WorldWideScience

Sample records for factor erythroid 2-related

  1. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  2. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  3. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  5. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  6. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  8. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  10. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  11. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  12. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  13. Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway.

    Science.gov (United States)

    Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang

    2018-04-18

    Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

  14. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    Science.gov (United States)

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  16. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  17. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  18. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  19. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  20. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  1. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  2. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  3. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  4. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  6. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  7. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  8. Protection by dimethyl fumarate against diabetic cardiomyopathy in type 1 diabetic mice likely via activation of nuclear factor erythroid-2 related factor 2.

    Science.gov (United States)

    Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu

    2018-05-01

    Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  10. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  11. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  12. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  13. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  14. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  15. Transcriptional regulation of Hb-α and Hb-β through nuclear factor E2-related factor-2 (Nrf2) activation in human vaginal cells: A novel mechanism of cellular adaptability to oxidative stress.

    Science.gov (United States)

    Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami

    2017-06-01

    Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  17. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  18. The transcription factor, Nuclear factor, erythroid 2 (Nfe2), is a regulator of the oxidative stress response during Danio rerio development

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others

    2016-11-15

    Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were

  19. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  20. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  1. Dual-energy precursor and nuclear erythroid-related factor 2 activator treatment additively improve redox glutathione levels and neuron survival in aging and Alzheimer mouse neurons upstream of reactive oxygen species.

    Science.gov (United States)

    Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J

    2014-01-01

    To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Effects of Nuclear Factor-E2-related factor 2/Heme Oxygenase 1 on splanchnic hemodynamics in experimental cirrhosis with portal hypertension.

    Science.gov (United States)

    Qin, Jun; He, Yue; Duan, Ming; Luo, Meng

    2017-05-01

    We explored the effects of Nuclear Factor-E2-related factor 2 (Nrf2) and Heme Oxygenase 1 (HO-1) on splanchnic hemodynamics in portal hypertensive rats. Experimental cirrhosis with portal hypertension was induced by intraperitoneal injection of carbon tetrachloride. The expression of proteins was examined by immunoblotting. Hemodynamic studies were performed by radioactive microspheres. The vascular perfusion system was used to measure the contractile response of mesentery arterioles in rats. Nrf2 expression in the nucleus and HO-1 expression in cytoplasm was significantly enhanced in portal hypertensive rats. Portal pressure, as well as regional blood flow, increased significantly in portal hypertension and can be blocked by tin protoporphyrin IX. The expression of endogenous nitric oxide synthase and vascular endothelial growth factors increased significantly compared to normal rats, while HO-1 inhibition decreased the expression of these proteins significantly. The contractile response of mesenteric arteries decreased in portal hypertension, but can be partially recovered through tin protoporphyrin IX treatment. The expression of Nrf2/HO-1 increased in mesenteric arteries of portal hypertensive rats, which was related to oxidative stress. HO-1was involved in increased portal pressure and anomaly splanchnic hemodynamics in portal hypertensive rats. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

    Directory of Open Access Journals (Sweden)

    Heung Bum Lee

    2012-06-01

    Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

  4. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  5. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  6. Th2-related immune responses by the Brucella abortus cellular antigens, malate dehydrogenase, elongation factor, and arginase.

    Science.gov (United States)

    Im, Young Bin; Shim, Soojin; Park, Woo Bin; Kim, Suk; Yoo, Han Sang

    2017-09-01

    Brucellosis is an important zoonotic disease caused by Brucella species. The disease is difficult to control due to the intracellular survival of the bacterium and the lack of precise understanding of pathogenesis. Despite of continuous researches on the pathogenesis of Brucella spp. infection, there is still question on the pathogenesis, especially earlier immune response in the bacterial infection. Malate dehydrogenase (MDH), elongation factor (Tsf), and arginase (RocF), which showed serological reactivity, were purified after gene cloning, and their immune modulating activities were then analyzed in a murine model. Cytokine production profiles were investigated by stimulating RAW 264.7 cells and naïve splenocytes with the three recombinant proteins. Also, immune responses were analyzed by ELISA and an ELIspot assay after immunizing mice with the three proteins. Only TNF-α was produced in stimulated RAW 264.7 cells, whereas Th1-related cytokines, IFN-γ and IL-2, were induced in naïve splenocytes. In contrast, Th2-type immune response was more strongly induced in antigen-secreting cells in the splenocytes obtained 28 days after immunizing mice with the three proteins, as were IgM and IgG. The induction of Th2-related antibody, IgG1, was higher than the Th1-related antibody, IgG2a, in immunized mice. These results suggest that the three proteins strongly induce Th2-type immune response in vivo, even though Th1-related cytokines were produced in vitro. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  8. NFE2-Related Transcription Factor 2 Coordinates Antioxidant Defense with Thyroglobulin Production and Iodination in the Thyroid Gland.

    Science.gov (United States)

    Ziros, Panos G; Habeos, Ioannis G; Chartoumpekis, Dionysios V; Ntalampyra, Eleni; Somm, Emmanuel; Renaud, Cédric O; Bongiovanni, Massimo; Trougakos, Ioannis P; Yamamoto, Masayuki; Kensler, Thomas W; Santisteban, Pilar; Carrasco, Nancy; Ris-Stalpers, Carrie; Amendola, Elena; Liao, Xiao-Hui; Rossich, Luciano; Thomasz, Lisa; Juvenal, Guillermo J; Refetoff, Samuel; Sykiotis, Gerasimos P

    2018-06-01

    The thyroid gland has a special relationship with oxidative stress. While generation of oxidative substances is part of normal iodide metabolism during thyroid hormone synthesis, the gland must also defend itself against excessive oxidation in order to maintain normal function. Antioxidant and detoxification enzymes aid thyroid cells to maintain homeostasis by ameliorating oxidative insults, including during exposure to excess iodide, but the factors that coordinate their expression with the cellular redox status are not known. The antioxidant response system comprising the ubiquitously expressed NFE2-related transcription factor 2 (Nrf2) and its redox-sensitive cytoplasmic inhibitor Kelch-like ECH-associated protein 1 (Keap1) defends tissues against oxidative stress, thereby protecting against pathologies that relate to DNA, protein, and/or lipid oxidative damage. Thus, it was hypothesized that Nrf2 should also have important roles in maintaining thyroid homeostasis. Ubiquitous and thyroid-specific male C57BL6J Nrf2 knockout (Nrf2-KO) mice were studied. Plasma and thyroids were harvested for evaluation of thyroid function tests by radioimmunoassays and of gene and protein expression by real-time polymerase chain reaction and immunoblotting, respectively. Nrf2-KO and Keap1-KO clones of the PCCL3 rat thyroid follicular cell line were generated using CRISPR/Cas9 technology and were used for gene and protein expression studies. Software-predicted Nrf2 binding sites on the thyroglobulin enhancer were validated by site-directed in vitro mutagenesis and chromatin immunoprecipitation. The study shows that Nrf2 mediates antioxidant transcriptional responses in thyroid cells and protects the thyroid from oxidation induced by iodide overload. Surprisingly, it was also found that Nrf2 has a dramatic impact on both the basal abundance and the thyrotropin-inducible intrathyroidal abundance of thyroglobulin (Tg), the precursor protein of thyroid hormones. This effect is mediated

  9. Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

    Science.gov (United States)

    Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

    2014-01-01

    Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

  10. The role of nuclear factor E2-Related factor 2 and uncoupling protein 2 in glutathione metabolism: Evidence from an in vivo gene knockout study

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xu, Yuanyuan; Zheng, Hongzhi; Fu, Jingqi; Hou, Yongyong; Wang, Huihui; Zhang, Qiang; Yamamoto, Masayuki; Pi, Jingbo

    2016-01-01

    Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.

  11. The role of nuclear factor E2-Related factor 2 and uncoupling protein 2 in glutathione metabolism: Evidence from an in vivo gene knockout study

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yanyan [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Xu, Yuanyuan, E-mail: yyxu@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zheng, Hongzhi [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Fu, Jingqi; Hou, Yongyong; Wang, Huihui [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zhang, Qiang [Rollins School of Public Health, Emory University, Atlanta, GA (United States); Yamamoto, Masayuki [Graduate School of Medicine, Tohoku University, Sendai (Japan); Pi, Jingbo, E-mail: jbpi@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States)

    2016-09-09

    Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.

  12. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  13. Protective Role of Nuclear Factor E2-Related Factor 2 against Acute Oxidative Stress-Induced Pancreatic β-Cell Damage

    Directory of Open Access Journals (Sweden)

    Jingqi Fu

    2015-01-01

    Full Text Available Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2 is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2 and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF, and tert-butylhydroquinone (tBHQ, protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS are involved in regulating glucose-stimulated insulin secretion (GSIS and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes.

  14. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    International Nuclear Information System (INIS)

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-01-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs 3+ ) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs 3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs 3+ and monomethylarsonous acid (MMA 3+ )-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs 3+ -induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs 3+ . The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs 3+ in β-cells. ► Deficiency of Nrf2 in β-cells sensitized to iAs 3+ and MMA 3

  15. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Bei [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Department of Histology and Embryology, College of Basic Medical Sciences, China Medical University, Shenyang 110001 (China); Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

    2012-11-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in

  16. Nuclear factor E2-related factor 2’s activation in transgenic mice fed with dosage of saturated or unsaturated fatty acids using in vivo bioluminescent imaging

    Directory of Open Access Journals (Sweden)

    Elena Mariani

    2017-05-01

    Full Text Available To counteract oxidative stress cells developed several mechanisms, including the transcription factor Nuclear Factor E2-related factor 2 (Nrf2. The aim of the study was to evaluate the activation of Nrf2 in transgenic mice fed saturated or polyunsaturated fatty acids and the anti-inflammatory effect of estrogens on organism. Forty-eight ARE CRE OMO reporter mice were divided into 3 groups, consisting of 16 animals, based on presence/absence of estrogens (ovariectomized or sham female, OVX - SH; male, MA. Each group was further split in 4 subgroups of 4 animals each and fed different diets (7.5% lard, 7.5% tuna oil, 20.0 % lard and 20.0% tuna oil. Two times a week animals were anaesthetized and injected i.p. with 100µL luciferin 15 min before the imaging session. Using the Living Image Software, photon emission was mapped for selected body areas. On day 70, animals were sacrificed after a challenge with Sodium Arsenite. Specific organs were dissected and immediately subjected to ex vivo imaging session. MIXED and GLM procedures of SAS software were used for statistical analysis. Dietary treatments did not affect body weight and feed intake as well as Nrf2 expression in both pre- and post-challenge phases, with the exception of the abdominal region (P=0.031 pre-challenge; in this area, during the pre-challenge phase, OVX showed lower Nrf2 activation (P<0.001. Ex vivo results outlined a significant effect of the challenge on all the considered organs (P<0.001, while OVX subjects had higher Nrf2 expression on urinary bladder and kidney (P<0.05 and high fat diet increased Nrf2 in urinary bladder (P<0.05. The present trial shows how saturated or polyunsaturated fatty acids supplementation in the diet do not exert significant effects on oxidative stress in mice, but confirms the protective role of estrogens under physiological condition.

  17. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  18. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  20. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  1. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  2. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  3. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  4. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  5. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  6. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  7. Picroside II Attenuates Airway Inflammation by Downregulating the Transcription Factor GATA3 and Th2-Related Cytokines in a Mouse Model of HDM-Induced Allergic Asthma.

    Directory of Open Access Journals (Sweden)

    Jin Choi

    Full Text Available Picroside II isolated from Pseudolysimachion rotundum var. subintegrum has been used as traditional medicine to treat inflammatory diseases. In this study, we assessed whether picroside II has inhibitory effects on airway inflammation in a mouse model of house dust mite (HDM-induced asthma. In the HDM-induced asthmatic model, picroside II significantly reduced inflammatory cell counts in the bronchoalveolar lavage fluid (BALF, the levels of total immunoglobulin (Ig E and HDM-specific IgE and IgG1 in serum, airway inflammation, and mucus hypersecretion in the lung tissues. ELISA analysis showed that picroside II down-regulated the levels of Th2-related cytokines (including IL-4, IL-5, and IL-13 and asthma-related mediators, but it up-regulated Th1-related cytokine, IFNγ in BALF. Picroside II also inhibited the expression of Th2 type cytokine genes and the transcription factor GATA3 in the lung tissues of HDM-induced mice. Finally, we demonstrated that picroside II significantly decreased the expression of GATA3 and Th2 cytokines in developing Th2 cells, consistent with in vivo results. Taken together, these results indicate that picroside II has protective effects on allergic asthma by reducing GATA3 expression and Th2 cytokine bias.

  8. Knockdown of NF-E2-related factor 2 inhibits the proliferation and growth of U251MG human glioma cells in a mouse xenograft model.

    Science.gov (United States)

    Ji, Xiang-Jun; Chen, Sui-Hua; Zhu, Lin; Pan, Hao; Zhou, Yuan; Li, Wei; You, Wan-Chun; Gao, Chao-Chao; Zhu, Jian-Hong; Jiang, Kuan; Wang, Han-Dong

    2013-07-01

    NF-E2-related factor 2 (Nrf2) is a pivotal transcription factor of cellular responses to oxidative stress and recent evidence suggests that Nrf2 plays an important role in cancer pathobiology. However, the underlying mechanism has yet to be elucidated, particularly in glioma. In the present study, we investigated the role of Nrf2 in the clinical prognosis, cell proliferation and tumor growth of human glioblastoma multiforme (GBM). We detected overexpression of Nrf2 protein levels in GBM compared to normal brain tissues. Notably, higher protein levels of Nrf2 were significantly associated with poorer overall survival and 1-year survival for GBM patients. Furthermore, we constructed the plasmid Si-Nrf2 and transduced it into U251MG cells to downregulate the expression of Nrf2 and established stable Nrf2 knockdown cells. The downregulation of Nrf2 suppressed cell proliferation in vitro and tumor growth in mouse xenograft models. We performed immunohistochemistry staining to detect the protein levels of Nrf2, Ki-67, caspase-3 and CD31 in the xenograft tumors and found that the expression levels of Nrf2 and Ki-67 were much lower in the Si-Nrf2 group compared to the Si-control group. In addition, the number of caspase-3-positive cells was significantly increased in the Si-Nrf2 group. By analysis of microvessel density (MVD) assessed by CD31, the MVD value in the Si-Nrf2 group decreased significantly compared to the Si-control group. These findings indicate that the knockdown of Nrf2 may suppress tumor growth by inhibiting cell proliferation, increasing cell apoptosis and inhibiting angiogenesis. These results highlight the potential of Nrf2 as a candidate molecular target to control GBM cell proliferation and tumor growth.

  9. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  10. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  11. Effects of Lavender, Lemon and Eucalyptus Essential Oil on Th2 related Factors of DNCB-induced Atopy dermatitis in NC/Nga Mice Model

    Directory of Open Access Journals (Sweden)

    Kim, Hyeon-Ah

    2010-03-01

    Full Text Available Purpose : To investigate the effects of the lavender, lemon and eucalyptus oil mixture on the atopy dermatitis skin lesions induced on NC/Nga Mice by dinitrochlorobenzene (DNCB. Material and Method : For this purpose, we fabricated the oil mixture blending three essential oils (lavender, lemon, eucalyptus : ELL with one carrier oil (jojoba and apply it on the atopic dermatitis skin lesions of NC/Nga Mice. Atopic dermatitis in NC/Nga Mice was induced by DNCB treatment on the dorsal skin of mice for 8 weeks. The mixture of ratio of each essential oil drop was 1 (eucalyptus : 2 (lemon : 2 (lavender and this mixture was blended with jojoba oil 50ml (0.025%. The ELL-ointment was supplied for 8 weeks. We evaluated the effects of ELL on cell viability of mouse lung fibroblast, clinical skin features and severity, the level of serum Immunoglobulin (Ig E & Ig G1, Interleukin (IL-4, IL-13 and Interferon (IFN-. Results : ELL showed safety on the cell viability of mouse lung fibroblast compared with control group. The cell viability was measured by SRB method. The effects of ELL on clinical skin features and severity in DNCB-induced dermatitis model of NC/Nga mice was significant compared with control group. EEL also showed significant effects on clinical symptom score compared with control group. Serum IgE & IgG1 level and development of atopy dermatitis skin lesions were evaluated. Serum IgE & IgG1 production was significantly down-regulated in EEL group compared with control group. ELL also down-regulated the levels of IL-4 and IL-13, and up-regulated the level of IFN- compared with control group significantly. Conclusion : ELL was effective on atopy dermatitis by modulating Th2 related factors.

  12. Anti-oxidative stress regulator NF-E2-related factor 2 mediates the adaptive induction of antioxidant and detoxifying enzymes by lipid peroxidation metabolite 4-hydroxynonenal

    Directory of Open Access Journals (Sweden)

    Huang Ying

    2012-11-01

    Full Text Available Abstract Background NF-E2-related factor 2 (NRF2 regulates a battery of antioxidative and phase II drug metabolizing/detoxifying genes through binding to the antioxidant response elements (ARE. NRF2-ARE signaling plays a central role in protecting cells from a wide spectrum of reactive toxic species including reactive oxygen/nitrogen species (RONS. 4-hydroxylnonenal (4-HNE is a major end product from lipid peroxidation of omega-6 polyunsaturated fatty acids (PUFA induced by oxidative stress, and it is highly reactive to nucleophilic sites in DNA and proteins, causing cytotoxicity and genotoxicity. In this study, we examined the role of NRF2 in regulating the 4-HNE induced gene expression of antioxidant and detoxifying enzymes. Results When HeLa cells were treated with 4-HNE, NRF2 rapidly transloated into the nucleus, as determined by the distribution of NRF2 tagged with the enhanced green fluorescent protein (EGFP and increased NRF2 protein in the nuclear fraction. Transcriptional activity of ARE-luciferase was significantly induced by 0.01-10 μM of 4-HNE in a dose-dependent manner, and the induction could be blocked by pretreatment with glutathione (GSH. 4-HNE induced transcriptional expression of glutathione S-transferase (GST A4, aldoketone reductase (AKR 1C1 and heme oxygenase-1 (HO-1, and the induction was attenuated by knocking down NRF2 using small interfering RNA. Conclusions NRF2 is critical in mediating 4-HNE induced expression of antioxidant and detoxifying genes. This may account for one of the major cellular defense mechanisms against reactive metabolites of lipids peroxidation induced by oxidative stress and protect cells from cytotoxicity.

  13. LAMA2-related myopathy

    DEFF Research Database (Denmark)

    Løkken, Nicoline; Born, Alfred Peter; Duno, Morten

    2015-01-01

    INTRODUCTION: Muscular dystrophy caused by LAMA2-gene mutations is an autosomal recessive disease typically presenting as a severe, early-onset congenital muscular dystrophy (CMD). However, milder cases with a limb-girdle type muscular dystrophy (LGMD) have been described. METHODS: In this study......, we assessed the frequency and phenotypic spectrum of LAMA2-related muscular dystrophy in CMD (n = 18) and LGMD2 (n = 128) cohorts identified in the last 15 years in eastern Denmark. The medical history, brain-MRI, muscle pathology, muscle laminin-α2 expression, and genetic analyses were assessed....... RESULTS: Molecular genetics revealed 2 pathogenic LAMA2 mutations in 5 of 18 CMD and 3 of 128 LGMD patients, corresponding to a LAMA2-mutation frequency of 28% in the CMD and 2.3% in the LGMD cohorts, respectively. CONCLUSIONS: This study demonstrates a wide clinical spectrum of LAMA2-related muscular...

  14. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  15. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  16. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  17. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  18. Natural antioxidants exhibit chemopreventive characteristics through the regulation of CNC b-Zip transcription factors in estrogen-induced breast carcinogenesis.

    Science.gov (United States)

    Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K

    2014-12-01

    The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.

  19. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  20. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  1. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  2. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line.

    Science.gov (United States)

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20μM BDE-47 for 24h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20μM BDE-47 for 24h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  4. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  5. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  6. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    International Nuclear Information System (INIS)

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-01-01

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  7. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    Energy Technology Data Exchange (ETDEWEB)

    Park, Hae-Ryung, E-mail: heaven@umich.edu; Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  8. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  9. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  10. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  12. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  13. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  14. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  15. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  16. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  17. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  18. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  19. Association between the NF-E2 Related Factor 2 Gene Polymorphism and Oxidative Stress, Anti-Oxidative Status, and Newly-Diagnosed Type 2 Diabetes Mellitus in a Chinese Population

    Directory of Open Access Journals (Sweden)

    Xia Wang

    2015-07-01

    Full Text Available Oxidative stress is a major risk factor in the onset and progression of type 2 diabetes mellitus (T2DM. NF-E2 related factor 2 (NRF2 is a pivotal transcription factor in oxidative stress related illnesses. This study included 2174 subjects with 879 cases of newly-diagnosed T2DM and 1295 healthy controls. Compared to individuals with the CC genotype, those with the AA genotype had lower total anti-oxidative capacity, superoxide dismutase, catalase, glutathione, glutathione peroxidase activity; and lower homeostasis model assessment of β-cell function index. Those with the AA genotype also had a higher malondialdehyde concentration and homeostasis model assessment of insulin resistance index values. The frequency of allele A was significantly higher in T2DM subjects (29.4%, compared to control subjects (26.1%; p = 0.019. Individuals with the AA genotype had a significantly higher risk of developing T2DM (OR 1.56; 95% CI 1.11, 2.20; p = 0.011, relative to those with the CC genotype, even after adjusting for known T2DM risk factors. Our results suggest that the NRF2 rs6721961 polymorphism was significantly associated with oxidative stress, anti-oxidative status, and risk of newly-diagnosed T2DM. This polymorphism may also contribute to impaired insulin secretory capacity and increased insulin resistance in a Chinese population.

  20. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  1. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  2. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  3. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  4. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  5. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  6. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  7. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2013-11-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  8. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    International Nuclear Information System (INIS)

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-01-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and

  9. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  10. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  11. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  12. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  13. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  14. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  15. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  16. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  17. Melatonin Attenuates Memory Impairment Induced by Klotho Gene Deficiency Via Interactive Signaling Between MT2 Receptor, ERK, and Nrf2-Related Antioxidant Potential

    Science.gov (United States)

    Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

    2015-01-01

    Background: We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. Methods: First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Results: Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Conclusions: Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. PMID

  18. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  19. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  20. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  1. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  2. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. The anti-oxidative transcription factor Nuclear factor E2 related factor-2 (Nrf2) counteracts TGF-β1 mediated growth inhibition of pancreatic ductal epithelial cells -Nrf2 as determinant of pro-tumorigenic functions of TGF-β1

    International Nuclear Information System (INIS)

    Genrich, Geeske; Kruppa, Marcus; Lenk, Lennart; Helm, Ole; Broich, Anna; Freitag-Wolf, Sandra; Röcken, Christoph; Sipos, Bence; Schäfer, Heiner; Sebens, Susanne

    2016-01-01

    Nuclear factor E2 related factor-2 (Nrf2) is an oxidative stress inducible transcription factor being essential in regulating cell homeostasis. Thus, acute induction of Nrf2 in epithelial cells exposed to inflammation confers protection from oxidative cell damage and mutagenesis supporting an anti-tumorigenic role for Nrf2. However, pancreatic ductal adenocarcinoma (PDAC) is characterized by persistent Nrf2 activity conferring therapy resistance which points to a pro-tumorigenic role of Nrf2. A similar dichotomous role in tumorigenesis is described for the Transforming Growth Factor-beta 1 (TGF-β1). The present study therefore aimed at elucidating whether the switch of Nrf2 function towards a tumor promoting one relates to the modulation of TGF-β1 induced cell responses and whether this might occur early in PDAC development. In situ analysis comprised immunohistochemical stainings of activated (phosphorylated) Nrf2 and Ki67 in pancreatic tissues containing normal ducts and pancreatic intraepithelial neoplasia (PanINs). In vitro, Nrf2 levels in benign (H6c7-pBp), premalignant (H6c7-kras) and malignant (Colo357) pancreatic ductal epithelial cells were modulated by Nrf2 specific siRNA or Nrf2 overexpression. Then, the effect of Nrf2 alone and in combination with TGF-β1 on cell growth and survival was investigated by cell counting, Ki67 staining and apoptosis assays. The underlying cell signaling was investigated by western blotting. Statistical analysis was performed by Shapiro-Wilk test for normal distribution. Parametric data were analyzed by one-way ANOVA, while non-parametric data were analyzed by Kruskal-Wallis one-way ANOVA on ranks. Significantly elevated expression of activated Nrf2 and Ki67 could be detected in PanINs but not in normal pancreatic ductal epithelium. While the effect of Nrf2 on basal cell growth of H6c7-pBp, H6c7-kras and Colo357 cells was minor, it clearly attenuated the growth inhibiting effects of TGF-β1 in all cell lines. This enhanced

  5. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  6. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  7. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  8. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  9. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  10. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  12. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  13. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  14. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  15. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  16. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  17. The novel triterpenoid RTA 408 protects human retinal pigment epithelial cells against H2O2-induced cell injury via NF-E2-related factor 2 (Nrf2 activation

    Directory of Open Access Journals (Sweden)

    Xiaobin Liu

    2016-08-01

    Full Text Available Oxidative stress-induced retinal pigment epithelial (RPE cell damage is an important factor in the pathogenesis of age-related macular degeneration (AMD. Previous studies have shown that RTA 408, a synthetic triterpenoid compound, potently activates Nrf2. This study aimed to investigate the protective effects of RTA 408 in cultured RPE cells during oxidative stress and to determine the effects of RTA 408 on Nrf2 and its downstream target genes. Primary human RPE cells were pretreated with RTA 408 and then incubated in 200 μM H2O2 for 6 h. Cell viability was measured with the WST-8 assay. Apoptosis was quantitatively measured by annexin V/propidium iodide (PI double staining and Hoechst 33342 fluorescent staining. Reduced (GSH and oxidized glutathione (GSSG were measured using colorimetric assays. Nrf2 activation and its downstream effects on phase II enzymes were examined by Western blot. Treatment of RPE cells with nanomolar ranges (10 and 100 nM of RTA 408 markedly attenuated H2O2-induced viability loss and apoptosis. RTA 408 pretreatment significantly protected cells from oxidative stress-induced GSH loss, GSSG formation and decreased ROS production. RTA 408 activated Nrf2 and increased the expression of its downstream genes, such as HO-1, NQO1, SOD2, catalase, Grx1, and Trx1. Consequently, the enzyme activities of NQO1, Grx1, and Trx1 were fully protected by RTA 408 pretreatment under oxidative stress. Moreover, knockdown of Nrf2 by siRNA significantly reduced the cytoprotective effects of RTA 408. In conclusion, our data suggest that RTA 408 protect primary human RPE cells from oxidative stress-induced damage by activating Nrf2 and its downstream genes.

  18. 27 CFR 5.2 - Related regulations.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Related regulations. 5.2 Section 5.2 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS LABELING AND ADVERTISING OF DISTILLED SPIRITS Scope § 5.2 Related regulations...

  19. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  20. Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion

    Directory of Open Access Journals (Sweden)

    Sandra Capellera-Garcia

    2016-06-01

    Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.

  1. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  2. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  3. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  4. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  5. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  6. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  7. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  10. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  11. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  12. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  13. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  14. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  15. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  16. A dominant mutation in the gene encoding the erythroid transcription factor KLF1 causes a congenital dyserythropoietic anemia

    DEFF Research Database (Denmark)

    Arnaud, Lionel; Saison, Carole; Helias, Virginie

    2010-01-01

    The congenital dyserythropoietic anemias (CDAs) are inherited red blood cell disorders whose hallmarks are ineffective erythropoiesis, hemolysis, and morphological abnormalities of erythroblasts in bone marrow. We have identified a missense mutation in KLF1 of patients with a hitherto unclassified...

  17. MeCP2-Related Diseases and Animal Models

    Directory of Open Access Journals (Sweden)

    Chinelo D. Ezeonwuka

    2014-01-01

    Full Text Available The role of epigenetics in human disease has become an area of increased research interest. Collaborative efforts from scientists and clinicians have led to a better understanding of the molecular mechanisms by which epigenetic regulation is involved in the pathogenesis of many human diseases. Several neurological and non-neurological disorders are associated with mutations in genes that encode for epigenetic factors. One of the most studied proteins that impacts human disease and is associated with deregulation of epigenetic processes is Methyl CpG binding protein 2 (MeCP2. MeCP2 is an epigenetic regulator that modulates gene expression by translating epigenetic DNA methylation marks into appropriate cellular responses. In order to highlight the importance of epigenetics to development and disease, we will discuss how MeCP2 emerges as a key epigenetic player in human neurodevelopmental, neurological, and non-neurological disorders. We will review our current knowledge on MeCP2-related diseases, including Rett Syndrome, Angelman Syndrome, Fetal Alcohol Spectrum Disorder, Hirschsprung disease, and Cancer. Additionally, we will briefly discuss about the existing MeCP2 animal models that have been generated for a better understanding of how MeCP2 impacts certain human diseases.

  18. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  19. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  20. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  1. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  2. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  3. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  4. Control of erythropoiesis by erythropoietin and stem cell factor: a novel role for Bruton's tyrosine kinase

    NARCIS (Netherlands)

    von Lindern, Marieke; Schmidt, Uwe; Beug, Hartmut

    2004-01-01

    Erythropoietin (Epo) and stem cell factor (SCF) are essential factors in the control of survival, expansion and differentiation of erythroid progenitors. Upon activation, their receptors, the EpoR and c-Kit, initiate multiple signalling pathways that control many cellular processes. To control

  5. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  6. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  7. ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN

    Directory of Open Access Journals (Sweden)

    Marco Gabbianelli

    2009-11-01

    In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.

  8. An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

    International Nuclear Information System (INIS)

    Evans, T.; Reitman, M.; Felsenfeld, G.

    1988-01-01

    The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

  9. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  10. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  11. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  12. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  13. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  14. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  15. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Marta Pajares

    2017-04-01

    Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  16. Peroxiredoxin 6 expression is inversely correlated with nuclear factor-κB activation during Clonorchis sinensis infestation.

    Science.gov (United States)

    Pak, Jhang Ho; Son, Woo Chan; Seo, Sang-Beom; Hong, Sung-Jong; Sohn, Woon-Mok; Na, Byoung-Kuk; Kim, Tong-Soo

    2016-10-01

    Clonorchis sinensis is a carcinogenic human liver fluke. Its infection promotes persistent oxidative stress and chronic inflammation environments in the bile duct and surrounding liver tissues owing to direct contact with worms and their excretory-secretory products (ESPs), provoking epithelial hyperplasia, periductal fibrosis, and cholangiocarcinogenesis. We examined the reciprocal regulation of two ESP-induced redox-active proteins, NF-κB and peroxiredoxin 6 (Prdx6), during C. sinensis infection. Prdx6 overexpression suppressed intracellular free-radical generation by inhibiting NADPH oxidase2 and inducible nitric oxide synthase activation in the ESP-treated cholangiocarcinoma cells, substantially attenuating NF-κB-mediated inflammation. NF-κB overexpression decreased Prdx6 transcription levels by binding to two κB sites within the promoter. This transcriptional repression was compensated for by other ESP-induced redox-active transcription factors, including erythroid 2-related factor 2 (Nrf2), hypoxia inducible factor 1α (HIF1α), and CCAAT/enhancer-binding protein β (C/EBPβ). Distribution of immunoreactive Prdx6 and NF-κB was distinct in the early stages of infection in mouse livers but shared concomitant localization in the later stages. The intensity and extent of their immunoreactive staining in infected mouse livers are proportional to lesion severity and infection duration. The constitutive elevations of Prdx6 and NF-κB during C. sinensis infection may be associated with more severe persistent hepatobiliary abnormalities mediated by clonorchiasis. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors

    International Nuclear Information System (INIS)

    Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.

    2013-01-01

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage

  18. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  19. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  20. Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease

    DEFF Research Database (Denmark)

    de Zeeuw, Dick; Akizawa, Tadao; Audhya, Paul

    2013-01-01

    Although inhibitors of the renin-angiotensin-aldosterone system can slow the progression of diabetic kidney disease, the residual risk is high. Whether nuclear 1 factor (erythroid-derived 2)-related factor 2 activators further reduce this risk is unknown....

  1. Transcription factors: normal and malignant development of blood cells

    National Research Council Canada - National Science Library

    Ravid, Katya; Licht, Jonathan

    2001-01-01

    ... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...

  2. Bacteroides species produce Vibrio harveyi autoinducer 2-related molecules.

    Science.gov (United States)

    Antunes, Luis Caetano Martha; Ferreira, Lívia Queiroz; Ferreira, Eliane Oliveira; Miranda, Karla Rodrigues; Avelar, Kátia Eliane Santos; Domingues, Regina Maria Cavalcanti Pilotto; Ferreira, Maria Candida de Souza

    2005-10-01

    Quorum sensing is a density-dependent gene regulation mechanism that has been described in many bacterial species in the last decades. Bacteria that use quorum sensing as part of their gene regulation circuits produce molecules called autoinducers that accumulate in the environment and activate target genes in a quorum-dependent way. Some specific clues led us to hypothesize that Bacteroides species can produce autoinducers and possess a quorum sensing system. First, Bacteroides are anaerobic bacteria that are frequently involved in polymicrobial infections. These infections often involve Pseudomonas aeruginosa and Staphylococcus aureus, two of the best understood examples of bacteria that employ quorum sensing systems as part of their pathogenesis. Also, studies have detected the presence of a quorum sensing gene involved in the production of autoinducers in Porphyromonas gingivalis, a species closely related to the Bacteroides genus. These and other evidences prompted us to investigate if Bacteroides strains could produce autoinducer molecules that could be detected by a Vibrio harveyi reporter system. In this paper, we show that supernatants of B. fragilis, B. vulgatus and B. distasonis strains are able to stimulate the V. harveyi quorum sensing system 2. Also, we were able to demonstrate that the stimulation detected is due to the production of autoinducer molecules and not the growth of reporter strains after addition of supernatant. Moreover, the phenomenon observed does not seem to represent the degradation of repressors possibly present in the culture medium used. We could also amplify bands from some of the strains tested using primers designed to the luxS gene of Escherichia coli. Altogether, our results show that B. fragilis, B. vulgatus and B. distasonis (but possibly some other species) can produce V. harveyi autoinducer 2-related molecules. However, the role of such molecules in the biology of these organisms remains unknown.

  3. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response.

    Science.gov (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  4. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2017-01-01

    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  5. Transforming growth factor β-activated kinase 1 negatively regulates interleukin-1α-induced stromal-derived factor-1 expression in vascular smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Bin [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Li, Wei [Department of Gerontology, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Zheng, Qichang [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Qin, Tao [Department of Hepatobiliary Pancreatic Surgery, People' s Hospital of Zhengzhou University, School of Medicine, Zhengzhou University, Zhengzhou 450003 (China); Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Liu, Sanguang, E-mail: sanguang1998@sina.com [Department of Hepatobiliary Surgery, The Second Hospital, Hebei Medical University, Shijiazhuang 050000 (China); Song, Zifang, E-mail: zsong@hust.edu.cn [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China)

    2015-07-17

    Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.

  6. Transforming growth factor β-activated kinase 1 negatively regulates interleukin-1α-induced stromal-derived factor-1 expression in vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Yang, Bin; Li, Wei; Zheng, Qichang; Qin, Tao; Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen; Liu, Sanguang; Song, Zifang

    2015-01-01

    Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation

  7. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  8. GAR22: A novel target gene of thyroid hormone receptor causes growth inhibition in human erythroid cells

    Czech Academy of Sciences Publication Activity Database

    Gamper, I.; Koh, K.-R.; Ruau, D.; Ullrich, K.; Bartůňková, Jana; Piroth, D.; Hacker, C.; Bartůněk, Petr; Zenke, M.

    2009-01-01

    Roč. 37, č. 5 (2009), s. 539-548 ISSN 0301-472X R&D Projects: GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z50520514 Keywords : Thyroid hormone receptor * GAR22 * erythropoiesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.106, year: 2009

  9. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Science.gov (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Detection of trans-acting factors for hemoglobin switching by cell fusions

    International Nuclear Information System (INIS)

    Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.

