952 participants. The final model demonstrated a high level of goodness of fit. While the path from SOC to health-related habits was significant, those from self-efficacy to health-related habits and from mental health to health-related habits were not significant. The path coefficient from SOC to health-related habits was greater than the path coefficient from background characteristics. In the multiple population comparison that considered gender, a nearly identical model was supported for men and women. Psychosocial factors related to health-related habits were social capital, self-efficacy, mental health, and SOC. Furthermore, it was suggested that SOC functions as an intervening factor for maintaining a healthy lifestyle. It was observed that individual psychosocial factors influence health-related habits more than their background characteristics. Findings highlight that supporting the building of social relationships and social environments is essential to promote a healthy lifestyle among university students. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Ulu, Ramazan; Gozel, Nevzat; Tuzcu, Mehmet; Orhan, Cemal; Yiğit, İrem Pembegül; Dogukan, Ayhan; Telceken, Hafize; Üçer, Özlem; Kemeç, Zeki; Kaman, Dilara; Juturu, Vijaya; Sahin, Kazim
2018-05-31
In the present study, we evaluated the effects of M. pruriens administration on metabolic parameters, oxidative stress and kidney nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) signaling pathways in high-fructose fed rats. Male rats (n = 28) were divided into 4 groups as control, M. pruriens, fructose, and M. pruriens plus fructose. All rats were fed a standard diet supplemented or no supplemented with M. pruriens (200 mg/kg/d by gavage). Fructose was given in drinking water for 8 weeks. High fructose consumption led to an increase in the serum level of glucose, triglyceride, urea and renal malondialdehyde (MDA) levels. Although M. pruriens treatment reduced triglyceride and MDA levels, it did not affect other parameters. M. pruriens supplementation significantly decreased the expression of NF-ҡB and decreased expression of Nrf2 and HO-1 proteins in the kidney. This study showed that the adverse effects of high fructose were alleviated by M. pruriens supplementation via modulation of the expression of kidney nuclear transcription factors in rats fed high fructose diet. Copyright © 2018 Elsevier Ltd. All rights reserved.
The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.
Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A
2010-10-28
Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.
Assessment of Factors Related to Auto-PEEP.
Natalini, Giuseppe; Tuzzo, Daniele; Rosano, Antonio; Testa, Marco; Grazioli, Michele; Pennestrì, Vincenzo; Amodeo, Guido; Marsilia, Paolo F; Tinnirello, Andrea; Berruto, Francesco; Fiorillo, Marialinda; Filippini, Matteo; Peratoner, Alberto; Minelli, Cosetta; Bernardini, Achille
2016-02-01
Previous physiological studies have identified factors that are involved in auto-PEEP generation. In our study, we examined how much auto-PEEP is generated from factors that are involved in its development. One hundred eighty-six subjects undergoing controlled mechanical ventilation with persistent expiratory flow at the beginning of each inspiration were enrolled in the study. Volume-controlled continuous mandatory ventilation with PEEP of 0 cm H2O was applied while maintaining the ventilator setting as chosen by the attending physician. End-expiratory and end-inspiratory airway occlusion maneuvers were performed to calculate respiratory mechanics, and tidal flow limitation was assessed by a maneuver of manual compression of the abdomen. The variable with the strongest effect on auto-PEEP was flow limitation, which was associated with an increase of 2.4 cm H2O in auto-PEEP values. Moreover, auto-PEEP values were directly related to resistance of the respiratory system and body mass index and inversely related to expiratory time/time constant. Variables that were associated with the breathing pattern (tidal volume, frequency minute ventilation, and expiratory time) did not show any relationship with auto-PEEP values. The risk of auto-PEEP ≥5 cm H2O was increased by flow limitation (adjusted odds ratio 17; 95% CI: 6-56.2), expiratory time/time constant ratio 15 cm H2O/L s (3; 1.3-6.9), age >65 y (2.8; 1.2-6.5), and body mass index >26 kg/m(2) (2.6; 1.1-6.1). Flow limitation, expiratory time/time constant, resistance of the respiratory system, and obesity are the most important variables that affect auto-PEEP values. Frequency expiratory time, tidal volume, and minute ventilation were not independently associated with auto-PEEP. Therapeutic strategies aimed at reducing auto-PEEP and its adverse effects should be primarily oriented to the variables that mainly affect auto-PEEP values. Copyright © 2016 by Daedalus Enterprises.
Aerobic fitness related to cardiovascular risk factors in young children
DEFF Research Database (Denmark)
Dencker, Magnus; Thorsson, Ola; Karlsson, Magnus K
2012-01-01
Low aerobic fitness (maximum oxygen uptake (VO(2PEAK))) is predictive for poor health in adults. In a cross-sectional study, we assessed if VO(2PEAK) is related to a composite risk factor score for cardiovascular disease (CVD) in 243 children (136 boys and 107 girls) aged 8 to 11 years. VO(2PEAK...
Maurer, Britta; Busch, Nicole; Jüngel, Astrid; Pileckyte, Margarita; Gay, Renate E; Michel, Beat A; Schett, Georg; Gay, Steffen; Distler, Jörg; Distler, Oliver
2009-12-08
Microvascular damage is one of the first pathological changes in systemic sclerosis. In this study, we investigated the role of Fos-related antigen-2 (Fra-2), a transcription factor of the activator protein-1 family, in the peripheral vasculopathy of systemic sclerosis and examined the underlying mechanisms. Expression of Fra-2 protein was significantly increased in skin biopsies of systemic sclerosis patients compared with healthy controls, especially in endothelial and vascular smooth muscle cells. Fra-2 transgenic mice developed a severe loss of small blood vessels in the skin that was paralleled by progressive skin fibrosis at 12 weeks of age. The reduction in capillary density was preceded by a significant increase in apoptosis in endothelial cells at week 9 as detected by immunohistochemistry. Similarly, suppression of Fra-2 by small interfering RNA prevented human microvascular endothelial cells from staurosporine-induced apoptosis and improved both the number of tubes and the cumulative tube lengths in the tube formation assay. In addition, cell migration in the scratch assay and vascular endothelial growth factor-dependent chemotaxis in a modified Boyden chamber assay were increased after transfection of human microvascular endothelial cells with Fra-2 small interfering RNA, whereas proliferation was not affected. Fra-2 is present in human systemic sclerosis and may contribute to the development of microvasculopathy by inducing endothelial cell apoptosis and by reducing endothelial cell migration and chemotaxis. Fra-2 transgenic mice are a promising preclinical model to study the mechanisms and therapeutic approaches of the peripheral vasculopathy in systemic sclerosis.
Lansoprazole halts contrast induced nephropathy through activation of Nrf2 pathway in rats.
Khaleel, Sahar A; Alzokaky, Amany A; Raslan, Nahed A; Alwakeel, Asmaa I; Abd El-Aziz, Heba G; Abd-Allah, Adel R
2017-05-25
Contrast-induced nephropathy (CIN) is an important cause of acute kidney injury characterized by significant mortality and morbidity. To date, there is no successful protective regimen for CIN especially in poor kidney function patients. Lansoprazole has been shown to exert antioxidant action through induction of nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway. The aim of the present study is to investigate the potential of lansoprazole to activate Nrf2 pathway in the kidney and consequently to protect against oxidative stress induced by iodinated contrast media. Lansoprazole, at a dose of 100 mg/kg, showed a significant induction of Nrf2 mRNA after 3 h. Administration of contrast media induced significant increase in serum creatinine and blood urea nitrogen, histological deterioration, and reduction in total antioxidant capacity. Moreover, it instigated the defensive Nrf2 gene expression and immunoreactivity. In addition, there were overexpression of HO-1, caspase 3, p53 and IL6 genes and downregulation of Bcl2 gene. Pre-treatment with lansoprazole (100 mg/kg) ameliorated the nephrotoxicity parameters and oxidative stress, improved histological lesions, and hijacked apoptotic and inflammatory markers that were provoked by contrast media. In conclusion, lansoprazole attenuates experimental CIN which might be due to activation of Nrf2 antioxidant defence pathway. These findings highlight the potential benefit of incorporating lansoprazole in the protective regimen against CIN especially for susceptible patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Wang, Yeying; Chai, Yanling; He, Xiaojie; Ai, Li; Sun, Xia; Huang, Yiling; Li, Yongxia
2017-10-01
Obstructive sleep apnea (OSA) is a disorder with high morbidity in adults. OSA damages multiple organs and tissues, including the cardiovascular and cerebrovascular systems, the metabolism system, the lungs, liver and heart. OSA-induced damage is earliest and greatest to the pulmonary tissue. The present study established a rat OSA model of differing severity by inducing intermittent hypoxia with different concentrations of O 2 and it was determined that OSA caused a severe oxidative stress response and pulmonary inflammation in a dose-dependent manner. OSA increased serum levels of C-reactive protein and 8-isoprostane and elevated the expression of malondialdehyde, tumor necrosis factor α, interleukin (IL)-1β and IL-6 in the pulmonary tissue. Furthermore, the expression of two important antioxidants, superoxide dismutase and glutathione, was downregulated following intermittent hypoxia. By contrast, levels of cylooxygenase 2 and inducible nitric oxide synthase, which are crucial in the antioxidative response, increased. In addition, OSA activates the nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase (OH)-1 antioxidative signaling pathway. Finally, all increases and decreases in levels of inflammatory and antioxidative substances were dependent on oxygen concentrations. Therefore, the present study demonstrated that OSA, simulated by intermittent hypoxia, caused an oxidative stress response and pulmonary inflammation, and activated the canonical antioxidative Nrf2/HO-1 signaling pathway in a dose-dependent manner. These results may facilitate the development of clinical therapies to treat pulmonary diseases caused by OSA.
Lee, Bao-Hong; Hsu, Wei-Hsuan; Huang, Tao; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming
2013-02-13
Hyperglycemia is associated with advanced glycation end products (AGEs). This study was designed to evaluate the inhibitory effects of monascin on receptor for advanced glycation end product (RAGE) signal and THP-1 monocyte inflammation after treatment with S100b, a specific ligand of RAGE. Monascin inhibited cytokine production by S100b-treated THP-1 monocytes via up-regulation of nuclear factor-erythroid 2-related factor-2 (Nrf2) and alleviated p47phox translocation to the membrane. Methylglyoxal (MG, 600 mg/kg bw) was used to induce diabetes in Wistar rats. Inhibitions of RAGE and p47phox by monascin were confirmed by peripheral blood mononuclear cells (PBMCs) of MG-induced rats. Silymarin (SM) was used as a positive control group. It was found that monascin promoted heme oxygenase-1 (HO-1) expression mediated by Nrf2. Suppressions of AGEs, tumor necrosis factor-α (TNF-α), and interleukin-1β (IL-β) in serum of MG-induced rats were attenuated in the monascin administration group treated with retinoic acid (RA). RA treatment resulted in Nrf2 inactivation by increasing RA receptor-α (RARα) activity, suggesting that RA acts as an inhibitor of Nrf2. The results showed that monascin exerted anti-inflammatory and antioxidative effects mediated by Nrf2 to prevent the development of diseases such as type 2 diabetes caused by inflammation.
Factors related to suicide attempts among individuals with major depressive disorder
Directory of Open Access Journals (Sweden)
Niwatananun W
2012-04-01
Full Text Available Chidchanok Ruengorn1,2, Kittipong Sanichwankul3, Wirat Niwatananun2, Suwat Mahatnirunkul3, Wanida Pumpaisalchai3, Jayanton Patumanond11Clinical Epidemiology Unit, Faculty of Medicine, 2Department of Pharmaceutical Care, Faculty of Pharmacy, Chiang Mai University, Chiang Mai, Thailand; 3Suanprung Psychiatric Hospital, Chiang Mai, ThailandBackground: Major depressive disorder (MDD is the leading cause of suicidal behaviors. Risk related to suicide attempts among individuals with MDD remains uninvestigated in upper northern Thailand, where the completed suicide rate is the highest in the nation.Objective: To examine risk related to suicide attempts among individuals with MDD.Methods: Individuals diagnosed with MDD using the International Statistical Classification of Diseases and Related Health Problems 10th Revision (ICD-10, codes F32.x and F33.x, seeking care at Suanprung Psychiatric Hospital between October 2006 and May 2009 were eligible. All individuals with MDD admitted due to suicide attempts were defined as cases (n = 186, and four controls per case were selected from those who did not attempt suicide on the same day or within a week of case selection (n = 914. Their medical charts were reviewed for sociodemographic and clinical factors influencing suicide attempts using multivariable logistic regression analysis.Results: Factors related to suicide attempts were stressful life events (adjusted odds ratio [OR], 2.32; 95% confidence interval [CI]: 1.27–4.24, alcohol use (adjusted OR, 2.08; 95% CI: 1.29–3.34, intermittent or poor psychiatric medications adherence (adjusted OR, 2.25; 95% CI: 1.44–3.51, up to two previous suicide attempts (adjusted OR, 3.64; 95% CI: 2.32–5.71, more than two previous suicide attempts (adjusted OR, 11.47; 95% CI: 5.73–22.95, and prescribed antipsychotics (adjusted OR, 3.84; 95% CI: 2.48–5.95. Risk factors that were inversely related to suicide attempts were increasing years of MDD treatment; one to
Work-related risk factors for workplace violence among Korean employees.
Lee, Hye-Eun; Kim, Hyoung-Ryoul; Park, Jung Sun
2014-01-01
The aim of this study was to identify work-related risk factors for workplace violence in a representative sample of Korean employees. We analyzed the associations between work-related factors and workplace violence in 29,171 employees using data from the 2011 Korean Working Conditions Survey. The survey included questions about verbal abuse, unwanted sexual attention, threats and behavior that humiliated the victim, physical violence, bullying/harassment and sexual harassment, and a respondent who answered yes to any of these 6 items was considered a victim of workplace violence. The prevalences of verbal abuse, unwanted sexual attention and threats/behavior that humiliated victims in the month preceding the study were 4.8, 1.0 and 1.5%, respectively. The prevalences of physical violence, bullying/harassment and sexual harassment in the year preceding the study were 0.7, 0.3 and 0.4%, respectively. Service workers had higher prevalences of overall workplace violence. Non-regular workers (OR=2.38, 95% CI=2.01-2.84), working more than 60 hours per week as opposed to 40-48 hours per week (OR=1.83, 95% CI=1.45-2.31) and night shift work (OR=1.88, 95% CI=1.54-2.30) were significant risk factors associated with workplace violence. Long working hours, job insecurity and night shift work were associated with a significant increase in workplace violence among Korean employees.
Hemoglobin genetics: recent contributions of GWAS and gene editing
Smith, Elenoe C.; Orkin, Stuart H.
2016-01-01
The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226
Medication Adherence and its Related Factors in Patients with Type II Diabetes
Directory of Open Access Journals (Sweden)
Behzad Gholamaliei
2016-03-01
Full Text Available Background and Objectives: Low levels of medication adherence in patients with type 2 diabetes is one of the greatest challenges in the treatment and control of diabetes. This study was designed to determine medication adherence and its related factors in patients with type II diabetes. Materials and Methods: In this cross-sectional study, a total of 300patients with type 2diabetes records in the health centers of Tuyserkan city were randomly selected in 2015. Data collection instrument was a self-made questionnaire, which consisted of factors related to the medication adherence. Questionnaires were completed after confirmation of validity and reliability, by interviews. To analyze the data, descriptive and inferential statistics (T-test, AnOVA, Simple and multiple linear regression were applied, using SPSS software, version 19. Results: Overall, %26.3 of patients were male and %73.7 were female. Also, %65 of patients were illiterate, %24 had some degree of symptoms, and %59.4 had poor medication adherence. There was a significant relationship between age, education, patient care and treatment expenditure, health care team and health system, therapy-related factors and condition-related factors, beliefs about illness, efficacy, and concerns about drugs and medication adherence (P < 0.05. Conclusions: This study showed that medication adherence in patients with diabetes was not suitable and individual, economical and social factors were influential.Therefore, the role of these factors must be considered when designing intervention programs.
The extrahepatic role of TFR2 in iron homeostasis
Directory of Open Access Journals (Sweden)
Laura eSilvestri
2014-05-01
Full Text Available Transferrin receptor 2 (TFR2, a protein homologous to the cell iron importer transferrin receptor 1 (TFR1, is expressed in the liver and erythroid cells and is reported to bind diferric transferrin, although at lower affinity than TFR1. TFR2 gene is mutated in type 3 hemochromatosis, a disorder characterized by iron overload and inability to upregulate hepcidin in response to iron. Liver TFR2 is considered a sensor of diferric transferrin, possibly in a complex with HFE. In erythroid cells TFR2 is a partner of erythropoietin receptor (EPOR and stabilizes the receptor on the cell surface. However, Tfr2 null mice as well as TFR2 hemochromatosis patients do not show defective erythropoiesis and tolerate repeated phlebotomy. The iron deficient Tfr2-Tmprss6 double knock out mice have higher red cells count and more severe microcytosis than the liver specific Tfr2 and Tmprss6 double knock out mice. TFR2 in the bone marrow might be a sensor of iron deficiency that protects against excessive microcytosis in a way that involves EPOR, although the mechanisms remain to be worked out.
Kim, Sin Gon; Kim, Nam Hoon; Ku, Bon Jeong; Shon, Ho Sang; Kim, Doo Man; Park, Tae Sun; Kim, Yong-Seong; Kim, In Joo; Choi, Dong Seop
2017-05-01
To assess the time to initiation of insulin therapy, and concurrently investigate both patient- and physician-related factors associated with delaying insulin therapy in Korean patients with type 2 diabetes uncontrolled by oral hypoglycemic agents (OHAs). This prospective, observational disease registry study was carried out across 69 centers in Korea. Type 2 diabetes patients who had received two or more OHAs within the past 5 years, had a glycated hemoglobin ≥8% in the past 6 months and had not received insulin were included. Data recorded on data collection forms during a 12-month period were analyzed. Of 2168 patients enrolled, 1959 were evaluated and classified as the insulin-initiated or insulin-delayed group. Insulin was prescribed for just 20% of the patients during a 1-year follow-up period, and less than half (44.5%) of the patients who were taking two OHAs started insulin after 6 years. Patient-related factors for delay in insulin initiation included older age, shorter duration of diabetes and lower glycated hemoglobin. Physician-related factors included age (~50 to 1000) of patients consulted per month. Patient refusal (33.6%) and physicians' concerns of patient non-compliance (26.5%) were the major physician-reported reasons for delaying insulin therapy. Inconvenience of insulin therapy (51.6%) and fear of injection (48.2%) were the major reasons for patient refusal. Insulin initiation is delayed in patients with type 2 diabetes uncontrolled by two or more OHAs in Korea. Patient- and physician-related factors associated with this delay need to be addressed for better diabetes management. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.
Directory of Open Access Journals (Sweden)
Woong Jin Bae
2017-01-01
Full Text Available The Korean herbal formulation Ojayeonjonghwan is used for improving late-onset hypogonadism (LOH symptoms such as erectile dysfunction (ED. A previous research suggested that a modified Ojayeonjonghwan (KH-204 could be used as an alternative to the treatment for ED. The pharmacological effects were examined in different conditions, including in vitro and in vivo. We measured the survival rate of TM3 Leydig cells under the oxidative stress condition. The s.c. injection of leuprorelin was used to induce androgen deprivation. We measured serum testosterone levels, oxidative stress, and apoptosis. The results of the treatment by KH-204 (1 preserved TM3 cells from oxidative stress by improving the expression of nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase-1 (HO-1; (2 lowered the expression of transforming growth factor-beta (TGF-β 1/SMAD; (3 increased the average of serum testosterone in androgen-deprived male rats; (4 kept the activation of spermatogenesis; (5 upgraded the contents of 8-hydroxy-20-deoxyguanosine (8-OHdG and degraded the contents of superoxide dismutase (SOD; and (6 reduced apoptosis. We studied that KH-204 improved testicular dysfunction in LOH. It is likely, at least in part, to degrade oxidative stress through the Nrf2/HO-1 pathway. These findings may offer credible evidences for the use of new alternative therapies to treat LOH.
[Risk factors related to surgical site infection in elective surgery].
Angeles-Garay, Ulises; Morales-Márquez, Lucy Isabel; Sandoval-Balanzarios, Miguel Antonio; Velázquez-García, José Arturo; Maldonado-Torres, Lulia; Méndez-Cano, Andrea Fernanda
2014-01-01
The risk factors for surgical site infections in surgery should be measured and monitored from admission to 30 days after the surgical procedure, because 30% of Surgical Site Infection is detected when the patient was discharged. Calculate the Relative Risk of associated factors to surgical site infections in adult with elective surgery. Patients were classified according to the surgery contamination degree; patient with surgery clean was defined as no exposed and patient with clean-contaminated or contaminated surgery was defined exposed. Risk factors for infection were classified as: inherent to the patient, pre-operative, intra-operative and post-operative. Statistical analysis; we realized Student t or Mann-Whitney U, chi square for Relative Risk (RR) and multivariate analysis by Cox proportional hazards. Were monitored up to 30 days after surgery 403 patients (59.8% women), 35 (8.7%) developed surgical site infections. The factors associated in multivariate analysis were: smoking, RR of 3.21, underweight 3.4 hand washing unsuitable techniques 4.61, transfusion during the procedure 3.22, contaminated surgery 60, and intensive care stay 8 to 14 days 11.64, permanence of 1 to 3 days 2.4 and use of catheter 1 to 3 days 2.27. To avoid all risk factors is almost impossible; therefore close monitoring of elective surgery patients can prevent infectious complications.
Habte-Tsion, Habte-Michael; Ren, Mingchun; Liu, Bo; Ge, Xianping; Xie, Jun; Chen, Ruli
2016-04-01
A 9-week feeding trial was conducted to investigate the effects of graded dietary threonine (Thr) levels (0.58-2.58%) on the hematological parameters, immune response, antioxidant status and hepatopancreatic gene expression of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream. For this purpose, 3 tanks were randomly arranged and assigned to each experimental diet. Fish were fed with their respective diet to apparent satiation 4 times daily. The results indicated that white blood cell, red blood cell and haemoglobin significantly responded to graded dietary Thr levels, while hematocrit didn't. Complement components (C3 and C4), total iron-binding capacity (TIBC), immunoglobulin M (IgM), superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) increased with increasing dietary Thr levels up to 1.58-2.08% and thereafter tended to decrease. Dietary Thr regulated the gene expressions of Cu/Zn-SOD, Mn-SOD and CAT, GPx1, glutathione S-transferase mu (GST), nuclear factor erythroid 2-related factor 2 (Nrf2), heat shock protein-70 (Hsp70), tumor necrosis factor-alpha (TNF-α), apolipoprotein A-I (ApoA1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and fructose-bisphosphate aldolase B (ALDOB); while the gene expression of peroxiredoxin II (PrxII) was not significantly modified by graded Thr levels. These genes are involved in different functions including antioxidant, immune, and defense responses, energy metabolism and protein synthesis. Therefore, this study could provide a new molecular tool for studies in fish immunonutrition and shed light on the regulatory mechanisms that dietary Thr improved the antioxidant and immune capacities of fish. Copyright © 2015 Elsevier Ltd. All rights reserved.
Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias.
Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F
1997-02-01
The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.
Sun, Xinrong; Chen, Lu; Yan, Wen
2017-06-01
Childhood asthma, an airway inflammatory disease, is a serious threat to the child's quality of life. Recently, TIPE2 expression was reported to be decreased in children with asthma. Therefore, additional studies focusing on TIPE2 might provide an approach for treating childhood asthma. In this study, we found that TIPE2 was poorly expressed in hyperstretched human bronchial epithelial cells (BEAS-2B). TIPE2 overexpression also significantly suppressed the stretch-induced secretion of asthma-related inflammatory factors (TNF-α, TSLP, MMP-9, and VEGF). In contrast, TIPE2 inhibition significantly promoted the secretion of TNF-α, TSLP, MMP-9, and VEGF. Furthermore, overexpression of TIPE2 remarkably inhibited the activation of Wnt/β-catenin in hyperstretched BEAS-2B cells, while siTIPE2 activated Wnt/β-catenin in hyperstretched BEAS-2B cells. Further analysis showed that the Wnt/β-catenin signal inhibitor Dkk-1 could further enhance the TIPE2-induced suppression of Wnt/β-catenin signaling, which also suppressed the siTIPE2-induced secretion of TNF-α, TSLP, MMP-9, and VEGF in hyperstretched BEAS-2B cells. Dkk-1 reversed the effects of siRNA-TIPE2 on Wnt/β-catenin signaling and inflammatory cytokines. In summary, we have exhibited that TIPE2 inhibited the expression of asthma-related inflammatory factors in hyperstretched BEAS-2B cells by suppressing the Wnt/β-catenin signaling pathway. TIPE2 may be involved in airway inflammation during asthma attack, and it may be used as a potential therapeutic target for bronchial epithelial inflammation in childhood asthma.
Factors related to attrition from trauma-focused cognitive behavioral therapy.
Wamser-Nanney, Rachel; Steinzor, Cazzie E
2017-04-01
Attrition from child trauma-focused treatments such as Trauma-Focused Cognitive Behavioral Therapy (TF-CBT) is common; yet, the factors of children who prematurely terminate are unknown. The aim of the current study was to identify risk factors for attrition from TF-CBT. One hundred and twenty-two children (ages 3-18; M=9.97, SD=3.56; 67.2% females; 50.8% Caucasian) who received TF-CBT were included in the study. Demographic and family variables, characteristics of the trauma, and caregiver- and child-reported pretreatment symptoms levels were assessed in relation to two operational definitions of attrition: 1) clinician-rated dropout, and 2) whether the child received an adequate dose of treatment (i.e., 12 or more sessions). Several demographic factors, number of traumatic events, and children's caregiver-rated pretreatment symptoms were related to clinician-rated dropout. Fewer factors were associated with the adequate dose definition. Child Protective Services involvement, complex trauma exposure, and child-reported pretreatment trauma symptoms were unrelated to either attrition definition. Demographics, trauma characteristics, and level of caregiver-reported symptoms may help to identify clients at risk for premature termination from TF-CBT. Clinical and research implications for different operational definitions and suggestions for future work will be presented. Published by Elsevier Ltd.
