Factorization in the central region of inclusive reactions

International Nuclear Information System (INIS)

Kellett, B.H.; Joshi, G.C.; Lo, S.Y.

1978-01-01

Detailed factorization predictions for inclusive π +- production in the central region are compared with the available data. If account is taken of possible leading-particle effects extending into the central region at low energies, there is substantial agreement with factorization for both the energy-independent and the energy-dependent parts of the inclusive cross-sections. (author)

Factors influencing economic performance of the South Moravian Region

Directory of Open Access Journals (Sweden)

Iva Živělová

2011-01-01

Full Text Available The paper deals with selected factors influencing economic performance of the South Moravian Region in the years 2003–2009. The economic performance of the region is evaluated by means of a contribution to the Gross Domestic Product of the Czech Republic. Considering the fact that the level of economic activity depends on the exploitation rate of production factors in the considered region, both development of soil exploitation rate and development of labour market indicators correlated with working force utilization are analysed, a number of employed adults and registered unemployment are taken into consideration. Attention is paid to the economic activity rate. The formation of the Gross Fixed Capital, which an assumption of favourable economic performance, and development of Gross Added Value are evaluated.All the regions nowadays fumble with the negative impacts of the economic crisis. According to the analysis of the economic performance of the South Moravian Region and the analysis of the factors influencing this performance, it could be stated, that the development of the South Moravian Region could be evaluated quite positively.

HUMAN POTENTIAL AS A STRATEGIC FACTOR OF REGIONAL DEVELOPMENT

Directory of Open Access Journals (Sweden)

A.M. Korobeynikov

2008-12-01

Full Text Available The article gives an insight of human potential as the strategic factor of regional development. The matter of human potential and its role in regional reproducing process is considered; regional intellectual potential as an integral part of human potential is analysed. The author outlines major directions of active social policy, aimed to develop regional human potential.

Territory brand as a factor of region competitiveness (on the example of Penza region

Directory of Open Access Journals (Sweden)

Medushevskaya Inna

2016-03-01

Full Text Available The article describes the brand of territory as a factor of the region competitiveness. The examples of territory brands from the world and Russian practice are analyzed. The possible options for the brand for Penza region are proposed.

Total-factor energy efficiency of regions in Japan

Energy Technology Data Exchange (ETDEWEB)

Honma, Satoshi [Faculty of Economics, Kyushu Sangyo University, 2-3-1 Matsukadai, Higashi-ku, Fukuoka 813-8503 (Japan); Hu, Jin-Li [Institute of Business and Management, National Chiao Tung University (China)

2008-02-15

This study computes the regional total-factor energy efficiency (TFEE) in Japan by employing the data envelopment analysis (DEA). A dataset of 47 prefectures in Japan for the period 1993-2003 is constructed. There are 14 inputs, including three production factors (labor employment, private, and public capital stocks) and 11 energy sources (electric power for commercial and industrial use, electric power for residential use, gasoline, kerosene, heavy oil, light oil, city gas, butane gas, propane gas, coal, and coke). GDP is the sole output. Following Fukao and Yue [2000. Regional factor inputs and convergence in Japan - how much can we apply closed economy neoclassical growth models? Economic Review 51, 136-151 (in Japanese)], data on private and public capital stocks are extended. All the nominal variables are transformed into real variables, taking into consideration the 1995 price level. For kerosene, gas oil, heavy oil, butane gas, coal, and coke, there are a few prefectures with TFEEs less than 0.7. The five most inefficient prefectures are Niigata, Wakayama, Hyogo, Chiba, and Yamaguchi. Inland regions and most regions along the Sea of Japan are efficient in energy use. Most of the inefficient prefectures that are developing mainly upon energy-intensive industries are located along the Pacific Belt Zone. A U-shaped relation similar to the environmental Kuznets curve (EKC) is discovered between energy efficiency and per capita income for the regions in Japan. (author)

Total-factor energy efficiency of regions in Japan

International Nuclear Information System (INIS)

Honma, Satoshi; Hu, Jin-Li

2008-01-01

This study computes the regional total-factor energy efficiency (TFEE) in Japan by employing the data envelopment analysis (DEA). A dataset of 47 prefectures in Japan for the period 1993-2003 is constructed. There are 14 inputs, including three production factors (labor employment, private, and public capital stocks) and 11 energy sources (electric power for commercial and industrial use, electric power for residential use, gasoline, kerosene, heavy oil, light oil, city gas, butane gas, propane gas, coal, and coke). GDP is the sole output. Following Fukao and Yue [2000. Regional factor inputs and convergence in Japan-how much can we apply closed economy neoclassical growth models? Economic Review 51, 136-151 (in Japanese)], data on private and public capital stocks are extended. All the nominal variables are transformed into real variables, taking into consideration the 1995 price level. For kerosene, gas oil, heavy oil, butane gas, coal, and coke, there are a few prefectures with TFEEs less than 0.7. The five most inefficient prefectures are Niigata, Wakayama, Hyogo, Chiba, and Yamaguchi. Inland regions and most regions along the Sea of Japan are efficient in energy use. Most of the inefficient prefectures that are developing mainly upon energy-intensive industries are located along the Pacific Belt Zone. A U-shaped relation similar to the environmental Kuznets curve (EKC) is discovered between energy efficiency and per capita income for the regions in Japan

Cloning of cDNAs coding for the heavy chain region and connecting region of human factor V, a blood coagulation factor with four types of internal repeats

International Nuclear Information System (INIS)

Kane, W.H.; Ichinose, A.; Hagen, F.S.; Davie, E.W.

1987-01-01

Human factor V is a high molecular weight plasma glycoprotein that participates as a cofactor in the conversion of prothrombin to thrombin by factor X/sub a/. Prior to its participation in the coagulation cascade, factor V is converted to factor V/sub a/ by thrombin generating a heavy chain and a light chain, and these two chains are held together by calcium ions. A connecting region originally located between the heavy and light chains is liberated during the activation reaction. In a previous study, a cDNA of 2970 nucleotides that codes for the carboxyl-terminal 938 amino acids of factor V was isolated and characterized from a Hep G2 cDNA library. This cDNA has been used to obtain additional clones from Hep G2 and human liver cDNA libraries. Furthermore, a Hep G2 cDNA library prepared with an oligonucleotide from the 5' end of these cDNAs was screened to obtain overlapping cDNA clones that code for the amino-terminal region of the molecule. The composite sequence of these clones spans 6911 nucleotides and is consistent with the size of the factor V message present in Hep G2 cells (approximately 7 kilobases). The cDNA codes for a leader sequence of 28 amino acids and a mature protein of 2196 amino acids. The amino acid sequence predicted from the cDNA was in complete agreement with 139 amino acid residues that were identified by Edman degradation of cyanogen bromide peptides isolated from the heavy chain region and connecting region of plasma factor V. The domain structure of human factor V is similar to that previously reported for human coagulation factor VIII. Two types of tandem repeats (17 and 9 amino acids) have also been identified in the connecting region of factor V. The present data indicate that the amino acid sequence in the heavy and light chain regions of factor V is ∼ 40% identical with the corresponding regions of factor VIII

FACTORS DETERMINING THE INVESTMENT ATTRACTIVENESS OF THE REGION

Directory of Open Access Journals (Sweden)

O. I. Avtsinov

2014-01-01

Full Text Available Summary.In the article we can see relevance of the research aimed at creating a favorable investment climate in the country and its regions, as a necessary condition for solving the problems of modernization of industrial production, the introduction of scientific and technological progress in all spheres of public life, the implementation of large-scale social and productive programs. In the study we justify the theoretical principles and reveal the essence of the relationship concepts: investment climate, investment attractiveness and investment activity. It is proved that the investment attractiveness should be considered as a sign of factorial and important component of the investment climate in the region, and investment activity as a sign score. In the study we can see a wide range of factors shaping favorable conditions for investment activities. The author focuses on the importance of non-traditional factors shaping the investment attractiveness of such as reducing the time to connect to power grid, information communication, improvement of tax reporting procedures, clarity of customs work, the introduction of regulations for obtaining permits for construction of facilities and reducing the number of required documents. This article analyzes of the indices and the key factors of investment attractiveness of the Voronezh region, which attract investment, exceeding the national average. The main ones are the development of new industrial parks with good transport, engineering, business infrastructure. Investors in the region have favorable conditions to carry on business on the prepared sites with painted communications, junctions, allowing them to reduce production costs, while correspondingly increasing the investment attractiveness of the area. Success of the attracting investment in the Voronezh region is largely due to the introduction standard of the executive bodies of state power, including 15 documents designed to make the

Mapping the Binding Site for Escitalopram and Paroxetine in the Human Serotonin Transporter Using Genetically Encoded Photo-Cross-Linkers

DEFF Research Database (Denmark)

Rannversson, Hafsteinn; Andersen, Jacob; Bang-Andersen, Benny

2017-01-01

amber codon suppression in hSERT to encode the photo-cross-linking unnatural amino acid p-azido-l-phenylalanine into the suggested high- and low-affinity binding sites. We then employ UV-induced cross-linking with azF to map the binding site of escitalopram and paroxetine, two prototypical selective...... serotonin reuptake inhibitors (SSRIs). We find that the two antidepressant drugs exclusively cross-link to azF incorporated at the high-affinity binding site of hSERT, while cross-linking is not observed at the low-affinity binding site. Combined with previous homology models and recent structural data on h...

Different Factors of Llap as a Geographic Region

OpenAIRE

, F. Isufi; , S. Halimi; , F. Humolli

2011-01-01

In this work attempts were made to express in the best possible manner the factors which differentiate the Llap as geographic region. The Llap Region is located in the north-east of Kosovo. Within the ethnic geography, the Llap area is having peripheric position, but within the Balkan Penninsula it is having a central position, while along Llap goes the Highway which connects Kosovo and Serbia. The Llap region has important natural conditions; such as very good geographic position, running an...

Konkurentosposobnost' regiona: soderzhanie, faktory, politika [Competitiveness of the region: content, factors, policies

Directory of Open Access Journals (Sweden)

Shastitko Andrey

2009-01-01

Full Text Available The article describes a framework conception of regional competitiveness. The notion of regional competitiveness as well as approaches to the classification of competitiveness factors are considered in detail. The author elaborates a set of indicators of regional competitiveness. The article also discusses three groups of factors which can influence the competitiveness of any region.

Spatial econometric analysis of factors influencing regional energy efficiency in China.

Science.gov (United States)

Song, Malin; Chen, Yu; An, Qingxian

2018-05-01

Increased environmental pollution and energy consumption caused by the country's rapid development has raised considerable public concern, and has become the focus of the government and public. This study employs the super-efficiency slack-based model-data envelopment analysis (SBM-DEA) to measure the total factor energy efficiency of 30 provinces in China. The estimation model for the spatial interaction intensity of regional total factor energy efficiency is based on Wilson's maximum entropy model. The model is used to analyze the factors that affect the potential value of total factor energy efficiency using spatial dynamic panel data for 30 provinces during 2000-2014. The study found that there are differences and spatial correlations of energy efficiency among provinces and regions in China. The energy efficiency in the eastern, central, and western regions fluctuated significantly, and was mainly because of significant energy efficiency impacts on influences of industrial structure, energy intensity, and technological progress. This research is of great significance to China's energy efficiency and regional coordinated development.

[Research on climatic factors of ecology suitability regionalization of atractylodis].

Science.gov (United States)

Tan, Zhe-tian; Wang, Hao; Zhu, Shou-dong; Yan, Yu-ping; Guo, Lan-ping; Zheng, Yu-guang

2015-11-01

Through study on the correlation between atractylodis lactones ingredient content and climatic factors, we research regionalization from climatic of five main producing provinces of the country, in order to provide a scientific basis for atractylodis' conscious cultivation. By sampling from 40 origins which from five main producing provinces of the country, we use SPSS to analysis variation of atractylodis lactones ingredient content in different conditions of climatic factors and the effect of each factors. Then according to the relationship between atractylodis lactones ingredient content and climatic factors, we use ArcGIS to conduct ecological suitability regionalization based on climatic factors. The most suitable climatic condition for cultivation of atractylodis: the wettest month precipitation 220-230 mm, the warmest average temperature 25 degrees C, the average temperature of driest season 10 degrees C.

Total-factor energy efficiency of regions in China

International Nuclear Information System (INIS)

Hu, J.-L.; Wang, S.-C.

2006-01-01

This paper analyzes energy efficiencies of 29 administrative regions in China for the period 1995-2002 with a newly introduced index. Most existing studies of regional productivity and efficiency neglect energy inputs. We use the data envelopment analysis (DEA) to find the target energy input of each region in China at each particular year. The index of total-factor energy efficiency (TFEE) then divides the target energy input by the actual energy input. In our DEA model, labor, capital stock, energy consumption, and total sown area of farm crops used as a proxy of biomass energy are the four inputs and real GDP is the single output. The conventional energy productivity ratio regarded as a partial-factor energy efficiency index is computed for comparison in contrast to TFEE; our index is found fitting better to the real case. According to the TFEE index rankings, the central area of China has the worst energy efficiency and its total adjustmentof energy consumption amount is over half of China's total. Regional TFEE in China generally improved during the research period except for the western area. A U-shape relation between the area's TFEE and per capita income in the areas of China is found, confirming the scenario that energy efficiency eventually improves with economic growth

Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm

Energy Technology Data Exchange (ETDEWEB)

Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard; Nix, David; Pollard, Daniel A.; Iyer, Venky N.; Hechmer, Aaron; Simirenko, Lisa; Stapleton, Mark; Luengo Hendriks, Cris L.; Chu, Hou Cheng; Ogawa, Nobuo; Inwood, William; Sementchenko, Victor; Beaton, Amy; Weiszmann, Richard; Celniker, Susan E.; Knowles, David W.; Gingeras, Tom; Speed, Terence P.; Eisen, Michael B.; Biggin, Mark D.

2008-01-10

Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched in bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early

Regional economic development in Europe : the role of total factor productivity

NARCIS (Netherlands)

Beugelsdijk, Sjoerd; Klasing, Mariko J.; Milionis, Petros

2018-01-01

Regional economic development in Europe: the role of total factor productivity. Regional Studies. This paper documents the fact that the large and persistent differences in economic development across subnational regions in European Union countries can largely be attributed to differences in total

To question of radiation factors on onco-epidemiology in regions of Georgia

International Nuclear Information System (INIS)

Vepxadze, N.R.; Maqradze, Q.M.; Qoncilasvili, I.P.

2002-01-01

Full text: Planning of anticancer service is impossible without studying the actual dynamics and prognosis of diseases we have analyzed the morbidity and mortality rates for different regions conditioned by different ecological conditions in these regions. We have studied the space-structural features of extension of cancer as base of programme for recreative and preventive measures. It is shown that the dynamic of oncologic diseases in Georgian regions has a natural character and is not conditioned much by anthropogenic factor. 1. For regions exceeds death-rate that and points to validity processing statistical information, real reflecting regional particularities. 2.Simultaneously possible indicate that where average oncologic diseases exceeds checking point factors, alike death-rate level can point medical service to more high level of. 3.Migration of population, ethnic a spottiness really characteristic of some regions-on this reason insufficiently high general correlation factors and insufficiently mother a mistake prognostic regression equations. 4.As is 'cancer-discomfort' by the region that wholly follows from its ecological, and genetic features. Region is characterized moderate climate; extreme climatic parameters of external ambience here as a whole rare and low-probable; in the region of practically no bad production, polluting intensive surrounding ambience; region is agricultural, without intensive technical cultures already; social conditions of residence - moderate, no high density of population because of presence of greater areas and etc; stevedore is characterized by the person by temperance on fat and calorie content, on the base of wheat and corn bread; a general factor to correlations-a measure of relationship of chosen parameters pointing under investigation features, within 0,5 - 0,6 and above; a mistake of using an prognostic metaaluminate does not exceed 25% that sufficiently high factor, permitting practical using an prognostic equation

The Analysis of Theoretical Approaches to Identification of Factors of Regional Economic Growth

Directory of Open Access Journals (Sweden)

Kosyrieva Olena V.

2016-05-01

Full Text Available The article is devoted to the investigation of current approaches to identification of factors of economic growth in the regions. The theory of new economic geography based on works and studies of P. Krugman has been considered. There highlighted the key issues of regional economic growth requiring an in-depth studying and consideration in the elaboration of strategies for sustainable development of the regions. The views of leading domestic and foreign scholars as well as the OECD experts, the World Bank, the National Statistics Service of the United Kingdom and others on the main drivers of economic growth have been analyzed. On the basis of the study the factors of regional economic growth most commonly encountered in theory and practice have been generalized. It is proved that scientists and analysts most often classify as the factors of regional economic growth the following ones: those characterizing human potential, scientific-technical and innovative activity, management and institutional capacity. The factors less frequently correlated by specialists and scientists with the regional economic growth include: those characterizing the environment, business and sociopolitical factors, which is associated with difficulty of their quantification, but in any case does not diminish their importance.

Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men

Directory of Open Access Journals (Sweden)

Dinić Jelena

2007-01-01

Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and

An Analysis of Fuel Region to Region Dancoff Factor with the Random Mixture Effects of Moderator and Fuel Pebbles

International Nuclear Information System (INIS)

Kim, Song Hyun; Kim, Hong Chul; Kim, Jong Kyung; Noh, Jae Man

2009-01-01

Dancoff factor is an entering probability of the neutron escaped from specific fuel kernel to another one without the interaction with moderators. In order to analytically evaluate Dancoff factor considering double-heterogeneous effect, inter-pebble and intra-pebble Dancoff factors should be calculated, respectively. Intra-pebble Dancoff factor related with the fuel kernels in one pebble was analyzed in the past study. The fuel and moderator pebbles are randomly located in the pebble-type reactor. For the evaluation of inter-pebble Dancoff factor, a repetition of simple pebble structure is commonly assumed to simulate the complex geometry of pebble-type reactor. The evaluation using these structures can be underestimated because of the shadowing effects generated from the repetition of simple pebble structure. Fuel region to region Dancoff factor (FRDF) was defined as an entering probability of the neutron escaped from a specific fuel region to another one without any collision with moderator for a preliminary evaluation of inter-pebble Dancoff factor. To solve the underestimation problem of FRDF from the shadow effect, the specific pebble was assumed and FRDF was evaluated with the approximation method proposed in this study

Regional determinants of FDI in China: a factor-based approach

NARCIS (Netherlands)

Martijn A. Boermans; Zhang Yi; Hein Roelfsema

2011-01-01

We empirically investigate the factors that drive the uneven regional distribution of foreign direct investment (FDI) across Chinese provinces from 1995 to 2006. We first perform a factor analysis to summarize information embodied in around 40 variables and derive four FDI determinants:

Structural Fingerprints of Transcription Factor Binding Site Regions

Directory of Open Access Journals (Sweden)

Peter Willett

2009-03-01

Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.

Sons conceived by assisted reproduction techniques inherit deletions in the azoospermia factor (AZF) region of the Y chromosome and the DAZ gene copy number

DEFF Research Database (Denmark)

Mau Kai, C; Juul, A; McElreavey, K

2008-01-01

number, supplemented with haplogroup typing in deleted patients, were performed, in combination with clinical assessments in 264 fathers and their sons conceived by assisted reproduction techniques (ART), and in 168 fertile men with normal sperm concentration. RESULTS: In the ART fathers group...

Detroit regional transit study : a study of factors that enable and inhibit effective regional transit.

Science.gov (United States)

2014-03-01

An interdisciplinary team of six faculty members and six students at the University of Detroit Mercy (UDM) conducted a : comprehensive study of the factors enabling or inhibiting development of effective regional transit. Focusing on Metro Detroit an...

The effect of patient-specific factors on radiation-induced regional lung injury

International Nuclear Information System (INIS)

Garipagaoglu, Melahat; Munley, Michael T.; Hollis, Donna; Poulson, Jean M.; Bentel, Gunilla C.; Sibley, Gregory; Anscher, Mitchell S.; Fan Ming; Jaszczak, Ronald J.; Coleman, R. Edward; Marks, Lawrence B.

1999-01-01

Purpose: To assess the impact of patient-specific factors on radiation (RT)-induced reductions in regional lung perfusion. Methods: Fifty patients (32 lung carcinoma, 7 Hodgkin's disease, 9 breast carcinoma and 2 other thoracic tumors) had pre-RT and ≥24-week post-RT single photon emission computed tomography (SPECT) perfusion images to assess the dose dependence of RT-induced reductions in regional lung perfusion. The SPECT data were analyzed using a normalized and non-normalized approach. Furthermore, two different mathematical methods were used to assess the impact of patient-specific factors on the dose-response curve (DRC). First, DRCs for different patient subgroups were generated and compared. Second, in a more formal statistical approach, individual DRCs for regional lung injury for each patient were fit to a linear-quadratic model (reduction = coefficient 1 x dose + coefficient 2 x dose 2 ). Multiple patient-specific factors including tobacco history, pre-RT diffusion capacity to carbon monoxide (DLCO), transforming growth factor-beta (TGF-β), chemotherapy exposure, disease type, and mean lung dose were explored in a multivariate analysis to assess their impact on the coefficients. Results: None of the variables tested had a consistent impact on the radiation sensitivity of regional lung (i.e., the slope of the DRC). In the formal statistical analysis, there was a suggestion of a slight increase in radiation sensitivity in the dose range >40 Gy for nonsmokers (vs. smokers) and in those receiving chemotherapy (vs. no chemotherapy). However, this finding was very dependent on the specific statistical and normalization method used. Conclusion: Patient-specific factors do not have a dramatic effect on RT-induced reduction in regional lung perfusion. Additional studies are underway to better clarify this issue. We continue to postulate that patient-specific factors will impact on how the summation of regional injury translates into whole organ injury

Relationship between regional brain glucose metabolism and temperament factor of personality

Energy Technology Data Exchange (ETDEWEB)

Cho, Sang Soo; Lee, Eun Ju; Yoon, Eun Jin; Kim, Yu Kyeong; Lee, Won Woo; Kim, Sang Eun [Seoul National University College of Medicine, Seoul (Korea, Republic of)

2005-07-01

Temperament factor of personality has been considered to have correlation with activity in a specific central monoaminergic system. In an attempt to explore neuronal substrate of biogenetic personality traits, we examined the relationship between regional brain glucose metabolism and temperament factor of personality. Twenty right-handed healthy subjects (age, 24{+-}4 yr: 10 females and 10 males) were studied with FDG PET. Their temperaments were assessed using the Temperament and Character Inventory (TCI), which consisted of four temperament factors (harm avoidance (HA), novelty seeking (NS), reward dependence (RD), persistency) and three personality factors. The relationship between regional glucose metabolism and each temperament score was tested using SPM99 (P < 0.005, uncorrected). NS score was negatively correlated with glucose metabolism in the frontal areas, insula, and superior temporal gyrus mainly in the right hemisphere. Positive correlation between NS score and glucose metabolism was observed in the left superior temporal gyrus. HA score showed negative correlation with glucose metabolism in the middle and orbitofrontal gyri as well as in the parahippocampal gyrus. RD score was positively correlated with glucose metabolism in the left middle frontal gyrus and negative correlated in the posterior cingulate gyrus and caudate nucleus. We identified the relationship between regional brain glucose metabolism and temperamental personality trait. Each temperament factor had a relation with functions of specific brain areas. These results help understand biological background of personality and specific feedback circuits associated with each temperament factor.

Relationship between regional brain glucose metabolism and temperament factor of personality

International Nuclear Information System (INIS)

Cho, Sang Soo; Lee, Eun Ju; Yoon, Eun Jin; Kim, Yu Kyeong; Lee, Won Woo; Kim, Sang Eun

2005-01-01

Temperament factor of personality has been considered to have correlation with activity in a specific central monoaminergic system. In an attempt to explore neuronal substrate of biogenetic personality traits, we examined the relationship between regional brain glucose metabolism and temperament factor of personality. Twenty right-handed healthy subjects (age, 24±4 yr: 10 females and 10 males) were studied with FDG PET. Their temperaments were assessed using the Temperament and Character Inventory (TCI), which consisted of four temperament factors (harm avoidance (HA), novelty seeking (NS), reward dependence (RD), persistency) and three personality factors. The relationship between regional glucose metabolism and each temperament score was tested using SPM99 (P < 0.005, uncorrected). NS score was negatively correlated with glucose metabolism in the frontal areas, insula, and superior temporal gyrus mainly in the right hemisphere. Positive correlation between NS score and glucose metabolism was observed in the left superior temporal gyrus. HA score showed negative correlation with glucose metabolism in the middle and orbitofrontal gyri as well as in the parahippocampal gyrus. RD score was positively correlated with glucose metabolism in the left middle frontal gyrus and negative correlated in the posterior cingulate gyrus and caudate nucleus. We identified the relationship between regional brain glucose metabolism and temperamental personality trait. Each temperament factor had a relation with functions of specific brain areas. These results help understand biological background of personality and specific feedback circuits associated with each temperament factor

Regional-scale calculation of the LS factor using parallel processing

Science.gov (United States)

Liu, Kai; Tang, Guoan; Jiang, Ling; Zhu, A.-Xing; Yang, Jianyi; Song, Xiaodong

2015-05-01

With the increase of data resolution and the increasing application of USLE over large areas, the existing serial implementation of algorithms for computing the LS factor is becoming a bottleneck. In this paper, a parallel processing model based on message passing interface (MPI) is presented for the calculation of the LS factor, so that massive datasets at a regional scale can be processed efficiently. The parallel model contains algorithms for calculating flow direction, flow accumulation, drainage network, slope, slope length and the LS factor. According to the existence of data dependence, the algorithms are divided into local algorithms and global algorithms. Parallel strategy are designed according to the algorithm characters including the decomposition method for maintaining the integrity of the results, optimized workflow for reducing the time taken for exporting the unnecessary intermediate data and a buffer-communication-computation strategy for improving the communication efficiency. Experiments on a multi-node system show that the proposed parallel model allows efficient calculation of the LS factor at a regional scale with a massive dataset.

46,XX males: a case series based on clinical and genetics evaluation.

Science.gov (United States)

Mohammadpour Lashkari, F; Totonchi, M; Zamanian, M R; Mansouri, Z; Sadighi Gilani, M A; Sabbaghian, M; Mohseni Meybodi, A

2017-09-01

46,XX male sex reversal syndrome is one of the rarest sex chromosomal aberrations. The presence of SRY gene on one of the X chromosomes is the most frequent cause of this syndrome. Based on Y chromosome profile, there are SRY-positive and SRY-negative forms. The purpose of our study was to report first case series of Iranian patients and describe the different clinical appearances based on their genetic component. From the 8,114 azoospermic and severe oligozoospermic patients referred to Royan institute, we diagnosed 57 cases as sex reversal patients. Based on the endocrinological history, we performed karyotyping, SRY and AZF microdeletion screening. Patients had a female karyotype. According to available hormonal reports of 37 patients, 16 cases had low levels of testosterone (43.2%). On the other hand, 15 males were SRY positive (90.2%), while they lacked the spermatogenic factors encoding genes on Yq. Commencing the testicular differentiation in males, the SRY gene is considered to be very important in this process. Due to homogeneous results of karyotyping and AZF deletion, there are both positive and negative SRY cases that show similar sex reversal phenotypes. Evidences show that there could be diverse phenotypic differences that could be raised from various reasons. © 2016 Blackwell Verlag GmbH.

Ecological total-factor energy efficiency of regions in China

International Nuclear Information System (INIS)

Li Lanbing; Hu Jinli

2012-01-01

Most existing energy efficiency indices are computed without taking into account undesirable outputs such as CO 2 and SO 2 emissions. This paper computes the ecological total-factor energy efficiency (ETFEE) of 30 regions in China for the period 2005–2009 through the slack-based model (SBM) with undesirable outputs. We calculate the ETFEE index by comparing the target energy input obtained from SBM with undesirable outputs to the actual energy input. Findings show that China's regional ETFEE still remains a low level of around 0.600 and regional energy efficiency is overestimated by more than 0.100 when not looking at environmental impacts. China's regional energy efficiency is extremely unbalanced: the east area ranks first with the highest ETFEE of above 0.700, the northeast and central areas follow, and the west area has the lowest ETFEE of less than 0.500. A monotone increasing relation exists between the area's ETFEE and China's per capita GDP. The truncated regression model shows that the ratio of R and D expenditure to GDP and the degree of foreign dependence have positive impacts, whereas the ratio of the secondary industry to GDP and the ratio of government subsidies for industrial pollution treatment to GDP have negative effects, on the ETFEE. - Highlights: ► Most energy efficiency indices ignore undesirable outputs such as CO 2 and SO 2 emissions. ► The ecological total-factor energy efficiency (ETFEE) is computed by slack-based model (SBM). ► The datasets contains 30 regions in China for the period 2005–2009. ► China's regional energy efficiency is extremely unbalanced. ► A monotone increasing relation exists between ETFEE and per capita GDP.

Risk Factors for Post-treatment Complex Regional Pain Syndrome (CRPS)

DEFF Research Database (Denmark)

Petersen, Pelle B; Mikkelsen, Kim Lyngby; Lauritzen, Jes B

2018-01-01

OBJECTIVES: Complex regional pain syndrome is a challenging condition that includes a broad spectrum of sensory, autonomic, and motor features predominantly in extremities recovering from a trauma. Few large-scale studies have addressed occurrence of and factors associated with complex regional......, gender, initial diagnosis, treatment, and amount of compensation were extracted. Multivariate logistic regressions were performed to identify variables associated with approval of the claim. For carpal tunnel syndrome (CTS) patients, we registered whether symptoms were bilateral or unilateral...... normal neurophysiology. CONCLUSIONS: Female gender, surgical treatment, and treatment to the upper limb were risk factors. Elective surgery accounted for a large number of post-treatment CRPS patients. In CTS patients developing CRPS, normal neurophysiological examination findings were common...

Institutional factor in international economic activity of region and its socio-economic development

Directory of Open Access Journals (Sweden)

Elena Leonidovna Andreeva

2016-12-01

Full Text Available The article substantiates the impact of the institutional factor on the development of regional international economic relations. The scope of the study is regional international economic activity (IEA, the subject-matter is the role of the institutional factor in its development. The study purpose is to develop a scientific approach for the assessment of the institutional factor impact on the development of region’s international economic relations. The hypothesis is that the targeted efforts of all participants of IEA of the region (business, authorities, local community to strengthen of theese components of the institutional factor, which have a strong influence on the regional socio-economic development. A methodological approach for the assessment of this influenceis developed. It includes determining three elements of IEA institutionalization—agreements, organizations, events. A three-dimensional model is proposed for the coordination of these elements with 3 groups of countries—developed, developing and CIS, including the Eurasian Economic Union, and also with basic indexes characterizing the qualitative and quantitative contribution of region’s IEA into its socio-economic development. This model is tested on the example of the Sverdlovsk region of Russia for 2003–2015. That has allowed to define various kinds of the effects from strenthening the IEA institutional component, which are expressed in the increase of the export of the region, improvement of its investment attractiveness, the diversification of regional economy as well as the the generation of additional jobs and tax flows increase.

Analysis of regional difference on impact factors of China’s energy – Related CO2 emissions

International Nuclear Information System (INIS)

Li, Huanan; Mu, Hailin; Zhang, Ming; Gui, Shusen

2012-01-01

With the intensification of global warming, the issue of carbon emissions causes more and more attention in recent years. In this paper, China’s 30 provincial-level administrative units are divided into five emission regions according to the annual average value of provincial CO 2 emissions per capita during 1990 and 2010. The regional differences in impact factors on CO 2 emissions are discussed using STIRPAT (stochastic impacts by regression on population, affluence, and technology) model. The results indicate that although GDP (Gross domestic product) per capita, industrial structure, population, urbanization and technology level have different impacts on CO 2 emissions in different emission regions, they are almost always the main factors in all emission regions. In most emission regions, urbanization and GDP per capita has a bigger impact on CO 2 emissions than other factors. Improving technology level produces a small reduction in CO 2 emissions in most emission regions, but it is still a primary way for CO 2 reduction in China. It’s noteworthy that industrial structure isn’t the main factor and improving technology level increases CO 2 emissions in high emission region. Different measures should be adopted for CO 2 reductions according to local conditions in different regions. -- Highlights: ► Regional differences of the impact factors on China’s CO 2 emissions are analyzed. ► Five macro factors like GDP per capita are almost always main influence factors in all regions. ► The impacts of different factors are different. ► Improving technology has no significant reduction on CO 2 emission in most regions. ► Policy on CO 2 reduction should be adapted to local conditions.

Form factors and QCD in spacelike and timelike region

International Nuclear Information System (INIS)

A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

2000-01-01

The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

Form factors and QCD in spacelike and timelike regions

International Nuclear Information System (INIS)

Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

2000-01-01

We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

Improving cluster-based methods for investigating potential for insect pest species establishment: region-specific risk factors

Directory of Open Access Journals (Sweden)

Michael J. Watts

2011-09-01

Full Text Available Existing cluster-based methods for investigating insect species assemblages or profiles of a region to indicate the risk of new insect pest invasion have a major limitation in that they assign the same species risk factors to each region in a cluster. Clearly regions assigned to the same cluster have different degrees of similarity with respect to their species profile or assemblage. This study addresses this concern by applying weighting factors to the cluster elements used to calculate regional risk factors, thereby producing region-specific risk factors. Using a database of the global distribution of crop insect pest species, we found that we were able to produce highly differentiated region-specific risk factors for insect pests. We did this by weighting cluster elements by their Euclidean distance from the target region. Using this approach meant that risk weightings were derived that were more realistic, as they were specific to the pest profile or species assemblage of each region. This weighting method provides an improved tool for estimating the potential invasion risk posed by exotic species given that they have an opportunity to establish in a target region.

Factors Affecting Regional Per-Capita Carbon Emissions in China Based on an LMDI Factor Decomposition Model

Science.gov (United States)

Dong, Feng; Long, Ruyin; Chen, Hong; Li, Xiaohui; Yang, Qingliang

2013-01-01

China is considered to be the main carbon producer in the world. The per-capita carbon emissions indicator is an important measure of the regional carbon emissions situation. This study used the LMDI factor decomposition model–panel co-integration test two-step method to analyze the factors that affect per-capita carbon emissions. The main results are as follows. (1) During 1997, Eastern China, Central China, and Western China ranked first, second, and third in the per-capita carbon emissions, while in 2009 the pecking order changed to Eastern China, Western China, and Central China. (2) According to the LMDI decomposition results, the key driver boosting the per-capita carbon emissions in the three economic regions of China between 1997 and 2009 was economic development, and the energy efficiency was much greater than the energy structure after considering their effect on restraining increased per-capita carbon emissions. (3) Based on the decomposition, the factors that affected per-capita carbon emissions in the panel co-integration test showed that Central China had the best energy structure elasticity in its regional per-capita carbon emissions. Thus, Central China was ranked first for energy efficiency elasticity, while Western China was ranked first for economic development elasticity. PMID:24353753

On the factors controlling occurrence of F-region coherent echoes

Directory of Open Access Journals (Sweden)

D. W. Danskin

2002-09-01

Full Text Available Several factors are known to control the HF echo occurrence rate, including electron density distribution in the ionosphere (affecting the propagation path of the radar wave, D-region radio wave absorption, and ionospheric irregularity intensity. In this study, we consider 4 days of CUTLASS Finland radar observations over an area where the EISCAT incoherent scatter radar has continuously monitored ionospheric parameters. We illustrate that for the event under consideration, the D-region absorption was not the major factor affecting the echo appearance. We show that the electron density distribution and the radar frequency selection were much more significant factors. The electron density magnitude affects the echo occurrence in two different ways. For small F-region densities, a minimum value of 1 × 1011 m-3 is required to have sufficient radio wave refraction so that the orthogonality (with the magnetic field lines condition is met. For too large densities, radio wave strong "over-refraction" leads to the ionospheric echo disappearance. We estimate that the over-refraction is important for densities greater than 4 × 1011 m-3. We also investigated the backscatter power and the electric field magnitude relationship and found no obvious relationship contrary to the expectation that the gradient-drift plasma instability would lead to stronger irregularity intensity/echo power for larger electric fields.Key words. Ionosphere (ionospheric irregularities; plasma waves and instabilities; auroral ionosphere

Factors Influencing the Rating of Regional Economic Performance or Reasons why Prague has Become the 6th Best Economically Performing Region of the EU

Directory of Open Access Journals (Sweden)

Miloslav Chlad

2011-06-01

Full Text Available Regional Gross Domestic Product per capita is a key indicator for the distribution of financial resources within the Structural Funds in the EU. With regard to this fact, an increasing attention is also paid to this indicator in the Czech Republic (especially after its accession to the EU. Regional GDP per capita is often incorrectlypresented as the indicator of economic well-being of the population residing in the region. Some factors with significant impact on the value of regional GDP per capita and/or the ranking of regions in this international comparison are neglected. These factors include, for example, commuting to work, NUTS classification and/ or units of measure (PPS versus euro etc. The analysis shows the influence of these factors.

Regional Disparities in Online Map User Access Volume and Determining Factors

Science.gov (United States)

Li, R.; Yang, N.; Li, R.; Huang, W.; Wu, H.

2017-09-01

The regional disparities of online map user access volume (use `user access volume' in this paper to indicate briefly) is a topic of growing interest with the increment of popularity in public users, which helps to target the construction of geographic information services for different areas. At first place we statistically analysed the online map user access logs and quantified these regional access disparities on different scales. The results show that the volume of user access is decreasing from east to the west in China as a whole, while East China produces the most access volume; these cities are also the crucial economic and transport centres. Then Principal Component Regression (PCR) is applied to explore the regional disparities of user access volume. A determining model for Online Map access volume is proposed afterwards, which indicates that area scale is the primary determining factor for regional disparities, followed by public transport development level and public service development level. Other factors like user quality index and financial index have very limited influence on the user access volume. According to the study of regional disparities in user access volume, map providers can reasonably dispatch and allocate the data resources and service resources in each area and improve the operational efficiency of the Online Map server cluster.

Northeast Regional Cancer Institute's Cancer Surveillance and Risk Factor Program

Energy Technology Data Exchange (ETDEWEB)

Lesko, Samuel M.