    1986-01-01

    The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching

  11. Meloxicam elevates serum concentration of Erythropoietin and numbers of bone marrow erythroid progenitor cells in sublethally gamma-irradiated mice

    Czech Academy of Sciences Publication Activity Database

    Hofer, Michal; Pospíšil, Milan; Vacek, Antonín; Znojil, V.; Holá, Jiřina; Štreitová, Denisa

    2009-01-01

    Roč. 78, č. 1 (2009), s. 19-22 ISSN 0001-7213 R&D Projects: GA ČR(CZ) GA305/08/0158; GA AV ČR(CZ) 1QS500040507 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cyclooxygenase-2 inhibition * erythropoiesis * radiation-induced myelosuppression Subject RIV: BO - Biophysics Impact factor: 0.403, year: 2009

  12. Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

    International Nuclear Information System (INIS)

    Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

    1988-01-01

    The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

  13. PAS positivity of erythroid precursor cells is associated with a poor prognosis in newly diagnosed myelodysplastic syndrome patients.

    Science.gov (United States)

    Masuda, Kenta; Shiga, Shuichi; Kawabata, Hiroshi; Takaori-Kondo, Akifumi; Ichiyama, Satoshi; Kamikubo, Yasuhiko

    2018-07-01

    Myelodysplastic syndrome (MDS) is a group of clonal stem cell disorders characterized by hematopoietic insufficiency. The accurate risk stratification of patients with MDS is essential for selection of appropriate therapies. We herein conducted a retrospective cohort study to examine the prognostic value of periodic acid-Schiff (PAS) reaction-positive erythroblasts in MDS patients. We examined the PAS positivity of the bone marrow erythroblasts of 144 patients newly diagnosed with MDS; 26 (18.1%) of them had PAS-positive erythroblasts, whereas 118 (81.9%) did not. The PAS-positive group showed significantly poorer karyotypes as defined in the revised International Prognostic Scoring System (IPSS-R) and higher scores in age-adjusted IPSS-R (IPSS-RA) than the PAS-negative group. Overall survival (OS) and leukemia-free survival (LFS) were also significantly shorter in the PAS-positive group than in the PAS-negative group. Similar results were obtained when only high- and very high risk groups were analyzed using IPSS-RA. This retrospective study suggested that the PAS positivity of erythroblasts is an additional prognostic factor combined with other risk scores for OS and LFS in MDS, and our results may contribute to improved clinical decision-making and rapid risk stratification.

  14. Effects of trigonelline inhibition of the Nrf2 transcription factor in vitro on Echinococcus granulosus.

    Science.gov (United States)

    Qin, Wenjuan; Guan, Dongfang; Ma, Rongji; Yang, Rentan; Xing, Guoqiang; Shi, Hongjuan; Tang, Guangyao; Li, Jiajie; Lv, Hailong; Jiang, Yufeng

    2017-08-01

    The aim of this study was to investigate the impact of trigonelline (TRG) on Echinococcus granulosus, and to explore the inhibition impact of nuclear factor erythroid-2-related factor 2 (Nrf2) signaling pathway on E. granulosus protoscoleces. Echinococcus granulosus protoscoleces were incubated with various concentrations of TRG, and then Nrf2 protein expression and its localization in protoscoleces were detected by western blot analysis and immunofluorescence assay, respectively. Reactive oxygen species (ROS) level in protoscoleces was measured using ROS detection kit. Caspase-3 activity was measured using a caspase-3 activity assay kit, and NAD(P)H quinone oxidoreductase (NQO)-1 and heme oxygenase (HO)-1 activities in protoscoleces were measured by ELISA. The effect of TRG on protoscoleces viability was investigated using 0.1% eosin staining, and ultrastructural alterations in protoscoleces were examined by scanning electron microscopy (SEM). Immunolocalization experiment clearly showed that Nrf2 protein was predominantly present in cells of protoscoleces. TRG treatment reduced NQO-1 and HO-1 activities in protoscoleces, but could increase ROS level at early time. Protoscoleces could not survive when treated with 250 μM TRG for 12 days. SEM results showed that TRG-treated protoscoleces presented damage in the protoscoleces region, including hook deformation, lesions, and digitiform protuberance. Nrf2 protein expression was significantly decreased and caspase-3 activity was clearly increased in protoscoleces treated with TRG for 24 and 48 h, respectively, when compared with that in controls (P granulosus protoscoleces. Nrf2 protein was mainly expressed in the cells and TRG could efficiently inhibit the Nrf2 signaling pathway in E. granulosus. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For

  15. Omeprazole induces NAD(P)H quinone oxidoreductase 1 via aryl hydrocarbon receptor-independent mechanisms: Role of the transcription factor nuclear factor erythroid 2–related factor 2

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Shaojie; Patel, Ananddeep; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu

    2015-11-13

    Activation of the aryl hydrocarbon receptor (AhR) transcriptionally induces phase I (cytochrome P450 (CYP) 1A1) and phase II (NAD(P)H quinone oxidoreductase 1 (NQO1) detoxifying enzymes. The effects of the classical and nonclassical AhR ligands on phase I and II enzymes are well studied in human hepatocytes. Additionally, we observed that the proton pump inhibitor, omeprazole (OM), transcriptionally induces CYP1A1 in the human adenocarcinoma cell line, H441 cells via AhR. Whether OM activates AhR and induces the phase II enzyme, NAD(P)H quinone oxidoreductase 1 (NQO1), in fetal primary human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce NQO1 in HPMEC via the AhR. The concentrations of OM used in our experiments did not result in cytotoxicity. OM activated AhR as evident by increased CYP1A1 mRNA expression. However, contrary to our hypothesis, OM increased NQO1 mRNA and protein via an AhR-independent mechanism as AhR knockdown failed to abrogate OM-mediated increase in NQO1 expression. Interestingly, OM activated Nrf2 as evident by increased phosphoNrf2 (S40) expression in OM-treated compared to vehicle-treated cells. Furthermore, Nrf2 knockdown abrogated OM-mediated increase in NQO1 expression. In conclusion, we provide evidence that OM induces NQO1 via AhR-independent, but Nrf2-dependent mechanisms. - Highlights: • We investigated whether omeprazole induces NQO1 in human fetal lung cells. • Omeprazole induces the phase II enzyme, NQO1, in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of NQO1. • Omeprazole increases phosphoNrf2 (S40) protein expression in human fetal lung cells. • Nrf2 knockdown abrogates the induction of NQO1 by omeprazole in human lung cells.

  16. Evaluation of effects of various drugs on platelet functions using phorbol 12-myristate 13-acetate-induced megakaryocytic human erythroid leukemia cells

    Directory of Open Access Journals (Sweden)

    Tada T

    2016-09-01

    Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited

  17. High Serum Adiponectin Level Is a Risk Factor for Anemia in Japanese Men: A Prospective Observational Study of 1,029 Japanese Subjects.

    Directory of Open Access Journals (Sweden)

    Kei Kohno

    Full Text Available Erythroid abnormalities including anemia and polycythemia are often observed in the general clinical setting. Because recent studies reported that adiponectin negatively affects hematopoiesis, we performed a prospective observational study to assess the relationship between anemia and adiponectin, as well as other parameters, in 1029 Japanese subjects (477 men and 552 women 40 years of age and older. Body measurements, blood tests, and nutrition intake studies were performed at baseline, and 5 to 7 years later (follow-up. Hemoglobin (Hb and hematocrit (Hct levels in men with high serum adiponectin levels were lower at follow-up than at baseline. Multiple regression analysis showed that age, body mass index, adiponectin, and glutamic-pyruvic transaminase were significantly associated with erythroid-related variables (red blood cells, Hb, and Hct in both men and women (P <0.05. In a logistic regression analysis, adiponectin, fasting blood glucose, and β-natriuretic peptide were significant risk factors for anemia in men, and blood urea nitrogen and amylase were significant risk factors in women. Physical features and nutrient intake were not risk factors for anemia. Our study demonstrates, both clinically and epidemiologically, that a high serum adiponectin level decreases the amounts of erythroid-related variables and is a risk factor for anemia in Japanese men.

  18. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  19. Clinical Correlations With Lewy Body Pathology in LRRK2-Related Parkinson Disease

    Science.gov (United States)

    Kalia, Lorraine V.; Lang, Anthony E.; Hazrati, Lili-Naz; Fujioka, Shinsuke; Wszolek, Zbigniew K.; Dickson, Dennis W.; Ross, Owen A.; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Hurtig, Howard I.; Alcalay, Roy N.; Marder, Karen S.; Clark, Lorraine N.; Gaig, Carles; Tolosa, Eduardo; Ruiz-Martínez, Javier; Marti-Masso, Jose F.; Ferrer, Isidre; de Munain, Adolfo López; Goldman, Samuel M.; Schüle, Birgitt; Langston, J. William; Aasly, Jan O.; Giordana, Maria T.; Bonifati, Vincenzo; Puschmann, Andreas; Canesi, Margherita; Pezzoli, Gianni; De Paula, Andre Maues; Hasegawa, Kazuko; Duyckaerts, Charles; Brice, Alexis; Stoessl, A. Jon; Marras, Connie

    2015-01-01

    IMPORTANCE Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of genetic Parkinson disease (PD) known to date. The clinical features of manifesting LRRK2 mutation carriers are generally indistinguishable from those of patients with sporadic PD. However, some PD cases associated with LRRK2 mutations lack Lewy bodies (LBs), a neuropathological hallmark of PD. We investigated whether the presence or absence of LBs correlates with different clinical features in LRRK2-related PD. OBSERVATIONS We describe genetic, clinical, and neuropathological findings of 37 cases of LRRK2-related PD including 33 published and 4 unpublished cases through October 2013. Among the different mutations, the LRRK2 p.G2019S mutation was most frequently associated with LB pathology. Nonmotor features of cognitive impairment/dementia, anxiety, and orthostatic hypotension were correlated with the presence of LBs. In contrast, a primarily motor phenotype was associated with a lack of LBs. CONCLUSIONS AND RELEVANCE To our knowledge, this is the first report of clinicopathological correlations in a series of LRRK2-related PD cases. Findings from this selected group of patients with PD demonstrated that parkinsonian motor features can occur in the absence of LBs. However, LB pathology in LRRK2-related PD may be a marker for a broader parkinsonian symptom complex including cognitive impairment. PMID:25401511

  20. Expansion of phenotype and genotypic data in CRB2-related syndrome.

    Science.gov (United States)

    Lamont, Ryan E; Tan, Wen-Hann; Innes, A Micheil; Parboosingh, Jillian S; Schneidman-Duhovny, Dina; Rajkovic, Aleksandar; Pappas, John; Altschwager, Pablo; DeWard, Stephanie; Fulton, Anne; Gray, Kathryn J; Krall, Max; Mehta, Lakshmi; Rodan, Lance H; Saller, Devereux N; Steele, Deanna; Stein, Deborah; Yatsenko, Svetlana A; Bernier, François P; Slavotinek, Anne M

    2016-10-01

    Sequence variants in CRB2 cause a syndrome with greatly elevated maternal serum alpha-fetoprotein and amniotic fluid alpha-fetoprotein levels, cerebral ventriculomegaly and renal findings similar to Finnish congenital nephrosis. All reported patients have been homozygotes or compound heterozygotes for sequence variants in the Crumbs, Drosophila, Homolog of, 2 (CRB2) genes. Variants affecting CRB2 function have also been identified in four families with steroid resistant nephrotic syndrome, but without any other known systemic findings. We ascertained five, previously unreported individuals with biallelic variants in CRB2 that were predicted to affect function. We compiled the clinical features of reported cases and reviewed available literature for cases with features suggestive of CRB2-related syndrome in order to better understand the phenotypic and genotypic manifestations. Phenotypic analyses showed that ventriculomegaly was a common clinical manifestation (9/11 confirmed cases), in contrast to the original reports, in which patients were ascertained due to renal disease. Two children had minor eye findings and one was diagnosed with a B-cell lymphoma. Further genetic analysis identified one family with two affected siblings who were both heterozygous for a variant in NPHS2 predicted to affect function and separate families with sequence variants in NPHS4 and BBS7 in addition to the CRB2 variants. Our report expands the clinical phenotype of CRB2-related syndrome and establishes ventriculomegaly and hydrocephalus as frequent manifestations. We found additional sequence variants in genes involved in kidney development and ciliopathies in patients with CRB2-related syndrome, suggesting that these variants may modify the phenotype.

  1. Co-occurring Down syndrome and SUCLA2-related mitochondrial depletion syndrome.

    Science.gov (United States)

    Couser, Natario L; Marchuk, Daniel S; Smith, Laurie D; Arreola, Alexandra; Kaiser-Rogers, Kathleen A; Muenzer, Joseph; Pandya, Arti; Gucsavas-Calikoglu, Muge; Powell, Cynthia M

    2017-10-01

    Mitochondrial DNA depletion syndrome 5 (MIM 612073) is a rare autosomal recessive disorder caused by homozygous or compound heterozygous pathogenic variants in the beta subunit of the succinate-CoA ligase gene located within the 13q14 band. We describe two siblings of Hispanic descent with SUCLA2-related mitochondrial depletion syndrome (encephalomyopathic form with methylmalonic aciduria); the older sibling is additionally affected with trisomy 21. SUCLA2 sequencing identified homozygous p.Arg284Cys pathogenic variants in both patients. This mutation has previously been identified in four individuals of Italian and Caucasian descent. The older sibling with concomitant disease has a more severe phenotype than what is typically described in patients with either SUCLA2-related mitochondrial depletion syndrome or Down syndrome alone. The younger sibling, who has a normal female chromosome complement, is significantly less affected compared to her brother. While the clinical and molecular findings have been reported in about 50 patients affected with a deficiency of succinate-CoA ligase caused by pathogenic variants in SUCLA2, this report describes the first known individual affected with both a mitochondrial depletion syndrome and trisomy 21. © 2017 Wiley Periodicals, Inc.

  2. In vitro studies of the sensitivity of canine bone-marrow erythroid burst-forming units (BFU-E) and fibroblast colony-forming units (CFU-F) to X-irradiation

    International Nuclear Information System (INIS)

    Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm

    1989-01-01

    The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)

  3. [SUCLA2-related encephalomyopathic mitochondrial DNA depletion syndrome: a case report and review of literature].

    Science.gov (United States)

    Liu, Zhimei; Fang, Fang; Ding, Changhong; Wu, Husheng; Lyu, Junlan; Wu, Yun

    2014-11-01

    To analyze the clinical characteristics of SUCLA2-related encephalomyopathic mitochondrial DNA depletion syndrome (MDS) in one patient, and review the latest clinical research reports. Clinical, laboratory and genetic data of one case of SUCLA2-related encephalomyopathic MDS diagnosed by department of Neurology, Beijing Children's Hospital in November, 2013 were reported, and through taking "SUCLA2" as key words to search at CNKI, Wanfang, PubMed and the Human Gene Mutation Database (HGMD) professional to date, the clinical characteristics of 24 reported cases of SUCLA2-related encephalomyopathic MDS in international literature in combination with our case were analyzed. (1) The patient was 5 years and 9 months old, born as a term small for gestational age infant whose birth weight was 2 400 g, and presented since birth with severe muscular hypotonia, feeding difficulties, failure to thrive, psychomotor retardation and hearing impairment. Until now, he still showed severe developmental retardation, together with muscular atrophy, thoracocyllosis and scoliosis, and facial features. The patient is the first born from consanguineous healthy parents, whose relationship is cousins. Laboratory tests showed urinary excretion of mild methylmalonic acid (MMA), elevated plasma lactate concentration, and increased C3-carnitine and C4-dicarboxylic-carnitine in plasma carnitine ester profiling. MRI showed brain atrophy-like and bilateral T2 hyperintensities in bilateral caudate nuclei and putamen. By Next-Generation Sequencing (NGS), we identified a novel homozygous missense mutation (c.970G > A) in the SUCLA2 in a highly conserved amino acid residue. (2) The total number was only 25 with a male to female ratio of 14: 11, and age of onset of 23 was 0-4 months. The most common clinical features in patients with SUCLA2 mutation were permanent hypotonia, muscle atrophy, psychomotor retardation and scoliosis or kyphosis. Frequent signs included hearing impairment, hyperkinesia

  4. Isolating a cytoprotective compound from Ganoderma tsugae: effects on induction of Nrf-2-related genes in endothelial cells.

    Science.gov (United States)

    Wei, Yu-Shan; Wung, Being-Sun; Lin, Yuan-Chun; Hsieh, Chia-Wen

    2009-08-01

    Ganoderma tsugae is a medicinal fungus with several biological activities. It has long been used as a folk remedy for the promotion of health and longevity in China and other oriental countries. Here, a bioactive fraction of G. tsugae was progressively purified to be enriched in the activity of cytoprotective enzymes. The highest bioactivity was detected in the 20% EtOH-precipitated fraction, which was prepared from submerged fermentation filtrate of G. tsugae. Following further purification by gel filtration chromatography and acetone extraction, the most bioactive fraction, F5-2, was identified as a peptidoglycan-like compound. Extracts of G. tsugae (F5-2) induced heme oxygenase-1 (HO-1) and thioredoxin reductase-1 (TrxR1) expression in endothelial cells by increasing NF-E2-related factor-2 (Nrf2) nuclear translocation. Pretreatment with F5-2 increased intracellular glutathione (GSH) and protected against H(2)O(2), suggesting that induction of these antioxidant enzymes is important in protection against oxidative stress. Hence the bioactive peptidoglycan-like compound from G. tsugae might protect endothelial cells.

  5. A high-resolution peak fractionation approach for streamlined screening of nuclear-factor-E2-related factor-2 activators in Salvia miltiorrhiza.

    Science.gov (United States)

    Zhang, Hui; Luo, Li-Ping; Song, Hui-Peng; Hao, Hai-Ping; Zhou, Ping; Qi, Lian-Wen; Li, Ping; Chen, Jun

    2014-01-24

    Generation of a high-purity fraction library for efficiently screening active compounds from natural products is challenging because of their chemical diversity and complex matrices. In this work, a strategy combining high-resolution peak fractionation (HRPF) with a cell-based assay was proposed for target screening of bioactive constituents from natural products. In this approach, peak fractionation was conducted under chromatographic conditions optimized for high-resolution separation of the natural product extract. The HRPF approach was automatically performed according to the predefinition of certain peaks based on their retention times from a reference chromatographic profile. The corresponding HRPF database was collected with a parallel mass spectrometer to ensure purity and characterize the structures of compounds in the various fractions. Using this approach, a set of 75 peak fractions on the microgram scale was generated from 4mg of the extract of Salvia miltiorrhiza. After screening by an ARE-luciferase reporter gene assay, 20 diterpene quinones were selected and identified, and 16 of these compounds were reported to possess novel Nrf2 activation activity. Compared with conventional fixed-time interval fractionation, the HRPF approach could significantly improve the efficiency of bioactive compound discovery and facilitate the uncovering of minor active components. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN

    Directory of Open Access Journals (Sweden)

    Ugo Testa

    2009-06-01

    Full Text Available

    In humans the switch from fetal to adult  hemoglobin (HbF→ HbA takes place in the perinatal and postnatal period, determining the progressive replacement of HbF with HbA synthesis ( i.e., the relative HbF content in red blood cells decreases from 80-90% to <1%. In spite of more than twenty years of intensive investigations on this classic model, the molecular mechanisms regulating the Hb switching, as well as HbF synthesis in adults, has been only in part elucidated. In adult life, the residual HbF, restricted to F cell compartment, may be reactivated up to 10-20% of total Hb synthesis in various conditions associated with “stress erythropoiesis”: this reactivation represented until now an interesting model of partial Hb switch reverse with important therapeutic implications in patients with hemoglobinopathies, and particularly in -thalassemia.
    In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF.
    In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.

  7. Flow cytometric detection of growth factor receptors in autografts and analysis of growth factor concentrations in autologous stem cell transplantation: possible significance for platelet recovery

    DEFF Research Database (Denmark)

    Schiødt, I; Jensen, Charlotte Harken; Kjaersgaard, E

    2000-01-01

    In order to improve prediction of hematopoietic recovery, we conducted a pilot study, analyzing the significance of growth factor receptor expression in autografts as well as endogenous growth factor levels in blood before, during and after stem cell transplantation. Three early acting (stem cell......-CSF receptor positive, CD34+ progenitor cells were measured by flow cytometry in the leukapheresis product used for transplantation in a subgroup of 15 patients (NHL, n = 8, MM, n = 7). Three factors were identified as having a significant impact on platelet recovery. First, the level of Tpo in blood...... at the time of the nadir (day +7). Second, the percentage of re-infused thrombopoietin receptor positive progenitors and finally, the percentage of Flt3 receptor positive progenitors. On the other hand, none of the analyzed factors significantly predicted myeloid or erythroid recovery. These findings need...

  8. Progressive transfusion and growth factor independence with adjuvant sertraline in low risk myelodysplastic syndrome treated with an erythropoiesis stimulating agent and granulocyte-colony stimulating factor

    Directory of Open Access Journals (Sweden)

    Kirtan Nautiyal

    2015-01-01

    Full Text Available Refractoriness to growth factor therapy is commonly associated with inferior outcome in patients with low-risk myelodysplastic syndrome (LR-MDS who require treatment for cytopenias. However, the mechanisms leading to refractoriness are unknown. Here we describe a clinically depressed 74-year-old male with refractory cytopenia with multilineage dysplasia (RCMD and documented growth factor refractory anemia after erythropoeisis stimulating agent (ESA therapy, who attained transfusion and growth factor independence after the addition of sertraline to his medication regimen. Our case demonstrates hematological improvement-erythroid (HI-E in growth factor refractory, low risk MDS and highlights a potential mechanistic link between common inflammatory diseases and LR-MDS.

  9. Nucleation of polypropylene crystallization with gold nanoparticles. Part 2: relation between particle morphology and nucleation activity

    Czech Academy of Sciences Publication Activity Database

    Šlouf, Miroslav; Vacková, Taťana; Zhigunov, Alexander; Sikora, Antonín; Piorkowska, E.

    2016-01-01

    Roč. 55, č. 4 (2016), s. 393-410 ISSN 0022-2348 R&D Projects: GA ČR GAP205/10/0348; GA ČR(CZ) GA14-17921S Institutional support: RVO:61389013 Keywords : crystallization * gold nanoparticles * isotactic polyproplylene Subject RIV: JJ - Other Materials Impact factor: 0.828, year: 2016

  10. Mechanism governing heme synthesis reveals a GATA factor/heme circuit that controls differentiation.

    Science.gov (United States)

    Tanimura, Nobuyuki; Miller, Eli; Igarashi, Kazuhiko; Yang, David; Burstyn, Judith N; Dewey, Colin N; Bresnick, Emery H

    2016-02-01

    Metal ion-containing macromolecules have fundamental roles in essentially all biological processes throughout the evolutionary tree. For example, iron-containing heme is a cofactor in enzyme catalysis and electron transfer and an essential hemoglobin constituent. To meet the intense demand for hemoglobin assembly in red blood cells, the cell type-specific factor GATA-1 activates transcription of Alas2, encoding the rate-limiting enzyme in heme biosynthesis, 5-aminolevulinic acid synthase-2 (ALAS-2). Using genetic editing to unravel mechanisms governing heme biosynthesis, we discovered a GATA factor- and heme-dependent circuit that establishes the erythroid cell transcriptome. CRISPR/Cas9-mediated ablation of two Alas2 intronic cis elements strongly reduces GATA-1-induced Alas2 transcription, heme biosynthesis, and surprisingly, GATA-1 regulation of other vital constituents of the erythroid cell transcriptome. Bypassing ALAS-2 function in Alas2 cis element-mutant cells by providing its catalytic product 5-aminolevulinic acid rescues heme biosynthesis and the GATA-1-dependent genetic network. Heme amplifies GATA-1 function by downregulating the heme-sensing transcriptional repressor Bach1 and via a Bach1-insensitive mechanism. Through this dual mechanism, heme and a master regulator collaborate to orchestrate a cell type-specific transcriptional program that promotes cellular differentiation. © 2015 The Authors.

  11. Characterization of transcription factor networks involved in umbilical cord blood CD34+ stem cells-derived erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Biaoru Li

    Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34

  12. Microsecond molecular dynamics simulations of intrinsically disordered proteins involved in the oxidative stress response

    NARCIS (Netherlands)

    Cino, E.A.; Wong-ekkabut, J.; Karttunen, M.E.J.; Choy, W.-Y.

    2011-01-01

    Intrinsically disordered proteins (IDPs) are abundant in cells and have central roles in protein-protein interaction networks. Interactions between the IDP Prothymosin alpha (ProTa) and the Neh2 domain of Nuclear factor erythroid 2-related factor 2 (Nrf2), with a common binding partner, Kelch-like

  13. Baseline characteristics in the Bardoxolone methyl EvAluation in patients with Chronic kidney disease and type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Lambers Heerspink, Hiddo J; Chertow, Glenn M; Akizawa, Tadao

    2013-01-01

    Type 2 diabetes mellitus (T2DM) is the most important contributing cause of end-stage renal disease (ESRD) worldwide. Bardoxolone methyl, a nuclear factor-erythroid-2-related factor 2 activator, augments estimated glomerular filtration. The Bardoxolone methyl EvAluation in patients with Chronic...

  14. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators.

    Science.gov (United States)

    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane

    2016-11-10

    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  15. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. An evaluation of factors affecting the in vitro bioassay for erythropoietin

    International Nuclear Information System (INIS)

    Dunn, C.D.R.; Napier, J.A.F.

    1975-01-01

    Two main aspects of the in vitro mouse foetal liver cell assay for erythroid stimulating factor (ESF) in human sera have been investigated. The haem extraction process has been shown to give specific and quantitative recovery of 59 Fe labelled haem from haemoglobin thus confirming that the material assayed in human sera is stimulating the synthesis of this protein. The extraction procedure can be simplified considerably by prior mixing of the reagents without significantly influencing the results. Several serum constituents (citrate, testosterone, B 12 , folic acid and iron) have been investigated over a range of concentrations for possible effects on the cultures. Generally only small effects on haem synthesis were observed. It is concluded that variations in the levels of these factors in sera from treated patients will not produce any significant alterations in the estimated ESF concentrations. (author)

  17. EL2-related defects in neutron irradiated GaAs1/sub -x/P/sub x/ alloys

    International Nuclear Information System (INIS)

    Munoz, E.; Garcia, F.; Jimenez, B.; Calleja, E.; Gomez, A.; Alcober, V.

    1985-01-01

    The generation of EL2-related defects in GaAsP alloys by fast neutron irradiation has been studied through deep level transient spectroscopy and photocapacitance techniques. After irradiation p-n junctions were not annealed at high temperatures. In the composition range x>0.4, fast neutrons generate a broad center at E/sub c/-0.7 eV that it is suggested to belong to the EL2 family. The presence of photocapacitance quenching effects has been taken as a preliminary fingerprint to make the above assignment. From computer analysis of the nonexponential transient capacitance waveforms, evidence that neutron irradiation creates a family of midgap levels, EL2-related, is found

  18. Discerning the Mauve Factor, Part 1.

    Science.gov (United States)

    McGinnis, Woody R; Audhya, Tapan; Walsh, William J; Jackson, James A; McLaren-Howard, John; Lewis, Allen; Lauda, Peter H; Bibus, Douglas M; Jurnak, Frances; Lietha, Roman; Hoffer, Abram

    2008-01-01

    "Mauve Factor" was once mistaken for kryptopyrrole but is the hydroxylactam of hemopyrrole, hydroxyhemopyrrolin-2-one (HPL). Treatment with nutrients--particularly vitamin B6 and zinc--reduces urinary excretion of HPL and improves diverse neurobehavioral symptoms in subjects with elevated urinary HPL. Heightened HPL excretion classically associates with emotional stress, which in turn is known to associate with oxidative stress. For this review, markers for nutritional status and for oxidative stress were examined in relationship to urinary HPL. In cohorts with mixed diagnoses, 24-hour urinary HPL correlated negatively with vitamin B6 activity and zinc concentration in red cells (P stress. HPL is known to cause non-erythroid heme depression, which lowers zinc, increases nitric oxide, and increases oxidative stress. Administration of prednisone reportedly provoked HPL excretion in animals. Since adrenocorticoid (and catecholamine) stress hormones mediate intestinal permeability, urinary HPL examined in relationship to urinary indicans, presumptive marker for intestinal permeability. Urinary HPL associated with higher levels of indicans (P role in production. Potentially, gut is a reservoir for HPL or its precursor, and stress-related changes in intestinal permeability mediate systemic and urinary concentrations.

  19. Discerning the Mauve factor, Part 2.

    Science.gov (United States)

    McGinnis, Woody R; Audhya, Tapan; Walsh, William J; Jackson, James A; McLaren-Howard, John; Lewis, Allen; Lauda, Peter H; Bibus, Douglas M; Jurnak, Frances; Lietha, Roman; Hoffer, Abram

    2008-01-01

    "Mauve Factor" was once mistaken for kryptopyrrole but is the hydroxylactam of hemopyrrole, hydroxyhemopyrrolin-2-one (HPL). Treatment with nutrients--particularly vitamin B6 and zinc--reduces urinary excretion of HPL and improves diverse neurobehavioral symptoms in subjects with elevated urinary HPL. Heightened HPL excretion classically associates with emotional stress, which in turn is known to associate with oxidative stress. For this review, markers for nutritional status and for oxidative stress were examined in relationship to urinary HPL. In cohorts with mixed diagnoses, 24-hour urinary HPL correlated negatively with vitamin B6 activity and zinc concentration in red cells (P stress. HPL is known to cause non-erythroid heme depression, which lowers zinc, increases nitric oxide, and increases oxidative stress. Administration of prednisone reportedly provoked HPL excretion in animals. Since adrenocorticoid (and catecholamine) stress hormones mediate intestinal permeability, urinary HPL was examined in relationship to urinary indicans, presumptive marker for intestinal permeability. Urinary HPL associated with higher levels ofindicans (P role in production. Potentially, gut is reservoir for HPL or its precursor, and stress-related changes in intestinal permeability mediate systemic and urinary concentrations.

  20. Repair of rabbit radial bone defects using true bone ceramics combined with BMP-2-related peptide and type I collagen

    International Nuclear Information System (INIS)

    Li Jingfeng; Lin Zhenyu; Zheng Qixin; Guo Xiaodong; Lan Shenghui; Liu Sunan; Yang Shuhua

    2010-01-01

    An ideal bone graft material is the one characterized with good biocompatibility, biodegradation, osteoconductivity and osteoinductivity. In this study, a novel synthetic BMP-2-related peptide (designated P24) corresponding to residues of the knuckle epitope of BMP-2 was introduced into a biomimetic scaffold based on sintered bovine bone or true bone ceramics (TBC) and type I collagen (TBC/collagen I) using a simulated body fluid (SBF). Hydroxylapatite crystal mineralization with a Ca/P molar ratio of 1.63 was observed on the surface of P24/TBC/collagen I composite by scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX) and X-ray diffraction (XRD) techniques. Cell adhesion rate evaluation of bone marrow stromal cells (BMSCs) seeded on materials in vitro showed that the percentage of cells attached to P24/TBC/collagen I composite was significantly higher than that of the TBC/collagen I composite. A 10 mm unilateral segmental bone defect was created in the radius of New Zealand white rabbits and randomly implanted with three groups of biomaterials (Group A: P24/TBC/collagen I composite; Group B: TBC/collagen I composite and Group C: TBC alone). Based on radiographic evaluation and histological examination, the implants of P24/TBC/collagen I composite significantly stimulated bone growth, thereby confirming the enhanced rate of bone healing compared with that of TBC/collagen I composite and TBC alone. It was concluded that BMP-2-related peptide P24 could induce nucleation of calcium phosphate crystals on the surface of TBC/collagen I composite. The TBC/collagen I composite loaded with the synthetic BMP-2-related peptide is a promising scaffold biomaterial for bone tissue engineering.

  1. The C-terminal domain of Nrf1 negatively regulates the full-length CNC-bZIP factor and its shorter isoform LCR-F1/Nrf1β; both are also inhibited by the small dominant-negative Nrf1γ/δ isoforms that down-regulate ARE-battery gene expression.

    Science.gov (United States)

    Zhang, Yiguo; Qiu, Lu; Li, Shaojun; Xiang, Yuancai; Chen, Jiayu; Ren, Yonggang

    2014-01-01

    The C-terminal domain (CTD, aa 686-741) of nuclear factor-erythroid 2 p45-related factor 1 (Nrf1) shares 53% amino acid sequence identity with the equivalent Neh3 domain of Nrf2, a homologous transcription factor. The Neh3 positively regulates Nrf2, but whether the Neh3-like (Neh3L) CTD of Nrf1 has a similar role in regulating Nrf1-target gene expression is unknown. Herein, we report that CTD negatively regulates the full-length Nrf1 (i.e. 120-kDa glycoprotein and 95-kDa deglycoprotein) and its shorter isoform LCR-F1/Nrf1β (55-kDa). Attachment of its CTD-adjoining 112-aa to the C-terminus of Nrf2 yields the chimaeric Nrf2-C112Nrf1 factor with a markedly decreased activity. Live-cell imaging of GFP-CTD reveals that the extra-nuclear portion of the fusion protein is allowed to associate with the endoplasmic reticulum (ER) membrane through the amphipathic Neh3L region of Nrf1 and its basic c-tail. Thus removal of either the entire CTD or the essential Neh3L portion within CTD from Nrf1, LCR-F1/Nrf1β and Nrf2-C112Nrf1, results in an increase in their transcriptional ability to regulate antioxidant response element (ARE)-driven reporter genes. Further examinations unravel that two smaller isoforms, 36-kDa Nrf1γ and 25-kDa Nrf1δ, act as dominant-negative inhibitors to compete against Nrf1, LCR-F1/Nrf1β and Nrf2. Relative to Nrf1, LCR-F1/Nrf1β is a weak activator, that is positively regulated by its Asn/Ser/Thr-rich (NST) domain and acidic domain 2 (AD2). Like AD1 of Nrf1, both AD2 and NST domain of LCR-F1/Nrf1β fused within two different chimaeric contexts to yield Gal4D:Nrf1β607 and Nrf1β:C270Nrf2, positively regulate their transactivation activity of cognate Gal4- and Nrf2-target reporter genes. More importantly, differential expression of endogenous ARE-battery genes is attributable to up-regulation by Nrf1 and LCR-F1/Nrf1β and down-regulation by Nrf1γ and Nrf1δ.

  2. Molecular analysis of the interaction between the hematopoietic master transcription factors GATA-1 and PU.1

    DEFF Research Database (Denmark)

    Liew, Chu Wai; Rand, Kasper Dyrberg; Simpson, Raina J Y

    2006-01-01

    GATA-1 and PU.1 are transcription factors that control erythroid and myeloid development, respectively. The two proteins have been shown to function in an antagonistic fashion, with GATA-1 repressing PU.1 activity during erythropoiesis and PU.1 repressing GATA-1 function during myelopoiesis. It has...... also become clear that this functional antagonism involves direct interactions between the two proteins. However, the molecular basis for these interactions is not known, and a number of inconsistencies exist in the literature. We have used a range of biophysical methods to define the molecular details...... of the GATA-1-PU.1 interaction. A combination of NMR titration data and extensive mutagenesis revealed that the PU.1-Ets domain and the GATA-1 C-terminal zinc finger (CF) form a low affinity interaction in which specific regions of each protein are implicated. Surprisingly, the interaction cannot be disrupted...

  3. A casein-kinase-2-related protein kinase is tightly associated with the large T antigen of simian virus 40

    DEFF Research Database (Denmark)

    Götz, C; Koenig, M G; Issinger, O G

    1995-01-01

    by the addition of protein kinase CK2 suggest that at least one of the T-antigen-associated protein kinases is CK2 or a protein-kinase-CK2-related enzyme. The association of recombinant CK2 with T antigen was strongly confirmed by in vitro binding studies. Experiments with temperature-sensitive SV40-transformed......The simian virus 40 (SV40) large T antigen is a multifunctional protein involved in SV40 cell transformation and lytic virus infection. Some of its activities are regulated by interaction with cellular proteins and/or by phosphorylation of T antigen by various protein kinases. In this study, we...... show that immuno-purified T antigen from SV40-transformed cells and from baculovirus-infected insect cells is tightly associated with a protein kinase that phosphorylates T antigen in vitro. In the presence of heparin or a peptide resembling a protein kinase CK2 recognition site, the phosphorylation...