Curcumin ameliorates dopaminergic neuronal oxidative damage via activation of the Akt/Nrf2 pathway.
Cui, Qunli; Li, Xin; Zhu, Hongcan
2016-02-01
Parkinson's disease (PD) is an age-related complex neurodegenerative disease that affects ≤ 80% of dopaminergic neurons in the substantia nigra pars compacta (SNpc). It has previously been suggested that mitochondrial dysfunction, oxidative stress and oxidative damage underlie the pathogenesis of PD. Curcumin, which is a major active polyphenol component extracted from the rhizomes of Curcuma longa (Zingiberaceae), has been reported to exert neuroprotective effects on an experimental model of PD. The present study conducted a series of in vivo experiments, in order to investigate the effects of curcumin on behavioral deficits, oxidative damage and related mechanisms. The results demonstrated that curcumin was able to significantly alleviate motor dysfunction and increase suppressed tyrosine hydroxylase (TH) activity in the SNpc of rotenone (ROT)-injured rats. Biochemical measurements indicated that rats pretreated with curcumin exhibited increased glutathione (GSH) levels, and reduced reactive oxygen species activity and malondialdehyde content. Mechanistic studies demonstrated that curcumin significantly restored the expression levels of heme oxygenase-1 and quinone oxidoreductase 1, thus ameliorating ROT-induced damage in vivo, via the phosphorylation of Akt and nuclear factor erythroid 2-related factor 2 (Nrf2). Further studies indicated that the Akt/Nrf2 signaling pathway was associated with the protective role of curcumin in ROT-treated rats. Inhibiting the Akt/Nrf2 pathway using a lentiviral vector containing Nrf2-specific short hairpin RNA, or the phosphoinositide 3-kinase inhibitor LY294002, markedly reduced the expression levels of TH and GSH, ultimately attenuating the neuroprotective effects of curcumin against oxidative damage. These results indicated that curcumin was able to significantly ameliorate ROT-induced dopaminergic neuronal oxidative damage in the SNpc of rats via activation of the Akt/Nrf2 signaling pathway.
DEFF Research Database (Denmark)
Meyer, Maria Kristine Hagelskær; Køster, Brian; Juul, Lise
2017-01-01
Sunbed use is associated with an increased risk for skin cancer and is particularly dangerous for younger persons. The objective of this study was to assess how demographic factors, health-related behaviours and appearance-related factors are associated with sunbed use. Cross-sectional data from...... a smoker, been binge-drinking, longer duration of exercise and been dieting were also associated with sunbed use. For females, poor dietary habits were also associated with sunbed use. Feeling overweight was associated with lower odds for sunbed use for males, but with higher odds for females. Lower body......-related factors and sunbed use. Understanding these relations could help to identify high-risk groups and guide preventive strategies for sunbed use and skin cancer prevention....
Factors Relating to Self-Efficacy Among Psychiatric Nurses.
Yada, Hironori; Kobayashi, Mako; Odachi, Ryo; Yamane, Toshie
This study aimed to clarify the factors related to self-efficacy experienced by psychiatric nurses. Analysis of qualitative descriptive data from a free self-description questionnaire administered to 16 psychiatric nurses working in psychiatric hospitals revealed 24 codes across the following 8 categories as factors that increase self-efficacy: A1. possibility of practical use in nursing, A2. nursing judgment, A3. improvement of psychiatric symptoms, A4. the patients presenting a positive attitude, A5. building a relationship of trust with the patients, A6. building a relationship of trust with other nurses, A7. work progressing according to plan and A8. team medical practice. Twenty-five codes across the following 10 categories were identified as factors that decrease self-efficacy: B1. lack of communication, B2. uncertainty in caregiving, B3. recurrence of psychiatric symptoms, B4. feeling overpowered by a patient, B5. sense of being too busy to work adequately, B6. difficulty in bringing about self-improvement, B7. sense of loss regarding one's role as a nurse, B8. lack of physical strength, B9. mechanical performance of nursing and B10. fluctuating view of nursing due to mistakes. These factors require intervention for psychiatric nurses' self-efficacy.
Mortality-related Factors in Patients with Malignant Obstructive Jaundice.
Kurniawan, Juferdy; Hasan, Irsan; Gani, Rino Alvani; Simadibrata, Marcellus
2016-10-01
to obtain survival rate and mortality-related factors of malignant obstructive jaundice patients. all medical records of obstructive jaundice inpatient at Cipto Mangunkusumo Hospital, Jakarta from January 2010 to December 2013 were reviewed retrospectively. The following factors were analyzed in terms of mortality: age, gender, sepsis, hypoalbumin, serum bilirubin level, serum CA 19-9 level, billiary drainage, non-ampulla Vateri carcinoma, and comorbid factors. total 181 out of 402 patients were enrolled in this study with male proportion was 58.6%, and patients aged 50 years or above was 57.5%. Multivariate analysis showed that only sepsis, unsuccessful or no prior biliary drainage and Charlson comorbid score ≥4 were independent predictors of mortality. Patients with significant prognostic factors had median survival 14 days compared with overall median survival 26 days. Score ≥2 identified as the highest prognostic score threshold with sensitivity 68%, specificity 75%, and AUC on ROC curve 0.769. sepsis, unsuccessful or no prior bilirary drainage, and Charlson comorbid score ≥4 are factors significantly associated with shortened survival in malignant obstructive jaundice patients. Prognostic score ≥2 was determined to classify patients into high risk mortality group. Mortality of patients with those significant prognostic factors can be predicted in 76.9%.
Energy Technology Data Exchange (ETDEWEB)
Shinkai, Yasuhiro [Environmental Biology Laboratory, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575 (Japan); Kimura, Tomoki [Faculty of Science and Engineering, Setsunan University, 17-8 Ikedanaka-machi, Neyagawa, Osaka 572-8508 (Japan); Itagaki, Ayaka [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Yamamoto, Chika [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi, Chiba 274-8510 (Japan); Taguchi, Keiko; Yamamoto, Masayuki [Department of Medical Biochemistry, Tohoku University Graduate School of Medicine, 2-1 Seiryo-cho, Aoba-ku, Sendai 980-8575 (Japan); Kumagai, Yoshito, E-mail: yk-em-tu@md.tsukuba.ac.jp [Environmental Biology Laboratory, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575 (Japan); Kaji, Toshiyuki, E-mail: t-kaji@rs.tus.ac.jp [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Faculty of Pharmaceutical Sciences, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510 (Japan)
2016-03-15
Cadmium is an environmental electrophile that modifies protein reactive thiols such as Kelch-like ECH-associated protein 1 (Keap1), a negative regulator of nuclear factor-erythroid 2-related factor 2 (Nrf2). In the present study, we investigated a role of the Keap1–Nrf2 system in cellular response to cadmium in vascular endothelial cells. Exposure of bovine aortic endothelial cells to cadmium resulted in modification of Keap1 and Nrf2 activation, thereby up-regulating not only its typical downstream proteins but also metallothionein-1/2. Experiments with siRNA-mediated knockdown of Nrf2 or Keap1 supported participation of the Keap1–Nrf2 system in the modulation of metallothionein-1/2 expression. Furthermore, chromatin immunoprecipitation assay showed that Nrf2 was recruited to the antioxidant response element of the promoter region of the bovine metallothionein-2 gene in the presence of cadmium. These results suggest that the transcription factor Nrf2 plays, at least in part, a role in the changes in metallothionein expression mediated by exposure to cadmium. - Highlights: • Role of the Keap1–Nrf2 system in cellular response to cadmium was examined. • We used bovine aortic endothelial cells as a model of the vascular endothelium. • Exposure of cells to cadmium resulted in modification of Keap1 and Nrf2 activation. • Keap1–Nrf2 system participated in the modulation of metallothionein-1/2 expression. • Nrf2 was recruited to the antioxidant response element of MT2 promoter region.
Morale as a Protection Factor against Mission Related Stress
2006-04-01
Inventory [34]. Morale as a Protection Factor against Mission Related Stress RTO-MP HFM-134 10 - 7 - Inventario de Valoración y Afrontamiento...17-37. [27] Miguel-Tobal, J. J. and Cano Vindel, A. (1986). Inventario de Situaciones y Respuestas de Ansiedad. Madrid: Tea Ediciones. (2ª Edic...Psychology, 56, 2, 267-283. [35] Cano Vindel, A. and Miguel-Tobal, J. J. (1992). Inventario de Valoración y Afrontamiento (IVA). Mimeo: Universidad
Asthma-Related School Absenteeism, Morbidity, and Modifiable Factors.
Hsu, Joy; Qin, Xiaoting; Beavers, Suzanne F; Mirabelli, Maria C
2016-07-01
Asthma is a leading cause of chronic disease-related school absenteeism. Few data exist on how information on absenteeism might be used to identify children for interventions to improve asthma control. This study investigated how asthma-related absenteeism was associated with asthma control, exacerbations, and associated modifiable risk factors using a sample of children from 35 states and the District of Columbia. The Behavioral Risk Factor Surveillance System Child Asthma Call-back Survey is a random-digit dial survey designed to assess the health and experiences of children aged 0-17 years with asthma. During 2014-2015, multivariate analyses were conducted using 2006-2010 data to compare children with and without asthma-related absenteeism with respect to clinical, environmental, and financial measures. These analyses controlled for sociodemographic and clinical characteristics. Compared with children without asthma-related absenteeism, children who missed any school because of asthma were more likely to have not well controlled or very poorly controlled asthma (prevalence ratio=1.50; 95% CI=1.34, 1.69) and visit an emergency department or urgent care center for asthma (prevalence ratio=3.27; 95% CI=2.44, 4.38). Mold in the home and cost as a barrier to asthma-related health care were also significantly associated with asthma-related absenteeism. Missing any school because of asthma is associated with suboptimal asthma control, urgent or emergent asthma-related healthcare utilization, mold in the home, and financial barriers to asthma-related health care. Further understanding of asthma-related absenteeism could establish how to most effectively use absenteeism information as a health status indicator. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
William P Lafuse
Full Text Available Leishmania donovani is a parasite that causes visceral leishmaniasis by infecting and replicating in macrophages of the bone marrow, spleen, and liver. Severe anemia and leucopenia is associated with the disease. Although immune defense mechanisms against the parasite have been studied, we have a limited understanding of how L. donovani alters hematopoiesis. In this study, we used Syrian golden hamsters to investigate effects of L. donovani infection on erythropoiesis. Infection resulted in severe anemia and leucopenia by 8 weeks post-infection. Anemia was associated with increased levels of serum erythropoietin, which indicates the hamsters respond to the anemia by producing erythropoietin. We found that infection also increased numbers of BFU-E and CFU-E progenitor populations in the spleen and bone marrow and differentially altered erythroid gene expression in these organs. In the bone marrow, the mRNA expression of erythroid differentiation genes (α-globin, β-globin, ALAS2 were inhibited by 50%, but mRNA levels of erythroid receptor (c-kit, EpoR and transcription factors (GATA1, GATA2, FOG1 were not affected by the infection. This suggests that infection has a negative effect on differentiation of erythroblasts. In the spleen, erythroid gene expression was enhanced by infection, indicating that the anemia activates a stress erythropoiesis response in the spleen. Analysis of cytokine mRNA levels in spleen and bone marrow found that IFN-γ mRNA is highly increased by L. donovani infection. Expression of the IFN-γ inducible cytokine, TNF-related apoptosis-inducing ligand (TRAIL, was also up-regulated. Since TRAIL induces erythroblasts apoptosis, apoptosis of bone marrow erythroblasts from infected hamsters was examined by flow cytometry. Percentage of erythroblasts that were apoptotic was significantly increased by L. donovani infection. Together, our results suggest that L. donovani infection inhibits erythropoiesis in the bone marrow by
Introducing the "TCDD-inducible AhR-Nrf2 gene battery".
Yeager, Ronnie L; Reisman, Scott A; Aleksunes, Lauren M; Klaassen, Curtis D
2009-10-01
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces genes via the transcription factor aryl hydrocarbon receptor (AhR), including Cyp1a1, NAD(P)H:quinone oxidoreductase 1 (Nqo1), UDP-glucuronosyltransferase 1a6 (Ugt1a6), and glutathione S-transferase a1 (Gsta1). These genes are referred to as the "AhR gene battery." However, Nqo1 is also considered a prototypical target gene of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2). In mice, TCDD induction of Nrf2 and Nrf2 target, Nqo1, is dependent on AhR, and thus TCDD induction of drug-processing genes may be routed through an AhR-Nrf2 sequence. There has been speculation that Nrf2 may be involved in the TCDD induction of drug-processing genes; however, the data are not definitive. Therefore, to address whether TCDD induction of Nqo1, Ugts, and Gsts is dependent on Nrf2, we conducted the definitive experiment by administering TCDD (50 mug/kg, ip) to Nrf2-null and wild-type (WT) mice and collecting livers 24 h later to quantify the mRNA of drug-processing genes. TCDD induction of Cyp1a1 and Ugt1a1 was similar in WT and Nrf2-null mice, whereas TCDD induction of Ugt1a5 and 1a9 was blunted in Nrf2-null mice. TCDD induced Nqo1, Ugt1a6, 2b34, 2b35, 2b36, UDP-glucuronic acid-synthesizing gene UDP-glucose dehydrogenase, and Gsta1, m1, m2, m3, m6, p2, t2, and microsomal Gst1 in WT mice but not in Nrf2-null mice. Therefore, the present study demonstrates the novel finding that Nrf2 is required for TCDD induction of classical AhR battery genes Nqo1, Ugt1a6, and Gsta1, as well as most Ugt and Gst isoforms in livers of mice.
Carroll, Linda J; Connelly, Luke B; Spearing, Natalie M; Côté, Pierre; Buitenhuis, Jan; Kenardy, Justin
2011-12-01
Focused discussion. To present some of the complexities in conducting research on the role of compensation and compensation-related factors in recovery from whiplash-associated disorders (WAD) and to suggest directions for future research. There is divergence of opinion, primary research findings, and systematic reviews on the role of compensation and/or compensation-related factors in WAD recovery. The topic of research of compensation/compensation-related factors was discussed at an international summit meeting of 21 researchers from diverse fields of scientific enquiry. This article summarizes the main points raised in that discussion. Traffic injury compensation is a complex sociopolitical construct, which varies widely across jurisdictions. This leads to conceptual and methodological challenges in conducting and interpreting research in this area. It is important that researchers and their audiences be clear about what aspect of the compensation system is being addressed, what compensation-related variables are being studied, and what social/economic environment the compensation system exists in. In addition, summit participants also recommended that nontraditional, sophisticated study designs and analysis strategies be employed to clarify the complex causal pathways and mechanisms of effects. Care must be taken by both researchers and their audiences not to overgeneralize or confuse different aspects of WAD compensation. In considering the role of compensation/compensation-related factors on WAD and WAD recovery, it is important to retain a broad-based conceptualization of the range of biological, psychological, social, and economic factors that combine and interact to define and determine how people recover from WAD.
Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury
International Nuclear Information System (INIS)
Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang
2013-01-01
Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury
Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury
Energy Technology Data Exchange (ETDEWEB)
Jing, Xu [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Ren, Dongmei [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China); Wei, Xinbing; Shi, Huanying; Zhang, Xiumei [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Perez, Ruth G. [Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905 (United States); Lou, Haiyan, E-mail: louhaiyan@sdu.edu.cn [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Lou, Hongxiang [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China)
2013-12-15
Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.
Clinical study of the oral manifestations and related factors in type 2 diabetics patients.
Sousa, Maria Goretti de Menezes; Costa, Antonio de Lisboa Lopes; Roncalli, Angelo Giuseppe
2011-01-01
Diabetes Mellitus (DM) is reported with and associated to oral alterations, with conflicting results. The aim of this study was to identify the prevalence of oral soft tissue alterations in type 2 diabetes mellitus patients. Socioeconomic variables, gender, heredity, capillary glucose control and local factors (prosthesis, dry mouth sensation) were analyzed in 196 diabetic and non-diabetic patients enrolled in HIPERDIA, at 41 Health units of Natal, Brazil. A case study. The last blood glucose mean was 177.0 mg/dl for diabetics and 89.46 mg/dl for non-diabetics. Mean capillary blood glucose was elevated in diabetics (215.95 mg/dl); it was 102.31 mg/dl in non-diabetics. The family history confirmed the heredity nature of the disease in 68.8% of diabetic patients (n = 66) (p salivary flow was 49% (n = 47) in diabetics, and 34% (n = 34) in non-diabetics. Candidiasis was present in 30.5% of diabetic patients (n=29) and 36% of non-diabetics (n=36). Both groups had lesions in the palate - 81.4% (n = 35) in diabetics, and 71.1% in non-diabetics (n = 27) (p = 0.68). The alterations are not related to diabetes and are present independently of having or not type 2 Diabetes Mellitus.
Factors related to attempted suicide in Davanagere
Directory of Open Access Journals (Sweden)
Nagendra Gouda M
2008-01-01
Full Text Available Research Question: What are the factors responsible for suicidal attempts? Objectives: To study the socio-demographic factors, methods and reasons for suicidal attempts. Type of Study: Cross-sectional study. Setting: Bapuji and C.G. Hospitals attached to J.J.M. Medical College, Davanagere. Participants: A total of 540 suicidal attempters admitted to emergency wards. Methodology: A pretested proforma was administered to the subjects relating the factors responsible for the attempt. The data thus obtained was compiled and analyzed. Statistical Analysis: Proportions, Z -test and Chi-square test. Results: In this study, 61.3% were males and 38.7% were females. Peak occurrence of suicidal attempts was found in the second and third decades (15-29 years. Hindus constituted about 94.6% of the total suicidal attempters. Almost half (52.2% of the subjects had education below or up to matriculation and 83% of them were from the lower (classes IV and V socio-economic groups. Agriculturists, housewives and unskilled workers represented 75% of the total subjects. Fifty-five percent of the subjects were from nuclear families and most (62.4% of them were married; frequent mode of attempting suicides was by organo-phosphorus compounds (66.3% followed by overdosage of tablets (17.8%. Common cause was family problem (27.2% followed by illness (27%.
Low Calorie Diet Affects Aging-Related Factors
... Current Issue Past Issues Research News From NIH Low Calorie Diet Affects Aging-Related Factors Past Issues / ... to learn more about the effects of sustained low-calorie diets in humans on factors affecting aging. ...
Factors related to depression symptoms among working women in Menoufia, Egypt.
Kasemy, Zeinab A; Salama, Amal A; Abo Salem, Mahmoud E; Negm, Noha
2016-12-01
Lifetime prevalence rates for any psychological disorder are higher than previously thought. Depression in the workplace may lower work productivity and increase maladjustment in daily professional life. The study aimed to investigate the prevalence of depression symptoms and the work-related risk factors in Egyptian working women. A cross-sectional study was carried out on 600 working women in family health facilities in Tala district, Menoufia governorate in 2015. Two questionnaires were used: one of them was an Arabic translated form of the questionnaire found in the Egyptian Practice Guidelines established by the Ministry of Health and population for family physicians to use in assessing the prevalence of depression symptoms. The second one was a predesigned questionnaire used to assess risk factors concerning demographic characteristics and the work environment related to depression symptoms. The prevalence rate of depression symptoms among working women was 37.5%. Multiple logistic regression analyses reveal that the following work-related factors were associated with an increased likelihood of exhibiting positive depression symptoms: work-related activities continued during home time, such as telephone calls or messages [odds ratio (OR)=5.10; 95% confidence interval (CI): 1.69-15.39], when work problems affect concentration and interactions with family (OR=148.67; 95% CI: 50.04-441.71), and difficulty with household chores (OR=6.63; 95% CI: 1.64-26.73). In addition, the following sociodemographic factors were significant: being divorced or widowed (OR=4.10; 95% CI: 2.28-7.36), no enough income (OR=2.59; 95% CI: 1.68-3.97), and rural residence (OR=1.74; 95% CI: 1.08-2.78). Reported depression symptoms were high among working women in Menoufia. Both unfavorable employment conditions and background characteristics such as being divorced/widow, low income, and rural residence were factors determining depression symptoms. It is necessary to establish preventive
Yun, Jeong H; Morrow, Jarrett; Owen, Caroline A; Qiu, Weiliang; Glass, Kimberly; Lao, Taotao; Jiang, Zhiqiang; Perrella, Mark A; Silverman, Edwin K; Zhou, Xiaobo; Hersh, Craig P
2017-07-01
Although cigarette smoke (CS) is the primary risk factor for chronic obstructive pulmonary disease (COPD), the underlying molecular mechanisms for the significant variability in developing COPD in response to CS are incompletely understood. We performed lung gene expression profiling of two different wild-type murine strains (C57BL/6 and NZW/LacJ) and two genetic models with mutations in COPD genome-wide association study genes (HHIP and FAM13A) after 6 months of chronic CS exposure and compared the results to human COPD lung tissues. We identified gene expression patterns that correlate with severity of emphysema in murine and human lungs. Xenobiotic metabolism and nuclear erythroid 2-related factor 2-mediated oxidative stress response were commonly regulated molecular response patterns in C57BL/6, Hhip +/- , and Fam13a -/- murine strains exposed chronically to CS. The CS-resistant Fam13a -/- mouse and NZW/LacJ strain revealed gene expression response pattern differences. The Fam13a -/- strain diverged in gene expression compared with C57BL/6 control only after CS exposure. However, the NZW/LacJ strain had a unique baseline expression pattern, enriched for nuclear erythroid 2-related factor 2-mediated oxidative stress response and xenobiotic metabolism, and converged to a gene expression pattern similar to the more susceptible wild-type C57BL/6 after CS exposure. These results suggest that distinct molecular pathways may account for resistance to emphysema. Surprisingly, there were few genes commonly modulated in mice and humans. Our study suggests that gene expression responses to CS may be largely species and model dependent, yet shared pathways could provide biologically significant insights underlying individual susceptibility to CS.
Cardiac Aging - Benefits of Exercise, Nrf2 Activation and Antioxidant Signaling.
Narasimhan, Madhusudhanan; Rajasekaran, Namakkal-Soorappan
2017-01-01
Cardiovascular dysfunction and heart failure associated with aging not only impairs the cardiac function but also the quality of life eventually decreasing the life expectancy of the elderly. Notably, cardiac tissue can prematurely age under certain conditions such as genetic mutation, persistent redox stress and overload, aberrant molecular signaling, DNA damage, telomere attrition, and other pathological insults. While cardiovascular-related morbidity and mortality is on the rise and remains a global health threat, there has been only little to moderate improvements in its medical management. This is due to the fact that the lifestyle changes to molecular mechanisms underlying age-related myocardial structure and functional remodeling are multifactorial and intricately operate at different levels. Along these lines, the intrinsic redox mechanisms and oxidative stress (OS) are widely studied in the myocardium. The accumulation of reactive oxygen species (ROS) with age and the resultant oxidative damage has been shown to increase the susceptibility of the myocardium to multiple complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and heart failure. There has been growing interest in trying to enhance the mechanisms that neutralize the ROS and curtailing OS as a possible anti-aging intervention and as a treatment for age-related disorders. Natural defense system to fight against OS involves a master transcription factor named nuclear erythroid-2-p45-related factor-2 (Nrf2) that regulates several antioxidant genes. Compelling evidence exists on the Nrf2 gain of function through pharmacological interventions in counteracting the oxidative damage and affords cytoprotection in several organs including but not limited to lung, liver, kidney, brain, etc. Nevertheless, thus far, only a few studies have described the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. This chapter explores the effects of
Nesterko, Yuriy; Braehler, Elmar; Grande, Gesine; Glaesmer, Heide
2013-06-01
There is a lack of population-based studies on health-related quality of life (HRQoL) and satisfaction with life (SWL) of immigrants compared to the native populations. Findings of previous research are inconclusive. Our study compares HRQoL and SWL in immigrants and native-born Germans, investigating immigration-related factors as suspected determinants of HRQoL and SWL in immigrants. In the German Socio-economic panel from 2006, HRQoL (measured with the SF-12v2) and SWL as well as immigration-related factors were assessed in 21,079 subjects (including 2,971 immigrants). Analyses of variance were applied as statistical tests in our study. Native-born Germans report a higher amount of SWL and of HRQoL on the physical health component compared to the immigrants. With effect sizes ranging from E² = 0.001 to 0.111, these findings are of minimal practical relevance. In immigrants, the physical health component of HRQoL is significantly associated with younger age at migration and with country of origin. As the effect sizes are extremely low, these findings have limited practical relevance. There are small differences in SWL and HRQoL of immigrants and native-born Germans. Some immigration-related factors are related to HRQoL, but not to SWL. As immigrants are a quite heterogeneous group, it seems useful to focus on immigration-related factors, not simply comparing immigrants and the native-born. Our findings suggest that research on the association of immigration-related factors with quality of life in immigrants seems a promising approach to better identify subgroups of immigrants with lower levels of quality of life.
THE X-FACTOR IN GALAXIES. II. THE MOLECULAR-HYDROGEN-STAR-FORMATION RELATION
Energy Technology Data Exchange (ETDEWEB)
Feldmann, Robert; Gnedin, Nickolay Y.; Kravtsov, Andrey V.