2007-07-31

OBJECTIVES The Northeast Regional Cancer Institute is conducting a program of ongoing epidemiologic research to address cancer disparities in northeast Pennsylvania. Of particular concern are disparities in the incidence of, stage at diagnosis, and mortality from colorectal cancer. In northeast Pennsylvania, age-adjusted incidence and mortality rates for colorectal cancer are higher, and a significantly smaller proportion of new colorectal cancer cases are diagnosed with local stage disease than is observed in comparable national data. Further, estimates of the prevalence of colorectal cancer screening in northeast Pennsylvania are lower than the US average. The Northeast Regional Cancer Institute’s research program supports surveillance of common cancers, investigations of cancer risk factors and screening behaviors, and the development of resources to further cancer research in this community. This project has the following specific objectives: I. To conduct cancer surveillance in northeast Pennsylvania. a. To monitor incidence and mortality for all common cancers, and colorectal cancer, in particular, and b. To document changes in the stage at diagnosis of colorectal cancer in this high-risk, underserved community. II. To conduct a population-based study of cancer risk factors and screening behavior in a six county region of northeast Pennsylvania. a. To monitor and document changes in colorectal cancer screening rates, and b. To document the prevalence of cancer risk factors (especially factors that increase the risk of colorectal cancer) and to identify those risk factors that are unusually common in this community. APPROACH Cancer surveillance was conducted using data from the Northeast Regional Cancer Institute’s population-based Regional Cancer Registry, the Pennsylvania Cancer Registry, and NCI’s SEER program. For common cancers, incidence and mortality were examined by county within the region and compared to data for similar populations in the US

Socio-cultural factors and youth entrepreneurship in rural regions

Directory of Open Access Journals (Sweden)

Eduardo Gómez-Araujo

2017-04-01

Full Text Available Purpose – This paper aims to demonstrate the impact of two important socio-cultural factors on the level of the entrepreneurial activity of young individuals in rural regions. Design/methodology/approach – Our empirical study is based on a sample collected from an adult population survey, and analyzed using a logit model that controls for territorial and aging sources of heterogeneity. Our theoretical framework is anchored on a contingency perspective that emphasizes the unique influences of the contextual environment in driving entrepreneurial behavior. Findings – The main findings of our study is that in Spain the likelihood of being entrepreneurially active is no different for young and old individuals, and between rural and urban regions. Surprisingly, unlike shown in most studies, entrepreneurial role models do not have any effect on the entrepreneurship by young individuals in rural regions of Spain, while the negative impact of fear of failure in the entrepreneurship on young individuals in rural regions is much higher compared to the rest of the population. Originality/value – Our findings reveal that the context (regional has a more significant impact on entrepreneurship for some segments (younger individuals of the population than for others.

Natural capital as a factor in regional competitiveness

Directory of Open Access Journals (Sweden)

Kasztelan Armand

2015-09-01

Full Text Available Environmental resources and values (natural capital should be seen as a key factor in regional competitiveness. However, little attention has been paid so far to the role of natural capital in the process of achieving competitive advantage from the territorial perspective. Therefore, the main purpose of this paper is to present the results of a study on the environmental competitiveness of Polish regions. The author’s contribution to the theory is the use of taxonomic metrics for research purposes. Based on certain predefined criteria the environmental potential of each voivodship was assessed in 2004 and 2012. For research purposes, 26 indicators of state, pressure, and environmental protection were proposed. Owing to the fact that the subset of diagnostic variables (indicators contained elements that could not be directly aggregated, their unification was achieved using standardization formulas. The methodology proposed by the author might be used to assess environmental competitiveness in different regions or countries. The results of the performed analyses indicated that the Subcarpathian province scored highest in terms of environmental competitiveness, while Swiętokrzyskie province scored lowest.

The relative importance of regional, local, and evolutionary factors structuring cryptobenthic coral-reef assemblages

Science.gov (United States)

Ahmadia, Gabby N.; Tornabene, Luke; Smith, David J.; Pezold, Frank L.

2018-03-01

Factors shaping coral-reef fish species assemblages can operate over a wide range of spatial scales (local versus regional) and across both proximate and evolutionary time. Niche theory and neutral theory provide frameworks for testing assumptions and generating insights about the importance of local versus regional processes. Niche theory postulates that species assemblages are an outcome of evolutionary processes at regional scales followed by local-scale interactions, whereas neutral theory presumes that species assemblages are formed by largely random processes drawing from regional species pools. Indo-Pacific cryptobenthic coral-reef fishes are highly evolved, ecologically diverse, temporally responsive, and situated on a natural longitudinal diversity gradient, making them an ideal group for testing predictions from niche and neutral theories and effects of regional and local processes on species assemblages. Using a combination of ecological metrics (fish density, diversity, assemblage composition) and evolutionary analyses (testing for phylogenetic niche conservatism), we demonstrate that the structure of cryptobenthic fish assemblages can be explained by a mixture of regional factors, such as the size of regional species pools and broad-scale barriers to gene flow/drivers of speciation, coupled with local-scale factors, such as the relative abundance of specific microhabitat types. Furthermore, species of cryptobenthic fishes have distinct microhabitat associations that drive significant differences in assemblage community structure between microhabitat types, and these distinct microhabitat associations are phylogenetically conserved over evolutionary timescales. The implied differential fitness of cryptobenthic fishes across varied microhabitats and the conserved nature of their ecology are consistent with predictions from niche theory. Neutral theory predictions may still hold true for early life-history stages, where stochastic factors may be more

Climatological Factors Affecting Electromagnetic Surface Ducting in the Aegean Sea Region

Science.gov (United States)

2012-03-01

low precipitation, and northeasterly winds, all due to changes in large scale circulations and a northward shift in extratropical storm tracks. The...differences over the Aegean region, that are governed by large-scale climate factors. a. Winter During winter, the Aegean area is subject to extratropical ... extratropical cyclones from entering the Aegean region, while opposite shifts can 18 allow extratropical cyclones to more frequently enter the Aegean

Role of the environmental factor in the competitiveness of the region

Directory of Open Access Journals (Sweden)

N. Ya. Kalyuzhnova

2010-09-01

Full Text Available The article shows the role of environmental factor in the competitiveness of the region. The issue of the country's image and the region is considered according to ecology and touristic appeal. We consider the modern role of botanical gardens and their transformation from scientific horticultural organizations to the objects of multi-use facilities type, for a regional multi-utility. The experience of an innovative project of creation of Russia's first environmental technological park and tourist-recreational zone on the basis of the university botanical garden in Irkutsk using the public-private partnership is stated.

Causal inference between bioavailability of heavy metals and environmental factors in a large-scale region

International Nuclear Information System (INIS)

Liu, Yuqiong; Du, Qingyun; Wang, Qi; Yu, Huanyun; Liu, Jianfeng; Tian, Yu; Chang, Chunying; Lei, Jing

2017-01-01

The causation between bioavailability of heavy metals and environmental factors are generally obtained from field experiments at local scales at present, and lack sufficient evidence from large scales. However, inferring causation between bioavailability of heavy metals and environmental factors across large-scale regions is challenging. Because the conventional correlation-based approaches used for causation assessments across large-scale regions, at the expense of actual causation, can result in spurious insights. In this study, a general approach framework, Intervention calculus when the directed acyclic graph (DAG) is absent (IDA) combined with the backdoor criterion (BC), was introduced to identify causation between the bioavailability of heavy metals and the potential environmental factors across large-scale regions. We take the Pearl River Delta (PRD) in China as a case study. The causal structures and effects were identified based on the concentrations of heavy metals (Zn, As, Cu, Hg, Pb, Cr, Ni and Cd) in soil (0–20 cm depth) and vegetable (lettuce) and 40 environmental factors (soil properties, extractable heavy metals and weathering indices) in 94 samples across the PRD. Results show that the bioavailability of heavy metals (Cd, Zn, Cr, Ni and As) was causally influenced by soil properties and soil weathering factors, whereas no causal factor impacted the bioavailability of Cu, Hg and Pb. No latent factor was found between the bioavailability of heavy metals and environmental factors. The causation between the bioavailability of heavy metals and environmental factors at field experiments is consistent with that on a large scale. The IDA combined with the BC provides a powerful tool to identify causation between the bioavailability of heavy metals and environmental factors across large-scale regions. Causal inference in a large system with the dynamic changes has great implications for system-based risk management. - Causation between the

La reforma agraria como factor del desarrollo regional

Directory of Open Access Journals (Sweden)

José Ambrósio Ferreira Neto

2017-01-01

Full Text Available Este trabajo debate la reforma agraria brasilera como instrumento de desarrollo regional, discutiendo la política actual de asentamientos rurales y su importancia en los procesos de interacción con las dinámicas locales y regionales, investigando las transformaciones que esos proyectos pueden provocar en los municipios donde están inmersos. El trabajo toma como punto central de discusión los argumentos de Polanyi sobre los factores de producción, tierra, capital y trabajo, y de Amartya Sen sobre libertad como factor de desarrollo. La discusión emprendida defiende la reforma agraria como forma de conceder oportunidades y una condición de agentes a sus beneficiarios. Argumentamos que el acceso a la tierra, y a los medios de producción, garantiza al trabajador el control sobre su fuerza de trabajo.

Risk factors control in patients with cardiovascular diseases in Ivanovo region: possibilities of a regional registry

Directory of Open Access Journals (Sweden)

Belova O.A.

2016-03-01

Conclusion ― In primary care units of Ivanovo region in 2015 patients were insufficiently asked about their lifestyle (smoking, physical activity, eating habits, as well as their body weight was measured. If a patient had a risk factor he usually receive a proper advice. For BP, weight and blood lipids the goals were achieved rare.

Comparing critical success factors for PV between three regions

International Nuclear Information System (INIS)

Groenendaal, B.J.; Roosmalen, J.A.M. van

2000-01-01

As a research method the project team has chosen to survey the opinion of PV experts and persons involved in the implementation of PV. Therefore, a questionnaire was sent to about 300 persons spread among 3 regions America, Europe and Asia. The returned questionnaires have been statistical analysed with the software tool SPSS. The used analytical methods can be divided in a comparing method (Mann-Whitney test) and ranking methods (Friedman test and the medal classification test). General conclusions are that there is a significant difference in answers between America and Europe about the significance of 'cost reduction'. Also Asia is significant different from America and Europe for the factor 'technical' reliability. There is a significant difference about the status of financing between America and Europe versus Asia. All the regions have a different opinion about the status of RD and D'. Also the status of 'the PV network' is significant different between Asia and America. America and Europe rank 'financial aspects' and 'cost reduction' as the most significant aspects while Asia rank 'specialist knowledge' and 'the PV network' as the most significant. All regions rank 'specialist knowledge' having the worst status and rank 'environmental merits' and 'technical reliability' having the best status. Finally Europe and Asia differ significant about which aspect is the most important for the factors 'internationalisation and other activities'. Europe finds 'harmonisation of policy' the most important internationalisation aspect and Asia prefers 'development aid'. Asia prefers 'pioneering activities' and Europe prefers 'initiatives by social organisations' as most important other activity. (au)

GIS-based Analysis of LS Factor under Coal Mining Subsidence Impacts in Sandy Region

Directory of Open Access Journals (Sweden)

W. Xiao

2014-09-01

Full Text Available Coal deposits in the adjacent regions of Shanxi, Shaanxi, and Inner Mongolia province (SSI account for approximately two-thirds of coal in China; therefore, the SSI region has become the frontier of coal mining and its westward movement. Numerous adverse impacts to land and environment have arisen in these sandy, arid, and ecologically fragile areas. Underground coal mining activities cause land to subside and subsequent soil erosion, with slope length and slope steepness (LS as the key influential factor. In this investigation, an SSI mining site was chosen as a case study area, and 1 the pre-mining LS factor was obtained using a digital elevation model (DEM dataset; 2 a mining subsidence prediction was implemented with revised subsidence prediction factors; and 3 the post-mining LS factor was calculated by integrating the pre-mining DEM dataset and coal mining subsidence prediction data. The results revealed that the LS factor leads to some changes in the bottom of subsidence basin and considerable alterations at the basin’s edges of basin. Moreover, the LS factor became larger in the steeper terrain under subsidence impacts. This integrated method could quantitatively analyse LS changes and spatial distribution under mining impacts, which will benefit and provide references for soil erosion evaluations in this region

Monthly Rainfall Erosivity: Conversion Factors for Different Time Resolutions and Regional Assessments

Directory of Open Access Journals (Sweden)

Panos Panagos

2016-03-01

Full Text Available As a follow up and an advancement of the recently published Rainfall Erosivity Database at European Scale (REDES and the respective mean annual R-factor map, the monthly aspect of rainfall erosivity has been added to REDES. Rainfall erosivity is crucial to be considered at a monthly resolution, for the optimization of land management (seasonal variation of vegetation cover and agricultural support practices as well as natural hazard protection (landslides and flood prediction. We expanded REDES by 140 rainfall stations, thus covering areas where monthly R-factor values were missing (Slovakia, Poland or former data density was not satisfactory (Austria, France, and Spain. The different time resolutions (from 5 to 60 min of high temporal data require a conversion of monthly R-factor based on a pool of stations with available data at all time resolutions. Because the conversion factors show smaller monthly variability in winter (January: 1.54 than in summer (August: 2.13, applying conversion factors on a monthly basis is suggested. The estimated monthly conversion factors allow transferring the R-factor to the desired time resolution at a European scale. The June to September period contributes to 53% of the annual rainfall erosivity in Europe, with different spatial and temporal patterns depending on the region. The study also investigated the heterogeneous seasonal patterns in different regions of Europe: on average, the Northern and Central European countries exhibit the largest R-factor values in summer, while the Southern European countries do so from October to January. In almost all countries (excluding Ireland, United Kingdom and North France, the seasonal variability of rainfall erosivity is high. Very few areas (mainly located in Spain and France show the largest from February to April. The average monthly erosivity density is very large in August (1.67 and July (1.63, while very small in January and February (0.37. This study addresses

Causal inference between bioavailability of heavy metals and environmental factors in a large-scale region.

Science.gov (United States)

Liu, Yuqiong; Du, Qingyun; Wang, Qi; Yu, Huanyun; Liu, Jianfeng; Tian, Yu; Chang, Chunying; Lei, Jing

2017-07-01

The causation between bioavailability of heavy metals and environmental factors are generally obtained from field experiments at local scales at present, and lack sufficient evidence from large scales. However, inferring causation between bioavailability of heavy metals and environmental factors across large-scale regions is challenging. Because the conventional correlation-based approaches used for causation assessments across large-scale regions, at the expense of actual causation, can result in spurious insights. In this study, a general approach framework, Intervention calculus when the directed acyclic graph (DAG) is absent (IDA) combined with the backdoor criterion (BC), was introduced to identify causation between the bioavailability of heavy metals and the potential environmental factors across large-scale regions. We take the Pearl River Delta (PRD) in China as a case study. The causal structures and effects were identified based on the concentrations of heavy metals (Zn, As, Cu, Hg, Pb, Cr, Ni and Cd) in soil (0-20 cm depth) and vegetable (lettuce) and 40 environmental factors (soil properties, extractable heavy metals and weathering indices) in 94 samples across the PRD. Results show that the bioavailability of heavy metals (Cd, Zn, Cr, Ni and As) was causally influenced by soil properties and soil weathering factors, whereas no causal factor impacted the bioavailability of Cu, Hg and Pb. No latent factor was found between the bioavailability of heavy metals and environmental factors. The causation between the bioavailability of heavy metals and environmental factors at field experiments is consistent with that on a large scale. The IDA combined with the BC provides a powerful tool to identify causation between the bioavailability of heavy metals and environmental factors across large-scale regions. Causal inference in a large system with the dynamic changes has great implications for system-based risk management. Copyright © 2017 Elsevier Ltd. All

Evolution of postmating reproductive isolation: measuring the fitness effects of chromosomal regions containing hybrid male sterility factors.

Science.gov (United States)

Johnson, N A; Wu, C I

1993-08-01

At least six regions of the X chromosome can cause male sterility when introgressed from Drosophila mauritiana into Drosophila simulans. In this article, we present the results of the other fitness effects caused by two X-linked regions that contain hybrid male sterility factors. In both regions, females that are heterozygous for an introgression with such a sterility factor produce substantially-fewer offspring than females heterozygous for an introgression that lacks the sterility factor. Thus, the hybrid male sterility factors, or other genes nearby, have substantial effects on female productivity. In contrast, hybrid male sterility factors have little or no effect on the relative viabilities of either sex. The evolutionary implications of these findings are discussed.

Driving factors for the regional implementation of renewable energy ‐ A multiple case study on the German energy transition

International Nuclear Information System (INIS)

Lutz, Lotte Marie; Fischer, Lisa-Britt; Newig, Jens; Lang, Daniel Johannes

2017-01-01

Understanding what drives the regional implementation of renewable energy is a prerequisite for energy transitions toward a post-fossil-based energy economy. This paper presents an empirical analysis of driving factors for the regional implementation and use of renewable energy. We tested literature-derived driving factors in a comparative analysis of 18 selected study regions using Rough Set Analysis and performance analysis. We paid special attention to common combinations of driving factors, which we understand as established practices concerning the use and implementation of renewable energy. Our findings confirm most of the driving factors identified in the literature, for example the existence of key actors, knowledge exchange, or the use of goals and milestones. We also observe differences in key driving factors between highly successful and less successful regions, especially regarding funding opportunities. The results may support policy makers who aim to successfully implement renewable energy at a regional level. - Highlights: • We analyzed driving factors for RE implementation in 18 best-practice regions. • Most driving factors from transition and governance literature were confirmed. • We identified common successful practices concerning RE implementation.

Regional analysis of big five personality factors and suicide rates in Russia.

Science.gov (United States)

Voracek, Martin

2013-08-01

Extending cross-national and intranational studies on possible aggregate-level associations between personality dimensions and suicide prevalence, this study examined the associations of the Big Five personality factors and suicide rates across 32 regions of the Russian Federation. Failing to replicate one key finding of similar geographic studies, namely, a correspondence of higher suicide rates with lower Agreeableness and Conscientiousness (i.e., higher Psychoticism) scores, higher suicide rates corresponded to higher Agreeableness scores. This effect was obtained with one available data source (regional-level Big Five ratings based on the National Character Survey), but not with another (based on the NEO-PI-R measure). All in all, regional suicide rates across Russia were dissociated from regional variation in personality dimensions.

Social and economic factors of the natural risk increasing: estimation of the Russian regions

Directory of Open Access Journals (Sweden)

E. Petrova

2004-01-01

Full Text Available This study is an attempt to assess quantitatively social and economic factors that determine vulnerability of Russian regions to natural risk, to trace the space differences of the considered factors, and to group the regions by their similarity. In order to indicate the regional differences in social and economic development, equipment condition, dangerous substances accumulation, and social trouble four the most suitable parameters were estimated, including the per capita production of Gross Regional Product (GRP, capital consumption, volume of total toxic waste, and crime rate. Increase of the first parameter causes vulnerability reducing, the increase of the last three causes its increasing. Using multidimensional cluster analysis five types of regions were found for Russia according to similarity of the considered parameters. These types are characterized with higher value of a single (rarely two chosen parameter, which seems to be sufficient enough to affect natural risks increasing in these regions in near future. Only few regions belonging to the fifth type proved to have rather high value of GRP and relatively low values of the other parameters. The negative correlation was found between a number of natural disasters (ND and the per capita GRP in case when some parameters reached anomalously high value. The distinctions between regions by prevailing different parameters, which result in natural risk increasing, help risk management to find directions where to focus on.

Prevalence of abnormal birth weight and related factors in Northern region, Ghana

OpenAIRE

Abubakari, Abdulai; Kynast-Wolf, Gisela; Jahn, Albrecht

2015-01-01

Background: Birth weight is a crucial determinant of the development potential of the newborn. Abnormal newborn weights are associated with negative effects on the health and survival of the baby and the mother. Therefore, this study was designed to determine the prevalence of abnormal birth weight and related factors in Northern region, Ghana. Methods: The study was a facility-based cross-sectional survey in five hospitals in Northern region, Ghana. These hospitals were selected based on t...

Screening for Y Chromosome Microdeletion in a Nonobstructive Azoospermic Male Patient with Allogeneic Bone Marrow Transplantation from His Sister

Directory of Open Access Journals (Sweden)

Hakan Gurkan

2010-01-01

Full Text Available Genomic DNA of a patient diagnosed with nonobstructive azoospermia and with the history of allogenic bone marrow transplantation from his sister due to chronic myeloid leukemia was isolated from peripheral blood in order to screen Y chromosome microdeletions. 13 short tagged sites belonging to AZF a, b, and c loci were detected with multiplex polymerase chain reaction technique. Bands were determined in ZFX/ZFY wells, whereas no bands were determined in wells of other STS regions. DNA isolation was done from buccal mucosa smear to obtain genomic DNA from patient's own cells and multiplex polymerase chain reaction technique was performed again. Bands were seen in all wells of 13 STS regions. Y chromosome microdeletion was not detected in the patient. In conclusion, genomic DNA isolation in patients undergoing BMT should be done from patients' own cells.

Factors affecting employment in the Arabian Gulf region, 1975-1985.

Science.gov (United States)

Looney, R E

1991-01-01

"This paper attempts to shed light on factors contributing to the identification of the main employment patterns in the countries of the Arab Gulf region. It also seeks to answer the question of how determinants of employment vary between national and foreign workforces and whether these determinants have changed over time." The countries concerned are Bahrain, Kuwait, Oman, Qatar, Saudi Arabia, and the United Arab Emirates. excerpt

Sociocultural Factors of Survival of Males and Females in Economically Active Age: a Regional Analysis

Directory of Open Access Journals (Sweden)

Evgeniya Khasanovna Tukhtarova

2018-03-01

Full Text Available The period, when a person starts and completes his or her professional carrier and labour participation, in general, coincides with the age when the self-preservation behaviour develops. It is a time when a person aims for a healthy and safe lifestyle. During this period, an individual assumes the main standards, values of the self-preservation behaviour inherent in an ethnic, social and cultural macro-environment. To research the sociocultural factors of survival, we applied econometric modelling to demographic processes using the discrete and probabilistic indicators of the mortality tables of male and female in economically active age. The econometric model included the elements of spatiotemporal characteristics of territories. These characteristics are interrelated with the indicators of survival probability and the indicator of average life expectancy in the regions of Russia. We choose the major sociocultural factors by the correlation ratio of indicators and their sensitivity. The econometric analysis has revealed a high degree of sensitivity of a territorial variation of demographic and sociocultural factors in the regions of Russia, including a gender aspect. The most significant socio-economic factors, which determine the self-preservation behaviour of males, are the following: 1 the size of Gross Regional Product per capita; 2 quality of health infrastructure; 3 fixed investments; 4 population with monetary income under the subsistence minimum (share coefficient of income differentials. The female have the same hierarchy of socio-economic factors, except for the sensitivity of variables to the regional differentiation of signs. The household poverty factor has little significance for the women and it is the main difference between male and female. The built model has shown the predictive importance in the assessment of the above-mentioned factors in short and medium-term prospects.

Factors associated with exclusive breastfeeding in the Legal Amazon and Northeast regions, Brazil, 2010

Directory of Open Access Journals (Sweden)

Alice Cristina Medeiros das Neves

2014-01-01

Full Text Available OBJECTIVE: The objective of this study was to identify the factors associated with exclusive breastfeeding in children aged less than six months from the Brazilian Legal Amazon and Northeast regions. METHODS: The study used data from a survey that assessed prenatal and infant (<1 year care in 2010. Sociodemographic, prenatal, delivery, and puerperium care factors with p<0.05 in multivariate analysis were associated with exclusive breastfeeding. RESULTS: For both regions, the prevalence of exclusive breastfeeding decreased with age, which was the main variable associated with early weaning. In the Legal Amazon, exclusive breastfeeding prevailed among: mothers aged 35 years or more; mothers living in state capitals; and mothers who breastfed on the first hour of life. In the Northeast, the probability of exclusive breastfeeding was greater for mothers aged 35 years or more. CONCLUSION: The factors associated with exclusive breastfeeding were child's and mother's age in both regions; and residence location and breastfeeding in the first hour of life in the Legal Amazon, suggesting the need of differentiated strategies for the promotion of exclusive breastfeeding.

Factors Affecting Tourist Expenditure Coming To Mugla Region

Directory of Open Access Journals (Sweden)

Fehime Korkmaz Bingöl

2012-12-01

Full Text Available Increasing tourist expenditure is a means to increase tourism income, which is extremely important for local economies. The purpose of this study is to understand the expending pattern of tourists coming to Mugla Region and provide empirical background for the policies to increase per tourist expenditure. The survey conducted at Dalaman International Airport and the data has been analyzed using OLS method. Nationality, age, accommodation type, pension type, credit card usage, availability of shopping facilities, standard of night life and entertainment, quality of food and beverage, length of holiday and group size has been found as significant factors affecting tourist expenditure

Regional total factor energy efficiency: An empirical analysis of industrial sector in China

International Nuclear Information System (INIS)

Wang, Zhao-Hua; Zeng, Hua-Lin; Wei, Yi-Ming; Zhang, Yi-Xiang

2012-01-01

Highlights: ► We evaluate energy efficiency under framework of total factor energy efficiency. ► We focus on industry sector of China. ► We use statistical data of industrial enterprises above designated size. ► Energy efficiencies among regions in China are obvious because of technological differences. ► Large scale of investment should be stopped especially in central and western regions. -- Abstract: The rapid growth of the Chinese economy has resulted in great pressure on energy consumption, especially the energy intensive sector – the industrial sector. To achieve sustainable development, China has to consider how to promote energy efficiency to meet the demand of Chinese rapid economic growth, as the energy efficiency of China is relatively low. Meanwhile, the appeal of energy saving and emission reduction has been made by the Chinese central government. Therefore, it is important to evaluate the energy efficiency of industrial sector in China and to assess efficiency development probabilities. The framework of total factor energy efficiency index is adopted to determine the discrepancy of energy efficiency in Chinese industrial sector based on the provincial statistical data of industrial enterprises above designated size in 30 provinces from 2005 to 2009, with gross industrial output as the output value and energy consumption, average remaining balance of capital assets and average amount of working force as the input values. Besides, in considerate of the regional divide of China, namely eastern, central, and western, and economic development differences in each region, energy efficiency of each region is also analysed in this paper. The results show that there is room for China to improve its energy efficiency, especially western provinces which have large amount of energy input excess. Generally speaking, insufficient technological investment and fail of reaching best scale of manufacture are two factors preventing China from energy

ASSESSING THE RELATIONSHIP BETWEEN MARKET FACTORS AND REGIONAL PRICE DYNAMICS IN U.S. CATTLE MARKETS

OpenAIRE

Walburger, Allan M.; Foster, Kenneth A.

1997-01-01

Regional live cattle prices are decomposed into two components: (a) a trend common to all regional cattle price series and (b) regional deviations or price dynamics around that trend. Tests are developed to determine if market factors are related to the regional price deviations around a common trend. Slaughter volume, distance between a market and the next closest, and forward contract deliveries are significantly related to price deviations from the estimated common trend.

Prehospital factors determining regional variation in thrombolytic therapy in acute ischemic stroke

NARCIS (Netherlands)

Lahr, Maarten M.H.; Vroomen, P.C.A.J.; Luijckx, Gert-Jan; van der Zee, Durk-Jouke; de Vos, Ronald; Buskens, Erik

2014-01-01

Background Treatment rates with intravenous tissue plasminogen activator vary by region, which can be partially explained by organizational models of stroke care. A recent study demonstrated that prehospital factors determine a higher thrombolysis rate in a centralized vs. decentralized model in the

Development Factors of Shipping Industry Special Zone to Support Regional Innovation System

Directory of Open Access Journals (Sweden)

Eko Budi Santoso

2014-12-01

Full Text Available The central government has established the industry road map through MP3EI to support the shipbuilding industry. The region of Surabaya, Gresik, Lamongan and Tuban areas will be developed as the national shipping industry. The purpose of this study is to f ormulate the shipbuilding industry development cooperation to support the development of regional innovation systems. The goal and objectives are to identify the type of support the shipbuilding industry in Lamongan, to obtain a general picture of the existing condition of shipbuilding industries and the subsequent descriptive analysis to identify factors that influence the development of the shipbuilding industry. The method is using a theoretical review of the literature and the descriptive analysis of the results of depth interviews with stakeholders in Lamongan. The results of this study are the factors that influence the development of the shipbuilding industry.

Toward a regional power plant siting method: AEC-Maryland regional siting factors study, FY 1974 progress report

International Nuclear Information System (INIS)

Yaffee, S.L.; Miller, C.A.

1974-11-01

The ''AEC-Maryland Regional Siting Factors Study'' examines the process of siting in a regional context. It is developing an analysis method to delineate candidate areas for siting of several power plant technology packages, including both fossil-fueled and nuclear options. Tools that are being used include simulation modeling, economic and demographic forecasting, spatial analysis, and computer graphics and numerical manipulation. The approach will describe the trade-offs incurred if a power plant is located in one candidate area rather than in another. In FY 1974, a suitability analysis method was developed which uses engineering and environmental parameters to define a level of environmental cost incurred if a segment of land is used to site a specific technology package. (U.S.)

The Knowledge Economy: the Socio-Humanitarian Development Factors and Regional Aspects

Directory of Open Access Journals (Sweden)

Turskyy Ihor V.

2017-08-01

Full Text Available The article discusses the socio-humanitarian factors in the development of small and medium-sized businesses at the current stage, in terms of the origins of the knowledge economy phenomenon. The conception of unconditional basic income was considered as a factor. Other concepts of the knowledge economy were analyzed: the paradigm of the economy of abundance, the «End of History» by F. Fukuyama – as the most perfect form of social organization, and the Toffler's wave theory; as well as the information civilization and the information society. On the basis of today’s most popular concepts of knowledge economy, a comprehensive model for the interaction of socio-humanitarian factors in the knowledge economy has been proposed. The excessive massing factor has been recognized as a major negative sociocultural factor in the regional and business development of our State. It has been concluded that the basic criterion for development of the knowledge economy, which is common to most modern theories, is a creative person working in an environment where most of its needs are satisfied.

The Impact of Environmental Regulation on Total Factor Energy Efficiency: A Cross-Region Analysis in China

Directory of Open Access Journals (Sweden)

Jianting Lin

2017-10-01

Full Text Available Environmental regulations are the key measure by which governments achieve sustainable environmental and economic development. This study aimed to determine the direct and indirect impacts of environmental regulations on total factor energy efficiency of regions in China. Since regions have different levels of economic development and resource endowment, we used the slacks-based measure (SBM-undesirable model to calculate total factor energy efficiency considering regional technology heterogeneity and examined the regional impacts of environmental regulation on this efficiency using the Tobit regression model. A positive direct impact was generated in the eastern region of China by the forced mechanism, which forced enterprises to reduce fossil fuel energy demand and increase clean energy consumption; whereas a negative direct impact was generated in the middle and western regions owing to the green paradox, which is the observation that expected stringent environmental regulation prompts energy owners to accelerate resource extraction. Moreover, indirect impacts through technological progress and foreign direct investment were taken into account in the model, and the results show that the indirect impacts vary across regions. A logical response to these findings would be to develop different policies for different regions.

Danger ahead: the burden of diseases, injuries, and risk factors in the Eastern Mediterranean Region, 1990-2015.

Science.gov (United States)

2018-05-01

The Eastern Mediterranean Region faces several health challenges at a difficult time with wars, unrest, and economic change. We used the Global Burden of Disease 2015 study to present the burden of diseases, injuries, and risk factors in the Eastern Mediterranean Region from 1990 to 2015. Ischemic heart disease was the leading cause of death in the region in 2015, followed by cerebrovascular disease. Changes in total deaths ranged from a reduction of 25% for diarrheal diseases to an increase of about 42% for diabetes and tracheal, bronchus, and lung cancer. Collective violence and legal intervention increased by 850% during the time period. Diet was the leading risk factor for disability-adjusted life years (DALYs) for men compared to maternal malnutrition for females. Childhood undernutrition was the leading risk factor for DALYs in 1990 and 2005, but the second in 2015 after high blood pressure. Our study shows that the region is facing several health challenges and calls for global efforts to stabilise the region and to address the current and future burden of disease.

Factors that influence pa of adult inhabitants in the Olomouc region

Directory of Open Access Journals (Sweden)

Svatopluk Horák

2011-01-01

Full Text Available BACKGROUND: Regular physical activity has significant benefits for health. For instance, it can reduce the risk of cardiovascular disease, diabetes and osteoporosis, help control weight, and promote psychological well-being. There are many factors that can influence physical activity; socioeconomic status, family, size of place of residence, environmental conditions etc AIM: The aim of the study was to analyze physical activity and inactivity of adult population in the Olomouc region in terms of size of residence, type of housing, body weight status, smoking and participation in organized physical activity. METHODS: 1011 randomly selected residents of the Olomouc region (448 males and 563 females aged 41.14 ± 8.63 years participated in this study. To obtain selected indicators of physical activity, we used the ANEWS questionnaire which was distributed by university students in Spring and Fall periods from 2005 to 2009. For healthy adults aged 18 to 65 years, the goal recommended by the WHO is to achieve a minimum of 30 minutes of moderateintensity physical activity 5 days a week or at least 20 minutes of vigorous-intensity physical activity 3 days a week. RESULTS: The most physically active were males aged 36-45 years. From the selected correlates, those with the highest influence on total weekly PA were the size of residence and type of house. On the other hand, factors that did not affect total weekly PA were smoking, participation in organized PA and body mass index. The most commonly performed type of PA is cycling; followed in males with soccer and tennis and in women with aerobic dance and fitness walking. CONCLUSION: In the Olomouc region there is a need to preserve and develop the conditions to perform PA. Due to the landscape in the Olomouc region and due to the popularity of cycling, we recommend focus on this type of PA.

Evolution of psychosocial factors at work in a French region.

Science.gov (United States)

Bègue, C; Fouquet, N; Bodin, J; Ramond-Roquin, A; Huez, J-F; Bouton, C; Roquelaure, Y

2016-03-01

Psychosocial factors at work (PFW) can be defined as all non-physicochemical occupational risks. Several epidemiological models have been proposed to measure PFW, but one of the most widely used is Karasek's model. To determine whether psychosocial factors, evaluated by Karasek's questionnaire, had increased in a cohort of workers. A random sample of workers in the Pays de la Loire region of France, who could be considered representative of the region's population of salaried workers, filled in a self-administered questionnaire, including Karasek's self-administered questionnaire, in 2002-05 and 2007-09. Karasek's questionnaire can be used to study three psychosocial dimensions (psychological demand, decision latitude and social support in the workplace) in workers in order to define two high-risk situations for their health: 'Job Strain' and 'Iso Strain'. Changes in job strain and iso strain among workers were studied according to the workers' sociodemographic characteristics and their working conditions. In this sample of 2049 workers, the proportion with iso strain increased between the two periods from 12 to 16%, P workers. Deterioration of Karasek indicators was mainly explained by an increase of the 'low social support' dimension (38 versus 49%, P workers in recent years. © The Author 2015. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Regional differences in self-reported screening, prevalence and management of cardiovascular risk factors in Switzerland

Science.gov (United States)

2012-01-01

Background In Switzerland, health policies are decided at the local level, but little is known regarding their impact on the screening and management of cardiovascular risk factors (CVRFs). We thus aimed at assessing geographical levels of CVRFs in Switzerland. Methods Swiss Health Survey for 2007 (N = 17,879). Seven administrative regions were defined: West (Leman), West-Central (Mittelland), Zurich, South (Ticino), North-West, East and Central Switzerland. Obesity, smoking, hypertension, dyslipidemia and diabetes prevalence, treatment and screening within the last 12 months were assessed by interview. Results After multivariate adjustment for age, gender, educational level, marital status and Swiss citizenship, no significant differences were found between regions regarding prevalence of obesity or current smoking. Similarly, no differences were found regarding hypertension screening and prevalence. Two thirds of subjects who had been told they had high blood pressure were treated, the lowest treatment rates being found in East Switzerland: odds-ratio and [95% confidence interval] 0.65 [0.50-0.85]. Screening for hypercholesterolemia was more frequently reported in French (Leman) and Italian (Ticino) speaking regions. Four out of ten participants who had been told they had high cholesterol levels were treated and the lowest treatment rates were found in German-speaking regions. Screening for diabetes was higher in Ticino (1.24 [1.09 - 1.42]). Six out of ten participants who had been told they had diabetes were treated, the lowest treatment rates were found for German-speaking regions. Conclusions In Switzerland, cardiovascular risk factor screening and management differ between regions and these differences cannot be accounted for by differences in populations' characteristics. Management of most cardiovascular risk factors could be improved. PMID:22452881

STATISTICAL ANALYSIS OF COMPETITIVENESS FACTORS OF REGIONS OF THE RUSSIAN FEDERATION

Directory of Open Access Journals (Sweden)

O. V. Bakanach

2015-01-01

Full Text Available In the conditions of market economy the competition is the main driving force of economic growth. The idea about existence of the interregional competition isn't conventional and demands the proof. The phenomena allowing to state existence of the interregional competitive relations which are realized through system of prerequisites of political, economic, legal and technological character were for this purpose studied. Competitiveness – one of the most important characteristics of the territory which level directly influences formation of positive tendencies in development of subjects of the Russian Federation. Productive indicators of level of competitiveness of the region are: a gross regional product on one occupied in economy, production of a gross regional product for one ruble of fixed assets, a gross regional product for one ruble of investments, a share of balanced financial result in a gross regional product. On the basis of private indicators the Pattern method received an integrated indicator of level of competitiveness of region. The quantitative assessment of the factors determining distinctions of regions of the Russian Federation by competitiveness level allowed to define that the competitiveness variation in the territory of regions in the greatest measure depends on a variation of number of graduates of educational institutions with higher education on 1000 people and the specific weight of investments into the enterprises occupied with mining. Regional values of competitiveness are most elastic relatively the specific weight of own investments, that is increase of this indicator for 1 % causes increase of competitiveness for 0.9 %. The practical importance of this work is caused by possibility of application of results of research by federal and regional executive authorities as information representation when developing programs of increase of level of competitiveness of regions of the Russian Federation. Besides, it is

Study of the factors of interregional convergence/divergence in real incomes and «social well-being» of Russian regions

Directory of Open Access Journals (Sweden)

Malkina Marina, Yu.

2015-12-01

Full Text Available The purpose of this paper is the measurement of the degree of inter-regional convergence / divergence of Russian regions in per capita GRP, nominal and real incomes and social well-being index (SWI in 2004-2013, as well as the evaluation of the factors that have caused these changes. Methods: deflation of household incomes by means of relative cost of living index in the regions; measurement of social well-being, based on the index of localization of real incomes relatively intraregional Gini coefficient; calculation of weighted indices of inter-regional differentiation (Gini and variation coefficients, Hachman, Theil and Atkinson indexes; proportional method of factor analysis. Results obtained: 1 in 2004-2013 in Russia there was a convergence of all regional indicators, however, in a change of the social well-being index there are two periods of divergence: 2009 (a weak growth and 2012 (a significant burst; 2 the main factors of regions’ convergence in the SWI were: (re distribution factor (its impact over time increased significantly, inflation factor (it is observed a small reduction in its influence and the factor of intraregional income inequality (its influence is mainly depleted. The results may be useful for different levels government in the management of regional development.