  4. Gene disruptions indicate an essential function for the LmmCRK1 cdc2-related kinase of Leishmania mexicana.

    Science.gov (United States)

    Mottram, J C; McCready, B P; Brown, K G; Grant, K M

    1996-11-01

    The generation of homozygous null mutants for the crk1 Cdc2-Related Kinase of Leishmania mexicana was attempted using targeted gene disruption. Promastigote mutants heterozygous for crk1 were readily isolated with a hyg-targeting fragment, but attempts to create null mutants by second-round transfections with a bie-targeting fragment yielded two classes of mutant, neither of which was null. First, the transfected fragment formed an episome; second, the cloned transfectants were found to contain wild-type crk1 alleles as well as hyg and ble integrations. DNA-content analysis revealed that these mutants were triploid or tetraploid. Plasticity in chromosome number following targeting has been proposed as a means by which Leishmania avoids deletion of essential genes. These data support this theory and implicate crk1 as an essential gene, validating CRK1 as a potential drug target. L mexicana transfected with a Trypanosoma brucel homologue, tbcrk1, was shown to be viable in an immcrk1 null background, thus showing complementation of function between these trypanosomatid genes. The expression of crk1 was further manipulated by engineering a six-histidine tag at the C-terminus of the kinase, allowing purification of the active complex by affinity selection on Nl(2+)-nitriloacetic acid (NTA) agarose.

  5. Evaluation of Th1/Th2-Related Immune Response against Recombinant Proteins of Brucella abortus Infection in Mice.

    Science.gov (United States)

    Im, Young Bin; Park, Woo Bin; Jung, Myunghwan; Kim, Suk; Yoo, Han Sang

    2016-06-28

    Brucellosis is a zoonotic disease caused by Brucella, a genus of gram-negative bacteria. Cytokines have key roles in the activation of innate and acquired immunities. Despite several research attempts to reveal the immune responses, the mechanism of Brucella infection remains unclear. Therefore, immune responses were analyzed in mice immunized with nine recombinant proteins. Cytokine production profiles were analyzed in the RAW 264.7 cells and naive splenocytes after stimulation with three recombinant proteins, metal-dependent hydrolase (r0628), bacterioferritin (rBfr), and thiamine transporter substrate-binding protein (rTbpA). Immune responses were analyzed by ELISA and ELISpot assay after immunization with proteins in mice. The production levels of NO, TNF-α, and IL-6 were time-dependently increased after having been stimulated with proteins in the RAW 264.7 cells. In naive splenocytes, the production of IFN-γ and IL-2 was increased after stimulation with the proteins. It was concluded that two recombinant proteins, r0628 and rTbpA, showed strong immunogenicity that was induced with Th1-related cytokines IFN-γ, IL-2, and TNF-α more than Th2-related cytokines IL-6, IL-4, and IL-5 in vitro. Conversely, a humoral immune response was activated by increasing the number of antigen-secreting cells specifically. Furthermore, these could be candidate diagnosis antigens for better understanding of brucellosis.

  6. The mitochondrial SIR2 related protein 2 (SIR2RP2 impacts Leishmania donovani growth and infectivity.

    Directory of Open Access Journals (Sweden)

    Nimisha Mittal

    2017-05-01

    Full Text Available Leishmania donovani, a protozoan parasite is the major causative agent of visceral leishmaniasis. Increased toxicity and resistance to the existing repertoire of drugs has been reported. Hence, an urgent need exists for identifying newer drugs and drug targets. Previous reports have shown sirtuins (Silent Information Regulator from kinetoplastids as promising drug targets. Leishmania species code for three SIR2 (Silent Information Regulator related proteins. Here, we for the first time report the functional characterization of SIR2 related protein 2 (SIR2RP2 of L. donovani.Recombinant L. donovani SIR2RP2 was expressed in E. coli and purified. The enzymatic functions of SIR2RP2 were determined. The subcellular localization of LdSIR2RP2 was done by constructing C-terminal GFP-tagged full-length LdSIR2RP2. Deletion mutants of LdSIR2RP2 were generated in Leishmania by double targeted gene replacement methodology. These null mutants were tested for their proliferation, virulence, cell cycle defects, mitochondrial functioning and sensitivity to known SIR2 inhibitors.Our data suggests that LdSIR2RP2 possesses NAD+-dependent ADP-ribosyltransferase activity. However, NAD+-dependent deacetylase and desuccinylase activities were not detected. The protein localises to the mitochondrion of the promastigotes. Gene deletion studies showed that ΔLdSIR2RP2 null mutants had restrictive growth phenotype associated with accumulation of cells in the G2/M phase and compromised mitochondrial functioning. The null mutants had attenuated infectivity. Deletion of LdSIR2RP2 resulted in increased sensitivity of the parasites to the known SIR2 inhibitors. The sirtuin inhibitors inhibited the ADP-ribosyltransferase activity of recombinant LdSIR2RP2. In conclusion, sirtuins could be used as potential new drug targets for visceral leishmaniasis.

  7. Increasing the effectiveness of hematopoiesis in myelodysplastic syndromes: erythropoiesis-stimulating agents and transforming growth factor-β superfamily inhibitors.

    Science.gov (United States)

    Mies, Anna; Platzbecker, Uwe

    2017-07-01

    Patients with lower-risk myelodysplastic syndromes (MDS) are mainly affected by chronic anemia and fatigue. Treatment strategies aim to improve anemia and quality of life, as well as iron overload due to red blood cell transfusion support. To promote proliferation and differentiation of erythropoiesis, erythropoiesis-stimulating agents (ESAs) such as erythropoietin (EPO) and mimetics are applied as first-line therapy in a large fraction of lower-risk MDS patients. In general, ESAs yield favorable responses in about half of the patients, although responses are often short-lived. In fact, many ESA-refractory patients harbor defects in late-stage erythropoiesis downstream of EPO action. Novel transforming growth factor (TGF)-β superfamily inhibitors sotatercept and luspatercept represent a promising approach to alleviate anemia by stimulating erythroid differentiation. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Physiological Actions of Fibroblast Growth Factor-23

    Directory of Open Access Journals (Sweden)

    Reinhold G. Erben

    2018-05-01

    Full Text Available Fibroblast growth factor-23 (FGF23 is a bone-derived hormone suppressing phosphate reabsorption and vitamin D hormone synthesis in the kidney. At physiological concentrations of the hormone, the endocrine actions of FGF23 in the kidney are αKlotho-dependent, because high-affinity binding of FGF23 to FGF receptors requires the presence of the co-receptor αKlotho on target cells. It is well established that excessive concentrations of intact FGF23 in the blood lead to phosphate wasting in patients with normal kidney function. Based on the importance of diseases associated with gain of FGF23 function such as phosphate-wasting diseases and chronic kidney disease, a large body of literature has focused on the pathophysiological consequences of FGF23 excess. Less emphasis has been put on the role of FGF23 in normal physiology. Nevertheless, during recent years, lessons we have learned from loss-of-function models have shown that besides the paramount physiological roles of FGF23 in the control of 1α-hydroxylase expression and of apical membrane expression of sodium-phosphate co-transporters in proximal renal tubules, FGF23 also is an important stimulator of calcium and sodium reabsorption in distal renal tubules. In addition, there is an emerging role of FGF23 as an auto-/paracrine regulator of alkaline phosphatase expression and mineralization in bone. In contrast to the renal actions of FGF23, the FGF23-mediated suppression of alkaline phosphatase in bone is αKlotho-independent. Moreover, FGF23 may be a physiological suppressor of differentiation of hematopoietic stem cells into the erythroid lineage in the bone microenvironment. At present, there is little evidence for a physiological role of FGF23 in organs other than kidney and bone. The purpose of this mini-review is to highlight the current knowledge about the complex physiological functions of FGF23.

  9. Bone induction through controlled release of novel BMP-2-related peptide from PTMC11-F127-PTMC11 hydrogels

    International Nuclear Information System (INIS)

    Tang Shuo; Li Jingfeng; Teng Yu; Guo Xiaodong; Zhao Jingjing; Xu Shuyun; Quan Daping

    2012-01-01

    Bone morphogenetic protein 2 (BMP-2) is the most powerful osteogenic factor; its effectiveness in enhancing osteoblastic activation has been confirmed both in vitro and in vivo. We developed a novel peptide (designated P24) derived from the ‘knuckle’ epitope of BMP-2 and found it also had osteogenic bioactivity to some extent. The main objective of this study was to develop a controlled release system based on poly(trimethylene carbonate)–F127–poly(trimethylene carbonate) (PTMC 11 -F127-PTMC 11 ) hydrogels for the P24 peptide, to promote bone formation. By varying the copolymer concentrations, we demonstrated that P24/PTMC 11 -F127-PTMC 11 hydrogels were an efficient system for the sustained release of P24 over 21–35 days. The P24-loaded hydrogels elevated alkaline phosphatase activity and promoted the expression of osteocalcin mRNA in bone marrow stromal cells (BMSCs) in vitro. Radiographic and histological examination showed that P24-loaded hydrogels could induce more effective ectopic bone formation in vivo than P24-free hydrogels. These results indicate that the PTMC 11 -F127-PTMC 11 hydrogel is a suitable carrier for the controlled release of P24, and is a promising injectable biomaterial for the induction of bone regeneration. (paper)

  10. Risk Factors

    Science.gov (United States)

    ... cells do not invade nearby tissues or spread. Risk Factors Key Points Factors That are Known to ... chemicals . Factors That are Known to Increase the Risk of Cancer Cigarette Smoking and Tobacco Use Tobacco ...

  11. DNA Methylation as an Epigenetic Factor in the Development and Progression of Polycythemia Vera

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2007-01-01

    Polycythemia vera (PV) is the most common myeloproliferative disorder with a yearly incidence of 28 per 1 million people and a slightly higher prevalence in males PV is characterized by clonal expansion of erythroid...

  12. Factor XII (Hageman factor) deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000545.htm Factor XII (Hageman factor) deficiency To use the sharing features on this ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  13. Myelodysplastic syndromes: histopathology as prognostic factor

    Directory of Open Access Journals (Sweden)

    Romeo Maura

    2001-01-01

    Full Text Available Bone marrow biopsy allows evaluation of cellularity, abnormal localization of immature precursors and fibrosis in myelodysplastic syndrome. It has been considered important to make diagnosis and prognosis of this disorder. The object of this study evaluated the influence of histopathological parameters, such as cellularity, erythroid/myeloid ratio, abnormal localization of immature precursors and marrow fibrosis, on survival of myelodysplastic syndrome patients. Forty-six patients, admitted from April 1985 to June 1998, and diagnosed as being myelodysplastic syndrome according to French-American-British criteria, were selected. There were 20 males and 26 females, with median age of 61 years. Forty-six bone marrow smears and 36 trephine biopsies were reviewed. Mean survival of hypocellular cases was 64.8 months and of hyper and normocellular cases was 31.8 months. Patients with predominance of erythroid hyperplasia had mean survival of 50.8 months, greater than those with predominance of myeloid hyperplasia (20.3 months. There was no statistical difference in survival of patients with or without abnormal localization of immature precursors and with or without marrow fibrosis. Bone marrow biopsy is a useful tool for the identification of parameters that influence prognosis in myelodysplastic syndrome. Hypocellularity and erythroid hyperplasia were correlated with longer survival while myeloid hyperplasia with poorer survival.

  14. Studies of the erythroid inductive microenvironment in vitro

    International Nuclear Information System (INIS)

    van Zant, G.; Goldwasser, E.; Pech, N.

    1977-01-01

    Spleen cells from radiated mice (XS), but not from normal mice (NS), when combined with mouse marrow cells in vitro, had two effects on hemoglobin synthesis: (1) increased baseline, and (2) augmented erythropoietin-induced, hemoglobin formation. Spleen cells from normal and radiated rats caused increased hemoglobin synthesis by rat marrow cells in a dose-dependent manner. In addition, lung and thymus cells from radiated rats, but not from normal rats, caused increased hemoglobin synthesis by rat marrow cells. Rat NS augmented hemoglobin formation by mouse marrow, but neither mouse NS nor mouse XS had an effect on rat marrow. Medium from rat NS cultures stimulated hemoglobin synthesis when added to rat marrow cells. The increases in baseline, and in the response to erythropoietin, were dependent on the amount of ''conditioned medium.'' The substance in the medium responsible for these effects was not erythropoietin

  15. Robust factorization

    DEFF Research Database (Denmark)

    Aanæs, Henrik; Fisker, Rune; Åström, Kalle

    2002-01-01

    Factorization algorithms for recovering structure and motion from an image stream have many advantages, but they usually require a set of well-tracked features. Such a set is in generally not available in practical applications. There is thus a need for making factorization algorithms deal effect...

  16. Organizational factors

    International Nuclear Information System (INIS)

    Holy, J.

    1999-12-01

    The following organizational factors are considered with respect to the human factor and operating safety of nuclear power plants: external influences; objectives and strategy; positions and ways of management; allocation of resources; working with human resources; operators' training; coordination of work; knowledge of organization and management; proceduralization of the topic; labour organizing culture; self-improvement system; and communication. (P.A.)

  17. El factoring

    Directory of Open Access Journals (Sweden)

    Alberto Rosenthal

    1988-04-01

    Full Text Available RESUMEN El artículo  presenta, una conceptualización general de lo que es el factoring, el origen del mismo, su evolución y hace una clasificación de los distintos tipos de factoring.

  18. Expression of the Grb2-related protein of the lymphoid system in B cell subsets enhances B cell antigen receptor signaling through mitogen-activated protein kinase pathways.

    Science.gov (United States)

    Yankee, Thomas M; Solow, Sasha A; Draves, Kevin D; Clark, Edward A

    2003-01-01

    Adapter proteins play a critical role in regulating signals triggered by Ag receptor cross-linking. These small molecules link receptor proximal events with downstream signaling pathways. In this study, we explore the expression and function of the Grb2-related protein of the lymphoid system (GrpL)/Grb2-related adaptor downstream of Shc adapter protein in human B cells. GrpL is expressed in naive B cells and is down-regulated following B cell Ag receptor ligation. By contrast, germinal center and memory B cells express little or no GrpL. Using human B cell lines, we detected constitutive interactions between GrpL and B cell linker protein, Src homology (SH)2 domain-containing leukocyte protein of 76 kDa, hemopoietic progenitor kinase 1, and c-Cbl. The N-terminal SH3 domain of GrpL binds c-Cbl while the C-terminal SH3 domain binds B cell linker protein and SH2 domain-containing leukocyte protein of 76 kDa. Exogenous expression of GrpL in a GrpL-negative B cell line leads to enhanced Ag receptor-induced extracellular signal-related kinase and p38 mitogen-activated protein kinase phosphorylation. Thus, GrpL expression in human B cell subsets appears to regulate Ag receptor-mediated signaling events.

  19. The effects of Mucuna pruriens on the renal oxidative stress and transcription factors in high-fructose-fed rats.

    Science.gov (United States)

    Ulu, Ramazan; Gozel, Nevzat; Tuzcu, Mehmet; Orhan, Cemal; Yiğit, İrem Pembegül; Dogukan, Ayhan; Telceken, Hafize; Üçer, Özlem; Kemeç, Zeki; Kaman, Dilara; Juturu, Vijaya; Sahin, Kazim

    2018-05-31

    In the present study, we evaluated the effects of M. pruriens administration on metabolic parameters, oxidative stress and kidney nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) signaling pathways in high-fructose fed rats. Male rats (n = 28) were divided into 4 groups as control, M. pruriens, fructose, and M. pruriens plus fructose. All rats were fed a standard diet supplemented or no supplemented with M. pruriens (200 mg/kg/d by gavage). Fructose was given in drinking water for 8 weeks. High fructose consumption led to an increase in the serum level of glucose, triglyceride, urea and renal malondialdehyde (MDA) levels. Although M. pruriens treatment reduced triglyceride and MDA levels, it did not affect other parameters. M. pruriens supplementation significantly decreased the expression of NF-ҡB and decreased expression of Nrf2 and HO-1 proteins in the kidney. This study showed that the adverse effects of high fructose were alleviated by M. pruriens supplementation via modulation of the expression of kidney nuclear transcription factors in rats fed high fructose diet. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. El factoring

    Directory of Open Access Journals (Sweden)

    Alberto Rosenthal

    2015-04-01

    Full Text Available RESUMEN Se presenta la segunda parte del artículo aparecido en  el número 6 de la revista EAN. Su contenido es complementario a lo expuesto en dicho número, en está aparecen las ventajas del factoring, conveniencias, limitaciones así como la forma  de efectuar un factor en Colombia,  su necesidad, incidencia económica, etc.

  1. Quality factors

    International Nuclear Information System (INIS)

    Kerr, G.D.

    1986-01-01

    The quality factor, Q, is a dimensionless modifier used in converting absorbed dose, expressed in rads (or grays), to dose equivalent, expressed in rems (or seiverts). The dose equivalent is used in radiation protection to account for the biological effectiveness of different kinds of radiation. The quality factor is related to both the linear energy transfer (LET) and relative biological effectiveness (RBE). The RBE's obtained from biological experiments depend in a complex way on the observed biological effect, the specific test organism, and the experimental conditions. Judgement is involved, therefore, in the choice of the quality factor. Questions regarding the adequacy of current Q values for neutrons were raised first in a 1980 statement by the National Council on Radiation Protection (NCRP) and later in a 1985 statement by the International Commission on Radiological Protection (ICRP). In 1980, the NCRP alerted the technical community to possible future increases between a factor of three and ten in the Q for neutrons, and in 1985, the ICRP suggested an increase by a factor of two in Q for neutrons. Both the ICRP and NRCP are now recommending essentially the same guidance with regard to Q for neutrons: an increase by a factor of two. The Q for neutrons is based on a large, albeit unfocused, body of experimental data. In spite of the lack of focus, the data supporting a change in the neutron quality factor are substantial. However, the proposed doubling of Q for neutrons is clouded by other issues regarding its application. 33 refs., 4 figs., 6 tabs

  2. Constructing TC-1-GLUC-LMP2 Model Tumor Cells to Evaluate the Anti-Tumor Effects of LMP2-Related Vaccines

    Science.gov (United States)

    Sun, Liying; Hao, Yanzhe; Wang, Zhan; Zeng, Yi

    2018-01-01

    Epstein-Barr virus (EBV) is related to a variety of malignant tumors, and its encoded protein, latent membrane protein 2 (LMP2), is an effective target antigen that is widely used to construct vector vaccines. However, the model cells carrying LMP2 have still not been established to assess the oncolytic effect of LMP2-related vaccines at present. In this study, TC-1-GLUC-LMP2 tumor cells were constructed as target cells to evaluate the anti-tumor effects of LMP2-assosiated vaccines. The results showed that both LMP2 and Gaussia luciferase (GLuc) genes could be detected by polymerase chain reaction (PCR) and reverse transcription-polymerase chain reaction (RT-PCR) in TC-1-GLUC-LMP2 cells. Western blot results showed that the LMP2 and Gaussia luciferase proteins were stably expressed in tumor cells for at least 30 generations. We mixed 5 × 104 LMP2-specific mouse splenic lymphocytes with 5 × 103 TC-1-GLUC-LMP2 target cells and found that the target cells were killed as the specific killing effect was obviously enhanced by the increased quantities of LMP2-peptide stimulated spleens. Furthermore, the tumor cells could not be observed in the mice inoculated TC-1-GLUC-LMP2 cells after being immunized with vaccine-LMP2, while the vaccine-NULL immunized mice showed that tumor volume gradually grew with increased inoculation time. These results indicated that the TC-1-GLUC-LMP2 cells stably expressing LMP2 and GLuc produced tumors in mice, and that the LMP2-specific cytotoxic T lymphocyte (CTL) effectively killed the cells in vitro and in vivo, suggesting that TC-1-GLUC-LMP2 cells can be used as model cells to assess the immune and antitumor effects of LMP2-related vaccines. PMID:29570629

  3. H4 histamine receptors mediate cell cycle arrest in growth factor-induced murine and human hematopoietic progenitor cells.

    Directory of Open Access Journals (Sweden)

    Anne-France Petit-Bertron

    Full Text Available The most recently characterized H4 histamine receptor (H4R is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional and protein levels and respond to its agonists by reduced growth factor-induced cell cycle progression that leads to decreased myeloid, erythroid and lymphoid colony formation. H4R activation prevents the induction of cell cycle genes through a cAMP/PKA-dependent pathway that is not associated with apoptosis. It is mediated specifically through H4R signaling since gene silencing or treatment with selective antagonists restores normal cell cycle progression. The arrest of growth factor-induced G1/S transition protects murine and human progenitor cells from the toxicity of the cell cycle-dependent anticancer drug Ara-C in vitro and reduces aplasia in a murine model of chemotherapy. This first evidence for functional H4R expression in hematopoietic progenitors opens new therapeutic perspectives for alleviating hematotoxic side effects of antineoplastic drugs.

  4. High-level expression of human stem cell factor fused with erythropoietin mimetic peptide in Escherichia coli.

    Science.gov (United States)

    Su, Lin; Chen, Song-Sen; Yang, Ke-Gong; Liu, Chang-Zheng; Zhang, Yan-Li; Liang, Zhi-Quan

    2006-06-01

    Stem cell factor (SCF) and erythropoietin are essential for normal erythropoiesis and induce proliferation and differentiation synergistically for erythroid progenitor cells. Here, we report our work on construction of SCF/erythropoietin mimetic peptide (EMP) fusion protein gene, in which human SCF cDNA (1-165aa) and EMP sequence (20aa) were connected using a short (GGGGS) or long (GGGGSGGGGGS) linker sequence. The SCF/EMP gene was cloned into the pBV220 vector and expressed in the Escherichia coli DH5alpha strain. The expression level of the fusion protein was about 30% of total cell protein. The resulting inclusion bodies were solubilized with 8 M urea, followed by dilution refolding. The renatured protein was subsequently purified by Q-Sepharose FF column. The final product was >95% pure by SDS-PAGE and the yield of fusion protein was about 40 mg/L of culture. UT-7 cell proliferation and human cord blood cell colony-forming assays showed that the fusion proteins exhibited more potent activity than recombinant human SCF, suggesting a new strategy to enhance biological activities of growth factors.

  5. Risk factors

    International Nuclear Information System (INIS)

    Dennery, M.; Dupont, M.A.

    2007-01-01

    This article deals with the development of risk management in the gas sector business: why a risk factor legal mention must precede any published financial information? Do gas companies have to face new risks? Is there specific risks bound to gas activities? Why companies want to master their risks? Is it mandatory or just a new habit? Do they expect a real benefit in return? These are the risk management questions that are analyzed in this article which is based on the public communication of 15 gas companies randomly selected over the world. The information comes from their annual reports or from documents available on their web sites. The intention of this document is not to be exhaustive or to make statistics but only to shade light on the risk factors of the gas sector. (J.S.)

  6. Organizational factors

    International Nuclear Information System (INIS)

    Wahlstroem, B.; Kettunen, J.

    2005-01-01

    The goal of this lecture is to give an overview of important concepts connected to organisational factors and to provide an understanding of mechanisms by which they can contribute to safe or unsafe behaviour of people. The lecture gives examples of ways to organise work, organisational deficiencies and good practices applied in safety oriented organisations. The lecture also gives an introduction to international work and Finnish national regulation connected to organisation and management. (orig.)

  7. Factor analysis

    CERN Document Server

    Gorsuch, Richard L

    2013-01-01

    Comprehensive and comprehensible, this classic covers the basic and advanced topics essential for using factor analysis as a scientific tool in psychology, education, sociology, and related areas. Emphasizing the usefulness of the techniques, it presents sufficient mathematical background for understanding and sufficient discussion of applications for effective use. This includes not only theory but also the empirical evaluations of the importance of mathematical distinctions for applied scientific analysis.

  8. Repair of rat cranial bone defect by using bone morphogenetic protein-2-related peptide combined with microspheres composed of polylactic acid/polyglycolic acid copolymer and chitosan

    International Nuclear Information System (INIS)

    Li, Jingfeng; Jin, Lin; Zhu, Shaobo; Wang, Mingbo; Xu, Shuyun

    2015-01-01

    The effects of the transplanted bone morphogenetic protein-2 (BMP2) -related peptide P24 and rhBMP 2 combined with poly(lactic-co-glycolic acid) (PLGA)/chitosan (CS) microspheres were investigated in promoting the repair of rat cranial bone defect. Forty white rats were selected and equally divided into four groups (group A: 1 μg of rhBMP 2 /PLGA/CS composite; group B: 3 mg of P24/PLGA/CS composite; group C: 0.5 μg of rhBMP 2 + 1.5 mg of P24/PLGA/CS composite; group D: blank PLGA/CS material), and rat cranial bone defect models with a diameter of 5 mm were established. The materials were transplanted to the cranial bone defects. The animals were sacrificed on weeks 6 and 12 post-operation. Radiographic examinations (x-ray imaging and 3D CT scanning) and histological evaluations were performed. The repaired areas of cranial bone defects were measured, and the osteogenetic abilities of various materials were compared. Cranial histology, imaging, and repaired area measurements showed that the osteogenetic effects at two time points (weeks 6 and 12) in group C were better than those in groups A and B. The effects in groups A and B were similar. Group D achieved the worst repair effect of cranial bone defects, where a large number of fibrous connective tissues were observed. The PLGA/CS composite microspheres loaded with rhBMP 2 and P24 had optimal concrescence and could mutually increase their osteogenesis capability. rhBMP 2 + P24/PLGA/CS composite is a novel material for bone defect repair with stable activity to induce bone formation. (paper)

  9. Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9

    Directory of Open Access Journals (Sweden)

    So-Jung Kim

    2017-03-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.

  10. Human factors

    International Nuclear Information System (INIS)

    Brown, G.J.

    1991-01-01

    Recent reactor accidents have spurred the major review, described here, of the contribution of operator personnel to safety in Scottish Nuclear Power Stations. The review aims to identify factors leading to the Chernobyl accident and take preventative measures to avoid possible recurrence. Scottish Nuclear power stations aim to remove the operator from a position where failure to take correct action could lead to a safety hazard. Instead operators concentrate on routine and breakdown maintenance and measures are taken to minimize the probability of operator error. The review concluded that most safety procedures were satisfactory but safety analysis supported by good design practices may offer a significant reduction in the risk of operator error. (UK)

  11. Factors predisposing to post-renal transplant erythrocytosis. A prospective matched-pair control study.

    Science.gov (United States)

    Kessler, M; Hestin, D; Mayeux, D; Mertes, P M; Renoult, E

    1996-02-01

    We conducted a prospective study on 81 consecutive patients who had a kidney transplant with graft function for over 3 months to evaluate the prevalence of erythrocytosis following renal transplantation (PTE) and its potential risk factors. True PTE was defined as a RBC mass > 120% of the theoretical value allowing for sex, weight and height. 18 patients (22.2%) developed PTE (RBC mass = 157 +/- 21%) with no evidence of polycythemia vera (PV), or secondary polycythemia due to reduced arterial oxygen, kidney or hepatic tumors. PTE was more common in males (p = 0.041) and less common in patients treated with recombinant erythropoietin (rHEPO) prior to transplantation. 18 non-polycythemic patients (Hb 12.6 +/- 1.3 g/dl) matched for sex, age and renal function were used as case controls. Fewer PTE patients were transfused post-transplantation (p = 0.026). At the time of diagnosis, mean serum EPO was normal and similar to that of controls. PTE patients had lower serum ferritin (p = 0.005) and more commonly received iron supplementation when PTE occurred (p = 0.003). Other clinical factors did not differ significantly between the two groups. Two patients had a thrombotic event, 6 recovered spontaneously and 11 were successfully treated with angiotensin-converting enzyme inhibitors (ACEI). The normalization of Hb, hematocrit and RBC mass in ACEI treated patients was accompanied by a decline in serum EPO (p = 0.008). We conclude that true erythrocytosis is prevalent in cyclosporine-treated renal transplant patients. PTE seems to be an idiopathic erythrocytosis. Pretransplant rHEPO treatment may limit PTE by blunting the increased sensitivity of erythroid precursors to EPO and iron supplementation, which stimulates the development of PTE. ACEI treatment is effective and safe.

  12. Identification of key factors regulating self-renewal and differentiation in EML hematopoietic precursor cells by RNA-sequencing analysis.

    Science.gov (United States)

    Zong, Shan; Deng, Shuyun; Chen, Kenian; Wu, Jia Qian

    2014-11-11

    Hematopoietic stem cells (HSCs) are used clinically for transplantation treatment to rebuild a patient's hematopoietic system in many diseases such as leukemia and lymphoma. Elucidating the mechanisms controlling HSCs self-renewal and differentiation is important for application of HSCs for research and clinical uses. However, it is not possible to obtain large quantity of HSCs due to their inability to proliferate in vitro. To overcome this hurdle, we used a mouse bone marrow derived cell line, the EML (Erythroid, Myeloid, and Lymphocytic) cell line, as a model system for this study. RNA-sequencing (RNA-Seq) has been increasingly used to replace microarray for gene expression studies. We report here a detailed method of using RNA-Seq technology to investigate the potential key factors in regulation of EML cell self-renewal and differentiation. The protocol provided in this paper is divided into three parts. The first part explains how to culture EML cells and separate Lin-CD34+ and Lin-CD34- cells. The second part of the protocol offers detailed procedures for total RNA preparation and the subsequent library construction for high-throughput sequencing. The last part describes the method for RNA-Seq data analysis and explains how to use the data to identify differentially expressed transcription factors between Lin-CD34+ and Lin-CD34- cells. The most significantly differentially expressed transcription factors were identified to be the potential key regulators controlling EML cell self-renewal and differentiation. In the discussion section of this paper, we highlight the key steps for successful performance of this experiment. In summary, this paper offers a method of using RNA-Seq technology to identify potential regulators of self-renewal and differentiation in EML cells. The key factors identified are subjected to downstream functional analysis in vitro and in vivo.

  13. The HER4 isoform JM-a/CYT2 relates to improved survival in bladder cancer patients but only if the estrogen receptor α is not expressed

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Poulsen, Steen Seier

    2013-01-01

    Abstract Bladder cancer tumors expressing human epidermal growth factor receptor 4 (HER4) demonstrate improved patient survival. HER4 isoforms and estrogen receptor alpha (ER-α) can form chaperone complexes causing cell-proliferation. We wanted to explore if HER4 isoforms and ER-α could correlate...... to poor prognosis in bladder cancers. We developed mRNA assays for HER4 isoforms (JM-a, JM-b, CYT1, and CYT2) and for ER-α. Expression was analyzed in tumors from 85 bladder cancer patients and compared to overall survival (median follow-up of 5.1 years). ER-α was expressed in 38% (n = 32) of tumors...... and half of those (18/36) expressed both isoforms. JM-a/CYT2 expression correlated to improved survival (p = 0.004), but not when ER-α was co-expressed (p = 0.897). Immunohistochemistry revealed protein expression of HER4 and ER-α in tumor cells. Growth of RT4 bladder cancer cells, expressing both JM...

  14. Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias.

    Science.gov (United States)

    Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F

    1997-02-01

    The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.

  15. Relationship between TCF7L2 Relative Expression in Pancreas Tissue with Changes in Insulin by High Intensity Interval Training (HIIT in Type 2 Diabetes Rats

    Directory of Open Access Journals (Sweden)

    Mojtaba Eizadi

    2017-03-01

    Full Text Available Introduction: Both environmental and genetic factors have been implicated in the development of type 2 diabetes (T2D. The objectives of the present study were: 1 to investigate the effect of high intensity interval training (HIIT on fasting glucose, insulin and TCF7L2 expression in pancreas tissue of T2D rats, 2 to determine the relation between TCF7L2 expression with insulin changes in the HIIT and control groups. Methods: In the present applied-experimental study, T2D male Wistar rats induced by intraperitoneal streptozotocin-nicotinamide were assigned to control (no-training and HIIT (5 times/week/12-week groups. Fasting glucose, serum insulin and TCF7L2 expression in pancreas tissues of both groups were measured after lasted exercise and compared between 2 groups by independent T test. Also, the relation between TCF7L2 expression and insulin of HIIT to the control group was assessed by Pearson correlations. Results: The HIIT training in the training group was associated with improved fasting glucose compared with the control group (P<0.001. A significant increase was observed in serum insulin levels (P< 0.001. Also, there was seen a significant decrease in TCF7L2 expression in pancreas tissues in HIIT group compared with the control group (P= 0.038. Significant negative correlation was found between TCF7L2 expression and insulin changes of the HIIT to control groups (r=0.84, P=0.034. conclusion: HIIT training is associated with improvements in glycemic control and insulin secretion in T2D rats. Based on these data, this improvement can be attributed to decrease in TCF7L2 expression at pancreas tissues by HIIT training.

  16. Individual Differences in the Expression of Conditioned Fear Are Associated with Endogenous Fibroblast Growth Factor 2

    Science.gov (United States)

    Graham, Bronwyn M.; Richardson, Rick

    2016-01-01

    These experiments examined the relationship between the neurotrophic factor fibroblast growth factor 2 (FGF2) and individual differences in the expression of conditioned fear. Experiments 1 and 2 demonstrated that rats naturally expressing low levels of contextual or cued fear have higher levels of hippocampal FGF2 relative to rats that express…

  17. Survey and evaluation of mutations in the human KLF1 transcription unit.

    Science.gov (United States)

    Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J

    2018-04-26

    Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.

  18. Heart disease - risk factors

    Science.gov (United States)

    Heart disease - prevention; CVD - risk factors; Cardiovascular disease - risk factors; Coronary artery disease - risk factors; CAD - risk ... a certain health condition. Some risk factors for heart disease you cannot change, but some you can. ...

  19. Role of platelet-released growth factors in detoxification of reactive oxygen species in osteoblasts.

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Wruck, Christoph-Jan; Slowik, Alexander; Kweider, Nisreen; Beckmann, Rainer; Bayer, Andreas; Houben, Astrid; Brandenburg, Lars-Ove; Varoga, Deike; Sönmez, Tolga-Taha; Stoffel, Marcus; Jahr, Holger; Lippross, Sebastian; Pufe, Thomas

    2014-08-01

    Oxidative stress can impair fracture healing. To protect against oxidative damage, a system of detoxifying and antioxidative enzymes works to reduce the cellular stress. The transcription of these enzymes is regulated by antioxidant response element (ARE). The nuclear factor (erythroid-derived 2)-like2 (Nrf2) plays a major role in transcriptional activation of ARE-driven genes. Recently it has been shown that vascular endothelial growth factor (VEGF) prevents oxidative damage via activation of the Nrf2 pathway in vitro. Platelet-released growth factor (PRGF) is a mixture of autologous proteins and growth factors, prepared from a determined volume of platelet-rich plasma (PRP). It has already used to enhance fracture healing in vitro. The aim of the present study was to elucidate if platelets can lead to upregulation of VEGF and if platelets can regulate the activity of Nrf2-ARE system in primary human osteoblast (hOB) and in osteoblast-like cell line (SAOS-2). Platelets and PRGF were obtained from healthy human donors. HOB and SAOS-2 osteosarcoma cell line were used. The ARE activity was analysed using a dual luciferase reporter assay system. We used Western blot to detect the nuclear accumulation of Nrf2 and the amount of cytosolic antioxidant Thioredoxin Reductase-1 (TXNRD-1), Heme Oxygenase-1 (HO-1) and NAD(P)H quinine oxidoreductase-1 (NQO1). Gene expression analysis was performed by real-time RT PCR. ELISA was used for the quantification of growth factors. The activity of ARE was increased in the presence of PRGF up to 50%. Western blotting demonstrated enhanced nuclear accumulation of Nrf2. This was followed by an increase in the protein expression of the aforementioned downstream targets of Nrf2. Real-time RT PCR data showed an upregulation in the gene expression of the VEGF after PRGF treatment. This was confirmed by ELISA, where the treatment with PRGF induced the protein level of VEGF in both cells. These results provide a new insight into PRGF's mode of

  20. Evaluation of transforming growth factor-β1 suppress Pokemon/epithelial-mesenchymal transition expression in human bladder cancer cells.