2012-10-08
There is ample observational evidence that the star formation rate (SFR) surface density, Sigma_SFR, is closely correlated with the surface density of molecular hydrogen, Sigma_H2. This empirical relation holds both for galaxy-wide averages and for individual >=kpc sized patches of the interstellar medium (ISM), but appears to degrade substantially at a sub-kpc scale. Identifying the physical mechanisms that determine the scale-dependent properties of the observed Sigma_H2-Sigma_SFR relation remains a challenge from a theoretical perspective. To address this question, we analyze the slope and scatter of the Sigma_H2-Sigma_SFR relation using a set of cosmological, galaxy formation simulations with a peak resolution of ~100 pc. These simulations include a chemical network for molecular hydrogen, a model for the CO emission, and a simple, stochastic prescription for star formation that operates on ~100 pc scales. Specifically, star formation is modeled as a Poisson process in which the average SFR is directly proportional to the present mass of H2. The predictions of our numerical model are in good agreement with the observed Kennicutt-Schmidt and Sigma_H2-Sigma_SFR relations. We show that observations based on CO emission are ill suited to reliably measure the slope of the latter relation at low (<20 M_sun pc^-2) H2 surface densities on sub-kpc scales. Our models also predict that the inferred Sigma_H2-Sigma_SFR relation steepens at high H2 surface densities as a result of the surface density dependence of the CO/H2 conversion factor. Finally, we show that on sub-kpc scales most of the scatter in the relation is a consequence of discreteness effects in the star formation process. In contrast, variations of the CO/H2 conversion factor are responsible for most of the scatter measured on super-kpc scales.
McGill, Anne-Thea
2014-01-01
Metabolic syndrome (MetS) predicts type II diabetes mellitus (TIIDM), cardiovascular disease (CVD) and cancer, and their rates have escalated over the last few decades. Obesity related co-morbidities also overlap the concept of the metabolic syndrome (MetS). However, understanding of the syndrome's underlying causes may have been misapprehended. The current paper follows on from a theory review by McGill, A-T in Archives of Public Health, 72: 30. This accompanying paper utilises research on human evolution and new biochemistry to theorise on why MetS and obesity arise and how they affect the population. The basis of this composite unifying theory is that the proportionately large, energy-demanding human brain may have driven co-adaptive mechanisms to provide, or conserve, energy for the brain. A 'dual system' is proposed. 1) The enlarged, complex cortico-limbic-striatal system increases dietary energy by developing strong neural self-reward/motivation pathways for the acquisition of energy dense food, and (2) the nuclear factor-erythroid 2-related factor 2 (NRF2) cellular protection system amplifies antioxidant, antitoxicant and repair activity by employing plant chemicals. In humans who consume a nutritious diet, the NRF2 system has become highly energy efficient. Other relevant human-specific co-adaptations are explored. In order to 'test' this composite unifying theory it is important to show that the hypothesis and sub-theories pertain throughout the whole of human evolution and history up till the current era. Corollaries of the composite unifying theory of MetS are examined with respect to past under-nutrition and malnutrition since agriculture began 10,000 years ago. The effects of man-made pollutants on degenerative change are examined. Projections are then made from current to future patterns on the state of 'insufficient micronutrient and/or unbalanced high energy malnutrition with central obesity and metabolic dysregulation' or 'malnubesity'. Forecasts
Energy Technology Data Exchange (ETDEWEB)
Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying [Department of Biochemical Science and Technology, College of Life Science, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China); Hsu, Ya-Wen [SunWay Biotechnology Company, Taipei, Taiwan (China); Pan, Tzu-Ming, E-mail: tmpan@ntu.edu.tw [Department of Biochemical Science and Technology, College of Life Science, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China)
2013-11-01
Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to D-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. - Highlights: • Monascin acts as a PPARgamma agonist. • Monascin activates Nrf2 and AMPK. • Monascin promotes MG metabolism into D-lactic acid. • Monascin attenuates inflammation and diabetes in vivo.
Business factors related to manufacturing firms' performance
Directory of Open Access Journals (Sweden)
Stergios Vranakis
2014-01-01
Full Text Available Purpose: The main goal is to understand the way many factors affect the investment decision making process and business performance. Design/methodology/approach: This study proposes a new conceptual framework for examining the reasons that manufacturing firms decide to invest on the acquisition of new machinery and equipment in order to improve their infrastructure. It incorporates various factors related to the internal business environment (quality management, investment decisions etc. Findings and Originality/value: A new conceptual framework, establishing the relations between many factors, has been developed, allowing the determinants of adoption of many implications to be discussed and to relate them to the peculiarities of the Greek manufacturing industry. Originality/value: This study presents an overview of the impact of machinery and equipment investment on firm’s performance, giving grasp for further research of the inter-organizational relationships that exist between them.
International Nuclear Information System (INIS)
Schmidt, P.; Fellinger, J.; Henniger, J.; Huebner, K.
1988-01-01
The efficiency of thermoluminescent (TL) detectors to heavy charged particles is described by the so-called light conversion factor η. Relative light conversion factors for protons, alphas and heavier recoils are needed for the calculation of the neutron sensitivity of TL detectors. Such light conversion factors can be determined experimentally. In this paper a method is presented for the experimental determination of relative light conversion factors. Using the experimental arrangement described, relative light conversion factors for LiF material (TLD-100) for protons were determined. In LiF the relative main peak (peak V) efficiency is always lower than 1. It increases with increasing proton energy whereas the relative efficiency of the high temperature peak (peak VI) shows an opposite dependence on the proton energy. Relative light conversion factors for peak VI clearly exceed 1. (orig.)
Happiness and related factors in pregnant women.
Jayasvasti, Kanthika; Kanchanatawan, Buranee
2005-09-01
Pregnancy is a crisis in the human life cycle as an important turning point in aspects of anatomical, physiological and psychosocial changes. An unhappy pregnanus could influence the fetal growth and development and sense of maternal competence as well as bonding with the fetus which profoundly affect the nurture of the infant after delivery. The authors'purposes were to study happiness and related factors in pregnant women having antenatal care at King Chulalongkorn Memorial Hospital. Four hundred and thirty-eight pregnant women from the antenatal clinic at King Chulalongkorn Memorial Hospital were randomly selected to complete a set of questionnaires that consisted of personal information, pregnant information, The Oxford Happiness Questionnaire (OHQ), The Maudsley Personality Inventory (MPI) and The Marital Satisfaction Scale (MSS). Prevalence of happiness level was classified by descriptive analysis. Unpaired t-test, ANOVA and Pearson's Product Moment Correlation analyzed related factors to happiness in pregnant woman. Also Stepwise Multiple Regression Analysis was used to define predictive factors for happiness in pregnant women. The sample had a high level of happiness of 57.3%. Significant related factors to happiness were age between 31-35 years, high education level, high individual and family income, having saving deposition, no drug abuse, improved marital relationship, no conflict with relatives, extrovert and stable personality types and no concerns about post-partum body image. Four predictive factors for happiness in pregnant women were extrovert personality, stable personality, high family income and improved marital relationship. Level of happiness in pregnant women could be predicted by type of personality, family income and marital relationship.
Directory of Open Access Journals (Sweden)
Feng-Cheng Tang
Full Text Available Prolonged fatigue is common among employees, but the relationship between prolonged fatigue and job-related psychosocial factors is seldom studied. This study aimed (1 to assess the individual relations of physical condition, psychological condition, and job-related psychosocial factors to prolonged fatigue among employees, and (2 to clarify the associations between job-related psychosocial factors and prolonged fatigue using hierarchical regression when demographic characteristics, physical condition, and psychological condition were controlled.A cross-sectional study was employed. A questionnaire was used to obtain information pertaining to demographic characteristics, physical condition (perceived physical health and exercise routine, psychological condition (perceived mental health and psychological distress, job-related psychosocial factors (job demand, job control, and workplace social support, and prolonged fatigue.A total of 3,109 employees were recruited. Using multiple regression with controlled demographic characteristics, psychological condition explained 52.0% of the variance in prolonged fatigue. Physical condition and job-related psychosocial factors had an adjusted R2 of 0.370 and 0.251, respectively. Hierarchical multiple regression revealed that, among job-related psychosocial factors, job demand and job control showed significant associations with fatigue.Our findings highlight the role of job demand and job control, in addition to the role of perceived physical health, perceived mental health, and psychological distress, in workers' prolonged fatigue. However, more research is required to verify the causation among all the variables.
Mohagheghi, Fatemeh; Khalaj, Leila; Ahmadiani, Abolhassan; Rahmani, Behrouz
2013-04-01
Two important pathophysiological mechanisms involved during cerebral ischemia are oxidative stress and inflammation. In pathological conditions such as brain ischemia the ability of free radicals production is greater than that of elimination by endogenous antioxidative systems, so brain is highly injured due to oxidation and neuroinflammation. Fibrates as peroxisome proliferator-activated receptor (PPAR)-α ligands, are reported to have antioxidant and anti-inflammatory actions. In this study, gemfibrozil, a fibrate is investigated for its therapeutic potential against global cerebral ischemia-reperfusion (I/R) injury of male and female rats. This study particularly has focused on inflammatory and antioxidant signaling pathways, such as nuclear factor erythroid-related factor (Nrf)-2, as well as the activity of some endogenous antioxidant agents. It was found that pretreatment of animals with gemfibrozil prior to I/R resulted in a sexually dimorphic outcome. Within females it proved to be protective, modulating inflammatory factors and inducing antioxidant defense system including superoxide dismutase (SOD), catalase, as well as glutathione level. However, Nrf-2 signaling pathway was not affected. It also decreased malondialdehyde level as an index of lipid peroxidation. In contrast, gemfibrozil pretreatment was toxic to males, enhancing the expression of inflammatory factors such as tumor necrosis factor-α, nuclear factor-κB, and cyclooxygenase-2, and decreasing Nrf-2 expression and SOD activity, leading to hippocampal neurodegeneration. Considering that gemfibrozil is a commonly used anti-hyperlipidemic agent in clinic, undoubtedly more investigations are crucial to exactly unravel its sex-dependent neuroprotective/neurodegenerative potential.
Cancer-related fatigue--mechanisms, risk factors, and treatments.
Bower, Julienne E
2014-10-01
Fatigue is one of the most common adverse effects of cancer that might persist for years after treatment completion in otherwise healthy survivors. Cancer-related fatigue causes disruption in all aspects of quality of life and might be a risk factor of reduced survival. The prevalence and course of fatigue in patients with cancer have been well characterized and there is growing understanding of the underlying biological mechanisms. Inflammation seems to have a key role in fatigue before, during, and after cancer-treatment. However, there is a considerable variability in the presentation of cancer-related fatigue, much of which is not explained by disease-related or treatment-related characteristics, suggesting that host factors might be important in the development and persistence of this symptom. Indeed, longitudinal studies have identified genetic, biological, psychosocial, and behavioural risk factors associated with cancer-related fatigue. Although no current gold-standard treatment for fatigue is available, a variety of intervention approaches have shown beneficial effects in randomized controlled trials, including physical activity, psychosocial, mind-body, and pharmacological treatments. This Review describes the mechanisms, risk factors, and possible interventions for cancer-related fatigue, focusing on recent longitudinal studies and randomized trials that have targeted fatigued patients.
Directory of Open Access Journals (Sweden)
Jenn-Jhy Tseng
2006-06-01
Full Text Available Placenta accreta is the major cause of maternal death complicated by massive peripartum hemorrhage. Its development is traditionally considered to be related to a decidual defect caused by previous cesarean deliveries or uterine curettages. Usually, placental villi firmly adhere to the superficial myometrium and deeply invade, or even penetrate, the uterine wall. Abnormal uteroplacental neovascularization is another characteristic. Therefore, we hypothesized that placenta accreta develops as a result of abnormal expressions of growth-, angiogenesis- and invasion-related factors in trophoblast populations. We have found, in pregnancies complicated by placenta accreta: upregulated epidermal growth factor receptor and downregulated c-erbB-2 oncoprotein in syncytiotrophoblasts; downregulated vasculoendothelial growth factor receptor-2 expression in syncytiotrophoblasts and increased vasculoendothelial growth factor in placental lysates; and downregulated Tie-2 expression in syncytiotrophoblasts and enhanced angiopoietin-2 level in placental lysates. However, matrix metalloproteinase expression was not upregulated, so the association of these invasion-related molecules with placenta accreta is less likely. Taken together, these findings imply that complex factors, either alone or in combination, might be responsible for the development of placenta accreta. Further studies are needed to understand the signaling pathways and possible genetic events.
Systems approach to the study of brain damage in the very preterm newborn
Leviton, Alan; Gressens, Pierre; Wolkenhauer, Olaf; Dammann, Olaf
2015-01-01
Background: A systems approach to the study of brain damage in very preterm newborns has been lacking. Methods: In this perspective piece, we offer encephalopathy of prematurity as an example of the complexity and interrelatedness of brain-damaging molecular processes that can be initiated inflammatory phenomena. Results: Using three transcription factors, nuclear factor-kappa B (NF-κB), Notch-1, and nuclear factor erythroid 2 related factor 2 (NRF2), we show the inter-connectedness of signaling pathways activated by some antecedents of encephalopathy of prematurity. Conclusions: We hope that as biomarkers of exposures and processes leading to brain damage in the most immature newborns become more readily available, those who apply a systems approach to the study of neuroscience can be persuaded to study the pathogenesis of brain disorders in the very preterm newborn. PMID:25926780
Yang, Po-Min; Chen, Huang-Zhi; Huang, Yu-Ting; Hsieh, Chia-Wen; Wung, Being-Sun
2017-06-01
The endothelial expression of cell adhesion molecules plays a leading role in atherosclerosis. Lycopene, a carotenoid with 11 conjugated double bonds, has been shown to have anti-inflammatory properties. In the present study, we demonstrate a putative mechanism for the anti-inflammatory effects of lycopene. We demonstrate that lycopene inhibits the adhesion of tumor necrosis factor α (TNFα)-stimulated monocytes to endothelial cells and suppresses the expression of intercellular cell adhesion molecule-1 (ICAM-1) at the transcriptional level. Moreover, lycopene was found to exert its inhibitory effects by blocking the degradation of the inhibitory protein, IκBα, following 6 h of pre-treatment. In TNFα-stimulated endothelial cells, nuclear factor-κB (NF-κB) nuclear translocation and transcriptional activity were abolished by up to 12 h of lycopene pre-treatment. We also found that lycopene increased the intracellular glutathione (GSH) level and glutamate-cysteine ligase expression. Subsequently, lycopene induced nuclear factor-erythroid 2 related factor 2 (Nrf2) activation, leading to the increased expression of downstream of heme oxygenase-1 (HO-1). The use of siRNA targeting HO-1 blocked the inhibitory effects of lycopene on IκB degradation and ICAM-1 expression. The inhibitory effects of lycopene thus appear to be mediated through its induction of Nrf2-mediated HO-1 expression. Therefore, the findings of the present study indicate that lycopene suppresses the activation of TNFα-induced signaling pathways through the upregulation of Nrf2-mediated HO-1 expression.
Ishida, Atsushi; Ohto, Hitoshi; Yasuda, Hiroyasu; Negishi, Yutaka; Tsuiki, Hideki; Arakawa, Takeshi; Yagi, Yoshihito; Uchimura, Daisuke; Miyazaki, Toru; Ohashi, Wataru; Takamoto, Shigeru
2015-08-01
Hemolytic disease of the newborn (HDN) arising from MNSs incompatibility is rare, with few reports of prolonged anemia and reticulocytopenia following HDN. We report the younger of 2 male siblings, both of whom had anti-M-induced HDN and anemia persisting for over a month. Peripheral reticulocytes remained inappropriately low for the degree of anemia, and they needed multiple red cell transfusions. Viral infections were ruled out. Corticosteroids were given for suspected pure red cell aplasia. Anemia and reticulocytopenia subsequently improved. Colony-forming unit erythroid assay revealed erythropoietic suppression of M antigen-positive erythroid precursor cells cultured with maternal or infant sera containing anti-M. In conclusion, maternal anti-M caused HDN and prolonged anemia by erythropoietic suppression in 2 siblings.
The burden of high blood pressure and related risk factors in urban ...
African Journals Online (AJOL)
Objective: To provide the current burden of high blood pressure and related risk factors in urban setting in Cameroon. Methods:We used the WHO STEPS approach for Surveillance of non-communicable diseases and their risk factors to collect data from 2,559 adults aged 15-99 years, residing at Cite des Palmiers in Douala ...
Pathology consultation on anticoagulation monitoring: factor X-related assays.
Wool, Geoffrey D; Lu, Chuanyi M
2013-11-01
To review various anticoagulation therapies and related laboratory monitoring issues, with a focus on factor X-related chromogenic assays. A case-based approach is used to review pertinent published literatures and product inserts of anticoagulation drugs and to look back on clinical use of factor X-related chromogenic assays. The number of anticoagulants available to clinicians has increased greatly in the past decade. Whether and how these anticoagulants should be monitored are areas of uncertainty for clinicians, which can lead to misuse of laboratory assays and suboptimal patient management. Factor X-related assays are of particular concern because of the similar and often confusing test names. Based on a common clinical case scenario and literature review regarding anticoagulant monitoring, an up-to-date discussion and review of the various factor X-related assays are provided, focusing on the differences in test designs and clinical utilities between the chromogenic anti-Xa and chromogenic factor X activity assays. Anticoagulation therapy and related laboratory monitoring are rapidly evolving areas of clinical practices. A good knowledge of relevant laboratory assays and their clinical applications is necessary to help optimize patient care.
Energy Technology Data Exchange (ETDEWEB)
Lu, Changfang; Zou, Yu; Liu, Yuzhang; Niu, Yingcai, E-mail: nyc1968@126.com
2017-03-01
Recently, oxidative stress is involved in hepatofibrogenesis. Matrix metalloproteinase-2 (MMP-2) is required for activation of hepatic stellate cells (HSCs) in response to reactive oxygen species (ROS). This study was designed to explore the hypothesis that the inhibitory effect of rosmarinic acid (RA) on HSCs activation might mainly result from its antioxidant capability by increasing the synthesis of glutathione (GSH) involved in nuclear factor kappa B (NF-κB)-dependent inhibition of MMP-2 activity. Here, we demonstrate that RA reverses activated HSCs to quiescent cells. Concomitantly, RA inhibits MMP-2 activity. RNA interference-imposed knockdown of NF-κB abolished down-regulation of MMP-2 by RA. RA-mediated inactivation of NF-κB could be blocked by the diphenyleneiodonium chloride (DPI; a ROS inhibitor). Conversely, transfection of dominant-negative (DN) mutant of extracellular signal-regulated kinases 2 (ERK2), c-Jun N-terminal kinase 1 (JNK1), or p38α kinase had no such effect. Simultaneously, RA suppresses ROS generation and lipid peroxidation (LPO) whereas increases cellular GSH in HSC-T6 cells. Furthermore, RA significantly increased antioxidant response element (ARE)-mediated luciferase activity, nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and catalytic subunits from glutamate cysteine ligase (GCLc) expression, but not modulatory subunits from GCL (GCLm). RA-mediated up-regulation of GClc is inhibited by the shRNA-induced Nrf2 knockdown. The knocking down of Nrf2 or buthionine sulfoximine (a GCL inhibitor) abolished RA-mediated inhibition of ROS. Collectively, these results provide novel insights into the mechanisms of RA as an antifibrogenic candidate in the prevention and treatment of liver fibrosis. - Highlights: • RA reverses activated HSCs to quiescent cells. • RA suppresses MMP-2 activity through a NF-κB-dependent pathway. • Inhibition of oxidative stress by RA is dependent on nuclear translocation of Nrf2
International Nuclear Information System (INIS)
Lu, Changfang; Zou, Yu; Liu, Yuzhang; Niu, Yingcai
2017-01-01
Recently, oxidative stress is involved in hepatofibrogenesis. Matrix metalloproteinase-2 (MMP-2) is required for activation of hepatic stellate cells (HSCs) in response to reactive oxygen species (ROS). This study was designed to explore the hypothesis that the inhibitory effect of rosmarinic acid (RA) on HSCs activation might mainly result from its antioxidant capability by increasing the synthesis of glutathione (GSH) involved in nuclear factor kappa B (NF-κB)-dependent inhibition of MMP-2 activity. Here, we demonstrate that RA reverses activated HSCs to quiescent cells. Concomitantly, RA inhibits MMP-2 activity. RNA interference-imposed knockdown of NF-κB abolished down-regulation of MMP-2 by RA. RA-mediated inactivation of NF-κB could be blocked by the diphenyleneiodonium chloride (DPI; a ROS inhibitor). Conversely, transfection of dominant-negative (DN) mutant of extracellular signal-regulated kinases 2 (ERK2), c-Jun N-terminal kinase 1 (JNK1), or p38α kinase had no such effect. Simultaneously, RA suppresses ROS generation and lipid peroxidation (LPO) whereas increases cellular GSH in HSC-T6 cells. Furthermore, RA significantly increased antioxidant response element (ARE)-mediated luciferase activity, nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and catalytic subunits from glutamate cysteine ligase (GCLc) expression, but not modulatory subunits from GCL (GCLm). RA-mediated up-regulation of GClc is inhibited by the shRNA-induced Nrf2 knockdown. The knocking down of Nrf2 or buthionine sulfoximine (a GCL inhibitor) abolished RA-mediated inhibition of ROS. Collectively, these results provide novel insights into the mechanisms of RA as an antifibrogenic candidate in the prevention and treatment of liver fibrosis. - Highlights: • RA reverses activated HSCs to quiescent cells. • RA suppresses MMP-2 activity through a NF-κB-dependent pathway. • Inhibition of oxidative stress by RA is dependent on nuclear translocation of Nrf2
Foresti, Roberta; Bains, Sandip K; Pitchumony, Tamil Selvi; de Castro Brás, Lisandra E; Drago, Filippo; Dubois-Randé, Jean-Luc; Bucolo, Claudio; Motterlini, Roberto
2013-10-01
The nuclear factor erythroid derived 2-related factor 2 (Nrf2) and the antioxidant protein heme oxygenase-1 (HO-1) are crucial components of the cellular stress response. These two systems work together to combat oxidative stress and inflammation and are attractive drug targets for counteracting different pathologies, including neuroinflammation. We aimed to identify the most effective Nrf2/HO-1 activators that modulate the inflammatory response in microglia cells. In the present study, we searched the literature and selected 56 compounds reported to activate Nrf2 or HO-1 and analyzed them for HO-1 induction at 6 and 24h and cytotoxicity in BV2 microglial cells in vitro. Approximately 20 compounds up-regulated HO-1 at the concentrations tested (5-20 μM) with carnosol, supercurcumin, cobalt protoporphyrin-IX and dimethyl fumarate exhibiting the best induction/low cytotoxicity profile. Up-regulation of HO-1 by some compounds resulted in increased cellular bilirubin levels but did not augment the expression of proteins involved in heme synthesis (ALAS 1) or biliverdin reductase. Bilirubin production by HO-1 inducers correlated with their potency in inhibiting nitrite production after challenge with interferon-γ (INF-γ) or lipopolysaccharide (LPS). The compounds down-regulated the inflammatory response (TNF-α, PGE2 and nitrite) more strongly in cells challenged with INF-γ than LPS, and silencing HO-1 or Nrf2 with shRNA differentially affected the levels of inflammatory markers. These findings indicate that some small activators of Nrf2/HO-1 are effective modulators of microglia inflammation and highlight the chemical scaffolds that can serve for the synthesis of potent new derivatives to counteract neuroinflammation and neurodegeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tao Chen
2016-09-01
Full Text Available The serious air pollution problem has aroused widespread public concerns in China. Nanjing city, as one of the famous cities of China, is faced with the same situation. This research aims to investigate spatial and temporal distribution characteristics of fine particulate matter (PM2.5 and the influence of weather factors on PM2.5 in Nanjing using Spearman-Rank analysis and the Complete Ensemble Empirical Mode Decomposition with Adaptive Noise (CEEMDAN method. Hourly PM2.5 observation data and daily meteorological data were collected from 1 April 2013 to 31 December 2015. The spatial distribution result shows that the Maigaoqiao site suffered the most serious pollution. Daily PM2.5 concentrations in Nanjing varied from 7.3 μg/m3 to 336.4 μg/m3. The highest concentration was found in winter and the lowest in summer. The diurnal variation of PM2.5 increased greatly from 6 to 10 a.m. and after 6 p.m., while the concentration exhibited few variations in summer. In addition, the concentration was slightly higher on weekends compared to weekdays. PM2.5 was found to exhibit a reversed relation with wind speed, relative humidity, and precipitation. Although temperature had a positive association with PM2.5 in most months, a negative correlation was observed during the whole period. Additionally, a high concentration was mainly brought with the wind with a southwest direction and several relevant factors are discussed to explain the difference of the impacts of diverse wind directions.
Factors Related to Job Satisfaction of Information Technology Professionals
Directory of Open Access Journals (Sweden)
İbrahim Halil SEYREK
2016-01-01
Full Text Available Job satisfaction of employees in any type of organization is important both for the employee and for the organization he/she works for. There are several factors researchers studied that are related to employee satisfaction. Even though there are several common factors for the job satisfaction of employees, there can be differences based on the personal and job characteristics. Information Technology (IT workers are important for current information economy and therefore factors related to their job satisfaction is an important research topic. In this study, based on survey data collected from 455 IT workers from different industries, the factors related to IT worker job satisfaction are investigated. As a result of analyses, it was found that demographic factors like gender, sector (public vs. private, work experience, and wage are not related to the job satisfaction of the worker. On the other hand, the results show that feel of belonging, feel of acceptance, job autonomy, burnout, role clarity and fairness of rewards are factors that affect job satisfaction.
Risk factors for treatment related mortality in childhood acute lymphoblastic leukaemia
DEFF Research Database (Denmark)
Lund, Bendik; Åsberg, Ann; Heyman, Mats
2011-01-01
-cell disease (HR: 1.9, 95% CI: 1.01-3.7), Down syndrome (HR: 7.3, 95% CI: 3.6-14.9) and haematopoietic stem cell transplantation in CR1 (HR: 8.0, 95% CI: 3.3-19.5) were identified as independent risk factors for TRD. CONCLUSION: Several TRDs were potentially preventable and future efforts should be directed......BACKGROUND: In spite of major improvements in the cure rate of childhood acute lymphoblastic leukaemia (ALL), 2-4% of patients still die from treatment related complications. PROCEDURE: We investigated the pattern of treatment related deaths (TRDs) and possible risk factors in the NOPHO ALL-92...