Transcription Factor Zbtb20 Controls Regional Specification of Mammalian Archicortex

DEFF Research Database (Denmark)

Rosenthal, Eva Helga

2010-01-01

Combinatorial expression of sets of transcription factors (TFs) along the mammalian cortex controls its subdivision into functional areas. Unlike neocortex, only few recent data suggest genetic mechanisms controlling the regionalization of the archicortex. TF Emx2 plays a crucial role in patterning...... later on becoming restricted exclusively to postmitotic neurons of hippocampus (Hi) proper, dentate gyrus (DG), and two transitory zones, subiculum (S) and retrosplenial cortex (Rsp). Analysis of Zbtb20-/- mice revealed altered cortical patterning at the border between neocortex and archicortex...

FACTORS INFLUENCING PURCHASING DECISIONS FOR TRADITIONAL AND REGIONAL PRODUCTS AMONG RESIDENTS OF THE PODKARPACIE VOIVODESHIP

Directory of Open Access Journals (Sweden)

Marta Kawa

2014-09-01

Full Text Available The paper presents the factors determining the choice of traditional and regional products by Podkarpacie residents. The surveyed consumers found the quality as the most important trait that encourages the purchase of traditional and regional products. The price has an important impact on decision in terms of purchase.

HIV and HCV coinfection: prevalence, associated factors and genotype characterization in the Midwest Region of Brazil.

Science.gov (United States)

Freitas, Solange Zacalusni; Teles, Sheila Araújo; Lorenzo, Paulo Cesar; Puga, Marco Antonio Moreira; Tanaka, Tayana Serpa Ortiz; Thomaz, Danilo Yamamoto; Martins, Regina Maria Bringel; Druzian, Angelita Fernandes; Lindenberg, Andréa Siqueira Campos; Torres, Marina Sawada; Pereira, Sérgio A; Villar, Livia Melo; Lampe, Elisabete; Motta-Castro, Ana Rita Coimbra

2014-01-01

A cross-sectional study on prevalence, associated factors and genotype distribution of HCV infection was conducted among 848 HIV-infected patients recruited at reference centers in the Midwest Region of Brazil. The prevalence rate of HIV-HCV coinfection was 6.9% (95% CI: 5.2 to 8.6). In multivariable analysis, increasing age, use of illicit drugs (injection and non-injection), a history of blood transfusion before 1994, and the absence of a steady partnership were significant independent associated factors for HIV-HCV coinfection. The phylogenetic analysis based on the NS5B region revealed the presence of two major circulating genotypes of HCV: genotypes 1 (58.3%) and 3 (41.7%). The prevalence of HIV-HCV coinfection was lower than those reported in studies conducted with HIV-infected patients in different regions of Brazil, due to the fact that illicit drug use is not a frequent mode of HIV transmission in this region of Brazil. Serologic screening of HIV-patients for HCV before initiating antiretroviral treatment, a comprehensive identification of associated factors, and the implementation of effective harm reduction programs are highly recommended to provide useful information for treatment and to prevent HCV coinfection in these patients.

Neoindustrialization as a factor in improving economic security of old-industrial regions

Directory of Open Access Journals (Sweden)

Ol’ga Aleksandrovna Romanova

2012-06-01

Full Text Available This paper proves that the paradigm of the world of the XXIcentury is neoindustrialization on the basis of alternativestrategic goals of the global economy associated with the formation of post-industrial society and financialization neoindustrialization. A systematic proposal for the driving forces and mechanisms for its implementation is suggested. It is shown that target-oriented approach can be successfully used at the regional level as a mechanism for economic neoindustrialization of an old-industrial region. Conceptual approach to developing comprehensive program of industrial development in the industrial region that implements the ideas of neoindustrialization in relation to industry of Sverdlovsk region is presented. It was found that the regional technology platform can be an effective tool for combining the interests of territorial and sectoral development. It is proved that the idea of neoindustrialization can be realized only as a result of wise industrial policy and road map formation for the movement to an entirely new high-tech based industrial development. In the process of forming, the problem of neoindustrialization of a «pure» market as a factor in increasing the economic security is actualized.

Competitive and innovation factors in wine tourism clusters: A comparative study between consolidated and emerging regions in Brazil and Uruguay / Factores de competitividad e innovación en clusters enoturísticos: Un estudio comparativo entre las regiones consolidadas y emergentes en Brasil y Uruguay

Directory of Open Access Journals (Sweden)

Flores Shana Sabbado

2016-01-01

Full Text Available The purpose of this article is to establish a cross-country analysis of the structure and organization of wine tourism clusters in consolidated and emerging wine regions in Brazil and Uruguay, looking for identifying the key factors for competitiveness and innovation. The regions chosen for analysis are: Vale dos Vinhedos, Campanha and Vale do São Francisco, in Brazil, and sites on Montevideo and Canelones, in Uruguay. The study analyze competitive factors in each region, including: the structure and density, support institutions at national and regional level, educational and research institutions, organization process for the geographical indication and the relationship between wine tourism and the promotion of wine and region. Further than comparing the two countries, the research also puts stop regions according to their stage of development in each assessed factor. Thus, the study suggests strategies that can be adopted at regional level or in cooperation between regions (in the country or bi-national cooperation to strengthen and develop the tourist areas of the wine as a whole.

Investigation on the Regional Loss Factor and Its Anisotropy for Aortic Aneurysms

Directory of Open Access Journals (Sweden)

Nastaran Shahmansouri

2016-10-01

Full Text Available An aortic aneurysm is a lethal arterial disease that mainly occurs in the thoracic and abdominal regions of the aorta. Thoracic aortic aneurysms are prevalent in the root/ascending parts of the aorta and can lead to aortic rupture resulting in the sudden death of patients. Understanding the biomechanical and histopathological changes associated with ascending thoracic aortic aneurysms (ATAAs, this study investigates the mechanical properties of the aorta during strip-biaxial tensile cycles. The loss factor—defined as the ratio of dissipated energy to the energy absorbed during a tensile cycle—the incremental modulus, and their anisotropy indexes were compared with the media fiber compositions for aneurysmal (n = 26 and control (n = 4 human ascending aortas. The aneurysmal aortas were categorized into the aortas with bicuspid aortic valves (BAV and tricuspid aortic valves (TAV. The strip-biaxial loss factor correlates well with the diameter of the aortas with BAV and TAV (for the axial direction, respectively, R2 = 0.71, p = 0.0022 and R2 = 0.54, p = 0.0096. The loss factor increases significantly with patients’ age in the BAV group (for the axial direction: R2 = 0.45, p = 0.0164. The loss factor is isotropic for all TAV quadrants, whereas it is on average only isotropic in the anterior and outer curvature regions of the BAV group. The results suggest that loss factor may be a useful surrogate measure to describe the histopathology of aneurysmal tissue and to demonstrate the differences between ATAAs with the BAV and TAV.

Applicability of angular flux discontinuity factor preserving region-wise leakage for integro-differential transport equation

International Nuclear Information System (INIS)

Sakamoto, Tatsuya; Endo, Tomohiro; Yamamoto, Akio

2014-01-01

In the current core analysis, spatial homogenization is utilized to reduce the computational time. The discontinuity factor (DF) is one of the effective correction factors to reduce spatial homogenization error. The DF in diffusion equation is widely used; on the other hand the DF in transport equation has not been put to practical use although several efforts have been carried out. In this paper, the angular flux discontinuity factor (AFDF) as the DF for the integro-differential transport equation (e.g., the discrete-ordinate method, the method of characteristics) is theoretically described and its applicability is discussed. The AFDF is used to preserve the region-wise neutron leakage at each spatial mesh and defined as a ratio of heterogeneous and homogeneous angular fluxes at the homogenized region surface. In a homogeneous calculation with the AFDF, the angular flux is discontinuous at the region surface. In this paper the applicability of the AFDF to fuel pin cell homogenization is verified for one-dimensional slab geometry. As a result of this verification, it is confirmed that the AFDF has the capability to reduce the spatial homogenization error of fuel pin cell homogenization. (author)

HIV AND HCV COINFECTION: PREVALENCE, ASSOCIATED FACTORS AND GENOTYPE CHARACTERIZATION IN THE MIDWEST REGION OF BRAZIL

Directory of Open Access Journals (Sweden)

Solange Zacalusni Freitas

2014-12-01

Full Text Available A cross-sectional study on prevalence, associated factors and genotype distribution of HCV infection was conducted among 848 HIV-infected patients recruited at reference centers in the Midwest Region of Brazil. The prevalence rate of HIV-HCV coinfection was 6.9% (95% CI: 5.2 to 8.6. In multivariable analysis, increasing age, use of illicit drugs (injection and non-injection, a history of blood transfusion before 1994, and the absence of a steady partnership were significant independent associated factors for HIV-HCV coinfection. The phylogenetic analysis based on the NS5B region revealed the presence of two major circulating genotypes of HCV: genotypes 1 (58.3% and 3 (41.7%. The prevalence of HIV-HCV coinfection was lower than those reported in studies conducted with HIV-infected patients in different regions of Brazil, due to the fact that illicit drug use is not a frequent mode of HIV transmission in this region of Brazil. Serologic screening of HIV-patients for HCV before initiating antiretroviral treatment, a comprehensive identification of associated factors, and the implementation of effective harm reduction programs are highly recommended to provide useful information for treatment and to prevent HCV coinfection in these patients.

Factors that influence attitudes and sexual behavior among constituency youth workers in Oshana Region, Namibia.

Science.gov (United States)

Lawoyin, Olusheyi O; Kanthula, Ruth M

2010-03-01

This survey was carried out to assess attitudes and behaviour among youth within four constituencies in Oshana region, Namibia and to understand to how certain social and cultural factors inform attitudes and influence sexual behaviour among the population of young people surveyed. Using a structured questionnaire, data were collected from a random sample of eighty young men and women between the ages of 15-30 years from four constituencies in Oshana region. Survey outcomes revealed attitudes and certain factors that are linked to sexual risk behaviour such as multiple sexual partnerships. Outcomes also reveal an influence of established socio-cultural norms on gender dynamics within relationships and a culture of reserve around discussions of sex and sexuality among young people. Stakeholder interventions should be directed towards incorporating approaches that address these factors as part of efforts to curb the incidence of HIV among young people in Namibia.

Analysis of Entrepreneurship barriers in Moravia-Silesian Region by VRIO and Factor analysis application

OpenAIRE

Šebestová, Jarmila

2007-01-01

The small and medium sized entrepreneurship is often considered to be as a phenomenon of our times. Why many authors dedicated their work on this field? The main reason is that SME make influence on society life and contribute to economic development of the region, where they establish their business. The same situation is in Moravia-Silesian region, where the fac-tor analysis being applied. VRIO and Porter's analysis were used to interpret clearly research findings.

MIGRATION INTEGRATION AS A FACTOR OF ECONOMIC AND REGIONAL DEVELOPMENT IN THE EUROPEAN UNION

Directory of Open Access Journals (Sweden)

Petronela Daniela FERARU

2015-10-01

Full Text Available International migration, together with economic and financial crisis or the different socio-economic development of Member States, is a serious threat to security in Europe. Population migration as a threatening factor, places the European Union in the face of a decision to establish clear policies for the establishment of a climate of external security, both for the migrant population and for the rest of the population. All in all, this study will centre on the following hypothesis: the better we know the challenges of international migration in the European Union and its Member States the more the European policies to mitigate negative effects of the world will be diminished. The aim is to highlight aspects pertaining to migration integration as a factor of economic, social and regional development in the European Union, and less as a factor of destabilization and insecurity. In other words, a good knowledge of the phenomenon leads to drawing up effective policies to reduce hazards, risks, threats and negative effects that happen today due to the increasing number of immigrants. Finally, the study will present a series of conclusions, including on the work hypothesis verification and some proposals related to migration integration efficiency as a factor of regional and economic development in the European Union.

Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

International Nuclear Information System (INIS)

Cui Wei; Yin Lingling; Dong Lingyue

2012-01-01

Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

The Determinant Factors of Regional Development Toward Land Use Change in Deli Serdang

Science.gov (United States)

Lindarto, D.; Sirojuzilam; Badaruddin; Dwira

2017-03-01

The concept of regional development Mebidangro (Medan, Binjai, Deli Serdang, and Karo) creating neighboring region hinterland Medan city with Deli Serdang Regency especially in Tembung village, Percut Sei Tuan District. Population structure in Tembung shows occurrence condition of rural-urban change which seen from the sprawl land use change. The aim of the study is to reveal the genius locus as one of land use change factors. The study conducted with quantitative approach intended at obtaining variables which describing several factors forming land use change. Descriptive approach intended to give an idea, justification, and fact-finding with correct interpretation. Data collected through a purposive sampling of 300 respondents who have built the house between 2010 till 2014. With overlay figure/ground technique, scoring analysis, descriptive quantitative and SEM (Structural Equational Models) gained a result that place character/genius locus (p=0,007) potentially as one of the main land use change driving factors besides accessibility (p=0,039), infrastructure (p=0,005), social-economic p=0,038). Topographic (p=0,663) was inversely potentially. The implication of the findings is required intensive control in space utilization considering the rapid change in land use transformation that tend to have the negative impact of urban sprawl.

Prevalence of abnormal birth weight and related factors in Northern region, Ghana.

Science.gov (United States)

Abubakari, Abdulai; Kynast-Wolf, Gisela; Jahn, Albrecht

2015-12-15

Birth weight is a crucial determinant of the development potential of the newborn. Abnormal newborn weights are associated with negative effects on the health and survival of the baby and the mother. Therefore, this study was designed to determine the prevalence of abnormal birth weight and related factors in Northern region, Ghana. The study was a facility-based cross-sectional survey in five hospitals in Northern region, Ghana. These hospitals were selected based on the different socio-economic backgrounds of their clients. The data on birth weight and other factors were derived from hospital records. It was observed that low birth weight is still highly prevalent (29.6%), while macrosomia (10.5%) is also increasingly becoming important. There were marginal differences in low birth weight observed across public hospitals but marked difference in low birth weight was observed in Cienfuegos Suglo Specialist Hospital (Private hospital) as compared to the public hospitals. The private hospital also had the highest prevalence of macrosomia (20.1%). Parity (0-1) (p malnutrition phenomenon, which is currently being experienced by developing and transition counties. Both low birth weight and macrosomia are risk factors, which could contribute considerably to the current and future burden of diseases. This may overstretch the already fragile health system in Ghana. Therefore, it is prudent to recommend that policies aiming at reducing diet related diseases should focus on addressing malnutrition during pregnancy and early life.

UNEMPLOYMENT REDUCTION AS A FACTOR OF SUSTAINABLE DEVELOPMENT IN THE KURSK REGION

Directory of Open Access Journals (Sweden)

E. N. Dyukanova

2016-01-01

Full Text Available Aim. The Kursk region is the central part of European Russia. The region's economy is based on the use of fertile agricultural land. The share of the employed population in agriculture is more than 17%. The flip side is unemployment in rural areas. Basing on the statistical data we analyzed the unemployment situation between 2009 and 2014 in the administrative districts of the region.Methods. In order to study the problem of unemployment we used methods such as the collection and compilation of statistics, factor analysis, and method of comparison of the data on registered unemployment rate calculated by the ILO and GIS technology for visualization of the results.Results. Unemployment is a social and economic problem for all sectors of society which is critical for the steady development of the Kursk region. The results of study on the female unemployment among women, young people and rural population show the geographical classification of administrative districts with three main types of unemployment: 1 - predominantly female; 2 - female and youth; 3 - without priorities.Conclusions. Our results show that during the period under study only 2 regions showed an increase in registered unemployment rate and other areas showed a marked decrease (13 districts and the stabilization of the situation (13 districts. This typology can be useful for the regional employment services, as it allows to individualize the content of programs to combat unemployment in accordance with its territorial expression by taking into account the needs of specific focus groups for sustainable development of the region.

An evolutionarily conserved intronic region controls the spatiotemporal expression of the transcription factor Sox10

Directory of Open Access Journals (Sweden)

Pavan William J

2008-10-01

Full Text Available Abstract Background A major challenge lies in understanding the complexities of gene regulation. Mutation of the transcription factor SOX10 is associated with several human diseases. The disease phenotypes reflect the function of SOX10 in diverse tissues including the neural crest, central nervous system and otic vesicle. As expected, the SOX10 expression pattern is complex and highly dynamic, but little is known of the underlying mechanisms regulating its spatiotemporal pattern. SOX10 expression is highly conserved between all vertebrates characterised. Results We have combined in vivo testing of DNA fragments in zebrafish and computational comparative genomics to identify the first regulatory regions of the zebrafish sox10 gene. Both approaches converged on the 3' end of the conserved 1st intron as being critical for spatial patterning of sox10 in the embryo. Importantly, we have defined a minimal region crucial for this function. We show that this region contains numerous binding sites for transcription factors known to be essential in early neural crest induction, including Tcf/Lef, Sox and FoxD3. We show that the identity and relative position of these binding sites are conserved between zebrafish and mammals. A further region, partially required for oligodendrocyte expression, lies in the 5' region of the same intron and contains a putative CSL binding site, consistent with a role for Notch signalling in sox10 regulation. Furthermore, we show that β-catenin, Notch signalling and Sox9 can induce ectopic sox10 expression in early embryos, consistent with regulatory roles predicted from our transgenic and computational results. Conclusion We have thus identified two major sites of sox10 regulation in vertebrates and provided evidence supporting a role for at least three factors in driving sox10 expression in neural crest, otic epithelium and oligodendrocyte domains.

Inconsistencies of Breast Cancer Risk Factors between the Northern and Southern Regions of Vietnam

Science.gov (United States)

Trieu, Phuong Dung (Yun); Mello-Thoms, Claudia; Peat, Jennifer K; Do, Thuan Doan; Brennan, Patrick C

2017-10-26

Background: In recent decades the amount of new breast cancer cases in the southern region has been reported to increase more rapidly than in the northernVietnam. The aim of this study is to compare breast cancer risk factors between the two regions and establish if westernized influences have an impact on any reported differences. Method: Data was collected from the two largest oncology hospitals in the north and the south of Vietnam in 2015. Breast density, demographic, reproductive and lifestyle data of 127 cases and 269 controls were collected in the north and 141 cases and 250 controls were gathered from the south. Baseline differences in factors between cases and age-matched controls in each region were assessed using chi-square tests and independent t-tests. Odds ratios (OR) for independent risk factors for breast cancer were obtained from conditional logistic regression. Results: In northern Vietnam significantly increased risks in developing breast cancer were observed for women with age at first menstrual period less than 14 years old (OR=2.1; Pcup of coffee per day (OR=1.9; P<0.05) were more likely to be diagnosed with breast cancer. Conclusion: We found that women living in the south had some breast cancer associations, such as increased mammographic density and coffee consumption, which are closer to the risks in westernized populations than women in the north. Creative Commons Attribution License

Influential factors on debris flow events and hillslope-channel connectivity in Alpine regions: case studies from two Alpine regions in Styria, Austria

Science.gov (United States)

Traper, Sandra; Pöppl, Ronald; Rascher, Eric; Sass, Oliver

2016-04-01

In recent times different types of natural disasters like debris flow events have attracted increasing attention worldwide, since they can cause great damage and loss of infrastructure or even lives is not unusual when it comes to such an event. The engagement with debris flows is especially important in mountainous areas like Austria, since Alpine regions have proved to be particularly prone to the often harmful consequences of such events because of increasing settlement of previously uninhabited regions. Due to those frequently damaging effects of debris flows, research on this kind of natural disaster often focuses on mitigation and recovery measures after an event and on how to restore the initial situation. However, a view on the situation of an area, where severe debris flows recently occurred and are well documented, before the actual event can aid in discovering important preparatory factors that contribute to initiating debris flows and hillslope-channel connectivity in the first place. Valuable insights into the functioning and preconditions of debris flows and their potential connectivity to the main channel can be gained. The study focuses on two geologically different areas in the Austrian Alps, which are both prone to debris flows and have experienced rather severe events recently. Based on data from debris flow events in two regions in Styria (Austria), the Kleinsölk and the Johnsbach valleys, the aim of the study is to identify factors which influence the development of debris flows and the potential of such debris flows to reach the main channel potentially clogging up the river (hillslope-channel connectivity). The degree of hillslope-channel coupling was verified in extensive TLS and ALS surveys, resulting in DEMs of different resolution and spatial extension. Those factors are obtained, analyzed and evaluated with DEM-based GIS- and statistical analyses. These include factors that are attributed to catchment topography, such as slope angle

[Study on the factors impacting on early cochlear implantation between the eastern and western region of China].

Science.gov (United States)

Xiao, Hanqiong; Li, Wei; Ma, Ruixia; Gong, Zhengpeng; Shi, Haibo; Li, Huawei; Chen, Bing; Jiang, Ye; Dai, Chunfu

2015-06-01

To describe tne regional different factors which impact on early cochlear implantation in prelingual deaf children between eastern and western regions of China. The charts of 113 children who received the cochlear implantation after 24 months old were reviewed and analyzed. Forty-five of them came from the eastern region (Jiangsu, Zhejiang or Shanghai) while 68 of them came from the western region (Ningxia or Guizhou). Parental interviews were conducted to collect information regarding the factors that impact on early cochlear implantation. Result:Based on the univariate logistic regression analysis, the odds ratio (OR) value of universal newborn hearing screening (UNHS) was 5. 481, which indicated the correlation of UNHS with early cochlear implantation is significant. There was statistical difference between the 2 groups (P0. 05). The multivariate analysis indicated that the UNHS and financial burden are statistically different between the eastern and western regions (P=0. 00 and 0. 040 respectively). The UNHS and financial burden are statistically different between the eastern reinforced in the western region. In addition, the government and society should provide powerful policy and more financial support in the western region of China. The innovation of management system is also helpful to the early cochlear implantation.

Factors Related to the Selection of Information Sources: A Study of Ramkhamhaeng University Regional Campuses Graduate Students

Science.gov (United States)

Angchun, Peemasak

2011-01-01

This study assessed students' satisfaction with Ramkhamhaeng University regional library services (RURLs) and the perceived quality of information retrieved from other information sources. In particular, this study investigated factors relating to regional students' selection of information sources to meet their information needs. The researcher…

Variations between world regions in individual health: a multilevel analysis of the role of socio-economic factors

NARCIS (Netherlands)

Witvliet, Margot I.; Kunst, Anton E.; Stronks, Karien; Arah, Onyebuchi A.

2012-01-01

Background: Living in a particular region might affect health. We aimed to assess variations between regions in individual health. The role of socio-economic factors in the associations was also investigated. Methods: World Health Survey data were analysed on 220 487 individuals. Main outcomes

Sector-wise midpoint characterization factors for impact assessment of regional consumptive and degradative water use.

Science.gov (United States)

Lin, Chia-Chun; Lin, Jia-Yu; Lee, Mengshan; Chiueh, Pei-Te

2017-12-31

Water availability, resulting from either a lack of water or poor water quality is a key factor contributing to regional water stress. This study proposes a set of sector-wise characterization factors (CFs), namely consumptive and degradative water stresses, to assess the impact of water withdrawals with a life cycle assessment approach. These CFs consider water availability, water quality, and competition for water between domestic, agricultural and industrial sectors and ecosystem at the watershed level. CFs were applied to a case study of regional water management of industrial water withdrawals in Taiwan to show that both regional or seasonal decrease in water availability contributes to a high consumptive water stress, whereas water scarcity due to degraded water quality not meeting sector standards has little influence on increased degradative water stress. Degradative water stress was observed more in the agricultural sector than in the industrial sector, which implies that the agriculture sector may have water quality concerns. Reducing water intensity and alleviating regional scale water stresses of watersheds are suggested as approaches to decrease the impact of both consumptive and degradative water use. The results from this study may enable a more detailed sector-wise analysis of water stress and influence water resource management policies. Copyright © 2017 Elsevier B.V. All rights reserved.

Prevalence and predictive factors for regional osteopenia in women with anorexia nervosa.

Science.gov (United States)

Grinspoon, S; Thomas, E; Pitts, S; Gross, E; Mickley, D; Miller, K; Herzog, D; Klibanski, A

2000-11-21

Anorexia nervosa is highly prevalent among young women. To determine prevalence and predictive factors for regional bone loss. Prospective cohort analysis. University hospital. 130 women with anorexia nervosa. Dual-energy x-ray absorptiometry. The prevalence of osteopenia (-1.0 SD >/= T-score > -2.5 SD) and osteoporosis (T-score anorexia nervosa. Weight, but not estrogen use, is a significant predictor of BMD in this population at all skeletal sites.

The Comparison and Modeling of the Driving Factors of Urban Expansion for Thirty-Five Big Cities in the Three Regions in China

Directory of Open Access Journals (Sweden)

Tian Guangjin

2016-01-01

Full Text Available This paper presents a national- and regional-scale urban growth model (NRUGM of China based on panel data analysis. Through the panel analysis, population growth, road construction, salary increment per capita, and secondary industry product increment were proven to be the major driving factors for national-scale urban expansion. According to Seventh Five-Year Plan, China had been divided into three regions, Eastern China, Middle China, and Western China, by their geographic position and economic development. We studied the relationship between urban expansion and the driving factors for the three regions between 1990 and 2010 in China. The driving factors of urban expansion were different for the different regions and periods. Population growth and road construction were identified as the two major factors driving urban expansion for Eastern China. Secondary industry and economic development had become the major driving factors for urban expansion over the last twenty years in Middle China. Over the same period, for Western China, economic growth had become the major driving factor for urban expansion. Our results have significant policy implications for China. The macrocontrol of the central government should utilize different policies to adjust urban expansion in the different regions.

Regional mortality by socioeconomic factors in Slovakia: a comparison of 15 years of changes.

Science.gov (United States)

Rosicova, Katarina; Bosakova, Lucia; Madarasova Geckova, Andrea; Rosic, Martin; Andrejkovic, Marek; Žežula, Ivan; Groothoff, Johan W; van Dijk, Jitse P

2016-07-19

Like most Central European countries Slovakia has experienced a period of socioeconomic changes and at the same time a decline in the mortality rate. Therefore, the aim is to study socioeconomic factors that changed over time and simultaneously contributed to regional differences in mortality. The associations between selected socioeconomic indicators and the standardised mortality rate in the population aged 20-64 years in the districts of the Slovak Republic in the periods 1997-1998 and 2012-2013 were analysed using linear regression models. A higher proportion of inhabitants in material need, and among males also lower income, significantly contributed to higher standardised mortality in both periods. The unemployment rate did not contribute to this prediction. Between the two periods no significant changes in regional mortality differences by the selected socioeconomic factors were found. Despite the fact that economic growth combined with investments of European structural funds contributed to the improvement of the socioeconomic situation in many districts of Slovakia, there are still districts which remain "poor" and which maintain regional mortality differences.

Regional mortality by socioeconomic factors in Slovakia : a comparison of 15 years of changes

NARCIS (Netherlands)

Rosicova, Katarina; Bosakova, Lucia; Geckova, Andrea Madarasova; Rosic, Martin; Andrejkovic, Marek; Zezula, Ivan; Groothoff, Johan W.; van Dijk, Jitse P.

2016-01-01

Background: Like most Central European countries Slovakia has experienced a period of socioeconomic changes and at the same time a decline in the mortality rate. Therefore, the aim is to study socioeconomic factors that changed over time and simultaneously contributed to regional differences in

HUMAN CAPITAL OF THE REGIONS-DRIVEN FACTOR FOR GROWTH AND EMPLOYMENT.THE CASE OF ROMANIA

Directory of Open Access Journals (Sweden)

Olimpia Neagu

2011-01-01

Full Text Available The world is entering a new era - a time when economic wealth is created by knowledgeand skills and the human capital of nations, regions and cities will determine the winnersfrom the loosers. The paper is focused on the human capital’s performance of the romanianregions, measured by economic growth and employment, analysing statistical data fromeuropean sources. There are differences between regions regarding the human capitalendowment, employment and economic growth. The assumption of a positive correlationbetween these variables is partially confirmed. Further researches are needed to measure theimpact of other factors such as: human migration or attractivity of regions. Designing anddeveloping regional human capital strategies would be a good starting point for a positiveperspective of the Europe 2020 strategy implementation.

Has the civil society a real place in the governance of the nuclear and chemical activities?

International Nuclear Information System (INIS)

2005-01-01

This colloquium, organized in three sessions discusses the following topics: the historical aspects of the transparency in the nuclear domain, the AZF accident, the nuclear wastes specific case, the access of the society to the knowledge, the democratic participation to the management of the risk activities and the conditions of this sustainable participation, the international situation and the public trust. (A.L.B.)

Has the civil society a real place in the governance of the nuclear and chemical activities?; La societe civile a-t-elle 'vraiment' une place dans la gouvernance des activites nucleaires et chimiques?

Energy Technology Data Exchange (ETDEWEB)

NONE

2005-07-01

This colloquium, organized in three sessions discusses the following topics: the historical aspects of the transparency in the nuclear domain, the AZF accident, the nuclear wastes specific case, the access of the society to the knowledge, the democratic participation to the management of the risk activities and the conditions of this sustainable participation, the international situation and the public trust. (A.L.B.)

Risk factors associated with hantavirosis fatality: a regional analysis from a case-control study in Brazil

Directory of Open Access Journals (Sweden)

Maria Cristina Antunes Willemann

2014-01-01

Full Text Available Introduction: In Brazil, hantavirus cardiopulmonary syndrome (HCPS has a high lethality rate that varies by region. This study aimed to identify the risk factors associated with fatal hantavirosis. Methods: This study was a case-control study that included all laboratory confirmed cases of hantavirosis. The cases were stratified by the different Brazilian regions using data from the Notifiable Diseases Information System. “Cases” were patients who progressed to death, whereas “controls” were patients who were cured. The odds ratio (OR and the adjusted OR were calculated. Results: Overall, 158 cases and 281 controls were included in this study. In the Midwest region, the cases were 60% less likely to present with flank pain, and the time between the beginning of symptoms and death was shorter than the time between the beginning of symptoms and a cure. In the Southeast region, the cases were 60% less likely to present with thrombocytopenia or reside in rural areas compared to those who progressed to a cure. Additionally, the cases sought medical assistance, notification and investigation more quickly than the controls. In the Southern region, the cases that died were 70% less likely to be male compared to the controls. Conclusions: HCPS manifests with nonspecific symptoms, and there are few published studies related to the condition, so determining a patient's therapeutic strategy is difficult. This study presents findings from different Brazilian regions and highlights the need for further investigations to improve comprehension about regional risk factors associated with hantavirosis and to reduce morbimortality.

Radon variations in active volcanoes and in regions with high seismicity: internal and external factors

International Nuclear Information System (INIS)

Segovia, N.; Cruz-Reyna, S. De la; Mena, M.

1986-01-01

The results of 4 years of observations of radon concentrations in soils of active volcanoes of Costa Rica and a highly seismic region in Mexico are discussed. A distinction is made between the influences of external (mostly meteorological) and internal (magmatic or tectonic) factors on the variation in radon levels. The geological meaning of the radon data can be thus enhanced if the external factors are excluded. (author)

Regional variations in risk factors for asthma in school children.

Science.gov (United States)

Lawson, Joshua A; Rennie, Donna C; Senthilselvan, Ambikaipakan; Cockcroft, Donald W; McDuffie, Helen H

2005-09-01

The authors have previously reported an increased prevalence of asthma in Estevan, Saskatchewan (21.4%) compared with Swift Current, Saskatchewan (16.2%). To determine the association between asthma and personal and indoor environmental risk factors in these communities. A population-based cross-sectional study was conducted in January 2000. A questionnaire was distributed to school children in grades 1 to 6 for completion by a parent. Multivariate logistic regression was used to examine associations between various risk factors and physician-diagnosed asthma. Asthma was associated with respiratory allergy (adjusted OR [adjOR]=8.85, 95% CI 6.79 to 11.54), early respiratory illness (adjOR=2.81, 95% CI 1.96 to 4.03) and family history of asthma (adjOR=2.37, 95% CI 1.67 to 3.36). Several environmental factors varied with asthma by town. In Estevan, asthma was associated with home mould or dampness (adjOR=1.82, 95% CI 1.23 to 2.69) and was inversely associated with air conditioning (adjOR=0.56, 95% CI 0.37 to 0.85). The risk of asthma was increased if the child had previous exposure to environmental tobacco smoke from the mother in both communities (Swift Current: OR=1.87, 95% CI 1.06 to 3.30; Estevan: OR=2.00, 95% CI 1.17 to 3.43), and there was an inverse association with current exposure to environmental tobacco smoke from the mother in Estevan (OR=0.64, 95% CI 0.40 to 1.00). When multivariate analyses were stratified by sex, the relationship between home mould or dampness and asthma was most prominent in girls in Estevan. Despite a similar regional location, different risk factors for asthma were identified in each community. Local environmental factors are important to consider when interpreting findings and planning asthma care.

GROUPING OF MUNICIPAL DISTRICTS OF THE ASTRAKHAN REGION OF SOCIO-ECONOMIC INDICATORS WITH APPLICATION OF FACTOR ANALYSIS

Directory of Open Access Journals (Sweden)

Marina V. Kolomeiko

2014-01-01

Full Text Available In the article analyzed and identifi ed the main factors affecting the level of poverty of the population in Astrakhan region made a multi-dimensional classifi cation of municipal districts of the Astrakhan region on socio-economic indicators characterizing the poverty of the population on thebasis of the cluster analysis.

Push and pull factors determing wine tourism development in the 'Tri Morave' sub-region

Directory of Open Access Journals (Sweden)

Jovanović-Tončev Melita

2016-01-01

Full Text Available The subject of this paper are the factors affecting the decision of wine tourists to take a trip to a particular destination. These factors can be divided into internal (push and external (pull factors. The purpose of this study is to determine the development potential as well as the factors that influence participation in wine tourism in Tri Morave sub-region. In order to do that, two researches were conducted: one on the offer side and another on the demand side. Based on the results of the survey on the offer side, one can conclude that Tri Morave sub-region abounds in natural and anthropological resources that should be turned into an integrated wine product. On the other hand, research concerning tourist demand was conducted by polling winery visitors. The obtained data confirms assumptions about the appearance of modern tourists seeking authentic experience, satisfaction of hedonistic needs, and enjoyment of high-quality wine and food. Based on the results of the survey, the purchase of wine and wine tasting are the highest ranked benefits that tourists expect from visits to wineries. The application of Spearman's correlation coefficient points to statistically significant correlation between respondents, who referred to tasting, wine purchase, and authentic tourist experience as the basic motives of their visit, and future behavior of tourists in terms of revisiting and recommendations of the given wine destination to friends.

Factors affecting stream nutrient loads: A synthesis of regional SPARROW model results for the continental United States

Science.gov (United States)

Preston, Stephen D.; Alexander, Richard B.; Schwarz, Gregory E.; Crawford, Charles G.

2011-01-01

We compared the results of 12 recently calibrated regional SPARROW (SPAtially Referenced Regressions On Watershed attributes) models covering most of the continental United States to evaluate the consistency and regional differences in factors affecting stream nutrient loads. The models - 6 for total nitrogen and 6 for total phosphorus - all provide similar levels of prediction accuracy, but those for major river basins in the eastern half of the country were somewhat more accurate. The models simulate long-term mean annual stream nutrient loads as a function of a wide range of known sources and climatic (precipitation, temperature), landscape (e.g., soils, geology), and aquatic factors affecting nutrient fate and transport. The results confirm the dominant effects of urban and agricultural sources on stream nutrient loads nationally and regionally, but reveal considerable spatial variability in the specific types of sources that control water quality. These include regional differences in the relative importance of different types of urban (municipal and industrial point vs. diffuse urban runoff) and agriculture (crop cultivation vs. animal waste) sources, as well as the effects of atmospheric deposition, mining, and background (e.g., soil phosphorus) sources on stream nutrients. Overall, we found that the SPARROW model results provide a consistent set of information for identifying the major sources and environmental factors affecting nutrient fate and transport in United States watersheds at regional and subregional scales. ?? 2011 American Water Resources Association. This article is a U.S. Government work and is in the public domain in the USA.

Job satisfaction and associated factors among health professionals working at Western Amhara Region, Ethiopia.

Science.gov (United States)

Temesgen, Kalkidan; Aycheh, Moges Wubie; Leshargie, Cheru Tesema

2018-04-17

In Ethiopia assuring the satisfaction of health care provider with their job is a major challenging problem. Job satisfaction is a worker's emotional response to different job related factors resulting in finding pleasure, comfort, confidence, rewards, personal growth and various positive opportunities, including upward mobility, recognition, and appraisal done on a merit pattern with monetary value as compensation. Professionals, whose needs and expectations are satisfied, tend to be more productive compared to their colleagues. Thus, study is aimed at assessing job satisfaction and associated factors among health professionals working at Western Amhara region, Ethiopia. An institution-based cross sectional study was conducted on March 2016 at Western Amhara region among 575 health professionals selected using simple random sampling. Logistic regression analysis was used to identify factors related to job satisfaction. Variables which have p-value less than or equal to 0.05 with corresponding AOR at 95 confidence interval was considered to declare the significance association. This study revealed that job satisfaction of health professional working at Western Amhara region was 31.7%. The mean age of respondent was 27.13 years. Majority of them, 79.3% and 95.3% were less than 30 years in age and orthodox Christian religion followers respectively. The presence of health professionals' reference manual/guide, alcohol drinking, workload, experience, educational status and profession types were identified as significant factors associated with health care professionals' job satisfaction level. Professional being laboratory technicians, pharmacists and Environmental health workers were 4.86 times more likely to satisfy themselves than nurses, midwives and Public health officers. Similarly, in their educational status, degree and above holders were 5.64 times more likely to satisfy themselves than below degree holders. Health professionals whose experience with > 3�

Factor value determination and applicability evaluation of universal soil loss equation in granite gneiss region

Directory of Open Access Journals (Sweden)

Wen-hai Zhang

2009-06-01

Full Text Available Six types of runoff plots were set up and an experimental study was carried out to examine natural rate of soil and water loss in the granite gneiss region of northern Jiangsu Province in China. Through correlation analysis of runoff and soil loss during 364 rainfall events, a simplified and convenient mathematical formula suitable for calculating the rainfall erosivity factor (R for the local region was established. Other factors of the universal soil loss equation (USLE model were also determined. Relative error analysis of the soil loss of various plots calculated by the USLE model on the basis of the observed values showed that the relative error ranged from -3.5% to 9.9% and the confidence level was more than 90%. In addition, the relative error was 5.64% for the terraced field and 12.36% for the sloping field in the practical application. Thus, the confidence level was above 87.64%. These results provide a scientific basis for forecasting and monitoring soil and water loss, for comprehensive management of small watersheds, and for soil and water conservation planning in the region.

Risk factors for prevalence of pig parasitoses in Mbeya Region, Tanzania.