    Science.gov (United States)

    Li, Wei; Kidiyoor, Amritha; Hu, Yangyang; Guo, Changcheng; Liu, Min; Yao, Xudong; Zhang, Yuanyuan; Peng, Bo; Zheng, Junhua

    2015-02-01

    Transforming growth factor-β1 (TGF-β1) plays a dual role in apoptosis and in proapoptotic responses in the support of survival in a variety of cells. The aim of this study was to determine the function of TGF-β1 in bladder cancer cells and the relationship with POK erythroid myeloid ontogenic factor (Pokemon). TGF-β1 and its receptors mediate several tumorigenic cascades that regulate cell proliferation, migration, and survival of bladder cancer cells. Bladder cancer cells T24 were treated with different levels of TGF-β1. Levels of Pokemon, E-cadherin, Snail, MMP2, MMP9, Twist, VEGF, and β-catenin messenger RNA (mRNA) and protein were examined by real-time quantitative fluorescent PCR and Western blot analysis, respectively. The effects of TGF-β1 on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay, proliferation of T24 was evaluated with reference to growth curves with MTT assay, and cell invasive ability was investigated by Transwell assay. Data show that Pokemon was inhibited by TGF-β1 treatment; the gene and protein of E-cadherin and β-catenin expression level showed decreased markedly after TGF-β1 treatment (P Pokemon, β-catenin, and E-cadherin. The high expression of TGF-β1 leads to an increase in the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Related mechanism is worthy of further investigation.

  1. Expression of Leukemia/Lymphoma-Related Factor (LRF/POKEMON) in Human Breast Carcinoma and Other Cancers

    Science.gov (United States)

    Aggarwal, Anshu; Hunter, William J.; Aggarwal, Himanshu; Silva, Edibaldo D.; Davey, Mary S.; Murphy, Richard F.; Agrawal, Devendra K.

    2010-01-01

    The POK family of proteins plays an important role in not only embryonic development and cell differentiation, but also in oncogenesis. Leukemia/lymphoma-related factor (LRF) belongs to the POK family of transcriptional repressors and is also known as POK erythroid myeloid ontogenic factor (POKEMON), which binds to short transcripts of HIV-1 (FBI-1) and TTF-1 interacting peptide (TIP21). Its oncogenic role is known only in lymphoma, non-small cell lung carcinoma, and malignant gliomas. The functional expression of LRF in human breast carcinoma has not yet been confirmed. The aim of this study was to investigate and compare the expression of LRF in human breast cancer tissues and other human tumors. The expression of LRF mRNA transcripts and protein was observed in twenty human benign and malignant breast biopsy tissues. Expression of LRF was observed in several formalin-fixed tissues by immunohistochemistry and immunofluorescence. All malignant breast tissues expressed mRNA transcripts and protein for LRF. However, 40% and 15% benign breast biopsy tissues expressed LRF mRNA transcripts and protein, respectively. The overall expression of LRF mRNA transcripts and total protein was significantly more in malignant breast tissues than the benign breast tissues. LRF expression was also observed in the nuclei of human colon, renal, lung, hepatocellular carcinomas and thymoma tumor cells. In general, a significantly higher expression of LRF was seen in malignant tissues than in the corresponding benign or normal tissue. Further studies are warranted to determine the malignant role of LRF in human breast carcinoma. PMID:20471975

  2. Insulin-like growth factor 1 signaling is essential for mitochondrial biogenesis and mitophagy in cancer cells.

    Science.gov (United States)

    Lyons, Amy; Coleman, Michael; Riis, Sarah; Favre, Cedric; O'Flanagan, Ciara H; Zhdanov, Alexander V; Papkovsky, Dmitri B; Hursting, Stephen D; O'Connor, Rosemary

    2017-10-13

    Mitochondrial activity and metabolic reprogramming influence the phenotype of cancer cells and resistance to targeted therapy. We previously established that an insulin-like growth factor 1 (IGF-1)-inducible mitochondrial UTP carrier (PNC1/SLC25A33) promotes cell growth. This prompted us to investigate whether IGF signaling is essential for mitochondrial maintenance in cancer cells and whether this contributes to therapy resistance. Here we show that IGF-1 stimulates mitochondrial biogenesis in a range of cell lines. In MCF-7 and ZR75.1 breast cancer cells, IGF-1 induces peroxisome proliferator-activated receptor γ coactivator 1β (PGC-1β) and PGC-1α-related coactivator (PRC). Suppression of PGC-1β and PRC with siRNA reverses the effects of IGF-1 and disrupts mitochondrial morphology and membrane potential. IGF-1 also induced expression of the redox regulator nuclear factor-erythroid-derived 2-like 2 (NFE2L2 alias NRF-2). Of note, MCF-7 cells with acquired resistance to an IGF-1 receptor (IGF-1R) tyrosine kinase inhibitor exhibited reduced expression of PGC-1β, PRC, and mitochondrial biogenesis. Interestingly, these cells exhibited mitochondrial dysfunction, indicated by reactive oxygen species expression, reduced expression of the mitophagy mediators BNIP3 and BNIP3L, and impaired mitophagy. In agreement with this, IGF-1 robustly induced BNIP3 accumulation in mitochondria. Other active receptor tyrosine kinases could not compensate for reduced IGF-1R activity in mitochondrial protection, and MCF-7 cells with suppressed IGF-1R activity became highly dependent on glycolysis for survival. We conclude that IGF-1 signaling is essential for sustaining cancer cell viability by stimulating both mitochondrial biogenesis and turnover through BNIP3 induction. This core mitochondrial protective signal is likely to strongly influence responses to therapy and the phenotypic evolution of cancer. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Krüppel-like factor 1 mutations and expression of hemoglobins F and A2 in homozygous hemoglobin E syndrome.

    Science.gov (United States)

    Tepakhan, Wanicha; Yamsri, Supawadee; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

    2015-07-01

    The basis for variability of hemoglobin (Hb) F in homozygous Hb E disease is not well understood. We have examined multiple mutations of the Krüppel-like factor 1 (KLF1) gene; an erythroid specific transcription factor and determined their associations with Hbs F and A2 expression in homozygous Hb E. Four KLF1 mutations including G176AfsX179, T334R, R238H, and -154 (C-T) were screened using specific PCR assays on 461 subjects with homozygous Hb E and 100 normal controls. None of these four mutations were observed in 100 normal controls. Among 461 subjects with homozygous Hb E, 306 had high (≥5 %) and 155 had low (<5 %) Hb F. DNA analysis identified the KLF1 mutations in 35 cases of the former group with high Hb F, including the G176AfsX179 mutation (17/306 = 5.6 %), T334R mutation (9/306 = 2.9 %), -154 (C-T) mutation (7/306 = 2.3 %), and R328H mutation (2/306 = 0.7 %). Only two subjects in the latter group with low Hb F carried the G176AfsX179 and -154 (C-T) mutations. Significant higher Hb A2 level was observed in those of homozygous Hb E with the G176AfsX179 mutation as compared to those without KLF1 mutations. These results indicate that KLF1 is among the genetic factors associated with increased Hbs F and A2, and in combination with other factors could explain the variabilities of these Hb expression in Hb E syndrome.

  4. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  5. Risk Factors for Scleroderma

    Science.gov (United States)

    ... You are here: Home For Patients Risk Factors Risk Factors for Scleroderma The cause of scleroderma is ... what biological factors contribute to scleroderma pathogenesis. Genetic Risk Scleroderma does not tend to run in families ...

  6. Risk Factors and Prevention

    Science.gov (United States)

    ... Resources Risk Factors & Prevention Back to Patient Resources Risk Factors & Prevention Even people who look healthy and ... Blood Pressure , high cholesterol, diabetes, and thyroid disease. Risk Factors For Arrhythmias and Heart Disease The following ...

  7. Factors and factorizations of graphs proof techniques in factor theory

    CERN Document Server

    Akiyama, Jin

    2011-01-01

    This book chronicles the development of graph factors and factorizations. It pursues a comprehensive approach, addressing most of the important results from hundreds of findings over the last century. One of the main themes is the observation that many theorems can be proved using only a few standard proof techniques. This stands in marked contrast to the seemingly countless, complex proof techniques offered by the extant body of papers and books. In addition to covering the history and development of this area, the book offers conjectures and discusses open problems. It also includes numerous explanatory figures that enable readers to progressively and intuitively understand the most important notions and proofs in the area of factors and factorization.

  8. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  9. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  10. Foundations of factor analysis

    CERN Document Server

    Mulaik, Stanley A

    2009-01-01

    Introduction Factor Analysis and Structural Theories Brief History of Factor Analysis as a Linear Model Example of Factor AnalysisMathematical Foundations for Factor Analysis Introduction Scalar AlgebraVectorsMatrix AlgebraDeterminants Treatment of Variables as Vectors Maxima and Minima of FunctionsComposite Variables and Linear Transformations Introduction Composite Variables Unweighted Composite VariablesDifferentially Weighted Composites Matrix EquationsMulti

  11. Blood coagulation factor VIII

    Indian Academy of Sciences (India)

    Factor VIII (FVIII) functions as a co-factor in the blood coagulation cascade for the proteolytic activation of factor X by factor IXa. Deficiency of FVIII causes hemophilia A, the most commonly inherited bleeding disorder. This review highlights current knowledge on selected aspects of FVIII in which both the scientist and the ...

  12. Constructivism, Factoring, and Beliefs.

    Science.gov (United States)

    Rauff, James V.

    1994-01-01

    Discusses errors made by remedial intermediate algebra students in factoring polynomials in light of student definitions of factoring. Found certain beliefs about factoring to logically imply many of the errors made. Suggests that belief-based teaching can be successful in teaching factoring. (16 references) (Author/MKR)

  13. Crucial factors of the inflammatory microenvironment (IL-1β/TNF-α/TIMP-1) promote the maintenance of the malignant hemopoietic clone of myelofibrosis: an in vitro study.

    Science.gov (United States)

    Sollazzo, Daria; Forte, Dorian; Polverelli, Nicola; Romano, Marco; Perricone, Margherita; Rossi, Lara; Ottaviani, Emanuela; Luatti, Simona; Martinelli, Giovanni; Vianelli, Nicola; Cavo, Michele; Palandri, Francesca; Catani, Lucia

    2016-07-12

    Along with molecular abnormalities (mutations in JAK2, Calreticulin (CALR) and MPL genes), chronic inflammation is the major hallmark of Myelofibrosis (MF). Here, we investigated the in vitro effects of crucial factors of the inflammatory microenvironment (Interleukin (IL)-1β, Tumor Necrosis Factor (TNF)-α, Tissue Inhibitor of Metalloproteinases (TIMP)-1 and ATP) on the functional behaviour of MF-derived circulating CD34+ cells.We found that, regardless mutation status, IL-1β or TNF-α increases the survival of MF-derived CD34+ cells. In addition, along with stimulation of cell cycle progression to the S-phase, IL-1β or TNF-α ± TIMP-1 significantly stimulate(s) the in vitro clonogenic ability of CD34+ cells from JAK2V617 mutated patients. Whereas in the JAK2V617F mutated group, the addition of IL-1β or TNF-α + TIMP-1 decreased the erythroid compartment of the CALR mutated patients. Megakaryocyte progenitors were stimulated by IL-1β (JAK2V617F mutated patients only) and inhibited by TNF-α. IL-1β + TNF-α + C-X-C motif chemokine 12 (CXCL12) ± TIMP-1 highly stimulates the in vitro migration of MF-derived CD34+ cells. Interestingly, after migration toward IL-1β + TNF-α + CXCL12 ± TIMP-1, CD34+ cells from JAK2V617F mutated patients show increased clonogenic ability.Here we demonstrate that the interplay of these inflammatory factors promotes and selects the circulating MF-derived CD34+ cells with higher proliferative activity, clonogenic potential and migration ability. Targeting these micro-environmental interactions may be a clinically relevant approach.

  14. Granulocyte colony-stimulating factor and drugs elevating extracellular adenosine synergize to enhance haematopoietic reconstitution in irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Pospisil, M.; Hofer, M.; Netikova, J.; Hola, J.; Vacek, A. [Academy of Sciences of the Czech Republic, Inst. of Biophysics, Brno (Czech Republic); Znojil, V.; Vacha, J. [Masaryk Univ., Medical Faculty, Brno (Czech Republic)

    1998-03-01

    The activation of adenosine receptors has recently been demonstrated to stimulate haematopoiesis. In the present study, we investigated the ability of drugs elevating extracellular adenosine to influence curative effects of granulocyte colony-stimulating factor (G-CSF) in mice exposed to a sublethal dose of 4 Gy of {sup 60}Co radiation. Elevation of extracellular adenosine in mice was induced by the combined administration of dipyridamole, a drug inhibiting the cellular uptake of adenosine, and adenosine monophosphate (AMP), an adenosine prodrug. The effects of dipyridamole plus AMP, and G-CSF, administered either alone or in combination, were evaluated. The drugs were injected to mice in a 4-d treatment regimen starting on d 3 after irradiation and the haematopoietic response was evaluated on d 7, 10, 14, 18 and 24 after irradiation. While the effects of G-CSF on the late maturation stages of blood cells, appearing shortly after the completion of the treatment, were not influenced by dipyridamole plus AMP, positive effects of the combination therapy occurred in the post-irradiation recovery phase which is dependent on the repopulation of haematopoietic stem cells. This was indicated by the significant elevation of counts of granulocyte-macrophage progenitor cells (GM-CFC) and granulocytic cells in the bone marrow (d 14), of GM-CFC (d 14), granulocytic and erythroid cells (d 14 and 18) in the spleen, and of neutrophils (d 18), monocytes (d 14 and 18) and platelets (d 18) in the peripheral blood. These effects suggest that the repopulation potential of the combination therapy lies in a common multi-lineage cell population. The results of this study implicate the promising possibility to enhance the curative effects of G-CSF under conditions of myelosuppressive state induced by radiation exposure. (au) 43 refs.

  15. Granulocyte colony-stimulating factor and drugs elevating extracellular adenosine synergize to enhance haematopoietic reconstitution in irradiated mice

    International Nuclear Information System (INIS)

    Pospisil, M.; Hofer, M.; Netikova, J.; Hola, J.; Vacek, A.; Znojil, V.; Vacha, J.

    1998-01-01

    The activation of adenosine receptors has recently been demonstrated to stimulate haematopoiesis. In the present study, we investigated the ability of drugs elevating extracellular adenosine to influence curative effects of granulocyte colony-stimulating factor (G-CSF) in mice exposed to a sublethal dose of 4 Gy of 60 Co radiation. Elevation of extracellular adenosine in mice was induced by the combined administration of dipyridamole, a drug inhibiting the cellular uptake of adenosine, and adenosine monophosphate (AMP), an adenosine prodrug. The effects of dipyridamole plus AMP, and G-CSF, administered either alone or in combination, were evaluated. The drugs were injected to mice in a 4-d treatment regimen starting on d 3 after irradiation and the haematopoietic response was evaluated on d 7, 10, 14, 18 and 24 after irradiation. While the effects of G-CSF on the late maturation stages of blood cells, appearing shortly after the completion of the treatment, were not influenced by dipyridamole plus AMP, positive effects of the combination therapy occurred in the post-irradiation recovery phase which is dependent on the repopulation of haematopoietic stem cells. This was indicated by the significant elevation of counts of granulocyte-macrophage progenitor cells (GM-CFC) and granulocytic cells in the bone marrow (d 14), of GM-CFC (d 14), granulocytic and erythroid cells (d 14 and 18) in the spleen, and of neutrophils (d 18), monocytes (d 14 and 18) and platelets (d 18) in the peripheral blood. These effects suggest that the repopulation potential of the combination therapy lies in a common multi-lineage cell population. The results of this study implicate the promising possibility to enhance the curative effects of G-CSF under conditions of myelosuppressive state induced by radiation exposure. (au)

  16. Factors affecting construction performance: exploratory factor analysis

    Science.gov (United States)

    Soewin, E.; Chinda, T.

    2018-04-01

    The present work attempts to develop a multidimensional performance evaluation framework for a construction company by considering all relevant measures of performance. Based on the previous studies, this study hypothesizes nine key factors, with a total of 57 associated items. The hypothesized factors, with their associated items, are then used to develop questionnaire survey to gather data. The exploratory factor analysis (EFA) was applied to the collected data which gave rise 10 factors with 57 items affecting construction performance. The findings further reveal that the items constituting ten key performance factors (KPIs) namely; 1) Time, 2) Cost, 3) Quality, 4) Safety & Health, 5) Internal Stakeholder, 6) External Stakeholder, 7) Client Satisfaction, 8) Financial Performance, 9) Environment, and 10) Information, Technology & Innovation. The analysis helps to develop multi-dimensional performance evaluation framework for an effective measurement of the construction performance. The 10 key performance factors can be broadly categorized into economic aspect, social aspect, environmental aspect, and technology aspects. It is important to understand a multi-dimension performance evaluation framework by including all key factors affecting the construction performance of a company, so that the management level can effectively plan to implement an effective performance development plan to match with the mission and vision of the company.

  17. The joy of factoring

    CERN Document Server

    Wagstaff, Samuel S

    2013-01-01

    This book is about the theory and practice of integer factorization presented in a historic perspective. It describes about twenty algorithms for factoring and a dozen other number theory algorithms that support the factoring algorithms. Most algorithms are described both in words and in pseudocode to satisfy both number theorists and computer scientists. Each of the ten chapters begins with a concise summary of its contents. The book starts with a general explanation of why factoring integers is important. The next two chapters present number theory results that are relevant to factoring. Further on there is a chapter discussing, in particular, mechanical and electronic devices for factoring, as well as factoring using quantum physics and DNA molecules. Another chapter applies factoring to breaking certain cryptographic algorithms. Yet another chapter is devoted to practical vs. theoretical aspects of factoring. The book contains more than 100 examples illustrating various algorithms and theorems. It also co...

  18. Lycopene activates antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers.

    Science.gov (United States)

    Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O

    2016-05-01

    This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (Plycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. © 2016 Poultry Science Association Inc.

  19. Risk factors and long-term outcomes of parvovirus B19 infection in kidney transplant patients.

    Science.gov (United States)

    Baek, Chung Hee; Kim, Hyosang; Yang, Won Seok; Han, Duck Jong; Park, Su-Kil

    2017-10-01

    Parvovirus B19 is a small, non-enveloped, single-stranded DNA virus with a special affinity for the erythroid progenitor cells of the bone marrow. The first case of parvovirus B19 infection in a kidney transplant recipient (KTR) was reported in 1986. Data on the risk factors and specific clinical characteristics of parvovirus B19 infection remain insufficient. We screened 602 KTRs for parvovirus B19 infection using parvovirus B19 polymerase chain reaction (PCR) from January 1990 to April 2016, and the clinical characteristics of patients with positive results were compared to those of age- and gender-matched patients with negative PCR results. A total of 39 KTRs tested positive for parvovirus B19, and they were compared to 78 age- and gender-matched patients among 563 KTRs who had negative PCR results. In all, 89.7% of positive cases were reported within the first year after kidney transplantation. In multivariate analyses, deceased-donor kidney transplantation (odds ratio [OR] 9.067, 95% confidence interval [CI] 1.668-49.275, P = .011), use of tacrolimus (OR 3.607, 95% CI 1.024-12.706, P = .046), PCR test within 1 year of kidney transplantation (OR 12.456, 95% CI 2.674-58.036, P = .001), and hemoglobin levels (OR 0.559, 95% CI 0.351-0.889, P = .014) showed significant correlations with parvovirus B19 infection. Graft survival did not differ between the two groups during the follow-up period of 111.68 ± 54.54 months (P = .685 by log-rank test). The identification of factors related to positive parvovirus B19 PCR results may promote the early detection of parvovirus B19 infection. Further studies are needed to elucidate the characteristics of parvovirus B19 infection in kidney transplantation. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Factor VII deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000548.htm Factor VII deficiency To use the sharing features on this page, please enable JavaScript. Factor VII (seven) deficiency is a disorder caused by a ...

  1. Annual Adjustment Factors

    Data.gov (United States)

    Department of Housing and Urban Development — The Department of Housing and Urban Development establishes the rent adjustment factors - called Annual Adjustment Factors (AAFs) - on the basis of Consumer Price...

  2. Stroke - risk factors

    Science.gov (United States)

    ... oxygen. Brain cells can die, causing lasting damage. Risk factors are things that increase your chance of ... a disease or condition. This article discusses the risk factors for stroke and things you can do ...

  3. Human factors in training

    International Nuclear Information System (INIS)

    Dutton, J.W.; Brown, W.R.

    1981-01-01

    The Human Factors concept is a focused effort directed at those activities which require human involvement. Training is, by its nature, an activity totally dependent on the Human Factor. This paper identifies several concerns significant to training situations and discusses how Human Factor awareness can increase the quality of learning. Psychology in the training arena is applied Human Factors. Training is a method of communication represented by sender, medium, and receiver. Two-thirds of this communications model involves the human element directly

  4. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  5. Disconnected electromagnetic form factors

    International Nuclear Information System (INIS)

    Wilcox, Walter

    2001-01-01

    Preliminary results of a calculation of disconnected nucleon electromagnetic factors factors on the lattice are presented. The implementation of the numerical subtraction scheme is outlined. A comparison of results for electric and magnetic disconnected form factors on two lattice sizes with those of the Kentucky group is presented. Unlike previous results, the results found in this calculation are consistent with zero in these sectors

  6. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  7. Age-related changes of healthy bone marrow cell signaling in response to growth factors provide insight into low risk MDS.

    Science.gov (United States)

    Kornblau, Steven M; Cohen, Aileen C; Soper, David; Huang, Ying-Wen; Cesano, Alessandra

    2014-11-01

    Single Cell Network Profiling (SCNP) is a multiparametric flow cytometry-based assay that quantifiably and simultaneously measures changes in intracellular signaling proteins in response to in vitro extracellular modulators at the single cell level. Myelodysplastic syndrome (MDS) is a heterogeneous clonal disorder of hematopoietic stem cells that occurs in elderly subjects and is characterized by dysplasia and ineffective hematopoiesis. The functional responsiveness of MDS bone marrow (BM) hematopoietic cells, including functionally distinct myeloid and erythroid precursor subsets, to hematopoietic growth factors (HGF) and the relationship of modulated signaling to disease characteristics is poorly understood. SCNP was used first to examine the effects of age on erythropoietin (EPO) and granulocyte colony stimulating factor (GCSF)-induced signaling in myeloid, nucleated red blood cells (nRBC), and CD34 expressing cell subsets in healthy BM (n = 15). SCNP was then used to map functional signaling profiles in low risk (LR) MDS (n = 7) for comparison to signaling in samples from healthy donors and to probe signaling associations within clinically defined subgroups. In healthy BM samples, signaling responses to HGF were quite homogeneous (i.e., tightly regulated) with age-dependent effects observed in response to EPO but not to GCSF. Despite the relatively small number of samples assayed in the study, LR MDS could be classified into distinct subgroups based on both cell subset frequency and signaling profiles. As a correlate of underlying genetic abnormalities, signal transduction analyses may provide a functional and potentially clinically relevant classification of MDS. Further evaluation in a larger cohort is warranted. © 2013 Clinical Cytometry Society.

  8. demographic factors associated factors associated with malaria

    African Journals Online (AJOL)

    userpc

    .8%) than those in other nce of 35.4% which was actors can predispose alence of malaria in a study were significantly eveloping guidelines and more effective disease endemic areas (Bashar et therefore attempts to rmation on possible demographic factors d out in four selected geria; Major Ibrahim B. Hospital Zaria, Hajiya.

  9. Aspects of QCD factorization

    International Nuclear Information System (INIS)

    Neubert, Matthias

    2001-01-01

    The QCD factorization approach provides the theoretical basis for a systematic analysis of nonleptonic decay amplitudes of B mesons in the heavy-quark limit. After recalling the basic ideas underlying this formalism, several tests of QCD factorization in the decays B→D (*) L, B→K * γ, and B→πK, ππ are discussed. It is then illustrated how factorization can be used to obtain new constraints on the parameters of the unitarity triangle

  10. Oversimplifying quantum factoring.

    Science.gov (United States)

    Smolin, John A; Smith, Graeme; Vargo, Alexander

    2013-07-11

    Shor's quantum factoring algorithm exponentially outperforms known classical methods. Previous experimental implementations have used simplifications dependent on knowing the factors in advance. However, as we show here, all composite numbers admit simplification of the algorithm to a circuit equivalent to flipping coins. The difficulty of a particular experiment therefore depends on the level of simplification chosen, not the size of the number factored. Valid implementations should not make use of the answer sought.

  11. Radioimmunoassay of human Hageman factor (factor XII)

    International Nuclear Information System (INIS)

    Saito, H.; Ratnoff, O.D.; Pensky, J.

    1976-01-01

    A specific, sensitive, and reproducible radioimmunoassay for human Hageman factor (HF, factor XII) has been developed with purified human HF and monospecific rabbit antibody. Precise measurements of HF antigen were possible for concentrations as low as 0.1 percent of that in normal pooled plasma. A good correlation (correlation coefficient = 0.82) existed between the titers of HF measured by clot-promoting assays and radioimmunoassays among 42 normal adults. Confirming earlier studies, HF antigen was absent in Hageman trait plasma, but other congenital deficient plasmas, including those of individuals with Fletcher trait and Fitzgerald trait, contained normal amounts of HF antigen. HF antigen was reduced in the plasmas of patients with disseminated intravascular coagulation or advanced liver cirrhosis, but it was normal in those of patients with chronic renal failure or patients under treatment with warfarin. HF antigen was detected by this assay in plasmas of primates, but not detectable in plasmas of 11 nonprimate mammalian and one avian species

  12. What Are Rare Clotting Factor Deficiencies?

    Science.gov (United States)

    ... Deficiency Factor V Deficiency Combined FV & FVIII Deficiencies Factor VII Deficiency Factor X Deficiency Factor XI Deficiency Factor ... Deficiency Factor V Deficiency Combined FV & FVIII Deficiencies Factor VII Deficiency Factor X Deficiency Factor XI Deficiency Factor ...

  13. PAYMENT CAPACITY SENSITIVITY FACTORS

    Directory of Open Access Journals (Sweden)

    Daniel BRÎNDESCU – OLARIU

    2014-11-01

    The results of the study facilitate the determination and classification of the main sensitivity factors for the payment capacity at sample level, the establishment of general benchmarks for the payment capacity (as no such benchmarks currently exist in the Romanian literature and the identification of the mechanisms through which the variation of different factors impacts the payment capacity.

  14. Respirator field performance factors

    International Nuclear Information System (INIS)

    Skaggs, B.J.; DeField, J.D.; Strandberg, S.W.; Sutcliffe, C.R.

    1985-01-01

    The Industrial Hygiene Group assisted OSHA and the NRC in measurements of respirator performance under field conditions. They reviewed problems associated with sampling aerosols within the respirator in order to determine fit factors (FFs) or field performance factor (FPF). In addition, they designed an environmental chamber study to determine the effects of temperature and humidity on a respirator wearer

  15. Factors affecting nuclear development

    International Nuclear Information System (INIS)

    Stevens, G.H.; Girouard, P.

    1995-01-01

    Among the factors affecting nuclear development, some depend more or less on public authorities, but many are out of public authorities control (foreign policies, market and deregulation, socials and environmental impacts, public opinion). As far as possible, the following study tries to identify those factors. (D.L.). 2 photos

  16. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  17. Nd{sub 39}Ir{sub 10.98}In{sub 36.02}. A complex intergrowth structure with CsCl- and AlB{sub 2}-related slabs

    Energy Technology Data Exchange (ETDEWEB)

    Dominyuk, Nataliya; Zaremba, Vasyl' I. [Ivan Franko National Univ., Lviv (Ukraine). Dept. of Inorganic Chemistry; Rodewald, Ute C.; Poettgen, Rainer [Muenster Univ. (Germany). Inst. fuer Anorganische und Analytische Chemie

    2015-11-01

    The ternary indide Nd{sub 39}Ir{sub 10.98}In{sub 36.02} was synthesized by arc-melting and characterized by single crystal X-ray diffraction. Nd{sub 39}Ir{sub 10.98}In{sub 36.02} crystallizes with a new structure type: Pearson code oP172, Pbam, a = 3175.4(6), b = 3762.5(8), c = 378.02(8) pm, wR2 = 0.0828, 5544 F{sup 2} values, and 262 variables. Although the structure contains 44 crystallographically independent sites, it can easily be explained as an intergrowth structure of CsCl and AlB{sub 2} related slabs. The larger indium atoms fill all distorted CsCl slabs. The trigonal prismatic (AlB{sub 2}) slabs have no uniform size. The larger ones are filled by indium and the smaller ones by the iridium atoms. Additionally, one trigonal prism shows a mixed occupancy by indium and iridium. The crystal chemistry of Nd{sub 39}Ir{sub 10.98}In{sub 36.02} is discussed in the context of other intergrowth structures with the same simple slabs.

  18. Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

    Energy Technology Data Exchange (ETDEWEB)

    Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.

    2006-03-01

    Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.

  19. Defibrotide in combination with granulocyte colony-stimulating factor significantly enhances the mobilization of primitive and committed peripheral blood progenitor cells in mice.

    Science.gov (United States)

    Carlo-Stella, Carmelo; Di Nicola, Massimo; Magni, Michele; Longoni, Paolo; Milanesi, Marco; Stucchi, Claudio; Cleris, Loredana; Formelli, Franca; Gianni, Massimo A

    2002-11-01

    Defibrotide is a polydeoxyribonucleotide, which significantly reduces the expression of adhesion molecules on endothelial cells. We investigated the activity of Defibrotide alone or in combination with recombinant human granulocyte colony-stimulating factor (rhG-CSF) to mobilize peripheral blood progenitor cells (PBPCs) in BALB/c mice. A 5-day treatment with Defibrotide alone (1-15 mg/mouse/day) had no effect on WBC counts, frequencies and absolute numbers of total circulating colony-forming cells (CFCs), i.e., granulocyte-macrophage colony-forming units, erythroid burst-forming units, and multilineage colony-forming units. As compared with mock-injected mice, administration of rhG-CSF alone (5 micro g/mouse/day) for 5 days significantly (P Defibrotide (15 mg/mouse/day) and rhG-CSF significantly (P Defibrotide plus rhG-CSF resulted in a significant increase (P Defibrotide/rhG-CSF-mobilized mononuclear cells rescued 43% and 71% of recipient mice, respectively. Experiments of CFC homing performed in lethally irradiated or nonirradiated recipients showed that marrow homing of transplanted PBPCs was reduced by 3-fold in Defibrotide-treated animals as compared with mock-injected mice (P Defibrotide might be because of an effect on PBPC trafficking. In conclusion, our data demonstrate that Defibrotide synergizes with rhG-CSF and significantly increases the mobilization of a broad spectrum of PBPCs, including primitive and committed progenitor cells. These data might have relevant implications for autologous and allogeneic anticancer therapy in humans.

  20. Two-factor authentication

    CERN Document Server

    Stanislav, Mark

    2015-01-01

    During the book, readers will learn about the various technical methods by which two-factor authentication is implemented, security concerns with each type of implementation, and contextual details to frame why and when these technologies should be used. Readers will also be provided with insight about the reasons that two-factor authentication is a critical security control, events in history that have been important to prove why organization and individual would want to use two factor, and core milestones in the progress of growing the market.

  1. Business Intelligence Success Factors

    DEFF Research Database (Denmark)

    Gaardboe, Rikke; Jonasen, Tanja Svarre

    2018-01-01

    Business intelligence (BI) is a strategically important practice in many organizations. Several studies have investigated the factors that contribute to BI success; however, an overview of the critical success factors (CSFs) involved is lacking in the extant literature. We have integrated...... 34 CSFs related to BI success. The distinct CSFs identified in the extant literature relate to project management skills (13 papers), management support (20 papers), and user involvement (11 papers). In the articles with operationalized BI success, we found several distinct factors: system quality...

  2. Human factor reliability program

    International Nuclear Information System (INIS)

    Knoblochova, L.

    2017-01-01

    The human factor's reliability program was at Slovenske elektrarne, a.s. (SE) nuclear power plants. introduced as one of the components Initiatives of Excellent Performance in 2011. The initiative's goal was to increase the reliability of both people and facilities, in response to 3 major areas of improvement - Need for improvement of the results, Troubleshooting support, Supporting the achievement of the company's goals. The human agent's reliability program is in practice included: - Tools to prevent human error; - Managerial observation and coaching; - Human factor analysis; -Quick information about the event with a human agent; -Human reliability timeline and performance indicators; - Basic, periodic and extraordinary training in human factor reliability(authors)

  3. [Human factors in medicine].

    Science.gov (United States)

    Lazarovici, M; Trentzsch, H; Prückner, S

    2017-01-01

    The concept of human factors is commonly used in the context of patient safety and medical errors, all too often ambiguously. In actual fact, the term comprises a wide range of meanings from human-machine interfaces through human performance and limitations up to the point of working process design; however, human factors prevail as a substantial cause of error in complex systems. This article presents the full range of the term human factors from the (emergency) medical perspective. Based on the so-called Swiss cheese model by Reason, we explain the different types of error, what promotes their emergence and on which level of the model error prevention can be initiated.

  4. Shell Buckling Knockdown Factors

    Data.gov (United States)

    National Aeronautics and Space Administration — The Shell Buckling Knockdown Factor (SBKF) Project, NASA Engineering and Safety Center (NESC) Assessment #: 07-010-E, was established in March of 2007 by the NESC in...

  5. Risk factors for neoplasms

    International Nuclear Information System (INIS)

    Brachner, A.; Grosche, B.

    1991-06-01

    A broad survey is given of risk factors for neoplasms. The main carcinogenic substances (including also ionizing radiation and air pollution) are listed, and are correlated with the risk factors for various cancers most frequently explained and discussed in the literature. The study is intended to serve as a basis for a general assessment of the incidence of neoplasms in children, and of cancer mortality in the entire population of Bavaria in the years 1983-1989, or 1979-1988, respectively, with the principal idea of drawing up an environment-related health survey. The study therefore takes into account not only ionizing radiation as a main risk factor, but also other risk factors detectable within the ecologic context, as e.g. industrial installations and their effects, refuse incineration plants or waste dumps, or the social status. (orig./MG) [de

  6. Factor IX assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003679.htm Factor IX assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  7. Factor VIII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003678.htm Factor VIII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  8. Factor II assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003674.htm Factor II assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  9. Factor V deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000550.htm Factor V deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  10. Rheumatoid factor (RF)

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003548.htm Rheumatoid factor (RF) To use the sharing features on this ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  11. Factor II deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000549.htm Factor II deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  12. Factor VII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003676.htm Factor VII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  13. Factor X deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000553.htm Factor X deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  14. New microbial growth factor

    Science.gov (United States)

    Bok, S. H.; Casida, L. E., Jr.

    1977-01-01

    A screening procedure was used to isolate from soil a Penicillium sp., two bacterial isolates, and a Streptomyces sp. that produced a previously unknown microbial growth factor. This factor was an absolute growth requirement for three soil bacteria. The Penicillium sp. and one of the bacteria requiring the factor, an Arthrobacter sp., were selected for more extensive study concerning the production and characteristics of the growth factor. It did not seem to be related to the siderochromes. It was not present in soil extract, rumen fluid, or any other medium component tested. It appears to be a glycoprotein of high molecular weight and has high specific activity. When added to the diets for a meadow-vole mammalian test system, it caused an increased consumption of diet without a concurrent increase in rate of weight gain.

  15. Human factors in aviation

    National Research Council Canada - National Science Library

    Salas, Eduardo; Maurino, Daniel E

    2010-01-01

    .... HFA offers a comprehensive overview of the topic, taking readers from the general to the specific, first covering broad issues, then the more specific topics of pilot performance, human factors...

  16. [Risk factors of schizophrenia].