No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.
Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte
2017-07-20
Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.
A case-crossover study on transient risk factors of work-related eye injuries.
Chen, S-Y; Fong, P-C; Lin, S-F; Chang, C-H; Chan, C-C
2009-08-01
To investigate modifiable risk and preventive factors of work-related eye injuries. A case-crossover study conducted to explore the associations between transient risk factors and work-related eye injuries. Patients seen at seven medical centres in Taiwan with work-related eye injuries over a 4-year period were enrolled in the study. Clinical information was collected from medical charts and detailed information on exposure to eight potentially modifiable factors during the 60 minutes prior to the occurrence of each injury, as well as during the same time interval on the last work day prior to the injury, were obtained using questionnaire surveys. Matched-pair interval analysis was adopted to assess the odds ratios (ORs) for work-related eye injuries given exposure to the eight modifiable factors. A total of 283 subjects were interviewed. Most of these injured workers were young, male, and self-employed or small enterprise workers. The most common injury type was photokeratitis (33.2%), mainly caused by welding (30.4%). The OR for a work-related eye injury was increased with the performance of an unfamiliar task (57.0), operation of a faulty tool or piece of equipment (48.5), distractions (24.0), being rushed (13.0), or fatigued (10.0), and a poor work environment (4.3). Wearing eye protection devices was found to have a significant protective effect on workers who might otherwise have been exposed to eye injuries (OR = 0.4; 95% CI 0.2 to 0.7). Potential modifiable risk and preventive factors for work-related eye injuries were identified using a case-crossover study. This information should be helpful in the development of preventive strategies.
Cancer-related fatigue: Mechanisms, risk factors, and treatments
Bower, Julienne E.
2015-01-01
Fatigue is one of the most common and distressing side effects of cancer and its treatment, and may persist for years after treatment completion in otherwise healthy survivors. Cancer-related fatigue causes disruption in all aspects of quality of life and may be a risk factor for reduced survival. The prevalence and course of fatigue in cancer patients has been well characterized, and there is growing understanding of underlying biological mechanisms. Inflammation has emerged as a key biological pathway for cancer-related fatigue, with studies documenting links between markers of inflammation and fatigue before, during, and particularly after treatment. There is considerable variability in the experience of cancer-related fatigue that is not explained by disease- or treatment-related characteristics, suggesting that host factors may play an important role in the development and persistence of this symptom. Indeed, longitudinal studies have begun to identify genetic, biological, psychosocial, and behavioral risk factors for cancer-related fatigue. Given the multi-factorial nature of cancer-related fatigue, a variety of intervention approaches have been examined in randomized controlled trials, including physical activity, psychosocial, mind-body, and pharmacological treatments. Although there is currently no gold standard for treating fatigue, several of these approaches have shown beneficial effects and can be recommended to patients. This report provides a state of the science review of mechanisms, risk factors, and interventions for cancer-related fatigue, with a focus on recent longitudinal studies and randomized trials that have targeted fatigued patients. PMID:25113839
Tang, Feng-Cheng; Li, Ren-Hau; Huang, Shu-Ling
2016-01-01
Background and Objectives Prolonged fatigue is common among employees, but the relationship between prolonged fatigue and job-related psychosocial factors is seldom studied. This study aimed (1) to assess the individual relations of physical condition, psychological condition, and job-related psychosocial factors to prolonged fatigue among employees, and (2) to clarify the associations between job-related psychosocial factors and prolonged fatigue using hierarchical regression when demographic characteristics, physical condition, and psychological condition were controlled. Methods A cross-sectional study was employed. A questionnaire was used to obtain information pertaining to demographic characteristics, physical condition (perceived physical health and exercise routine), psychological condition (perceived mental health and psychological distress), job-related psychosocial factors (job demand, job control, and workplace social support), and prolonged fatigue. Results A total of 3,109 employees were recruited. Using multiple regression with controlled demographic characteristics, psychological condition explained 52.0% of the variance in prolonged fatigue. Physical condition and job-related psychosocial factors had an adjusted R2 of 0.370 and 0.251, respectively. Hierarchical multiple regression revealed that, among job-related psychosocial factors, job demand and job control showed significant associations with fatigue. Conclusion Our findings highlight the role of job demand and job control, in addition to the role of perceived physical health, perceived mental health, and psychological distress, in workers’ prolonged fatigue. However, more research is required to verify the causation among all the variables. PMID:26930064
Mortality, Causes of Death and Associated Factors Relate to a Large HIV Population-Based Cohort.
Directory of Open Access Journals (Sweden)
César Garriga
Full Text Available Antiretroviral therapy has led to a decrease in HIV-related mortality and to the emergence of non-AIDS defining diseases as competing causes of death. This study estimates the HIV mortality rate and their risk factors with regard to different causes in a large city from January 2001 to June 2013.We followed-up 3137 newly diagnosed HIV non-AIDS cases. Causes of death were classified as HIV-related, non-HIV-related and external. We examined the effect of risk factors on survival using mortality rates, Kaplan-Meier plots and Cox models. Finally, we estimated survival for each main cause of death groups through Fine and Gray models.182 deaths were found [14.0/1000 person-years of follow-up (py; 95% confidence interval (CI:12.0-16.1/1000 py], 81.3% of them had a known cause of death. Mortality rate by HIV-related causes and non-HIV-related causes was the same (4.9/1000 py; CI:3.7-6.1/1000 py, external was lower [1.7/1000 py; (1.0-2.4/1000 py].Kaplan-Meier estimate showed worse survival in intravenous drug user (IDU and heterosexuals than in men having sex with men (MSM. Factors associated with HIV-related causes of death include: IDU male (subHazard Ratio (sHR:3.2; CI:1.5-7.0 and <200 CD4 at diagnosis (sHR:2.7; CI:1.3-5.7 versus ≥500 CD4. Factors associated with non-HIV-related causes of death include: ageing (sHR:1.5; CI:1.4-1.7 and heterosexual female (sHR:2.8; CI:1.1-7.3 versus MSM. Factors associated with external causes of death were IDU male (sHR:28.7; CI:6.7-123.2 and heterosexual male (sHR:11.8; CI:2.5-56.4 versus MSM.There are important differences in survival among transmission groups. Improved treatment is especially necessary in IDUs and heterosexual males.
Directory of Open Access Journals (Sweden)
Marcelo R Vargas
Full Text Available The nuclear factor erythroid 2-related factor 2 (Nrf2 governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1 cause familial forms of amyotrophic lateral sclerosis (ALS, a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.
Heme and erythropoieis: more than a structural role.
Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela
2014-06-01
Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own synthesis and regulates the expression of several erythroid-specific genes. Heme is synthesized in developing erythroid progenitors by the stage of proerythroblast, through a series of eight enzymatic reactions divided between mitochondria and cytosol. Defects of heme synthesis in the erythroid lineage result in sideroblastic anemias, characterized by microcytic anemia associated to mitochondrial iron overload, or in erythropoietic porphyrias, characterized by porphyrin deposition in erythroid cells. Here, we focus on the heme biosynthetic pathway and on human erythroid disorders due to defective heme synthesis. The regulatory role of heme during erythroid differentiation is discussed as well as the heme-mediated regulatory mechanisms that allow the orchestration of the adaptive cell response to heme deficiency. Copyright© Ferrata Storti Foundation.
Inhibition of early T cell cytokine production by arsenic trioxide occurs independently of Nrf2.
Directory of Open Access Journals (Sweden)
Kelly R VanDenBerg
Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is a stress-activated transcription factor that induces a variety of cytoprotective genes. Nrf2 also mediates immunosuppressive effects in multiple inflammatory models. Upon activation, Nrf2 dissociates from its repressor protein, Keap1, and translocates to the nucleus where it induces Nrf2 target genes. The Nrf2-Keap1 interaction is disrupted by the environmental toxicant and chemotherapeutic agent arsenic trioxide (ATO. The purpose of the present study was to determine the effects of ATO on early events of T cell activation and the role of Nrf2 in those effects. The Nrf2 target genes Hmox-1, Nqo-1, and Gclc were all upregulated by ATO (1-2 μM in splenocytes derived from wild-type, but not Nrf2-null, mice, suggesting that Nrf2 is activated by ATO in splenocytes. ATO also inhibited IFNγ, IL-2, and GM-CSF mRNA and protein production in wild-type splenocytes activated with the T cell activator, anti-CD3/anti-CD28. However, ATO also decreased production of these cytokines in activated splenocytes from Nrf2-null mice, suggesting the inhibition is independent of Nrf2. Interestingly, ATO inhibited TNFα protein secretion, but not mRNA expression, in activated splenocytes suggesting the inhibition is due to post-transcriptional modification. In addition, c-Fos DNA binding was significantly diminished by ATO in wild-type and Nrf2-null splenocytes activated with anti-CD3/anti-CD28, consistent with the observed inhibition of cytokine production by ATO. Collectively, this study suggests that although ATO activates Nrf2 in splenocytes, inhibition of early T cell cytokine production by ATO occurs independently of Nrf2 and may instead be due to impaired AP-1 DNA binding.
Skin Redox Balance Maintenance: The Need for an Nrf2-Activator Delivery System
Directory of Open Access Journals (Sweden)
Maya Ben-Yehuda Greenwald
2016-01-01
Full Text Available The skin, being the largest organ of the body, functions as a barrier between our body and the environment. It is consistently exposed to various exogenous and endogenous stressors (e.g., air pollutants, ionizing and non-ionizing irradiation, toxins, mitochondrial metabolism, enzyme activity, inflammatory process, etc. producing reactive oxygen species (ROS and physical damage (e.g., wounds, sunburns also resulting in reactive oxygen species production. Although skin is equipped with an array of defense mechanisms to counteract reactive oxygen species, augmented exposure and continued reactive oxygen species might result in excessive oxidative stress leading to many skin disorders including inflammatory diseases, pigmenting disorders and some types of cutaneous malignancy. The nuclear factor erythroid 2-related factor 2 (Nrf2 is an emerging regulator of cellular resistance and of defensive enzymes such as the phase II enzymes. Induction of the Keap1–Nrf2 pathway may have a beneficial effect in the treatment of a large number of skin disorders by stimulating an endogenous defense mechanism. However, prolonged and enhanced activation of this pathway is detrimental and, thus, limits the therapeutic potential of Keap1–Nrf2 modulators. Here, we review the consequences of oxidative stress to the skin, and the defense mechanisms that skin is equipped with. We describe the challenges of maintaining skin redox balance and its impact on skin status and function. Finally, we suggest a novel strategy for maintenance of skin redox homeostasis by modulating the Keap1–Nrf2 pathway using nanotechnology-based delivery systems.
Allen, Nancy A; Melkus, Gail D; Chyun, Deborah A
2011-10-01
To describe relationships among physical activity (PA), physiological factors, and psychological factors in Black women with type 2 diabetes mellitus (T2DM). A cross-sectional design was used (N = 109). Data were collected on PA(activity/inactivity, TV hours, bed confinement), physiology (blood pressure, lipids, hemoglobin A1c), psychology (anxiety,emotional distress, physical functioning, bodily pain, vitality), and health care provider (HCP) support. Walking was the preferred PA; TV viewing averaged 3.7 hours/day, and 24% reported confinement to bed >1 week in the last year. Inactive women had greater physiological and psychological problems than active women. Women watching TV >2 hours/day had more physiological problems than women watching TV Women reporting >1 week of confinement to bed in the last year had more physiological and psychological problems than those confined to bed women with T2DM should promote walking, address TV viewing time, incorporate HCP’s role of PA counseling/support,and address several psychological factors.
An evaluation of factors affecting the in vitro bioassay for erythropoietin
International Nuclear Information System (INIS)
Dunn, C.D.R.; Napier, J.A.F.
1975-01-01
Two main aspects of the in vitro mouse foetal liver cell assay for erythroid stimulating factor (ESF) in human sera have been investigated. The haem extraction process has been shown to give specific and quantitative recovery of 59 Fe labelled haem from haemoglobin thus confirming that the material assayed in human sera is stimulating the synthesis of this protein. The extraction procedure can be simplified considerably by prior mixing of the reagents without significantly influencing the results. Several serum constituents (citrate, testosterone, B 12 , folic acid and iron) have been investigated over a range of concentrations for possible effects on the cultures. Generally only small effects on haem synthesis were observed. It is concluded that variations in the levels of these factors in sera from treated patients will not produce any significant alterations in the estimated ESF concentrations. (author)
Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A
2008-10-01
The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.
Abdominal obesity: causal factor or simply a symptom of obesity-related health risk
Directory of Open Access Journals (Sweden)
Oh S
2014-07-01
Full Text Available Sechang Oh,1 Kiyoji Tanaka,2 Jin-won Noh,3 Rina So,2,4 Takehiko Tsujimoto,2 Hiroyuki Sasai,1,4 Mijung Kim,5 Junichi Shoda11Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki, Japan; 2Faculty of Health and Sports Science, University of Tsukuba, Tsukuba, Ibaraki, Japan; 3Department of Healthcare Management, Eulji University, Seongnam-si, Gyeonggi-do, Republic of Korea; 4Japan Society for the Promotion of Science, Tokyo, Japan; 5Faculty of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, JapanBackground: Abdominal fat (AF reduction is advocated in the treatment of obesity-related diseases. Nonetheless, recent studies have shown additional beneficial effects against obesity-related health risks, independent of AF reduction. Therefore it is important to determine whether AF plays a causal role in promoting metabolic disorders or is simply a symptom of increased obesity-related health risk factors. Clarification of the primary role of AF in the pathogenesis of obesity-related disease is also important.Objective: This retrospective study was conducted with the objectives of 1 comparison between groups exhibiting equivalent amounts of AF loss that resulted from distinct treatments (exercise and dietary restriction with respect to degrees of improvement in obesity-related health risk factors and 2 determination of definite differences in the outcomes of obesity-related health risk in subjects receiving identical treatment (exercise but exhibiting a remarkable difference in AF reduction.Design: In 66 subjects who completed a 12-week exercise or dietary restriction program, 17 parameters (systolic blood pressure [SBP] and diastolic blood pressure [DBP]; high-sensitivity C-reactive protein [hs-CRP]; leptin, adiponectin, tumor necrosis factor [TNF]-α, interleukin [IL]-6; alanine aminotransferase [ALT], gamma glutamyl transpeptidase [γGT]; lipid profile: high-density lipoprotein cholesterol [HDLC], triglyceride [TG
Trimetazidine protects retinal ganglion cells from acute glaucoma via the Nrf2/Ho-1 pathway.
Wan, Peixing; Su, Wenru; Zhang, Yingying; Li, Zhidong; Deng, Caibin; Zhuo, Yehong
2017-09-15
Acute glaucoma is one of the leading causes of irreversible vision impairment characterized by the rapid elevation of intraocular pressure (IOP) and consequent retinal ganglion cell (RGC) death. Oxidative stress and neuroinflammation have been considered critical for the pathogenesis of RGC death in acute glaucoma. Trimetazidine (TMZ), an anti-ischemic drug, possesses antioxidative and anti-inflammatory properties, contributing to its therapeutic potential in tissue damage. However, the role of TMZ in acute glaucoma and the underlying molecular mechanisms remain elusive. Here, we report that treatment with TMZ significantly attenuated retinal damage and RGC death in mice with acute glaucoma, with a significant decrease in reactive oxygen species (ROS) and inflammatory cytokine production in the retina. Furthermore, TMZ treatment directly decreased ROS production and rebalanced the intracellular redox state, thus contributing to the survival of RGCs in vitro TMZ treatment also reduced the production of inflammatory cytokines in vitro Mechanistically, the TMZ-mediated inhibition of apoptosis and inflammatory cytokine production in RGCs occurred via the regulation of the nuclear factor erythroid 2-related factor 2/heme oxygenase 1/caspase-8 pathway. Moreover, the TMZ-mediated neuroprotection in acute glaucoma was abrogated when an HO-1 inhibitor, SnPP, was used. Our findings identify potential mechanisms of RGC apoptosis and propose a novel therapeutic agent, TMZ, which exerts a precise neuroprotective effect against acute glaucoma. © 2017 The Author(s).
25 CFR Appendix C to Subpart C - Relative Need Distribution Factor
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Relative Need Distribution Factor C Appendix C to Subpart...—Relative Need Distribution Factor The Relative Need Distribution Factor (RNDF) is a mathematical formula for distributing the IRR Program construction funds using the following three factors: Cost to...
Factors associated with drug-related harms related to policing in Tijuana, Mexico
2011-01-01
Objective To assess factors associated with drug-related harms related to policing among injection drug users (IDUs) in Tijuana, Mexico. Methods IDUs who were over 18 years old and had injected drugs within the last six months were recruited via respondent-driven sampling and underwent questionnaires and testing for HIV (human immunodeficiency virus), syphilis and TB (tuberculosis). Random effects logistic regression was used to simultaneously model factors associated with five drug-related harms related to policing practices in the prior six months (i.e., police led them to rush injections; affected where they bought drugs; affected locations where they used drugs; feared that police will interfere with their drug use; receptive syringe sharing). Results Of 727 IDUs, 85% were male; median age was 38 years. Within the last 6 months, 231 (32%) of IDUs reported that police had led them to rush injections, affected where they bought or used drugs or were very afraid police would interfere with their drug use, or shared syringes. Factors independently associated with drug-related harms related to policing within the last six months included: recent arrest, homelessness, higher frequencies of drug injection, use of methamphetamine, using the local needle exchange program and perceiving a decrease in the purity of at least one drug. Conclusions IDUs who experienced drug-related harms related to policing were those who were most affected by other micro and macro influences in the physical risk environment. Police education programs are needed to ensure that policing practices do not exacerbate risky behaviors or discourage protective behaviors such as needle exchange program use, which undermines the right to health for people who inject drugs. PMID:21477299
Factors associated with drug-related harms related to policing in Tijuana, Mexico
Directory of Open Access Journals (Sweden)
Patterson Thomas L
2011-04-01
Full Text Available Abstract Objective To assess factors associated with drug-related harms related to policing among injection drug users (IDUs in Tijuana, Mexico. Methods IDUs who were over 18 years old and had injected drugs within the last six months were recruited via respondent-driven sampling and underwent questionnaires and testing for HIV (human immunodeficiency virus, syphilis and TB (tuberculosis. Random effects logistic regression was used to simultaneously model factors associated with five drug-related harms related to policing practices in the prior six months (i.e., police led them to rush injections; affected where they bought drugs; affected locations where they used drugs; feared that police will interfere with their drug use; receptive syringe sharing. Results Of 727 IDUs, 85% were male; median age was 38 years. Within the last 6 months, 231 (32% of IDUs reported that police had led them to rush injections, affected where they bought or used drugs or were very afraid police would interfere with their drug use, or shared syringes. Factors independently associated with drug-related harms related to policing within the last six months included: recent arrest, homelessness, higher frequencies of drug injection, use of methamphetamine, using the local needle exchange program and perceiving a decrease in the purity of at least one drug. Conclusions IDUs who experienced drug-related harms related to policing were those who were most affected by other micro and macro influences in the physical risk environment. Police education programs are needed to ensure that policing practices do not exacerbate risky behaviors or discourage protective behaviors such as needle exchange program use, which undermines the right to health for people who inject drugs.
4-Hydroxy hexenal derived from docosahexaenoic acid protects endothelial cells via Nrf2 activation.
Directory of Open Access Journals (Sweden)
Atsushi Ishikado
Full Text Available Recent studies have proposed that n-3 polyunsaturated fatty acids (n-3 PUFAs have direct antioxidant and anti-inflammatory effects in vascular tissue, explaining their cardioprotective effects. However, the molecular mechanisms are not yet fully understood. We tested whether n-3 PUFAs showed antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (Nrf2, a master transcriptional factor for antioxidant genes. C57BL/6 or Nrf2(-/- mice were fed a fish-oil diet for 3 weeks. Fish-oil diet significantly increased the expression of heme oxygenase-1 (HO-1, and endothelium-dependent vasodilation in the aorta of C57BL/6 mice, but not in the Nrf2(-/- mice. Furthermore, we observed that 4-hydroxy hexenal (4-HHE, an end-product of n-3 PUFA peroxidation, was significantly increased in the aorta of C57BL/6 mice, accompanied by intra-aortic predominant increase in docosahexaenoic acid (DHA rather than that in eicosapentaenoic acid (EPA. Human umbilical vein endothelial cells were incubated with DHA or EPA. We found that DHA, but not EPA, markedly increased intracellular 4-HHE, and nuclear expression and DNA binding of Nrf2. Both DHA and 4-HHE also increased the expressions of Nrf2 target genes including HO-1, and the siRNA of Nrf2 abolished these effects. Furthermore, DHA prevented oxidant-induced cellular damage or reactive oxygen species production, and these effects were disappeared by an HO-1 inhibitor or the siRNA of Nrf2. Thus, we found protective effects of DHA through Nrf2 activation in vascular tissue, accompanied by intra-vascular increases in 4-HHE, which may explain the mechanism of the cardioprotective effects of DHA.
Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo
Energy Technology Data Exchange (ETDEWEB)
Chian, Song; Thapa, Ruby; Chi, Zhexu [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: xiuwentang@zju.edu.cn [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China)
2014-05-16
Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.
The Role of the Nrf2/ARE Antioxidant System in Preventing Cardiovascular Diseases
Directory of Open Access Journals (Sweden)
Robert E. Smith
2016-11-01
Full Text Available It is widely believed that consuming foods and beverages that have high concentrations of antioxidants can prevent cardiovascular diseases and many types of cancer. As a result, many articles have been published that give the total antioxidant capacities of foods in vitro. However, many antioxidants behave quite differently in vivo. Some of them, such as resveratrol (in red wine and epigallocatechin gallate or EGCG (in green tea can activate the nuclear erythroid-2 like factor-2 (Nrf2 transcription factor. It is a master regulator of endogenous cellular defense mechanisms. Nrf2 controls the expression of many antioxidant and detoxification genes, by binding to antioxidant response elements (AREs that are commonly found in the promoter region of antioxidant (and other genes, and that control expression of those genes. The mechanisms by which Nrf2 relieves oxidative stress and limits cardiac injury as well as the progression to heart failure are described. Also, the ability of statins to induce Nrf2 in the heart, brain, lung, and liver is mentioned. However, there is a negative side of Nrf2. When over-activated, it can cause (not prevent cardiovascular diseases and multi-drug resistance cancer.
Khuwaja, Ali Khan; Lalani, Saima; Azam, Iqbal Syed; Ali, Badar Sabir; Jabbar, Abdual; Dhanani, Raheem
2011-01-01
Background. We evaluated the prevalence and clustering pattern of cardiovascular disease (CVD) related lifestyle factors and their association with CVD among patients with type 2 diabetes. We also examined the association of these factors with various socio-demographic characteristics. Methods. A total of 1000 patients with type 2 diabetes were interviewed in a cross-sectional, multi-center study in out-patient clinics in Karachi, Pakistan. Results. In this study 30.3% study participants had CVD. Majority of the patients were physically inactive and had adverse psychosocial factors. Forty percent of the study participants were exposed to passive smoking while 12.7% were current smokers. Only 8.8% of study subjects had none of the studied lifestyle factor, 27.5% had one, while 63.7% had two or three factors. CVDs were independently associated with physical inactivity, adverse psychosocial factors, passive smoking and clustering of two or three lifestyle factors. Physical inactivity was more prevalent among females and patients with no/less education. Proportion of adverse psychosocial factors were higher among females, elders and patients with no/less education. Clustering of these lifestyle factors was significantly higher among females, elderly and no/less educated patients. Conclusion. These results suggest the need of comprehensive and integrated interventions to reduce the prevalence of lifestyle factors. PMID:21837274
Risk factors for age-related maculopathy.
Connell, Paul P; Keane, Pearse A; O'Neill, Evelyn C; Altaie, Rasha W; Loane, Edward; Neelam, Kumari; Nolan, John M; Beatty, Stephen
2009-01-01
Age-related maculopathy (ARM) is the leading cause of blindness in the elderly. Although beneficial therapeutic strategies have recently begun to emerge, much remains unclear regarding the etiopathogenesis of this disorder. Epidemiologic studies have enhanced our understanding of ARM, but the data, often conflicting, has led to difficulties with drawing firm conclusions with respect to risk for this condition. As a consequence, we saw a need to assimilate the published findings with respect to risk factors for ARM, through a review of the literature appraising results from published cross-sectional studies, prospective cohort studies, case series, and case control studies investigating risk for this condition. Our review shows that, to date, and across a spectrum of epidemiologic study designs, only age, cigarette smoking, and family history of ARM have been consistently demonstrated to represent risk for this condition. In addition, genetic studies have recently implicated many genes in the pathogenesis of age-related maculopathy, including Complement Factor H, PLEKHA 1, and LOC387715/HTRA1, demonstrating that environmental and genetic factors are important for the development of ARM suggesting that gene-environment interaction plays an important role in the pathogenesis of this condition.
Risk Factors for Age-Related Maculopathy
Directory of Open Access Journals (Sweden)
Paul P. Connell
2009-01-01
Full Text Available Age-related maculopathy (ARM is the leading cause of blindness in the elderly. Although beneficial therapeutic strategies have recently begun to emerge, much remains unclear regarding the etiopathogenesis of this disorder. Epidemiologic studies have enhanced our understanding of ARM, but the data, often conflicting, has led to difficulties with drawing firm conclusions with respect to risk for this condition. As a consequence, we saw a need to assimilate the published findings with respect to risk factors for ARM, through a review of the literature appraising results from published cross-sectional studies, prospective cohort studies, case series, and case control studies investigating risk for this condition. Our review shows that, to date, and across a spectrum of epidemiologic study designs, only age, cigarette smoking, and family history of ARM have been consistently demonstrated to represent risk for this condition. In addition, genetic studies have recently implicated many genes in the pathogenesis of age-related maculopathy, including Complement Factor H, PLEKHA 1, and LOC387715/HTRA1, demonstrating that environmental and genetic factors are important for the development of ARM suggesting that gene-environment interaction plays an important role in the pathogenesis of this condition.