Science.gov (United States)

Kabululu, Mwemezi Lutakyawa; Ngowi, Helena Aminiel; Kimera, Sharadhuli Iddi; Lekule, Faustin Paul; Kimbi, Eliakunda Casmir; Johansen, Maria Vang

2015-09-15

A cross-sectional study was carried out to determine risk factors for prevalence of common endo- and ectoparasites of pigs kept by smallholder farmers in Mbozi and Mbeya (Rural) districts of Mbeya Region, in Tanzania. A total of 482 pigs from 220 households of 16 villages, eight in each district were randomly selected and examined. Prevalence of Taenia solium cysticercosis was 11.5%, gastrointestinal nematodes 63.7% and ectoparasites 21.2% based on Ag-ELISA, McMaster technique and full body searches/ear scrapings, respectively. Nematode eggs identified were strongyles (Oesophagostomum spp. and Trichostrongylus spp.), Ascaris suum, Trichuris suis and Strongyloides ransomi with prevalence of 57.4%, 17.5%, 5.3% and 1.1%, respectively. Four groups of ectoparasites were identified, i.e. lice (Haematopinus suis), ticks (Rhipicephalus spp., Amblyomma spp., Haemaphysalis spp. and Boophilus spp.), fleas (Ctenocephalides canis) and mites (Sarcoptes scabiei var. suis and Demodex phylloides), with prevalence of 19.1%, 2.1%, 0.4%, and 1.2%, respectively. Pigs in Mbeya (Rural) District had higher odds for porcine cysticercosis (OR=2.63, 95% CI: [1.22-5.55]). Poor pen hygiene and infrequent antiparasitic treatment were identified to be risk factors for prevalence of nematode infections (OR=1.95 [1.09-3.52] and OR=1.78 [1.06-2.94], respectively). The odds for high nematode burdens increased in cases of poor pen hygiene (OR=4.20 [2.54-6.62]) and poor feed quality (OR=3.7 [1.66-8.33]). Pigs not treated with antiparasitic drugs within the last three months had higher odds for ectoparasite (OR=4.0 [1.78-9.09]) and lice infestations (OR=8.33 [1.96-14.28]) than treated pigs. This study has shown that parasitoses constitute a major burden for smallholder pigs in Mbeya Region and major risk factors included infrequent antiparasitic treatment, poor pen hygiene and poor feed quality. Cost-effective intervention strategies are needed to improve pork production, secure pig welfare and ensure

Empirical Study on Total Factor Productive Energy Efficiency in Beijing-Tianjin-Hebei Region-Analysis based on Malmquist Index and Window Model

Science.gov (United States)

Xu, Qiang; Ding, Shuai; An, Jingwen

2017-12-01

This paper studies the energy efficiency of Beijing-Tianjin-Hebei region and to finds out the trend of energy efficiency in order to improve the economic development quality of Beijing-Tianjin-Hebei region. Based on Malmquist index and window analysis model, this paper estimates the total factor energy efficiency in Beijing-Tianjin-Hebei region empirically by using panel data in this region from 1991 to 2014, and provides the corresponding political recommendations. The empirical result shows that, the total factor energy efficiency in Beijing-Tianjin-Hebei region increased from 1991 to 2014, mainly relies on advances in energy technology or innovation, and obvious regional differences in energy efficiency to exist. Throughout the window period of 24 years, the regional differences of energy efficiency in Beijing-Tianjin-Hebei region shrank. There has been significant convergent trend in energy efficiency after 2000, mainly depends on the diffusion and spillover of energy technologies.

Seroprevalence and risk factor analysis of human leptospirosis in distinct climatic regions of Pakistan.

Science.gov (United States)

Sohail, Muhammad Luqman; Khan, Muhammad Sarwar; Ijaz, Muhammad; Naseer, Omer; Fatima, Zahida; Ahmad, Abdullah Saghir; Ahmad, Waqas

2018-05-01

Leptospirosis is a worldwide emerging infectious disease of zoonotic importance and large epidemics and epizootics have been reported all over the globe. A cross survey study was conducted to estimate seroprevalence of human leptospirosis in climatically distinct regions of Pakistan and to identify the risk factors associated with the disease. Blood samples from 360 humans were collected through convenient sampling, 120 from each of three study areas. Serological testing was performed using ELISA kit as per manufacturer's recommendations. The results showed an overall prevalence of 40.83% (95% CI; 35.71-46.11). Statistical analysis showed significant (P climatic region (50.83%; 95% CI; 41.55-60.07), followed by semi-arid region (44.16%; 95% CI; 35.11-53.52) and lowest in hot and dry region (27.50%; 95% CI; 19.75-36.40). After multivariate analysis age, gender, exposure to flooding water, source of water usage, disinfection schedule of surroundings and history of cut and wound were found significantly associated with the seropositivity of Leptospira. The present study, first to uncover seroprevalence of human Leptospira in different climatic regions of Pakistan, alarms about effect of climate on prevalence of Leptospira in the region. Copyright © 2018 Elsevier B.V. All rights reserved.

Hierarchical Fabrication of Engineered Vascularized Bone Biphasic Constructs via Dual 3D Bioprinting: Integrating Regional Bioactive Factors into Architectural Design.

Science.gov (United States)

Cui, Haitao; Zhu, Wei; Nowicki, Margaret; Zhou, Xuan; Khademhosseini, Ali; Zhang, Lijie Grace

2016-09-01

A biphasic artificial vascularized bone construct with regional bioactive factors is presented using dual 3D bioprinting platform technique, thereby forming a large functional bone grafts with organized vascular networks. Biocompatible mussel-inspired chemistry and "thiol-ene" click reaction are used to regionally immobilize bioactive factors during construct fabrication for modulating or improving cellular events. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of the driving factors' influences on regional energy-related carbon emissions in China based on geographical detector method.

Science.gov (United States)

Zhang, Xinlin; Zhao, Yuan

2018-04-01

To investigate the influences of different factors on spatial heterogeneity of regional carbon emissions, we firstly studied the spatial-temporal dynamics of regional energy-related carbon emissions using global Moran's I and Getis-Ord Gi and applied geographical detector model to explain the spatial heterogeneity of regional carbon emissions. Some conclusions were drawn. Regional carbon emissions showed significant global and local spatial autocorrelation. The carbon emissions were greater in eastern and northern regions than in western and southern regions. Fixed assets investment and economic output had been the main contributing factors over the study period, and economic output had been decreasing its influence. Industrial structure's influence showed a decrease trend and became smaller in 2015. The results of the interaction detections in 2015 can be divided into two types: enhance and nonlinear, and enhance and bivariate. The interactive influences between technological level and fixed assets investment, economic output and technological level, population size and technological level, and economic output and economic development were greater than others. Some policy recommendations were proposed.

Contribution of susceptibility locus at HLA class I region and environmental factors to occurrence of nasopharyngeal cancer in Northeast India.

Science.gov (United States)

Lakhanpal, Meena; Singh, Laishram Chandreshwor; Rahman, Tashnin; Sharma, Jagnnath; Singh, M Madhumangal; Kataki, Amal Chandra; Verma, Saurabh; Chauhan, Pradeep Singh; Singh, Y Mohan; Wajid, Saima; Kapur, Sujala; Saxena, Sunita

2015-04-01

High incidence of nasopharyngeal carcinoma (NPC) has been reported from China, Southeast Asia and Northeast (NE) region of India. Populations at geographic regions having higher incidence of NPC display human leukocyte antigen (HLA) distribution patterns different from areas having low incidence. The current study has investigated the contribution of environmental risk factors and ethnic variation of microsatellite markers in HLA region for the high incidence of NPC in NE India. Genotyping of HLA region using 33 microsatellite markers by fragment length analysis was done in 220 study subjects (120 NPC patients and 100 healthy controls). Association analysis showed two adjacent microsatellite markers HL003 (allele 121) and D6S2704 (allele 218) in the HLA class I region having association with high risk of NPC while allele 127 of HL003 and allele 255 of D6S2678 conferred a protective effect. The environmental factors mainly use of firewood (odds ratio (OR) = 3.797385, confidence interval (CI) = 1.97-7.30, P < 0), living in mud house (OR = 3.46, CI = 1.19-10.08, P = 0.022) and consumption of alcohol (OR = 2.11, CI = 1.02-4.37, P = 0.043) were found as major risk factors for NPC. Higher-order interaction showed combination of smoked food consumption and firewood use for cooking in multifactor dimensionality reduction (MDR) analysis and interaction of non-firewood users, non-ventilated houses and residence in mud houses in classification and regression tree (CART) analysis as the significant risk factors for NPC. Expression of Epstein-Barr virus (EBV) RNA was found in 92% (23/25) of NPC cases suggesting its significant role in NPC aetiopathogenesis. This study identified association of NPC with a susceptibility locus in the HLA class I region which has complex interaction with viral DNA and environmental factors.

Recurrent bacteraemia: A 10-year regional population-based study of clinical and microbiological risk factors

DEFF Research Database (Denmark)

Jensen, U.S.; Knudsen, J.D.; Andersen, Christian Østergaard

2010-01-01

Background: A population-based nested case-control study was conducted in order to characterize patient factors and microbial species associated with recurrent bacteraemia. Methods: All patients with bacteraemia in a Danish region during 1996-2006 were investigated. Recurrence was defined based o...

Transfer factors for the „soil-cereals” system in the region of Pcinja, Serbia

Directory of Open Access Journals (Sweden)

Marković Jelena S.

2016-01-01

Full Text Available The aim of the paper was to estimate the values of transfer factors for natural radionuclides (40K, 226Ra, 232Th, 235U, and 238U and 137Cs from soil to plants (cereals: wheat, corn and barley as important parameters for the agricultures in the selection of the location and the sort of cereals to be planted on. The results presented in this paper refer to the „soil-cereals” system in the region of Pcinja, Serbia. Total of 9 samples of soil and 7 samples of cereals were measured in the Department of Radiation and Environmental Protection, Vinca Institute of Nuclear Sciences, using three high-purity germanium detectors for gamma spectrometry measurements. In all the samples, transfer factors for 226Ra are significantly lower than for 40K, but they are all in good agreement with the literature data. On the three investigated locations, the calculated values of transfer factors for 40K were in the range of 0.144 to 0.392, while in the case of 226Ra, the transfer factors ranged from 0.008 to 0.074. Only one value (0.051 was obtained for transfer factor of 232Th. Specific activities of 137Cs, as well as uranium isotopes, in all the investigated cereal samples, were below minimal detectable activity concentrations. Also, the absorbed dose rate and the annual absorbed dose from the natural radionuclides in the soil, were calculated. The absorbed dose rate ranged from 49-86 nSv/h, while the annual absorbed dose ranged from 0.061-0.105 mSv. The measurements presented in this manuscript are the first to be conducted in the region of Pcinja, thus providing the results that can be used as a baseline for future measurements and monitoring.

Analysis of the influence of external factors on efficiency of use of resource potential and economic growth of the region

Directory of Open Access Journals (Sweden)

M. P. Vasiliev

2017-01-01

Full Text Available In the article are described and analyzed the influence of factors of external and internal environments on maintaining the planned economic growth, efficient use of the resource potential of the regional economic complex. Are provided methods of analysis and comprehensive measures to maintain the planned pace of economic growth of the region, expansion of competitive advantages. Enlargement and generalization determine the impact of economic environmental factors, in accordance with the duration of optimization and changes in the business cycle, provide a high level of confidence in the estimates of the impact of the macro environment on the process of achieving economic success, efficient use of the resource potential of the regional economic complex. Analysis of the internal conditions of region is carried out by management on the basis of establishing the optimal values of the distribution of the resource potential for high-priority, economically viable, and socially important areas of efficient use of logistical, labor, information, and natural resources, analysis of the current or having a tendency to the formation of informal communities in the sectoral components of economic activities, industrial complexes and social services. The possibilities of the availability and abilities of the region to influence the structural components in achieving the economic and financial goals of the activity are considered, including ensuring sustainable dynamics in increasing the efficiency of regional production, providing competitive advantages in the use of consumed resources. The factors proposed for consideration, different management of the regional economy, contribute to the creation of both formal and informal organizational and economic communities, taking into account the interests of all its participants. In addition, mechanisms and tools are proposed that facilitate the creation of favorable conditions for participants in informal clusters

Diet and Other Lifestyle Factors Associated with Prostate Cancer Differ Between the German and Italian Region of Switzerland.

Science.gov (United States)

Richard, Aline; Faeh, David; Bopp, Matthias; Rohrmann, Sabine

2017-12-08

In Switzerland, prostate cancer mortality is higher in the German than in the Italian-speaking region. We aimed at exploring the association of living in one of the two regions with lifestyle factors presumably lowering the risk of prostate cancer. We pooled data from the Swiss Health Survey, conducted every 5 years 1992 - 2012. Information on diet (meat, fish, dairy, fruits and vegetables), alcohol, smoking, physical activity and body mass index were dichotomized into "risky" and "risk-reducing" lifestyle behaviour with respect to prostate cancer. Multivariable logistic regression analyses were performed to assess associations between the German and Italian region of Switzerland and each single lifestyle factor. Living in the Italian region was associated with "risk-reducing" diet, i.e. with a higher prevalence of low dairy products and meat consumption and high fish consumption (odds ratio [OR] 1.34, 95% confidence interval [CI] 1.21 - 1.48; OR 3.31, 95% CI 2.94 - 3.72; OR 1.90, 95% CI 1.71 - 2.12, respectively). However, men in the Italian region were less likely to have low alcohol consumption and regular physical activity than men in the German region (OR 0.43, 95% CI 0.36 - 0.52 and OR 0.77, 95% CI 0.69 - 0.86, respectively). Prostate cancer risk-reducing dietary behaviour (i.e., less dairy products, less meat and more fish) was more common in the Italian region, whereas other risk-reducing lifestyle behaviours were more common in the German region.

The System-Supplementing Effect of the Interaction between Innovative Capacity and Institutional Environment Factors of a Region

Directory of Open Access Journals (Sweden)

Viktor Nikolayevich Ovchinnikov

2016-06-01

Full Text Available In the article, the effect of interaction between the development level of regional innovative capacity and its innovative and institutional infrastructure is traced. The research objective is to prove the hypothesis of the essential impact of the regional institutional and information environment on its innovative capacity, the identification of the effect of their systemsupplementing interaction. From the standpoint of the methodology of system-structural research its components are allocated within the innovative capacity of the regional innovative system (RIS, they are presented by a corporate sector, the structures of small and medium business, and also by the subjects of ethnic economy. The use of essential-analytical and functional approaches has revealed the leading role of intangible assets of the corporate sector of the economy in region’s innovative development. The correlation and regression analysis has confirmed the essential dependence of the innovative activity of the region on the systemic completeness of the development of its institutional and infrastructure environment. The results of the research have shown that to ensure the system-supplementing effect of the interaction between innovative capacity and the factors of its activation in the sphere of institutional infrastructure, it is necessary to consistently develop its operational base — the institutions of RIS. The recommendations reasoned in the article may be used for the development of regional innovation strategies, the formation of innovation clusters. The three-component structure of the innovation cluster of the region is offered; its integrating function in relation to the innovative components of the regional sectoral clusters is determined. The factors constraining the growth of innovation activity of the regional economic subjects are revealed and the recommendations on the development of the institutional and infrastructural environment of the Rostov

Sensitivity of extreme precipitation to temperature: the variability of scaling factors from a regional to local perspective

Science.gov (United States)

Schroeer, K.; Kirchengast, G.

2018-06-01

Potential increases in extreme rainfall induced hazards in a warming climate have motivated studies to link precipitation intensities to temperature. Increases exceeding the Clausius-Clapeyron (CC) rate of 6-7%/°C-1 are seen in short-duration, convective, high-percentile rainfall at mid latitudes, but the rates of change cease or revert at regionally variable threshold temperatures due to moisture limitations. It is unclear, however, what these findings mean in term of the actual risk of extreme precipitation on a regional to local scale. When conditioning precipitation intensities on local temperatures, key influences on the scaling relationship such as from the annual cycle and regional weather patterns need better understanding. Here we analyze these influences, using sub-hourly to daily precipitation data from a dense network of 189 stations in south-eastern Austria. We find that the temperature sensitivities in the mountainous western region are lower than in the eastern lowlands. This is due to the different weather patterns that cause extreme precipitation in these regions. Sub-hourly and hourly intensities intensify at super-CC and CC-rates, respectively, up to temperatures of about 17 °C. However, we also find that, because of the regional and seasonal variability of the precipitation intensities, a smaller scaling factor can imply a larger absolute change in intensity. Our insights underline that temperature precipitation scaling requires careful interpretation of the intent and setting of the study. When this is considered, conditional scaling factors can help to better understand which influences control the intensification of rainfall with temperature on a regional scale.

A Rare De novo Complex Chromosomal Rearrangement (CCR) Involving Four Chromosomes in An Oligo-asthenosperm Infertile Man.

Science.gov (United States)

Asia, Saba; Vaziri Nasab, Hamed; Sabbaghian, Marjan; Kalantari, Hamid; Zari Moradi, Shabnam; Gourabi, Hamid; Mohseni Meybodi, Anahita

2014-01-01

Complex chromosomal rearrangements (CCRs) are rare events involving more than two chromosomes and over two breakpoints. They are usually associated with infertility or sub fertility in male carriers. Here we report a novel case of a CCR in a 30-year-old oligoasthenosperm man with a history of varicocelectomy, normal testes size and normal endocrinology profile referred for chromosome analysis to the Genetics unit of Royan Reproductive Biomedicine Research Center. Chromosomal analysis was performed using peripheral blood lymphocyte cultures and analyzed by GTG banding. Additional tests such as C-banding and multicolor fluorescence in situ hybridization (FISH) procedure for each of the involved chromosomes were performed to determine the patterns of the segregations. Y chromosome microdeletions in the azoospermia factor (AZF) region were analyzed with multiplex polymerase chain reaction. To identify the history and origin of this CCR, all the family members were analyzed. No micro deletion in Y chromosome was detected. The same de novo reciprocal exchange was also found in his monozygous twin brother. The other siblings and parents were normal. CCRs are associated with male infertility as a result of spermatogenic disruption due to complex meiotic configurations and the production of chromosomally abnormal sperms. These chromosomal rearrangements might have an influence on decreasing the number of sperms.

Higher incidence of nasopharyngeal carcinoma in some regions in the world confers for interplay between genetic factors and external stimuli.

Science.gov (United States)

Roy Chattopadhyay, Nabanita; Das, Piyanki; Chatterjee, Koustav; Choudhuri, Tathagata

2017-01-01

Nasopharyngeal carcinoma (NPC) is a rare variety of head and neck cancers. The risk factors include three major causes: genetic factors, viral infection, and environmental and dietary factors. The types of NPC show strong ethnic and geographic variations. The keratinizing and non-keratinizing types are prevalent in the lower incidence regions like North America and Europe; whereas the undifferentiated type is mostly found in the regions with higher incidences like China, North Africa, Arctic, and Nagaland of North-East India. These suggest a possible major role of the internal genetic factors for generation and promotion of this disease. Viral infections might accelerate the process of carcinogenesis by helping in cellular proliferation and loss of apoptosis. Diet and other environmental factors promote these neoplastic processes and further progression of the disease occurs.

Site specific transfer factor studies for Kaiga region

International Nuclear Information System (INIS)

Karunakara, N.

2012-01-01

The Radioecology Laboratory of University Science Instrumentation Centre, Mangalore University is engaged in frontline research studies on different aspects of environmental radioactivity and radiation protection for the last 20 years. Extensive studies have been carried out on radiation levels, radionuclides distribution, and transfer of radionuclides through terrestrial, aquatic and atmospheric pathways in the environment of West Coast of India including the Kaiga nuclear power plant. The baseline studies on radioactivity levels around Kaiga region was carried out well before the nuclear power plant became operational and the data generated under these studies are considered to be highly valuable for future impact assessments. The nuclear power plant became operational in the year 1999 and since then this laboratory is involved in radiological impact assessment studies around the nuclear power plant. Detailed Kaiga specific studies are now ongoing to estimate the transfer factors and transfer coefficients for radionuclides for different pathways, such as, (i) soil to rice (ii) soil to different types of vegetables (iii) water/sediment to fish (iv) soil to grass (v) grass to cow milk and (vi) milk to child. For these studies, rice and vegetable fields were developed very close to the nuclear power plant in Kaiga to study the transfer of radionuclides. The water required for this field was drawn from coolant water discharge canal of the power plant. Rice and different types of vegetables were grown in the experimental fields in different seasons of the year and the uptake of radionuclides was studied. For a comparative study, rice and vegetables were also collected from the fields of farmers of nearby villages and analysed. The transfer of artificial radionuclides through pathway involving cow milk was also studied in detail. A grass field was developed and cows were adopted specifically for this study. The cows were allowed to graze freely in this grass field

Prevalence and Risk Factors of Diabetic Nephropathy in Omani Type 2 Diabetics in Al-Dakhiliyah Region

Directory of Open Access Journals (Sweden)

Abdulhakeem Hamood Alrawahi

2012-05-01

Full Text Available Objective: To assess the prevalence and risk factors of diabetic nephropathy among Omani type 2 diabetics in Al-Dakhiliyah region of the Sultanate of Oman.Methods: A cross-sectional and a case control study designs were used to assess the prevalence and risk factors respectively. For the prevalence study a sample of 699 diabetic subjects were selected randomly from two polyclinics in Al-Dakhiliyah region; Sumail and Nizwa polyclinics. For the case control study, a sample consisting of 215 cases and 358 controls were randomly selected from those who were included in the cross-sectional study. A well designed questionnaire has been used to collect data regarding the disease and risk factors. Data was analyzed using SPSS19 statistical program.Results: Total prevalence of diabetic nephropathy was calculated as 42.5% (95% C.I: 38.83% - 46.15%. The difference in the prevalence in the two polyclinic catchment area was not significant. The prevalence was significantly higher among males (51.6% compared to females (36.5%. Crude analysis of the risk factors showed significant association between diabetic nephropathy and the following factors; male gender, decreased literacy, long duration of diabetes mellitus, hypertension, retinopathy, neuropathy, family history of diabetic nephropathy, poor glycemic control (high HbA1c, and hypertriglyceridemia. Multivariate analysis showed the following factors to be independent risk factors; male gender, decreased literacy, long duration of diabetes, family history of diabetic nephropathy and poor glycaemic control (high HbA1c.Conclusion: The prevalence of diabetic nephropathy in this study was 42.5% and the significant risk factors associated with it included male gender, decreased literacy, long duration of diabetes, family history of diabetic nephropathy and poor glycemic control (high HbA1c.

Pro-region engineering for improved yeast display and secretion of brain derived neurotrophic factor.

Science.gov (United States)

Burns, Michael L; Malott, Thomas M; Metcalf, Kevin J; Puguh, Arthya; Chan, Jonah R; Shusta, Eric V

2016-03-01

Brain derived neurotrophic factor (BDNF) is a promising therapeutic candidate for a variety of neurological diseases. However, it is difficult to produce as a recombinant protein. In its native mammalian context, BDNF is first produced as a pro-protein with subsequent proteolytic removal of the pro-region to yield mature BDNF protein. Therefore, in an attempt to improve yeast as a host for heterologous BDNF production, the BDNF pro-region was first evaluated for its effects on BDNF surface display and secretion. Addition of the wild-type pro-region to yeast BDNF production constructs improved BDNF folding both as a surface-displayed and secreted protein in terms of binding its natural receptors TrkB and p75, but titers remained low. Looking to further enhance the chaperone-like functions provided by the pro-region, two rounds of directed evolution were performed, yielding mutated pro-regions that further improved the display and secretion properties of BDNF. Subsequent optimization of the protease recognition site was used to control whether the produced protein was in pro- or mature BDNF forms. Taken together, we have demonstrated an effective strategy for improving BDNF compatibility with yeast protein engineering and secretion platforms. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Epitope mapping of alpha-transforming growth factor: evidence of an immunodominant region

International Nuclear Information System (INIS)

Hazarika, P.; Dedman, J.R.

1988-01-01

Antisera were produced in rabbits and sheep against both full-length synthetic rat alpha-transforming growth factor and peptides corresponding to the carboxy-terminal 17 amino acids. These antisera were used to develop a peptide based radioimmunoassay of alpha-TGF. All antisera reacted only with a restricted region of the alpha-TGF corresponding to the 8 residues (43-50) at the carboxy-terminus: Cyslt. slash43, Glult. slash44, Hislt. slash45, Alalt. slash46, Asplt. slash47, Leult. slash48, Leult. slash49, Alalt. slash50. A series of synthetic peptides presenting deletions or substitutions of amino acids in this carboxy-terminal region were tested for competition with 125 I-alpha-TGF. All changes in the above peptide sequence resulted in a marked reduction in competition. All of the polyclonal antisera demonstrated similar specificity whether they were produced against the 50 amino acid, full-length alpha-TGF, against shorter 17 amino acid and 8 amino acid carboxy-terminal sequences

Epitope mapping of alpha-transforming growth factor: evidence of an immunodominant region

Energy Technology Data Exchange (ETDEWEB)

Hazarika, P.; Dedman, J.R.

1988-01-01

Antisera were produced in rabbits and sheep against both full-length synthetic rat alpha-transforming growth factor and peptides corresponding to the carboxy-terminal 17 amino acids. These antisera were used to develop a peptide based radioimmunoassay of alpha-TGF. All antisera reacted only with a restricted region of the alpha-TGF corresponding to the 8 residues (43-50) at the carboxy-terminus: Cyslt. slash43, Glult. slash44, Hislt. slash45, Alalt. slash46, Asplt. slash47, Leult. slash48, Leult. slash49, Alalt. slash50. A series of synthetic peptides presenting deletions or substitutions of amino acids in this carboxy-terminal region were tested for competition with /sup 125/I-alpha-TGF. All changes in the above peptide sequence resulted in a marked reduction in competition. All of the polyclonal antisera demonstrated similar specificity whether they were produced against the 50 amino acid, full-length alpha-TGF, against shorter 17 amino acid and 8 amino acid carboxy-terminal sequences.

Functional identification of an Arabidopsis snf4 ortholog by screening for heterologous multicopy suppressors of snf4 deficiency in yeast

DEFF Research Database (Denmark)

Kleinow, T.; Bhalerao, R.; Breuer, F.

2000-01-01

Yeast Snf4 is a prototype of activating gamma-subunits of conserved Snf1/AMPK-related protein kinases (SnRKs) controlling glucose and stress signaling in eukaryotes. The catalytic subunits of Arabidopsis SnRKs, AKIN10 and AKIN11, interact with Snf4 and suppress the snf1 and snf4 mutations in yeast....... By expression of an Arabidopsis cDNA library in yeast, heterologous multicopy snf4 suppressors were isolated. In addition to AKIN10 and AKIN11, the deficiency of yeast snf4 mutant to grown on non-fermentable carbon source was suppressed by Arabidopsis Myb30, CAAT-binding factor Hap3b, casein kinase I, zinc......-finger factors AZF2 and ZAT10, as well as orthologs of hexose/UDP-hexose transporters, calmodulin, SMC1-cohesin and Snf4. Here we describe the characterization of AtSNF4, a functional Arabidopsis Snf4 ortholog, that interacts with yeast Snf1 and specifically binds to the C-terminal regulatory domain...

Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions

Energy Technology Data Exchange (ETDEWEB)

MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi; Brown, James B.; Chu, Hou Cheng; Zeng, Lucy; Grondona, Brandi P.; Hechmer, Aaron; Simirenko, Lisa; Keranen, Soile V.E.; Knowles, David W.; Stapleton, Mark; Bickel, Peter; Biggin, Mark D.; Eisen, Michael B.

2009-05-15

BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of function and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.

Socioeconomic factors influencing childhood vaccination in two northern Italian regions.

Science.gov (United States)

Anello, Paola; Cestari, Laura; Baldovin, Tatjana; Simonato, Lorenzo; Frasca, Gabriella; Caranci, Nicola; Grazia Pascucci, Maria; Valent, Francesca; Canova, Cristina

2017-08-24

Infant vaccination rates have been declining in Italy over the past 5-7years. The aims of this study were to assess the trend in the proportions of children unvaccinated at 24months old, to identify sociodemographic factors associated with non-vaccination; and to examine changes in parental attitudes to vaccination over time. We conducted a population-based birth cohort study by combining existing electronic data sets. The study population consisted of children born from 1995 to 2010 in the Friuli-Venezia Giulia (FVG) region, and from 2007 to 2011 in part of the Emilia Romagna (ER) region, in north-eastern Italy. The immunization registers were linked with the medical birth registers, which contain sociodemographic data on both parents and the newborn. Unconditional logistic regressions were used to identify associations between vaccine uptake at 24months and maternal sociodemographic variables. Of 145,571 babies born in FVG and 75,308 in ER, there were 4222 (1.9%) who had not been vaccinated at all, and 23,948 (11.0%) without the optional measles, mumps and rubella (MMR) vaccination. The number of unvaccinated infants increased over time. Mothers who were over 35 or under 25years old, unmarried, with a higher formal education, and citizens of highly-developed countries were less compliant with vaccination recommendations in both the regions. A cohort effect was observed in FVG, for both educational level and citizenship: babies born between 1995 and 2000 to mothers without an Italian citizenship and with a lower formal education were more likely to refuse vaccination for their offspring, while this association was reversed between 2006 and 2010. Mothers who are Italian citizens and have a good formal education have begun to refuse vaccination for their children in recent years. Future public health action in this setting should target highly educated parents. Copyright © 2017. Published by Elsevier Ltd.

Risk factors of neural tube defects: A reality of Batna region in Algeria

Directory of Open Access Journals (Sweden)

Romyla Bourouba

2018-07-01

Full Text Available Background: Neural tube defects (NTDs are severe birth defects, with genetic and/or environmental risk factors. Aim: The objective of this study was to analyze data on NTDs cases at the Batna Maternity Hospital and to investigate some environmental and two genetic risk factors suspected in the etiology of NTDs. Subjects and methods: This study was conducted on 82 healthy participants and 48 mothers with an NTD child. Peripheral blood samples were collected, in EDTA tubes and frozen at −20 °C until DNA extraction by conventional method. Genetic analysis of methylene tetrahydrofolate reductase C677T polymorphism was determined by real time PCR, while cystathionine-beta-synthase 844 insertion was investigated by traditional PCR. Chi-square analyses were used to evaluate differences in the distribution of data. The odds-ratio was also calculated. A P-value less than 0.05 were significant. Results: The incidence of NTD in Batna region was 1.58 per 1000 births. The rate of NTD was significantly higher in females than males, highest affected NTD newborn’s was observed in mothers aged between 25 and 29 years and the consanguinity among all NTD cases was 30%. Data showed no significant association of NTDs with personal education, obesity, diabetes, but regarding folic acid consumption, about 86% of NTD’s mothers in our region didn’t take pre-conceptional supplementation with this vitamin .Genetic factors results didn't show a significant association of NTDs with specific mutations of the variant C677T MTHFR, and no gene-gene interaction of CBS insertion and C677T polymorphism was found, despite a significant difference in heterozygote frequency of CBS 844ins68 genotype between NTD’s mothers and controls, OR: 2.85(1.18–6.88. Conclusion: NTD represents a real public health problem in Batna, Algeria. Various genetic and/or nutritional factors are implicated, although the mechanism is not clear. We suggest that further research should continue

Regional patterns and controlling factors in plant species composition and diversity in Canadian lowland coastal bogs and laggs

Directory of Open Access Journals (Sweden)

S.A. Howie

2016-11-01

Full Text Available Inventories of natural assemblages of plant species are critical when planning ecological restoration of bogs. However, little is known about the regional variation in plant communities at the margins (laggs of bogs, even though they are an integral element of raised bog ecosystems. Therefore, we investigated the regional patterns in the plant communities of bogs and laggs, and the factors that control them, for thirteen bogs in coastal British Columbia, Canada. Species richness was significantly higher in the bogs and laggs of the cooler, wetter Pacific Oceanic wetland region. Beta Diversity analyses showed that bogs in the Pacific Oceanic wetland region often shared species with their respective laggs, whereas half of the laggs in the warmer, drier Pacific Temperate wetland region had no species in common with the adjacent bogs and were thus more ecologically distinct from the bog. Primary climatic variables, such as mean annual precipitation, mean annual temperature and latitude, as well as climate-influenced variables, such as pH, peat depth, and Na+ concentrations were the main correlates of plant species composition in the studied bogs. Site-specific factors, particularly depth to water table, and fraction of inorganic material in peat samples, were as strongly related to lagg plant communities as climate, while hydrochemistry appeared to have less influence.

Impact of Clinical Factors on the Achievement of Target Blood Pressure in Hypertensive Patients from Ivanovo Region of Russia: Data of 2015.

Science.gov (United States)

Kiselev, A R; Posnenkova, O M; Belova, O A; Romanchuk, S V; Popova, Y V; Prokhorov, M D; Gridnev, V I

2017-12-01

In Russia, blood pressure (BP) control is below the optimal. The little is known about regional features and barriers to adequate BP control in Russian primary care. To evaluate the impact of clinical factors on achieving the target BP in hypertensive patients in one region of Russia. Retrospective medical data of 2015 on 11,129 patients (31.4% male) with hypertension (Htn) from Ivanovo region of Russia were examined. Achievement of target BP was assessed in all patients. We study association between BP control and clinical factors. 45.9% of studied patients with Htn had controlled BP. The frequency of achieving the target BP in subsets of hypertensive patients was 37.8% in patients with diabetes, 39.5% in patients with coronary artery disease, and 29.9% in patients with chronic heart failure. The main clinical factors associated with achieving the target BP in studied hypertensive patients were the advice on alcohol consumption, advice on smoking cessation, and advice on weight reduction. Therapy with main antihypertensive drugs (in particular, beta-blockers and thiazide diuretics) were also factors of optimal BP control in these patients. Comorbidities (chronic heart failure and cardiovascular diseases requiring the prescription of aspirin and statins) and family history of coronary artery disease were associated with inadequate BP control. A negative effect of some antihypertensive drugs (potassium sparing diuretics, ARBs, ACE-Is, and dihydropyridine CCBs) on BP control that was found out in our study requires further investigation. Other studied factors had no influence on BP control in patients with Htn from Ivanovo region. We identified regional factors of BP control in hypertensive patients from Ivanovo region of Russia. It is shown that individual medical education (in particular, medical advices) is the most important factor of optimal BP control. The intervention with antihypertensive therapy (beta-blockers and thiazide diuretics) facilitates the

Non-communicable diseases in the Asia-Pacific region: Prevalence, risk factors and community-based prevention

Directory of Open Access Journals (Sweden)

Wah-Yun Low

2015-02-01

Full Text Available Non-communicable diseases (NCDs lead to substantial mortality and morbidity worldwide. The most common NCDs are cardiovascular diseases (CVD, diabetes, cancer and chronic respiratory diseases. With the rapid increase in NCD-related deaths in Asia Pacific countries, NCDs are now the major cause of deaths and disease burden in the region. NCDs hamper achievement of the Millennium Development Goals (MDG. People in the low socio-economic group are most affected by NCDs as they have poor access to policies, legislations, regulations and healthcare services meant to combat NCDs. This results in loss of productivity by a decreasing labor force with implications at the macroeconomic level. The 3 major NCDs in the Asia Pacific region are CVDs, cancer and diabetes due to the increasing loss of disability adjusted life years (DALYs. The 4 major behavioral risk factors for NCDs are: tobacco use, alcohol consumption, inadequate physical activity and unhealthy diet. The underlying risk factors are urbanization, globalization, sedentary lifestyle, obesity and hypertension. Strategies to combat NCDs in the Asia Pacific region are as follows: population-based dietary salt reduction, health education, psychological interventions, i.e., cognitive behavioral therapy and motivational-interviewing, taxation and bans on tobacco-related advertisements, implementing smoke-free zones and surveillance by the World Health Organization. Control measures must focus on prevention and strengthening inter-sectorial collaboration.

Factor analysis of regional brain activation in bipolar and healthy individuals reveals a consistent modular structure.

Science.gov (United States)

Fleck, David E; Welge, Jeffrey A; Eliassen, James C; Adler, Caleb M; DelBello, Melissa P; Strakowski, Stephen M

2018-07-01

The neurophysiological substrates of cognition and emotion, as seen with fMRI, are generally explained using modular structures. The present study was designed to probe the modular structure of cognitive-emotional processing in bipolar and healthy individuals using factor analysis and compare the results with current conceptions of the neurophysiology of bipolar disorder. Exploratory factor analysis was used to assess patterns of covariation among brain regions-of-interest activated during the Continuous Performance Task with Emotional and Neutral Distractors in healthy and bipolar individuals without a priori constraints on the number or composition of latent factors. Results indicated a common cognitive-emotional network consisting of prefrontal, medial temporal, limbic, parietal, anterior cingulate and posterior cingulate modules. However, reduced brain activation to emotional stimuli in the frontal, medial temporal and limbic modules was apparent in the bipolar relative to the healthy group, potentially accounting for emotional dysregulation in bipolar disorder. This study is limited by a relatively small sample size recruited at a single site. The results have yet to be validated on a larger independent sample. Although the modular structure of cognitive-emotional processing is similar in bipolar and healthy individuals, activation in response to emotional/neutral cues varies. These findings are not only consistent with recent conceptions of mood regulation in bipolar disorder, but also suggest that regional activation can be considered within tighter modular structures without compromising data interpretation. This demonstration may serve as a template for data reduction in future region-of-interest analyses to increase statistical power. Copyright © 2018 Elsevier B.V. All rights reserved.

Proposed measurement of the imaginary component of atomic form factor for medium Z-elements in regions exhibiting significant discrepancies

International Nuclear Information System (INIS)

De Jonge, M.; Dhal, B.B.; Tran, C.Q.; Barnea, Z.; Chantler, C.T.

2000-01-01

Full text: Discrepancies in measurements of the complex atomic form factor in regions of medium Z are alarmingly high for such a fundamental problem. The consequence of this is that any experiment reliant on the Beer-Lambert absorption law that uses the tabulated absorption coefficients assumes an immediate experimental uncertainty of 2-10%, depending on the element and the energy under consideration. We have begun to address this state of affairs in the medium Z-region through a series of precise determinations of attenuation coefficients. We will elaborate on a proposed method of measuring the atomic form factor to 0.2% absolute accuracy

Diversity of dietary habits in the population as important factor of the regional radioecological sensitivity

International Nuclear Information System (INIS)

Travnikova, I.; Bruk, G.; Shutov, V.

2001-01-01

The assessment of the ways and regularities of internal dose formation in the population is impossible without the determination of food consumption habits for the population residing in contaminated areas. Food habits of peoples inhabiting the former Soviet Union differ both due to historical reasons and to religious traditions. Variation of food consumption is an important factor of radio-ecological sensitivity of the population. We try to show this on the example of south-west districts of the Bryansk region contaminated as a result of the Chernobyl accident. In these regions, a set of countermeasures has been applied that strongly deformed traditional food consumption. (orig.)