    Science.gov (United States)

    Suvisaari, Jaana

    2010-01-01

    Schizophrenia is a multifactorial, neurodevelopmental disorder caused by a combination of genetic and environmental risk factors. Disturbances of brain development begin prenatally, while different environmental insults further affect postnatal brain maturation during childhood and adolescence. Genome-wide association studies (GWAS) have succeeded in identifying hundreds of new risk variants for common, multifactorial diseases. In schizophrenia research, GWAS have found several rare copy number variants that considerably increase the risk of schizophrenia, and have shown an association between schizophrenia and the major histocompatibility complex. Research on environmental risk factors in recent years has provided new information particularly on risk factors related to pregnancy and childhood rearing environment. Gene-environment interactions have become a central research topic. There is evidence that genetically susceptible children are more vulnerable to the effects of unstable childhood rearing environment and other environmental risk factors.

  17. Human Factors Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — Purpose: The purpose of the Human Factors Laboratory is to further the understanding of highway user needs so that those needs can be incorporated in roadway design,...

  18. Factors Affecting Wound Healing

    Science.gov (United States)

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutaneous wound healing and the potential cellular and/or molecular mechanisms involved. The factors discussed include oxygenation, infection, age and sex hormones, stress, diabetes, obesity, medications, alcoholism, smoking, and nutrition. A better understanding of the influence of these factors on repair may lead to therapeutics that improve wound healing and resolve impaired wounds. PMID:20139336

  19. Systems approach to the study of brain damage in the very preterm newborn

    Science.gov (United States)

    Leviton, Alan; Gressens, Pierre; Wolkenhauer, Olaf; Dammann, Olaf

    2015-01-01

    Background: A systems approach to the study of brain damage in very preterm newborns has been lacking. Methods: In this perspective piece, we offer encephalopathy of prematurity as an example of the complexity and interrelatedness of brain-damaging molecular processes that can be initiated inflammatory phenomena. Results: Using three transcription factors, nuclear factor-kappa B (NF-κB), Notch-1, and nuclear factor erythroid 2 related factor 2 (NRF2), we show the inter-connectedness of signaling pathways activated by some antecedents of encephalopathy of prematurity. Conclusions: We hope that as biomarkers of exposures and processes leading to brain damage in the most immature newborns become more readily available, those who apply a systems approach to the study of neuroscience can be persuaded to study the pathogenesis of brain disorders in the very preterm newborn. PMID:25926780

  20. The stem factor challenge

    International Nuclear Information System (INIS)

    Russell, M.J.; Steele, R. Jr.; DeWall, K.G.; Watkins, J.C.; Bramwell, D.

    1994-01-01

    One of the most important challenges that still needs to be met in the effort to understand the operation of motor-operated, rising-stem valves is the ability to determine stem factor throughout the valve's load range. The stem factor represents the conversion of operator torque to stem thrust. Determining the stem factor is important because some motor-operated valves (MOVs) cannot be tested in the plant at design basis conditions. The ability of these valves to perform their design basis function (typically, to operate against specified flow and pressure loads) must be ensured by analytical methods or by extrapolating from the results of tests conducted at lower loads. Because the stem factor tends to vary in response to friction and lubrication phenomena that occur during loading and wedging, analytical methods and extrapolation methods have been difficult to develop and implement. Early investigations into variability in the stem factor tended to look only at the tip of the iceberg; they focused on what was happening at torque switch trip, which usually occurs at full wedging. In most stems, the stem factor is better (lower) in the wedging transient than before wedging, so working with torque switch trip data alone led many early researchers to false conclusions about the relationship between stem factor and load. However, research at the Idaho National Engineering Laboratory (INEL) has taken a closer look at what happens during the running portion of the closing stroke along with the wedging portion. This shift in focus is important, because functional failure of a valve typically consists of a failure to isolate flow, not a failure to achieve full wedging. Thus, the stem factor that must be determined for a valve's design basis closing requirements is the one that corresponds with the running load before wedging

  1. Factors Affecting Wound Healing

    OpenAIRE

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutane...

  2. Los factores de riesgo

    Directory of Open Access Journals (Sweden)

    Justo Senado Dumoy

    1999-01-01

    Full Text Available Sobre el fundamento filosófico de los conceptos de la Dialéctica Materialista, se presenta un análisis en relación con el concepto e interpretación de los Factores de Riesgo.A analysis on the concept and interpretation of risk factors is presented based on the philosophical foundation of the concepts of materialist dialectics.

  3. Brain derived neurotrophic factor

    DEFF Research Database (Denmark)

    Mitchelmore, Cathy; Gede, Lene

    2014-01-01

    Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies are curre......Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies...

  4. Factors Impacting Knowledge Sharing

    DEFF Research Database (Denmark)

    Schulzmann, David; Slepniov, Dmitrij

    The purpose of this paper is to examine various factors affecting knowledge sharing at the R&D center of a Western MNE in China. The paper employs qualitative methodology and is based on the action research and case study research techniques. The findings of the paper advance our understanding...... about factors that affect knowledge sharing. The main emphasis is given to the discussion on how to improve knowledge sharing in global R&D organizations....

  5. FGF growth factor analogs

    Science.gov (United States)

    Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY; Takahashi, Kazuyuki [Germantown, MD

    2012-07-24

    The present invention provides a fibroblast growth factor heparin-binding analog of the formula: ##STR00001## where R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, X, Y and Z are as defined, pharmaceutical compositions, coating compositions and medical devices including the fibroblast growth factor heparin-binding analog of the foregoing formula, and methods and uses thereof.

  6. Factorization and pion form factor in QCD

    International Nuclear Information System (INIS)

    Efremov, A.V.; Radyushkin, A.V.

    1979-01-01

    The behaviour of the pion electromagnetic form factor (EMFF) in the framework of quantum chromodynamics (QCD) is discussed. Pion is considered to be a quark-antiquark bound state. It is proposed to use an OPE description of the bound state structure by matrix elements of certain local gauge-invariant operators. Short-distance quark interactions is proved using a direct analysis of perturbation theory in the α-parametric representation of the Feynman diagrams. It is shown that the short-distance parton picture privides a self-consistent description of the large Q 2 momentum behaviour of the pion EMFF in QCD. Pion EMFF asymptotics is expressed in terms of fu fundamental constants of the theory

  7. [Pathological gambling: risk factors].

    Science.gov (United States)

    Bouju, G; Grall-Bronnec, M; Landreat-Guillou, M; Venisse, J-L

    2011-09-01

    In France, consumption of gambling games increased by 148% between 1960 and 2005. In 2004, gamblers lost approximately 0.9% of household income, compared to 0.4% in 1960. This represents approximately 134 Euros per year and per head. In spite of this important increase, the level remains lower than the European average (1%). However, gambling practices may continue to escalate in France in the next few years, particularly with the recent announce of the legalisation of online games and sports betting. With the spread of legalised gambling, pathological gambling rates may increase in France in the next years, in response to more widely available and more attractive gambling opportunities. In this context, there is a need for better understanding of the risk factors that are implicated in the development and maintenance of pathological gambling. This paper briefly describes the major risk factors for pathological gambling by examining the recent published literature available during the first quarter of 2008. This documentary basis was collected by Inserm for the collective expert report procedure on Gambling (contexts and addictions). Seventy-two articles focusing on risk factors for pathological gambling were considered in this review. Only 47 of them were taken into account for analysis. The selection of these 47 publications was based on the guide on literature analysis established by the French National Agency for Accreditation and Assessment in Health (ANAES, 2000). Some publications from more recent literature have also been added, mostly about Internet gambling. We identify three major types of risk factors implicated in gambling problems: some of them are related to the subject (individual factors), others are related to the object of the addiction, here the gambling activity by itself (structural factors), and the last are related to environment (contextual or situational factors). Thus, the development and maintenance of pathological gambling seems to be

  8. The Regulatory Roles of Toll-Like Receptor 4 in Secretions of Type 1/Type 2 Relative Cytokines by Splenocytes and Dendritic Cells Exposed to Clonorchis sinensis Excretory/Secretory Products.

    Science.gov (United States)

    Hua, Hui; Du, Ying; Ma, Rui; Zhang, Bei-Bei; Yu, Qian; Li, Bo; Xu, Jiang-Tao; Li, Xiang-Yang; Tang, Ren-Xian; Yan, Chao; Zheng, Kui-Yang

    2018-02-01

    The roles of TLR4 in mediation of innate immune response and in regulation of adaptive immune responses triggered by Clonorchis sinensis remain unknown. In the present study, splenocytes derived from C3H/HeN (TLR4 wild ) and C3H/Hej mice (TLR4 mut ) that were infected with 45 metacercariae of C. sinensis were harvested, then stimulated by C. sinensis excretory/secretory products (ESP) or medium (control) for 48 h, respectively. Meanwhile, bone marrow-derived dendritic cells (BMDCs) from normal C3H/HeN and C3H/Hej mice were prepared and stimulated with medium, ESP, LPS, or ESP+LPS for 24 h, respectively. The supernatants were collected, and the concentrations of type 1 and type 2 relative cytokines were determined by ELISA. The maturation of BMDCs indicated by surface markers of CD80, CD86, and MHC II was evaluated by flow cytometry. The results showed that the levels of IFN-γ, IL-6, TNF-α, and IL-10 in the splenocytes from C. sinensis-infected TLR4 mut mice were significantly lower than those from TLR4 wild mice when they were further exposed to ESP. For BMDCs, the productions of the cytokines IL-12p70 and IL-10, but not IL-4, in the BMDCs from TLR4 mutation mice were predominantly decreased compared with those from TLR4 wild mice when the BMDCs were co-stimulated by ESP combined with LPS. Flow cytometry analysis showed that ESP could significantly decrease the high levels of CD80, CD86, and MHC II which were elevated by LPS. In conclusion, these data suggest that TLR4 may play a regulatory role in type 1 immune responses during C. sinensis infection.

  9. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells

    OpenAIRE

    Van Handel, Ben; Prashad, Sacha L.; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I.; Mikkola, Hanna K. A.

    2010-01-01

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in fir...

  10. Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

    Science.gov (United States)

    Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

    2011-01-01

    Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

  11. Erythroid-specific transcriptional changes in PBMCs from pulmonary hypertension patients.

    Directory of Open Access Journals (Sweden)

    Chris Cheadle

    Full Text Available Gene expression profiling of peripheral blood mononuclear cells (PBMCs is a powerful tool for the identification of surrogate markers involved in disease processes. The hypothesis tested in this study was that chronic exposure of PBMCs to a hypertensive environment in remodeled pulmonary vessels would be reflected by specific transcriptional changes in these cells.The transcript profiles of PBMCs from 30 idiopathic pulmonary arterial hypertension patients (IPAH, 19 patients with systemic sclerosis without pulmonary hypertension (SSc, 42 scleroderma-associated pulmonary arterial hypertensio patients (SSc-PAH, and 8 patients with SSc complicated by interstitial lung disease and pulmonary hypertension (SSc-PH-ILD were compared to the gene expression profiles of PBMCs from 41 healthy individuals. Multiple gene expression signatures were identified which could distinguish various disease groups from controls. One of these signatures, specific for erythrocyte maturation, is enriched specifically in patients with PH. This association was validated in multiple published datasets. The erythropoiesis signature was strongly correlated with hemodynamic measures of increasing disease severity in IPAH patients. No significant correlation of the same type was noted for SSc-PAH patients, this despite a clear signature enrichment within this group overall. These findings suggest an association of the erythropoiesis signature in PBMCs from patients with PH with a variable presentation among different subtypes of disease.In PH, the expansion of immature red blood cell precursors may constitute a response to the increasingly hypoxic conditions prevalent in this syndrome. A correlation of this erythrocyte signature with more severe hypertension cases may provide an important biomarker of disease progression.

  12. Tyrosine kinase receptor RON functions downstream of the erythropoietin receptor to induce expansion of erythroid progenitors

    NARCIS (Netherlands)

    van den Akker, Emile; van Dijk, Thamar; Parren-van Amelsvoort, Martine; Grossmann, Katja S.; Schaeper, Ute; Toney-Earley, Kenya; Waltz, Susan E.; Löwenberg, Bob; von Lindern, Marieke

    2004-01-01

    Erythropoietin (EPO) is required for cell survival during differentiation and for progenitor expansion during stress erythropoiesis. Although signaling pathways may couple directly to docking sites on the EPO receptor (EpoR), additional docking molecules expand the signaling platform of the

  13. Generalised Batho correction factor

    International Nuclear Information System (INIS)

    Siddon, R.L.

    1984-01-01

    There are various approximate algorithms available to calculate the radiation dose in the presence of a heterogeneous medium. The Webb and Fox product over layers formulation of the generalised Batho correction factor requires determination of the number of layers and the layer densities for each ray path. It has been shown that the Webb and Fox expression is inefficient for the heterogeneous medium which is expressed as regions of inhomogeneity rather than layers. The inefficiency of the layer formulation is identified as the repeated problem of determining for each ray path which inhomogeneity region corresponds to a particular layer. It has been shown that the formulation of the Batho correction factor as a product over inhomogeneity regions avoids that topological problem entirely. The formulation in terms of a product over regions simplifies the computer code and reduces the time required to calculate the Batho correction factor for the general heterogeneous medium. (U.K.)

  14. factores psicosociales asociados

    Directory of Open Access Journals (Sweden)

    María Teresa Varela Arévalo

    2007-01-01

    Full Text Available El objetivo de este trabajo fue describir el consumo de sustancias psicoactivas [SPA] ilegales en jóvenes y los factores psicosociales de riesgo y de protección asociados. Participaron 763 estudiantes (46,5% hombres y 52,4% mujeres de una universidad privada de Cali, quienes diligenciaron el cuestionario de factores de riesgo y protección para el consumo de drogas. Los resultados muestran que la marihuana fue la droga de mayor consumo; y que existe una fuerte asociación entre el consumo de las cuatro SPA ilegales (marihuana, opiáceos, cocaína y éxtasis y los factores psicosociales de riesgo y/o protección, principalmente, las habilidades de autocontrol, los preconceptos y valoración de las SPA, la relación con personas consumidoras y los comportamientos perturbadores.

  15. Multi-factor authentication

    Science.gov (United States)

    Hamlet, Jason R; Pierson, Lyndon G

    2014-10-21

    Detection and deterrence of spoofing of user authentication may be achieved by including a cryptographic fingerprint unit within a hardware device for authenticating a user of the hardware device. The cryptographic fingerprint unit includes an internal physically unclonable function ("PUF") circuit disposed in or on the hardware device, which generates a PUF value. Combining logic is coupled to receive the PUF value, combines the PUF value with one or more other authentication factors to generate a multi-factor authentication value. A key generator is coupled to generate a private key and a public key based on the multi-factor authentication value while a decryptor is coupled to receive an authentication challenge posed to the hardware device and encrypted with the public key and coupled to output a response to the authentication challenge decrypted with the private key.

  16. Human factors guides

    International Nuclear Information System (INIS)

    Penington, J.

    1995-10-01

    This document presents human factors guides, which have been developed in order to provide licensees of the AECB with advice as to how to address human factors issues within the design and assessment process. This documents presents the results of a three part study undertaken to develop three guides which are enclosed in this document as Parts B, C and D. As part of the study human factors standards, guidelines, handbooks and other texts were researched, to define those which would be most useful to the users of the guides and for the production of the guides themselves. Detailed specifications were then produced to outline the proposed contents and format of the three guides. (author). 100 refs., 3 tabs., 11 figs

  17. Human factors guides

    Energy Technology Data Exchange (ETDEWEB)

    Penington, J [PHF Services Inc., (Canada)

    1995-10-01

    This document presents human factors guides, which have been developed in order to provide licensees of the AECB with advice as to how to address human factors issues within the design and assessment process. This documents presents the results of a three part study undertaken to develop three guides which are enclosed in this document as Parts B, C and D. As part of the study human factors standards, guidelines, handbooks and other texts were researched, to define those which would be most useful to the users of the guides and for the production of the guides themselves. Detailed specifications were then produced to outline the proposed contents and format of the three guides. (author). 100 refs., 3 tabs., 11 figs.

  18. The focus factor

    DEFF Research Database (Denmark)

    Nicolaisen, Jeppe; Frandsen, Tove Faber

    2015-01-01

    Introduction. We present a new bibliometric indicator to measure journal specialisation over time, named the focus factor. This new indicator is based on bibliographic coupling and counts the percentage of re-citations given in subsequent years. Method. The applicability of the new indicator....... To validate re-citations as caused by specialisation, other possible causes were measured and correlated (obsolescence, journal self-citations and number of references). Results. The results indicate that the focus factor is capable of distinguishing between general and specialised journals and thus...... effectively measures the intended phenomenon (i.e., journal specialisation). Only weak correlations were found between journal re-citations and obsolescence, journal self-citations, and number of references. Conclusions. The focus factor successfully measures journal specialisation over time. Measures based...

  19. WRKY transcription factors

    Science.gov (United States)

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  20. On braid monodromy factorizations

    International Nuclear Information System (INIS)

    Kharlamov, V M; Kulikov, Vik S

    2003-01-01

    We introduce and develop a language of semigroups over the braid groups to study the braid monodromy factorizations (bmf's) of plane algebraic curves and other related objects. As an application, we give a new proof of Orevkov's theorem on the realization of bmf's over a disc by algebraic curves and show that the complexity of such a realization cannot be bounded in terms of the types of factors of the bmf. We also prove that the type of a bmf distinguishes Hurwitz curves with singularities of inseparable type up to H-isotopy and J-holomorphic cuspidal curves in CP 2 up to symplectic isotopy

  1. Dose conversion factors

    International Nuclear Information System (INIS)

    Kocher, D.C.; Eckerman, K.F.

    1992-01-01

    The following is discussed in this report: concepts and quantities used in calculating radiation dose from internal and external exposure. Tabulations of dose conversion factor for internal and external exposure to radionuclides. Dose conversion factors give dose per unit intake (internal) or dose per unit concentration in environment (external). Intakes of radionuclides for internal exposure and concentrations of radionuclides in environment for external exposure are assumed to be known. Intakes and concentrations are obtained, e.g., from analyses of environmental transport and exposure pathways. differences between dosimetry methods for radionuclides and hazardous chemicals are highlighted

  2. Factors stimulating content marketing

    Directory of Open Access Journals (Sweden)

    Naser Azad

    2016-02-01

    Full Text Available This paper presents an empirical investigation to determine factors influencing on content marketing in banking industry. The study designs a questionnaire consists of 40 questions in Likert scale and distributes it among 550 randomly selected regular customers of Bank Mellat in city of Tehran, Iran and 400 properly filled questionnaires are collected. Cronbach alphas for all components of the survey are well above desirable level. Using principle component analysis with Varimax rotation, the study has determined six factors influencing the most on content marketing including organization, details, having new ideas, quality, sensitivity and power while the last component contains only two subcomponents and is removed from the study.

  3. STEREOTYPICAL FACTORS IN TOURISM

    Directory of Open Access Journals (Sweden)

    Cristina-Elena ALBU

    2013-06-01

    Full Text Available International tourism has grown rapidly nowdays, contributing to the growth of the global economy. The purpose of this essay is to identify and analyze stereotypical factors in the development of strategies concerning the offer for the tourism industry: the image of a tourist destination, brand, country of origin and customer behaviour. Documentary study was the research method used: representative articles were analysed, as recent as possible, to determine the factors mentioned above. Professionals in the industry of tourism need to understand cultural differences between tourists, as well as those of the host country, to be able to create tourist reception offers that live up to the standards expected by clients.

  4. Factor analysis and scintigraphy

    International Nuclear Information System (INIS)

    Di Paola, R.; Penel, C.; Bazin, J.P.; Berche, C.

    1976-01-01

    The goal of factor analysis is usually to achieve reduction of a large set of data, extracting essential features without previous hypothesis. Due to the development of computerized systems, the use of largest sampling, the possibility of sequential data acquisition and the increase of dynamic studies, the problem of data compression can be encountered now in routine. Thus, results obtained for compression of scintigraphic images were first presented. Then possibilities given by factor analysis for scan processing were discussed. At last, use of this analysis for multidimensional studies and specially dynamic studies were considered for compression and processing [fr

  5. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I

    2012-01-01

    mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...

  6. Factorizations and physical representations

    International Nuclear Information System (INIS)

    Revzen, M; Khanna, F C; Mann, A; Zak, J

    2006-01-01

    A Hilbert space in M dimensions is shown explicitly to accommodate representations that reflect the decomposition of M into prime numbers. Representations that exhibit the factorization of M into two relatively prime numbers: the kq representation (Zak J 1970 Phys. Today 23 51), and related representations termed q 1 q 2 representations (together with their conjugates) are analysed, as well as a representation that exhibits the complete factorization of M. In this latter representation each quantum number varies in a subspace that is associated with one of the prime numbers that make up M

  7. Model Correction Factor Method

    DEFF Research Database (Denmark)

    Christensen, Claus; Randrup-Thomsen, Søren; Morsing Johannesen, Johannes

    1997-01-01

    The model correction factor method is proposed as an alternative to traditional polynomial based response surface techniques in structural reliability considering a computationally time consuming limit state procedure as a 'black box'. The class of polynomial functions is replaced by a limit...... of the model correction factor method, is that in simpler form not using gradient information on the original limit state function or only using this information once, a drastic reduction of the number of limit state evaluation is obtained together with good approximations on the reliability. Methods...

  8. [Natural factors influencing sleep].

    Science.gov (United States)

    Jurkowski, Marek K; Bobek-Billewicz, Barbara

    2007-01-01

    Sleep is a universal phenomenon of human and animal lives, although the importance of sleep for homeo-stasis is still unknown. Sleep disturbances influence many behavioral and physiologic processes, leading to health complications including death. On the other hand, sleep improvement can beneficially influence the course of healing of many disorders and can be a prognostic of health recovery. The factors influencing sleep have different biological and chemical origins. They are classical hormones, hypothalamic releasing and inhibitory hormones, neuropeptides, peptides and others as cytokines, prostaglandins, oleamid, adenosine, nitric oxide. These factors regulate most physiologic processes and are likely elements integrating sleep with physiology and physiology with sleep in health and disorders.

  9. Brain-Derived Neurotrophic Factor Increases Synaptic Protein Levels via the MAPK/Erk Signaling Pathway and Nrf2/Trx Axis Following the Transplantation of Neural Stem Cells in a Rat Model of Traumatic Brain Injury.

    Science.gov (United States)

    Chen, Tao; Wu, Yu; Wang, Yuzi; Zhu, Jigao; Chu, Haiying; Kong, Li; Yin, Liangwei; Ma, Haiying

    2017-11-01

    Brain-derived neurotrophic factor (BDNF) plays an important role in promoting the growth, differentiation, survival and synaptic stability of neurons. Presently, the transplantation of neural stem cells (NSCs) is known to induce neural repair to some extent after injury or disease. In this study, to investigate whether NSCs genetically modified to encode the BDNF gene (BDNF/NSCs) would further enhance synaptogenesis, BDNF/NSCs or naive NSCs were directly engrafted into lesions in a rat model of traumatic brain injury (TBI). Immunohistochemistry, western blotting and RT-PCR were performed to detect synaptic proteins, BDNF-TrkB and its downstream signaling pathways, at 1, 2, 3 or 4 weeks after transplantation. Our results showed that BDNF significantly increased the expression levels of the TrkB receptor gene and the phosphorylation of the TrkB protein in the lesions. The expression levels of Ras, phosphorylated Erk1/2 and postsynaptic density protein-95 were elevated in the BDNF/NSCs-transplanted groups compared with those in the NSCs-transplanted groups throughout the experimental period. Moreover, the nuclear factor (erythroid-derived 2)-like 2/Thioredoxin (Nrf2/Trx) axis, which is a specific therapeutic target for the treatment of injury or cell death, was upregulated by BDNF overexpression. Therefore, we determined that the increased synaptic proteins level implicated in synaptogenesis might be associated with the activation of the MAPK/Erk1/2 signaling pathway and the upregulation of the antioxidant agent Trx modified by BDNF-TrkB following the BDNF/NSCs transplantation after TBI.

  10. Der-p2 (Dermatophagoides pteronyssinus) allergen-like protein from the hard tick Ixodes ricinus - a novel member of ML (MD-2-related lipid-recognition) domain protein family

    Czech Academy of Sciences Publication Activity Database

    Horáčková, Jana; Rudenko, Natalia; Golovchenko, Maryna; Grubhoffer, Libor

    2010-01-01

    Roč. 137, č. 7 (2010), s. 1139-1149 ISSN 0031-1820 R&D Projects: GA ČR(CZ) GA524/06/1479 Institutional research plan: CEZ:AV0Z60220518 Keywords : Der-p2 allergen-like protein * Ixodes ricinus * tick, * ML protein family * IgE-binding activity Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.522, year: 2010

  11. Environmental factors and leukaemia

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, L

    1985-01-01

    Investigations on the association between environmental hazards and the development of various types of leukaemia are reviewed. Regarding acute non-lymphocytic leukaemia (ANLL) exposure to ionizing radiation is a well-documented risk factor. According to several recent studies exposure to strong electromagnetic fields may be suspected to be of etiologic importance for ANLL. There is evidence that occupational handling of benzene is a risk factor and other organic solvents may also be leukaemogenic. Occupational exposure to petrol products has been proposed to be a risk factor although the hazardous substances have not yet been defined. Results of cytogenetic studies in ANLL suggest that exposure to certain environmental agents may be associated with relatively specific clonal chromosome aberrations. Exposure in utero to ionizing radiation has been proposed to be a risk factor for acute lymphocytic leukaemia (ALL) in children. Unlike ANLL there seems at present to be little evidence that ALL is related to exposure to some chemicals. Chronic myeloid leukaemia (CML) may follow exposure to high doses of ionizing radiation whereas such exposure seems to be of insignificant importance for the development of chronic lymphocytic leukaemia (CLL). According to some studies an abnormally high incidence of CLL may be found among farmers in the USA. These results have not been confirmed in Scandinavian studies. There seems to be little evidence that CML or CLL are related to occupational handling of some chemicals. 35 references.

  12. Hyperglycemia: a prothrombotic factor?

    NARCIS (Netherlands)

    Lemkes, B. A.; Hermanides, J.; DeVries, J. H.; Holleman, F.; Meijers, J. C. M.; Hoekstra, J. B. L.

    2010-01-01

    Diabetes mellitus is characterized by a high risk of atherothrombotic events. What is more, venous thrombosis has also been found to occur more frequently in this patient group. This prothrombotic condition in diabetes is underpinned by laboratory findings of elevated coagulation factors and

  13. Thermal disadvantage factor

    International Nuclear Information System (INIS)

    Abdullah, K.M.S.; Loyalka, S.K.

    1990-01-01

    A method is described where reactor cell flux and the disadvantage factor are calculated by using diffusion theory in the moderator and integral transport in the fuel. The method is efficient (noniterative) and provides results that agree well with Monte Carlo, P 5 and ABH results

  14. Threshold factorization redux

    Science.gov (United States)

    Chay, Junegone; Kim, Chul

    2018-05-01

    We reanalyze the factorization theorems for the Drell-Yan process and for deep inelastic scattering near threshold, as constructed in the framework of the soft-collinear effective theory (SCET), from a new, consistent perspective. In order to formulate the factorization near threshold in SCET, we should include an additional degree of freedom with small energy, collinear to the beam direction. The corresponding collinear-soft mode is included to describe the parton distribution function (PDF) near threshold. The soft function is modified by subtracting the contribution of the collinear-soft modes in order to avoid double counting on the overlap region. As a result, the proper soft function becomes infrared finite, and all the factorized parts are free of rapidity divergence. Furthermore, the separation of the relevant scales in each factorized part becomes manifest. We apply the same idea to the dihadron production in e+e- annihilation near threshold, and show that the resultant soft function is also free of infrared and rapidity divergences.

  15. Fibroblast growth factor 23

    African Journals Online (AJOL)

    Dr Olaleye

    Systemic phosphate homeostasis is maintained through several hormonal mechanisms which involve fibroblast growth factor 23 (FGF-23), α-klotho, vitamin D and parathyroid hormone. FGF-23 is known to be the major regulator of phosphate balance (Mirams et al., 2004). FGF-23 is a phosphaturic hormone, which is.

  16. Human factors information system

    International Nuclear Information System (INIS)

    Goodman, P.C.; DiPalo, C.A.

    1991-01-01

    Nuclear power plant safety is dependent upon human performance related to plant operations. To provide improvements in human performance, data collection and assessment play key roles. This paper reports on the Human factors Information System (HFIS) which is designed to meet the needs of the human factors specialists of the United States Nuclear Regulatory Commission. These specialists identify personnel errors and provide guidance designed to prevent such errors. HFIS is a simple and modular system designed for use on a personal computer. It is designed to contain four separate modules that provide information indicative of program or function effectiveness as well as safety-related human performance based on programmatic and performance data. These modules include the Human Factors Status module; the Regulatory Programs module; the Licensee Event Report module; and the Operator Requalification Performance module. Information form these modules can either be used separately or can be combined due to the integrated nature of the system. HFIS has the capability, therefore, to provide insights into those areas of human factors that can reduce the probability of events caused by personnel error at nuclear power plants and promote the health and safety of the public. This information system concept can be applied to other industries as well as the nuclear industry

  17. PATTERNS AND FACTORS INVOLVED

    African Journals Online (AJOL)

    Between 1*' of July 1996 and 30'h of June 2000 a total of 3583 patients were registered at the accident and emergency unit of Nnamdi. Azikiwe ... The case files of these were reviewed with a view to ascertaining the causes and factors involved in the deaths of these patients. The .... H.I.V/AIDS related complications 23 6.8.

  18. Introduction to human factors

    International Nuclear Information System (INIS)

    Winters, J.M.

    1988-03-01

    Some background is given on the field of human factors. The nature of problems with current human/computer interfaces is discussed, some costs are identified, ideal attributes of graceful system interfaces are outlined, and some reasons are indicated why it's not easy to fix the problems

  19. Prognostic factors in oligodendrogliomas

    DEFF Research Database (Denmark)

    Westergaard, L; Gjerris, F; Klinken, L

    1997-01-01

    An outcome analysis was performed on 96 patients with pure cerebral oligodendrogliomas operated in the 30-year period 1962 to 1991. The most important predictive prognostic factors were youth and no neurological deficit, demonstrated as a median survival for the group younger than 20 years of 17...

  20. Factors affecting mining costs

    International Nuclear Information System (INIS)

    Lowell, A.F.

    1977-01-01

    The subject is discussed under the following headings: investment decision-making, unit cost factors (declining ore grade, low-price contracts, ore grade/output relationship, above average cost increases). Economic, environmental, sociological and political aspects are considered. (U.K.)

  1. Human factors in network security

    OpenAIRE

    Jones, Francis B.

    1991-01-01

    Human factors, such as ethics and education, are important factors in network information security. This thesis determines which human factors have significant influence on network security. Those factors are examined in relation to current security devices and procedures. Methods are introduced to evaluate security effectiveness by incorporating the appropriate human factors into network security controls

  2. Electromagnetic form factors

    International Nuclear Information System (INIS)

    Desplanques, B.

    1987-01-01

    Electromagnetic form factors, in first approximation, are sensitive to spatial distribution of nucleons and to their current. In second approximation, more precise effects are concerned, whose role is increasing with momentum transfer and participating essentially of short range nuclei description. They concern of course the nucleon-nucleon interaction while approaching each other and keeping their free-state identity, but also mutually polarizing one the other. In this last effect, radial and orbital excitations of nucleon, the nucleon mesonic cloud modification and the nucleon antinucleon pair excitation are included. In this paper, these contributions are discussed while trying to find the important elements for a good description of form factors. Current questions are also discussed. Light nuclei are essentially concerned [fr

  3. Researching organizational factors

    International Nuclear Information System (INIS)

    Coffman, F.

    1991-01-01

    This paper discusses feedback and insights from experience (both successful and unsuccessful) with the past and the ongoing organizational factors research. That experience suggests a leading set of ingredients that appear proper for performing regulatory research on organizational processes. By keeping focused upon these proper ingredients, the research will contribute to the regulatory assessments of utility management through the use of improved methods and measures in investigations, inspections, diagnostics, performance indicators, and PRA insights. This paper is organized into (1) an introductory description of what the agency is doing to assess organizational effectiveness, (2) some insights from past and ongoing research, (3) an opinion on a leading set of ingredients to properly research organizational factors, and (4) a summary

  4. On braid monodromy factorizations

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamov, V M [Institut de Recherche Matematique Avanee Universite Louis Pasteur et CNRS 7 rue Rene Descartes (France); Kulikov, Vik S [Steklov Mathematical Institute, Russian Academy of Sciences (Russian Federation)

    2003-06-30

    We introduce and develop a language of semigroups over the braid groups to study the braid monodromy factorizations (bmf's) of plane algebraic curves and other related objects. As an application, we give a new proof of Orevkov's theorem on the realization of bmf's over a disc by algebraic curves and show that the complexity of such a realization cannot be bounded in terms of the types of factors of the bmf. We also prove that the type of a bmf distinguishes Hurwitz curves with singularities of inseparable type up to H-isotopy and J-holomorphic cuspidal curves in CP{sup 2} up to symplectic isotopy.

  5. Factors in Agile Methods Adoption

    Directory of Open Access Journals (Sweden)

    Samia Abdalhamid

    2017-05-01

    Full Text Available There are many factors that can affect the process of adopting Agile methods during software developing. This paper illustrates the critical factors in Agile methods adoption in software organizations. To present the success and failure factors, an exploratory study is carried out among the critical factors of success and failure from existing studies. Dimensions and Factors are introduced utilizing success and failure dimensions. The mind map was used to clarify these factors.

  6. Factors of academic procrastination

    OpenAIRE

    Kranjec, Eva; Košir, Katja; Komidar, Luka

    2017-01-01

    This study investigated dimensions of perfectionism, anxiety, and depression as factors of academic procrastination. Our main research interest was to examine the role of specific dimensions of perfectionism as moderators in the relationship between anxiety and depression and academic procrastination. Four scales were administered on the sample of 403 students: perfectionism scale FMPS, academic procrastination scale APS-SI, depression scale CESD and anxiety scale STAI-X2. The results showed ...

  7. Concentration factors for fish

    International Nuclear Information System (INIS)

    Feldt, W.; Lauer, R.; Melzer, M.; Siebert, W.

    1978-01-01

    Concentration factors are defined as operators allowing to calculate the specific activity of fish meat from a given concentration of an element in the water. This parameter depends among others from the content of stable isotopes and homologues in the different waters. If this parameter is reasonably to be used for model calculations it must be referred to water with all of its content substances, these calculations also being based on this type of 'water'. (orig.) [de

  8. Prognostic factors for medulloblastoma

    International Nuclear Information System (INIS)

    Jenkin, Derek; Al Shabanah, Mohamed; Al Shail, Essam; Gray, Alan; Hassounah, Maher; Khafaga, Yasser; Kofide, Amani; Mustafa, Mahmoud; Schultz, Henrik

    2000-01-01

    Purpose: To evaluate prognostic factors for medulloblastoma. Methods and Materials: One hundred and seventy-three consecutive patients with medulloblastoma, treated at King Faisal Specialist Hospital (KFSH) from 1988-1997, were reviewed. Eighty-four percent were children less than 15 years old. From 1988-1994, treatment was at the discretion of the investigator. From 1994-1998, patients entered a single-arm best practice protocol in which, in staged patients, the surgical intent was total resection, standard radiation treatment was defined, and adjuvant chemotherapy was given to a 'high-risk' subset. Results: For 150 patients who completed surgical and radiation treatment, the 5-year survival rate was 58%, compared with 0% for 16 patients who were unable to start or complete radiation treatment. For staged patients, the 5-year survival was M0 + M1, 78% and M2 + M3, 21% (p 14 years and gross cystic/necrotic features in the primary tumor. The size of the primary tumor, the degree of hydrocephalus at diagnosis, the presence of residual tumor in the post-operative CT/MRI, and the functional status of the patient prior to radiation treatment were not significant factors. Conclusions: Stage M0 + M1 was the most powerful favorable prognostic factor. In Saudi Arabia more patients present with advanced disseminated disease, 41% M2 + M3, than in the West, and this impacts adversely on overall survival. Total resection and standard radiation treatment were not sensitive prognostic factors in a treatment environment in which 78% of patients underwent at least 90% tumor resection and 60% received standard radiation treatment. In order to improve the proportion of patients able to complete radiation treatment, consideration should be given to limiting resection when the attainment of total resection is likely to be morbid, and to delaying rather than omitting radiation treatment in the patient severely compromised postoperatively

  9. Risk factors for cancer

    International Nuclear Information System (INIS)

    Lyman, G.H.