Risk factors for age-related maculopathy.
LENUS (Irish Health Repository)
Connell, Paul P
2012-02-01
Age-related maculopathy (ARM) is the leading cause of blindness in the elderly. Although beneficial therapeutic strategies have recently begun to emerge, much remains unclear regarding the etiopathogenesis of this disorder. Epidemiologic studies have enhanced our understanding of ARM, but the data, often conflicting, has led to difficulties with drawing firm conclusions with respect to risk for this condition. As a consequence, we saw a need to assimilate the published findings with respect to risk factors for ARM, through a review of the literature appraising results from published cross-sectional studies, prospective cohort studies, case series, and case control studies investigating risk for this condition. Our review shows that, to date, and across a spectrum of epidemiologic study designs, only age, cigarette smoking, and family history of ARM have been consistently demonstrated to represent risk for this condition. In addition, genetic studies have recently implicated many genes in the pathogenesis of age-related maculopathy, including Complement Factor H, PLEKHA 1, and LOC387715\\/HTRA1, demonstrating that environmental and genetic factors are important for the development of ARM suggesting that gene-environment interaction plays an important role in the pathogenesis of this condition.
Britanin Ameliorates Cerebral Ischemia-Reperfusion Injury by Inducing the Nrf2 Protective Pathway.
Wu, Guozhen; Zhu, Lili; Yuan, Xing; Chen, Hao; Xiong, Rui; Zhang, Shoude; Cheng, Hao; Shen, Yunheng; An, Huazhang; Li, Tiejun; Li, Honglin; Zhang, Weidong
2017-10-10
Oxidative stress is considered the major cause of tissue injury after cerebral ischemia. The nuclear factor erythroid 2-related factor 2 (Nrf2) pathway is one of the most important defensive mechanisms against oxidative stresses and has been confirmed as a target for stroke treatment. Thus, we desired to find new Nrf2 activators and test their neuronal protective activity both in vivo and in vitro. The herb-derived compound, Britanin, is a potent inducer of the Nrf2 system. Britanin can induce the expression of protective enzymes and reverse oxygen-glucose deprivation, followed by reperfusion (OGD-R)-induced neuronal injury in primary cortical neurons in vitro. Furthermore, the administration of Britanin significantly ameliorated middle cerebral artery occlusion-reperfusion (MCAO-R) insult in vivo. We report here the crystal structure of the complex of Britanin and the BTB domain of Keap1. Britanin selectively binds to a conserved cysteine residue, cysteine 151, of Keap1 and inhibits Keap1-mediated ubiquitination of Nrf2, leading to induction of the Nrf2 pathway. Britanin is a potent inducer of Nrf2. The complex crystal structure of Britanin and the BTB domain of Keap1 help clarify the mechanism of Nrf2 induction. Britanin was proven to protect primary cortical neurons against OGD-R-induced injury in an Nrf2-dependant way. Additionally, Britanin had excellent cerebroprotective effect in an MCAO-R model. Our results demonstrate that the natural product Britanin with potent Nrf2-activating and neural protective activities both in vitro and in vivo could be developed into a cerebroprotective therapeutic agent. Antioxid. Redox Signal. 27, 754-768.
Factors Related to the Glycemic Control in Lithuanian Adolescents with Type 1 Diabetes Mellitus
Kassem, Salem
2017-01-01
1) Adolescent female patients with type 1 diabetes mellitus have better glycemic control and higher levels of diabetes distress than male patients. 2) Parents of adolescents using insulin pumps experience higher diabetes distress than parents of adolescents using multiple daily injections. 3) No differences in diabetes-related factors, emotional state, diabetes-related distress (in adolescent patients and in their primary care-givers) and social factors in groups of adolescent patients ...
The NLstart2run study: Incidence and risk factors of running-related injuries in novice runners
Kluitenberg, B.; van Middelkoop, M.; Smits, D.W.; Verhagen, E.A.L.M.; Hartgens, F.; Diercks, R.; van der Worp, H.
2015-01-01
Running is a popular form of physical activity, despite of the high incidence of running-related injuries (RRIs). Because of methodological issues, the etiology of RRIs remains unclear. Therefore, the purposes of the study were to assess the incidence of RRIs and to identify risk factors for RRIs in
The NLstart2run study : Incidence and risk factors of running-related injuries in novice runners
Kluitenberg, B; van Middelkoop, M; Smits, D W; Verhagen, E; Hartgens, F; Diercks, R; van der Worp, H
2015-01-01
Running is a popular form of physical activity, despite of the high incidence of running-related injuries (RRIs). Because of methodological issues, the etiology of RRIs remains unclear. Therefore, the purposes of the study were to assess the incidence of RRIs and to identify risk factors for RRIs in
Longitudinal health-related quality of life outcomes and related factors after pediatric SCT.
Barrera, M; Atenafu, E; Hancock, K
2009-08-01
Our purpose was to investigate longitudinally health-related quality of life (HRQOL) outcomes and related factors up to 2 years post-pediatric SCT. A total of 99 mothers of patients, aged 1.5-17 years, completed two standardized HRQOL questionnaires, generic and disease specific (DS), about the child, and reported on their own symptoms of depression and family function pre-SCT, 12 and 24 months post-SCT. Clinical (diagnosis, radiation), child (age) and family (maternal depression) information was also obtained. Significant improvement in physical and psychosocial HRQOL from pre-SCT to 1 or 2 years post-SCT was reported. Survivors of ALL were reported to have poorer physical and psychosocial HRQOL than survivors of solid tumors on the DS measure. Maternal depression was negatively associated with physical and psychosocial HRQOL. Maternal education (higher) at pre-SCT predicted improvements in physical domains 2 years post-SCT; mother's age (older) and child's age (younger) also predicted improvements of physical and emotional HRQOL. We conclude that survivors of pediatric SCT improved physical and psychosocial HRQOL by 1 and 2 years post-SCT. Older survivors whose mothers are younger and distressed, with lower education at SCT have compromised HRQOL compared to other survivors. This study has important implications for the care of SCT survivors and their families.
Chen, Tao; Wu, Yu; Wang, Yuzi; Zhu, Jigao; Chu, Haiying; Kong, Li; Yin, Liangwei; Ma, Haiying
2017-11-01
Brain-derived neurotrophic factor (BDNF) plays an important role in promoting the growth, differentiation, survival and synaptic stability of neurons. Presently, the transplantation of neural stem cells (NSCs) is known to induce neural repair to some extent after injury or disease. In this study, to investigate whether NSCs genetically modified to encode the BDNF gene (BDNF/NSCs) would further enhance synaptogenesis, BDNF/NSCs or naive NSCs were directly engrafted into lesions in a rat model of traumatic brain injury (TBI). Immunohistochemistry, western blotting and RT-PCR were performed to detect synaptic proteins, BDNF-TrkB and its downstream signaling pathways, at 1, 2, 3 or 4 weeks after transplantation. Our results showed that BDNF significantly increased the expression levels of the TrkB receptor gene and the phosphorylation of the TrkB protein in the lesions. The expression levels of Ras, phosphorylated Erk1/2 and postsynaptic density protein-95 were elevated in the BDNF/NSCs-transplanted groups compared with those in the NSCs-transplanted groups throughout the experimental period. Moreover, the nuclear factor (erythroid-derived 2)-like 2/Thioredoxin (Nrf2/Trx) axis, which is a specific therapeutic target for the treatment of injury or cell death, was upregulated by BDNF overexpression. Therefore, we determined that the increased synaptic proteins level implicated in synaptogenesis might be associated with the activation of the MAPK/Erk1/2 signaling pathway and the upregulation of the antioxidant agent Trx modified by BDNF-TrkB following the BDNF/NSCs transplantation after TBI.
Guan, SP; Tee, W; Ng, DSW; Chan, TK; Peh, HY; Ho, WE; Cheng, C; Mak, JC; Wong, WSF
2013-01-01
Background and Purpose Cigarette smoke is a major cause for chronic obstructive pulmonary disease (COPD). Andrographolide is an active biomolecule isolated from the plant Andrographis paniculata. Andrographolide has been shown to activate nuclear factor erythroid-2-related factor 2 (Nrf2), a redox-sensitive antioxidant transcription factor. As Nrf2 activity is reduced in COPD, we hypothesize that andrographolide may have therapeutic value for COPD. Experimental Approach Andrographolide was given i.p. to BALB/c mice daily 2 h before 4% cigarette smoke exposure for 1 h over five consecutive days. Bronchoalveolar lavage fluid and lungs were collected for analyses of cytokines, oxidative damage markers and antioxidant activities. BEAS-2B bronchial epithelial cells were exposed to cigarette smoke extract (CSE) and used to study the antioxidant mechanism of action of andrographolide. Key Results Andrographolide suppressed cigarette smoke-induced increases in lavage fluid cell counts; levels of IL-1β, MCP-1, IP-10 and KC; and levels of oxidative biomarkers 8-isoprostane, 8-OHdG and 3-nitrotyrosine in a dose-dependent manner. Andrographolide promoted inductions of glutathione peroxidase (GPx) and glutathione reductase (GR) activities in lungs from cigarette smoke-exposed mice. In BEAS-2B cells, andrographolide markedly increased nuclear Nrf2 accumulation, promoted binding to antioxidant response element (ARE) and total cellular glutathione level in response to CSE. Andrographolide up-regulated ARE-regulated gene targets including glutamate-cysteine ligase catalytic (GCLC) subunit, GCL modifier (GCLM) subunit, GPx, GR and heme oxygenase-1 in BEAS-2B cells in response to CSE. Conclusions Andrographolide possesses antioxidative properties against cigarette smoke-induced lung injury probably via augmentation of Nrf2 activity and may have therapeutic potential for treating COPD. PMID:23146110
Mortality, Causes of Death and Associated Factors Relate to a Large HIV Population-Based Cohort.
Garriga, César; García de Olalla, Patricia; Miró, Josep M; Ocaña, Inma; Knobel, Hernando; Barberá, Maria Jesús; Humet, Victoria; Domingo, Pere; Gatell, Josep M; Ribera, Esteve; Gurguí, Mercè; Marco, Andrés; Caylà, Joan A
2015-01-01
Antiretroviral therapy has led to a decrease in HIV-related mortality and to the emergence of non-AIDS defining diseases as competing causes of death. This study estimates the HIV mortality rate and their risk factors with regard to different causes in a large city from January 2001 to June 2013. We followed-up 3137 newly diagnosed HIV non-AIDS cases. Causes of death were classified as HIV-related, non-HIV-related and external. We examined the effect of risk factors on survival using mortality rates, Kaplan-Meier plots and Cox models. Finally, we estimated survival for each main cause of death groups through Fine and Gray models. 182 deaths were found [14.0/1000 person-years of follow-up (py); 95% confidence interval (CI):12.0-16.1/1000 py], 81.3% of them had a known cause of death. Mortality rate by HIV-related causes and non-HIV-related causes was the same (4.9/1000 py; CI:3.7-6.1/1000 py), external was lower [1.7/1000 py; (1.0-2.4/1000 py)]. Kaplan-Meier estimate showed worse survival in intravenous drug user (IDU) and heterosexuals than in men having sex with men (MSM). Factors associated with HIV-related causes of death include: IDU male (subHazard Ratio (sHR):3.2; CI:1.5-7.0) and causes of death include: ageing (sHR:1.5; CI:1.4-1.7) and heterosexual female (sHR:2.8; CI:1.1-7.3) versus MSM. Factors associated with external causes of death were IDU male (sHR:28.7; CI:6.7-123.2) and heterosexual male (sHR:11.8; CI:2.5-56.4) versus MSM. There are important differences in survival among transmission groups. Improved treatment is especially necessary in IDUs and heterosexual males.
Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O
2016-05-01
This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (Plycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. © 2016 Poultry Science Association Inc.
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Ji, Xiang-Jun; Chen, Sui-Hua; Zhu, Lin; Pan, Hao; Zhou, Yuan; Li, Wei; You, Wan-Chun; Gao, Chao-Chao; Zhu, Jian-Hong; Jiang, Kuan; Wang, Han-Dong
2013-07-01
NF-E2-related factor 2 (Nrf2) is a pivotal transcription factor of cellular responses to oxidative stress and recent evidence suggests that Nrf2 plays an important role in cancer pathobiology. However, the underlying mechanism has yet to be elucidated, particularly in glioma. In the present study, we investigated the role of Nrf2 in the clinical prognosis, cell proliferation and tumor growth of human glioblastoma multiforme (GBM). We detected overexpression of Nrf2 protein levels in GBM compared to normal brain tissues. Notably, higher protein levels of Nrf2 were significantly associated with poorer overall survival and 1-year survival for GBM patients. Furthermore, we constructed the plasmid Si-Nrf2 and transduced it into U251MG cells to downregulate the expression of Nrf2 and established stable Nrf2 knockdown cells. The downregulation of Nrf2 suppressed cell proliferation in vitro and tumor growth in mouse xenograft models. We performed immunohistochemistry staining to detect the protein levels of Nrf2, Ki-67, caspase-3 and CD31 in the xenograft tumors and found that the expression levels of Nrf2 and Ki-67 were much lower in the Si-Nrf2 group compared to the Si-control group. In addition, the number of caspase-3-positive cells was significantly increased in the Si-Nrf2 group. By analysis of microvessel density (MVD) assessed by CD31, the MVD value in the Si-Nrf2 group decreased significantly compared to the Si-control group. These findings indicate that the knockdown of Nrf2 may suppress tumor growth by inhibiting cell proliferation, increasing cell apoptosis and inhibiting angiogenesis. These results highlight the potential of Nrf2 as a candidate molecular target to control GBM cell proliferation and tumor growth.
Directory of Open Access Journals (Sweden)
Yu XIAO
2018-03-01
Full Text Available Background and objective There are significantly interindividual variations of the expression level of nuclear factor erythroid-2-related factor 2 (Nrf2 and/or Kelch-like ECH-associated protein 1 (Keap1 in our previous studies. It has been proven that Nrf2 or Keap1 is related to resistance of chemotherapeutic drugs and/or epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs. However, the expression of Nrf2 and Keap1 in lung adenocarcinoma patients with different “driver gene” is not clear. The aim of this study is to investigate the protein expression level of Nrf2 and Keap1 in lung adenocarcinoma and to elucidate the correlation between Nrf2 or Keap1 expression and the status of EGFR gene mutation and to determine the effects of Nrf2 and Keap1 on the patients. Methods Immunohistochemical analysis of Nrf2 and Keap1 in tumor specimens was performed in a total of 104 lung adenocarcinoma patients with the status of EGFR gene mutations or EGFR wide-type. Results The Nrf2 positive rate was 71.2% and Keap1 high expression rate was 34.6% in 104 patients. The Nrf2 positive rate significantly correlated with gender, stage and status of EGFR gene mutation (P0.05. The high expression of Keap1 was not significantly correlated with gender, age, smoking, differentiation, subtype of lung adenocarcinoma and status of EGFR gene mutation (P>0.05. The progression -free survival (PFS and overall survival (OS of the patients treated by EGFR-TKIs were significantly correlated with the expression level of Nrf2, but not with Keap1. The PFS and OS of the patients with Nrf2 high expression were significantly shorter than the patients with low/negative expression (P<0.05. Furthermore, Nrf2 high expression was the independent predictive factor for EGFR-TKIs induced PFS and OS (P<0.05. Conclusion The Nrf2 positive rate significantly correlated with the status of EGFR gene mutation in lung adenocarcinoma. The Nrf2 high expression significantly
Gore, Prashant R.; Prajapati, Chaitali P.; Mahajan, Umesh B.; Goyal, Sameer N.; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R.
2016-01-01
Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498
Study Of Socio- Economic Factors In Relation To Leprosy
Directory of Open Access Journals (Sweden)
Alam Mahjabeen
1998-01-01
Full Text Available Research question: what are the socio-economic factors in relation to leprosy and their implications? Objectives: (i To study the socio-economic factors in relation to leprosy.(ii To assess the impact of disease on patients†job/income. Study design: Cross-sectional. Setting and Participants: Patients attending the dermatology OPD, J.N. Medical college hospital, A.M.U., Aligarh. Sample size: 200 leprosy patients. Study variables: education, occupation, social class, incapacitation, change in job, reduction in income. Statically analysis: Chi-square test Results: 46% of the leprosy patients were illiterate. A large majority of patients (78% were involved in heavy manual work as farmers and labourers. 68.5% patients belonged to low social classes (IV and V. More males (26.3% suffered from incapacitation than females (8.5%. 2.5% patients lost their job or were unable to work and 11.5% had to change their jobs due to the disease or disability caused by it. 17.5% patients had a history of reduction in their income after occurrence of leprosy.
Pu, Q L; Zhou, Q Y; Liu, J; Li, P; Huang, H F; Jiang, H Q
2017-05-11
Objective: To observe and analyze related factors of neonatal asphyxia complicated with retinal hemorrhage. Methods: It was a retrospective case series. Seven hundred and twenty-one cases with neonatal asphyxia after 72 hours of birth were enrolled in this study. Fundus examination was performed on these newborns using the third generation wide-angle digital retina imaging system (RetCamⅢ), and the bleeding level was divided into level I, level Ⅱ and level Ⅲ. The conditions of the newborn and the mother during pregnancy were correlatively analyzed. The other factors were also analyzed including delivery mode, birth weight, gestational age, gender, grade of neonatal asphyxia, scalp hematoma, intracranial hemorrhage, fetal intrauterine distress, mother's age and antenatal complications. Single factor χ(2) test and multivariate logistic regression analysis were used to screen and judge risk factors causing retinal hemorrhage related to neonatal asphyxia. Results: In 721 cases of neonatal asphyxia, retinal hemorrhage was found in 204 newborns (28.29%). The hemorrhage was at level Ⅰ in 77 cases (37.75%) , at level Ⅱ in 38 cases (18.63%) and at level Ⅲ in 89 cases (43.63%) . Four cases also had vitreous hemorrhage. Asphyxia was mild in 673 infants (93.34%) and severe in 48 infants (6.66%). The difference in the degree of retinal hemorrhage between the patients with mild and severe asphyxia was significant (χ(2)=22.336, P= 0.000). When asphyxia was aggravated, the degree of retinal hemorrhage increased. Relative factors analysis showed that delivery mode (χ(2)=158.643, Pneonatal asphyxia (χ(2)=19.809, Phemorrhage. Logistic regression analysis indicated that grade of neonatal asphyxia and delivery mode were risk factors of retinal hemorrhage in neonatal asphyxia ( OR= 0.304, 0.085). Conclusion: The incidence of retinal hemorrhage in neonatal asphyxia was 28.29%. The degree of neonatal asphyxia and delivery mode may play roles in the occurrence of retinal
Uveal melanoma in relation to ultraviolet light exposure and host factors.
Holly, E A; Aston, D A; Char, D H; Kristiansen, J J; Ahn, D K
1990-09-15
We conducted a case-control interview study among 1277 subjects (407 patients, 870 controls selected by using random digit dial) in 11 western United States to determine whether uveal melanoma and cutaneous melanoma shared common risk factors. After adjustment for other factors, the risk of uveal melanoma was increased for those with green, gray, or hazel eyes [relative risk (RR) = 2.5, P less than 0.001] or blue eyes (RR = 2.2, P less than 0.001) when compared to brown. A tendency to sunburn after 0.5 h midday summer sun exposure increased risk for uveal melanoma (burn with tanning RR = 1.5, P = 0.02; burn with little tanning RR = 1.8, P less than 0.001; burn with no tanning RR = 1.7, P = 0.002); as did exposure to UV or black lights (RR = 3.7, P = 0.003); and welding burn, sunburn of the eye, or snow blindness (RR = 7.2, P less than 0.001). An association with uveal melanoma was also noted with an increasing number of large nevi (P = 0.04 for trend), although the individual risk estimates were not remarkable. These data suggest that host factors and exposure to UV light are risk factors for uveal melanoma.
Factors related to nursing students' readiness to enter working life - A scoping literature review.
Järvinen, Tiina; Eklöf, Niina; Salminen, Leena
2018-03-01
The aim of this scoping literature review was to identify the factors related to nursing students' readiness to enter working life. The literature search was carried out in autumn 2017 in PubMed and CINAHL databases. The studies selected for this review (n = 17) were analyzed thematically with inductive content analysis. Four subthemes that were combined into two main factors related to nursing students' readiness to enter working life were found. The main factors found were 1) educational factors and 2) personal factors. Educational factors consisted of professional competence and clinical practice, while personal factors consisted of nursing students' background and feelings. Some nursing students tend to feel insecure about entering working life as a newly graduated nurse. This literature review also supports the importance of clinical practice periods in nursing education and for readiness for working life. Nurse education needs to ensure clinical practice periods which support nursing students' professional growth. Further research is needed on how the factors related to nursing students' readiness to enter working life correlate with each other. Particularly, the association between competence, readiness and positive feelings towards graduation needs further investigation. Copyright © 2018 Elsevier Ltd. All rights reserved.
Kovavisarach, Ekachai; Phromsila, Raweewan
2012-08-01
To determine the risk factors related to heartburn in pregnant women attending the antenatal care clinic, Rajavithi Hospital. Self-reporting questionnaire about demographic data and risk factors related to heartburn in those pregnant women between May 1 and July 31, 2010. Heartburn was found in 55 out of 452 pregnant women (12.2%). There were no significant differences in demographic characteristics and risk factors between the heartburn and non-heartburn groups. Consumption of alcoholic drinks was a reversely significant risk factor of heartburn (OR 0.11, CI 0.01 to 0.78) (p = 0.005). Heartburn was not uncommon, and no associated factors were demonstrated.
Prognosis and related factors of HPV infections in postmenopausal Uyghur women.
Sui, Shuang; Zhu, Mingyue; Jiao, Zhen; Han, Lili; Wang, Lin; Niyazi, Mayineur; Zhu, Kaichun
2018-03-25
With the aim to explore the characteristics of persistent HPV infections in postmenopausal Uyghur women and analyse the possible related risk factors, from September 2012 to September 2013; postmenopausal Uyghur women with HPV positive and pathologically diagnosed as non-cervical intraepithelial neoplasia (CIN) lesions and non-cervical cancer were recruited. Their clinical course was closely followed up for 24-36 months, and the risk factors were analysed by a logistic regression model. One hundred and sixteen positive women were followed for 36 months. The total persistent HPV infection rate was 67.9%, and the type-specific persistent infection rate was 73.7% at 36 months. Nine (32.1%) women were naturally cleared of their HPV infection at 36 months. We found that an HPV16 infection and an HPV58 infection, and time since menopause over 2 years were closely related with a persistent HPV infection. More attention should be paid to the women above 2 years of menopause who were infected with HPV16 and HPV58 in their further cervical carcinoma screening. Impact statement What is already known on this subject? Previous study revealed that menopause was a risk factor for a persistent HPV infection in Uyghur women. What do the results of this study add? The present study presented the characteristics of HPV persistent infection and the risk factors in Uyghur postmenopausal women. More attention should be paid to the women above 2 of years of menopause who are infected with HPV16 and HPV58. What are the implications of these findings for clinical practice and/or further research? This study would offer a theoretical basis for a better screening design, especially the women above 2 years' menopause who have been infected with HPV16 and HPV58 in the Xinjiang region.
[Factors Related to Presenteeism in Young and Middle-aged Nurses].
Yoshida, Mami; Miki, Akiko
2018-04-03
Presenteeism is considered to be not only a work-related stressor but also a factor involved in the development of workaholism and error proneness, which is often described as careless. Additionally, increasing health issues arising from aging suggest the possibility that presenteeism in middle-aged nurses is different than that in young ones. Therefore, the present study aimed to identify and tease apart factors involved in presenteeism among young and middle-aged nurses. An anonymous self-administered questionnaire survey was conducted among 2,006 nurses working at 10 hospitals. In total, 761 nurses aged nurses aged ≥40 years were enrolled in this study. Work Impairment Scores (WIS) on the Japanese version of the Stanford Presenteeism Scale were measured for presenteeism. Job stressors, workaholism, and error proneness were measured for related factors. Multiple regression analysis was conducted after determining the WIS as the dependent variable and related factors as independent variables. Overall, 70.8% of the young nurses reported health problems compared to 82.5% of the middle-aged nurses. However, WIS in young nurses was significantly higher than that in middle-aged ones (p nurses showed a significant relationship with the degree of stressors, "difficulty of work" (β = 0.28, p nurses showed a significant relationship with "cognitive narrowing" (β = 0.29, p nurses does not necessarily lower their working capacity. Also, compared to young nurses, the degree of failing tendency, rather than the degree of job stressors, was more related to presenteeism for middle-aged nurses. It can be considered that middle-aged nurses simply realize that their working ability is hindered because of incidents resulting from attention narrowing. As fatigue and state of tension tend to cause narrowing of attention, it may be necessary to reduce such risks and adjust work environments so mistakes can be avoided.
Energy Technology Data Exchange (ETDEWEB)
Gu, Lina; Tao, Xufeng; Xu, Youwei; Han, Xu; Qi, Yan; Xu, Lina; Yin, Lianhong; Peng, Jinyong, E-mail: jinyongpeng2014@163.com
2016-02-01
Oxidative stress is involved in hepatic stellate cells (HSCs) activation and extracellular matrix overproduction. We previously reported the promising effects of dioscin against CCl{sub 4}-induced liver fibrosis, but its effects and mechanisms on BDL- and DMN-induced liver fibrosis remain unknown. The results in the present study indicated that dioscin significantly inhibited HSCs activation and attenuated hepatic fibrosis in rats. Furthermore, dioscin markedly up-regulated the levels of sirtuin 1 (Sirt1), HO-1, GST, GCLC and GCLM via increasing the nuclear translocation of nuclear erythroid factor 2-related factor 2 (Nrf2), which in turn inhibited mitogen-activated protein kinase 14 (p38 MAPK) phosphorylation and reduced the levels of COL1A1, COL3A1, α-SMA and fibronectin. These results were further validated by knockdown of Sirt1 and Nrf2 using siRNAs silencing, and abrogation of p38 MAPK using SB-203580 (a p38 MAPK inhibitor) in HSC-T6 and LX-2 cells. Collectively, our findings confirmed the potent effects of dioscin against liver fibrosis and also provided novel insights into the mechanisms of this compound as a candidate for the prevention of liver fibrosis in the future. - Highlights: • Dioscin showed potent effects against BDL- and DMN-induced liver fibrosis in rats. • Dioscin significantly suppressed oxidative stress. • Dioscin triggered Sirt1/Nrf2-mediated inhibition of p38 MAPK pathway. • Dioscin should be developed as a novel candidate to treat liver fibrosis.