Gene copy number reduction in the azoospermia factor c (AZFc) region and its effect on total motile sperm count

NARCIS (Netherlands)

Noordam, Michiel J.; Westerveld, G. Henrike; Hovingh, Suzanne E.; van Daalen, Saskia K. M.; Korver, Cindy M.; van der Veen, Fulco; van Pelt, Ans M. M.; Repping, Sjoerd

2011-01-01

The azoospermia factor c (AZFc) region harbors multi-copy genes that are expressed in the testis. Deletions of the AZFc region lead to reduced copy numbers of these genes. Four (partial) AZFc deletions have been described of which the b2/b4 and gr/gr deletions affect semen quality. In most studies,

Regional and national differences in stressful life events: The role of cultural factors, economic development, and gender.

Science.gov (United States)

Vázquez, José Juan; Panadero, Sonia; Martín, Rosa M

2015-07-01

The study analyzed differences in the risk of experiencing stressful life events (SLE) according to cultural factors, the level of economic development of the region inhabited, and gender. Information was gathered on the number and nature of SLE experienced by a sample of 604 undergraduates from 3 regions with very different levels of economic development: Madrid (Spain), León (Nicaragua), and Bilwi (Nicaragua). The results indicated a greater risk of experiencing SLE among undergraduates from Nicaragua, but few differences attributed to the undergraduates' gender or the level of economic development in the region they inhabit within the same country. (c) 2015 APA, all rights reserved).

A coccolithophore based view on paleoenvironmental changes in the open ocean mid-latitude North Atlantic between 130 and 48ka BP with special emphasis on MIS 5e

DEFF Research Database (Denmark)

Schwab, C.; Kinkel, Hanno; Weinelt, M.

2013-01-01

in coccolithophore assemblages and changes in the abundance of siliceous plankton (diatoms) indicate a southward shift of the Azores Front (AzF), and hence a southward retreat of the North Atlantic subtropical gyre, as well as an increased productivity, during glacial Marine Isotope Stage (MIS) 4, Termination II...... and during cold substages of MIS 5. Furthermore we hypothesize that the ecological changes led to distinct evolutionary patterns of coccolithophores, resulting e.g. in a dominance of Gephyrocapsa ornata between 76 and 105ka BP. Additionally, high-resolution analysis of MIS 5e indicate a short reversal...... towards cool conditions during MIS 5e, corresponding to a basin-wide cooling event. Full interglacial conditions are reached only late in the Azores region. During MIS 5e an increased advection of Subantarctic Mode Water (SAMW), and/or the possibility to occupy new habitats after glacial conditions...

Isoprene Emission Factors for Subtropical Street Trees for Regional Air Quality Modeling.

Science.gov (United States)

Dunn-Johnston, Kristina A; Kreuzwieser, Jürgen; Hirabayashi, Satoshi; Plant, Lyndal; Rennenberg, Heinz; Schmidt, Susanne

2016-01-01

Evaluating the environmental benefits and consequences of urban trees supports their sustainable management in cities. Models such as i-Tree Eco enable decision-making by quantifying effects associated with particular tree species. Of specific concern are emissions of biogenic volatile organic compounds, particularly isoprene, that contribute to the formation of photochemical smog and ground level ozone. Few studies have quantified these potential disservices of urban trees, and current models predominantly use emissions data from trees that differ from those in our target region of subtropical Australia. The present study aimed (i) to quantify isoprene emission rates of three tree species that together represent 16% of the inventoried street trees in the target region; (ii) to evaluate outputs of the i-Tree Eco model using species-specific versus currently used, generic isoprene emission rates; and (iii) to evaluate the findings in the context of regional air quality. Isoprene emission rates of (Myrtaceae) and (Proteaceae) were 2.61 and 2.06 µg g dry leaf weight h, respectively, whereas (Sapindaceae) was a nonisoprene emitter. We substituted the generic isoprene emission rates with these three empirical values in i-Tree Eco, resulting in a 182 kg yr (97%) reduction in isoprene emissions, totaling 6284 kg yr when extrapolated to the target region. From these results we conclude that care has to be taken when using generic isoprene emission factors for urban tree models. We recommend that emissions be quantified for commonly planted trees, allowing decision-makers to select tree species with the greatest overall benefit for the urban environment. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

Seasonality of livebirths and climatic factors in Italian regions (1863-1933

Directory of Open Access Journals (Sweden)

Gabriele Ruiu

2017-07-01

Full Text Available Birth seasonality is a phenomenon that characterizes almost all the populations of the world. In spite of this, the causes underlying these seasonal fluctuations represent an as yet unsolved puzzle. Two main theoretical approaches have been proposed to explain birth seasonality. The first encompasses a social explanation and emphasizes the role of social, economic and cultural factors in determining the optimal moment (from a social perspective for conception (e.g., according to the cycle of agricultural workload, religious festivity, marriage seasonality, etc.. The second theoretical approach encompasses an environmental explanation and focuses on the role that climatic factors (e.g., temperature, rainfall, light intensity, etc. play in determining the optimal moment of conception from a biological perspective. Our paper may be collocated in the latter strand of the literature. The aim is to investigate the effects of temperature on conceptions, and subsequently on the seasonality of livebirths, while controlling for a possible social confounding effect, i.e. the seasonal pattern of marriage. To achieve this end, we empirically investigate the role of temperature as well as that of marriage seasonality in Italian regions for the period stretching from the Italian unification to the eve of World War II. We find that extreme temperatures (both cold and hot negatively affect the number of births. At the same time, marriage seasonality also seems to be an important explicative factor of the seasonal fluctuation of live births.

Regional metallogenic essential factor of granite-type uranium deposits in Guangdong province

International Nuclear Information System (INIS)

Pan Yongzheng

1987-12-01

The uranium origin, activation region, red basin, and fault depressed zone constitute the regional metallogenic essential factor of the four united like one granite-type uranium deposits in the post-Caledonian rise area in China. In the development of sub-geosyncline in the Caledonian, the clastic formation with widely deposited carbon, silicon, mud rich bearing organic matter, which drow a great amount of uranium formed the uranium-bearing system in the Sinian-Cambrian period. The magmagranite activation in a large scale in the Indosinian-Yenshanian period caused the continental crust to be suffered strong reformation and the uranium-bearing basement system to be eroded and remelted, and formed the rich uranium granite body. The multiple structure-magmatic movement further made the uranium in the rock body suffered the endogenic, structure, supergene active reformation, and produced mobile uranium concentrated area. Under the dry and hot paleoclimate condition in the Cretaceous-Tertiary period, strong weathering and hot water leaching forced uranium to be concentrated into the 'rock origin activation' type uranium deposits in the fault depressed zone

Influence of region and site-specific factors on the degree of general validity of ecological and primary-energy-related assessments of biogas

International Nuclear Information System (INIS)

Dressler, Daniela

2015-01-01

As described in this publication, since the early 1990s numerous studies based on the life cycle assessment methodology have been dedicated to assessments of different kinds of bioenergy in comparison with fossil energy resources in terms of their energy balance and environmental impact. On reviewing the results of these studies one finds a strikingly wide range of variation. One major factor of influence on the results of life cycle assessments, besides methodological factors such as the choice of allocation method, is the representativeness of the data used. Thus, widely varying results are also obtained when balance calculations and assessments are performed on energy crops with due consideration to regional and site-specific factors. To address this problem the present study endeavoured to identify region and site-specific factors and assess them in terms of their influence on the life cycle assessment of the cultivation and conversion to biogas of different kinds of energy crops. For this purpose the following questions were explored: What influence do region, site and equipment-specific factors have on the results of ecological and primary-energy-related assessments; and how large are the differences in results between region and site-specific assessments on the one hand and assessments based on general assumptions on the other? It transpires that the results of region and site-specific assessments differ from one another in terms of both the assessment of energy cropping and the assessment of the entire process chain of biogas production and conversion to electricity.

Increasing the industrial potential of a region as a factor of improving the region’s competitiveness

Directory of Open Access Journals (Sweden)

Lidiya Viktorovna Shamray

2015-09-01

Full Text Available Objective to determine the factors of increasing the region competitiveness by defining the industrial potential of its enterprises. Methods in the research the systemic structural functional situational economic analysis was widely used as well as modelling of the economic entities functioning. The main modeling method used in this work is the model of breakeven point widely known and tested in many enterprises. The dependence proposed by the author is of analytical character. Results the article considers different approaches to the definition of competitiveness the effect of the factors is described. The industrial potential of the enterprises is presented as one of the factors of regional competitiveness. The difference is described between the competitive advantage in commercial and production activities. The author suggests a methodology allowing to evaluate the competitiveness of industrial enterprises through the performance of production capacity the possibility of making managerial decisions based on the results of its application the results of the model testing are present. The possibility of applying the model at the regional level is shown. Scientific novelty the article presents the authorrsquos method allowing to calculate the potential growth of the enterprises competitiveness using the output capacities as the difference between the maximum and actual values of capacity. Practical significance the use of models in the practice of the company allows to evaluate the enterprise competitiveness identifying the marginal productivity of the equipment. Once it has been reached the questions arise how long the company will remain competitive in achieving 100 capacity utilization selection of areas of extensive growth due to the fact that the limits of intensive growth have been achieved. Testing of the model was carried out at the Volgograd baking enterprises it showed a high accuracy of the calculation the deviation of calculated

Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

Science.gov (United States)

Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

2017-11-15

Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

Wind distribution and capacity factor estimation for wind turbines in the coastal region of South Africa

International Nuclear Information System (INIS)

Ayodele, T.R.; Jimoh, A.A.; Munda, J.L.; Agee, J.T.

2012-01-01

Highlights: ► We evaluate capacity factor of some commercially available wind turbines. ► Wind speed in the sites studied can best be modelled using Weibull distribution. ► Site WM05 has the highest wind power potential while site WM02 has the lowest. ► More wind power can be harnessed during the day period compared to the night. ► Turbine K seems to be the best turbine for the coastal region of South Africa. - Abstract: The operating curve parameters of a wind turbine should match the local wind regime optimally to ensure maximum exploitation of available energy in a mass of moving air. This paper provides estimates of the capacity factor of 20 commercially available wind turbines, based on the local wind characteristics of ten different sites located in the Western Cape region of South Africa. Ten-min average time series wind-speed data for a period of 1 year are used for the study. First, the wind distribution that best models the local wind regime of the sites is determined. This is based on root mean square error (RMSE) and coefficient of determination (R 2 ) which are used to test goodness of fit. First, annual, seasonal, diurnal and peak period-capacity factor are estimated analytically. Then, the influence of turbine power curve parameters on the capacity factor is investigated. Some of the key results show that the wind distribution of the entire site can best be modelled statistically using the Weibull distribution. Site WM05 (Napier) presents the highest capacity factor for all the turbines. This indicates that this site has the highest wind power potential of all the available sites. Site WM02 (Calvinia) has the lowest capacity factor i.e. lowest wind power potential. This paper can assist in the planning and development of large-scale wind power-generating sites in South Africa.

Population - A Critical Factor in the Formation of the Regional System of the Land of the Moţi

Directory of Open Access Journals (Sweden)

CRISTIAN NICOLAE BOŢAN

2009-01-01

Full Text Available “The Land of the Moţi” is a regional geographical entity where the impact of the anthropic component is essential. If, for a long period, the population has been a cohesion factor in the birth of this regional system, at present, by means of the negative features of the demographical indicators, the population stands out by inducing several elements of high risk. The massive emigration of the population, especially from the areas of high altitude, the gentrification process, the low degree of economic development, are all serious problems which must be on the agenda of the decision-making political factors.

URBAN LANDSCAPE QUALITY AND FACTORS THAT HAVE INFLUENCE ON LANDSCAPE QUALITY IN LATGALE REGION

OpenAIRE

Matisovs, Ivars

2005-01-01

The paper deals with urban landscape individualities in the cities and towns of Latgale region. Also show facilities and methods of integrated assessment of urban landscape quality. Article provides information about specifics of urban landscape and factors, that have influence on landscape quality. The paper presents the results of Daugavpils and Rēzekne urban landscape quality complex assessment, that have been realised in 2003- 2005. This results don’t establish significant disparities bet...

Anti-Tumor Necrosis Factor With a Glyco-Engineered Fc-Region Has Increased Efficacy in Mice With Colitis

NARCIS (Netherlands)

Bloemendaal, Felicia M.; Levin, Alon D.; Wildenberg, Manon E.; Koelink, Pim J.; Mcrae, Bradford L.; Salfeld, Jochen; Lum, Jenifer; van der Neut Kolfschoten, Marijn; Claassens, Jill W.; Visser, Remco; Bentlage, Arthur; D'Haens, Geert R. A. M.; Verbeek, J. Sjef; Vidarsson, Gestur; van den Brink, Gijs R.

2017-01-01

Although tumor necrosis factor (TNF) antagonists reduce many clinical features of inflammatory bowel disease, complete mucosal healing occurs in fewer than 50% of patients. The Fc-region of monoclonal antibodies against TNF has immunosuppressive properties via effects on macrophage polarization. We

Sheep gastrointestinal helminthiasis in the Sertão region of Paraíba State, Northeastern Brazil: prevalence and risk factors.

Science.gov (United States)

Vieira, Vanessa Diniz; Vilela, Vinícius Longo Ribeiro; Feitosa, Thais Ferreira; Athayde, Ana Célia Rodrigues; Azevedo, Sérgio Santos; Souto, Diego Vagner de Oliveira; Silveira, Gian Libânio da; Melo, Lídio Ricardo Bezerra de

2014-01-01

In this study, we aimed to establish the prevalence and risk factors relating to gastrointestinal helminthiasis, and to characterize the sanitary management practiced among sheep herds in the Sertão region of the state of Paraíba, northeastern Brazil, based on factors that condition the ways of controlling these parasites in these herds. The research was carried out between April and July 2012. We visited 54 farms, where fecal and blood samples were individually collected from 465 animals. On each farm, a questionnaire was applied to gather information on variables relating to potential risk factors. The prevalence of sheep gastrointestinal helminthiasis in the region was 75.9%. At least one animal tested positive for this helminthiasis on 53 (98.1%) of the 54 farms evaluated. The eggs per gram of feces (EPG) analysis showed the following infection burdens: 51.8% with mild infection, 27.1% moderate infection, 9.9% heavy infection and 11.2% fatal infection. Among the sheep farms visited, anthelmintics were used on 81.5% (p helminthiasis, because the animals are more prone to reinfection. The Sertão region of Paraíba presents high prevalence of gastrointestinal helminthiasis among sheep, and the farm area is the most relevant risk factor for the development of these parasites.

Analysis of regional total factor energy efficiency in China under environmental constraints: based on undesirable-minds and DEA window model

Science.gov (United States)

Zhang, Shuying; Li, Deshan; Li, Shuangqiang; Jiang, Hanyu; Shen, Yuqing

2017-06-01

With China’s entrance into the new economy, the improvement of energy efficiency has become an important indicator to measure the quality of ecological civilization construction and economic development. According to the panel data of Chinese regions in 1996-2014, the nearest distance to the efficient frontier of Undesirable-MinDS Xeon model and DEA window model have been used to calculate the total factor energy efficiency of China’s regions. Study found that: Under environmental constraints, China’s total factor energy efficiency has increased after the first drop in the overall 1996-2014, and then increases again. And the difference between the regions is very large, showing a characteristic of “the east is the highest, the west is lower, and lowest is in the central” finally, this paper puts forward relevant policy suggestions.

Expression and characterization of recombinant human factor V and a mutant lacking a major portion of the connecting region

International Nuclear Information System (INIS)

Kane, W.H.; Devore-Carter, D.; Ortel, T.L.

1990-01-01

Human coagulation factor V is a protein cofactor that is an essential component of the prothrombinase complex. A full-length factor V cDNA has been subcloned into the mammalian expression vector pDX and used to transfect COS cells. Approximately 95 ± 4% of the recombinant human factor V (rHFV) synthesized in COS cells is secreted into the culture medium. Factor V activity determined by fibrometer assay increased approximately 5-fold from 0.027 ± 0.012 to 0.124 ± 0.044 unit/mL following activation by the factor V activating enzyme from Russell's viper venom (RVV-V). A chromogenic assay specific for factor Va indicated that recombinant factor V had 3.8 ± 1.3% of the activity of the activated protein. The estimated specific activity of the recombinant factor Va was approximately 1,800 ± 500 units/mg, which is similar to the specific activity of purified plasma factor Va of 1,700-2,000 units/mg. Immunoprecipitation of [ 35 S]methionine-labeled rHFV revealed a single high molecular mass component. Treatment of rHFV with thrombin or RVV-V resulted in the formation of proteolytic products that were similar to those seen with plasma factor V. The authors have also expressed a mutant, rHFV-des-B 811-1441 , that lacks a large portion of the highly glycosylated connecting region that is present in factor V. This mutant constitutively expressed 38 ± 7% of the activity of the RVV-V-activated protein. These results suggest that one of the functions of the large connecting region in factor V is to inhibit constitutive procoagulant activity

Application of Geomorphologic Factors for Identifying Soil Loss in Vulnerable Regions of the Cameron Highlands

Directory of Open Access Journals (Sweden)

Kahhoong Kok

2018-03-01

Full Text Available The main purpose of this study is to propose a methodology for identifying vulnerable regions in the Cameron Highlands that are susceptible to soil loss, based on runoff aggregation structure and the energy expenditure pattern of the natural river basin, within the framework of power law distribution. To this end, three geomorphologic factors, namely shear stress and stream power, as well as the drainage area of every point in the basin of interest, have been extracted using GIS, and then their complementary cumulative distributions are graphically analyzed by fitting them to power law distribution, with the purpose of identifying the sensitive points within the basin that are susceptible to soil loss with respect to scaling regimes of shear stress and stream power. It is observed that the range of vulnerable regions by the scaling regime of shear stress is much narrower than by the scaling regime of stream power. This result seems to suggest that shear stress is a scale-dependent factor, which does not follow power law distribution and does not adequately reflect the energy expenditure pattern of a river basin. Therefore, stream power is preferred as a more reasonable factor for the evaluation of soil loss. The methodology proposed in this study can be validated by visualizing the path of soil loss, which is generated from the hillslope process (characterized by the local slope to the valley through a fluvial process (characterized by the drainage area as well as the local slope.

A systematic review of childhood obesity in the Middle East and North Africa (MENA) region: Prevalence and risk factors meta-analysis.

Science.gov (United States)

Farrag, Nesrine S; Cheskin, Lawrence J; Farag, Mohamed K

2017-01-01

Obesity rates are rising globally, but there is evidence that young people in the Middle East and North Africa (MENA) region are at particularly high risk. We systematically searched the literature to map the MENA region for prevalence of childhood overweight and obesity, and examine the underlying risk factors and adverse effects associated with obesity in this region. Inclusion criteria were: English-language, non-basic-science focused articles that used any of the standard obesity definitions and were conducted in the MENA countries within the last five years. We searched PubMed using combinations of key terms ((childhood) OR adolescence) AND obesity) AND (MENA or each country) AND ("last five years" [PDat]). Studies demonstrated an increasing prevalence of obesity among many countries in the MENA region, especially in the Gulf area. Notably, in Kuwait, prevalence rates of overweight and obesity were 25.6% and 34.8% among young males and 20.8% and 20.5% among females. A meta-analysis revealed that physical inactivity, increased screen time, and higher social status were risk factors for childhood obesity. Childhood and adolescent obesity is a major challenge facing countries of the MENA region. Further research is needed to fully investigate the role of nutrition and other specific risk factors and evaluate various interventions to manage this pervasive and growing health problem.

A case–control study of epidemiological factors associated with leptospirosis in South Gujarat region

Directory of Open Access Journals (Sweden)

K T Desai

2016-01-01

Full Text Available Background: The current study was planned to identify the epidemiological factors associated with leptospirosis in South Gujarat region using neighborhood controls. Methods: A total of 100 cases of leptospirosis occurred in South Gujarat region during the year 2012 were selected using simple random sampling. Three neighbors of the selected cases formed the controls (n = 300. A pretested structured questionnaire was used for data collection and data were analyzed using Epi Info 2007. Results: There was significant association of illiteracy (odds ratio [OR] =1.82, 95% confidence interval [CI] =1.14–2.89, working in waterlogged fields during the reference season (OR = 4.6, 95% CI = 1.6–17.9, swimming/bathing in canals, open air defecation practices, storage of cow dung in or surrounding house, residence in the house made up of cow dung walls, households with access of food to rodents, injuries over hands/foot during the endemic season (OR = 3, 95% CI = 1.8–4.8, and history of skin disease during the endemic season (OR = 4.2, 95% CI = 2–8.5, with leptospirosis. Only 10% of individuals had gumboots for protection. A total of 83 (83% cases and 240 (80% controls had taken oral doxycycline chemoprophylaxis (P > 0.05. Cases had taken chemoprophylaxis for a median 4 weeks (range: 1–8 while controls had taken the same for median 8 weeks (range = 1–8 (P < 0.002. Conclusions: Although the commonly established factors appear to be associated with leptospirosis, the role of host factors seems to play a more important role in determining susceptibility to leptospirosis in exposed individuals.

Controlling factors in the dynamics of soil organic carbon from the region of Murcia; Factores de control en la dinamica del Carbono Organico de los suelos de la Region de Murcia

Energy Technology Data Exchange (ETDEWEB)

Albaladejo, J.; Martinez-Mena, M.; Almagro, M.; Ruiz-navarro, A.; Ortiz, R.

2009-07-01

Sequestration and accumulation of C on the soil is a useful way to reduce the atmospheric concentration of CO{sub 2} and to mitigate the climate change. The purpose of this study was to identify the key factors which determine the accumulation and permanence of CO on the soils of the Murcia Region. The study was arranged from data displayed on the Murcia Region Soils Map (1:100.000). The results showed that quantity of stored CO in the 30cm superficial soil is significantly different depending on soil uses, soil type, altitude and texture. One conclusion is that changes from natural vegetation to cultivated soil are the greatest cause of losses of CO of soil. The increasing of altitude and proportion of thin-silt + clay contributes to CE accumulation. In altitude, the speed of mineralization of organic materials decreases, and the thin particles stimulate the physical protection and the chemical stabilization of CO of soil. (Author) 8 refs.

Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

KAUST Repository

Foley, Joseph W; Sidow, Arend

2013-01-01

BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF's direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF's motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

KAUST Repository

Foley, Joseph W

2013-10-20

BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF\\'s direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF\\'s motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

Factors Associated with the Utilization and Quality of Prenatal Care in Western Rural Regions of China

Science.gov (United States)

Dongxu, Wang; Yuhui, Shi; Stewart, Donald; Chun, Chang; Chaoyang, Li

2012-01-01

Purpose: The paper seeks to identify key features of prenatal care utilization and quality in western regions of China and to determine the factors affecting the quality of prenatal care. Design/methodology/approach: A descriptive, cross-sectional study was conducted. The instrument for the study was a 10-stem respondent-administered, structured…

Potential Risk Factors for the Onset of Complex Regional Pain Syndrome Type 1: A Systematic Literature Review

Directory of Open Access Journals (Sweden)

Tracey Pons

2015-01-01

Full Text Available Anaesthetists in the acute and chronic pain teams are often involved in treating Complex Regional Pain Syndromes. Current literature about the risk factors for the onset of Complex Regional Pain Syndrome Type 1 (CRPS 1 remains sparse. This syndrome has a low prevalence, a highly variable presentation, and no gold standard for diagnosis. In the research setting, the pathogenesis of the syndrome continues to be elusive. There is a growing body of literature that addresses efficacy of a wide range of interventions as well as the likely mechanisms that contribute to the onset of CRPS 1. The objective for this systematic search of the literature focuses on determining the potential risk factors for the onset of CRPS 1. Eligible articles were analysed, dated 1996 to April 2014, and potential risk factors for the onset of CRPS 1 were identified from 10 prospective and 6 retrospective studies. Potential risk factors for the onset of CRPS 1 were found to include being female, particularly postmenopausal female, ankle dislocation or intra-articular fracture, immobilisation, and a report of higher than usual levels of pain in the early phases of trauma. It is not possible to draw definite conclusions as this evidence is heterogeneous and of mixed quality, relevance, and weighting strength against bias and has not been confirmed across multiple trials or in homogenous studies.

Regional factors rather than forest type drive the community structure of soil living oribatid mites (Acari, Oribatida).

Science.gov (United States)

Erdmann, Georgia; Scheu, Stefan; Maraun, Mark

2012-06-01

Most European forests are managed by humans. However, the manner and intensity of management vary. While the effect of forest management on above-ground communities has been investigated in detail, effects on the below-ground fauna remain poorly understood. Oribatid mites are abundant microarthropods in forest soil and important decomposers in terrestrial ecosystems. Here, we investigated the effect of four forest types (i.e., managed coniferous forests; 30 and 70 years old managed beech forests; natural beech forests) on the density, diversity and community structure of oribatid mites (Acari). The study was replicated at three regions in Germany: the Swabian Alb, the Hainich and the Schorfheide. To relate changes in oribatid mite community structure to environmental factors, litter mass, pH, C and N content of litter, fine roots and C content of soil were measured. Density of oribatid mites was highest in the coniferous forests and decreased in the order 30 years old, 70 years old, and natural beech forests. Mass of the litter layer and density of oribatid mites were strongly correlated indicating that the litter layer is an important factor regulating oribatid mite densities. Diversity of oribatid mites was little affected by forest type indicating that they harbor similar numbers of niches. Species composition differed between the forest types, suggesting different types of niches. The community structure of oribatid mites differed more strongly between the three regions than between the forest types indicating that regional factors are more important than effects associated with forest type.

Prevalence and risk factors associated with Theileria parva infection in cattle in three regions of Tanzania

DEFF Research Database (Denmark)

Kerario, Isack I.; Simuunza, Martin C; Chenyambuga, Sebastian W

2017-01-01

of ECF in Tanzania has continued to be a challenge due to inadequate epidemiological information. The main objective of this study was to determine the epidemiological situation of Theileria parva infections in cattle kept under pastoral and agro-pastoral farming systems in Mara, Singida, and Mbeya...... not found to be significant predictors of being PCR positive for T. parva. The present study showed high variation in tick burden and T. parva prevalence across the regions. Therefore, different strategic planning and cost-effective control measures for ticks and T. parva infection should be implemented...... regions of Tanzania. Blood samples were collected from 648 cattle in the three regions. Genomic DNA was extracted and amplified in a polymerase chain reaction (PCR) using T. parva-specific primers targeting the 104-kD antigen (P104) gene. In addition, information was collected on the possible risk factors...

Crew Factors in Flight Operations XIV: Alertness Management in Regional Flight Operations Education Module

Science.gov (United States)

Rosekind, Mark R.; Co, Elizabeth L.; Neri, David F.; Oyung, Raymond L.; Mallis, Melissa M.

2002-01-01

Regional operations encompass a broad range of pilots and equipment. This module is intended to help all those involved in regional aviation, including pilots, schedulers, dispatchers, maintenance technicians, policy makers, and others, to understand the physiological factors underlying fatigue, how flight operations affect fatigue, and what can be done to counteract fatigue and maximize alertness and performance in their operations. The overall purpose of this module is to promote aviation safety, performance, and productivity. It is intended to meet three specific objectives: (1) to explain the current state of knowledge about the physiological mechanisms underlying fatigue; (2) to demonstrate how this knowledge can be applied to improving flight crew sleep, performance, and alertness; and (3) to offer strategies for alertness management. Aviation Safety Reporting System (ASRS) and National Transportation Safety Board (NISH) reports are used throughout this module to demonstrate that fatigue is a safety issue in the regional operations community. The appendices at the end of this module include the ASRS reports used for the examples contained in this publication, brief introductions to sleep disorders and relaxation techniques, summaries of relevant NASA publications, and a list of general readings on sleep, sleep disorders, and circadian rhythms.

Comparison of influencing factors on outcomes of single and multiple road traffic injuries: A regional study in Shanghai, China (2011-2014.

Directory of Open Access Journals (Sweden)

Wenya Yu

Full Text Available To identify key intervention factors and reduce road traffic injury (RTI-associated mortality, this study compared outcomes and influencing factors of single and multiple road traffic injuries (RTIs in Shanghai.Based on the design of National Trauma Data Bank, this study collected demographic, injury, and outcome data from RTI patients treated at the four largest trauma centers in Shanghai from January 2011 to January 2015. Data were analyzed with descriptive statistics, univariate analysis, and hierarchical logistic regression analysis.Among 2397 participants, 59.4% had a single injury, and 40.6% had multiple injuries. Most patients' outcome was cure or improvement. For single-RTI patients, length of stay, body region, central nervous system injury, acute renal failure, multiple organ dysfunction syndrome, bacterial infection, and coma were significantly related to outcome. For multiple-RTI patients, age, admission pathway, prehospital time, length of stay, number of body regions, body region, injury condition, injury severity score, and coma were significantly related to outcome.Emergency rescue in road traffic accidents should focus on high-risk groups (the elderly, high-incidence body regions (head, thorax, pelvis and number of injuries, injury condition (central nervous system injury, coma, complications, admission pathway, injury severity (critically injured patients, and time factors (particularly prehospital time.

Global and regional effects of potentially modifiable risk factors associated with acute stroke in 32 countries (INTERSTROKE)

DEFF Research Database (Denmark)

O'Donnell, Martin J; Chin, Siu Lim; Rangarajan, Sumathy

2016-01-01

BACKGROUND: Stroke is a leading cause of death and disability, especially in low-income and middle-income countries. We sought to quantify the importance of potentially modifiable risk factors for stroke in different regions of the world, and in key populations and primary pathological subtypes o...

Association of climatic factors with infectious diseases in the Arctic and subarctic region--a systematic review.

Science.gov (United States)

Hedlund, Christina; Blomstedt, Yulia; Schumann, Barbara

2014-01-01

The Arctic and subarctic area are likely to be highly affected by climate change, with possible impacts on human health due to effects on food security and infectious diseases. To investigate the evidence for an association between climatic factors and infectious diseases, and to identify the most climate-sensitive diseases and vulnerable populations in the Arctic and subarctic region. A systematic review was conducted. A search was made in PubMed, with the last update in May 2013. Inclusion criteria included human cases of infectious disease as outcome, climate or weather factor as exposure, and Arctic or subarctic areas as study origin. Narrative reviews, case reports, and projection studies were excluded. Abstracts and selected full texts were read and evaluated by two independent readers. A data collection sheet and an adjusted version of the SIGN methodology checklist were used to assess the quality grade of each article. In total, 1953 abstracts were initially found, of which finally 29 articles were included. Almost half of the studies were carried out in Canada (n=14), the rest from Sweden (n=6), Finland (n=4), Norway (n=2), Russia (n=2), and Alaska, US (n=1). Articles were analyzed by disease group: food- and waterborne diseases, vector-borne diseases, airborne viral- and airborne bacterial diseases. Strong evidence was found in our review for an association between climatic factors and food- and waterborne diseases. The scientific evidence for a link between climate and specific vector- and rodent-borne diseases was weak due to that only a few diseases being addressed in more than one publication, although several articles were of very high quality. Air temperature and humidity seem to be important climatic factors to investigate further for viral- and bacterial airborne diseases, but from our results no conclusion about a causal relationship could be drawn. More studies of high quality are needed to investigate the adverse health impacts of weather and

A panel data parametric frontier technique for measuring total-factor energy efficiency: An application to Japanese regions

International Nuclear Information System (INIS)

Honma, Satoshi; Hu, Jin-Li

2014-01-01

Using the stochastic frontier analysis model, we estimate TFEE (total-factor energy efficiency) scores for 47 regions across Japan during the years 1996–2008. We extend the cross-sectional stochastic frontier model proposed by Zhou et al. (2012) to panel data models and add environmental variables. The results provide not only the TFEE scores, in which statistical noise is taken into account, but also the determinants of inefficiency. The three stochastic TFEE scores are compared with a TFEE score derived using data envelopment analysis. The four TFEE scores are highly correlated with one another. For the inefficiency estimates, higher manufacturing industry shares and wholesale and retail trade shares correspond to lower TFEE scores. - Highlights: • This study estimates total-factor energy efficiency of Japanese regions using the stochastic frontier analysis model. • Determinants of inefficiency are also estimated. • The higher the manufacturing share and wholesale and retail trade share, the lower the energy efficiency

Plant safety in France 2000 until 2010; Anlagensicherheitspolitik in Frankreich 2000 bis 2010

Energy Technology Data Exchange (ETDEWEB)

Vallee, Agnes; Affeltranger, Bastien; Descourriere, Sandrine; Oger, Florence; Duval, Christophe; Gaucher, Rodolphe [Institut National de l' Environnement Industriel et des Risques (INERIS), 60 - Verneuil-en-Halatte (France)

2013-03-15

The study on the safety of industrial plants on France covers the following issues: The explosion in the operational area of AZF (plant Grande Paroisse) and the consequences; classified installations; the players of accident risks in France; realization of the accident prevention policy in France from 2000 to 2010; prevention of natural risks and consideration of these risks on the level of classified installations (NATECH accidents) in France from 2000 to 2010; further specific topics; actual activities and developments.

A boy with 46,X,+mar presenting gynecomastia and short stature

Directory of Open Access Journals (Sweden)

Ki Eun Kim

2017-12-01

Full Text Available A 15-year-old boy was referred due to gynecomastia and short stature. He was overweight and showed the knuckle-dimple sign on the left hand, a short fourth toe on the left foot, and male external genitalia with a small phallus. His levels of estradiol and follicle-stimulating hormone were increased, and his testosterone concentration was normal. Other hormonal tests were within the normal range. Radiographs showed short fourth and fifth metacarpals and fourth metatarsal bones. The karyotype was reported as 46,X,+mar, and the marker chromosome was shown to originate from the Y chromosome, which was identified by fluorescence in situ hybridization. Polymerase chain reaction and direct sequencing were used to clarify the deleted loci of the Y chromosome by making use of Y-specific sequence-tagged sites (STSs. The sex-determining region Y and centromere were verified, and there were microdeletions on the long arm of the Y chromosome. The azoospermia factor (AZF b region was partially deleted, and AZFa and AZFc were completely deleted. Two STS probes of sY143 and the Y chromosome RNA recognition motif in AZFb showed positive signals corresponding to Yq11.223. The karyotype of the patient was interpreted as 46,X,der(Ydel(Y(q11.21q11.222del(Y(q11.23qter. Herein, we report a rare case of a boy presenting with gynecomastia and short stature with 46, X, +mar, which originated from the Y chromosome, which was identified to have Yq microdeletions.

Y Choromosomal Microdeletion Screening in The Workup of Male Infertility and Its Current Status in India

Directory of Open Access Journals (Sweden)

Ramaswamy Suganthi

2014-01-01

Full Text Available Spermatogenesis is an essential stage in human male gamete development, which is regulated by many Y chromosome specific genes. Most of these genes are centred in a specific region located on the long arm of the human Y chromosome known as the azoospermia factor region (AZF. Deletion events are common in Y chromosome because of its peculiar structural organization. Astonishingly, among the several known genetic causes of male infertility, Y chromosomal microdeletions emerged as the most frequent structural chromosome anomaly associated with the quantitative reduction of sperm. The development of assisted reproductive techniques (ART like intra-cytoplasmic sperm injection (ICSI and testicular sperm extraction (TESE helps to bypass the natural barriers of fertilization, but it increases the concern about the transmission of genetic defects. Experimental evidence suggested that the men with Y chromosomal microdeletions vertically transmitted their deletion as well as related fertility disorders to their offspring via these ART techniques. In India, infertility is on alarming rise. ART centres have opened up in virtually every state but still most of the infertility centres in India do not choose to perform Y chromosomal microdeletion diagnosis because of some advanced theoretical reasons. Moreover, there is no consensus among the clinicians about the diagnosis and management of Y chromosomal microdeletion defects. The current review discusses thoroughly the role of Y chromosome microdeletion screening in the workup of male infertility, its significance as a diagnostic test, novel approaches for screening Y deletions and finally a systematic review on the current status of Y chromosome microdeletion deletion screening in India.

[Prevalence and risk factors for urinary incontinence in women living in the South Priaralye region].

Science.gov (United States)

Gaibullaev, A A; Iskandarova, G T; Abdurizaev, A A

2016-04-01

To estimate prevalence and types of urinary incontinence (UI) among women living in the South Priaralye region, and to analyze risk factors associated with UI. The population-based study was conducted by nested-typological method. Analysis was carried out on the data of 1487 women collected by a standard ICIQ-SF questionnaire, an assessment tool for female urinary incontinence recommended by the European Association of Urology. The study showed that the prevalence of UI among women aged 18 years and older in the South Priaralye region was 27%. The predominant type of the disease was stress UI since in 44.8% of women, the uncontrolled urine loss occurred during exercise. In 16.1% of women urgent type UI was observed, and in 38.6% mixed type of UI was found. The most significant risk factors for UI were recurrent urinary tract infection (odds ratio (OR) of 5.9 (95% confidence interval (CI) 4.12-8.38), gynecological disease (OR 2.7 (95% CI 1.99-3.59), enuresis in childhood (OR 2.4 (95% CI 1.21-4.88), constipation (OR = 2.1 (95% CI 1.45-2.93) the number of births (OR = 1.2 (95% CI 1,05-1.28), and occupation, namely work involving physical strain (odds ratio of 1.2 (95% CI 1.04-1.43). In the area of the South Priaralye, more than a fourth of adult females were found to have a UI. Understanding the nature and risk factors for UI will allow planning the resources required to provide treatment and preventive measures in the future.

Investigation of factors influencing the formation of the middle class on the territory of regions of Capital socio-geographical area

Directory of Open Access Journals (Sweden)

Julia Pereguda

2017-10-01

Full Text Available The article stated that to determine the specifics of a middle class it is necessary to apply economic and mathematical methods allowing one to display a certain proportion and sometimes qualitative patterns of distribution of different forms and types of settlement and problems that are investigated. The key components of each factor can be determined based on the analysis of factor analysis and the indicators playing a major role in shaping sets of factors can be shown based on a factor variance. The spatial organization of society in this research study has been noted to have a multi-level character, because it is going to cover the territory within the regions and the accommodation of diverse population on it will include spatial distribution of various types of economic activity and economic indicators. In this study, the special attention has been paid to economic poverty to determine the boundaries of the middle class, and conduction of more accurate inequality of economic indicators in the regions. The regional specifics of the Capital socio-geographical area has been conducted through socio-geographical approach aimed at disclosing the middle class. Based on statistical data systematization, the analysis has been conducted due to the matrix factorization of selected indicators intercorrelation. It has been noted that the study of the middle class from the standpoint of social geography as spatially conditioned phenomenon requires the formulation of methodological regulations, it defines procedures for research highlighting the main stages, and it studies the techniques and methods of forming the system of scientific research to further disclosure issues.