    1992-01-01

    It is no longer reasonable to divide cancers into those that are genetic in origin and those that are environmental in origin. With rare exception, carcinogenesis involves environmental factors that directly or indirectly exert a change in the cell's genome. Virtually all causes of cancer are multifactorial, sometimes involving an inherited predisposition to the carcinogenic effects of environmental factors, which include chemicals, ionizing radiation, and oncogenic virus. Carcinogenesis is a multistep process including induction, promotion, and progression. Initiation requires an irreversible change in the cellular genome, whereas promotion is commonly associated with prolonged and reversible exposure. Tumor progression results in genotypic and phenotypic changes associated with tumor growth, invasion, and metastasis. Most information on human cancer risk is based on epidemiologic studies involving both exposed and unexposed individuals. The quality of such studies depends on their ability to assess the strength of any association of exposure and disease and careful attention to any potential bias. Few cancers are inherited in a Mendelian fashion. Several preneoplastic conditions, however, are clearly inherited and several malignancies demonstrate weak familial patterns. Environmental factors may exert their effect on DNA in a random fashion, but certain consistent changes, including specific translocations of genetic information, are often found. Currently, there is great interest in the close proximity of certain oncogenes governing growth control to the consistent chromosomal changes observed. Such changes may represent a final common pathway of action for environmental carcinogens. Sufficient laboratory and epidemiologic evidence exists to establish a causal association of several chemical agents with cancer

  10. Human factoring administrative procedures

    International Nuclear Information System (INIS)

    Grider, D.A.; Sturdivant, M.H.

    1991-01-01

    In nonnuclear business, administrative procedures bring to mind such mundane topics as filing correspondence and scheduling vacation time. In the nuclear industry, on the other hand, administrative procedures play a vital role in assuring the safe operation of a facility. For some time now, industry focus has been on improving technical procedures. Significant efforts are under way to produce technical procedure requires that a validated technical, regulatory, and administrative basis be developed and that the technical process be established for each procedure. Producing usable technical procedures requires that procedure presentation be engineered to the same human factors principles used in control room design. The vital safety role of administrative procedures requires that they be just as sound, just a rigorously formulated, and documented as technical procedures. Procedure programs at the Tennessee Valley Authority and at Boston Edison's Pilgrim Station demonstrate that human factors engineering techniques can be applied effectively to technical procedures. With a few modifications, those same techniques can be used to produce more effective administrative procedures. Efforts are under way at the US Department of Energy Nuclear Weapons Complex and at some utilities (Boston Edison, for instance) to apply human factors engineering to administrative procedures: The techniques being adapted include the following

  11. Human Factors Review Plan

    International Nuclear Information System (INIS)

    Paramore, B.; Peterson, L.R.

    1985-12-01

    ''Human Factors'' is concerned with the incorporation of human user considerations into a system in order to maximize human reliability and reduce errors. This Review Plan is intended to assist in the assessment of human factors conditions in existing DOE facilities. In addition to specifying assessment methodologies, the plan describes techniques for improving conditions which are found to not adequately support reliable human performance. The following topics are addressed: (1) selection of areas for review describes techniques for needs assessment to assist in selecting and prioritizing areas for review; (2) human factors engineering review is concerned with optimizing the interfaces between people and equipment and people and their work environment; (3) procedures review evaluates completeness and accuracy of procedures, as well as their usability and management; (4) organizational interface review is concerned with communication and coordination between all levels of an organization; and (5) training review evaluates training program criteria such as those involving: trainee selection, qualification of training staff, content and conduct of training, requalification training, and program management

  12. Human Factors Review Plan

    Energy Technology Data Exchange (ETDEWEB)

    Paramore, B.; Peterson, L.R. (eds.)

    1985-12-01

    ''Human Factors'' is concerned with the incorporation of human user considerations into a system in order to maximize human reliability and reduce errors. This Review Plan is intended to assist in the assessment of human factors conditions in existing DOE facilities. In addition to specifying assessment methodologies, the plan describes techniques for improving conditions which are found to not adequately support reliable human performance. The following topics are addressed: (1) selection of areas for review describes techniques for needs assessment to assist in selecting and prioritizing areas for review; (2) human factors engineering review is concerned with optimizing the interfaces between people and equipment and people and their work environment; (3) procedures review evaluates completeness and accuracy of procedures, as well as their usability and management; (4) organizational interface review is concerned with communication and coordination between all levels of an organization; and (5) training review evaluates training program criteria such as those involving: trainee selection, qualification of training staff, content and conduct of training, requalification training, and program management.

  13. Human and Organizational Factors

    International Nuclear Information System (INIS)

    Eshiett, P.B.S.

    2016-01-01

    The Human and Organizational Factors Approach to Industrial Safety (HOFS) consists of identifying and putting in place conditions which encourage a positive contribution from operators (individually and in a team) with regards to industrial safety. The knowledge offered by the HOFS approach makes it possible better to understand what conditions human activity and to act on the design of occupational situations and the organization, in the aim of creating the conditions for safe work. Efforts made in this area can also lead to an improvement in results in terms of the quality of production or occupational safety (incidence and seriousness rates) (Daniellou, F., et al., 2011). Research on industrial accidents shows that they rarely happen as a result of a single event, but rather emerge from the accumulation of several, often seemingly trivial, malfunctions, misunderstandings, incorrect assumptions and other issues. The nuclear community has established rigorous international safety standards and concepts to ensure the protection of people and the environment from harmful effects of ionizing radiation (IAEA, 2014). A review of major human induced disasters in a number of countries and in different industries yields insights into several of the human and organizational factors involved in their occurrence. Some of these factors relate to failures in: • Design or technology; • Training; • Decision making; • Communication; • Preparation for the unexpected; • Understanding of organizational interdependencies

  14. Molecular factors in migraine

    Science.gov (United States)

    Kowalska, Marta; Prendecki, Michał; Kozubski, Wojciech; Lianeri, Margarita; Dorszewska, Jolanta

    2016-01-01

    Migraine is a common neurological disorder that affects 11% of adults worldwide. This disease most likely has a neurovascular origin. Migraine with aura (MA) and more common form - migraine without aura (MO) – are the two main clinical subtypes of disease. The exact pathomechanism of migraine is still unknown, but it is thought that both genetic and environmental factors are involved in this pathological process. The first genetic studies of migraine were focused on the rare subtype of MA: familial hemiplegic migraine (FHM). The genes analysed in familial and sporadic migraine are: MTHFR, KCNK18, HCRTR1, SLC6A4, STX1A, GRIA1 and GRIA3. It is possible that migraine is a multifactorial disease with polygenic influence. Recent studies have shown that the pathomechanisms of migraine involves both factors responsible for immune response and oxidative stress such as: cytokines, tyrosine metabolism, homocysteine; and factors associated with pain transmission and emotions e.g.: serotonin, hypocretin-1, calcitonin gene-related peptide, glutamate. The correlations between genetic variants of the HCRTR1 gene, the polymorphism 5-HTTLPR and hypocretin-1, and serotonin were observed. It is known that serotonin inhibits the activity of hypocretin neurons and may affect the appearance of the aura during migraine attack. The understanding of the molecular mechanisms of migraine, including genotype-phenotype correlations, may contribute to finding markers important for the diagnosis and treatment of this disease. PMID:27191890

  15. Structuring factoring business: accounting aspects

    Directory of Open Access Journals (Sweden)

    I.M. Vygivska

    2017-08-01

    Full Text Available The article theoretically substantiates the fact that factoring belongs to the main operational activity of a factoring company, and this allowed structuring the factoring business by types of activity. The lack of a unified approach to the classification of factoring (factoring services made it possible to systematize and refine their classification as a basis for developing accounting and analytical support for risk management of factoring business. The authors single out such classification signs as: the right of the reverse claim (reverse, irretrievable, a territorial feature (international, internal, the subject of the factoring contract (real, consensual, the availability of notification of the debtor (conventional, confidential. The structuring of factoring business contributes to the identification of the risks of the economic activities of a factoring company depending on the type of factoring, the development of methodological support for the bookkeeping of factoring transactions in a risk environment, the search for risk management practices and the determination of management effectiveness in general.

  16. Milestones and Impact Factors

    Directory of Open Access Journals (Sweden)

    Grandjean Philippe

    2010-07-01

    Full Text Available Abstract Environmental Health has just received its first Impact Factor by Thomson ISI. At a level of 2.48, this achievement is quite satisfactory and places Environmental Health in the top 25% of environmental science journals. When the journal was launched in 2002, it was still unclear whether the Open Access publishing model could be made into a viable commercial enterprise within the biomedical field. During the past eight years, Open Access journals have become widely available, although still covering only about 15% of journal titles. Major funding agencies and institutions, including prominent US universities, now require that researchers publish in Open Access journals. Because of the profound role of scientific journals for the sharing of results and communication between researchers, the advent of Open Access may be of as much significance as the transition from handwriting to printing via moveable type. As Environmental Health is an electronic Open Access journal, the numbers of downloads at the journal website can be retrieved. The top-20 list of articles most frequently accessed shows that all of them have been downloaded over 10,000 times. Back in 2002, the first article published was accessed only 49 times during the following month. A year later, the server had over 1,000 downloads per month, and now the total number of monthly downloads approaches 50,000. These statistics complement the Impact Factor and confirm the viability of Open Access in our field of research. The advent of digital media and its decentralized mode of distribution - the internet - have dramatically changed the control and financing of scientific information dissemination, while facilitating peer review, accelerating editorial handling, and supporting much needed transparency. Both the meaning and means of "having an impact" are therefore changing, as will the degree and way in which scientific journals remain "factors" in that impact.

  17. Factor 4 planning

    International Nuclear Information System (INIS)

    Bariol-Mathais, Brigitte; Lavoillotte, Philippine; Gall-Sorrentino, Florence; Malez, Marianne; Sanna, Daniela; Marsauche, Maud; Marquet, Sarah; Debergue, Sophie; Aminu, Olufunmi; Bernard, Helene; Marchand, Jean-Michel; Blin, Frederic; Grange, Jerome; Caillierez, Sophie; Muller, Dania; Clement, Bob; Desire, Jean-Charles; Metais, Benedicte; Lannuzel, Philippe; Pezet-Kuhn, Murielle; Pons, Anne; Rivoire-Meley, Benedicte; Tissot, Heloise

    2015-07-01

    Factor 4 is the goal of cutting our greenhouse gas emissions by 75% by 2050. Achieving this objective will necessitate radical changes in our practices, in particular concerning transport and housing; the measures currently implemented, such as positive-energy buildings, low-impact mobility and eco-neighbourhoods, will not be enough to meet this goal. These measures must be conceived in the framework of broad territorial planning that integrates environmental and energy objectives far upstream. To this end, the French Environment and Energy Management Agency (ADEME) and the French network of Urban Planning Agencies (FNAU), pursuing their missions in their respective areas of competence, have joined forces to make infrastructure and land use planning an integral part of the environmental and energy transition process. In 2013, the two organisations signed a partnership agreement and compiled an inventory of practices that are relevant to Factor 4 planning. This work was led by Epures, Saint-etienne urban planning agency, along with FNAU, drawing upon the expertise of a dozen urban planning agencies in precursor territories. This inventory describes the stakes, resources and strengths for each territory, which have led to cross-sectoral territorial planning exercises with ambitious environmental and energy objectives; the importance of evaluation in attaining these goals is emphasised. Current experience, questions and available methodological tools are summarised in this document, to encourage territories and help them design their planning policies along a trajectory to achieve Factor 4 goals. The compilation also aims to be a contribution to the COP21 climate conference

  18. Accidents and human factors

    International Nuclear Information System (INIS)

    Nishiwaki, Y.; Kawai, H.; Morishima, H.; Terano, T.; Sugeno, M.

    1984-01-01

    When the TMI accident occurred it was 4 a.m., an hour when the error potential of the operators would have been very high. The frequency of car and train accidents in Japan is also highest between 4 a.m. and 6 a.m. The error potential may be classified into five phases corresponding to the electroencephalogramic pattern (EEG). At phase 0, when the delta wave appears, a person is unconscious and in deep sleep; at phase I, when the theta wave appears, he is very tired, sleepy and subnormal; at phase II, when the alpha wave appears, he is normal, relaxed and passive; at phase III, when the beta wave appears, he is normal, clear-minded and active; at phase IV, when the strong beta or epileptic wave appears, he is hypernormal, excited and incapable of normal judgement. Should an accident occur at phase II, the brain condition may jump to phase IV. At this phase the error or accident potential is maximum. The response of the human brain to different types of noises and signals may vary somewhat for different individuals and for different groups of people. Therefore, the possibility that such differences in brain functions may influence the mental structure would be worthy of consideration in human factors and in the design of man-machine systems. Human reliability and performance would be affected by many factors: medical, physiological and psychological, etc. The uncertainty involved in human factors may not necessarily be probabilistic, but fuzzy. Therefore, it would be important to develop a theory by which both non-probabilistic uncertainties, or fuzziness, of human factors and the probabilistic properties of machines can be treated consistently. From the mathematical point of view, probabilistic measure is considered a special case of fuzzy measure. Therefore, fuzzy set theory seems to be an effective tool for analysing man-machine systems. To minimize human error and the possibility of accidents, new safety systems should not only back up man and make up for his

  19. Speeding Fermat's factoring method

    Science.gov (United States)

    McKee, James

    A factoring method is presented which, heuristically, splits composite n in O(n^{1/4+epsilon}) steps. There are two ideas: an integer approximation to sqrt(q/p) provides an O(n^{1/2+epsilon}) algorithm in which n is represented as the difference of two rational squares; observing that if a prime m divides a square, then m^2 divides that square, a heuristic speed-up to O(n^{1/4+epsilon}) steps is achieved. The method is well-suited for use with small computers: the storage required is negligible, and one never needs to work with numbers larger than n itself.

  20. Improved Balanced Incomplete Factorization

    Czech Academy of Sciences Publication Activity Database

    Bru, R.; Marín, J.; Mas, J.; Tůma, Miroslav

    2010-01-01

    Roč. 31, č. 5 (2010), s. 2431-2452 ISSN 0895-4798 R&D Projects: GA AV ČR IAA100300802 Grant - others:GA AV ČR(CZ) M100300902 Institutional research plan: CEZ:AV0Z10300504 Source of funding: I - inštitucionálna podpora na rozvoj VO Keywords : preconditioned iterative methods * sparse matrices * incomplete decompositions * approximate inverses * Sherman-Morrison formula * nonsymmetric matrices Subject RIV: BA - General Mathematics Impact factor: 1.725, year: 2010

  1. Sleep-inducing factors.

    Science.gov (United States)

    García-García, Fabio; Acosta-Peña, Eva; Venebra-Muñoz, Arturo; Murillo-Rodríguez, Eric

    2009-08-01

    Kuniomi Ishimori and Henri Piéron were the first researchers to introduce the concept and experimental evidence for a chemical factor that would presumably accumulate in the brain during waking and eventually induce sleep. This substance was named hypnotoxin. Currently, the variety of substances which have been shown to alter sleep includes peptides, cytokines, neurotransmitters and some substances of lipidic nature, many of which are well known for their involvement in other biological activities. In this chapter, we describe the sleep-inducing properties of the vasoactive intestinal peptide, prolactin, adenosine and anandamide.

  2. "Factor Analysis Using ""R"""

    Directory of Open Access Journals (Sweden)

    A. Alexander Beaujean

    2013-02-01

    Full Text Available R (R Development Core Team, 2011 is a very powerful tool to analyze data, that is gaining in popularity due to its costs (its free and flexibility (its open-source. This article gives a general introduction to using R (i.e., loading the program, using functions, importing data. Then, using data from Canivez, Konold, Collins, and Wilson (2009, this article walks the user through how to use the program to conduct factor analysis, from both an exploratory and confirmatory approach.

  3. Perinatal risk factors for strabismus

    DEFF Research Database (Denmark)

    Torp-Pedersen, Tobias; Boyd, Heather A; Poulsen, Gry

    2010-01-01

    Little is known about the aetiological factors underlying strabismus. We undertook a large cohort study to investigate perinatal risk factors for strabismus, overall and by subtype.......Little is known about the aetiological factors underlying strabismus. We undertook a large cohort study to investigate perinatal risk factors for strabismus, overall and by subtype....

  4. Activation of human factor V by factor Xa and thrombin

    International Nuclear Information System (INIS)

    Monkovic, D.D.; Tracy, P.B.

    1990-01-01

    The activation of human factor V by factor Xa and thrombin was studied by functional assessment of cofactor activity and sodium dodecyl sulfate-polycarylamide gel electrophoresis followed by either autoradiography of 125 I-labeled factor V activation products or Western blot analyses of unlabeled factor V activation products. Cofactor activity was measured by the ability of the factor V/Va peptides to support the activation of prothrombin. The factor Xa catalyzed cleavage of factor V was observed to be time, phospholipid, and calcium ion dependent, yielding a cofactor with activity equal to that of thrombin-activated factor V (factor Va). The cleavage pattern differed markedly from the one observed in the bovine system. The factor Xa activated factor V subunits expressing cofactor activity were isolated and found to consist of peptides of M r 220,000 and 105,000. Although thrombin cleaved the M r 220,000 peptide to yield peptides previously shown to be products of thrombin activation, cofactor activity did not increase. N-Terminal sequence analysis confirmed that both factor Xa and thrombin cleave factor V at the same bond to generate the M r 220,000 peptide. The factor Xa dependent functional assessment of 125 I-labeled factor V coupled with densitometric analyses of the cleavage products indicated that the cofactor activity of factor Xa activated factor V closely paralleled the appearance of the M r 220,000 peptide. The data indicate that factor Xa is as efficient an enzyme toward factor V as thrombin

  5. Organizational factors in Korean NPPs

    International Nuclear Information System (INIS)

    Jang, D. J.; Kim, Y. I.; Jeong, C. H.; Kim, J. W.

    2003-01-01

    Organizational factors are referred to as the factors that influence the achievement of a goal of an organization. Latent problems of an organization could contribute to causing human errors in such stages as design, operation and maintenance, and furthermore, leading to an severe accident. In order to evaluate an organization from the safety viewpoint, it is necessary to identify the organizational factors in a systematic fashion. In this paper, some efforts to identify the organizational factors in Korean NPPs are presented. The study was performed in the following steps: 1) Reviewing the definitions and range of the organizational factors used by the previous 13 researches, 2) Structuring the organizational factors by screening and collating factors, 3) Analysing the organizational factors that is considered to have contributed to the trip events based on the trip report of Korean NPPs, 4) Suggesting a more reliable taxonomy of organizational factors for event analysis by applying the Onion Structure Model to the selected factors

  6. Risk Factors in Pemphigus

    Directory of Open Access Journals (Sweden)

    Gülşen Tükenmez Demirc

    2011-09-01

    Full Text Available Background and Design: There have been reports suggesting the involvement of environmental factors in the disease process of pemphigus. In this study, we aimed to find out the risk factors which could play role in the etiopathogenesis in our pemphigus patients.Material and method: A total of 42 patients (15 male and 27 female who were diagnosed as pemphigus with histopathological and direct immunoflurosence examinations in our clinic between the years 1998-2004, were interviewed for assessment of regarding with the subjects of the demographic properties, occupational groups, educational level, the number of pregnancies, stressfull life events, diet habits, smoking and alcohol consumption before the onset of the disease and the results were compared to 42 age and gender-matched controls with similar socioeconomic circumstances. Results: Working in agriculture and livestock, multi-parity, absence of smoking and stressfull life events were found to be statistically significant in pemphigus patients than in controls. Conclusion: Working in agriculture and livestock, multi-parity, absence of smoking and stressfull life events were assumed to play role in the etiopathogenesis and course of pemphigus.

  7. Let the sun shine in: mechanisms and potential for therapeutics in skin photodamage.

    Science.gov (United States)

    Wondrak, Georg T

    2007-05-01

    Photoaging and photocarcinogenesis are the two Janus faces of skin photodamage. Reactivity-based design of prototype agents that antagonize, modulate and reverse the chemistry of skin photodamage holds promise in delivering unprecedented therapeutic benefit. In contrast to structure-based approaches that use selective ligands to target macromolecules, reactivity-based drug discovery uses chemical reagents as therapeutics to target reactive chemical species as key mediators of skin photo-oxidative stress. The following classes of reactivity-based agents for skin photoprotection can be distinguished based on their mechanism of action: direct antagonists of photo-oxidative stress (sunscreens, quenchers of photo-excited states, antioxidants, redox modulators and glycation inhibitors) and skin photo-adaptation inducers (nuclear factor erythroid 2-related factor 2 [Nrf2] activators, heat-shock response inducers and metallothionein inducers).

  8. Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury

    Directory of Open Access Journals (Sweden)

    Ravirajsinh N. Jadeja

    2016-01-01

    Full Text Available Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2, a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans.

  9. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    Directory of Open Access Journals (Sweden)

    Angélica S. Jiménez-Osorio

    2014-11-01

    Full Text Available The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2 was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS in plasma and erythrocytes, glutathione (GSH and malondialdehyde (MDA content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC. Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients.

  10. Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases.

    Science.gov (United States)

    Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug

    2014-01-01

    Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.

  11. Activation of 125I-Factor IX and 125I-Factor X: Effect of tissue factor and Factor VII, Factor Xsub(a) and thrombin

    International Nuclear Information System (INIS)

    Oesterud, B.; Rapaport, S.I.

    Activation of Factor IX and Factor X was studied by adding 125 I-Factor IX or 125 I-Factor X to reaction mixtures and quantitating cleavage products by reduced sodium dodecylsulfate gel electrophoresis. Thrombin failed to activate Factors IX or X; Factor Xsub(a) produced insignificant amounts of cleavage products of both factors. In contrast, the reaction product of tissue factor and Factor VII cleaved large amounts of both Factor IX and Factor X in purified systems and in plasma. In incubation mixtures of plasma containing added 125 I-Factor IX or 125 I-Factor X, tissue factor and Ca 2+ ions, the percentage of total radioactivity in the heavy chain peak of 125 I-IXsub(a) and the heavy chain of 125 I-Xsub(a) increased at a similar rate. When the tissue factor was diluted, similar curves were obtained for percent cleavage of 125 I-Factor IX and percent cleavage of 125 I-Factor X plotted against tissue factor concentration. These findings support the hypothesis that activation of Factor IX by the tissue factor-Factor VII reaction product represents a physiologically significant step in normal haemostasis. (author)

  12. Psychosomatic factors in pruritus.

    Science.gov (United States)

    Tey, Hong Liang; Wallengren, Joanna; Yosipovitch, Gil

    2013-01-01

    Pruritus and psyche are intricately and reciprocally related, with psychophysiological evidence and psychopathological explanations helping us to understand their complex association. Their interaction may be conceptualized and classified into 3 groups: pruritic diseases with psychiatric sequelae, pruritic diseases aggravated by psychosocial factors, and psychiatric disorders causing pruritus. Management of chronic pruritus is directed at treating the underlying causes and adopting a multidisciplinary approach to address the dermatologic, somatosensory, cognitive, and emotional aspects. Pharmcotherapeutic agents that are useful for chronic pruritus with comorbid depression and/or anxiety comprise selective serotonin reuptake inhibitors, mirtazapine, tricyclic antidepressants (amitriptyline and doxepin), and anticonvulsants (gabapentin, pregabalin); the role of neurokinin receptor-1 antagonists awaits verification. Antipsychotics are required for treating itch and formication associated with schizophrenia and delusion of parasitosis (including Morgellons disease). Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Factorization of Observables

    Science.gov (United States)

    Eliaš, Peter; Frič, Roman

    2017-12-01

    Categorical approach to probability leads to better understanding of basic notions and constructions in generalized (fuzzy, operational, quantum) probability, where observables—dual notions to generalized random variables (statistical maps)—play a major role. First, to avoid inconsistencies, we introduce three categories L, S, and P, the objects and morphisms of which correspond to basic notions of fuzzy probability theory and operational probability theory, and describe their relationships. To illustrate the advantages of categorical approach, we show that two categorical constructions involving observables (related to the representation of generalized random variables via products, or smearing of sharp observables, respectively) can be described as factorizing a morphism into composition of two morphisms having desired properties. We close with a remark concerning products.

  14. Functional Maximum Autocorrelation Factors

    DEFF Research Database (Denmark)

    Larsen, Rasmus; Nielsen, Allan Aasbjerg

    2005-01-01

    MAF outperforms the functional PCA in concentrating the interesting' spectra/shape variation in one end of the eigenvalue spectrum and allows for easier interpretation of effects. Conclusions. Functional MAF analysis is a useful methods for extracting low dimensional models of temporally or spatially......Purpose. We aim at data where samples of an underlying function are observed in a spatial or temporal layout. Examples of underlying functions are reflectance spectra and biological shapes. We apply functional models based on smoothing splines and generalize the functional PCA in......\\verb+~+\\$\\backslash\\$cite{ramsay97} to functional maximum autocorrelation factors (MAF)\\verb+~+\\$\\backslash\\$cite{switzer85,larsen2001d}. We apply the method to biological shapes as well as reflectance spectra. {\\$\\backslash\\$bf Methods}. MAF seeks linear combination of the original variables that maximize autocorrelation between...

  15. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  16. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin

    2017-01-01

    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... regions with function-related, short sequence motifs and molecular recognition features with structural propensities. This review focuses on molecular aspects of TFs, which represent paradigms of ID-related features. Through specific examples, we review how the ID-associated flexibility of TFs enables....... It is furthermore emphasized how classic biochemical concepts like allostery, conformational selection, induced fit, and feedback regulation are undergoing a revival with the appreciation of ID. The review also describes the most recent advances based on computational simulations of ID-based interaction mechanisms...

  17. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  18. Wave friction factor rediscovered

    Science.gov (United States)

    Le Roux, J. P.

    2012-02-01

    The wave friction factor is commonly expressed as a function of the horizontal water particle semi-excursion ( A wb) at the top of the boundary layer. A wb, in turn, is normally derived from linear wave theory by {{U_{{wb}}/T_{{w}}}}{{2π }} , where U wb is the maximum water particle velocity measured at the top of the boundary layer and T w is the wave period. However, it is shown here that A wb determined in this way deviates drastically from its real value under both linear and non-linear waves. Three equations for smooth, transitional and rough boundary conditions, respectively, are proposed to solve this problem, all three being a function of U wb, T w, and δ, the thickness of the boundary layer. Because these variables can be determined theoretically for any bottom slope and water depth using the deepwater wave conditions, there is no need to physically measure them. Although differing substantially from many modern attempts to define the wave friction factor, the results coincide with equations proposed in the 1960s for either smooth or rough boundary conditions. The findings also confirm that the long-held notion of circular water particle motion down to the bottom in deepwater conditions is erroneous, the motion in fact being circular at the surface and elliptical at depth in both deep and shallow water conditions, with only horizontal motion at the top of the boundary layer. The new equations are incorporated in an updated version (WAVECALC II) of the Excel program published earlier in this journal by Le Roux et al. Geo-Mar Lett 30(5): 549-560, (2010).

  19. [The Steel factor].

    Science.gov (United States)

    Cáceres-Cortés, J R

    1997-01-01

    Mice bearing mutations at either of two loci, dominant White spotting(W) or Steel(Sl), exhibit development defects in hematopoietic, melanocytic and germ cells. Genetics studies have shown that the SI locus encodes the Steel factor (SF), which is the ligand for the tyrosine kinase receptor c-kit, the product of the W locus. SF is synthesized in membrane-bound form and can be processed to produce a soluble form. Cell-cell interaction is important in the production of normal blood cells in vivo and in vitro and in the cellular expansion of leukemic cells. We discuss here how SF decreases the requirements in cell interaction for blast colony formation in acute myeloblastic leukemia (AML) and the presence of membrane-bound SF possibly contributes to the density-dependent growth of the AML blasts. We explain that SF is mainly a survival factor for hematopoietic cells, of little proliferative effect, which maintains CD34+ hematopoietic cells in an undifferentiated state. These properties would potentially allow the maintenance of hematopoietic cells in culture for the purpose of marrow purging or gene therapy. The activation of the c-kit signal transduction pathway may play a significant role in the development of many types of non-hematological malignancies by disrupting normal cell-cell interactions and allowing the growth of cancer cell populations. In summary, the properties of the SF indicate it has a role for survival signals during the process of normal differentiation, AML proliferation and in the maintenance of many c-kit+ tumors.

  20. Neutron quality factor

    International Nuclear Information System (INIS)

    1995-06-01

    Both the International Commission on Radiological Protection (ICRP) and the National Council on Radiation Protection and Measurements (NCRP) have recommended that the radiation quality weighting factor for neutrons (Q n , or the corresponding new modifying factor, w R ) be increased by a value of two for most radiation protection practices. This means an increase in the recommended value for Q n from a nominal value of 10 to a nominal value of 20. This increase may be interpreted to mean that the biological effectiveness of neutrons is two times greater than previously thought. A decision to increase the value of Q n will have a major impact on the regulations and radiation protection programs of Federal agencies responsible for the protection of radiation workers. Therefore, the purposes of this report are: (1) to examine the general concept of open-quotes quality factorclose quotes (Q) in radiation protection and the rationale for the selection of specific values of Q n ; and (2) to make such recommendations to the Federal agencies, as appropriate. This report is not intended to be an exhaustive review of the scientific literature on the biological effects of neutrons, with the aim of defending a particular value for Q n . Rather, the working group examined the technical issues surrounding the current recommendations of scientific advisory bodies on this matter, with the aim of determining if these recommendations should be adopted by the Federal agencies. Ultimately, the group concluded that there was no compelling basis for a change in Q n . The report was prepared by Federal scientists working under the auspices of the Science Panel of the Committee on Interagency Radiation Research and Policy Coordination (CIRRPC)

  1. Factorization and non-factorization in diffractive hard scattering

    International Nuclear Information System (INIS)

    Berera, Arjun

    1997-01-01

    Factorization, in the sense defined for inclusive hard scattering, is discussed for diffractive hard scattering. A factorization theorem similar to its inclusive counterpart is presented for diffractive DIS. For hadron-hadron diffractive hard scattering, in contrast to its inclusive counterpart, the expected breakdown of factorization is discussed. Cross section estimates are given from a simple field theory model for non-factorizing double-pomeron-exchange (DPE) dijet production with and without account for Sudakov suppression

  2. Robust and Sparse Factor Modelling

    DEFF Research Database (Denmark)

    Croux, Christophe; Exterkate, Peter

    Factor construction methods are widely used to summarize a large panel of variables by means of a relatively small number of representative factors. We propose a novel factor construction procedure that enjoys the properties of robustness to outliers and of sparsity; that is, having relatively few...... nonzero factor loadings. Compared to the traditional factor construction method, we find that this procedure leads to a favorable forecasting performance in the presence of outliers and to better interpretable factors. We investigate the performance of the method in a Monte Carlo experiment...

  3. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  4. External Factors, Internal Factors and Self-Directed Learning Readiness

    Science.gov (United States)

    Ramli, Nurjannah; Muljono, Pudji; Afendi, Farit M.

    2018-01-01

    There are many factors which affect the level of self-directed learning readiness. This study aims to investigate the relationship between external factors, internal factors and self-directed learning readiness. This study was carried out by using a census method for fourth year students of medical program of Tadulako University. Data were…

  5. Electromagnetic Hadronic Form-Factors

    International Nuclear Information System (INIS)

    Edwards, Robert G.

    2005-01-01

    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks

  6. R-Factor for Alaska

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The rainfall-runoff erosivity factor (R-Factor) quantifies the effects of raindrop impacts and reflects the amount and rate of runoff associated with the rain. The...

  7. Air Emissions Factors and Quantification

    Science.gov (United States)

    Emissions factors are used in developing air emissions inventories for air quality management decisions and in developing emissions control strategies. This area provides technical information on and support for the use of emissions factors.

  8. Integrated Factors Correlating Undergraduate Academic ...

    African Journals Online (AJOL)

    Integrated Factors Correlating Undergraduate Academic Achievement in Bayelsa State, Nigeria. ... AFRREV IJAH: An International Journal of Arts and Humanities ... Thus, it is study investigated the integrated factors determining academic performance of students in public secondary schools in Bayelsa State, Nigeria.

  9. Human Factors in Training

    Science.gov (United States)

    Barshi, Immanuel; Byrne, Vicky; Arsintescu, Lucia; Connell, Erin

    2010-01-01

    Future space missions will be significantly longer than current shuttle missions and new systems will be more complex than current systems. Increasing communication delays between crews and Earth-based support means that astronauts need to be prepared to handle the unexpected on their own. As crews become more autonomous, their potential span of control and required expertise must grow to match their autonomy. It is not possible to train for every eventuality ahead of time on the ground, or to maintain trained skills across long intervals of disuse. To adequately prepare NASA personnel for these challenges, new training approaches, methodologies, and tools are required. This research project aims at developing these training capabilities. By researching established training principles, examining future needs, and by using current practices in space flight training as test beds, both in Flight Controller and Crew Medical domains, this research project is mitigating program risks and generating templates and requirements to meet future training needs. Training efforts in Fiscal Year 09 (FY09) strongly focused on crew medical training, but also began exploring how Space Flight Resource Management training for Mission Operations Directorate (MOD) Flight Controllers could be integrated with systems training for optimal Mission Control Center (MCC) operations. The Training Task addresses Program risks that lie at the intersection of the following three risks identified by the Project: 1) Risk associated with poor task design; 2) Risk of error due to inadequate information; and 3) Risk associated with reduced safety and efficiency due to poor human factors design.

  10. Self-shielding factors

    International Nuclear Information System (INIS)

    Kaul, D.C.

    1982-01-01

    Throughout the last two decades many efforts have been made to estimate the effect of body self-shielding on organ doses from externally incident neutrons and gamma rays. These began with the use of simple geometry phantoms and have culminated in the use of detailed anthropomorphic phantoms. In a recent effort, adjoint Monte Carlo analysis techniques have been used to determine dose and dose equivalent to the active marrow as a function of energy and angle of neutron fluence externally incident on an anthropomorphic phantom. When combined with fluences from actual nuclear devices, these dose-to-fluence factors result in marrow dose values that demonstrate great sensitivity to variations in device type, range, and body orientation. Under a state-of-the-art radiation transport analysis demonstration program for the Japanese cities, sponsored by the Defense Nuclear Agency at the request of the National Council on Radiation Protection and Measurements, the marrow dose study referred to above is being repeated to obtain spectral distributions within the marrow for externally incident neutrons and gamma rays of arbitrary energy and angle. This is intended to allow radiobiologists and epidemiologists to select and to modify numbers of merit for correlation with health effects and to permit a greater understanding of the relationship between human and laboratory subject dosimetry

  11. Research organizational factors

    International Nuclear Information System (INIS)

    Coffman, F.D. Jr.

    1990-01-01

    Organizational processes at nuclear power plants should be sufficient to prevent accidents and to protect public health and safety upon the occurrence of an accident. The role of regulatory research is to confirm that agency assessments of organization processes are on a firm technical basis and provide for improvements in the NRC [Nuclear Regulatory Commission] programs. A firm technical basis is achieved by reducing uncertainties associated with methods and measures used to assess organization processes. The general objective for regulatory research is to confirm that the agency has a coherent understanding of the organizational processes that are individually necessary and are collectively sufficient for safe operations, methods are available to reliably characterize organizational processes, and measures exist to monitor changes in the key organizational processes. The first specific objective was to develop a method to translate organizational processes into PRAs. The discussion provides feedback and insights from experience with the past and the ongoing organizational factors research. That experience suggests a set of ingredients that appear proper for performing regulatory research on organizational processes. By keeping focused upon these proper ingredients, the research will contribute to the regulatory assessments of utility management through the use of improved methods and measures in investigations, inspections, diagnostics, performance indicators, and PRA insights

  12. BASIC FACTORS OF MARKET CONCENTRATION

    OpenAIRE

    V. Fyliuk

    2013-01-01

    The paper systemizes factors which reinforce trends towards market concentration in all economic systems. These factors include factors related to the general changes in economic environment such as globalization of the world economy, state structural and taxation policies, cycle of economic development and changes in consumer demand. They also include factors related to competition (intensification of competition, companies’ desire to monopolize market and present market structure) and scien...