Farm Work-Related Injuries and Risk Factors in South Korean Agriculture.
Kim, Hyocher; Räsänen, Kimmo; Chae, Hyeseon; Kim, Kyungsu; Kim, Kyungran; Lee, Kyungsuk
2016-01-01
Agriculture is known to be a risk-filled industry in South Korea, as it is worldwide. The aims of this study were to identify the magnitude of farm work-related injuries and evaluate the association between injury and possible risk factors. Farmers, including farm members (N = 16,160), were surveyed. After excluding 7 subjects with missing data in questions about injury, 16,153 farmer responses were used for the analysis. Of the 16,153 farmers, 3.6% answered having at least one farm work-related injury requiring outpatient treatment or hospitalization during 2012. The proportion of injured men (4.3%) was 1.5 times higher than women (2.9%). From an age perspective, the proportion was 1.3% of those aged 49 or below, 2.7% of those aged 50-59, 4.2% of those aged 60-69, 4.2% of those aged 70-79, and 3.1% of those aged 80 or above. We used a multivariate logistic regression analysis with a stepwise model (forward) for risk factors (gender, age, farm ownership, farm type, work years in agriculture, work months during 2012, night work experience, and work experience under the influence of alcohol). The increased risk of farm work-related injuries significantly remained associated with age, farm ownership, and experience of night work. Further studies should be conducted to consistently identify injury characteristics, especially for old farmers, considering the crop cultivation in Asian countries.
Nrf2 Inhibits Periodontal Ligament Stem Cell Apoptosis under Excessive Oxidative Stress
Directory of Open Access Journals (Sweden)
Yanli Liu
2017-05-01
Full Text Available The present study aimed to analyze novel mechanisms underlying Nrf2-mediated anti-apoptosis in periodontal ligament stem cells (PDLSCs in the periodontitis oxidative microenvironment. We created an oxidative stress model with H2O2-treated PDLSCs. We used real-time PCR, Western blotting, TUNEL staining, fluorogenic assay and transfer genetics to confirm the degree of oxidative stress and apoptosis as well as the function of nuclear factor-erythroid 2-related factor 2 (Nrf2. We demonstrated that with upregulated levels of reactive oxygen species (ROS and malondialdehyde (MDA, the effect of oxidative stress was obvious under H2O2 treatment. Oxidative molecules were altered after the H2O2 exposure, whereby the signaling of Nrf2 was activated with an increase in its downstream effectors, heme oxygenase-1 (HO-1, NAD(PH:quinone oxidoreductase 1 (NQO1 and γ-glutamyl cysteine synthetase (γ-GCS. Additionally, the apoptosis levels gradually increased with oxidative stress by the upregulation of caspase-9, caspase-3, Bax and c-Fos levels in addition to the downregulation of Bcl-2. However, there was no alterations in levels of caspase-8. The enhanced antioxidant effect could not mitigate the occurrence of apoptosis. Furthermore, Nrf2 overexpression effectively improved the anti-oxidative levels and increased cell proliferation. At the same time, overexpression effectively restrained TUNEL staining and decreased the molecular levels of caspase-9, caspase-3, Bax and c-Fos, but not that of caspase-8. In contrast, silencing the expression of Nrf2 levels had the opposite effect. Collectively, Nrf2 alleviates PDLSCs via its effects on regulating oxidative stress and anti-intrinsic apoptosis by the activation of oxidative enzymes.
Yang, Jie; Wu, Renyi; Li, Wenji; Gao, Linbo; Yang, Yuqing; Li, Ping; Kong, Ah-Ng
2018-04-01
Corosolic acid (CRA) is found in various plants and has been used as a health food supplement worldwide. Although it has been reported that CRA exhibits significant anticancer activity, the effect of this compound on prostate cancer remains unknown. In this study, we investigated the effect of CRA on cellular transformation and the reactivation of nuclear factor erythroid 2-related factor 2 (Nrf2) through epigenetic regulation in TRAMP-C1 prostate cells. Specifically, we found that CRA inhibited anchorage-independent growth of prostate cancer TRAMP-C1 cells but not Nrf2 knockout prostate cancer TRAMP-C1 cells. Moreover, CRA induced mRNA and protein expression of Nrf2, heme oxygenase-1 (HO-1) and NAD(P)H Quinone Oxidoreductase 1 (NQO1). Bisulfite genomic sequencing and methylated DNA immunoprecipitation results revealed that CRA treatment decreased the level of methylation of the first five CpG sites of the Nrf2 promoter. Histone modification was analyzed using a chromatin immunoprecipitation (ChIP) assay, which revealed that CRA treatment increased the acetylation of histone H3 lysine 27 (H3K27ac) while decreasing the trimethylation of histone H3 lysine 27 (H3K27me3) in the promoter region of Nrf2. Furthermore, CRA treatment attenuated the protein expression of DNA methyltransferases (DNMTs) and histone deacetylases (HDACs). These findings indicate that CRA has a significant anticancer effect in TRAMP-C1 cells, which could be partly attributed to epigenetics including its ability to epigenetically restore the expression of Nrf2. © 2017 Wiley Periodicals, Inc.
Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D
2009-07-29
Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.
Let the sun shine in: mechanisms and potential for therapeutics in skin photodamage.
Wondrak, Georg T
2007-05-01
Photoaging and photocarcinogenesis are the two Janus faces of skin photodamage. Reactivity-based design of prototype agents that antagonize, modulate and reverse the chemistry of skin photodamage holds promise in delivering unprecedented therapeutic benefit. In contrast to structure-based approaches that use selective ligands to target macromolecules, reactivity-based drug discovery uses chemical reagents as therapeutics to target reactive chemical species as key mediators of skin photo-oxidative stress. The following classes of reactivity-based agents for skin photoprotection can be distinguished based on their mechanism of action: direct antagonists of photo-oxidative stress (sunscreens, quenchers of photo-excited states, antioxidants, redox modulators and glycation inhibitors) and skin photo-adaptation inducers (nuclear factor erythroid 2-related factor 2 [Nrf2] activators, heat-shock response inducers and metallothionein inducers).
Directory of Open Access Journals (Sweden)
Huiru Zhao
2018-03-01
Full Text Available Carbon dioxide (CO2 emissions forecasting is becoming more important due to increasing climatic problems, which contributes to developing scientific climate policies and making reasonable energy plans. Considering that the influential factors of CO2 emissions are multiplex and the relationships between factors and CO2 emissions are complex and non-linear, a novel CO2 forecasting model called SSA-LSSVM, which utilizes the Salp Swarm Algorithm (SSA to optimize the two parameters of the least squares support sector machine (LSSVM model, is proposed in this paper. The influential factors of CO2 emissions, including the gross domestic product (GDP, population, energy consumption, economic structure, energy structure, urbanization rate, and energy intensity, are regarded as the input variables of the SSA-LSSVM model. The proposed model is verified to show a better forecasting performance compared with the selected models, including the single LSSVM model, the LSSVM model optimized by the particle swarm optimization algorithm (PSO-LSSVM, and the back propagation (BP neural network model, on CO2 emissions in China from 2014 to 2016. The comparative analysis indicates the SSA-LSSVM model is greatly superior and has the potential to improve the accuracy and reliability of CO2 emissions forecasting. CO2 emissions in China from 2017 to 2020 are forecast combined with the 13th Five-Year Plan for social, economic and energy development. The comparison of CO2 emissions of China in 2020 shows that structural factors significantly affect CO2 emission forecasting results. The average annual growth of CO2 emissions slows down significantly due to a series of policies and actions taken by the Chinese government, which means China can keep the promise that greenhouse gas emissions will start to drop after 2030.
Hepatoma-derived growth factor-related protein-3 is a novel angiogenic factor.
Directory of Open Access Journals (Sweden)
Michelle E LeBlanc
Full Text Available Hepatoma-derived growth factor-related protein-3 (Hdgfrp3 or HRP-3 was recently reported as a neurotrophic factor and is upregulated in hepatocellular carcinoma to promote cancer cell survival. Here we identified HRP-3 as a new endothelial ligand and characterized its in vitro and in vivo functional roles and molecular signaling. We combined open reading frame phage display with multi-round in vivo binding selection to enrich retinal endothelial ligands, which were systematically identified by next generation DNA sequencing. One of the identified endothelial ligands was HRP-3. HRP-3 expression in the retina and brain was characterized by Western blot and immunohistochemistry. Cell proliferation assay showed that HRP-3 stimulated the growth of human umbilical vein endothelial cells (HUVECs. HRP-3 induced tube formation of HUVECs in culture. Wound healing assay indicated that HRP-3 promoted endothelial cell migration. HRP-3 was further confirmed for its in vitro angiogenic activity by spheroid sprouting assay. HRP-3 extrinsically activated the extracellular-signal-regulated kinase ½ (ERK1/2 pathway in endothelial cells. The angiogenic activity of HRP-3 was independently verified by mouse cornea pocket assay. Furthermore, in vivo Matrigel plug assay corroborated HRP-3 activity to promote new blood vessel formation. These results demonstrated that HRP-3 is a novel angiogenic factor.
EFFECTS OF PROCUREMENT RELATED FACTORS ON ...
African Journals Online (AJOL)
Osondu
2013-03-04
Mar 4, 2013 ... Policy makers in government, clients, and private developers into housing projects should give adequate .... constraints, payment method, finding methods and ... price and negotiation of contract details and firm ... All these discussed .... Decision. Cost related factors. 31.83. 3. 9.34. 0.00. S*. Accept H1.
Large theoretical thermoelectric power factor of suspended single-layer MoS2
International Nuclear Information System (INIS)
Babaei, Hasan; Khodadadi, J. M.; Sinha, Sanjiv
2014-01-01
We have calculated the semi-classical thermoelectric power factor of suspended single-layer (SL)- MoS 2 utilizing electron relaxation times derived from ab initio calculations. Measurements of the thermoelectric power factor of SL-MoS 2 on substrates reveal poor power factors. In contrast, we find the thermoelectric power factor of suspended SL-MoS 2 to peak at ∼2.8 × 10 4 μW/m K 2 at 300 K, at an electron concentration of 10 12 cm −2 . This figure is higher than that in bulk Bi 2 Te 3 , for example. Given its relatively high thermal conductivity, suspended SL-MoS 2 may hold promise for in-plane thin-film Peltier coolers, provided reasonable mobilities can be realized
Directory of Open Access Journals (Sweden)
Kaori Yama
2015-04-01
Full Text Available Epalrestat (EPS is the only aldose reductase inhibitor that is currently available for the treatment of diabetic neuropathy. Recently, we found that EPS at near-plasma concentration increases the intracellular levels of glutathione (GSH in rat Schwann cells. GSH plays a crucial role in protecting endothelial cells from oxidative stress, thereby preventing vascular diseases. Here we show that EPS increases GSH levels in not only Schwann cells but also endothelial cells. Treatment of bovine aortic endothelial cells (BAECs, an in vitro model of the vascular endothelium, with EPS caused a dramatic increase in intracellular GSH levels. This was concomitant with the up-regulation of glutamate cysteine ligase, an enzyme catalyzing the first and rate-limiting step in de novo GSH synthesis. Moreover, EPS stimulated the expression of thioredoxin and heme oxygenase-1, which have important redox regulatory functions in endothelial cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a key transcription factor that regulates the expression of antioxidant genes. EPS increased nuclear Nrf2 levels in BAECs. Nrf2 knockdown by siRNA suppressed the EPS-induced glutamate cysteine ligase, thioredoxin-1, and heme oxygenase-1 expression. Interestingly, LY294002, an inhibitor of phosphatidylinositol 3-kinase, abolished the EPS-stimulated GSH synthesis, suggesting that the kinase is associated with Nrf2 activation induced by EPS. Furthermore, EPS reduced the cytotoxicity induced by H2O2 and tert-butylhydroperoxide, indicating that EPS plays a role in protecting cells from oxidative stress. Taken together, the results provide evidence that EPS exerts new beneficial effects on endothelial cells by increasing GSH, thioredoxin, and heme oxygenase-1 levels through the activation of Nrf2. We suggest that EPS has the potential to prevent several vascular diseases caused by oxidative stress.
DEFF Research Database (Denmark)
Odgaard, Mette Vestergaard; Moeslund, Jesper Erenskjold; Bøcher, Peder Klith
2013-01-01
This study aimed at quantifying the spatial distribution of set-aside – highly valuable biodiversity reservoirs – in a typical lowland agricultural region (Denmark), just before and after the set-aside policy change (years 2007 and 2008), to assess which factors drive farmers’ set-aside priorities......, and to elaborate the potential consequence of the set-aside spatial transformation from 2007 to 2008 on nature. Multiple regressions were used to test if and how set-aside is linked to three potential groups of drivers: (1) geophysical constraints (topographic and edaphic constraints on the farming......-suitability of an area), (2) amenity values (nature conservation and aesthetic values), and (3) farming-related factors (e.g., field size and livestock density). The spatial distribution of set-aside was influenced by both geophysical constraints and amenity values and only some extent farming-related factors. More...
Health-related Quality of Life and Associated Factors Among Undergraduate University Students.
Nur, Naim; Kıbık, Ahmet; Kılıç, Esma; Sümer, Haldun
2017-07-01
The aims of this study were to explore factors associated with health-related quality of life (HRQOL) among students of Cumhuriyet University, Turkey. This cross-sectional study involved 1751 undergraduate students. HRQOL was measured using the Turkish version of 36-Item Short Form Health Survey questionnaire. We looked at the effect of sociodemographic characteristics (e.g., gender, age, drinking, and smoking) on the individual HRQOL domains. Place of residency (odds ratio (OR) = 3.947 for role emotion dimension), smoking status (OR = -2.756 for role physical dimension), received amount of pocket money (OR = 2.463 for mental health dimension), and body mass index (OR = 1.463 for mental health dimension) were the factors significantly associated with the HRQOL. Young students' HRQOL is affected by socioeconomic, demographic, and behavioral factors. To improve student's HRQOL, any health-promoting strategies should focus on modifiable risk factors and socioeconomic supports for students.
Background factors related to and/or influencing occupation in mentally disordered offenders.
Lindstedt, Helena; Ivarsson, Ann-Britt; Söderlund, Anne
2006-09-01
Knowledge of background and occupational related factors of mentally disordered offenders are missing. It is essential to understand these issues when planning discharge from forensic psychiatric hospital care to enable community dwelling. One aim was to investigate mentally disordered offenders' background factors, confidence in and how they value occupations. Another aim was to investigate MDOs background factors' in relation to and the influences on Occupational Performance and Social Participation. Data was collected with an explorative, correlative design after informed consent, from 74 mentally disordered offenders (mean age 34,2) cared for in forensic psychiatric hospitals. Assessments were Allen Cognitive Level Screen, Capability to Perform Daily Occupations, Interview Schedule of Social Interaction, Manchester Short Assessment of Quality of Life, Self-efficacy Scale and Importance scale. Eight background factors were assembled from the individual forensic psychiatric investigation. Most of the investigated background factors relate to and half of them influence occupational performance, particular the cognitive aspect of occupational performance. The influences on occupation originate from adulthood, such as suffering from schizophrenia, psycho/social problems, and having performed violent crimes. These findings indicate that staff in forensic hospital care should initiate rehabilitation with knowledge about MDOs' complex daily occupations. For avoiding information bias, information gathering preceding treatment planning should be performed in collaboration between caring staff and mentally disordered offenders.
Review on risk factors related to lower back disorders at workplace
A' Tifah Jaffar, Nur; Nasrull Abdol Rahman, Mohd
2017-08-01
This review examines the evidence of the occurrence of risk exposure on work-related lower back disorders in the workplace. This review also investigates potential interactions between the risk factors in the workplace which include heavy physical work risk factor, static work postures risk factor, frequent bending and twisting risk factor, lifting risk factor, pushing and pulling risk factor, repetitive work risk factor, vibration risk factor, psychological and psychosocial risk factor that may be associated with symptoms of musculoskeletal disorders of lower back. These risk factors can reinforce each other and their influence can also be mediated by cultural or social factors. A systematic review of the literature was carried out by searching using databases and the searching strategy was used combined keyword for risk factors, work-related lower back disorders, heavy physical work, static work postures, frequent bending and twisting, lifting, pushing and pulling, repetitive work, vibration, psychological and psychosocial risk factor. A total of 67 articles were identified and reviewed. The risk factors identified that related for low back disorder are seven which are heavy physical work, static work postures, frequent bending and twisting, lifting, pushing and pulling, repetitive work, vibration, psychological and psychosocial risk factor and the level of evidence supporting the relationship with lower back disorders also described such as strong, moderate, insufficient, limited and no evidence. This result confirms that, existing of higher physical and psychosocial demand related to reported risk factors of low back disorders. The result also showed that previous reviews had evaluated relationship between risk factors of low back disorders and specific types of musculoskeletal disorders. This review also highlights the scarves evidence regarding some of the frequently reported risk factors for work related lower back disorders.
Lanikova, Lucie; Lorenzo, Felipe; Yang, Chunzhang; Vankayalapati, Hari; Drachtman, Richard; Divoky, Vladimir; Prchal, Josef T
2013-05-09
Germline von Hippel-Lindau (VHL) gene mutations underlie dominantly inherited familial VHL tumor syndrome comprising a predisposition for renal cell carcinoma, pheochromocytoma/paraganglioma, cerebral hemangioblastoma, and endolymphatic sac tumors. However, recessively inherited congenital polycythemia, exemplified by Chuvash polycythemia, has been associated with 2 separate 3' VHL gene mutations in exon 3. It was proposed that different positions of loss-of-function VHL mutations are associated with VHL syndrome cancer predisposition and only C-terminal domain-encoding VHL mutations would cause polycythemia. However, now we describe a new homozygous VHL exon 2 mutation of the VHL gene:(c.413C>T):P138L, which is associated in the affected homozygote with congenital polycythemia but not in her, or her-heterozygous relatives, with cancer or other VHL syndrome tumors. We show that VHL(P138L) has perturbed interaction with hypoxia-inducible transcription factor (HIF)1α. Further, VHL(P138L) protein has decreased stability in vitro. Similarly to what was reported in Chuvash polycythemia and some other instances of HIFs upregulation, VHL(P138L) erythroid progenitors are hypersensitive to erythropoietin. Interestingly, the level of RUNX1/AML1 and NF-E2 transcripts that are specifically upregulated in acquired polycythemia vera were also upregulated in VHL(P138L) granulocytes.
Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition
Energy Technology Data Exchange (ETDEWEB)
Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)
2016-01-15
Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.
Strange magnetic form factor of the proton at $Q^2 = 0.23$ GeV$^2$
Energy Technology Data Exchange (ETDEWEB)
Wang, Ping; Leinweber, Derek; Thomas, Anthony; Young, Ross
2009-06-01
We determine the $u$ and $d$ quark contributions to the proton magnetic form factor at finite momentum transfer by applying chiral corrections to quenched lattice data. Heavy baryon chiral perturbation theory is applied at next to leading order in the quenched, and full QCD cases for the valence sector using finite range regularization. Under the assumption of charge symmetry these values can be combined with the experimental values of the proton and neutron magnetic form factors to deduce a relatively accurate value for the strange magnetic form factor at $Q^2=0.23$ GeV$^2$, namely $G_M^s=-0.034 \\pm 0.021$ $\\mu_N$.
Associations between generic substitution and patient-related factors
DEFF Research Database (Denmark)
Østergaard Rathe, Jette
Associations between generic substitution and patient-related factors Jette Østergaard Rathe1, Pia V. Larsen1, Morten Andersen2, Janus L. Thomsen3, Maja S. Paulsen1, Jens Søndergaard1 1. Research Unit of General Practice, Institute of Public Health, University of Southern Denmark 2. Centre...... for Pharmacoepidemiology, Karolinska Institutet, Department of Medicine Solna, Stockholm, Sweden 3. Danish Quality Unit of General Practice, Odense, Denmark Background Generic substitution means that chemically equivalent but less expensive drugs are dispensed in place of a brand name product. Although generic medicines...... by definition are bioequivalent to their brand name counterparts there are concerns about whether generic substitution is always accompanied by clinical equivalence in terms of effectiveness and that it may cause concerns and thereby causing some skepticism towards generic substitution. There is, however...
Energy Technology Data Exchange (ETDEWEB)
Park, Gunhyuk, E-mail: uranos5@kiom.re.kr [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Oh, Dal-Seok [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Lee, Mi Gi; Lee, Chang Eon [Major in Cosmeceutical Science, Division of Bio-technology and Convergence, Daegu Haany University, Gyeongsan (Korea, Republic of); Kim, Yong-ung, E-mail: ykim@dhu.ac.kr [Department of Pharmaceutical Engineering, College of Biomedical Science, Daegu Haany University (Korea, Republic of)
2016-11-01
Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.
International Nuclear Information System (INIS)
Park, Gunhyuk; Oh, Dal-Seok; Lee, Mi Gi; Lee, Chang Eon; Kim, Yong-ung
2016-01-01
Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.
Lacombe, C; Mayeux, P
1998-08-01
Erythropoietin (Epo) controls the proliferation, differentiation and survival of the erythroid progenitors. This cytokine was cloned in 1985 and rapidly became used for treatment of anemia of renal failure, opening the way to the first clinical trials of a hematopoietic growth factor. The clonage of one chain of the Epo receptor followed in 1989, thereby opening the research on intracellular signal transduction induced by Epo. Epo is synthesized mainly by the kidney and the liver and sequences required for tissue-specific expression have been localized in the Epo gene. A 3'enhancer is responsible for hypoxia-inducible Epo gene expression. HIF-1 alpha and beta proteins bind to this enhancer. Gene regulation by hypoxia is widespread in many cells and involves numerous genes in addition to the Epo gene. The Epo receptor belongs to the cytokine receptor family and includes a p66 chain which is dimerized upon Epo activation; two accessory proteins defined by cross-linking remain to be characterized. Epo binding induces the stimulation of Jak2 tyrosine kinase. Jak2 activation leads to the tyrosine phosphorylation of several proteins including the Epo receptor itself. As a result, different intracellular pathways are activated: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. However, the exact mechanisms by which the proliferation and/or the differentiation of erythroid cells are regulated after Epo stimulation are not known. Furthermore, target disruption of both Epo and Epo receptor showed that Epo was not involved in the commitment of the erythroid lineage and seemed to act mainly as a survival factor.
Directory of Open Access Journals (Sweden)
Xiaobin Liu
2016-08-01
Full Text Available Oxidative stress-induced retinal pigment epithelial (RPE cell damage is an important factor in the pathogenesis of age-related macular degeneration (AMD. Previous studies have shown that RTA 408, a synthetic triterpenoid compound, potently activates Nrf2. This study aimed to investigate the protective effects of RTA 408 in cultured RPE cells during oxidative stress and to determine the effects of RTA 408 on Nrf2 and its downstream target genes. Primary human RPE cells were pretreated with RTA 408 and then incubated in 200 μM H2O2 for 6 h. Cell viability was measured with the WST-8 assay. Apoptosis was quantitatively measured by annexin V/propidium iodide (PI double staining and Hoechst 33342 fluorescent staining. Reduced (GSH and oxidized glutathione (GSSG were measured using colorimetric assays. Nrf2 activation and its downstream effects on phase II enzymes were examined by Western blot. Treatment of RPE cells with nanomolar ranges (10 and 100 nM of RTA 408 markedly attenuated H2O2-induced viability loss and apoptosis. RTA 408 pretreatment significantly protected cells from oxidative stress-induced GSH loss, GSSG formation and decreased ROS production. RTA 408 activated Nrf2 and increased the expression of its downstream genes, such as HO-1, NQO1, SOD2, catalase, Grx1, and Trx1. Consequently, the enzyme activities of NQO1, Grx1, and Trx1 were fully protected by RTA 408 pretreatment under oxidative stress. Moreover, knockdown of Nrf2 by siRNA significantly reduced the cytoprotective effects of RTA 408. In conclusion, our data suggest that RTA 408 protect primary human RPE cells from oxidative stress-induced damage by activating Nrf2 and its downstream genes.
Lin, Chia-Yuan; Wu, Chi-Rei; Chang, Shu-Wei; Wang, Yu-Jung; Wu, Jia-Jiuan; Tsai, Chia-Wen
2015-06-01
Induction of phase II enzymes is important in cancer chemoprevention. We compared the effect of rosemary diterpenes on the expression of the pi class of glutathione S-transferase (GSTP) in rat liver Clone 9 cells and the signaling pathways involved. Culturing cells with 1, 5, 10, or 20 μM carnosic acid (CA) or carnosol (CS) for 24 h in a dose-dependent manner increased the GSTP expression. CA was more potent than CS. The RNA level and the enzyme activity of GSTP were also enhanced by CA treatment. Treatment with 10 μM CA highly induced the reporter activity of the enhancer element GPEI. Furthermore, CA markedly increased the translocation of nuclear factor erythroid-2 related factor 2 (Nrf2) from the cytosol to the nucleus after 30 to 60 min. CA the stimulated the protein induction of p38, nuclear Nrf2, and GSTP was diminished in the presence of SB203580 (a p38 inhibitor). In addition, SB203580 pretreatment or silencing of Nrf2 by siRNA suppressed the CA-induced GPEI-DNA binding activity and GSTP protein expression. Knockdown of p38 or Nrf2 by siRNA abolished the activation of p38 and Nrf2 as well as the protein induction and enzyme activity of GSTP by CA. These results suggest that CA up-regulates the expression and enzyme activity of GSTP via the p38/Nrf2/GPEI pathway.