Social and human capital as determining factors of entrepreneurship in the Spanish Regions

Directory of Open Access Journals (Sweden)

Isabel Neira

2013-01-01

Full Text Available Entrepreneurship, innovation and creativity are considered key factors of the economic growth because they usually bring on behaviors aligned with the market development, productivity and social cohesion. This study aims to analyze the factors that influence the entrepreneurial role, and provide a better understanding of this behavior from a dynamic perspective, in order to support policies for encouraging entrepreneurship. To do this we used the data presented in the report of the Global Entrepreneurship Monitor (GEM, in its 2011 edition, which is based on an empirical analysis of a sample of 27,000 Spanish citizens.The results confirm that the perception of market opportunities, and having the skills and knowledge required to create new companies are explanatory factors of the entrepreneurial activity. However, it is also possible to assert that the increase of the entrepreneurial activity rate motivated by the need of self-employment of the entrepreneur influences the increase of fear of failure, and this could generate a dynamic harmful to the business creation in the medium term.Our model aims to support the decisions of public institutions about the incentive measures for entrepreneurs. This work contributes to the study of entrepreneurship and business creation from a multidisciplinary perspective, incorporating psychological, sociological and economic approaches from a dynamic perspective. It also allows an in-depth analysis of factors undetected with other methodologies.We examined the determining factors of entrepreneurship by estimating a logit model based on entrepreneur’s social capital (networking and the geographical location (region of the business activity. This analysis has shown significant differences of these factors according to the stage of the entrepreneurial process. These results have let discuss the implications for the entrepreneurial dynamic, in order to support new policies in favor of entrepreneurship.

Shaping Regional Strategies of Multinational Corporations

DEFF Research Database (Denmark)

Gilbert, Dirk Ulrich; Heinicke, Patrick; Rasche, Andreas

This paper examines the factors that drive the success of multinational corporations (MNCs) in their pursuit of regional strategies. We develop a comprehensive regional success factor model to investigate the effects of regional management autonomy and regional product/service adaption...... management autonomy and regional product/service adaption are higly contingent upon contextual influences on MNCs....

Environmental and spatial factors influencing the distribution of cladocerans in lakes across the central Canadian Arctic treeline region

Directory of Open Access Journals (Sweden)

John P. SMOL

2010-02-01

Full Text Available We examine the role of local environmental and spatial factors in explaining variation in the composition of cladoceran assemblages from surface sediments within a set of 50 lakes spanning a broad southwest to northeast transect across the central Canadian Arctic treeline region from Yellowknife (Northwest Territories to the northern boundary of the Thelon Game Sanctuary (Nunavut Territory. Within each lake, the cladoceran fauna was identified based on the subfossil exoskeletal remains preserved in recently deposited lake sediments. Physical and chemical limnological data were measured in August of 1996 and 1998. Spatial data were generated based on latitude and longitude using Principal Coordinates of Neighbors Matrices analysis (PCNM. The relationships between cladocerans and the measured environmental and spatial variables were examined using both unconstrained (Principal Components Analysis, PCA and constrained (Redundancy Analysis, RDA ordination techniques. Variance partitioning, based on partial RDAs, was used to identify the relative importance of significant environmental and spatial explanatory variables. Three environmental variables were identified as significantly influencing cladoceran community structure: surface water temperature, dissolved organic carbon (DOC, and total phosphorus (TP. Five PCNM-generated spatial variables were also significant in explaining cladoceran distributions. Variance partitioning attributed 14% of the variance in the distribution of Cladocera to spatial factors, an additional 10% to spatially-structured environmental variables, and 8% to environmental factors that were not spatially-structured. Within the central Canadian Arctic treeline region, spatial and other environmental processes had an important influence on the distribution of cladoceran communities. The strong influence of spatial factors was related to the large ecoclimatic gradient across treeline. The distribution patterns of cladocerans

Relationships between carbon fluxes and environmental factors in a drip-irrigated, film-mulched cotton field in arid region

OpenAIRE

Li, Xiaoyu; Liu, Lijuan; Yang, Huijin; Li, Yan

2018-01-01

Environmental factors and human activities play important roles in carbon fixation and emissions generated from croplands. Eddy covariance measurements in a drip-irrigated, film-mulched cotton field were used to analyze the relationships between carbon fluxes and environmental factors in Wulanwusu, northern Xinjiang, an arid region of Northwest China. Our results showed that the cumulative net carbon flux (NEE) was -304.8 g C m-2 (a strong sink) over the whole cotton growing season in 2012, w...

Examining significant factors in micro and small enterprises performance: case study in Amhara region, Ethiopia

Science.gov (United States)

Cherkos, Tomas; Zegeye, Muluken; Tilahun, Shimelis; Avvari, Muralidhar

2017-07-01

Furniture manufacturing micro and small enterprises are confronted with several factors that affect their performance. Some enterprises fail to sustain, some others remain for long period of time without transforming, and most are producing similar and non-standard products. The main aim of this manuscript is on improving the performance and contribution of MSEs by analyzing impact of significant internal and external factors. Data was collected via a questionnaire, group discussion with experts and interviewing process. Randomly selected eight representative main cities of Amhara region with 120 furniture manufacturing enterprises are considered. Data analysis and presentation was made using SPSS tools (correlation, proximity, and T test) and impact-effort analysis matrix tool. The correlation analysis shows that politico-legal with infrastructure, leadership with entrepreneurship skills and finance and credit with marketing factors are those factors, which result in high correlation with Pearson correlation values of r = 0.988, 0.983, and 0.939, respectively. The study investigates that the most critical factors faced by MSEs are work premises, access to finance, infrastructure, entrepreneurship and business managerial problems. The impact of these factors is found to be high and is confirmed by the 50% drop-out rate in 2014/2015. Furthermore, more than 25% work time losses due to power interruption daily and around 65% work premises problems challenged MSEs. Further, an impact-effort matrix was developed to help the MSEs to prioritize the affecting factors.

The Value Chains of High-Technology Products as Factor of formation the Regional Comprehensive Economic Partnership

Directory of Open Access Journals (Sweden)

Irina A. Safronova

2016-01-01

Full Text Available This article analyzes the value chain of high-tech products in Asia and the role of this phenomenon in the further consolidation of trade blocs and alliances in the region. The presence of these chains and their gradual transition from a vertically integrated model to a system of horizontal linkages and interdependence leads to the formation of mechanisms of economic de-facto integration (so-called regionalization process. The East Asian region has demonstrated unprecedented high rates of economic growth in recent decades. The countries are actively developing mechanisms of multilateral cooperation, involving partners from across the Asia-Pacific region. Particular features of a new regional architecture of economic relations are becoming more tangible, and the essential element of this architecture is the intra-regional integration. The author presents an assessment of further developments of the Regional comprehensive economic partnership (RCEP using the structural-functional approach and analytical instruments of the international political economy, The creation of this trade block will help less advanced countries of ASEAN to accelerate economic growth and improve the conditions for integration into global value chains. For advanced economies, participation in the RCEP seems controversial, because production chains have well-established formats within the framework of ASEAN +. The political standoff between Washington and Beijing has an impact on dynamics of regional integration. The split among the East Asian countries was galvanized by the Trans-Pacific Partnership Project (TTP, because TPP has objectives that are very similar to those of RCEP (trade liberalization and economic integration. The author concludes that the extension of this partnership in the ASEAN countries can seriously complicate the operation RVEP and enhance the impact of political factors on economic cooperation. In this case, the value of production and supply chains

Factors affecting groundnut yield in pothwar region of Punjab, Pakistan

International Nuclear Information System (INIS)

Qasim, M.; Tariq, S.A.; Nasir, M.; Saeed, R.; Mahmood, M.A.

2016-01-01

Groundnut being an important oilseed crop in the Pothwar region of Pakistan has the productivity level of 609 kg ha/sup -1/ , much lower from the potential yield of 3000 kg ha/sup -1/. Present study was designed to explore factors affecting productivity of groundnut along with its profitability analysis. The sample farms were classified into small, medium and large farms. Farm-level crop data were gathered during two cropping seasons i.e., rabi 2008-09 and kharif 2009. One hundred and forty groundnut producers were selected for collecting data using the well-structured questionnaire from two important districts recognised for area and production of groundnut. Results showed that large farmers allocated significantly higher area (34 percent) to groundnut cultivation compared to other categories of farmers. The gross margins were also significantly higher at large farms. Ploughing frequency, seed rate and labor man-days have positive relationship with groundnut productivity. Therefore, the provision of improved groundnut production technologies package and improved seed to groundnut growers may enhance the productivity and area under this crop. (author)

Controlling factors in the dynamics of soil organic carbon from the region of Murcia

International Nuclear Information System (INIS)

Albaladejo, J.; Martinez-Mena, M.; Almagro, M.; Ruiz-navarro, A.; Ortiz, R.

2009-01-01

Sequestration and accumulation of C on the soil is a useful way to reduce the atmospheric concentration of CO 2 and to mitigate the climate change. The purpose of this study was to identify the key factors which determine the accumulation and permanence of CO on the soils of the Murcia Region. The study was arranged from data displayed on the Murcia Region Soils Map (1:100.000). The results showed that quantity of stored CO in the 30cm superficial soil is significantly different depending on soil uses, soil type, altitude and texture. One conclusion is that changes from natural vegetation to cultivated soil are the greatest cause of losses of CO of soil. The increasing of altitude and proportion of thin-silt + clay contributes to CE accumulation. In altitude, the speed of mineralization of organic materials decreases, and the thin particles stimulate the physical protection and the chemical stabilization of CO of soil. (Author) 8 refs.

Risk factors associated with default among new pulmonary TB patients and social support in six Russian regions.

Science.gov (United States)

Jakubowiak, W M; Bogorodskaya, E M; Borisov, S E; Borisov, E S; Danilova, I D; Danilova, D I; Kourbatova, E V; Kourbatova, E K

2007-01-01

Tuberculosis (TB) services in six Russian regions in which social support programmes for TB patients were implemented. To identify risk factors for default and to evaluate possible impact of social support. Retrospective study of new pulmonary smear-positive and smear-negative TB patients registered during the second and third quarters of the 2003. Data were analysed in a case-control study including default patients as cases and successfully treated patients as controls, using multivariate logistic regression modelling. A total of 1805 cases of pulmonary TB were enrolled. Default rates in the regions were 2.3-6.3%. On multivariate analysis, risk factors independently associated with default outcome included: unemployment (OR 4.44; 95%CI 2.23-8.86), alcohol abuse (OR 1.99; 95%CI 1.04-3.81), and homelessness (OR 3.49; 95%CI 1.25-9.77). Social support reduced the default outcome (OR 0.13; 95%CI 0.06-0.28), controlling for age, sex, region, residence and acid-fast bacilli (AFB) smear of sputum. Unemployment, alcohol abuse and homelessness were associated with increased default outcome among new TB patients, while social support for TB patients reduced default. Further prospective randomised studies are necessary to evaluate the impact and to determine the most cost-effective social support for improving treatment outcomes of TB in patients in Russia, especially among populations at risk of default.

Prevalence of porcine cysticercosis and associated risk factors in smallholder pig production systems in Mbeya region, southern highlands of Tanzania

DEFF Research Database (Denmark)

Komba, Erick V. G.; Kimbi, Eliakunda C.; Ngowi, Helena A.

2013-01-01

in smallholder pig production systems in Mbeya region, the major pig rearing region of Tanzania. A cross-sectional survey employing a random sample of 300 pig keepers from 30 villages of Mbozi and Mbeya Rural districts, Mbeya region were used to evaluate pig production systems and practices. Concurrently, 600...... of water from rivers (OR=3.1; 95% CI=1.6-6.3; p... of important risk factors in smallholder pig management that may be addressed (e.g. confinement, quality of pens and water sources) in future interventions and educational campaigns for control of T. solium....

Regional spore dispersal as a factor in disease risk warnings for potato late blight: A proof of concept

NARCIS (Netherlands)

Skelsey, P.; Kessel, G.J.T.; Holtslag, A.A.M.; Moene, A.F.; Werf, van der W.

2009-01-01

This study develops and tests a novel approach for including regional risk factors in operational disease risk warnings against potato late blight. The central premise is that fungicide inputs can be reduced by omitting applications on days when conditions are unsuitable for the atmospheric

Regional spore dispersal as a factor in disease risk warnings for potato late blight : A proof of concept

NARCIS (Netherlands)

Skelsey, P.; Kessel, G. J. T.; Holtslag, A. A. M.; Moene, A. F.; van der Werf, W.

2009-01-01

This study develops and tests a novel approach for including regional risk factors in operational disease risk warnings against potato late blight. The central premise is that fungicide inputs can be reduced by omitting applications on days when conditions are unsuitable for the atmospheric

Spectral damping scaling factors for shallow crustal earthquakes in active tectonic regions

Science.gov (United States)

Rezaeian, Sanaz; Bozorgnia, Yousef; Idriss, I.M.; Campbell, Kenneth; Abrahamson, Norman; Silva, Walter

2012-01-01

Ground motion prediction equations (GMPEs) for elastic response spectra, including the Next Generation Attenuation (NGA) models, are typically developed at a 5% viscous damping ratio. In reality, however, structural and non-structural systems can have damping ratios other than 5%, depending on various factors such as structural types, construction materials, level of ground motion excitations, among others. This report provides the findings of a comprehensive study to develop a new model for a Damping Scaling Factor (DSF) that can be used to adjust the 5% damped spectral ordinates predicted by a GMPE to spectral ordinates with damping ratios between 0.5 to 30%. Using the updated, 2011 version of the NGA database of ground motions recorded in worldwide shallow crustal earthquakes in active tectonic regions (i.e., the NGA-West2 database), dependencies of the DSF on variables including damping ratio, spectral period, moment magnitude, source-to-site distance, duration, and local site conditions are examined. The strong influence of duration is captured by inclusion of both magnitude and distance in the DSF model. Site conditions are found to have less significant influence on DSF and are not included in the model. The proposed model for DSF provides functional forms for the median value and the logarithmic standard deviation of DSF. This model is heteroscedastic, where the variance is a function of the damping ratio. Damping Scaling Factor models are developed for the “average” horizontal ground motion components, i.e., RotD50 and GMRotI50, as well as the vertical component of ground motion.

Non-Formal Education as a Factor in Civilizational Development of Educational Space Subject in the Cross-Border Region

Science.gov (United States)

Dugarova, Dulma T.; Starostina, Svetlana E.; Namsarayev, Sergey D.; Dagbaeva, Nina Zh.; Malanov, Innokentiy A.

2016-01-01

The research is aimed at determining the organizational and pedagogical conditions of nonformal education implementation as a factor in civilizational development of subjects, joint international projects performers, in the educational space of the cross-border region. New integration projects forming the need for effective models implementation…

Sero-prevalence, risk factors and distribution of sheep and goat pox in Amhara Region, Ethiopia.

Science.gov (United States)

Fentie, Tsegaw; Fenta, Nigusie; Leta, Samson; Molla, Wassie; Ayele, Birhanu; Teshome, Yechale; Nigatu, Seleshe; Assefa, Ashenafi

2017-12-11

Sheep pox and goat pox are contagious viral diseases of sheep and goats, respectively. The diseases result in substantial economic losses due to decreased milk and meat production, damage to hides and wool, and possible trade restriction. A study was undertaken in Amhara region of Ethiopia. A cross-sectional study design was used to estimate the sero-prevalence and identify associated risk factors, while retrospective study design was used to assess the temporal and spatial distribution of the disease. A total of 672 serum samples were collected from 30 Kebeles and tested using virus neutralization test. From a total of 672 sera tested, 104 (15.5%) were positive for sheep and goat pox virus antibody; from which 56 (17%) were sheep and 48 (14%) were goats. The diseases were prevalent in all study zones, the highest sero-prevalence was observed in South Gondar (20.9%) and the lowest in North Gondar and West Gojjam zones (11.9% each). From the potential risk factors considered (species, sex, age, agro-ecology and location); only sex and age were significantly associated (p pox is one of the most prevalent and widespread diseases of sheep and goats in the study area. Hence, annual mass vaccination program must be implemented for economic and viable control of sheep and goat pox diseases in the Amhara region in particular and at a national level in general.

Effects of climatic factors, drought risk and irrigation requirement on maize yield in the Northeast Farming Region of China

DEFF Research Database (Denmark)

Yin, Xiaogang; Jabloun, Mohamed; Olesen, Jørgen Eivind

2016-01-01

Drought risk is considered to be among the main limiting factors for maize (Zea mays L.) production in the Northeast Farming Region of China (NFR). Maize yield data from 44 stations over the period 1961–2010 were combined with data from weather stations to evaluate the effects of climatic factors...... drought and intense rainfall illustrate the importance of further development of irrigation and drainage systems for ensuring the stability of maize production in NFR....

Longitudinal Regional Brain Development and Clinical Risk Factors in Extremely Preterm Infants.

Science.gov (United States)

Kersbergen, Karina J; Makropoulos, Antonios; Aljabar, Paul; Groenendaal, Floris; de Vries, Linda S; Counsell, Serena J; Benders, Manon J N L

2016-11-01

To investigate third-trimester extrauterine brain growth and correlate this with clinical risk factors in the neonatal period, using serially acquired brain tissue volumes in a large, unselected cohort of extremely preterm born infants. Preterm infants (gestational age regions covering the entire brain. Multivariable regression analysis was used to determine the influence of clinical variables on volumes at both scans, as well as on volumetric growth. MRIs at term equivalent age were available for 210 infants and serial data were available for 131 infants. Growth over these 10 weeks was greatest for the cerebellum, with an increase of 258%. Sex, birth weight z-score, and prolonged mechanical ventilation showed global effects on brain volumes on both scans. The effect of brain injury on ventricular size was already visible at 30 weeks, whereas growth data and volumes at term-equivalent age revealed the effect of brain injury on the cerebellum. This study provides data about third-trimester extrauterine volumetric brain growth in preterm infants. Both global and local effects of several common clinical risk factors were found to influence serial volumetric measurements, highlighting the vulnerability of the human brain, especially in the presence of brain injury, during this period. Copyright © 2016 Elsevier Inc. All rights reserved.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

OpenAIRE

Matsutani Sachiko

2004-01-01

Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

[Effects of land use and environmental factors on the variability of soil quality indicators in hilly Loess Plateau region of China].

Science.gov (United States)

Xu, Ming-Xiang; Liu, Guo-Bin; Zhao, Yun-Ge

2011-02-01

Classical statistics methods were adopted to analyze the soil quality variability, its affecting factors, and affecting degree at a regional scale (700 km2) in the central part of hilly Loess Plateau region of China. There existed great differences in the variability of test soil quality indicators. Soil pH, structural coefficient, silt content, specific gravity, bulk density, total porosity, capillary porosity, and catalase activity were the indicators with weak variability; soil nutrients (N, P, and K) contents, CaCO3 content, cation exchange capacity (CEC), clay content, micro-aggregate mean mass diameter, aggregate mean mass diameter, water-stable aggregates, respiration rate, microbial quotient, invertase and phosphatase activities, respiratory quotient, and microbial carbon and nitrogen showed medium variation; while soil labile organic carbon and phosphorus contents, erosion-resistance, permeability coefficient, and urease activity were the indicators with strong variability. The variability of soil CaCO3, total P and K, CEC, texture, and specific gravity, etc. was correlated with topography and other environmental factors, while the variability of dynamic soil quality indicators, including soil organic matter content, nitrogen content, water-stable aggregates, permeability, microbial biomass carbon and nitrogen, enzyme activities, and respiration rate, was mainly correlated with land use type. Overall, land use pattern explained 97% of the variability of soil quality indicators in the region. It was suggested that in the evaluation of soil quality in hilly Loess Plateau region, land use type and environmental factors should be fully considered.

Regional differences of undiagnosed type 2 diabetes and prediabetes prevalence are not explained by known risk factors.

Directory of Open Access Journals (Sweden)

Teresa Tamayo

Full Text Available We have previously found regional differences in the prevalence of known type 2 diabetes between northeastern and southern Germany. We aim to also provide prevalence estimates for prediabetes (isolated impaired fasting glucose (i-IFG, isolated glucose intolerance (i-IGT, combined IFG and IGT and unknown type 2 diabetes for both regions.Prevalence (95%CI of prediabetes (i-IFG: fasting glucose 5.6-6.9 mmol/l; i-IGT: 2 h postchallenge glucose 7.8-11.0 mmol/l, oral glucose tolerance test (OGTT, ≥ 8 h overnight fasting and unknown diabetes were analyzed in two regional population-based surveys (age group 35-79 years: SHIP-TREND (Study of Health in Pomerania (northeast, 2008-2012 and KORA F4 (Cooperative Health Research in the region of Augsburg (south, 2006-2008. Both studies used similar methods, questionnaires, and identical protocols for OGTT. Overall, 1,980 participants from SHIP-TREND and 2,617 participants from KORA F4 were included.Age-sex-standardized prevalence estimates (95%CI of prediabetes and unknown diabetes were considerably higher in the northeast (SHIP-TREND: 43.1%; 40.9-45.3% and 7.1%; 5.9-8.2% than in the south of Germany (KORA F4: 30.1%; 28.4-31.7% and 3.9%; 3.2-4.6%, respectively. In particular, i-IFG (26.4%; 24.5-28.3% vs. 17.2%; 15.7-18.6% and IFG+IGT (11.2%; 9.8-12.6% vs. 6.6%; 5.7-7.5% were more frequent in SHIP-TREND than in KORA. In comparison to normal glucose tolerance, the odds of having unknown diabetes (OR, 95%CI: 2.59; 1.84-3.65 or prediabetes (1.98; 1.70-2.31 was higher in the northeast than in the south after adjustment for known risk factors (obesity, lifestyle.The regional differences of prediabetes and unknown diabetes are in line with the geographical pattern of known diabetes in Germany. The higher prevalences in the northeast were not explained by traditional risk factors.

A new approach to evaluate factors controlling elemental sediment–seawater distribution coefficients (K{sub d}) in coastal regions, Japan

Energy Technology Data Exchange (ETDEWEB)

Takata, Hyoe, E-mail: takata@kaiseiken.or.jp [Marine Ecology Research Institute, Central Laboratory, Onjuku, Chiba (Japan); National Institute of Radiological Sciences, Chiba City, Chiba (Japan); Aono, Tatsuo; Tagami, Keiko; Uchida, Shigeo [National Institute of Radiological Sciences, Chiba City, Chiba (Japan)

2016-02-01

In numerical models to simulate the dispersion of anthropogenic radionuclides in the marine environment, the sediment–seawater distribution coefficient (K{sub d}) for various elements is an important parameter. In coastal regions, K{sub d} values are largely dependent on hydrographic conditions and physicochemical characteristics of sediment. Here we report K{sub d} values for 36 elements (Na, Mg, Al, K, Ca, V, Mn, Fe, Co, Ni, Cu, Se, Rb, Sr, Y, Mo, Cd, I, Cs, rare earth elements, Pb, {sup 232}Th and {sup 238}U) in seawater and sediment samples from 19 Japanese coastal regions, and we examine the factors controlling the variability of these K{sub d} values by investigating their relationships to hydrographic conditions and sediment characteristics. There was large variability in K{sub d} values for Al, Mn, Fe, Co, Ni, Cu, Se, Cd, I, Pb and Th. Variations of K{sub d} for Al, Mn, Fe, Co, Pb and Th appear to be controlled by hydrographic conditions. Although K{sub d} values for Ni, Cu, Se, Cd and I depend mainly on grain size, organic matter content, and the concentrations of hydrous oxides/oxides of Fe and Mn in sediments, heterogeneity in the surface characteristics of sediment particles appears to hamper evaluation of the relative importance of these factors. Thus, we report a new approach to evaluate the factors contributing to variability in K{sub d} for an element. By this approach, we concluded that the K{sub d} values for Cu, Se, Cd and I are controlled by grain size and organic matter in sediments, and the K{sub d} value for Ni is dependent on grain size and on hydrous oxides/oxides of Fe and Mn. - Highlights: • K{sub d}s for 36 elements were determined in 19 Japanese coastal regions. • K{sub d}s for several elements appeared to be controlled by multiple factors in sediments. • We evaluated these factors based on physico-chemical characteristics of sediments.

Interaction of a nodule specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin Ibc(3) 5' upstream region

DEFF Research Database (Denmark)

Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J

1988-01-01

Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...

The history of safety factors for Dutch regional dykes

NARCIS (Netherlands)

De Gast, T.; Vardon, P.J.; Jommi, C.; Hicks, M.A.

2015-01-01

Regular dyke assessment is part of reducing the risk of flooding in the Netherlands. 18 000 km of dykes are assessed at regular intervals, of which 14 000 km are classified as regional dykes and their main aim is to defend polders from inundating. The methods of assessing regional dykes are strongly

The History of Safety Factors for Dutch Regional Dykes

NARCIS (Netherlands)

De Gast, T.; Vardon, P.J.; Jommi, C.; Hicks, M.A.

2015-01-01

Regular dyke assessment is part of reducing the risk of flooding in the Netherlands. 18 000 km of dykes are assessed at regular intervals, of which 14 000 km are classified as regional dykes and their main aim is to defend polders from inundating. The methods of assessing regional dykes are strongly

Prevalence and risk factors for poor nutritional status among children in the Kilimanjaro region of Tanzania.

Science.gov (United States)

Abubakar, Amina; Uriyo, Jacqueline; Msuya, Sia E; Swai, Mark; Stray-Pedersen, Babill

2012-10-05

The current study investigated the prevalence and risk factors for poor nutritional status among children less than 36 months of age in the Kilimanjaro region of Tanzania. Using a cross sectional study design, children and their caregivers were recruited into the study. Anthropometric measures were taken based on established protocol while a standard questionnaire was utilized to collect socio-demographic data. A finger-prick blood sample was collected from all the children and haemoglobin (Hb) concentration analyzed using a HemoCue photometer (HemoCue AB, Angelholm, Sweden). Four hundred and twenty three (423) children (214 females) took part in this study. Participating children were aged between 1–35 months (mean = 13.04, SD = 7.70). We observed high rates of stunting (44.2%) and underweight (19.1%). Nearly 70% (n = 295) of the sample was anaemic (Hb education, and child's age were found to independently predict stunting; whereas concerns over child's growth and development, and distance to water source were found to uniquely predict being underweight. Maternal education was the only factor related to the child's anaemia. The current study further emphasizes the need to implement context relevant interventions to combat malnutrition in this region of Tanzania and other similar settings.

Nuclear issues in the Asia-Pacific region: socio-political factors

International Nuclear Information System (INIS)

Tanaka, Y.

1984-01-01

This paper explores the prospect of peaceful use of nuclear power in the Asia-Pacific region, criteria for judging the acceptability of nuclear electric power in the region, and alternative worldviews on the basis of which a regional nuclear order should be established. First, current nuclear power issues in Japan are discussed. Secondly, the Asia-Pacific countries are classified according to their stages of civil nuclear development, Thirdly, the acceptability of civil nuclear power in the region is discussed, using nuclear nonproliferation, safety, and public acceptance as three major criteria. Fourthly, conflicts of interest that cut across North/South, East/West, nuclear/non-nuclear, and nuclear weapons states/non-nuclear weapons states boundaries are discussed. Lastly,it is proposed that an international forum be convened of all the countries concerned with nuclear issues in the region. Several major objectives of this forum are suggested, including construction of a rational model for a solution for non-zero-sum gain to everyone regarding use of nuclear power in the region. (author)

Impaired spermatogenesis and gr/gr deletions related to Y chromosome haplogroups in Korean men.

Directory of Open Access Journals (Sweden)

Jin Choi

Full Text Available Microdeletion of the Azoospermia Factor (AZF regions in Y chromosome is a well-known genetic cause of male infertility resulting from spermatogenetic impairment. However, the partial deletions of AZFc region related to spermatogenetic impairment are controversial. In this study, we characterized partial deletion of AZFc region in Korean patients with spermatogenetic impairment and assessed whether the DAZ and CDY1 contributes to the phenotype in patients with gr/gr deletions. Total of 377 patients with azoo-/oligozoospermia and 217 controls were analyzed using multiplex polymerase chain reaction (PCR, analysis of DAZ-CDY1 sequence family variants (SFVs, and quantitative fluorescent (QF-PCR. Of the 377 men with impaired spermatogenesis, 59 cases (15.6% had partial AZFc deletions, including 32 gr/gr (8.5%, 22 b2/b3 (5.8%, four b1/b3 (1.1% and one b3/b4 (0.3% deletion. In comparison, 14 of 217 normozoospermic controls (6.5% had partial AZFc deletions, including five gr/gr (2.3% and nine b2/b3 (4.1% deletions. The frequency of gr/gr deletions was significantly higher in the azoo-/oligozoospermic group than in the normozoospermic control group (p = 0.003; OR = 3.933; 95% CI = 1.509-10.250. Concerning Y haplogroup, we observed no significant differences in the frequency of gr/gr deletions between the case and the control groups in the YAP+ lineages, while gr/gr deletion were significantly higher in azoo-/oligozoospermia than normozoospermia in the YAP- lineage (p = 0.004; OR = 6.341; 95% CI = 1.472-27.312. Our data suggested that gr/gr deletion is associated with impaired spermatogenesis in Koreans with YAP- lineage, regardless of the gr/gr subtypes.

Risk Factors and Spatial Clusters of Cryptosporidium Infection among School-Age Children in a Rural Region of Eastern China.

Science.gov (United States)

Zheng, Hao; He, Jianfeng; Wang, Li; Zhang, Rong; Ding, Zhen; Hu, Wenbiao

2018-05-06

The epidemiological features of Cryptosporidium infection among school-age children in China still remain unclear. Hereby, a cross-sectional study of 1637 children aged 3⁻9 years was designed to investigate the risk factors and spatial clusters of Cryptosporidium infection in a rural region of Eastern China. Stool specimens collected from participants were examined using the auramine-phenol and modified acid-fast staining. Univariable and multivariable analyses were performed to identify the risk factors of Cryptospordium infection. The spatial clusters were analyzed by a discrete Poisson model using SaTScan software. Our results showed that the overall prevalence of Cryptosporidium infection was 11‰ in the research region. At the age of 3⁻6 years (odds ratios (OR) = 3.072, 95% confidence intervals (CI) : 1.001⁻9.427), not washing hands before eating and after defecation (OR = 3.003, 95% CI: 1.060⁻8.511) were recognized as risk factors. Furthermore, a high-risk spatial cluster (relative risk = 4.220, p = 0.025) was identified. These findings call for effective sustainable interventions including family and school-based hygienic education to reduce the prevalence of Cryptosporidium infection. Therefore, an early warning system based spatiotemporal models with risk factors is required to further improve the effectiveness and efficiency of cryptosporidiosis control in the future.

Human Papillomavirus Cervical Infection and Associated Risk Factors in a Region of Argentina With a High Incidence of Cervical Carcinoma

Directory of Open Access Journals (Sweden)

S. A. Tonon

1999-01-01

Full Text Available Objective: To assess the prevalence and potential risk factors associated with human papillomavirus (HPV cervical infection among women residing in a region of northeastern Argentina with a high incidence of cervical cancer.

Similarities and discrepancies in homozygous factor VII defects due to mutations in the region of residues Met298 to Cys310 (exon 8) in the catalytic domain of factor VII.

Science.gov (United States)

Girolami, A; Berti de Marinis, G; Bonamigo, E; Vettore, S

2011-06-01

Patients with the Arg304Gln mutation in factor VII Padua (FVII Padua) show discrepant activity levels that depend on the thromboplastin used in the assay system. This report investigates the possibility that residues close to Arg304 (exon 8) show the same discrepant behavior. All available homozygous patients with a mutation in a 13-residue region (preceding and following Arg304) have been evaluated. Only the Arg304Trp mutation showed a discrepancy similar to that shown by the Arg304Gln mutation. Other homozygotes failed to show differences, despite their all being positive for cross-reacting material. Another FVII amino acid residue involved in tissue factor binding and activation is Arg79 (exon 4). No comparison could be carried out because no homozygotes for deficiency in this region have ever been described. The relationship between these 2 residues involved in tissue factor binding and activation has not yet been completely clarified; however, Arg residues 79 and 304 are the only 2 residues definitely shown thus far to be involved in this important function.

Trends and risk factors for syphilis infection in Piedmont Region, Italy, 2002-2008.

Directory of Open Access Journals (Sweden)

Federica Vigna-Taglianti

2011-03-01

Full Text Available

Abstract:
Background: This work aims to analyze trends of syphilis infections in the Piedmont Region (Italy between 2002 and 2008, and to evaluate risk factors for infection. Methods: Syphilis trends were described according to socio-demographic characteristics, sexual behavior, condom use, number of partners and HIV infection. Independent risk factors for syphilis among men having sex with men (MSM, men having sex with women (MSW, and women were identified through logistic regression comparing cases with 12,773 negative patients. Results: Between 2002 and 2008, 1,046 cases of syphilis were diagnosed, with peaks in 2004 and 2007. The risk of a syphilis diagnosis was independently associated with being older than 24, having a low education level, homosexual behavior, HIV self-reported infection (for MSM and MSW, number of partners (for MSW and women and non- consistent condom use (for women. Conclusions: Recent outbreaks suggest that the attention to syphilis can’t be lowered. Screening, treatment of cases and notification of partners should be reinforced and integrated with sexual health education and counselling in high-risk environments. Surveillance data must be continuously collected.

Identification of Environmental Factors Associated with Inflammatory Bowel Disease in a Southwestern Highland Region of China: A Nested Case-Control Study.

Directory of Open Access Journals (Sweden)

Junkun Niu

Full Text Available The aim of this study was to examine environmental factors associated with inflammatory bowel disease (IBD in Yunnan Province, a southwestern highland region of China.In this nested case-control study, newly diagnosed ulcerative colitis (UC cases in 2 cities in Yunnan Province and Crohn's disease (CD cases in 16 cities in Yunnan Province were recruited between 2008 and 2013. Controls were matched by geography, sex and age at a ratio of 1:4. Data were collected using the designed questionnaire. Conditional logistic regression models were used to estimate adjusted odds ratios (ORs.A total of 678 UC and 102 CD cases were recruited. For UC, various factors were associated with an increased risk of developing UC: dietary habits, including frequent irregular meal times; consumption of fried foods, salty foods and frozen dinners; childhood factors, including intestinal infectious diseases and frequent use of antibiotics; and other factors, such as mental labor, high work stress, use of non-aspirin non-steroidal anti-inflammatory drugs and allergies (OR > 1, p 1, p < 0.05, whereas physical activity may have reduced this risk (OR < 1, p < 0.05.This study is the first nested case-control study to analyze the association between environmental factors and IBD onset in a southwestern highland region of China. Certain dietary habits, lifestyles, allergies and childhood factors may play important roles in IBD, particularly UC.

Enhancing capacity for risk factor surveillance at the regional/local level: a follow-up review of the findings of the Canadian Think Tank Forum after 4 years.

Science.gov (United States)

Choi, Bernard Ck; Decou, Mary Lou; Rasali, Drona; Martens, Patricia J; Mancuso, Michelina; Plotnikoff, Ronald C; Neudorf, Cory; Thanos, Joanne; Svenson, Lawrence W; Denny, Keith; Orpana, Heather; Stewart, Paula; King, Michael; Griffith, Jane; Erickson, Tannis; van Dorp, Renate; White, Deanna; Ali, Amira

2014-01-22

National health surveys are sometimes used to provide estimates on risk factors for policy and program development at the regional/local level. However, as regional/local needs may differ from national ones, an important question is how to also enhance capacity for risk factor surveillance regionally/locally. A Think Tank Forum was convened in Canada to discuss the needs, characteristics, coordination, tools and next steps to build capacity for regional/local risk factor surveillance. A series of follow up activities to review the relevant issues pertaining to needs, characteristics and capacity of risk factor surveillance were conducted. Results confirmed the need for a regional/local risk factor surveillance system that is flexible, timely, of good quality, having a communication plan, and responsive to local needs. It is important to conduct an environmental scan and a gap analysis, to develop a common vision, to build central and local coordination and leadership, to build on existing tools and resources, and to use innovation. Findings of the Think Tank Forum are important for building surveillance capacity at the local/county level, both in Canada and globally. This paper provides a follow-up review of the findings based on progress over the last 4 years.

FACTORS OF LABOUR PRODUCTIVITY GROWTH IN AGRICULTURE OF THE AGRARIAN REGION

Directory of Open Access Journals (Sweden)

Anatoly Babenko

2017-09-01

Full Text Available The aim of the article is to study the conceptual provisions of the essence of labour productivity in agriculture in order to determine the factors and conditions for its growth at the present stage of economic development. Methods. The theoretical and methodological bases of research are the works of classical and modern economic science concerning labour productivity and human capital. With the aim of concretizing the conceptual and categorical apparatus, the dialectical and abstract-logical methods were used; a monographic method was used during covering the views of scientists on the investigated problem; for the analysis of labour productivity trends, the method of comparative analysis and the graphical method were used. Results. The conditions of agricultural production management in an agrarian region are characterized. Factors of labour productivity growth in agriculture are determined. It is established that the main reserves of increasing labour productivity consist of reducing labour costs for the production of agricultural products. In turn, the reduction of labour costs is caused by the use of new equipment and new technologies, progressive forms of labour organization, improvement of the system of material incentives for labour. Practical significance. The realization of proposals and recommendations concerning the formation and development of human capital for agricultural production, optimization of production resources, strengthening of labour motivation will provide an opportunity to increase the labour activity of personnel, the volume of agricultural production. Relevance/originality. Further development of research results allows us to collect an empirical, multifactorial model of labour productivity growth in agricultural production.

Regional precipitation variability in East Asia related to climate and environmental factors during 1979-2012

Science.gov (United States)

Deng, Yinyin; Gao, Tao; Gao, Huiwang; Yao, Xiaohong; Xie, Lian

2014-01-01

This paper studies the inter-annual precipitation variations in different regions of East Asia from oceans to interior areas in China during 1979 – 2012. The results computed by Empirical Orthogonal Functions (EOF) demonstrate that the annual precipitation changes are mainly related to the El Niño-Southern Oscillation, East Asian summer monsoon and aerosols. We also found that the increased Sea surface temperature (SST) could explain the precipitation changes over the Northwest Pacific in the dry season (Oct. – May) and the East China Sea and the South China Sea in the rainy season (Jun. – Sep.). The precipitation changes over the ocean unexplained by SST were likely due to the water vapor transport dominated by dynamic factors. With the increased SST, the moisture transported from oceans to interior land was likely redistributed and caused the complicated regional variability of precipitation. Moreover, the impacts of aerosols on cloud and precipitation varied with different pollution levels and different seasons. PMID:25033387

Effect of climatic factors affecting saffron using analytic hierarchy process(AHP; (Case Study Roshtkhar Region, Iran

Directory of Open Access Journals (Sweden)

Saeid Kamyabi

2014-06-01

Full Text Available The present paper aimed to determine the criteria for understanding climate and ranking factors influencing saffron and assess its impact on Roshtkhoar city of Khorasan Razavi province. The city of Roshtkhar has potential for increasing saffron cultivation; therefore, the main hypothesis during the research was, which climatic factors had the most influence on the cultivation of saffron in the city Roshtkhar. The research methodology was based on a period of ten years cross-sectional data collected from meteorological stations in the studied area. In this study, with taking into account of climatic factors affecting the cultivation of saffron, Analytical Hierarchy Process (AHP method was used to prioritize rural and regional municipalities Roshtkhar cultivated land. Research process included data collection, analysis, statistical analysis, data entry software Expert choice, clustering and selection criteria, and integrating information. The results showed that, among environmental factors, precipitation index (0.281 and temperature coefficient (0.137 had the greatest impact in saffron cultivation. Water resources and evaporation of water had the lowest score in the survey accounted. In the municipalities of the city, Hossein-Abad districts had favorable conditions for growing saffron.