  13. Human Factors in Marine Casualties

    Directory of Open Access Journals (Sweden)

    Jelenko Švetak

    2002-05-01

    Full Text Available Human factors play an important role in the origin of accidents,and it is commonly claimed that between seventy andninety-five percent of industrial and transport accidents involvehuman factors, see Figure 1.Some authorities, however, claim that ultimately, all accidentsinvolve human factors.

  14. Risks factoring business: accounting measurement

    Directory of Open Access Journals (Sweden)

    Z.V. Gutsaylyuk

    2015-06-01

    Full Text Available The paper carried out the identification of risk factors for the development of possible accounting software management. Studied theoretical and methodological aspects of the risk classification of factoring operations in the part of the risk assessment factors. It is proposed to consider the risks factors as the risk that is acceptable controlled by accounting instruments and the risks that can not be taken into account in the accounting records. To minimize the risk factor, accounting-driven tools, a method of self-insurance, which is a factor in the creation of provision for factoring transactions designed to cover unexpected expenses and losses. Provision for factoring factor will establish more stable conditions of financial activity and avoid the fluctuations of profit factor in relation to the writing off of losses on factoring operatsіyam.Developed proposals allow for further research to improve the organizational and methodological basis of accounting and analysis of information as a basis for providing risk management factor, particularly in terms of improving the evaluation questions such risks and their qualitative and quantitative analysis.

  15. Investing in systematic factor premiums

    NARCIS (Netherlands)

    Koedijk, Kees G.; Slager, Alfred M. H.; Stork, P.A.

    In this paper we investigate and evaluate factor investing in the US and Europe for equities and bonds. We show that factor-based portfolios generally produce comparable or better portfolios than market indices. We expand the analysis to other asset classes and factors, work with other optimisation

  16. Sparse and Robust Factor Modelling

    NARCIS (Netherlands)

    C. Croux (Christophe); P. Exterkate (Peter)

    2011-01-01

    textabstractFactor construction methods are widely used to summarize a large panel of variables by means of a relatively small number of representative factors. We propose a novel factor construction procedure that enjoys the properties of robustness to outliers and of sparsity; that is, having

  17. Risk Factor Assessment Branch (RFAB)

    Science.gov (United States)

    The Risk Factor Assessment Branch (RFAB) focuses on the development, evaluation, and dissemination of high-quality risk factor metrics, methods, tools, technologies, and resources for use across the cancer research continuum, and the assessment of cancer-related risk factors in the population.

  18. Geriatic Disability Related Factors

    Directory of Open Access Journals (Sweden)

    Mohsen Adib Hajbagheri

    2008-07-01

    Full Text Available Objectives: Reports are indicating of increasing trend of aging and disability in the developing countries while such disabilities are decreasing within the developed countries. This study designed to evaluate the disability and some of its related factors among the elderly population (65 and older in Kashan, Iran. Methods & Materials: A cross-sectional analytical study was conducted on a multi-stage random sample of 350 elderly people (65 year and older in Kashan. The WHO-DAS-II was used as the generic disability measure. The questionnair had 48 questions. The range of score could be between 0-144. Chi-square, t-test analysis and ANOVA were utilized to check significant differences between subgroups. Results: 61% were men and 12% were living lonely. One fourth had some type of addiction, the majority were ilitrate and two thired had not regular phisycal activity.Twenty percent of the old people had a modereate disability and 4.3% were extremely disabled. A significant relationship was found between the disability and variables such as sex, age, living style, needing help, marriage status, living location, addiction, job, level of physical activity, education, and having multiple diseases. Conclusion: In conclusion, geriatric population in Iran, has a lower levels of disability in compare to those of other developed countries. Need of geriatric cares must be be increasing, since the populationpattern of elderly people is increasing in Iran. Female and ilitrate elders were sufering of more disability. These findings indicated the nessesity to more attention to these voulnarable subgroups of population.

  19. Gut transfer factors

    International Nuclear Information System (INIS)

    1990-01-01

    A Nuclear Energy Agency (NEA) Expert Group has proposed values for the absorbed fractions (f 1 values) of radionuclides ingested in food and drinking water by members of the public. The f 1 values for adults, which are also taken to apply to children from 1 year of age, are increased from those given in ICRP Publication 30 for occupationally exposed adults for 7 elements out of the 31 considered. Since the publication of the NEA report, further information has become available that is relevant to the choice of f 1 values for polonium and thorium. These data suggest that for the present the f 1 value for polonium currently recommended by ICRP (0.1) should be retained, and that for thorium a reasonable f 1 value is 0.0005. With these exceptions, the NRPB endorses the revisions in f 1 values proposed by the NEA Expert Group for adults and children from 1 year of age. Higher f 1 values are proposed by the NEA expert Group for absorption in the first year of life. For adult values of between 0.01 and 0.5, an increase by a factor of two is assumed, and for adult values of 0.001 or less, absorption by infants is taken to be ten times greater. This approach is consistent with, and extends, that applied to the actinides in ICRP Publication 48 and represents a reasonable interpretation of current evidence. The NRPB therefore endorses the approach proposed by the NEA Expert Group for the calculation of doses to infants. (author)

  20. Transcriptomic Analysis of Lung Tissue from Cigarette Smoke-Induced Emphysema Murine Models and Human Chronic Obstructive Pulmonary Disease Show Shared and Distinct Pathways.

    Science.gov (United States)

    Yun, Jeong H; Morrow, Jarrett; Owen, Caroline A; Qiu, Weiliang; Glass, Kimberly; Lao, Taotao; Jiang, Zhiqiang; Perrella, Mark A; Silverman, Edwin K; Zhou, Xiaobo; Hersh, Craig P

    2017-07-01

    Although cigarette smoke (CS) is the primary risk factor for chronic obstructive pulmonary disease (COPD), the underlying molecular mechanisms for the significant variability in developing COPD in response to CS are incompletely understood. We performed lung gene expression profiling of two different wild-type murine strains (C57BL/6 and NZW/LacJ) and two genetic models with mutations in COPD genome-wide association study genes (HHIP and FAM13A) after 6 months of chronic CS exposure and compared the results to human COPD lung tissues. We identified gene expression patterns that correlate with severity of emphysema in murine and human lungs. Xenobiotic metabolism and nuclear erythroid 2-related factor 2-mediated oxidative stress response were commonly regulated molecular response patterns in C57BL/6, Hhip +/- , and Fam13a -/- murine strains exposed chronically to CS. The CS-resistant Fam13a -/- mouse and NZW/LacJ strain revealed gene expression response pattern differences. The Fam13a -/- strain diverged in gene expression compared with C57BL/6 control only after CS exposure. However, the NZW/LacJ strain had a unique baseline expression pattern, enriched for nuclear erythroid 2-related factor 2-mediated oxidative stress response and xenobiotic metabolism, and converged to a gene expression pattern similar to the more susceptible wild-type C57BL/6 after CS exposure. These results suggest that distinct molecular pathways may account for resistance to emphysema. Surprisingly, there were few genes commonly modulated in mice and humans. Our study suggests that gene expression responses to CS may be largely species and model dependent, yet shared pathways could provide biologically significant insights underlying individual susceptibility to CS.

  1. Relação entre retinopatia diabética e dermopatia diabética em pacientes portadores de diabetes mellitus tipo 2 Relation between diabetic retinopathy and diabetic dermopathy in type 2 diabetes mellitus patients

    Directory of Open Access Journals (Sweden)

    Hugo Roberto Kurtz Lisboa

    2008-12-01

    both considered as manifestations of diabetic microangiopathy, there are only few reports in the literature regarding their possible association. The purpose of this study was to investigate the association between diabetic dermopathy and diabetic retinopathy and to determine the prevalence and the associated risk factors for diabetic retinopathy in type 2 diabetes patients from the Outpatient Diabetic Clinic of the Faculty of Medicine of the University of Passo Fundo and Teaching Hospital Sao Vicente de Paulo. METHODS: Cross sectional study was performed in 90 type 2 diabetes mellitus patients who attend to the outpatient diabetic clinic, consecutively. Physical, dermatological and ophthalmologic evaluations were performed in all the patients. RESULTS: The prevalence of diabetic dermopathy was 16,6% (n = 15 and diabetic retinopathy was 34,4% (n = 31; 67,8% of those (n = 21 consisted of non-proliferative diabetic retinopathy and 32,2% (n = 10 of proliferative diabetic retinopathy. The duration of the disease greater than 10 years (p = 0,001 and age over 50 years (p = 0,014 were associated to retinopathy, but no association was found with elevated levels of HbA1c (p = 0,5 and fasting plasma glucose of 126 or higher (p = 0,8. The frequency of diabetic retinopathy in patients with diabetic dermopathy was not higher than in patients without dermopathy (7,7%, 7 cases, p = 0,586. There was no statistically significant association between diabetic retinopathy and diabetic dermopathy. CONCLUSION: No association between diabetic dermopathy and diabetic retinopathy in this group of type 2 diabetes patients was found. The presence of diabetic retinopathy was associated to the duration of the disease and the advanced age of the patients.

  2. Factors Affecting Medical Service Quality.

    Science.gov (United States)

    Mosadeghrad, Ali Mohammad

    2014-02-01

    A better understanding of factors influencing quality of medical service can pinpoint better strategies for quality assurance in medical services. This study aimed to identify factors affecting the quality of medical services provided by Iranian physicians. Exploratory in-depth individual interviews were conducted with sixty-four physicians working in various medical institutions in Iran. Individual, organizational and environmental factors enhance or inhibit the quality of medical services. Quality of medical services depends on the personal factors of the physician and patient, and factors pertaining to the healthcare setting and the broader environment. Differences in internal and external factors such as availability of resources, patient cooperation and collaboration among providers affect the quality of medical services and patient outcomes. Supportive leadership, proper planning, education and training and effective management of resources and processes improve the quality of medical services. This article contributes to healthcare theory and practice by developing a conceptual framework for understanding factors that influence medical services quality.

  3. Prognostic factors of breast cancer

    International Nuclear Information System (INIS)

    Gonzalez Ortega, Jose Maria; Morales Wong, Mario Miguel; Lopez Cuevas, Zoraida; Diaz Valdez, Marilin

    2011-01-01

    The prognostic factors must to be differentiated of the predictive ones. A prognostic factor is any measurement used at moment of the surgery correlated with the free interval of disease or global survival in the absence of the systemic adjuvant treatment and as result is able to correlate with the natural history of the disease. In contrast, a predictive factor is any measurement associated with the response to a given treatment. Among the prognostic factors of the breast cancer are included the clinical, histological, biological, genetic and psychosocial factors. In present review of psychosocial prognostic factors has been demonstrated that the stress and the depression are negative prognostic factors in patients presenting with breast cancer. It is essential to remember that the assessment of just one prognostic parameter is a help but it is not useful to clinical and therapeutic management of the patient.(author)

  4. The population factor.

    Science.gov (United States)

    Kats, G

    1983-01-01

    Reducing population growth is essentil to Egypt's broader efforts to improve facilities, services, and the phsycial quality of life. Although a family planning program has existed since the mid-1950s, the 2.7% annual rate of population growth has not changed in 30 years. Nasser and the other "free officers" who seized power in 1952 became concerned about the adverse effects of the rapidly growing population, but perhaps out of concern with a possible religious backlash, they confined themselves to launching studies and subsidizing several dozen private family planning clinics. From 1962-72, the number of private clinics grew from 28 to 480, and family planning was introduced in government healthclinics in 1965. Such clinics are mainly located in rural areas and are staffed by doctors and other personnel who are not members of the local community and are not very effective at promoting family planning. Local girls and women called Rayadet were recruited to promote the idea to birth control in local communities. By 1970, 12.6% of Egyptians were using reliable contraception. A national survey 12 years later found 34% using contraception, buth the figure seems high. Approximately 60-65% of eligible couples would need to practice birth control for Egypt to reach a less than 1% annuel increase. The Egyptian government hopes to slow population growth to 1% by the year 2000, but major problems of motivation remain especially among the rural poor. Several factors may lead to success of the family planning effort: 1) financial and technical support from international family planning sources has grown rapidley and is likely to remain high; 2) the mortality rate has dropped from 17.8/1000 in 1952 to about half that level, while the rate of natural increase is about the same, suggesting that future reductions in the birth rate will translate to a reduced rate of natural increase, and that parents will be less reluctant to practice faimly planning if there is a greater chance

  5. A factor analysis to detect factors influencing building national brand

    Directory of Open Access Journals (Sweden)

    Naser Azad

    Full Text Available Developing a national brand is one of the most important issues for development of a brand. In this study, we present factor analysis to detect the most important factors in building a national brand. The proposed study uses factor analysis to extract the most influencing factors and the sample size has been chosen from two major auto makers in Iran called Iran Khodro and Saipa. The questionnaire was designed in Likert scale and distributed among 235 experts. Cronbach alpha is calculated as 84%, which is well above the minimum desirable limit of 0.70. The implementation of factor analysis provides six factors including “cultural image of customers”, “exciting characteristics”, “competitive pricing strategies”, “perception image” and “previous perceptions”.

  6. Risk factors for stress fractures.

    Science.gov (United States)

    Bennell, K; Matheson, G; Meeuwisse, W; Brukner, P

    1999-08-01

    Preventing stress fractures requires knowledge of the risk factors that predispose to this injury. The aetiology of stress fractures is multifactorial, but methodological limitations and expediency often lead to research study designs that evaluate individual risk factors. Intrinsic risk factors include mechanical factors such as bone density, skeletal alignment and body size and composition, physiological factors such as bone turnover rate, flexibility, and muscular strength and endurance, as well as hormonal and nutritional factors. Extrinsic risk factors include mechanical factors such as surface, footwear and external loading as well as physical training parameters. Psychological traits may also play a role in increasing stress fracture risk. Equally important to these types of analyses of individual risk factors is the integration of information to produce a composite picture of risk. The purpose of this paper is to critically appraise the existing literature by evaluating study design and quality, in order to provide a current synopsis of the known scientific information related to stress fracture risk factors. The literature is not fully complete with well conducted studies on this topic, but a great deal of information has accumulated over the past 20 years. Although stress fractures result from repeated loading, the exact contribution of training factors (volume, intensity, surface) has not been clearly established. From what we do know, menstrual disturbances, caloric restriction, lower bone density, muscle weakness and leg length differences are risk factors for stress fracture. Other time-honoured risk factors such as lower extremity alignment have not been shown to be causative even though anecdotal evidence indicates they are likely to play an important role in stress fracture pathogenesis.

  7. Special Issue: “Molecules against Alzheimer”

    Directory of Open Access Journals (Sweden)

    Michael Decker

    2016-12-01

    Full Text Available This Special Issue, entitled “Molecules against Alzheimer”, gathers a number of original articles, short communications, and review articles on recent research efforts toward the development of novel drug candidates, diagnostic agents and therapeutic approaches for Alzheimer’s disease (AD, the most prevalent neurodegenerative disorder and a leading cause of death worldwide. This Special Issue contains many interesting examples describing the design, synthesis, and pharmacological profiling of novel compounds that hit one or several key biological targets, such as cholinesterases, β-amyloid formation or aggregation, monoamine oxidase B, oxidative stress, biometal dyshomeostasis, mitochondrial dysfunction, serotonin and/or melatonin systems, the Wnt/β-catenin pathway, sigma receptors, nicotinamide phosphoribosyltransferase, or nuclear erythroid 2-related factor. The development of novel AD diagnostic agents based on tau protein imaging and the use of lithium or intranasal insulin for the prevention or the symptomatic treatment of AD is also covered in some articles of the Special Issue.

  8. Marine Natural Product Honaucin A Attenuates Inflammation by Activating the Nrf2-ARE Pathway.

    Science.gov (United States)

    Mascuch, Samantha J; Boudreau, Paul D; Carland, Tristan M; Pierce, N Tessa; Olson, Joshua; Hensler, Mary E; Choi, Hyukjae; Campanale, Joseph; Hamdoun, Amro; Nizet, Victor; Gerwick, William H; Gaasterland, Teresa; Gerwick, Lena

    2018-03-23

    The cyanobacterial marine natural product honaucin A inhibits mammalian innate inflammation in vitro and in vivo. To decipher its mechanism of action, RNA sequencing was used to evaluate differences in gene expression of cultured macrophages following honaucin A treatment. This analysis led to the hypothesis that honaucin A exerts its anti-inflammatory activity through activation of the cytoprotective nuclear erythroid 2-related factor 2 (Nrf2)-antioxidant response element/electrophile response element (ARE/EpRE) signaling pathway. Activation of this pathway by honaucin A in cultured human MCF7 cells was confirmed using an Nrf2 luciferase reporter assay. In vitro alkylation experiments with the natural product and N-acetyl-l-cysteine suggest that honaucin A activates this pathway through covalent interaction with the sulfhydryl residues of the cytosolic repressor protein Keap1. Honaucin A presents a potential therapeutic lead for diseases with an inflammatory component modulated by Nrf2-ARE.

  9. [Predictive factors of anxiety disorders].

    Science.gov (United States)

    Domschke, K

    2014-10-01

    Anxiety disorders are among the most frequent mental disorders in Europe (12-month prevalence 14%) and impose a high socioeconomic burden. The pathogenesis of anxiety disorders is complex with an interaction of biological, environmental and psychosocial factors contributing to the overall disease risk (diathesis-stress model). In this article, risk factors for anxiety disorders will be presented on several levels, e.g. genetic factors, environmental factors, gene-environment interactions, epigenetic mechanisms, neuronal networks ("brain fear circuit"), psychophysiological factors (e.g. startle response and CO2 sensitivity) and dimensional/subclinical phenotypes of anxiety (e.g. anxiety sensitivity and behavioral inhibition), and critically discussed regarding their potential predictive value. The identification of factors predictive of anxiety disorders will possibly allow for effective preventive measures or early treatment interventions, respectively, and reduce the individual patient's suffering as well as the overall socioeconomic burden of anxiety disorders.

  10. Factor of originality in advertising

    OpenAIRE

    Ešner, Rudolf

    2009-01-01

    The bachelor thesis deals with exploitation of original attitudes in advertising. The thesis solves answers, what role plays the factor of originality in advertising, when and why firms use that factor, how creators work with it, how consumers perceive the factor and what other elements it generally contains. The bachelor thesis qualifies relationship of advertising and originality, describes and probes practical situations, when originality in advertising can be used as a serious competitive...

  11. Risk factors in school shootings.

    Science.gov (United States)

    Verlinden, S; Hersen, M; Thomas, J

    2000-01-01

    Nine incidents of multiple-victim homicide in American secondary schools are examined and common risk factors are identified. The literature dealing with individual, family, social, societal, and situational risk factors for youth violence and aggression is reviewed along with existing risk assessment methods. Checklists of risk factors for serious youth violence and school violence are used in reviewing each school shooting case. Commonalties among the cases and implications for psychologists practicing in clinical and school settings are discussed.

  12. First course in factor analysis

    CERN Document Server

    Comrey, Andrew L

    2013-01-01

    The goal of this book is to foster a basic understanding of factor analytic techniques so that readers can use them in their own research and critically evaluate their use by other researchers. Both the underlying theory and correct application are emphasized. The theory is presented through the mathematical basis of the most common factor analytic models and several methods used in factor analysis. On the application side, considerable attention is given to the extraction problem, the rotation problem, and the interpretation of factor analytic results. Hence, readers are given a background of

  13. Summable series and convergence factors

    CERN Document Server

    Moore, Charles N

    1938-01-01

    Fairly early in the development of the theory of summability of divergent series, the concept of convergence factors was recognized as of fundamental importance in the subject. One of the pioneers in this field was C. N. Moore, the author of the book under review.... Moore classifies convergence factors into two types. In type I he places the factors which have only the property that they preserve convergence for a convergent series or produce convergence for a summable series. In type II he places the factors which not only maintain or produce convergence but have the additional property that

  14. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  15. Factorization method of quadratic template

    Science.gov (United States)

    Kotyrba, Martin

    2017-07-01

    Multiplication of two numbers is a one-way function in mathematics. Any attempt to distribute the outcome to its roots is called factorization. There are many methods such as Fermat's factorization, Dixońs method or quadratic sieve and GNFS, which use sophisticated techniques fast factorization. All the above methods use the same basic formula differing only in its use. This article discusses a newly designed factorization method. Effective implementation of this method in programs is not important, it only represents and clearly defines its properties.

  16. Social networks and factor markets

    DEFF Research Database (Denmark)

    Abay, Kibrom Araya; Kahsay, Goytom Abraha; Berhane, Guush

    In the absence of well-established factor markets, the role of indigenous institutions and social networks can be substantial for mobilizing factors for agricultural production. We investigate the role of an indigenous social network in Ethiopia, the iddir, in facilitating factor market...... transactions among smallholder farmers. Using detailed longitudinal household survey data and employing a difference-in-differences approach, we find that iddir membership improves households’ access to factor markets. Specifically, we find that joining an iddir network improves households’ access to land...

  17. FACTORING- CREDIT OPPORTUNITIES IN ROMANIA

    Directory of Open Access Journals (Sweden)

    ADELA IONESCU

    2013-05-01

    Full Text Available Capital is the main factor of production, business development becomes virtually impossible without taking into account the financial market and the resources it provides to businesses. Any business, regardless of its degree of development, is involving direct contact with financial markets, namely the institutions that mediate mobilization of capital and the services they provide. Understanding the functioning of the financial system, the specific financial mechanisms through which savings are allocated to support capital investments and the costs and risks involved is essential for the development of a solid base for business. In this context, factoring operations can support economic agents, allowing a transfer of commercial receivables from their holder to a factor who commits to their recovery and guarantee such operations even if temporary or permanent insolvency of the debtor . Thus, factoring is a complex technique in at least two aspects, of the debt and the transfer of credit. . Factoring is a means of financing business, especially export-import transactions, less known in Romania. Maybe because of poor business environment popularize the term is as little known as it was a few years ago the leasing. Present in Romanian legislation since 2002, factoring appears as a contract between one party (called adherent, providing goods or service and a banking company or a financial institution specialized (called factor, which the last one shall finance debts pursuing and preservation against credit risks and adherent gives factor by way of sale, debts arising from the sale of goods or services to third parties. The article is divided into three parts. In the first part we defined the concept of factoring and international factoring, then I presented the advantages and development of factoring in Romania, and the last part conclusions.

  18. Activation of factor VII bound to tissue factor: a key early step in the tissue factor pathway of blood coagulation.

    OpenAIRE

    Rao, L V; Rapaport, S I

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and factor IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. Our earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were ma...

  19. Activation of factor VII bound to tissue factor: A key early step in the tissue factor pathway of blood coagulation

    International Nuclear Information System (INIS)

    Rao, L.V.M.; Rapaport, S.I.

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. The earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were made with purified factor VII, X, and tissue factor; in some experiments antithrombin III and heparin were added to prevent back-activation of factor VII. Factor X was activated at similar rates in reaction mixtures containing either VII or factor VIIa after an initial 30-sec lag with factor VII. In reaction mixtures with factor VII a linear activation of factor X was established several minutes before cleavage of 125 I-labeled factor VII to the two-chain activated molecule was demonstrable on gel profiles. These data suggest that factor VII/tissue factor cannot activate measurable amounts of factor X over several minutes. Overall, the results support the hypothesis that a rapid preferential activation of factor VII bound to tissue factor by trace amounts of factor Xa is a key early step in tissue factor-dependent blood coagulation

  20. Factors of trade in Europe

    Czech Academy of Sciences Publication Activity Database

    Hanousek, Jan; Kočenda, Evžen

    2014-01-01

    Roč. 38, č. 4 (2014), s. 518-535 ISSN 0939-3625 R&D Projects: GA ČR(CZ) GAP403/12/0080 Grant - others:UK(CZ) UNCE 204005/2012 Institutional support: PRVOUK-P23 Keywords : bilateral trade * factors of trade * panel data Subject RIV: AH - Economics Impact factor: 0.649, year: 2014

  1. Quadratic prediction of factor scores

    NARCIS (Netherlands)

    Wansbeek, T

    1999-01-01

    Factor scores are naturally predicted by means of their conditional expectation given the indicators y. Under normality this expectation is linear in y but in general it is an unknown function of y. II is discussed that under nonnormality factor scores can be more precisely predicted by a quadratic

  2. Hidden Risk Factors for Women

    Science.gov (United States)

    ... A.S.T. Quiz Hidden Stroke Risk Factors for Women Updated:Nov 22,2016 Excerpted from "What Women Need To Know About The Hidden Risk Factors ... 2012) This year, more than 100,000 U.S. women under 65 will have a stroke. Stroke is ...

  3. Factor analysis of multivariate data

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, A.A.; Mahadevan, R.

    A brief introduction to factor analysis is presented. A FORTRAN program, which can perform the Q-mode and R-mode factor analysis and the singular value decomposition of a given data matrix is presented in Appendix B. This computer program, uses...

  4. Pineal factors other than melatonin

    NARCIS (Netherlands)

    Ebels, I.

    Some sheep pineal factors other than melatonin are described. A “nonmelatonin” antigonadotropic activity has been detected by application of the inhibition of compensatory ovarian hypertrophy (COH) in unilaterally ovariectomized adult Charles River CD-1 mice. The factor has been extracted from

  5. Stroke Risk Factors and Symptoms

    Science.gov (United States)

    ... » [ pdf, 433 kb ] Order Materials » Stroke Risk Factors and Symptoms Risk Factors for a Stroke Stroke prevention is still ... it. Treatment can delay complications that increase the risk of stroke. Transient ischemic attacks (TIAs). Seek help. ...

  6. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.

    1976-01-01

    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  7. Shell model and spectroscopic factors

    International Nuclear Information System (INIS)

    Poves, P.

    2007-01-01

    In these lectures, I introduce the notion of spectroscopic factor in the shell model context. A brief review is given of the present status of the large scale applications of the Interacting Shell Model. The spectroscopic factors and the spectroscopic strength are discussed for nuclei in the vicinity of magic closures and for deformed nuclei. (author)

  8. EAMJ Risk Factors 10.indd

    African Journals Online (AJOL)

    2010-02-02

    Feb 2, 2010 ... Several factors have been suggested as independent risk factors for their development. Identification of these ... with age, gender or haematological test. ... A meta-analysis of prospective studies on ..... The marked difference may be because monthly .... and dyslipidemia among patients taking first-line,.

  9. Factors That Shape Design Thinking

    Science.gov (United States)

    Gray, Colin M.

    2013-01-01

    A wide range of design literature discusses the role of the studio and its related pedagogy in the development of design thinking. Scholars in a variety of design disciplines pose a number of factors that potentially affect this development process, but a full understanding of these factors as experienced from a critical pedagogy or student…

  10. Kadison-Kastler stable factors

    DEFF Research Database (Denmark)

    Cameron, Jan; Christensen, Erik; Sinclair, Allan M.

    2014-01-01

    It is proven that a pair of continuous finite von Neumann algebra factors are unitarily equivalent if sufficiently close and one satisfies a certain cohomological condition.......It is proven that a pair of continuous finite von Neumann algebra factors are unitarily equivalent if sufficiently close and one satisfies a certain cohomological condition....

  11. Human factors influencing decision making

    OpenAIRE

    Jacobs, Patricia A.

    1998-01-01

    This report supplies references and comments on literature that identifies human factors influencing decision making, particularly military decision making. The literature has been classified as follows (the classes are not mutually exclusive): features of human information processing; decision making models which are not mathematical models but rather are descriptive; non- personality factors influencing decision making; national characteristics influencing decision makin...

  12. Genetics Home Reference: FOXP2-related speech and language disorder

    Science.gov (United States)

    ... skills such as walking and tying shoelaces, and autism spectrum disorders, which are conditions characterized by impaired communication and social interaction. Related Information What does it mean if a disorder seems to run in my family? What is the prognosis of a genetic condition? ...

  13. Genetics Home Reference: LAMA2-related muscular dystrophy

    Science.gov (United States)

    ... movement, and joint deformities (contractures). Weakness of the muscles in the face and throat can result in feeding difficulties and an inability to grow and gain weight at the expected rate (failure ...

  14. The molecular and phenotypic spectrum of IQSEC2-related epilepsy.

    Science.gov (United States)

    Zerem, Ayelet; Haginoya, Kazuhiro; Lev, Dorit; Blumkin, Lubov; Kivity, Sara; Linder, Ilan; Shoubridge, Cheryl; Palmer, Elizabeth Emma; Field, Michael; Boyle, Jackie; Chitayat, David; Gaillard, William D; Kossoff, Eric H; Willems, Marjolaine; Geneviève, David; Tran-Mau-Them, Frederic; Epstein, Orna; Heyman, Eli; Dugan, Sarah; Masurel-Paulet, Alice; Piton, Ame'lie; Kleefstra, Tjitske; Pfundt, Rolph; Sato, Ryo; Tzschach, Andreas; Matsumoto, Naomichi; Saitsu, Hirotomo; Leshinsky-Silver, Esther; Lerman-Sagie, Tally

    2016-11-01

    IQSEC2 is an X-linked gene associated with intellectual disability (ID) and epilepsy. Herein we characterize the epilepsy/epileptic encephalopathy of patients with IQSEC2 pathogenic variants. Forty-eight patients with IQSEC2 variants were identified worldwide through Medline search. Two patients were recruited from our early onset epileptic encephalopathy cohort and one patient from personal communication. The 18 patients who have epilepsy in addition to ID are the subject of this study. Information regarding the 18 patients was ascertained by questionnaire provided to the treating clinicians. Six affected individuals had an inherited IQSEC2 variant and 12 had a de novo one (male-to-female ratio, 12:6). The pathogenic variant types were as follows: missense (8), nonsense (5), frameshift (1), intragenic duplications (2), translocation (1), and insertion (1). An epileptic encephalopathy was diagnosed in 9 (50%) of 18 patients. Seizure onset ranged from 8 months to 4 years; seizure types included spasms, atonic, myoclonic, tonic, absence, focal seizures, and generalized tonic-clonic (GTC) seizures. The electroclinical syndromes could be defined in five patients: late-onset epileptic spasms (three) and Lennox-Gastaut or Lennox-Gastaut-like syndrome (two). Seizures were pharmacoresistant in all affected individuals with epileptic encephalopathy. The epilepsy in the other nine patients had a variable age at onset from infancy to 18 years; seizure types included GTC and absence seizures in the hereditary cases and GTC and focal seizures in de novo cases. Seizures were responsive to medical treatment in most cases. All 18 patients had moderate to profound intellectual disability. Developmental regression, autistic features, hypotonia, strabismus, and white matter changes on brain magnetic resonance imaging (MRI) were prominent features. The phenotypic spectrum of IQSEC2 disorders includes epilepsy and epileptic encephalopathy. Epileptic encephalopathy is a main clinical feature in sporadic cases. IQSEC2 should be evaluated in both male and female patients with an epileptic encephalopathy. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  15. Genetics Home Reference: HIVEP2-related intellectual disability

    Science.gov (United States)

    ... to have difficulty with this activity; their walking style (gait) is often unbalanced and wide-based. Speech ... Cell Biol. 1999 May;19(5):3736-47. Citation on PubMed or Free article on PubMed Central ...

  16. 50 CFR 20.2 - Relation to other provisions.

    Science.gov (United States)

    2010-10-01

    ... (CONTINUED) TAKING, POSSESSION, TRANSPORTATION, SALE, PURCHASE, BARTER, EXPORTATION, AND IMPORTATION OF... migratory game birds under the National Wildlife Refuge System Administration Act of 1966 (80 Stat. 927, as...

  17. Genetics Home Reference: MECP2-related severe neonatal encephalopathy

    Science.gov (United States)

    ... and Stroke: Encephalopathy Information Page National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (8 links) Boston Children's Hospital: Seizures Centers for Disease Control and Prevention: ...

  18. The molecular and phenotypic spectrum of IQSEC2-related epilepsy

    NARCIS (Netherlands)

    Zerem, A.; Haginoya, K.; Lev, D.; Blumkin, L.; Kivity, S.; Linder, I.; Shoubridge, C.; Palmer, E.E.; Field, M.; Boyle, J.; Chitayat, D.; Gaillard, W.D.; Kossoff, E.H.; Willems, M.; Genevieve, D.; Tran-Mau-Them, F.; Epstein, O.; Heyman, E.; Dugan, S.; Masurel-Paulet, A.; Piton, A.; Kleefstra, T.; Pfundt, R.; Sato, R.; Tzschach, A.; Matsumoto, N.; Saitsu, H.; Leshinsky-Silver, E.; Lerman-Sagie, T.

    2016-01-01

    OBJECTIVE: IQSEC2 is an X-linked gene associated with intellectual disability (ID) and epilepsy. Herein we characterize the epilepsy/epileptic encephalopathy of patients with IQSEC2 pathogenic variants. METHODS: Forty-eight patients with IQSEC2 variants were identified worldwide through Medline

  19. Factoring in Factor VIII With Acute Ischemic Stroke.

    Science.gov (United States)

    Siegler, James E; Samai, Alyana; Albright, Karen C; Boehme, Amelia K; Martin-Schild, Sheryl

    2015-10-01

    There is growing research interest into the etiologies of cryptogenic stroke, in particular as it relates to hypercoagulable states. An elevation in serum levels of the procoagulant factor VIII is recognized as one such culprit of occult cerebral infarctions. It is the objective of the present review to summarize the molecular role of factor VIII in thrombogenesis and its clinical use in the diagnosis and prognosis of acute ischemic stroke. We also discuss the utility of screening for serum factor VIII levels among patients at risk for, or those who have experienced, ischemic stroke. © The Author(s) 2015.

  20. Using Bayes factors for multi-factor, biometric authentication

    Science.gov (United States)

    Giffin, A.; Skufca, J. D.; Lao, P. A.

    2015-01-01

    Multi-factor/multi-modal authentication systems are becoming the de facto industry standard. Traditional methods typically use rates that are point estimates and lack a good measure of uncertainty. Additionally, multiple factors are typically fused together in an ad hoc manner. To be consistent, as well as to establish and make proper use of uncertainties, we use a Bayesian method that will update our estimates and uncertainties as new information presents itself. Our algorithm compares competing classes (such as genuine vs. imposter) using Bayes Factors (BF). The importance of this approach is that we not only accept or reject one model (class), but compare it to others to make a decision. We show using a Receiver Operating Characteristic (ROC) curve that using BF for determining class will always perform at least as well as the traditional combining of factors, such as a voting algorithm. As the uncertainty decreases, the BF result continues to exceed the traditional methods result.

  1. The aryl hydrocarbon receptor (AHR) transcription factor regulates megakaryocytic polyploidization.

    Science.gov (United States)

    Lindsey, Stephan; Papoutsakis, Eleftherios T

    2011-02-01

    We propose that the aryl hydrocarbon receptor (AHR) is a novel transcriptional regulator of megakaryopoietic polyploidization. Functional evidence was obtained that AHR impacts in vivo megakaryocytic differentiation and maturation; compared to wild-type mice, AHR-null mice had lower platelet counts, fewer numbers of newly synthesized platelets, increased bleeding times and lower-ploidy megakaryocytes (Mks). AHR mRNA increased 3·6-fold during ex vivo megakaryocytic differentiation, but reduced or remained constant during parallel isogenic granulocytic or erythroid differentiation. We interrogated the role of AHR in megakaryopoiesis using a validated Mk model of megakaryopoiesis, the human megakaryoblastic leukaemia CHRF cell line. Upon CHRF Mk differentiation, AHR mRNA and protein levels increased, AHR protein shifted from the cytoplasm to the nucleus and AHR binding to its consensus DNA binding sequence increased. Protein and mRNA levels of the AHR transcriptional target HES1 also increased. Mk differentiation of CHRF cells where AHR or HES1 was knocked-down using RNAi resulted in lower ploidy distributions and cells that were incapable of reaching ploidy classes ≥16n. AHR knockdown also resulted in increased DNA synthesis of lower ploidy cells, without impacting apoptosis. Together, these data support a role for AHR in Mk polyploidization and in vivo platelet function, and warrant further detailed investigations. © 2011 Blackwell Publishing Ltd.