Talking about relations: Factors influencing the production of relational descriptions
Directory of Open Access Journals (Sweden)
Adriana eBaltaretu
2016-02-01
Full Text Available In a production experiment (Experiment 1 and an acceptability rating one (Experiment 2, we assessed two factors, spatial position and salience, which may influence the production of relational descriptions (such as the ball between the man and the drawer. In Experiment 1, speakers were asked to refer unambiguously to a target object (a ball. In Experiment 1a, we addressed the role of spatial position, more specifically if speakers mention the entity positioned leftmost in the scene as (first relatum. The results showed a preference to start with the left entity, however, only as a trend, which leaves room for other factors that could influence spatial reference. Thus, in the following studies, we varied salience systematically, by making one of the relatum candidates animate (Experiment 1b, and by adding attention capture cues, first subliminally by priming one relatum candidate with a flash (Experiment 1c, then explicitly by using salient colors for objects (Experiment 1d. Results indicate that spatial position played a dominant role. Entities on the left were mentioned more often as (first relatum than those on the right (Experiment 1a, 1b, 1c, 1d. Animacy affected reference production in one out of three studies (in Experiment 1d. When salience was manipulated by priming visual attention or by using salient colors, there were no significant effects (Experiment 1c, 1d. In the acceptability rating study (Experiment 2, participants expressed their preference for specific relata, by ranking descriptions on the basis of how good they thought the descriptions fitted the scene. Results show that participants preferred most the description that had an animate entity as the first mentioned relatum. The relevance of these results for models of reference production is discussed.
Factors Related to Medicaid Payment Acceptance at Outpatient Substance Abuse Treatment Programs
Terry-McElrath, Yvonne M; Chriqui, Jamie F; McBride, Duane C
2011-01-01
Objective To examine factors associated with Medicaid acceptance for substance abuse (SA) services by outpatient SA treatment programs. Data Sources Secondary analysis of 2003–2006 National Survey of Substance Abuse Treatment Services data combined with state Medicaid policy and usage measures and other publicly available data. Study Design We used cross-sectional analyses, including state fixed effects, to assess relationships between SA treatment program Medicaid acceptance and (1) program-level factors, (2) county-level sociodemographics and treatment program density, and (3) state-level population characteristics, SA treatment-related factors, and Medicaid policy and usage. Data Extraction Methods State Medicaid policy data were compiled based on reviews of state Medicaid-related statutes/regulations and Medicaid plans. Other data were publicly available. Principal Findings Medicaid acceptance was significantly higher for programs: (a) that were publicly funded and in states with Medicaid policy allowing SA treatment coverage; (b) with accreditation/licensure and nonprofit/government ownership, as well as mental- and general-health focused programs; and (c) in counties with lower household income. Conclusions SA treatment program Medicaid acceptance related to program-, county, and state-level factors. The data suggest the importance of state policy and licensure/accreditation requirements in increasing SA program Medicaid access. PMID:21105870
Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong Su [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)
2015-10-09
Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.
Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity
International Nuclear Information System (INIS)
Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han
2015-01-01
Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.
Age-related percutaneous penetration part 1: skin factors.
Konda, S; Meier-Davis, S R; Cayme, B; Shudo, J; Maibach, H I
2012-05-01
Changes in the skin that occur in the elderly may put them at increased risk for altered percutaneous penetration from pharmacotherapy along with potential adverse effects. Skin factors that may have a role in age-related percutaneous penetration include blood flow, pH, skin thickness, hair and pore density, and the content and structure of proteins, glycosaminoglycans (GAGs), water, and lipids. Each factor is examined as a function of increasing age along with its potential impact on percutaneous penetration. Additionally, topical drugs that successfully overcome the barrier function of the skin can still fall victim to cutaneous metabolism, thereby producing metabolites that may have increased or decreased activity. This overview discusses the current data and highlights the importance of further studies to evaluate the impact of skin factors in age-related percutaneous penetration.
Backus, Bridgid A.
Two-year chemistry-based technology training (CBTT) programs in the U.S. are important in the preparation of the professional technical workforce. The purpose of this study was to identify, examine, and analyze factors related to the economic sustainability of CBTT programs. A review of literature identified four clustered categories of 31 sub-factors related to program sustainability. Three research questions relating to program sustainability were: (1) What is the relative importance of the identified factors?, (2) What differences exist between the opinions of administrators and faculty?, and (3) What are the interrelationships among the factors? In order to answer these questions, survey data gathered from CBTT programs throughout the United States were analyzed statistically. Conclusions included the following: (1) Rank order of the importance to sustainability of the clustered categories was: (1) Partnerships, (2) Employer and Student Educational Goals, (3) Faculty and Their Resources, and (4) Community Perceptions and Marketing Strategies. (2) Significant correlations between ratings of sustainability and the sub-factors included: degree of partnering, college responsiveness, administration involvement in partnerships, experiential learning opportunities, employer input in curriculum development, use of skill standards, number of program graduates, student job placement, professional development opportunities, administrator support, presence of a champion, flexible scheduling, program visibility, perception of chemical technicians, marketing plans, and promotion to secondary students. (3) Faculty and administrators differed significantly on only two sub-factor ratings: employer assisted curriculum development, and faculty workloads. (4) Significant differences in ratings by small program faculty and administrators and large program faculty and administrators were indicated, with most between small program faculty and large program administrators. The study
Uncertainty of relative sensitivity factors in glow discharge mass spectrometry
Meija, Juris; Methven, Brad; Sturgeon, Ralph E.
2017-10-01
The concept of the relative sensitivity factors required for the correction of the measured ion beam ratios in pin-cell glow discharge mass spectrometry is examined in detail. We propose a data-driven model for predicting the relative response factors, which relies on a non-linear least squares adjustment and analyte/matrix interchangeability phenomena. The model provides a self-consistent set of response factors for any analyte/matrix combination of any element that appears as either an analyte or matrix in at least one known response factor.
Chen, Huang-Hui; Chang, Hsin-Huei; Chang, Jang-Yang; Tang, Ya-Chu; Cheng, Yung-Chi; Lin, Li-Mei; Cheng, Shu-Ying; Huang, Chih-Hsiang; Sun, Man-Wu; Chen, Chiung-Tong; Kuo, Ching-Chuan
2017-12-01
Nuclear factor erythroid-2-related factor 2 (NRF2) mainly regulates transcriptional activation through antioxidant-responsive elements (AREs) present in the promoters of NRF2 target genes. Recently, we found that NRF2 was overexpressed in a KB-derived drug-resistant cancer cell panel. In this panel, KB-7D cells, which show acquired resistance to topoisomerase II (Top II) poisons, exhibited the highest NRF2 activation. To investigate whether NRF2 directly contributed to acquired resistance against Top II poisons, we manipulated NRF2 by genetic and pharmacological approaches. The result demonstrated that silencing of NRF2 by RNA interference increased the sensitivity and treatment with NRF2 activator decreased the sensitivity of KB and KB-7D cells toward Top II poisons. Further, increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation activated NRF2 signaling in KB-7D cells. Moreover, increased binding of NRF2 to an ARE in the promoter of ATP-binding cassette subfamily C member 1 (ABCC1) directly contributed to Top II poison resistance. In addition, activation of NRF2 increased glutathione level and antioxidant capacity in KB-7D cells compared with that in KB cells; moreover, high glutathione level provided survival advantage to KB-7D cells. Our study is the first to show that aberrant NRF2 activation is via increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation, which increases the acquired resistance and promote the survival of Top II poison-resistant cancer cells. Importantly, NRF2 downstream effectors ABCC1 and glutathione directly contribute to acquired resistance and survival, respectively. These results suggest that blockade of NRF2 signaling may enhance therapeutic efficacy and reduce the survival of Top II poison-refractory tumors in clinical. Copyright © 2017 Elsevier Inc. All rights reserved.
Health-related Quality of Life and Associated Factors Among Undergraduate University Students
Directory of Open Access Journals (Sweden)
Naim Nur
2017-07-01
Full Text Available Objectives: The aims of this study were to explore factors associated with health-related quality of life (HRQOL among students of Cumhuriyet University, Turkey. Methods: This cross-sectional study involved 1751 undergraduate students. HRQOL was measured using the Turkish version of 36-Item Short Form Health Survey questionnaire. We looked at the effect of sociodemographic characteristics (e.g., gender, age, drinking, and smoking on the individual HRQOL domains. Results: Place of residency (odds ratio (OR = 3.947 for role emotion dimension, smoking status (OR = -2.756 for role physical dimension, received amount of pocket money (OR = 2.463 for mental health dimension, and body mass index (OR = 1.463 for mental health dimension were the factors significantly associated with the HRQOL. Conclusions: Young students’ HRQOL is affected by socioeconomic, demographic, and behavioral factors. To improve student’s HRQOL, any health-promoting strategies should focus on modifiable risk factors and socioeconomic supports for students.
Abass, Marwa Ahmed; Elkhateeb, Shereen Ahmed; Abd El-Baset, Samia Adel; Kattaia, Asmaa Alhosiny; Mohamed, Eman Mosallam; Atteia, Hebatallah Husseini
2016-08-01
Atrazine (ATZ) is one of the most commonly used herbicides contaminating plants, soil and water resources. Several strategies have been used to counteract ATZ toxicity. Here, we tested the hypothesis that lycopene could ameliorate ATZ-induced toxicity in the adrenal cortex. For this purpose, 35 adult male albino rats were randomized into five equal groups: untreated control, vehicle control (received 0.5 mL corn oil/day), lycopene (treated with lycopene dissolved in 0.5 mL corn oil, 10 mg/kg b.w./day), ATZ (received ATZ dissolved in 0.5 mL corn oil 300 mg/kg b.w./day), and ATZ + lycopene (treated with ATZ and lycopene at the same previously mentioned doses). All treatments were given by oral gavage for 4 weeks. We found that ATZ exposure significantly increased relative adrenal weight, plasma ACTH levels, and adrenal oxidative stress as manifested by elevated malondialdehyde levels, decreased reduced glutathione content and depressed antioxidant enzyme activities in adrenal cortex tissues with respect to control groups. Furthermore, the transcription of adrenal cortex nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), nuclear factor kappa B, and caspase-3 genes was increased significantly compared with the control groups. This was accompanied with DNA fragmentation and structural and ultrastructural changes in zona glomerulosa and zona fasiculata of the adrenal cortex. Notably, all these changes were partially ameliorated in rats treated concomitantly with ATZ and lycopene. Our results showed that lycopene exerts protective effects against ATZ-induced toxicity in rat adrenal cortex. These effects may be attributed to the antioxidative property of lycopene and its ability to activate the Nrf2/HO-1 pathway.
Hooftman, W.E.; Poppel, M.N.M. van; Beek, A.J. van der; Bongers, P.M.; Mechelen, W. van
2004-01-01
Gender differences in the prevalence of musculoskeletal complaints might be explained by differences in the effect of exposure to work-related physical and psychosocial risk factors. A systematic review was conducted to examine gender differences in the relations between these risk factors and
Directory of Open Access Journals (Sweden)
Md Badrul Alam
2017-09-01
Full Text Available This study was performed to investigate the antioxidant activities of Nymphaea nouchali flower (NNF extract and the underlying mechanism using RAW 264.7 cells. The presence of gallic acid, catechin, epicatechin, epigallocatechin, epicatechin gallate, caffeic acid, quercetin, and apigenin in the NNF was confirmed by high-performance liquid chromatography (HPLC. The extract had a very potent capacity to scavenge numerous free radicals. NNF extract was also able to prevent DNA damage and quench cellular reactive oxygen species (ROS generation induced by tert-Butyl hydroperoxide (t-BHP with no signs of toxicity. The NNF extract was able to augment the expression of both primary and phase II detoxifying enzyme, resulting in combat the oxidative stress. This is accomplished by phosphorylation of mitogen-activated protein kinase (MAP kinase (p38 kinase and extracellular signal-regulated kinase (ERK followed by enhancing the nuclear translocation of the nuclear factor erythroid 2-related factor 2 (Nrf2. This attenuates cellular ROS generation and confers protection from cell death. Altogether, the results of current study revealed that Nymphaea nouchali flower could be a source of natural phytochemicals that could lead to the development of new therapeutic agents for preventing oxidative stress associated diseases and attenuating disease progression.
Shetty, Aditya; Dasari, Subramanyam; Banerjee, Souresh; Gheewala, Taher; Zheng, Guoxing; Chen, Aoshuang; Kajdacsy-Balla, Andre; Bosland, Maarten C; Munirathinam, Gnanasekar
2016-11-01
Hepatoma-derived growth factor (HDGF) is a heparin-binding growth factor, which has previously been shown to be expressed in a variety of cancers. HDGF overexpression has also previously been correlated with a poor prognosis in several cancers. The significance of HDGF in prostate cancer, however, has not been investigated. Here, we show that HDGF is overexpressed in both androgen-sensitive LNCaP cells and androgen-insensitive DU145, 22RV1, and PC-3 cells. Forced overexpression enhanced cell viability of RWPE-1 cells, whereas HDGF knockdown reduced cell proliferation in human prostate cancer cells. We also show that HDGF may serve as a survival-related protein as ectopic overexpression of HDGF in RWPE cells up-regulated the expression of antiapoptosis proteins cyclin E and BCL-2, whereas simultaneously down-regulating proapoptotic protein BAX. Western blot analysis also showed that HDGF overexpression modulated the activity of phospho-AKT as well as NF-kB, and these results correlated with in vitro migration and invasion assays. We next assessed the therapeutic potential of HDGF inhibition with a HDGF monoclonal antibody and vitamin k 2 , showing reduced cell proliferation as well as inhibition of NF-kB expression in HDGF overexpressed RWPE cells treated with a HDGF monoclonal antibody and vitamin K 2 . Collectively, our results suggest that HDGF is a relevant protein in prostate oncogenesis and may serve as a potential therapeutic target in prostate cancer. Copyright © 2016 Elsevier Inc. All rights reserved.
The calculation of relative output factor and depth dose for irregular electron fields in water
International Nuclear Information System (INIS)
Dunscombe, Peter; McGhee, Peter; Chu, Terence
1996-01-01
Purpose: A technique, based on sector integration and interpolation, has been developed for the computation of both relative output factor and depth dose of irregular electron fields in water. The purpose of this study was to determine the minimum experimental data set required for the technique to yield results within accepted dosimetric tolerances. Materials and Methods: PC based software has been written to perform the calculations necessary to dosimetrically characterize irregular shaped electron fields. The field outline is entered via digitiser and the SSD and energy via the keyboard. The irregular field is segmented into sectors of specified angle (2 deg. was used for this study) and the radius of each sector computed. The central ray depth dose is reconstructed by summing the contributions from each sector deduced from calibration depth doses measured for circular fields. Relative output factors and depth doses at SSDs at which calibrations were not performed are found by interpolation. Calibration data were measured for circular fields from 2 to 9 cm diameter at 100, 105, 110, and 115 cm SSD. A clinical cut out can be characterized in less than 2 minutes including entry of the outline using this software. The performance of the technique was evaluated by comparing calculated relative output factors, surface dose and the locations of d 80 , d 50 and d 20 with experimental measurements on a variety of cut out shapes at 9 and 18 MeV. The calibration data set (derived from circular cut outs) was systematically reduced to identify the minimum required to yield an accuracy consistent with current recommendations. Results: The figure illustrates the ability of the technique to calculate the depth dose for an irregular field (shown in the insert). It was found that to achieve an accuracy of 2% in relative output factor and 2% or 2 mm (our criterion) in percentage depth dose, calibration data from five circular fields at the four SSDs spanning the range 100-115 cm
[Research on prevalence and related factors in allergic rhinitis].
Wang, Ze-hai; Lin, Wen-sen; Li, Shu-yan; Zhao, Shao-cheng; Wang, Li; Yang, Zhong-gang; Chen, Jie; Zhang, Zhen-fu; Yu, Jin-zhen
2011-03-01
To obtain the prevalence and related factors in allergic rhinitis (AR) and other allergic diseases in rural area in China through epidemiological investigation with large sample and multi-faceted survey data. Face to face survey was conducted in different regions (rural areas of Cangzhou, Hebei, coastal fishing village of Bohai Bay, area of Wuling Mountain, Chengde, urban areas of Tianjin) from April 2007 to May 2009. In the same time, serum specific IgE (sIgE) was detected in the digits of every 0, 1or 5 in them. SPSS 13.0 software was used to analyze the data. Five thousand and ten cases were investigated. There were 823 cases with the symptoms or signs of AR (16.4%). Four hundred and two cases were found to have positive serum sIgE antibody in 1576 detected cases (25.5%). One hundred and fourty-six cases with nasal allergic symptoms or signs were diagnosed as AR. The incidence of AR was 9.3% (146/1576). The occurrence of allergic symptoms or signs had a significant statistical difference with factors such as age, occupation, atopic constitution (χ(2) value were 7.96, 9.73, 16.53, 8.95 respectively, all P cat epithelium in rural areas and dust mites in city. The incidence of AR is higher whether in urban or rural areas, it should be taken seriously as the impact on human health. The occurrence is closely related to physical characteristics and environmental factors.
Elderly Taiwanese's Intrinsic Risk Factors for Fall-related Injuries
In-Fun Li; Yvonne Hsiung; Hui-Fen Hsing; Mei-Yu Lee; Te-Hsin Chang; Ming-Yuan Huang
2016-01-01
Background: As a vital issue in geriatric research, risk factors for falls were concluded to be multifactorial, and prevention has been mostly aimed at decreasing situational and environmental risks that cause and aggravate fall-related injuries, particularly within the institutions. While knowledge is limited about older patients' intrinsic determinants, the purpose of this study was to explore elderly Taiwanese's intrinsic risk factors associated with severe fall-related injuries. Method...
Anti-inflammatory Activity of Epimedium brevicornu Maxim Ethanol Extract.
Huang, Shan; Meng, Ning; Chang, Bingquan; Quan, Xianghua; Yuan, RuiYing; Li, Bin
2018-04-05
Epimedium brevicornu Maxim has been used as a traditional herbal drug in China. In this study, the anti-inflammatory effects of E. brevicornu Maxim ethanol extract (EBME) were investigated in RAW264.7 macrophages and mice challenged with lipopolysaccharide (LPS). Results showed that EBME attenuated inflammation by decreasing the production of several proinflammatory mediators, such as nitric oxide (NO), prostaglandin (PG) E 2 , inducible nitric oxide synthase, and cyclooxygenase-2, in LPS-stimulated RAW264.7 macrophages. EBME increased the expression of heme oxygenase-1 (HO-1) and promoted the nuclear translocation of nuclear factor erythroid 2-related factor 2. The inhibitory effects of EBME on LPS-stimulated NO and PGE 2 expression were partially reversed by HO-1 inhibitor. EBME also elicited an anti-inflammatory effect by inhibiting the production of tumor necrosis factor-α, interleukin (IL)-1β, and IL-6 in LPS-induced peritonitis. Therefore, EBME exhibited anti-inflammatory effects in vitro and in vivo.
Risk factors for breast cancer-related upper extremity lymphedema: a meta-analysis
International Nuclear Information System (INIS)
Xie Yuhuan; Guo Qi; Liu Fenghua; Zhu Yaqun; Tian Ye
2014-01-01
Objective: To systematically evaluate the risk factors for upper extremity lymphedema after breast cancer treatment and the strength of their associations. Methods: PubMed, Ovid, EMbase, and the Cochrane Library were searched to identify clinical trials published up to December 2012. The quality of included studies was assessed by the Newcastle-Ottawa Scale;data analysis was performed by Stata 10.0 and RevMan 5.2; the strength of associations between risk factors and breast cancer-related upper extremity lymphedema was described as odds ratio (OR) and 95% confidence intervals (CI). Results: Twenty-two studies involving 10106 patients were included in the meta-analysis. The risk factors for upper extremity lymphedema after breast cancer treatment mainly included axillary lymph node dissection (OR=2.72, 95% CI=1.06-6.99, P=0.038), hypertension (OR=1.84, 95% CI=1.38-2.44, P=0.000), body mass index (OR=1.68, 95% CI=1.22-2.32, P=0.001), and radiotherapy (OR=1.65, 95% CI=1.20-2.25, P=0.002), while no significant associations were found for such factors as chemotherapy, age, number of positive lymph nodes, and number of dissected lymph nodes. Conclusions: The incidence of upper extremity lymphedema is high among patients with breast cancer after treatment, and axillary lymph node dissection, hypertension,body mass index, and radiotherapy are the main risk factors for lymphedema after breast cancer treatment. (authors)
Directory of Open Access Journals (Sweden)
Irek P.
2017-03-01
Full Text Available The paper is the continuation of the previous ones entitled „Material factors in relation to development time in liquid-penetrant inspection. Part 1. Material factors“ and „Material factors in relation to development time in liquid-penetrant inspection. Part 2. Investigation programme and preliminary tests“ in which material factors influencing essentially the development time in penetrant testing as well as the range of their values have been specified. These factors are: material kind, surface roughness and imperfection width.
Energy Technology Data Exchange (ETDEWEB)
Liu, Bin, E-mail: iamicehe@163.com [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Cao, Bo, E-mail: caobo19814@126.com [Logistics University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Tianjin Key Laboratory of Cardiovascular Remodeling and Target Organ Injury, Tianjin, 300162 (China); Zhang, Di, E-mail: zhangdibad@163.com [Department of Otorhinolaryngology Head and Neck Surgery, Institute of Otorhinolaryngology, Tianjin First Center Hospital, Tianjin 300192 (China); Xiao, Na [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Chen, Hong [Logistics University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Li, Guo-qiang; Peng, Shou-chun [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Wei, Lu-qing, E-mail: luqing-wei@163.com [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China)
2016-10-15
The present study was aimed at exploring the protective effects of Salvianolic acid B (SalB) against paraquat (PQ)-induced lung injury in mice. Lung fibrotic injuries were induced in mice by a single intragastrical administration of 300 mg/kg PQ, then the mice were administrated with 200 mg/kg, 400 mg/kg SalB, 100 mg/kg vitamin C (Vit C) and dexamethasone (DXM) for 14 days. PQ-triggered structure distortion, collagen overproduction, excessive inflammatory infiltration, pro-inflammatory cytokine release, and oxidative stress damages in lung tissues and mortality of mice were attenuated by SalB in a dose-dependent manner. Furthermore, SalB was noted to enhance the expression and nuclear translocation of nuclear factor erythroid 2–related factor 2 (Nrf2) and reduce expression of the reactive oxygen species-generating enzyme Nox4 [NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidase-4]. SalB also inhibited the increasing expression of transforming growth factor (TGF)-β1 and the phosphorylation of its downstream target Smad3 which were enhanced by PQ. These results suggest that SalB may exert protective effects against PQ-induced lung injury and pulmonary fibrosis. Its mechanisms involve the mediation of Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling. - Highlights: • Salvianolic acid B (SalB) reduced Paraquat-induced mortality and pulmonary injury in mice. • SalB has anti-oxidation, anti-inflammatory and anti-fibrogenic effects simultaneously. • Its mechanisms were targeting Nrf2-Nox4 redox balance and TGF-β1/Smad3 signaling.
International Nuclear Information System (INIS)
Liu, Bin; Cao, Bo; Zhang, Di; Xiao, Na; Chen, Hong; Li, Guo-qiang; Peng, Shou-chun; Wei, Lu-qing
2016-01-01
The present study was aimed at exploring the protective effects of Salvianolic acid B (SalB) against paraquat (PQ)-induced lung injury in mice. Lung fibrotic injuries were induced in mice by a single intragastrical administration of 300 mg/kg PQ, then the mice were administrated with 200 mg/kg, 400 mg/kg SalB, 100 mg/kg vitamin C (Vit C) and dexamethasone (DXM) for 14 days. PQ-triggered structure distortion, collagen overproduction, excessive inflammatory infiltration, pro-inflammatory cytokine release, and oxidative stress damages in lung tissues and mortality of mice were attenuated by SalB in a dose-dependent manner. Furthermore, SalB was noted to enhance the expression and nuclear translocation of nuclear factor erythroid 2–related factor 2 (Nrf2) and reduce expression of the reactive oxygen species-generating enzyme Nox4 [NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidase-4]. SalB also inhibited the increasing expression of transforming growth factor (TGF)-β1 and the phosphorylation of its downstream target Smad3 which were enhanced by PQ. These results suggest that SalB may exert protective effects against PQ-induced lung injury and pulmonary fibrosis. Its mechanisms involve the mediation of Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling. - Highlights: • Salvianolic acid B (SalB) reduced Paraquat-induced mortality and pulmonary injury in mice. • SalB has anti-oxidation, anti-inflammatory and anti-fibrogenic effects simultaneously. • Its mechanisms were targeting Nrf2-Nox4 redox balance and TGF-β1/Smad3 signaling.