Prevalence and Factors Associated with Hydatidiform Mole among Patients Undergoing Uterine Evacuation at Mbarara Regional Referral Hospital

OpenAIRE

Mulisya, Olivier; Roberts, Drucilla J.; Sengupta, Elizabeth S.; Agaba, Elly; Laffita, Damaris; Tobias, Tusabe; Mpiima, Derrick Paul; Henry, Lugobe; Augustine, Ssemujju; Abraham, Masinda; Hillary, Twizerimana; Mugisha, Julius

2018-01-01

Objective. We sought to determine the prevalence of and factors associated with hydatidiform molar gestations amongst patients undergoing uterine evacuation at Mbarara Regional Referral Hospital (MRRH), Mbarara, Uganda. Methods. This was a cross-sectional study carried out from November 2016 to February 2017. All patients admitted for uterine evacuation for nonviable pregnancy were included. The study registered 181 patients. Data were collected on sociodemographics, medical conditions, obste...

Therapeutic results and prognostic factors after irradiation of loco-regional prostate cancer

International Nuclear Information System (INIS)

Debrigode, C.; Dubois, J.; Hay, H.M.; Astre, C.; Savu, N.M.

1994-01-01

The present study concerns 140 patients with loco-regional prostatic cancer, treated with external beam irradiation at the CRLC Val-d'Aurelle in Montpellier, France, between 1982 and 1988, with a minimum of 54 months follow-up. The local control after radiotherapy is 78.6%, all stages and histological grades combined. The median overall survival is 114 months and the median disease-free survival 59 months. The most frequent modality of treatment failure is metastatic disease, isolated (32.8%) or combined to local relapse (10%). The rate of urinary intolerance symptoms during treatment was 87.1 and 80.6% for the digestive ones. The late urinary complications and sequellae rate was 21.4% for the cystitis-type and 12.9% for post-radiotherapy urethral structures; the latter has imposed in 2/3 of cases one or more trans-urethral resections that never showed pathological signs of recurrence. Digestive complications and sequellae occurred in 31.3% of the patients; in the latter group there were two internal digestive fistulae which needed surgical treatment and three postradiotherapeutic stenosis of the anal canal. The prognostic factors revealed by statistical analysis are clinical stage, pathological grade for overall and disease-free survival, age for overall survival and trans-urethral resection for disease-free survival, the latter being equally a risk factor for cystitis-type complications and urethral structures. (authors). 26 refs., 8 figs., 7 tabs

The importance of residues 195-206 of human blood clotting factor VII in the interaction of factor VII with tissue factor

International Nuclear Information System (INIS)

Wildgoose, P.; Kisiel, W.; Kazim, A.L.

1990-01-01

Previous studies indicated that human and bovine factor VII exhibit 71% amino acid sequence identity. In the present study, competition binding experiments revealed that the interaction of human factor VII with cell-surface human tissue factor was not inhibited by 100-fold molar excess of bovine factor VII. This finding indicated that bovine and human factor VII are not structurally homologous in the region(s) where human factor VII interacts with human tissue factor. On this premise, the authors synthesized three peptides corresponding to regions of human factor VII that exhibited marked structural dissimilarity to bovine factor VII; these regions of dissimilarity included residues 195-206, 263-274, and 314-326. Peptide 195-206 inhibited the interaction of factor VII with cell-surface tissue factor and the activation of factor X by a complex of factor VIIa and tissue factor half-maximally at concentrations of 1-2 mM. A structurally rearranged form of peptide 195-206 containing an aspartimide residue inhibited these reactions half-maximally at concentrations of 250-300 μM. In contrast, neither peptide 263-274 nor peptide 314-326, at 2 mM concentration, significantly affected either factor VIIa interaction with tissue factor or factor VIIa-mediated activation of factor X. The data provide presumptive evidence that residues 195-206 of human factor VII are involved in the interaction of human factor VII with the extracellular domain of human tissue factor apoprotein

The assessment of selected factors influencing intent to get pregnant in the Greater Poland Region

Directory of Open Access Journals (Sweden)

Małgorzata Wojciechowska

2014-06-01

Full Text Available introduction and objective. Nowadays, people decide to have a baby by first analysing their financial situation. Tradition is no longer a factor which determines the decision whether or not to have a baby. A prognosis of the Polish Central Statistical Office (GUS shows that the population of Poland will fall from 38 to 36 million by 2035. The aim of this study is to assess the procreation behaviour of women in Greater Poland Region. materials and methods. For the research purpose, 3,120 women of reproductive age were examined by using an author designed questionnaire and a synthetic Family Financial Standard Index. results: 74.6% of the respondents lived in an urban area, 25.4% of women come from a rural area. 49% of examined women did not want to have a bigger family, 45% would like to have another child. Analysis of the reasons why women did not want to have another baby revealed that predominance of the financial factor – 67%, living conditions – 18.4% and health– 13.2%. Only 11.9% of the women declared their high financial status, 4.8% of families received family allowance from the government; 88.4% of the examined families did not receive any social benefits. Bad housing situation was declared by 5% of the respondents, 26.7% of the interviewees lived with family members, i.e. parents or grandparents. Analysis of the data concerning religious bonds showed that 67.6% of women declared their indifference to religion. conclusions. The economic factor was an important reason limiting procreation. The bad situation on the real estate market combined with an insufficient range of social welfare led to a decrease in the birth-rate in the Greater Poland region. The impact of religion on family planning was less important. The influence of the analysed socio-economic factors on family planning was similar in rural and urban areas.

Lake Area Changes and Their Influence on Factors in Arid and Semi-Arid Regions along the Silk Road

Directory of Open Access Journals (Sweden)

Chao Tan

2018-04-01

Full Text Available In the context of global warming, the changes in major lakes and their responses to the influence factors in arid and semi-arid regions along the Silk Road are especially important for the sustainable development of local water resources. In this study, the areas of 24 lakes were extracted using MODIS NDVI data, and their spatial-temporal characteristics were analyzed. In addition, the relationship between lake areas and the influence factors, including air temperature, precipitation, evapotranspiration, land use and land cover change (LULCC and population density in the watersheds, were investigated. The results indicated that the areas of most lakes shrank, and the total area decreased by 22,189.7 km2 from 2001 to 2016, except for those of the lakes located on the Qinghai-Tibetan Plateau. The air temperature was the most important factor for all the lakes and increased at a rate of 0.113 °C/a during the past 16 years. LULCC and the increasing population density markedly influenced the lakes located in the middle to western parts of this study area. Therefore, our results connecting lake area changes in the study region highlight the great challenge of water resources and the urgency of implementation of the green policy in the One Belt and One Road Initiative through international collaboration.

The characteristic and influence factors of extinction depth of shallow groundwater on the high-latitude region: a case study on the Sanjiang Plain, northeast China.

Science.gov (United States)

Wang, Xihua

2018-03-01

Accurate estimation of extinction depth of shallow groundwater (EDSG) and identification of its influence factors are important for sustainable management of groundwater resources, ecological protection, and human health in intensively irrigated region. In this study, the ratio of actual groundwater depth and EDSG (RAE) method was used to understand the spatial variability of EDSG in the Sanjiang Plain, one of China's largest grain production bases and China's largest inland freshwater wetland region. The study showed a large spatial variation of EDSG in the region. Spatially, the sites, which were in the northeast and center had the deepest and the shallowest EDSG, whereby, indicate that it has higher and lower pumping potential capacity. Many factors including climate, soil parameters, vegetation and topography affected the EDSG. We also identified an area of 3.86 × 10 10  m 2 , which accounting for 35.3% of the entire Sanjiang Plain, has exceeded the ESGD by over exploited for years. Knowledge of the variation and influence factors of EDSG for a certain plant system and the current shallow groundwater condition in the higher latitude region can be a key to the development of preventive actions for large quantity pumping groundwater and protection regional and sustainable development of irrigated agriculture.

Highly accessible AU-rich regions in 3’ untranslated regions are hotspots for binding of regulatory factors

Science.gov (United States)

2017-01-01

Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3’UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing “free” target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer

Social and economic factors of the natural risk growth: estimation of the Russian regions

Science.gov (United States)

Petrova, E.

2003-04-01

Òhe vulnerability of the population and economy territorial complexes (PETC) to the influence of unfavorable and dangerous natural processes and events is determined not only by the physical parameters of natural hazards in the given region, but also by economic and social peculiarities of the PETC by itself. It depends on economy type, on PETC’s age, structure and dimensions as well as on degree of its participation in the territorial division of labor. PETC would be more vulnerable to the natural hazards impact if its population density, concentration of the industrial capacities (especially of the objects that additionally create the potential danger of the man-caused catastrophes such as nuclear-power stations, chemical enterprises, oil refineries and so on), concentration of transport and other means of communication, the technological complexity, the originality of the objects included in it as well as the originality of PETC by itself would be higher. The PETC with the unfavorable socio-political and ecological situation and underdeveloped management structures are more vulnerable. The estimation of regions by PETC vulnerability degree to the natural hazards were marked out on a base of data about the actual distribution of the natural hazards in Russia and analysis of the economic indices of the Russian Federation subjects. Among the economic indexes the per capita production of Gross Regional Product (GRP), population density, road density, the degree of appraisal depreciation of the fixed assets, the land cultivation degree of the territory, forest share and so on were taken into account. As the analysis showed, the economic and social factors of the natural risk growth are active in the majority of the regions of the Russian Federation. Such a situation demands the increased attention of state and local authorities to this problem for lowering the economic and social constituents of the growth of natural hazards.

Prehospital factors determining regional variation in thrombolytic therapy in acute ischemic stroke.

Science.gov (United States)

Lahr, Maarten M H; Vroomen, Patrick C A J; Luijckx, Gert-Jan; van der Zee, Durk-Jouke; de Vos, Ronald; Buskens, Erik

2014-10-01

Treatment rates with intravenous tissue plasminogen activator vary by region, which can be partially explained by organizational models of stroke care. A recent study demonstrated that prehospital factors determine a higher thrombolysis rate in a centralized vs. decentralized model in the north of the Netherlands. To investigate prehospital factors that may explain variation in thrombolytic therapy between a centralized and a decentralized model. A consecutive case observational study was conducted in the north of the Netherlands comparing patients arriving within 4·5 h in a centralized vs. decentralized stroke care model. Factors investigated were transportation mode, prehospital diagnostic accuracy, and preferential referral of thrombolysis candidates. Potential confounders were adjusted using logistic regression analysis. A total of 172 and 299 arriving within 4·5 h were enrolled in centralized and decentralized settings, respectively. The rate of transportation by emergency medical services was greater in the centralized model (adjusted odds ratio 3·11; 95% confidence interval, 1·59-6·06). Also, more misdiagnoses of stroke occurred in the central model (P = 0·05). In postal code areas with and without potential preferential referral of thrombolysis candidates due to overlapping catchment areas, the odds of hospital arrival within 4·5 h in the central vs. decentral model were 2·15 (95% confidence interval, 1·39-3·32) and 1·44 (95% confidence interval, 1·04-2·00), respectively. These results suggest that the larger proportion of patients arriving within 4·5 h in the centralized model might be related to a lower threshold to use emergency services to transport stroke patients and partly to preferential referral of thrombolysis candidates. © 2013 The Authors. International Journal of Stroke © 2013 World Stroke Organization.

MAJOR RISK FACTORS FOR STROKE AND THEIR CONTROL IN PATIENTS LIVING IN A SMALL TOWN OF THE MOSCOW REGION

Directory of Open Access Journals (Sweden)

V. V. Kozyaykin

2015-01-01

Full Text Available Background: Evaluation of prevalence and degree of control of leading risk factors for stroke among population of various regions of the Russian Federation enables rational planning of preventive activities.Aim: To analyze prevalence of the leading stroke risk factors, to assess efficacy of their control and to determine their impact on outcomes.Materials and methods: We examined and treated 129 patients with primary and repeated cerebral accidents living in a small town of the Moscow region.Results: The most prevalent stroke risk factor was arterial hypertension (94.6%. During 6 months before the stroke, target levels of systolic blood pressure had been achieved in 36/122 patients with arterial hypertension and those of diastolic blood pressure, in 4/122 patients. During the last 2 years preceding the index stroke, 48.8% of patients had hypertensive crises. More than half of the patients (71/122 either had not been taking their antihypertensive medications, or had not taken them regularly. There was a positive correlation between duration of arterial hypertension and degree of stroke-related disability, assessed by NIHSS (r = 0.263, p = 0.003, as well as between duration of arterial hypertension and functional activity index on Rankin scale at manifestation of stroke (r = 0.268, p = 0.003. Other prevalent risk factors were smoking (51.9% of patients, alcohol use (67.44%, diabetes mellitus (23.26%. Hypercholesterolemia that was diagnosed in 102/129 of the stroke patients, did not significantly affect any parameter of stroke severity (p > 0.05. There were weak positive correlations between body mass index and difference in NIHSS scores at admission and at discharge (r = 0.204, p = 0.049, between body mass and difference in NIHSS scores at admission and at discharge (r = 0.227, p = 0.028, as well as between body mass and difference in Rankin scale scores at admission and at discharge (r = 0.247, p = 0.016. Chronic stress situation (depression

Discovery of transcription factors and regulatory regions driving in vivo tumor development by ATAC-seq and FAIRE-seq open chromatin profiling.

Directory of Open Access Journals (Sweden)

Kristofer Davie

2015-02-01

Full Text Available Genomic enhancers regulate spatio-temporal gene expression by recruiting specific combinations of transcription factors (TFs. When TFs are bound to active regulatory regions, they displace canonical nucleosomes, making these regions biochemically detectable as nucleosome-depleted regions or accessible/open chromatin. Here we ask whether open chromatin profiling can be used to identify the entire repertoire of active promoters and enhancers underlying tissue-specific gene expression during normal development and oncogenesis in vivo. To this end, we first compare two different approaches to detect open chromatin in vivo using the Drosophila eye primordium as a model system: FAIRE-seq, based on physical separation of open versus closed chromatin; and ATAC-seq, based on preferential integration of a transposon into open chromatin. We find that both methods reproducibly capture the tissue-specific chromatin activity of regulatory regions, including promoters, enhancers, and insulators. Using both techniques, we screened for regulatory regions that become ectopically active during Ras-dependent oncogenesis, and identified 3778 regions that become (over-activated during tumor development. Next, we applied motif discovery to search for candidate transcription factors that could bind these regions and identified AP-1 and Stat92E as key regulators. We validated the importance of Stat92E in the development of the tumors by introducing a loss of function Stat92E mutant, which was sufficient to rescue the tumor phenotype. Additionally we tested if the predicted Stat92E responsive regulatory regions are genuine, using ectopic induction of JAK/STAT signaling in developing eye discs, and observed that similar chromatin changes indeed occurred. Finally, we determine that these are functionally significant regulatory changes, as nearby target genes are up- or down-regulated. In conclusion, we show that FAIRE-seq and ATAC-seq based open chromatin profiling

Patterns of active and passive smoking, and associated factors, in the South-east Anatolian Project (SEAP region in Turkey

Directory of Open Access Journals (Sweden)

Ceylan Ali

2006-01-01

Full Text Available Abstract Background Smoking is an important health threat in Turkey. This study aimed to determine the frequency of and main factors associated with smoking in persons of 15 years and over, and the frequency of passive smoking in homes in the South-east Anatolian Project (SEAP Region in Turkey. Methods A cross sectional design was employed. The sample waschosen by the State Institute of Statistics using a stratified cluster probability sampling method. 1126 houses representing the SEAP Region were visited. Questionnaires about tobacco smoking and related factors were applied to 2166 women and 1906 men (of 15 years old and above in their homes. Face-to-face interview methods were employed. Participants were classified as current, ex, and non-smokers. The presence of a regular daily smoker in a house was used as an indication of passive smoking. The chi-square andlogistic regressionanalysis methods were used for the statistical analysis. Results The prevalence of smoking, in those of 15 years and over, was 11.8% in women and 49.7% in men. The prevalence of current smokers was higher in urban (34.5 % than in rural (22.8 % regions. The mean of total cigarette consumption was 6.5 packs/year in women and 17.9 packs/year in men. There was at least one current smoker in 70.1% of the houses. Conclusion Smoking is a serious problem in the South-eastern Anatolian Region. Male gender, middle age, a high level of education and urban residency were most strongly associated with smoking.

Lexical factors and cerebral regions influencing verbal fluency performance in MCI.

Science.gov (United States)

Clark, D G; Wadley, V G; Kapur, P; DeRamus, T P; Singletary, B; Nicholas, A P; Blanton, P D; Lokken, K; Deshpande, H; Marson, D; Deutsch, G

2014-02-01

To evaluate assumptions regarding semantic (noun), verb, and letter fluency in mild cognitive impairment (MCI) and Alzheimer disease (AD) using novel techniques for measuring word similarity in fluency lists and a region of interest (ROI) analysis of gray matter correlates. Fifty-eight individuals with normal cognition (NC, n=25), MCI (n=23), or AD (n=10) underwent neuropsychological tests, including 10 verbal fluency tasks (three letter tasks [F, A, S], six noun categories [animals, water creatures, fruits and vegetables, tools, vehicles, boats], and verbs). All pairs of words generated by each participant on each task were compared in terms of semantic (meaning), orthographic (spelling), and phonemic (pronunciation) similarity. We used mixed-effects logistic regression to determine which lexical factors were predictive of word adjacency within the lists. Associations between each fluency raw score and gray matter volumes in sixteen ROIs were identified by means of multiple linear regression. We evaluated causal models for both types of analyses to specify the contributions of diagnosis and various mediator variables to the outcomes of word adjacency and fluency raw score. Semantic similarity between words emerged as the strongest predictor of word adjacency for all fluency tasks, including the letter fluency tasks. Semantic similarity mediated the effect of cognitive impairment on word adjacency only for three fluency tasks employing a biological cue. Orthographic similarity was predictive of word adjacency for the A and S tasks, while phonemic similarity was predictive only for the S task and one semantic task (vehicles). The ROI analysis revealed different patterns of correlations among the various fluency tasks, with the most common associations in the right lower temporal and bilateral dorsal frontal regions. Following correction with gray matter volumes from the opposite hemisphere, significant associations persisted for animals, vehicles, and a composite

Personnel as a Factor of Production in Development of Regional Tourism Economy – a Conceptual Paper

Directory of Open Access Journals (Sweden)

Aleksander Panasiuk

2013-01-01

Full Text Available Tourism economy appears in every sphere of economy: production of goods and services, their division, exchange and consumption; it also occurs in the majority of the national economy branches that directly or indirectly deal with meeting tourist demand. The majority of economic processes in tourism sector are realized by direct tourism economy and its representatives, tourist entrepreneurs. Territorial self- government units and tourist organizations play a significant role in formation of economic processes in tourism sector on the regional and local levels. The classic economy distinguishes three basic production factors: labor, land and capital. In the modern approaches they are completed with the fourth that has different names. Beginning with technical and organizational progress which is a logic extension of coexistence and cooperation of three basic factors, ending with information and knowledge – treated as the most modern factors of production in the so-called new economy. In the totality of activities of tourism economy entities, a special role should be ascribed to the personnel, namely human potential of tourism economy entities.

Evaluating the Impact of Regional Marketing Projects on the Development of Regions from Different Stakeholder Perspectives

Directory of Open Access Journals (Sweden)

Kunze Kim-Kathrin

2014-01-01

Full Text Available In the competition for economically attractive stakeholders, regions have to implement strategies to gain and adhere those interest groups. Empirical studies concerning the migration motivations show that it is not only labor market but also soft locational factors of the social environment, nature and landscape that are of high importance: A majority of the population is willing to move or rather stay at a special place because of such soft locational factors. This study examines the impact of regional marketing projects on the development of regions from the perspectives of inhabitants and tourists as well as general attributes to measure a region’s attractiveness from the perspective of high potentials. We argue that those projects that fit to the region and its unique selling propositions contribute to positioning and building location brand value. We show that projects have a socio-economic effect on the attitude towards regions and contribute to building location brand value. An analysis of group differences shows that the project influence on the region and region attractiveness are perceived in significantly different manner depending on the knowledge level of the stakeholder group. Consequently, one should increase the awareness of marketing activities and regions and focus on soft locational factors while establishing and positioning a region brand.

Prevalence and risk factors associated with nutrition-related noncommunicable diseases in the Eastern Mediterranean region

Science.gov (United States)

Musaiger, Abdulrahman O; Al-Hazzaa, Hazzaa M

2012-01-01

This paper reviews the current situation concerning nutrition-related noncommunicable diseases (N-NCDs) and the risk factors associated with these diseases in the Eastern Mediterranean region (EMR). A systematic literature review of studies and reports published between January 1, 1990 and September 15, 2011 was conducted using the PubMed and Google Scholar databases. Cardiovascular disease, type 2 diabetes, metabolic syndrome, obesity, cancer, and osteoporosis have become the main causes of morbidity and mortality, especially with progressive aging of the population. The estimated mortality rate due to cardiovascular disease and diabetes ranged from 179.8 to 765.2 per 100,000 population, with the highest rates in poor countries. The prevalence of metabolic syndrome was very high, ranging from 19% to 45%. The prevalence of overweight and obesity (body mass index ≥25 kg/m2) has reached an alarming level in most countries of the region, ranging from 25% to 82%, with a higher prevalence among women. The estimated mortality rate for cancer ranged from 61.9 to 151 per 100,000 population. Osteoporosis has become a critical problem, particularly among women. Several risk factors may be contributing to the high prevalence of N-NCDs in EMR, including nutrition transition, low intake of fruit and vegetables, demographic transition, urbanization, physical inactivity, hypertension, tobacco smoking, stunting of growth of preschool children, and lack of nutrition and health awareness. Intervention programs to prevent and control N-NCDs are urgently needed, with special focus on promotion of healthy eating and physical activity. PMID:22399864

Gibberellin-regulated gene in the basal region of rice leaf sheath encodes basic helix-loop-helix transcription factor.

Science.gov (United States)

Komatsu, Setsuko; Takasaki, Hironori

2009-07-01

Genes regulated by gibberellin (GA) during leaf sheath elongation in rice seedlings were identified using the transcriptome approach. mRNA from the basal regions of leaf sheaths treated with GA3 was analyzed by high-coverage gene expression profiling. 33,004 peaks were detected, and 30 transcripts showed significant changes in the presence of GA3. Among these, basic helix-loop-helix transcription factor (AK073385) was significantly upregulated. Quantitative PCR analysis confirmed that expression of AK073385 was controlled by GA3 in a time- and dose-dependent manner. Basic helix-loop-helix transcription factor (AK073385) is therefore involved in the regulation of gene expression by GA3.

University, Knowledge and Regional Development: Factors Affecting Knowledge Transfer in a Developing Region

Science.gov (United States)

Fongwa, Neba Samuel; Marais, Lochner

2016-01-01

The role of knowledge in the current knowledge economy cannot be overly emphasised. Successful regions are continuously being linked to excellence in the production, accumulation, and application of knowledge. Universities have increasingly been at the centre of such knowledge production, application and transfer. Yet, there is little research and…

Khat Chewing among Students of Higher Education in Jazan Region, Saudi Arabia: Prevalence, Pattern, and Related Factors

OpenAIRE

Alsanosy, Rashad Mohammed; Mahfouz, Mohamed Salih; Gaffar, Abdelrahim Mutwakel

2013-01-01

Objectives. (1) To estimate the prevalence and behavioral patterns of Khat chewing and (2) to investigate factors that influenced the pattern of Khat use among undergraduate students in different higher education institutions in Jazan region, Saudi Arabia. Materials and Methods. A cross-sectional study using a pretested structured self-administered quantitative questionnaire was used to collect data. SPSS version 17 software program was used for data analysis. Results. The overall current Kha...

Ethnic and Regional Differences in Prevalence and Correlates of Chronic Diseases and Risk Factors in Northern Canada

OpenAIRE

Joykrishna Sarkar, MSc; Lisa M. Lix, PhD; Sharon Bruce, PhD; T. Kue Young, MD, PhD

2010-01-01

IntroductionWe investigated ethnic and geographic variations in major chronic diseases and risk factors in northern Canada, an area that is undergoing rapid changes in its social, cultural, and physical environments.MethodsSelf-report data were obtained from the population-based Canadian Community Health Survey in 2000-2001 and 2005-2006 for Aboriginal and non-Aboriginal respondents from the 3 regions of northern Canada: Yukon, Northwest Territories, and Nunavut. Crude prevalence estimates, a...

The Influencing Factors, Regional Difference and Temporal Variation of Industrial Technology Innovation: Evidence with the FOA-GRNN Model

Directory of Open Access Journals (Sweden)

Yongli Zhang

2018-01-01

Full Text Available Technology innovation is a motivating force for sustainable development. The recognition and measurement of influencing factors are a basic prerequisite of technology innovation research. In response to the gaps and shortages of existing theories and methods, this paper builds the impact indicators of technology innovation, the proposed FOA-GRNN model, and analyzes the influencing factors, regional differences and temporal variations of technology innovation based on industrial above-scale enterprises of 31 provinces in China from 2008 to 2015. The empirical results show that innovation investment is a determinant of technology innovation in China, and is more and more significant; meanwhile a wide gap of innovation resource between Eastern China and Western China exists. In general, the enterprise scale has a negative effect: with enlargement of enterprise in China, the innovation efficiency of enterprise will decline, while the effect has regional disparity, with positive influence in Central and Western China, and negative influence in Eastern China. Government support has negative effects on technology innovation: indirect equity investment contributes more to technology innovation than direct fund support. Innovation environment has positive and weak effects on technology innovation, but it is the biggest obstacle in Western China, and the innovation environment in China has improved continuously. This paper provides new evidence that can shine some light on determining the factors affecting technology innovation, and also presents a novel approach, which comprises characteristics of nonlinear function approximation, high accuracy and a small sample.

Single and Cumulative Relations of Social Risk Factors with Children's Dental Health and Care-Utilization Within Regions of the United States.

Science.gov (United States)

Yang, Alyssa J; Gromoske, Andrea N; Olson, Melissa A; Chaffin, Jeffrey G

2016-03-01

The purpose is to examine the relation of social risk factors, and the cumulative burden of social risk factors, on parent-reported dental health and dental care-seeking behavior. National Survey of Children's Health data (2011-2012) were analyzed for US children by Title V Block Grant regions. Multivariate logistic regressions were estimated for ten social risk factors, as well as a cumulative risk index, to find any associations with poor condition of teeth, presence of dental caries, and no dental care visits. Almost all of the risk factors were significantly associated with poor condition of teeth and presence of dental caries for the US. Models associating no dental care visits suggested that low family income (OR 1.58), poor maternal mental health (OR 1.54), high school education or less (OR 1.34), and multi-racial/other race (OR 1.18) were significant factors for the US. Regional variation existed for those risk factors and their association with the outcomes, but income, education, and poor maternal mental health consistently played a significant role in adverse outcomes. The cumulative risk index was strongly related to poor oral health outcomes, with a weaker relationship to dental care utilization. US children experiencing certain social risk factors, such as low family income, high school education or less, and poor maternal mental health, are likely to be at greater risk for poor dental health and low levels of dental-care seeking behavior. Children experiencing multiple social risks are at greater risk for poor oral outcomes than children who experience fewer social risks. An approach that involves the social determinants of health is needed to address these issues.

Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

International Nuclear Information System (INIS)

Kim, Kyungsik

2011-01-01

We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

Factors affecting performance of hospital nurses in Riyadh Region, Saudi Arabia.

Science.gov (United States)

Al-Ahmadi, Hanan

2009-01-01

The purpose of this paper is to identify factors influencing performance of hospital nurses in Riyadh Region, Saudi Arabia. Specific objectives were to estimate self-reported performance, and determine whether differences in employee demographics, job satisfaction, and organizational commitment, influenced performance. In total, 15 hospitals were randomly selected. The questionnaire was sent to all nurses (1,834) in these facilities and 923 nurses responded. Statistical analysis included correlation, t-test, and regression analysis. The study finds that job performance is positively correlated with organizational commitment, job satisfaction and personal and professional variables. Both job satisfaction and organizational commitment are strong predictors of nurses' performance. Job performance is positively related to some personal factors, including years of experience, nationality, gender, and marital status. Level of education is negatively related to performance. The findings of this study have a limited generalisability due to the fact that all measures used are based on self-reports. Future research may be directed to other objective measures of performance. Emphasis should be placed on effective supervision, empowerment, and a better reward system. Cultural diversity is a reality for most health organizations in Saudi Arabia; therefore, they need to adopt effective human resources strategies that aim to improve commitment and retention of qualified workers, and build a high performance organizational culture based on empowerment, open communication, and appreciation of impact of national culture on work attitudes. This study fulfills a research gap in the area of nursing performance, and its relationship with work attitudes in Saudi Arabia. The paper also highlights the impact of national culture on job performance and work attitude among nurses in Saudi Arabia, and other countries facing the issue of multi-national work force.

Logit Model of Analysing the Factors Affecting the Adoption of Goat Raising Activity by Farmers in the Non-pastoral Centre Region of Cameroon

Directory of Open Access Journals (Sweden)

Folefack, AJZ.

2018-01-01

Full Text Available Three years after the beginning of a goat project in the Centre region of Cameroon, the engagement of farmers in this activity has been timid. As this region is not a traditional pastoral zone, farmers have not yet incorporated the crop-livestock integration into their habits. Hence, this paper uses a logistic regression approach in order to analyse the factors affecting the adoption of goat raising activity by farmers of this locality. The computed odds ratio indicate that the practice of goat raising activity is significantly influenced by the farmer's age, gender, farming experience, practice of other livestock activities, frequency of contact with extension agents, access to credit and farm income. However, being a goat raiser does not depend on the farmer's marital status, education, farm size, household size, membership into a common initiative group. The study therefore recommends that the government authorities should give more attention to significant factors so as to popularize the goat raising activity in this region.

Emergence of regional clusters

DEFF Research Database (Denmark)

Dahl, Michael S.; Østergaard, Christian Richter; Dalum, Bent

2010-01-01

The literature on regional clusters has increased considerably during the last decade. The emergence and growth patterns are usually explained by such factors as unique local culture, regional capabilities, tacit knowledge or the existence of location-specific externalities (knowledge spillovers...

Deuteron electromagnetic form factors in the transitional region between nucleon-meson and quark-gluon pictures

International Nuclear Information System (INIS)

Kobushkin, A.P.; Syamtomov, A.I.

1994-01-01

Experimental observables of the elastic ed-scattering in the region of intermediate energies are discussed. We offer the numerical analysis of the available experimental data, which reproduces the results of the calculations with popular NN-potentials at low energies (Q 2 2 ), but, at the same time, provides the right asymptotic behavior of the deuteron e.m. form factors, following from the quark counting rules, at high energies (Q 2 >>1(GeV/c) 2 ). The numerical analysis developed allows to make certain estimations of the characteristic energy scale, at what the consideration of quark-gluon degrees of freedom in the deuteron becomes essential. (author). 18 refs., 2 tab., 10 figs

Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

International Nuclear Information System (INIS)

Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

2015-01-01

Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

Screening of the transcriptional regulatory regions of vascular endothelial growth factor receptor 2 (VEGFR2 in amyotrophic lateral sclerosis

Directory of Open Access Journals (Sweden)

Hartley Judith

2007-04-01

Full Text Available Abstract Background Vascular endothelial growth factor (VEGF has neurotrophic activity which is mediated by its main agonist receptor, VEGFR2. Dysregulation of VEGF causes motor neurone degeneration in a mouse model of amyotrophic lateral sclerosis (ALS, and expression of VEGFR2 is reduced in motor neurones and spinal cord of patients with ALS. Methods We have screened the promoter region and 4 exonic regions of functional significance of the VEGFR2 gene in a UK population of patients with ALS, for mutations and polymorphisms that may affect expression or function of this VEGF receptor. Results No mutations were identified in the VEGFR2 gene. We found no association between polymorphisms in the regulatory regions of the VEGFR2 gene and ALS. Conclusion Mechanisms other than genetic variation may downregulate expression or function of the VEGFR2 receptor in patients with ALS.

Image patch analysis of sunspots and active regions

Directory of Open Access Journals (Sweden)

Moon Kevin R.

2016-01-01

Full Text Available Context. Separating active regions that are quiet from potentially eruptive ones is a key issue in Space Weather applications. Traditional classification schemes such as Mount Wilson and McIntosh have been effective in relating an active region large scale magnetic configuration to its ability to produce eruptive events. However, their qualitative nature prevents systematic studies of an active region’s evolution for example. Aims. We introduce a new clustering of active regions that is based on the local geometry observed in Line of Sight magnetogram and continuum images. Methods. We use a reduced-dimension representation of an active region that is obtained by factoring the corresponding data matrix comprised of local image patches. Two factorizations can be compared via the definition of appropriate metrics on the resulting factors. The distances obtained from these metrics are then used to cluster the active regions. Results. We find that these metrics result in natural clusterings of active regions. The clusterings are related to large scale descriptors of an active region such as its size, its local magnetic field distribution, and its complexity as measured by the Mount Wilson classification scheme. We also find that including data focused on the neutral line of an active region can result in an increased correspondence between our clustering results and other active region descriptors such as the Mount Wilson classifications and the R-value. Conclusions. Matrix factorization of image patches is a promising new way of characterizing active regions. We provide some recommendations for which metrics, matrix factorization techniques, and regions of interest to use to study active regions.

An allelic polymorphism within the human tumor necrosis factor alpha promoter region is strongly associated with HLA A1, B8, and DR3 alleles

NARCIS (Netherlands)

Wilson, A. G.; de Vries, N. [=Niek; Pociot, F.; di Giovine, F. S.; van der Putte, L. B.; Duff, G. W.

1993-01-01

The tumor necrosis factor (TNF) alpha gene lies within the class III region of the major histocompatibility complex (MHC), telomeric to the class II and centromeric to the class I region. We have recently described the first polymorphism within the human TNF-alpha locus. This is biallelic and lies

Knowledge assessment of women living in the Wielkopolska region concerning risk factors for cervical cancer

Directory of Open Access Journals (Sweden)

Dorota Gawdzik

2015-01-01

Full Text Available Introduction: Cervical cancer (CC is a malignant tumor which for many years has been a serious epidemiological problem in Poland. This issue is important because CC is the second most common type of malignant tumor, after breast cancer, and the second most common cause of death among women. The aim of this study was to assess the knowledge and awareness of women living in the Wielkopolska region (Gniezno district of risk factors for cervical cancer. Material and methods: The study used the diagnostic poll method, based on a previously developed survey questionnaire. The study was carried out between March and April 2013. The study group consisted of 100 women, involving schoolgirls from the secondary school in Gniezno (Group I, workers (doctors, nurses and midwives of two outpatient clinics in the Gniezno district (Group II and patients of the same clinics (Group III. Results : According to the respondents, the main cause of CC is human papillomavirus (Group II – 36% and genetic predisposition (Group III – 35%. It is alarming that 26% of women did not know the risk factors for CC. Conclusions : It is necessary to improve health education, especially concerning the main factors affecting the development of CC, in order to reduce the morbidity and mortality rates related to this cancer.

Khat chewing among students of higher education in Jazan region, Saudi Arabia: prevalence, pattern, and related factors.

Science.gov (United States)

Alsanosy, Rashad Mohammed; Mahfouz, Mohamed Salih; Gaffar, Abdelrahim Mutwakel

2013-01-01

(1) To estimate the prevalence and behavioral patterns of Khat chewing and (2) to investigate factors that influenced the pattern of Khat use among undergraduate students in different higher education institutions in Jazan region, Saudi Arabia. A cross-sectional study using a pretested structured self-administered quantitative questionnaire was used to collect data. SPSS version 17 software program was used for data analysis. The overall current Khat chewing prevalence among higher education students was found to be 23.1%, significantly higher among males at 38.5% than among females at 2.1% (P higher compared with females at 3.7% (P higher education students in Jazan region. A multilevel, value based, comprehensive, and strategic long-term intervention plan is needed. The comprehensive plan may include social interventions geared by creating recreations alternatives and opportunities for youth and a critical review for current authorities' interventions and services.

Regional differences in the CO_2 emissions of China's iron and steel industry: Regional heterogeneity

International Nuclear Information System (INIS)

Xu, Bin; Lin, Boqiang

2016-01-01

Identifying the key influencing factors of CO_2 emissions in China's iron and steel industry is vital for mitigating its emissions and formulating effective environmental protection measures. Most of the existing researches utilized time series data to investigate the driving factors of the industry's CO_2 emission at the national level, but regional differences have not been given appropriate attention. This paper adopts provincial panel data from 2000 to 2013 and panel data models to examine the key driving forces of CO_2 emissions at the regional levels in China. The results show that industrialization dominates the industry's CO_2 emissions, but its effect varies across regions. The impact of energy efficiency on CO_2 emissions in the eastern region is greater than in the central and western regions because of a huge difference in R&D investment. The influence of urbanization has significant regional differences due to the heterogeneity in human capital accumulation and real estate development. Energy structure has large potential to mitigate CO_2 emissions on account of increased R&D investment in energy-saving technology and expanded clean energy use. Hence, in order to effectively achieve emission reduction, local governments should consider all these factors as well as regional heterogeneity in formulating appropriate mitigation policies. - Highlights: • We explore the driving forces of CO_2 emissions in China's steel industry. • Industrialization dominates CO_2 emissions in the iron and steel industry. • Energy structure has large potential to mitigate CO_2 emissions in the steel industry. • The influence of urbanization has significant regional differences.

Prevalence of intestinal parasitic infections and associated risk factors among schoolchildren in the Plateau Central and Centre-Ouest regions of Burkina Faso.