  2. What factors influence mitigative capacity?

    International Nuclear Information System (INIS)

    Winkler, Harald; Baumert, Kevin; Blanchard, Odile; Burch, Sarah; Robinson, John

    2007-01-01

    This article builds on Yohe's seminal piece on mitigative capacity, which elaborates 'determinants' of mitigative capacity, also reflected in the IPCC's third assessment report. We propose a revised definition, where mitigative capacity is a country's ability to reduce anthropogenic greenhouse gas emissions or enhance natural sinks. By 'ability' we mean skills, competencies, fitness, and proficiencies that a country has attained which can contribute to GHG emissions mitigation. A conceptual framework is proposed, linking mitigative capacity to a country's sustainable development path, and grouping the factors influencing mitigative capacity into three main sets: economic factors, institutional ones, and technology. Both quantitative and qualitative analysis of factors is presented, showing how these factors vary across countries. We suggest that it is the interplay between the three economic factors-income, abatement cost and opportunity cost-that shape mitigative capacity. We find that income is an important economic factor influencing mitigative capacity, while abatement cost is important in turning mitigative capacity into actual mitigation. Technology is a critical mitigative capacity, including the ability to absorb existing climate-friendly technologies or to develop innovative ones. Institutional factors that promote mitigative capacity include the effectiveness of government regulation, clear market rules, a skilled work force and public awareness. We briefly investigate such as high abatement cost or lack of political willingness that prevent mitigative capacity from being translated into mitigation

  3. Corrosion effects on friction factors

    International Nuclear Information System (INIS)

    Magleby, H.L.; Shaffer, S.J.

    1996-01-01

    This paper presents the results of NRC-sponsored material specimen tests that were performed to determine if corrosion increases the friction factors of sliding surfaces of motor-operated gate valves, which could require higher forces to close and open safety-related valves when subjected to their design basis differential pressures. Friction tests were performed with uncorroded specimens and specimens subjected to accelerated corrosion. Preliminary tests at ambient conditions showed that corrosion increased the friction factors, indicating the need for additional tests duplicating valve operating parameters at hot conditions. The additional tests showed friction factors of corroded specimens were 0.1 to 0.2 higher than for uncorroded specimens, and that the friction factors of the corroded specimens were not very dependent on contact stress or corrosion film thickness. The measured values of friction factors for the three corrosion films tested (simulating three operating times) were in the range of 0.3 to 0.4. The friction factor for even the shortest simulated operating time was essentially the same as the others, indicating that the friction factors appear to reach a plateau and that the plateau is reached quickly

  4. Conversion factors and oil statistics

    International Nuclear Information System (INIS)

    Karbuz, Sohbet

    2004-01-01

    World oil statistics, in scope and accuracy, are often far from perfect. They can easily lead to misguided conclusions regarding the state of market fundamentals. Without proper attention directed at statistic caveats, the ensuing interpretation of oil market data opens the door to unnecessary volatility, and can distort perception of market fundamentals. Among the numerous caveats associated with the compilation of oil statistics, conversion factors, used to produce aggregated data, play a significant role. Interestingly enough, little attention is paid to conversion factors, i.e. to the relation between different units of measurement for oil. Additionally, the underlying information regarding the choice of a specific factor when trying to produce measurements of aggregated data remains scant. The aim of this paper is to shed some light on the impact of conversion factors for two commonly encountered issues, mass to volume equivalencies (barrels to tonnes) and for broad energy measures encountered in world oil statistics. This paper will seek to demonstrate how inappropriate and misused conversion factors can yield wildly varying results and ultimately distort oil statistics. Examples will show that while discrepancies in commonly used conversion factors may seem trivial, their impact on the assessment of a world oil balance is far from negligible. A unified and harmonised convention for conversion factors is necessary to achieve accurate comparisons and aggregate oil statistics for the benefit of both end-users and policy makers

  5. Factors Influencing of Social Conflict

    Directory of Open Access Journals (Sweden)

    Suwandi Sumartias

    2013-07-01

    Full Text Available Social conflicts that occur in several areas in Indonesia lately, one of them is caused by the weakness of law certainty. This is feared to threaten the integration of the Republic of Indonesia. This study aims to determine the factors that affect social conflict in Manis Lor village in Kuningan district. The method used the explanatory quantitative methods, the statistical test Path Analysis. The study population was a formal and informal community leaders (village chief, clergy, and youth, and the people who involved in a conflict in Manis Lor village Kuningan regency. The result shows a There is no significant influence between social identity factors with social conflict anarchist. b There is significant influence between socio-economic factors with social conflict anarchists. c There is no significant influence between the credibility factor anarchist leaders with social conflict. d There is no significant influence between the motive factor with anarchist social conflict. e There is significant influence between personality factors/beliefs with anarchist social conflict. f There is significant influence of behavioral factors anarchist communication with social conflict.

  6. Factor concentrates for the treatment of factor XIII deficiency.

    Science.gov (United States)

    Gootenberg, J E

    1998-11-01

    Factor XIII deficiency is a severe autosomal recessive bleeding disorder associated with a characteristic pattern of neonatal hemorrhage and a lifelong bleeding diathesis. Even relatively minor trauma can be followed by prolonged and recurrent bleeding. Intracranial hemorrhage is a frequent complication. With the development of safe and effective factor XIII concentrates, reliable prophylactic treatment is possible. Two plasma-derived, virus-inactivated factor XIII concentrates are currently in production. The first, Fibrogammin P, (Centeon LLC, King of Prussia, PA, USA; and Centeon Pharma GmbH, Marburg, Germany) is marketed in Europe, South America, South Africa, and Japan. It is distributed in the United States under a Food and Drug Administration Investigational New Drug Application. A second factor XIII concentrate (Bio Products Laboratory, Elstree, UK) is available for use only on a "named patient" compassionate basis in the United Kingdom. Patients with factor XIII deficiency who receive appropriately timed periodic infusions of such factor XIII concentrates are able to live normal lives, free from catastrophic bleeding episodes.

  7. Sequence Factorization with Multiple References.

    Directory of Open Access Journals (Sweden)

    Sebastian Wandelt

    Full Text Available The success of high-throughput sequencing has lead to an increasing number of projects which sequence large populations of a species. Storage and analysis of sequence data is a key challenge in these projects, because of the sheer size of the datasets. Compression is one simple technology to deal with this challenge. Referential factorization and compression schemes, which store only the differences between input sequence and a reference sequence, gained lots of interest in this field. Highly-similar sequences, e.g., Human genomes, can be compressed with a compression ratio of 1,000:1 and more, up to two orders of magnitude better than with standard compression techniques. Recently, it was shown that the compression against multiple references from the same species can boost the compression ratio up to 4,000:1. However, a detailed analysis of using multiple references is lacking, e.g., for main memory consumption and optimality. In this paper, we describe one key technique for the referential compression against multiple references: The factorization of sequences. Based on the notion of an optimal factorization, we propose optimization heuristics and identify parameter settings which greatly influence 1 the size of the factorization, 2 the time for factorization, and 3 the required amount of main memory. We evaluate a total of 30 setups with a varying number of references on data from three different species. Our results show a wide range of factorization sizes (optimal to an overhead of up to 300%, factorization speed (0.01 MB/s to more than 600 MB/s, and main memory usage (few dozen MB to dozens of GB. Based on our evaluation, we identify the best configurations for common use cases. Our evaluation shows that multi-reference factorization is much better than single-reference factorization.

  8. Cardiovascular risk factors and dementia.

    Science.gov (United States)

    Fillit, Howard; Nash, David T; Rundek, Tatjana; Zuckerman, Andrea

    2008-06-01

    Dementias, such as Alzheimer's disease (AD) and vascular dementia, are disorders of aging populations and represent a significant economic burden. Evidence is accumulating to suggest that cardiovascular disease (CVD) risk factors may be instrumental in the development of dementia. The goal of this review was to discuss the relationship between specific CVD risk factors and dementia and how current treatment strategies for dementia should focus on reducing CVD risks. We conducted a review of the literature for the simultaneous presence of 2 major topics, cardiovascular risk factors and dementia (eg, AD). Special emphasis was placed on clinical outcome studies examining the effects of treatments of pharmacologically modifiable CVD risk factors on dementia and cognitive impairment. Lifestyle risk factors for CVD, such as obesity, lack of exercise, smoking, and certain psychosocial factors, have been associated with an increased risk of cognitive decline and dementia. Some evidence suggests that effectively managing these factors may prevent cognitive decline/dementia. Randomized, placebo-controlled trials of antihypertensive medications have found that such therapy may reduce the risk of cognitive decline, and limited data suggest a benefit for patients with AD. Some small open-label and randomized clinical trials of statins have observed positive effects on cognitive function; larger studies of statins in patients with AD are ongoing. Although more research is needed, current evidence indicates an association between CVD risk factors--such as hypertension, dyslipidemia, and diabetes mellitus--and cognitive decline/dementia. From a clinical perspective, these data further support the rationale for physicians to provide effective management of CVD risk factors and for patients to be compliant with such recommendations to possibly prevent cognitive decline/dementia.

  9. Improved multivariate polynomial factoring algorithm

    International Nuclear Information System (INIS)

    Wang, P.S.

    1978-01-01

    A new algorithm for factoring multivariate polynomials over the integers based on an algorithm by Wang and Rothschild is described. The new algorithm has improved strategies for dealing with the known problems of the original algorithm, namely, the leading coefficient problem, the bad-zero problem and the occurrence of extraneous factors. It has an algorithm for correctly predetermining leading coefficients of the factors. A new and efficient p-adic algorithm named EEZ is described. Bascially it is a linearly convergent variable-by-variable parallel construction. The improved algorithm is generally faster and requires less store then the original algorithm. Machine examples with comparative timing are included

  10. Quality factors for monoenergetic neutrons

    International Nuclear Information System (INIS)

    Cross, W.G.; Ing, H.

    1984-01-01

    Mean quality factors anti Q(E/sub n/), for the dose resulting from first interactons of monoenergetic neutrons in tissue, have been calculated at energies from thermal to 14.7 MeV. Knowledge of these values, along with kerma factors, allows the calculation of the heavy-particle dose equivalent for any known neutron spectrum in tissue. The partial quality factors for the dose delivered by C, N, and O elastic and inelastic recoils are found to be virtually independent of the scattering angular distributions and are given by simple expressions

  11. Nucleocytoplasmic shuttling of transcription factors

    DEFF Research Database (Denmark)

    Cartwright, P; Helin, K

    2000-01-01

    To elicit the transcriptional response following intra- or extracellular stimuli, the signals need to be transmitted to their site of action within the nucleus. The nucleocytoplasmic shuttling of transcription factors is a mechanism mediating this process. The activation and inactivation...... of the transcriptional response is essential for cells to progress through the cell cycle in a normal manner. The involvement of cytoplasmic and nuclear accessory molecules, and the general nuclear membrane transport components, are essential for this process. Although nuclear import and export for different...... transcription factor families are regulated by similar mechanisms, there are several differences that allow for the specific activation of each transcription factor. This review discusses the general import and export pathways found to be common amongst many different transcription factors, and highlights...

  12. Secreted factors as synaptic organizers.

    Science.gov (United States)

    Johnson-Venkatesh, Erin M; Umemori, Hisashi

    2010-07-01

    A critical step in synaptic development is the differentiation of presynaptic and postsynaptic compartments. This complex process is regulated by a variety of secreted factors that serve as synaptic organizers. Specifically, fibroblast growth factors, Wnts, neurotrophic factors and various other intercellular signaling molecules are proposed to regulate presynaptic and/or postsynaptic differentiation. Many of these factors appear to function at both the neuromuscular junction and in the central nervous system, although the specific function of the molecules differs between the two. Here we review secreted molecules that organize the synaptic compartments and discuss how these molecules shape synaptic development, focusing on mammalian in vivo systems. Their critical role in shaping a functional neural circuit is underscored by their possible link to a wide range of neurological and psychiatric disorders both in animal models and by mutations identified in human patients. © The Authors (2010). Journal Compilation © Federation of European Neuroscience Societies and Blackwell Publishing Ltd.

  13. Disadvantage factor for anisotropic scattering

    International Nuclear Information System (INIS)

    Saad, E.A.; Abdel Krim, M.S.; EL-Dimerdash, A.A.

    1990-01-01

    The invariant embedding method is used to solve the problem for a two region reactor with anisotropic scattering and to compute the disadvantage factor necessary for calculating some reactor parameters

  14. Calculation of pion form factor

    International Nuclear Information System (INIS)

    Vahedi, N.; Amirarjomand, S.

    1975-09-01

    The pion form factor is calculated using the structure function Wsub(2), which incorporates kinematical constraints, threshold behaviour and scaling. The Bloom-Gilman sum rule is used and only the two leading Regge trajectories are taken into account

  15. EAMJ Factors Aug.indd

    African Journals Online (AJOL)

    2009-08-01

    Aug 1, 2009 ... Objective: To bridge the existing gaps by examining the factors associated with attrition. Design: ... Results: In this cohort study, 1353 women were enrolled at delivery and 1188 (88%) ... wage earners with poor social support.

  16. HIV: Social and Environmental Factors

    Centers for Disease Control (CDC) Podcasts

    Dr. Kevin Fenton, Director of CDC’s National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention, discusses how social and environmental factors may put African Americans at greater risk for HIV.

  17. Lithuanian Population Aging Factors Analysis

    Directory of Open Access Journals (Sweden)

    Agnė Garlauskaitė

    2015-05-01

    Full Text Available The aim of this article is to identify the factors that determine aging of Lithuania’s population and to assess the influence of these factors. The article shows Lithuanian population aging factors analysis, which consists of two main parts: the first describes the aging of the population and its characteristics in theoretical terms. Second part is dedicated to the assessment of trends that influence the aging population and demographic factors and also to analyse the determinants of the aging of the population of Lithuania. After analysis it is concluded in the article that the decline in the birth rate and increase in the number of emigrants compared to immigrants have the greatest impact on aging of the population, so in order to show the aging of the population, a lot of attention should be paid to management of these demographic processes.

  18. Environmental risk factors and pressures

    International Nuclear Information System (INIS)

    Klinda, J.; Lieskovska, Z.

    1998-01-01

    In this chapter the physical risk factors (as radiation [air contamination, contamination of the environment components and food contamination], radon and its radioactive decay products, radioactive wastes, noise), chemical risk factors [chemical substances, xenobiotics in the food chain the ozone depletion], wastes (waste generation, waste management, municipal waste management, import, export and transit of waste) and natural an technological hazards (water quality deterioration as a result of various accidents and fire risk) in the Slovak Republic in 1997 are reviewed

  19. Factorization-algebraization-path integration

    International Nuclear Information System (INIS)

    Inomata, A.; Wilson, R.

    1986-01-01

    The authors review the method of factorization proposed by Schroedinger of a quantum mechanical second-order linear differential equation into a product of two first-order differential operators, often referred to as ladder operators, as well as the modifications made to Schroedinger's method by Infeld and Hull. They then review the group theoretical treatments proposed by Miller of the Schroedinger-Infeld-Hull factorizations and go on to demonstrate the application of dynamical symmetry to path integral calculations. 30 references

  20. Factors determining UK album success

    OpenAIRE

    Elliott, Caroline; Simmons, Robert

    2011-01-01

    This article uses a recently compiled dataset on the UK album sales to determine which factors contribute to best-selling album sales success. We control for factors including length of time since release, nationality of artist, artist type and album type, testing the increasing returns to information hypothesis. Information on general public online review scores for the albums in the dataset allows for a strong test of the accuracy of online reviews in predicting music sales, as online revie...

  1. Virulence Factors of Streptococcus mutans.

    Science.gov (United States)

    1986-08-01

    763512/715242 Final Report U VIRULENCE FACTORS OF STREPTOCOCCUS MUTANS U Samuel Rosen Department of Oral Biology For the Period April 1, 1983 - June 30...00 FINAL REPORT VIRULENCE FACTORS OF STREPTOCOCCUS MUTANS Sam Rosen, Irving Shklair, E. X. Beck and F. M. Beck Ohio State University Columbus,Oh and...206-212. Johnson CP, Gorss S, Hillman JD (1978). Cariogenic properties of LDH deficient mutants of streptococcus mutans . J Dent Res 57, Special Issue

  2. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  3. FACTORS INFLUENCING SECOND LANGUAGE ACQUISITION

    Directory of Open Access Journals (Sweden)

    Siti Khasinah

    2014-05-01

    Full Text Available Motivation, attitude, age, intelligence, aptitude, cognitive style, and personality are considered as factors that greatly influence someone in the process of his or her second language acquisition. Experts state that those factors give a more dominant contribution in SLA to learners variedly, depend on who the learners are, their age, how they behave toward the language, their cognitive ability, and also the way they learn.

  4. Clinical Application of Wedge Factor

    International Nuclear Information System (INIS)

    Choi, Dong Rak; Ahn, Yong Chan; Huh, Sueng Jae

    1995-01-01

    Purpose : In general. The wedge factors which are used clinical practices are ignored of dependency on field sizes and depths. In this present, we investigated systematically the depth and field size dependency to determine the absorbed dose more accurately. Methods : The wedge factors for each wedge filter were measured at various depth (depth of Dmax, 5cm, 10cm, and 15cm) and field sizes (5 X 5cm, 10 X 10cm, 15 X 15cm, 20 X 20 cm) by using 4-,6-, and 10-MV X rays. By convention, wedge factors are determined by taking the ratio of the central axis ionization readings when the wedge filter is in place to those of the open field in same field size and measurement depth. In this present work, we determined the wedge factors for 4-, 6-, and 10-MV X rays from Clinac 600C and 2100C linear accelerators (manufactured by Varian Associates, Inc., Palo Alto, CA). To confirm that the wedge was centered., measurements were done with the two possible wedge position and various collimator orientations. Results : The standard deviations of measured values are within 0.3% and the depth dependence of wedge factor is greater for the lower energies. Especially, the variation of wedge factor is no less than 5% for 4- and 6- MV X rays with more than 45 .deg. wedge filter. But there seems to be a small dependence on field size. Conclusion : The results of this study show a dependence on the point of measurement. There also seems to be a small dependence on field size. And so, we should consider the depth and field size dependence in determining the wedge factors. If one wedge factor were to be used for each wedge filter, it seems that the measurement for a 10cm X 10cm field size at a depth of 10cm would be a reasonable choice

  5. Demand, Energy, and Power Factor

    Science.gov (United States)

    1994-08-01

    POWER FACTOR DEFINITION I Basically , power factor (pf) is a measure of how effectively the plant uses the electricity it purchases from the utility. It...not be made available by the plant. U 24 This video is relatively short, less than fifteen-minutes, and covers the basics on demand, block extenders... ratemaking methodology and test period as used in determining the NC-RS rates. Pending final decision by the FERC, the Federal Government would pay a rate as

  6. Environmental Factors and Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Omer Faruk Tekbas

    2008-10-01

    Full Text Available Epidemiological and clinical observations have led to the hypothesis that the risk of developing cardiovascular diseases is influenced not only by genetic, lifestyle and major risk factors, but also by environmental factors. Environmental factors are considered key determinants of cardiovascular diseases. Although lifestyle choices such as smoking, diet, and exercise are viewed as major environmental influences, the contribution of pollutants and environmental chemicals is less clear. Accumulating evidence suggests that exposure to physically and chemical pollutants could elevate the risk of cardiovascular diseases. Many epidemiological studies report that exposure to physically, biologically and socio-cultural environmental factors are associated with an increase in cardiovascular mortality. Relationships between environmental factors and coronary arter disease, arhythmias, and cardiomyopathies have been reported. Exposures to arsenic, lead, cadmium, pollutant gases, solvents, and pesticides have also been linked to increased incidence of cardiovascular disease. In this paper, I review that relationships between exposure to physically, chemical, biologically and socio-cultural environmental factors and cardiovascular diseases. [TAF Prev Med Bull 2008; 7(5.000: 435-444

  7. Human factors in resuscitation teaching.

    Science.gov (United States)

    Norris, Elizabeth M; Lockey, Andrew S

    2012-04-01

    There is an increasing interest in human factors within the healthcare environment reflecting the understanding of their impact on safety. The aim of this paper is to explore how human factors might be taught on resuscitation courses, and improve course outcomes in terms of improved mortality and morbidity for patients. The delivery of human factors training is important and this review explores the work that has been delivered already and areas for future research and teaching. Medline was searched using MESH terms Resuscitation as a Major concept and Patient or Leadership as core terms. The abstracts were read and 25 full length articles reviewed. Critical incident reporting has shown four recurring problems: lack of organisation at an arrest, lack of equipment, non functioning equipment, and obstructions preventing good care. Of these, the first relates directly to the concept of human factors. Team dynamics for both team membership and leadership, management of stress, conflict and the role of debriefing are highlighted. Possible strategies for teaching them are discussed. Four strategies for improving human factors training are discussed: team dynamics (including team membership and leadership behaviour), the influence of stress, debriefing, and conflict within teams. This review illustrates how human factor training might be integrated further into life support training without jeopardising the core content and lengthening the courses. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  8. Growth factors and new periodontology

    Directory of Open Access Journals (Sweden)

    Paknejad M

    1999-06-01

    Full Text Available Growth factors are biological mediators that have a key roll in proliferation, chemotaxy and"ndifferentiation by acting on specific receptors on the surface of cells and regulating events in wound"nhealing.They can be considered hormones that are not released in to the blood stream but have one a"nlocal action. Some of these factors can regulate premature change in GO to Gl phase in cell devesion"ncycle and even may stimulate synthesis of DNA in suitable cells, Growth substances, primarily secreted"nby fibroblasts, endothelia! cells, macrophages and platelet, include platelet derived growth factor"n(PDGF, insulin like growth factor (IGF transforming growth factor (TGFa and (3 and bone"nmorphogenetic proteins BMPs that approximately are the most important of them. (BMPs could be"nused to control events during periodontal, craniofacial and implant wound healing through favoring bone"nformation"nAccording toLynch, combination of PGDF and IGF1 would be effective in promoting growth of all the"ncomponents of the periodontium."nThe aim of this study was to characterize growth factor and review the literature to determine the"nmechanism of their function, classification and application in implant and periodontal treatment.

  9. Sexual harassment: identifying risk factors.

    Science.gov (United States)

    O'Hare, E A; O'Donohue, W

    1998-12-01

    A new model of the etiology of sexual harassment, the four-factor model, is presented and compared with several models of sexual harassment including the biological model, the organizational model, the sociocultural model, and the sex role spillover model. A number of risk factors associated with sexually harassing behavior are examined within the framework of the four-factor model of sexual harassment. These include characteristics of the work environment (e.g., sexist attitudes among co-workers, unprofessional work environment, skewed sex ratios in the workplace, knowledge of grievance procedures for sexual harassment incidents) as well as personal characteristics of the subject (e.g., physical attractiveness, job status, sex-role). Subjects were 266 university female faculty, staff, and students who completed the Sexual Experience Questionnaire to assess the experience of sexual harassment and a questionnaire designed to assess the risk factors stated above. Results indicated that the four-factor model is a better predictor of sexual harassment than the alternative models. The risk factors most strongly associated with sexual harassment were an unprofessional environment in the workplace, sexist atmosphere, and lack of knowledge about the organization's formal grievance procedures.

  10. Modifying factors for metabolic parameters

    International Nuclear Information System (INIS)

    Inaba, Jiro

    1990-01-01

    Studies on factors which influence the metabolic parameter for calculation of radiation doses from intakes of radionuclides are very important for estimation of the doses for the general public, because the present procedures recommended by the International Commission on Radiological Protection is for occupationally exposed workers and the underlying metabolic and dosimetric models have been developed from studies on adult man and experiments on adult animals and from observations on radionuclides in physico-chemically simple form. Many factors have been reported to influence the metabolic parameters. Among them, the food-chain involvement of radionuclides and the age-dependence in humans and animals are most significant as environmental and physiological factor, respectively. In connection with the age-dependence of dose calculation, the ICRP started a new programme. They organized a Task Group on Age-Dependent Dose-Factors where relevant information on metabolic and biokinetic parameters are presently being reviewed for development of a set of dose factors for the following age-groups: infant, 1-year-old, 5-year-old, 10-year-old, 15-year-old, and ICRP Reference Man. The first stage of the work is for age-dependent integrated organ and effective dose factors for radioisotopes of the following elements: hydrogen, carbon, iodine, cesium, strontium, plutonium and americium. (author)

  11. Transcriptional control of megakaryocyte development.

    Science.gov (United States)

    Goldfarb, A N

    2007-10-15

    Megakaryocytes are highly specialized cells that arise from a bipotent megakaryocytic-erythroid progenitor (MEP). This developmental leap requires coordinated activation of megakaryocyte-specific genes, radical changes in cell cycle properties, and active prevention of erythroid differentiation. These programs result from upregulation of megakaryocyte-selective transcription factors, downregulation of erythroid-selective transcription factors and ongoing mediation of common erythro-megakaryocytic transcription factors. Unlike most developmental programs, no single lineage-unique family of master regulators exerts executive control over the megakaryocytic plan. Rather, an assemblage of non-unique factors and signals converge to determine lineage and differentiation. In human megakaryopoiesis, hereditary disorders of platelet production have confirmed contributions from three distinct transcription factor families. Murine models have extended this repertoire to include multiple additional factors. At a mechanistic level, the means by which these non-unique factors collaborate in the establishment of a perfectly unique cell type remains a central question.

  12. Multi-factor authentication using quantum communication

    Science.gov (United States)

    Hughes, Richard John; Peterson, Charles Glen; Thrasher, James T.; Nordholt, Jane E.; Yard, Jon T.; Newell, Raymond Thorson; Somma, Rolando D.

    2018-02-06

    Multi-factor authentication using quantum communication ("QC") includes stages for enrollment and identification. For example, a user enrolls for multi-factor authentication that uses QC with a trusted authority. The trusted authority transmits device factor information associated with a user device (such as a hash function) and user factor information associated with the user (such as an encrypted version of a user password). The user device receives and stores the device factor information and user factor information. For multi-factor authentication that uses QC, the user device retrieves its stored device factor information and user factor information, then transmits the user factor information to the trusted authority, which also retrieves its stored device factor information. The user device and trusted authority use the device factor information and user factor information (more specifically, information such as a user password that is the basis of the user factor information) in multi-factor authentication that uses QC.

  13. Rare coagulation disorders: fibrinogen, factor VII and factor XIII.

    Science.gov (United States)

    de Moerloose, P; Schved, J-F; Nugent, D

    2016-07-01

    Rare coagulation disorders (RCDs) include the inherited deficiencies of fibrinogen, factor (F) II, FV, combined FV and VIII, FVII, FX, combined FVII and X, FXI, FXIII and combined congenital deficiency of vitamin K-dependent factors (VKCFDs). Despite their rarity, a deep comprehension of all these disorders is essential to really understand haemostasis. Indeed, even if they share some common features each RCD has some particularity which makes it unique. In this review, we focus on three disorders: fibrinogen, FVII and FXIII. © 2016 John Wiley & Sons Ltd.

  14. Feed-Back Regulation of Haemopoiesis

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, M. [Department of Cell Biology, Weizmann Institute of Science, Rehovoth (Israel)

    1968-08-15

    Studies ate reported on the feed-back regulation of erythropoiesis by means of the intrasplenic cloning system of haemopoietic cells. Polycythaemia, produced by passive transfusion of synzeneic, allogeneic or xenogeneic red blood cells, inhibited the formation of bone-marrow derived erythroid clones. Polycythaemia also inhibited the formation of erythroid clones of endogenous stem cells. Oxygen overloading was found to be a necessary factor in the suppression of erythroid clone formation: no suppression of erythroid colonies was observed when polycythaemic animals were kept under hypoxic conditions. Erythropoietin, either of exogenous or of endogenous origin, elicited a reformation of erythroid clones in 'suppressed' animals. Studies on the kinetics of reformation of erythroid clones after the administration of erythropoietin suggested that the colony-forming stem cell can replicate a few times in the absence of erythropoietin and the cell progeny thus formed are the target cells for erythropoietin action. If, indeed, the colony-forming cell replicates in the absence of the specific inducer, then the cells thus formed should themselves be stem cells. This was substantiated by demonstrating that the cloning efficiency of spleens of polycythaemic recipients was higher than that of non-polycythaemic animals. Experiments indicating that erythroid clones produced by erythropoietin in polycythaemic animals disappeared after the discontinuance of erythropoietin application demonstrated the distinction between the 'mitogenic' and the 'morphogenetic' effects of erythropoietin. The latter seemed to be operated by an early transcription of RNA for proteins necessary for the complete maturation of the red blood cell, Erythroid clones produced by foetal haemopoietic stem cells seemed to be regulated by a different mechanism from that which controls the formation of bone-marrow derived clones. Clones produced by foetal cells were only partially suppressed in the polycythaemic

  15. Self-similar factor approximants

    International Nuclear Information System (INIS)

    Gluzman, S.; Yukalov, V.I.; Sornette, D.

    2003-01-01

    The problem of reconstructing functions from their asymptotic expansions in powers of a small variable is addressed by deriving an improved type of approximants. The derivation is based on the self-similar approximation theory, which presents the passage from one approximant to another as the motion realized by a dynamical system with the property of group self-similarity. The derived approximants, because of their form, are called self-similar factor approximants. These complement the obtained earlier self-similar exponential approximants and self-similar root approximants. The specific feature of self-similar factor approximants is that their control functions, providing convergence of the computational algorithm, are completely defined from the accuracy-through-order conditions. These approximants contain the Pade approximants as a particular case, and in some limit they can be reduced to the self-similar exponential approximants previously introduced by two of us. It is proved that the self-similar factor approximants are able to reproduce exactly a wide class of functions, which include a variety of nonalgebraic functions. For other functions, not pertaining to this exactly reproducible class, the factor approximants provide very accurate approximations, whose accuracy surpasses significantly that of the most accurate Pade approximants. This is illustrated by a number of examples showing the generality and accuracy of the factor approximants even when conventional techniques meet serious difficulties

  16. Factors Influencing Healthcare Service Quality

    Directory of Open Access Journals (Sweden)

    Ali Mohammad Mosadeghrad

    2014-07-01

    Full Text Available Background The main purpose of this study was to identify factors that influence healthcare quality in the Iranian context. Methods Exploratory in-depth individual and focus group interviews were conducted with 222 healthcare stakeholders including healthcare providers, managers, policy-makers, and payers to identify factors affecting the quality of healthcare services provided in Iranian healthcare organisations. Results Quality in healthcare is a production of cooperation between the patient and the healthcare provider in a supportive environment. Personal factors of the provider and the patient, and factors pertaining to the healthcare organisation, healthcare system, and the broader environment affect healthcare service quality. Healthcare quality can be improved by supportive visionary leadership, proper planning, education and training, availability of resources, effective management of resources, employees and processes, and collaboration and cooperation among providers. Conclusion This article contributes to healthcare theory and practice by developing a conceptual framework that provides policy-makers and managers a practical understanding of factors that affect healthcare service quality.

  17. TRASYS form factor matrix normalization

    Science.gov (United States)

    Tsuyuki, Glenn T.

    1992-01-01

    A method has been developed for adjusting a TRASYS enclosure form factor matrix to unity. This approach is not limited to closed geometries, and in fact, it is primarily intended for use with open geometries. The purpose of this approach is to prevent optimistic form factors to space. In this method, nodal form factor sums are calculated within 0.05 of unity using TRASYS, although deviations as large as 0.10 may be acceptable, and then, a process is employed to distribute the difference amongst the nodes. A specific example has been analyzed with this method, and a comparison was performed with a standard approach for calculating radiation conductors. In this comparison, hot and cold case temperatures were determined. Exterior nodes exhibited temperature differences as large as 7 C and 3 C for the hot and cold cases, respectively when compared with the standard approach, while interior nodes demonstrated temperature differences from 0 C to 5 C. These results indicate that temperature predictions can be artificially biased if the form factor computation error is lumped into the individual form factors to space.

  18. Peaking-factor of PWR

    International Nuclear Information System (INIS)

    Morioka, Noboru; Kato, Yasuji; Yokoi, M.

    1975-01-01

    Output peaking factor often plays an important role in the safety and operation of nuclear reactors. The meaning of the peaking factor of PWRs is categorized into two features or the peaking factor in core (FQ-core) and the peaking factor on the basis of accident analysis (or FQ-limit). FQ-core is the actual peaking factor realized in nuclear core at the time of normal operation, and FQ-limit should be evaluated from loss of coolant accident and other abnormal conditions. If FQ-core is lower than FQ-limit, the reactor may be operated at full load, but if FQ-core is larger than FQ-limit, reactor output should be controlled lower than FQ-limit. FQ-core has two kinds of values, or the one on the basis of nuclear design, and the other actually measured in reactor operation. The first FQ-core should be named as FQ-core-design and the latter as FQ-core-measured. The numerical evaluation of FQ-core-design is as follows; FQ-core-design of three-dimensions is synthesized with FQ-core horizontal value (X-Y) and FQ-core vertical value, the former one is calculated with ASSY-CORE code, and the latter one with one dimensional diffusion code. For the evaluation of FQ-core-measured, on-site data observation from nuclear reactor instrumentation or off-site data observation is used. (Iwase, T.)

  19. [Risk factors of necrotizing enterocolitis].

    Science.gov (United States)

    Tapia-Rombo, C A; Velasco-Lavín, M R; Nieto-Caldelas, A

    1993-09-01

    The purpose of the present study is to compare risk factors of necrotizing enterocolitis (NEC) between two group: group A, newborns with the disease and group B, newborns with other diseases different from NEC, in order to know if these risk factors are more frequent or not in the first group. We assessed the clinical records of all the patients hospitalized in the Neonatal Intensive Care Unit and Neonatology Service of the La Raza General Hospital between 1987 and 1991 with the diagnosis of NEC. They were compared with 65 clinical records chosen at random of patients hospitalized in the same Unit with other diagnosis at the same time, and who were discharged by improvement or deceased. In all of them were look for known risk factors for NEC generally accepted such as: prematurity, neonatal asphyxia, poliglobulia, cyanotic congenital heart disease, patent ductus arteriosus, respiratory distress syndrome, catheterization of umbilical vessels, early feeding of elevated formula increases, exchange exchange transfusion, hypoxic ischemic encephalopathy, infection, etc. Just 25 records of the possible 50 with the diagnosis of NEC full filled inclusion criteria. There were no statistically significant difference in weight, sex, mortality and known risk factors of NEC between both groups. Were concluded that NEC is a disease of unknown etiology that should be studied more thoroughly. The known risk factors must be avoided because the patient susceptibility probably play an important role.

  20. Epistaxis: Prevailing Factors and Treatment

    Directory of Open Access Journals (Sweden)

    Secchi, Myrian Marajó Dal

    2009-12-01

    Full Text Available Introduction: The epistaxis is one the most frequent otorhinolaryngologic emergencies in the medical practice. It is a benign affection, but the refractory cases require hospital admission. Objective: To evaluate prevailing factors in patients with epistaxis and treatment. Form of study: Retrospective study. Method: 60 patients with diagnosis of epistaxis were evaluated and they needed hospital admission between 2005 and 2006. Results: The main prevailing factors were: Systemic arterial hypertension 36% (n= 22, trauma 16% (n=10 and coagulopathy 5% (n=3. The treatment was the use of nasal splint: anterior 58% (n=35 and antero-posterior 27% (n=16, the electrocauterization of the identified bloody point 7% (n=4, endoscopic arterial bandage 8% (n=5 in severe epistaxis. For the patients with antero-posterior splint with recurrence of bleeding in the first 24 hours (five patients, after clinical stabilization, an arterial bandage was indicated by endoscopic means; four patients had systemic arterial hypertension and in one patient no prevailing factor was identified. Conclusion: The main associated prevailing factors were systemic arterial hypertension, trauma and coagulopathy. The treatment depends on the type, severity and cause of bleeding, initially the anterior and antero-posterior splint for bleeding control. The early endoscopic arterial bandage is indicated in patients with severe epistaxis and prevailing factors, and prolonged admission and morbidities associated with nasal splint should be avoided.