International Nuclear Information System (INIS)
Kusunoki, Chisato; Yang, Liu; Yoshizaki, Takeshi; Nakagawa, Fumiyuki; Ishikado, Atsushi; Kondo, Motoyuki; Morino, Katsutaro; Sekine, Osamu; Ugi, Satoshi; Nishio, Yoshihiko; Kashiwagi, Atsunori; Maegawa, Hiroshi
2013-01-01
Highlights: ► Omega-3 PUFA has a direct anti-oxidant effect in adipocytes. ► EPA and DHA induce HO-1 expression in 3T3-L1 adipocytes. ► Omega-3 PUFA and its end-product, 4-HHE, activates the Nrf-2/HO-1 pathway. ► Omega-3 PUFA protects against oxidative stress-induced cytotoxicity. -- Abstract: Oxidative stress is produced in adipose tissue of obese subjects and has been associated with obesity-related disorders. Recent studies have shown that omega-3 polyunsaturated fatty acid (ω3-PUFA) has beneficial effects in preventing atherosclerotic diseases and insulin resistance in adipose tissue. However, the role of ω3-PUFA on adipocytes has not been elucidated. In this study, 3T3-L1 adipocytes were treated with ω3-PUFA and its metabolites, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), or 4-hydroxy hexenal (4-HHE). ω3-PUFA and its metabolites dose-dependently increased mRNA and protein levels of the anti-oxidative enzyme, heme oxygenase-1 (HO-1); whereas no changes in the well-known anti-oxidant molecules, superoxide dismutase, catalase, and glutathione peroxidase, were observed. Knockdown of nuclear factor erythroid 2-related factor 2 (Nrf-2) significantly reduced EPA, DHA or 4-HHE-induced HO-1 mRNA and protein expression. Also, pretreatment with ω3-PUFA prevented H 2 O 2 -induced cytotoxicity in a HO-1 dependent manner. In conclusion, treatment with EPA and DHA induced HO-1 through the activation of Nrf-2 and prevented oxidative stress in 3T3-L1 adipocytes. This anti-oxidant defense may be of high therapeutic value for clinical conditions associated with systemic oxidative stress.
Chen, Li-You; Renn, Ting-Yi; Liao, Wen-Chieh; Mai, Fu-Der; Ho, Ying-Jui; Hsiao, George; Lee, Ai-Wei; Chang, Hung-Ming
2017-09-01
Prolonged exposure to gamma-hydroxybutyric acid (GHB) would cause drug intoxication in which impaired cognitive function results from enhanced hippocampal oxidative stress may serve as a major symptom in this deficiency. Considering melatonin possesses significant anti-oxidative efficacy, this study aimed to determine whether melatonin would successfully promote the nuclear factor erythroid 2-related factor 2 and antioxidant responsive element (Nrf2-ARE) signaling, depress oxidative stress, and rescue hippocampal bioenergetics and cognitive function following drug intoxication injury. Adolescent rats subjected to 10 days of GHB were received melatonin at doses of either 10 or 100 mg/kg. Time-of-flight secondary ion mass spectrometry, biochemical assay, quantitative histochemistry, [ 14 C]-2-deoxyglucose analysis, together with Morris water maze were employed to detect the molecular signaling, oxidative status, bioenergetic level, as well as the cognitive performances, respectively. Results indicated that in GHB-intoxicated rats, enhanced oxidative stress, increased cholesterol level, and decreased anti-oxidative enzymes activities were detected in hippocampal regions. Intense oxidative stress paralleled well with reduced bioenergetics and poor performance in behavioral testing. However, in rats treated with melatonin following GHB intoxication, all above parameters and cognitive function were gradually returned to nearly normal levels. Melatonin also remarkably promoted the translocation of Nrf2 from cytoplasm to nucleus in a dose-dependent manner, thereby increased the Nrf2-ARE signaling-related downstream anti-oxidative enzymes activities. As melatonin effectively rescues hippocampal bioenergetics through depressing the oxidative stress by promoting Nrf2-ARE molecular machinery, this study thus highlights for the first time that clinical use of melatonin may serve as a therapeutic strategy to improve the cognitive function in unsuspecting victims suffered from
Feed-Back Regulation of Haemopoiesis
Energy Technology Data Exchange (ETDEWEB)
Feldman, M. [Department of Cell Biology, Weizmann Institute of Science, Rehovoth (Israel)
1968-08-15
Studies ate reported on the feed-back regulation of erythropoiesis by means of the intrasplenic cloning system of haemopoietic cells. Polycythaemia, produced by passive transfusion of synzeneic, allogeneic or xenogeneic red blood cells, inhibited the formation of bone-marrow derived erythroid clones. Polycythaemia also inhibited the formation of erythroid clones of endogenous stem cells. Oxygen overloading was found to be a necessary factor in the suppression of erythroid clone formation: no suppression of erythroid colonies was observed when polycythaemic animals were kept under hypoxic conditions. Erythropoietin, either of exogenous or of endogenous origin, elicited a reformation of erythroid clones in 'suppressed' animals. Studies on the kinetics of reformation of erythroid clones after the administration of erythropoietin suggested that the colony-forming stem cell can replicate a few times in the absence of erythropoietin and the cell progeny thus formed are the target cells for erythropoietin action. If, indeed, the colony-forming cell replicates in the absence of the specific inducer, then the cells thus formed should themselves be stem cells. This was substantiated by demonstrating that the cloning efficiency of spleens of polycythaemic recipients was higher than that of non-polycythaemic animals. Experiments indicating that erythroid clones produced by erythropoietin in polycythaemic animals disappeared after the discontinuance of erythropoietin application demonstrated the distinction between the 'mitogenic' and the 'morphogenetic' effects of erythropoietin. The latter seemed to be operated by an early transcription of RNA for proteins necessary for the complete maturation of the red blood cell, Erythroid clones produced by foetal haemopoietic stem cells seemed to be regulated by a different mechanism from that which controls the formation of bone-marrow derived clones. Clones produced by foetal cells were only partially suppressed in the polycythaemic
Micieli, Jonathan A; Wang, Duncheng; Denomme, Gregory A
2010-08-01
Anti-glycophorin C (GPC), blood group antibodies of which cause hemolytic disease of the fetus and newborn (HDFN), is a potent inhibitor of erythroid progenitor cell growth. The cellular mechanism for growth inhibition has not been characterized. K562 cells were incubated in the presence of either anti-GPC, an immunoglobulin G isotype control, an inhibitor of actin polymerization called cytochalasin D with anti-GPC, or cytochalasin D alone. The JC-1 cationic dye was used to detect mitochondrial depolarization and the activity of the mitogen-activated protein kinases was assessed by Western blotting. Anti-GPC inhibits the activity of extracellular regulated kinase (ERK)1/2 within 10 minutes but does not alter the activity of p38 or c-Jun N-terminal kinase. After 24 hours there was a significant loss of mitochondrial membrane potential compared to isotype control–treated cells. Both the ERK1/2 inhibition and the loss of mitochondrial potential were prevented by pretreatment with cytochalasin D. A cell surface antibody can cause anemia by altering the signaling pathways in erythroid cells by promoting depolarization of mitochondria via cytoskeletal rearrangement. The observation that neonates with anti-GPC HDFN are unresponsive to erythropoietin can be explained by the antibody inhibiting a protein kinase through which this hematopoietic growth factor achieves its effects.
Zhang, Sha; Meng, Long; Qiu, Feng; Yang, Jia-Dan; Sun, Shusen
2018-01-01
Previous studies have demonstrated that medication adherence has an impact on health-related quality of life (HRQoL). However, other medication-related factors that may influence HRQoL have not been extensively studied, especially factors based on the Medication-Risk Questionnaire (MRQ), and such studies are mostly done in Western countries. Our objective was to explore risk factors associated with HRQoL among community-dwelling elderly with chronic diseases in mainland China, especially the medication-related risk factors regarding MRQ. The study was conducted in a community health service center through surveys to eligible patients. The main outcomes of HRQoL were assessed by the EuroQol-5D (EQ-5D) scale and EQ-visual analog scale (EQ-VAS). Medication-related risk factors according to MRQ associated with HRQoL were identified using a multiple linear regression. A total of 311 patients were analyzed, averaging 71.19±5.33 years, and 68.8% were female. The mean EQ-5D index was 0.72±0.09, and the mean EQ-VAS score was 71.37±11.97. The most prevalent problem was pain/discomfort, and 90.0% believed that they could take care of themselves without any problems. Sex, age, educational level, frailty, function status, and certain medication-related factors regarding MRQ were found to be significant factors impacting the HRQoL. A multivariate analysis showed that MRQ factors of polypharmacy, multimorbidity, feeling difficultly with taking medicines as prescribed, and taking medicines with narrow therapeutic index had negative impacts on the quality of life. Patient's internal characteristics and medication-related risk factors according to MRQ were associated with quality of life. The results of the MRQ is an indicator of quality of life that can identify patients who need interventions.
Directory of Open Access Journals (Sweden)
Khue Pham Minh
2014-12-01
Full Text Available Objectives: To determine the prevalence and associated factors of work-related depression among the employees of a shoe manufacturing factory in Haiphong City, Vietnam. Material and Methods: We carried out this cross-sectional study among 420 workers in 2012 in Le Lai II Shoe Manufacturing Factory in Haiphong City, Vietnam using Karasek’s Job Content Questionnaire (JCQ and the Diagnostic and Statistical Manual of Mental Disorders, 4th Edition (DSM IV tool for measuring depression. Results: The study results show that a relatively high proportion of workers (20.7% belongs to the high-strain group based on Karasek’s model. The prevalence of work-related depression among workers was relatively high (18.8%. The factors associated with depression at work were high psychological demand (adjusted OR = 3.0, 95% CI: 1.1–8.3, low social support (adjusted OR = 4.7, 95% CI: 1.2–12.8, inadequate work protection materials (OR = 4.1, 95% CI: 2.2–10.1 and work absenteeism (OR = 6.2, 95% CI: 2.5–18.9. Conclusions: Strengthening the social support network (involving supervisors and co‑workers, reducing psychological job demand and assuring work protection materials at the workplace may highly facilitate reducing work-related depression.
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)
2015-10-23
p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.
International Nuclear Information System (INIS)
Becks, Lisa; Shi, Runhua; McLarty, Jerry; Pruitt, Kevin; Zhang, Songlin; Kleiner-Hancock, Heather E; Prince, Misty; Burson, Hannah; Christophe, Christopher; Broadway, Mason; Itoh, Ken; Yamamoto, Masayuki; Mathis, Michael; Orchard, Elysse
2010-01-01
Activation of nuclear factor erythroid 2-related factor (Nrf2), which belongs to the basic leucine zipper transcription factor family, is a strategy for cancer chemopreventive phytochemicals. It is an important regulator of genes induced by oxidative stress, such as glutathione S-transferases, heme oxygenase-1 and peroxiredoxin 1, by activating the antioxidant response element (ARE). We hypothesized that (1) the citrus coumarin auraptene may suppress premalignant mammary lesions via activation of Nrf2/ARE, and (2) that Nrf2 knockout (KO) mice would be more susceptible to mammary carcinogenesis. Premalignant lesions and mammary carcinomas were induced by medroxyprogesterone acetate and 7,12-dimethylbenz[a]anthracene treatment. The 10-week pre-malignant study was performed in which 8 groups of 10 each female wild-type (WT) and KO mice were fed either control diet or diets containing auraptene (500 ppm). A carcinogenesis study was also conducted in KO vs. WT mice (n = 30-34). Comparisons between groups were evaluated using ANOVA and Kaplan-Meier Survival statistics, and the Mann-Whitney U-test. All mice treated with carcinogen exhibited premalignant lesions but there were no differences by genotype or diet. In the KO mice, there was a dramatic increase in mammary carcinoma growth rate, size, and weight. Although there was no difference in overall survival, the KO mice had significantly lower mammary tumor-free survival. Also, in the KO mammary carcinomas, the active forms of NF-κB and β-catenin were increased ~2-fold whereas no differences in oxidized proteins were observed. Many other tumors were observed, including lymphomas. Interestingly, the incidences of lung adenomas in the KO mice were significantly higher than in the WT mice. We report, for the first time, that there was no apparent difference in the formation of premalignant lesions, but rather, the KO mice exhibited rapid, aggressive mammary carcinoma progression
Cesarean Section Rate in Singleton Primiparae and Related Factors in Beijing, China.
Song, Geng; Wei, Yu-Mei; Zhu, Wei-Wei; Yang, Hui-Xia
2017-10-20
The cesarean section rate (CSR) has been a main concern worldwide. The present study aimed to investigate the CSR in Beijing, China, and to analyze the related factors of CS delivery. An observational study was conducted in 15 medical centers in Beijing using a systemic cluster sampling method. In total, 15,194 pregnancies were enrolled in the study between June 20, 2013 and November 30, 2013. Independent t-tests and Pearson's Chi-square test were used to examine differences between two groups, and related factors of the CSR were examined by multivariable logistic regression. The CSR was 41.9% (4471/10,671) in singleton primiparae. Women who were more than 35 years old had a 7.4-fold increased risk of CS delivery compared with women level. Neonates weighing 3000-3499 g had the lowest CSR (36.2%). Neonates weighing levels, residence, education level, and singleton fetal birth weight are all factors that might significantly affect the CSR.
Martín Delgado, M C; Merino de Cos, P; Sirgo Rodríguez, G; Álvarez Rodríguez, J; Gutiérrez Cía, I; Obón Azuara, B; Alonso Ovies, Á
2015-01-01
To explore contributing factors (CF) associated to related critical patients safety incidents. SYREC study pos hoc analysis. A total of 79 Intensive Care Departments were involved. The study sample consisted of 1.017 patients; 591 were affected by one or more incidents. The CF were categorized according to a proposed model by the National Patient Safety Agency from United Kingdom that was modified. Type, class and severity of the incidents was analyzed. A total 2,965 CF were reported (1,729 were associated to near miss and 1,236 to adverse events). The CF group more frequently reported were related patients factors. Individual factors were reported more frequently in near miss and task related CF in adverse events. CF were reported in all classes of incidents. The majority of CF were reported in the incidents classified such as less serious, even thought CF patients factors were associated to serious incidents. Individual factors were considered like avoidable and patients factors as unavoidable. The CF group more frequently reported were patient factors and was associated to more severe and unavoidable incidents. By contrast, individual factors were associated to less severe and avoidable incidents. In general, CF most frequently reported were associated to near miss. Copyright © 2014 Elsevier España, S.L.U. and SEMICYUC. All rights reserved.
What Factors Contribute to Headache-Related Disability in Teens?
Kemper, Kathi J; Heyer, Geoffrey; Pakalnis, Ann; Binkley, Philip F
2016-03-01
Our aim was to describe the relationship between risk factors, such as stress, depression, and anxiety, and potentially protective factors against pediatric headache-related disability, such as mindfulness, resilience, and self-compassion, and to determine teens' interest in mind-body skills training to help reduce headache-related disability. This was a cross-sectional survey among adolescents seen in an academic neurology clinic reporting four or more headaches monthly using standardized instruments to determine the relationship between putative risk and protective factors as well as physiologic markers of inflammation and vagal tone and headache-related disability. Among the 29 participants, 31% were male, the average age was 14.8 years, average headache frequency was 11.6 per month, and the most commonly reported trigger was stress (86%). The only risk or protective factor significantly associated with headache-related disability was depression (r = 0.52, P = 0.004). Depression was negatively correlated with mindfulness, resilience, and self-compassion (P stress, sleep disturbance, and anxiety (P headache-related disability or depression. There was strong interest in learning skills like slow, deep breathing practices supported by a smart phone application to reduce stress and the negative impact of headaches on daily life. Among teens with frequent migraine headaches, depression is the strongest risk factor for headache-related disability. Stress is viewed as a headache trigger, and teens reported wanting to learn simple stress management strategies supported by a smart phone application to help reduce headache-related disability. Copyright © 2016 Elsevier Inc. All rights reserved.
Glycolysis in contracting rat skeletal muscle is controlled by factors related to energy state
DEFF Research Database (Denmark)
Ørtenblad, Niels; Macdonald, Will A; Sahlin, Kent
2009-01-01
The control of glycolysis in contracting muscle is not fully understood. The aim of the present study was to examine whether activation of glycolysis is mediated by factors related to the energy state or by a direct effect of Ca2+ on the regulating enzymes. Extensor digitorum longus muscles from...... and 58% of those in Con respectively. Glycolytic rate in BTS was only 51% of that in Con but the relative contribution of ATP derived from PCr (phosphocreatine) and glycolysis and the relation between muscle contents of PCr and Lac (lactate) were not different. Prolonged cyanide incubation of quiescent...... contribution of energy delivered from PCr and glycolysis during both conditions suggests that the glycolytic rate is controlled by factors related to energy state....
Obesity related factors in school-aged children.
Soltani, Parvaneh Reza; Ghanbari, Atefeh; Rad, Afagh Hasanzadeh
2013-05-01
Overweight and obesity is becoming an increasingly prevalent problem in both developed and developing world, and is one of the most serious public health challenges of the 21(st) century. Although various studies demonstrated pediatric obesity-related factors, but, due to its ongoing hazardous effects, researchers aimed to assess obesity-related factors in school-aged children in Rasht, Iran. This was a case-control study which was performed in eight primary schools of Rasht. A cluster sampling method was used to select 320 students including 80 in case (BMI ≥85(th) percentile for age and gender) and 240 in control group (BMI = 5(th)-85(th) percentile for age and gender). Data were collected by a scale, a tape meter, and a form which consisted of obesity-related factors, and were analyzed by Chi-square, Mann-Whitney, and stepwise multivariate regression tests in SPSS 19. Findings showed that the mean and standard deviation of birth weight (g) in case and control groups were 3671 ± 5.64 and 190 ± 5.46, respectively (P = 0.000). 82.5% of case and 92.9% of control group had exclusive breastfeeding for 4-6 months (P = 0.024). Also, multivariate regression analysis indicated that birth weight, age, exclusive breastfeeding, and frequency of meals have significant effects on body mass index (BMI). It seems that more accurate interventions for primordial prevention are essential to reduce childhood obesity risk factors, including promotion of pre-pregnancy and prenatal care to have neonates who are appropriate for gestational age and also improving exclusive breastfeeding in the first 6 months of life. In addition, identifying children at risk for adolescent obesity provides physicians and midwives with an opportunity for earlier intervention with the goal of limiting the progression of abnormal weight gain.
[Factors related to the scientific production of gastroenterologists in Lima-Peru].
Parra Pérez, V; Monge Salgado, E; Vildósola Gonzales, H
2009-01-01
The biomedical investigation in Peru is limited; among the implicated factors we have the reduced per-capita expense in investigation, the disperse efforts and the low communication between the investigations and the social productive activities. To determinate the personal, professional and academic factors related with the scientific production of the medical gastroenterologists that work in province Lima. Co-relational, observational, comparative, transversal and retrospective studies that had happened in between march 2007 and april 2008. Was elaborated a survey containing the variables of the investigation which was applied autoadministered to the gastroenterologists. Using bivaried and multivaried, were identified factors related with the scientific production of the gastroenterologist. The bivaried analysis has found, as related factors with the scientific production: Teaching, type of bibliographic research, degree of comprehension of the scientific article, facilities for the investigation at the job, subscription at the scientific magazine, to belong to the scientific society and the number of employments. The multivaried analysis found the previous factors but teaching and subscription to the scientific magazine, related with the scientific production. Those gastroenterologists that, despite being in contact with factors that impede the development of the investigation, had overcome the local negative influence and emerge, deserve consideration, because is on them were we can recognize factors that favor the investigation labor.
Factors related to outcomes in lupus-related protein-losing enteropathy.
Lim, Doo-Ho; Kim, Yong-Gil; Bae, Seung-Hyeon; Ahn, Soomin; Hong, Seokchan; Lee, Chang-Keun; Yoo, Bin
2015-11-01
Protein-losing enteropathy (PLE), characterized by severe hypoalbuminemia and peripheral edema, is a rare manifestation of systemic lupus erythematosus. This present study aimed to identify the distinctive features of lupus-related PLE and evaluate the factors related to the treatment response. From March 1998 to March 2014, the clinical data of 14 patients with lupus PLE and seven patients with idiopathic PLE from a tertiary center were reviewed. PLE was defined as a demonstration of protein leakage from the gastrointestinal tract by either technetium 99m-labelled human albumin scanning or fecal α1-antitrypsin clearance. A positive steroid response was defined as a return of serum albumin to ≥ 3.0 g/dL within 4 weeks after initial steroid monotherapy, and remission as maintenance of serum albumin ≥ 3.0 g/dL for at least 3 months. A high serum total cholesterol level was defined as a level of ≥ 240 mg/dL. The mean age of the lupus-related PLE patients was 37.0 years, and the mean follow-up duration was 55.8 months. Significantly higher erythrocyte sedimentation rate and serum total cholesterol levels were found for lupus PLE than for idiopathic PLE. Among the 14 patients with lupus PLE, eight experienced a positive steroid response, and the serum total cholesterol level was significantly higher in the positive steroid response group. A positive steroid response was associated with an initial high serum total cholesterol level and achievement of remission within 6 months. In lupus-related PLE, a high serum total cholesterol level could be a predictive factor for the initial steroid response, indicating a good response to steroid therapy alone.
Nrf2 mediates redox adaptation in NOX4-overexpressed non-small cell lung cancer cells
Energy Technology Data Exchange (ETDEWEB)
Wu, Qipeng; Yao, Bei; Li, Ning; Ma, Lei; Deng, Yanchao; Yang, Yang; Zeng, Cheng; Yang, Zhicheng [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Liu, Bing, E-mail: liubing520@gdpu.edu.cn [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Guangdong Key Laboratory of Pharmaceutical Bioactive Substances, Guangdong Pharmaceutical University, Guangzhou 510006 (China)
2017-03-15
The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells. However, the comprehensive mechanisms for NOX4-mediated oxidative resistance of cancer cells remain still undentified. The present study found that NOX4-derived H{sub 2}O{sub 2} enhanced the nuclear factor erythroid 2-related factor 2 (Nrf2) stability via disruption of redox-dependent proteasomal degradation and stimulated its activity through activation of PI3K signaling. Specifically, the results showed that ectopic NOX4 expression did not induce apoptosis of A549 cells; however, inhibition of Nrf2 resulted in obvious apoptotic death of NOX4-overexpressed A549 cells, accompanied by a significant increase in H{sub 2}O{sub 2} level and decrease in GSH content. Besides, inhibition of Nrf2 could suppress cell growth and efficiently reverse the enhancement effect of NOX4 on cell growth. The in vivo data confirmed that inhibition of Nrf2 could interfere apoptosis resistance in NOX4-overexpressed A549 tumors and led to cell growth inhibition. In conclusion, these results reveal that Nrf2 is critically involved in redox adaptation regulation in NOX4-overexpressed NSCLC cells. Therefore, NOX4 and Nrf2 may be promising combination targets against malignant progression of NSCLC. - Highlights: • NOX4-derived H{sub 2}O{sub 2} upregulates Nrf2 expression and activity in NSCLC. • Nrf2 confers apoptosis resistance in NOX4-overexpressed NSCLC cells. • Inhibition of Nrf2 reverses the enhancement effect of NOX4 on cell growth.
Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo
Energy Technology Data Exchange (ETDEWEB)
Shi, Zhiqin [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Department of Laboratory Diagnosis, Hebei Medical University, Shijiazhuang (China); Niu, Yujie [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Wang, Qian [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Shi, Lei [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Guo, Huicai; Liu, Yi; Zhu, Yue [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Liu, Shufeng; Liu, Chao [Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China); Chen, Xin [Xiumen Community Health Service Centre, Shijiazhuang (China); Zhang, Rong, E-mail: rongzhang@hebmu.edu.cn [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China)
2015-11-15
Highlights: • Nrf2 signals were partly responsible for the DNA damage induced by Nano-TiO{sub 2}. • Nrf2 loss could aggravate the DNA damage induced by Nano-TiO{sub 2}. • Acquired Nrf2 decreased the susceptibility to DNA damage induced by Nano-TiO{sub 2}. - Abstract: Titanium dioxide nanoparticles (Nano-TiO{sub 2}) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO{sub 2} induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO{sub 2}. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO{sub 2}. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO{sub 2} exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO{sub 2} treatment. After treatment with Nano-TiO{sub 2}, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO{sub 2} and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO{sub 2} toxication.
NOx and SO2 emission factors for Serbian lignite Kolubara
Directory of Open Access Journals (Sweden)
Jovanović Vladimir V.
2012-01-01
Full Text Available Emission factors are widely accepted tool for estimation of various pollutants emissions in USA and EU. Validity of emission factors is strongly related to experimental data on which they are based. This paper is a result of an effort to establish reliable NOx and SO2 emission factors for Serbian coals. The results of NOx and SO2 emissions estimations based on USA and EU emission factors from thermal power plants Nikola Tesla Obrenovac A and B utilizing the Serbian lignite Kolubara are compared with experimental data obtained during almost one decade (2000-2008 of emissions measurements. Experimental data are provided from regular annual emissions measurement along with operational parameters of the boiler and coal (lignite Kolubara ultimate and proximate analysis. Significant deviations of estimated from experimental data were observed for NOx, while the results for SO2 were satisfactory. Afterwards, the estimated and experimental data were plotted and linear regression between them established. Single parameter optimization was performed targeting the ideal slope of the regression line. Results of this optimization provided original NOx and SO2 emission factors for Kolubara lignite.
[Factors related to the life space of daycare center users].
Kawamura, Koki; Kato, Chikako; Kondo, Izumi
2018-01-01
We examined the factors related to life space and changes in the care level after one year in daycare center users. The participants were 83 older adults (age, > 65 years; mean age, 79.5±6.8 years) with MMSE scores of ≥20, who could walk independently, who needed support (1-2) or care (1), and who underwent rehabilitation at a daycare center. The life space was evaluated by the Life Space Assessment (LSA). The subjects' basic information (i.e., age, medical history.) was collected, and their physical function (i.e., grip strength, timed up and go test [TUG]), mental function (i.e., vitality, fear of falls), and social function (i.e., friends, hobbies, public transportation) were assessed to investigate the factors associated with their LSA scores. In addition, a follow-up survey was conducted on the care level at approximately one year later. A multiple regression analysis indicated that TUG scores (β=-0.33), hobbies (β=0.30), friends (β=0.29), public transportation (β=0.26), and grip strength (β=0.24) were related to the life space. Next, the participants were divided into LSA-high and LSA-low groups, and changes in the care level (improvement, maintenance, deterioration) at approximately one year after the initial assessment were examined using a chi-squared test. A significant difference was observed in the distribution of the groups (p=0.03). Multiple factors were related to the life space. Moreover, it is possible that improvements in the level of care may be achieved by improving the life space.