Science.gov (United States)

Erismann, Séverine; Diagbouga, Serge; Odermatt, Peter; Knoblauch, Astrid M; Gerold, Jana; Shrestha, Akina; Grissoum, Tarnagda; Kaboré, Aminata; Schindler, Christian; Utzinger, Jürg; Cissé, Guéladio

2016-10-18

Unsafe drinking water, unimproved sanitation and lack of hygiene pose health risks, particularly to children in low- and middle-income countries. This study aimed to assess the prevalence and risk factors of intestinal parasitic infections in school-aged children in two regions of Burkina Faso. A cross-sectional survey was carried out in February 2015 with 385 children aged 8-14 years from eight randomly selected schools in the Plateau Central and Centre-Ouest regions of Burkina Faso. Stool samples were subjected to the Kato-Katz and a formalin-ether concentration method for the diagnosis of helminths and intestinal protozoa infections. Urine samples were examined with a urine filtration technique for Schistosoma haematobium eggs. Water samples from community sources (n = 37), children's households (n = 95) and children's drinking water cups (n = 113) were analysed for contamination with coliform bacteria and faecal streptococci. Data on individual and family-level risk factors were obtained using a questionnaire. Mixed logistic regression models were employed to determine factors associated with intestinal parasitic infections in schoolchildren. Intestinal parasitic infections were highly prevalent; 84.7 % of the children harboured intestinal protozoa, while helminth infections were diagnosed in 10.7 % of the children. We found significantly lower odds of pathogenic intestinal protozoa infection (Entamoeba histolytica/E. dispar and Giardia intestinalis) among children from the Plateau Central, compared to the Centre-Ouest region (P parasitic infections in children. Intestinal protozoa but not helminths were highly prevalent among schoolchildren in randomly selected schools in two regions of Burkina Faso. Our findings call for specific public health measures tailored to school-aged children and rural communities in this part of Burkina Faso. It will be interesting to assess the effect of water, sanitation and hygiene interventions on the

A functional SNP in the regulatory region of the decay-accelerating factor gene associates with extraocular muscle pareses in myasthenia gravis

KAUST Repository

Heckmann, J M

2009-08-13

Complement activation in myasthenia gravis (MG) may damage muscle endplate and complement regulatory proteins such as decay-accelerating factor (DAF) or CD55 may be protective. We hypothesize that the increased prevalence of severe extraocular muscle (EOM) dysfunction among African MG subjects reported earlier may result from altered DAF expression. To test this hypothesis, we screened the DAF gene sequences relevant to the classical complement pathway and found an association between myasthenics with EOM paresis and the DAF regulatory region c.-198CG SNP (odds ratio8.6; P0.0003). This single nucleotide polymorphism (SNP) results in a twofold activation of a DAF 5?-flanking region luciferase reporter transfected into three different cell lines. Direct matching of the surrounding SNP sequence within the DAF regulatory region with the known transcription factor-binding sites suggests a loss of an Sp1-binding site. This was supported by the observation that the c.-198CG SNP did not show the normal lipopolysaccharide-induced DAF transcriptional upregulation in lymphoblasts from four patients. Our findings suggest that at critical periods during autoimmune MG, this SNP may result in inadequate DAF upregulation with consequent complement-mediated EOM damage. Susceptible individuals may benefit from anti-complement therapy in addition to immunosuppression. © 2010 Macmillan Publishers Limited. All rights reserved.

Incompatibility between X chromosome factor and pericentric heterochromatic region causes lethality in hybrids between Drosophila melanogaster and its sibling species.

Science.gov (United States)

Cattani, M Victoria; Presgraves, Daven C

2012-06-01

The Dobzhansky-Muller model posits that postzygotic reproductive isolation results from the evolution of incompatible epistatic interactions between species: alleles that function in the genetic background of one species can cause sterility or lethality in the genetic background of another species. Progress in identifying and characterizing factors involved in postzygotic isolation in Drosophila has remained slow, mainly because Drosophila melanogaster, with all of its genetic tools, forms dead or sterile hybrids when crossed to its sister species, D. simulans, D. sechellia, and D. mauritiana. To circumvent this problem, we used chromosome deletions and duplications from D. melanogaster to map two hybrid incompatibility loci in F(1) hybrids with its sister species. We mapped a recessive factor to the pericentromeric heterochromatin of the X chromosome in D. simulans and D. mauritiana, which we call heterochromatin hybrid lethal (hhl), which causes lethality in F(1) hybrid females with D. melanogaster. As F(1) hybrid males hemizygous for a D. mauritiana (or D. simulans) X chromosome are viable, the lethality of deficiency hybrid females implies that a dominant incompatible partner locus exists on the D. melanogaster X. Using small segments of the D. melanogaster X chromosome duplicated onto the Y chromosome, we mapped a dominant factor that causes hybrid lethality to a small 24-gene region of the D. melanogaster X. We provide evidence suggesting that it interacts with hhl(mau). The location of hhl is consistent with the emerging theme that hybrid incompatibilities in Drosophila involve heterochromatic regions and factors that interact with the heterochromatin.

Regional trends and controlling factors of fatal landslides in Latin America and the Caribbean

Science.gov (United States)

Sepúlveda, S. A.; Petley, D. N.

2015-04-01

A database of landslides that caused loss of life in Latin America and the Caribbean in the period from 2004 and 2013 inclusive has been compiled using established techniques. This database indicates that in the ten year period a total of 11 631 people lost their lives across the region in 611 landslides. The geographical distribution of the landslides is very heterogeneous, with areas of high incidence in parts of the Caribbean (most notably Haiti), Central America, Colombia, and SE. Brazil. The number of landslides varies considerably between years; the El Niño/La Niña cycle emerges as a major factor controlling this variation, although the study period did not capture a large event. Analysis suggests that on a continental scale the mapped factors that best explain the observed distribution are topography, annual precipitation and population density. On a national basis we have compared the occurrence of fatality-inducing landslide occurrence with the production of research articles with a local author, which shows that there is a landslide research deficit in Latin America and the Caribbean. Understanding better the mechanisms, distributions causes and triggers of landslides in Latin America and the Caribbean must be an essential first step towards managing the hazard.

Factors associated with induced abortion at selected hospitals in the Volta Region, Ghana

Directory of Open Access Journals (Sweden)

Klutsey EE

2014-08-01

Full Text Available Ellen Eyi Klutsey,1 Augustine Ankomah2 1School of Nursing and Midwifery, University of Health and Allied Sciences, Ho, Volta Region, 2Department of Population, Family and Reproductive Health School of Public Health, University of Ghana, Legon, Accra, Ghana Background: Induced abortion rates remained persistently high in the Volta Region of Ghana in the 5 years from 2006 to 2011. Some hospitals, both rural and urban, report induced abortion-related complications as one of the top ten conditions in hospital admissions. This study explored demographic and other factors associated with induced abortion, and also assessed awareness of abortion-related complications among women of reproductive age in the Volta Region. Methods: A quantitative, hospital-based, unmatched case-control study was performed. The Volta Region was stratified into two health administration zones, ie, north and south. For each zone, hospitals were stratified into government and private hospitals. Employing simple random sampling, one private and three government hospitals were selected from each zone. This study is therefore based on eight hospitals, ie, six government hospitals and two private hospitals. Results: Marital status, employment status, number of total pregnancies, and knowledge about contraception were found to be associated with induced abortion. Multiple logistic regression showed a 4% reduction in the odds of induced abortion in married women compared with women who were single (odds ratio [OR] 0.11, 95% confidence interval [CI] 0.07–0.22. Unemployed women of reproductive age were found to be 0.35 times less likely to seek induced abortion compared with their employed counterparts (OR 0.35, CI 0.19–0.65. It was also observed that women with their second pregnancies were 3.8 times more likely to seek induced abortion and women with more than two pregnancies were 6.6 times more likely to do so (OR 3.81, CI 1.94–7.49 and OR 6.58, CI 2.58–16.79, respectively

Regional Disparities in the Transition Period

Directory of Open Access Journals (Sweden)

IBOLYA KURKÓ

2009-01-01

Full Text Available The abolishment of the communist regime, the establishment of a democratic legal and institutional system brought important changes in the development of the regional economy of Romania. The old – from an economic point of view – differentiating factors have lost some of their importance, mainly the level of industrialization, which, in the past, was used to measure economic development. In addition, other factors came forward, that correlate more with the economic capacity, but, nowadays, their positive effect can only be increased by the combination of several other factors: foreign investments, as an indicator of regional attractiveness, regional GDP, the level of personal income, and the appreciation of human resources. Today, in the interest of enhancing the competitiveness of the regions a special role is reserved for entrepreneurial activity, the strength of the SME sector, the role of foreign working capital in the local economy, but also the territorial concentration of R&D centers. The study focuses on some aspects of disparities regarding the regional economic structure.

Substance use and associated factors among preparatory school students in Bale Zone, Oromia Regional State, Southeast Ethiopia.

Science.gov (United States)

Dida, Nagasa; Kassa, Yibeltal; Sirak, Teshome; Zerga, Ephrem; Dessalegn, Tariku

2014-08-09

The use of cigarettes, alcohol, khat, and other substances is a worldwide threat which especially affects young people and which is also common among the youth of Ethiopia. However, its prevalence and associated factors have not been addressed well yet. Thus, this study aimed to assess the prevalence and associated factors of substance use among preparatory school students in Bale Zone, Oromia Regional State, Southeast Ethiopia. An institutional-based cross-sectional study was conducted among 603 randomly selected students from five of eight preparatory schools of Bale Zone, Oromia Regional State, Southeast Ethiopia, in March 2013. The sample size was calculated by a single population proportion formula and allocated proportionally for the schools based on the number of students. A pretested structured questionnaire was used to collect the data. The data were analyzed using SPSS version 16.0. Descriptive, bivariate, and multivariate logistic regressions were employed to identify the predictors of substance use. The overall current prevalence of substance use among the respondents was 34.8% (210). Specifically, 23.6% (102) and 4.6% (28) of the respondents chewed khat and smoked cigarette, respectively. Sex, age, and substance use status of the respondents' father, mother, siblings, and best friend had an association with substance use. Male respondents were about ten times more at risk of practicing substance use compared to female respondents [adjusted odds ratio (AOR) 11.37, 95% confidence interval (CI) 4.42-29.23]. Respondents whose sibling(s) smokes cigarette were four times more likely to use substance (AOR 4.44, 95% CI 1.11-17.79). Respondents whose best friend chews khat were 11 times more likely to use substance when compared with those whose best friend does not practice the given factor (AOR 11.15, 95% CI 4.43-28.07). Respondents whose family uses one or more substances were more likely use substance(s). Respondents whose best friend uses substance(s) were

Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

International Nuclear Information System (INIS)

Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

1988-01-01

The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

Forecasting the Optimal Factors of Formation of the Population Savings as the Basis for Investment Resources of the Regional Economy

Directory of Open Access Journals (Sweden)

Odintsova Tetiana M.

2017-04-01

Full Text Available The article is aimed at studying the optimal factors of formation of the population savings as the basis for investment resources of the regional economy. A factorial (nonlinear correlative-regression analysis of the formation of savings of the population of Ukraine was completed. On its basis a forecast of the optimal structure and volumes of formation of the population incomes was carried out taking into consideration impact of fundamental factors on these incomes. Such approach provides to identify the marginal volumes of tax burden, population savings, and capital investments, directed to economic growth.

Postpartum practices of puerperal women and their influencing factors in three regions of Hubei, China

Directory of Open Access Journals (Sweden)

Chen Banghua

2006-11-01

Full Text Available Abstract Background 'Sitting month' is a Chinese tradition for women's postpartum custom. The present study aims to explore the postpartum dietary and health practices of puerperal women and identify their influential factors in three selected regions of Hubei, China. Methods A cross-sectional retrospective study was conducted in the selected urban, suburban and rural areas in the province of Hubei from 1 March to 30 May 2003. A total of 2100 women who had given birth to full-term singleton infants in the past two years were selected as the participants. Data regarding postpartum practices and potentially related factors were collected through questionnaire by trained investigators. Results During the puerperium, 18% of the participants never ate vegetables, 78.8% never ate fruit and 75.7% never drank milk. Behaviour taboos such as no bathing, no hair washing or teeth brushing were still popular among the participants. About half of the women didn't get out of the bed two days after giving birth. The average time they stayed in bed during this period was 18.0 h. One third of them didn't have any outdoor activities in that time periods. The educational background of both women and their spouses, location of their residence, family income, postnatal visit, nutrition and health care educational courses were found to be the influencing factors of women's postpartum practices. Conclusion Traditional postpartum dietary and health behaviours were still popular among women in Hubei. Identifying the factors associated with traditional postpartum practices is critical to develop better targeting health education programs. Updated Information regarding postpartum dietary and health practices should be disseminated to women.

A review of the combination among global change factors in forests, shrublands and pastures of the Mediterranean Region: Beyond drought effects

Science.gov (United States)

Doblas-Miranda, E.; Alonso, R.; Arnan, X.; Bermejo, V.; Brotons, L.; de las Heras, J.; Estiarte, M.; Hódar, J. A.; Llorens, P.; Lloret, F.; López-Serrano, F. R.; Martínez-Vilalta, J.; Moya, D.; Peñuelas, J.; Pino, J.; Rodrigo, A.; Roura-Pascual, N.; Valladares, F.; Vilà, M.; Zamora, R.; Retana, J.

2017-01-01

Climate change, alteration of atmospheric composition, land abandonment in some areas and land use intensification in others, wildfires and biological invasions threaten forests, shrublands and pastures all over the world. However, the impacts of the combinations between global change factors are not well understood despite its pressing importance. Here we posit that reviewing global change factors combination in an exemplary region can highlight the necessary aspects in order to better understand the challenges we face, warning about the consequences, and showing the challenges ahead of us. The forests, shrublands and pastures of the Mediterranean Basin are an ideal scenario for the study of these combinations due to its spatial and temporal heterogeneity, increasing and diverse human population and the historical legacy of land use transformations. The combination of multiple global change factors in the Basin shows different ecological effects. Some interactions alter the effects of a single factor, as drought enhances or decreases the effects of atmospheric components on plant ecophysiology. Several interactions generate new impacts: drought and land use changes, among others, alter water resources and lead to land degradation, vegetation regeneration decline, and expansion of forest diseases. Finally, different factors can occur alone or simultaneously leading to further increases in the risk of fires and biological invasions. The transitional nature of the Basin between temperate and arid climates involves a risk of irreversible ecosystem change towards more arid states. However, combinations between factors lead to unpredictable ecosystem alteration that goes beyond the particular consequences of drought. Complex global change scenarios should be studied in the Mediterranean and other regions of the world, including interregional studies. Here we show the inherent uncertainty of this complexity, which should be included in any management strategy.

The Influence of Globalization, Integration and Regionalization Processes on the European States and Regions

Directory of Open Access Journals (Sweden)

T V Bazarenko

2013-12-01

Full Text Available The article deals with the impact of globalization, regionalization and integration in European countries and regions. It discusses the distinctive features and factors of influence of each of these processes on the European countries and sub national entities.

Factors affecting regional changes in hardwood lumber production

Science.gov (United States)

William G. Luppold; Gilbert P. Dempsey; Gilbert P. Dempsey

1994-01-01

Hardwood lumber production increased by nearly 1.8 billion board feet between 1986 and 1990 and decreased sharply in 1991. However, not all areas of the country experienced the same growth in hardwood lumber production during the 1980s. While lumber production in inland regions of the eastern United States and the west increased during the 1980s, lumber output in...

Investigation of functional aspects of the N-terminal region of elongation factor Tu from Escherichia coli using a protein engineering approach

DEFF Research Database (Denmark)

Laurberg, M; Mansilla, Francisco; Clark, Brian F. C.

1998-01-01

The function of the N-terminal region of elongation factor Tu is still unexplained. Until recently, it has not been visible in electron density maps from x-ray crystallography studies, but the presence of several well conserved basic residues suggest that this part of the molecule is of structural...

Family planning use and associated factors among pastoralist community of afar region, eastern Ethiopia.

Science.gov (United States)

Alemayehu, Mussie; Lemma, Hailemariam; Abrha, Kidan; Adama, Yohannes; Fisseha, Girmatsion; Yebyo, Henock; Gebeye, Ejigu; Negash, Kassahun; Yousuf, Jemal; Fantu, Tigist; Gebregzabher, Tesfay; Medhanyie, Araya Abrha

2016-07-18

Ethiopia is the second most populous country in Africa with a total fertility rate (TFR) of 4.8 children per a woman and contraceptive prevalence rate (CPR) of 29 %. The overall prevalence of modern family planning in a pastoralist community, like Afar region, is low (9.1 %). This study aimed to assess family planning utilization and associated factors among married women of Afar region, Eastern Ethiopia. A community-based cross-sectional study was conducted from January 10-28, 2013 among 602 women. Multistage sampling technique was used to select the study participants. Descriptive and multiple variable logistic regression analyses were done to isolate independent predictors on utilization of family planning using SPSS 20. The overall prevalence of family planning utilization in Afar region was 8.5 % (6.2-10.7). Majority of the women (92.2 %) had used injectable. The most common reasons mentioned in the non-use of family planning methods were religion-related (85.3 %), desire to have more children (75.3 %), and husband's objection (70.1 %). Women who had a positive attitude towards family planning utilization (AOR = 4.7, 95 % CI: 2.1, 10.3), owning radio (AOR = 1.8, 95 % CI: 1.02, 4.18), and literate (AOR = 4.4, 95 % CI: 1.80, 11.08) were more likely to use family planning methods as compared to their counterparts. The increase of monthly income was also associated with the likelihood of family planning methods utilization. The odds of using family planning methods were higher among those with monthly income of $27-$55.5 (AOR = 2. 0, 95 % CI: 1.9, 4.7) and > $55 (AOR = 4. 6, 95 % CI: 1.23-17.19) as compared to women with the lowest category of monthly income ($27 and less). The low coverage of family planning in the region could be due to the influence of husband, religious and clan leader. Attitude of women towards family planning methods, possession of radio, monthly income, and educational status could influence family

How can design be a platform for the development of a regional cluster in the Region of Southern Denmark

DEFF Research Database (Denmark)

Jensen, Susanne; Christensen, Poul Rind

2013-01-01

Analyses of key factors for the emergence of a cluster and the formation of a design cluster in the region of Southern Denmark......Analyses of key factors for the emergence of a cluster and the formation of a design cluster in the region of Southern Denmark...

Specific protein supplementation using soya, casein or whey differentially affects regional gut growth and luminal growth factor bioactivity in rats; implications for the treatment of gut injury and stimulating repair.

Science.gov (United States)

Marchbank, Tania; Mandir, Nikki; Calnan, Denis; Goodlad, Robert A; Podas, Theo; Playford, Raymond J

2018-01-24

Modulation of regional growth within specific segments of the bowel may have clinical value for several gastrointestinal conditions. We therefore examined the effects of different dietary protein sources on regional gut growth and luminal growth factor bioactivity as potential therapies. Rats were fed for 14 days on isonitrogenous and isocaloric diets comprising elemental diet (ED) alone (which is known to cause gut atrophy), ED supplemented with casein or whey or a soya protein-rich feed. Effects on regional gut growth and intraluminal growth factor activity were then determined. Despite calorie intake being similar in all groups, soya rich feed caused 20% extra total body weight gain. Stomach weight was highest on soya and casein diets. Soya enhanced diet caused greatest increase in small intestinal weight and preserved luminal growth factor activity at levels sufficient to increase proliferation in vitro. Regional small intestinal proliferation was highest in proximal segment in ED fed animals whereas distal small intestine proliferation was greater in soya fed animals. Colonic weight and proliferation throughout the colon was higher in animals receiving soya or whey supplemented feeds. We conclude that specific protein supplementation with either soya, casein or whey may be beneficial to rest or increase growth in different regions of the bowel through mechanisms that include differentially affecting luminal growth factor bioactivity. These results have implications for targeting specific regions of the bowel for conditions such as Crohn's disease and chemotherapy.

The influence of local- and landscape-level factors on wetland breeding birds in the Prairie Pothole Region of North and South Dakota

Science.gov (United States)

Igl, Lawrence D.; Shaffer, Jill A.; Johnson, Douglas H.; Buhl, Deborah A.

2017-08-17

We examined the relationship between local- (wetland) and landscape-level factors and breeding bird abundances on 1,190 depressional wetlands in the Prairie Pothole Region of North and South Dakota during the breeding seasons in 1995–97. The surveyed wetlands were selected from five wetland classes (alkali, permanent, semipermanent, seasonal, or temporary), two wetland types (natural or restored), and two landowner groups (private or Federal). We recorded 133 species of birds in the surveyed wetlands during the 3 years. We analyzed the nine most common (or focal) species (that is, species that were present in 25 percent or more of the 1,190 wetlands): the Red-winged Blackbird (Agelaius phoeniceus), Blue-winged Teal (Anas discors), Mallard (Anas platyrhynchos), American Coot (Fulica americana), Gadwall (Anas strepera), Common Yellowthroat (Geothlypis trichas), Yellow-headed Blackbird (Xanthocephalus xanthocephalus), Northern Shoveler (Anas clypeata), and Savannah Sparrow (Passerculus sandwichensis). Our results emphasize the ecological value of all wetland classes, natural and restored wetlands, and publicly and privately owned wetlands in this region, including wetlands that are generally smaller and shallower (that is, temporary and seasonal wetlands) and thus most vulnerable to drainage. Blue-winged Teal, Northern Shoveler, Gadwall, Common Yellowthroat, and Red-winged Blackbird had higher abundances on Federal than on private wetlands. Abundances differed among wetland classes for seven of the nine focal species: Blue-winged Teal, Northern Shoveler, Mallard, American Coot, Common Yellowthroat, Yellow-headed Blackbird, Red-winged Blackbird. American Coot had higher abundances on restored wetlands than on natural wetlands overall, and Gadwall and Common Yellowthroat had higher abundances on private restored wetlands than on private natural wetlands. The Common Yellowthroat was the only species that had higher abundances on restored private wetlands than on

Prevalence of anti-pestivirus antibodies and risk factors in dairy goats from the semiarid region of Paraíba State, Northeastern Brazil

Directory of Open Access Journals (Sweden)

Maria Luana Cristiny Rodrigues Silva

2014-06-01

Full Text Available t The aim of this survey was to determine the prevalence of anti-pestivirus antibodies in dairy goats from the semiarid region of the Paraíba state, Northeastern Brazil, as well as to identify risk factors associated with the flock-level prevalence. A total of 1,092 dairy goats from 110 flocks randomly selected in the county of Monteiro, Paraíba state, during March 2009 to March 2010, were used. In each selected flock a epidemiological questionnaire was applied to verify the occurrence of possible factors that could be associated with the flock-level prevalence. For the serological diagnosis of Pestivirus infection the serum neutralization test, using the BVDV-1 NADL strain, was carried out. Flock-level prevalence was 6.36% (95% CI = 2.60% – 12.67% and animal-level prevalence was 0.82% (95% CI = 0.38% – 1.56%. Not to perform vermifugation (odds ratio = 10.49; p = 0.035 and to perform navel cut and disinfection (odds ratio = 12.73; p = 0.034 were identified as risk factors. These results indicate viral circulation in dairy goats in the semiarid region of the Paraíba state.

Determinants of changes in agriculture and rural areas in the Piła sub-region in the light of factor analysis

Directory of Open Access Journals (Sweden)

Andrzej Czyżewski

2017-07-01

of road and social infrastructure in municipalities in the Piła sub-region and it explained 9.15% of the communality. These factors were induced by natural conditions, farm production constraints, the level of entrepreneurship, the situation on the labour market, which contributed to the development of sub-urbanization and the development of road and social infrastructure, as well as their derivatives, such as income levels, development of the building industry and early school education. Agriculture destimulated the development of municipalities in the Piła sub-region during the period under study.

Identification and comparative analysis of factors influencing road safety in US regions and in Polish voivodeships

Directory of Open Access Journals (Sweden)

Joanna WACHNICKA

2013-01-01

Full Text Available Analyses of road safety at national level have been run for many years and large number of publications concerning them appeared so far. How interdisciplinary the issue is, has been shown by literature studies done by the author of the paper. It appears that economists, mathematicians, doctors as well as engineers have studied the issue. It is not an easy one, as results of many analyses lead to conflicting conclusions and often fail to provide straightforward answers to questions asked. The administrative actions taken to improve road safety, uniform for the whole country, frequently fail to give expected results, including Poland’s case. Therefore there is a need to analyse what makes some provinces, and not the others, report improvement in road safety. This paper presents part of the work on author’s doctoral thesis, which analyses how regional characteristics may impact road safety in respective regions. However, during collection of data for the purpose of the doctoral thesis it turned out that many variables mentioned in literature as significant had not been collected on regional level in Europe, including Poland. There are, though, available data on respective American states, so the search for the best describing independent variables started from the analyses of US data. The analyses showed the impact of factors such as annual income per capita, transport activity, density of population, seatbelt rates, road and vehicle density, rate of doctors.

Prevalence, Clinical Presentation, and Factors Associated With Diabetic Foot Ulcer in Two Regional Hospitals in Cameroon.

Science.gov (United States)

Tindong, Maxime; Palle, John N; Nebongo, Daniel; Aminde, Leopold Ndemnge; Mboue-Djieka, Yannick; Mbarga, Nicole T Fouda; Dehayem, Mesmin Y; Choukem, Siméon-Pierre

2018-03-01

This study aimed to determine the prevalence of diabetic foot ulcer and high risk for ulceration, describe the clinical presentation, and identify factors associated with diabetic foot ulcer in the Southwest regional hospitals of Cameroon. In this cross-sectional study, data were collected using a structured questionnaire administered to consecutive patients with diabetes. Findings from detailed foot examination were recorded. Diabetic foot ulcer was diagnosed according to the International Working Group on Diabetic Foot (IWGDF) definition. Data were analyzed with Stata IC version 12. Of the 203 participants included, 63.1% were females. Age ranged from 26 to 96 years. The median duration of diabetes was 4.0 years (interquartile range 1.0-8.0 years). The prevalence of diabetic foot ulcer was 11.8% (24), of whom 29.2% (7) had high grade (grades 2 to 4), and most of the ulcers 58.3% (14) were located at the plantar region. The prevalence of high risk for ulceration was 21.8% (39). Loss of protective sensation (OR = 3.73, 95% CI = 1.43-9.71; P = .007), and peripheral arterial disease (OR = 3.48, 95% CI = 1.14-10.56; P = .028) were independently associated with diabetic foot. Diabetic foot ulcer is a common complication among patients with diabetes attending these regional hospitals. Loss of protective sensation, and peripheral arterial disease increase the odds of having diabetic foot ulcer, and we suggest them as the main target of interest for prevention.

Explaining the Allocation of Regional Structural Funds

DEFF Research Database (Denmark)

Charron, Nicholas

2016-01-01

What regional factors can explain the heterogeneity in Structural Funds distribution to European Union regions? Past studies have shown that aside from the level of economic development and rates of unemployment, other political, and economic factors systematically explain why certain European...... Union regions receive greater funding than others, in particular where there is room for bargaining. In this article, a novel theory is posited which argues that the determination of Structural Funds is based on an interaction between a region’s formal institutions (the level of a regional autonomy......) and informal institutions (its level of quality of government). In cases of low regional autonomy, member states and European Union level actors prefer to allocate greater levels of Funds to regions with lower quality of government in order to increase cohesion. Yet in cases of high regional autonomy, risks...

Impacts of climate change on mangrove ecosystems: A region by region overview

Science.gov (United States)

Ward, Raymond D.; Friess, Daniel A.; Day, Richard H.; MacKenzie, Richard A.

2016-01-01

Inter-related and spatially variable climate change factors including sea level rise, increased storminess, altered precipitation regime and increasing temperature are impacting mangroves at regional scales. This review highlights extreme regional variation in climate change threats and impacts, and how these factors impact the structure of mangrove communities, their biodiversity and geomorphological setting. All these factors interplay to determine spatially variable resiliency to climate change impacts, and because mangroves are varied in type and geographical location, these systems are good models for understanding such interactions at different scales. Sea level rise is likely to influence mangroves in all regions although local impacts are likely to be more varied. Changes in the frequency and intensity of storminess are likely to have a greater impact on N and Central America, Asia, Australia, and East Africa than West Africa and S. America. This review also highlights the numerous geographical knowledge gaps of climate change impacts, with some regions particularly understudied (e.g., Africa and the Middle East). While there has been a recent drive to address these knowledge gaps especially in South America and Asia, further research is required to allow researchers to tease apart the processes that influence both vulnerability and resilience to climate change. A more globally representative view of mangroves would allow us to better understand the importance of mangrove type and landscape setting in determining system resiliency to future climate change.

Factors and prospects of modernization of Russian regions development

Directory of Open Access Journals (Sweden)

Chernova Marija

2016-03-01

Full Text Available The content and efficiency of implementation of modernization processes in the economic system are, on the one hand, determined by the potential of the system and on the other hand by the consumers’ demand for manufactured modernization products (services. The article identifies and analyzes the main macroeconomic indicators that determine the prospects for modernization reforms in the economy of the Russian regions. Taking into consideration the fact, that for most Russian regions the greatest potential of modernization in the implementation of the projects of import substitution lies in the sphere of agricultural production, the consumer preferences of the population regarding domestic and foreign food products are assessed. Conclusion on priority measures for improving the competitiveness of domestic production in the framework of implementation of non-raw materials model of development of the domestic economy is made.

Success and failure factors in the regional health information system design process--results from a constructive evaluation study.

Science.gov (United States)

Nykänen, P; Karimaa, E

2006-01-01

To identify success and failure factors in the design process of a regional health information system. A constructive evaluation study including interviews, observations, usability study and document analysis. Modelling was found to be a key element for the successful implementation of a health information system. The developed service chain model helped to define use cases and to implement seamless service chains. User participation in the design process was a success factor resulting in good user acceptance and signs of positive impacts on work practices. Evaluation study also helped system developers to guide the system's further development. An important failure factor identified was the lack of semantic interoperability of the system components. The results emphasize the socio-technical nature of health information systems. The starting point for development should be thorough insight into the health care work practices where the information systems are to be used. Successful system design should start from modelling of work processes, data and information flows and definition of concepts and their relations. Health informatics as a scientific discipline provides theories and models for the design and development process.

COMPETITIVENESS IN REGIONAL DEVELOPMENT

Directory of Open Access Journals (Sweden)

ELENA MĂDĂLINA OPRIȚESCU

2012-12-01

Full Text Available The development and diversification of the economic activities, the stimulation of investments both in the public sector, but mainly in the private one, the reduction of unemployment, the improvement of living standards are just some of the concepts aimed at by the regional development. The main method which can lead to a balanced development of the regions is financing them differentially so that the underdeveloped regions would obtain proportionally more funds that the developed ones. At a region level, the main objective is represented by the more accelerated growth of the less developed regions, in an effort to diminish the inter-regional and intra-regional development disparities. A key role is played by the sustainable economic growth concept, while also analyzing the competitiveness at a regional level, as well as the main development factors.

Factors associated with non-attendance in a general practice super clinic population in regional Australia: A retrospective cohort study.

Science.gov (United States)

Nancarrow, Susan; Bradbury, Joanne; Avila, Catherine

2014-01-01

Non-attendance at medical appointments is associated with increased patient morbidity and is a significant drain on health service resources. Australian studies have focused on secondary healthcare settings, screening, and interventions to reduce non-attendance. To explore factors associated with non-attendance in a regional primary care setting. A retrospective cohort of all patients with a scheduled appointment between October 2011 and October 2013 at a regional, primary care clinic providing medical and allied health services in a region of New South Wales (NSW) serving a large Aboriginal population (10.7 per cent). Using multivariate logistic regression, non-attendance was regressed on a range of covariates, including number of appointments per person, gender and ethnicity, and day of the week. The overall proportion of missed appointments was 7.6 per cent. Risk factors for non-attendance were day of the week [Mondays (8.1 per cent), Fridays (8.0 per cent), and Thursdays (7.9 per cent), (χ2(4)= 20.208, pattend (FTA) (95% CI: 11-28%)]; Aboriginality (OR=4.022, 95% CI: 3.263, 4.956), and female gender (OR=1.077; 95% CI 1.024, 1.132). There was a trend toward an interaction between gender and Aboriginality, with Aboriginal females being the group most likely to miss appointments (OR=1.272, 95% CI: 0.949, 1.705). This is the largest study of non-attendance in an Australian primary healthcare setting. While not a typical setting, the study had the advantage of a large, mixed population. The suggested high rates of non-attendance by Aboriginal females have potentially important policy implications.

Epidemiological characterization and risk factors associated with Mycobacterium avium subsp. paratuberculosis infection in dairy goats in the Brazilian semiarid region

Directory of Open Access Journals (Sweden)

Theonys Diógenes Freitas

2015-02-01

Full Text Available The aim of this investigation was to conduct an epidemiological study and identify risk factors associated with the occurrence of paratuberculosis (Johne’s disease in dairy goats within the semiarid region of Paraíba State. The study was done during the period of March 2009 to July 2011, during which 727 female goats from 86 flocks from the city of Monteiro, Paraíba were investigated. For the serological diagnosis of Mycobacterium avium subsp. paratuberculosis (Map infection indirect ELISA tests (screening and confirmatory were performed. Of the 727 animals used six (0.82% were seropositive at the confirmatory test after screening, and of the 86 flocks six (6.97% presented at least one seropositive animal. In positive flocks the frequency of reactive animals ranged from 5.26% to 16.60%. Risk factors identified were production system (weaning and reproduction (odds ratio = 36.0; 95% CI = 2.6 –486.1; p < 0,001 and absence of technical infrastructure (odds ratio = 54.0; 95% CI = 4.5 –642.9; p < 0,001. It was concluded that Mycobacterium avium subsp. paratuberculosis is present in dairy goat flocks in the region; however, its influence on decrease productivity as well as the risk of transmission to humans through animal products must totally evaluated. Based on the analysis of risk factors, improvements are recommended for the technical infrastructure and the management of breeding goats.

Global and regional effects of potentially modifiable risk factors associated with acute stroke in 32 countries (INTERSTROKE): a case-control study.

Science.gov (United States)

O'Donnell, Martin J; Chin, Siu Lim; Rangarajan, Sumathy; Xavier, Denis; Liu, Lisheng; Zhang, Hongye; Rao-Melacini, Purnima; Zhang, Xiaohe; Pais, Prem; Agapay, Steven; Lopez-Jaramillo, Patricio; Damasceno, Albertino; Langhorne, Peter; McQueen, Matthew J; Rosengren, Annika; Dehghan, Mahshid; Hankey, Graeme J; Dans, Antonio L; Elsayed, Ahmed; Avezum, Alvaro; Mondo, Charles; Diener, Hans-Christoph; Ryglewicz, Danuta; Czlonkowska, Anna; Pogosova, Nana; Weimar, Christian; Iqbal, Romaina; Diaz, Rafael; Yusoff, Khalid; Yusufali, Afzalhussein; Oguz, Aytekin; Wang, Xingyu; Penaherrera, Ernesto; Lanas, Fernando; Ogah, Okechukwu S; Ogunniyi, Adesola; Iversen, Helle K; Malaga, German; Rumboldt, Zvonko; Oveisgharan, Shahram; Al Hussain, Fawaz; Magazi, Daliwonga; Nilanont, Yongchai; Ferguson, John; Pare, Guillaume; Yusuf, Salim

2016-08-20

Stroke is a leading cause of death and disability, especially in low-income and middle-income countries. We sought to quantify the importance of potentially modifiable risk factors for stroke in different regions of the world, and in key populations and primary pathological subtypes of stroke. We completed a standardised international case-control study in 32 countries in Asia, America, Europe, Australia, the Middle East, and Africa. Cases were patients with acute first stroke (within 5 days of symptom onset and 72 h of hospital admission). Controls were hospital-based or community-based individuals with no history of stroke, and were matched with cases, recruited in a 1:1 ratio, for age and sex. All participants completed a clinical assessment and were requested to provide blood and urine samples. Odds ratios (OR) and their population attributable risks (PARs) were calculated, with 99% confidence intervals. Between Jan 11, 2007, and Aug 8, 2015, 26 919 participants were recruited from 32 countries (13 447 cases [10 388 with ischaemic stroke and 3059 intracerebral haemorrhage] and 13 472 controls). Previous history of hypertension or blood pressure of 140/90 mm Hg or higher (OR 2·98, 99% CI 2·72-3·28; PAR 47·9%, 99% CI 45·1-50·6), regular physical activity (0·60, 0·52-0·70; 35·8%, 27·7-44·7), apolipoprotein (Apo)B/ApoA1 ratio (1·84, 1·65-2·06 for highest vs lowest tertile; 26·8%, 22·2-31·9 for top two tertiles vs lowest tertile), diet (0·60, 0·53-0·67 for highest vs lowest tertile of modified Alternative Healthy Eating Index [mAHEI]; 23·2%, 18·2-28·9 for lowest two tertiles vs highest tertile of mAHEI), waist-to-hip ratio (1·44, 1·27-1·64 for highest vs lowest tertile; 18·6%, 13·3-25·3 for top two tertiles vs lowest), psychosocial factors (2·20, 1·78-2·72; 17·4%, 13·1-22·6), current smoking (1·67, 1·49-1·87; 12·4%, 10·2-14·9), cardiac causes (3·17, 2·68-3·75; 9·1%, 8·0-10·2), alcohol consumption (2·09, 1·64

Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

Science.gov (United States)

Sandy, Charles; Masuka, Nyasha; Hazangwe, Patrick; Choto, Regis C.; Mutasa-Apollo, Tsitsi; Nkomo, Brilliant; Sibanda, Edwin; Mugurungi, Owen; Siziba, Nicholas

2017-01-01

Background. In 2013, the tuberculosis (TB) mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84%) were new cases compared with 314 (16%) retreatment cases. There were 1,538 (78%) TB/human immunodeficiency virus (HIV) coinfected patients, of whom 1,399 (91%) were on antiretroviral therapy (ART) with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282). Overall, 428 (22%) TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR) = 2.48 (95% CI 1.35–4.55)], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63)], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42)] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29)]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART. PMID:28352474

Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

Directory of Open Access Journals (Sweden)

Kudakwashe C. Takarinda

2017-01-01

Full Text Available Background. In 2013, the tuberculosis (TB mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84% were new cases compared with 314 (16% retreatment cases. There were 1,538 (78% TB/human immunodeficiency virus (HIV coinfected patients, of whom 1,399 (91% were on antiretroviral therapy (ART with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282. Overall, 428 (22% TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR = 2.48 (95% CI 1.35–4.55], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART.

Italian regional health system structure and expected cancer survival.

Science.gov (United States)

Vercelli, Marina; Lillini, Roberto; Quaglia, Alberto; Capocaccia, Riccardo

2014-01-01

Few studies deal with the association of socioeconomic and health system resource variables with cancer survival at the Italian regional level, where the greatest number of decisions about social and health policies and resource allocations are taken. The present study aimed to describe the causal relationships between socioeconomic and health system resource factors and regional cancer survival and to compute the expected cancer survival at provincial, regional and area levels. Age-standardized relative survival at 5 years from diagnosis of cases incident in 1995-1998 and followed up to 2004 were derived by gender for 11 sites from the Italian Association of Cancer Registries data bank. The socioeconomic and health system resource variables, describing at a regional level the macro-economy, demography, labor market, and health resources for 1995-2005, came from the Health for All database. A principal components factor analysis was applied to the socioeconomic and health system resource variables. For every site, linear regression models were computed considering the relative survival at 5 years as a dependent variable and the principal components factor analysis factors as independent variables. The factors described the socioeconomic and health-related features of the regional systems and were causally related to the characteristics of the patient taken in charge. The models built by the factors allowed computation of the expected relative survival at 5 years with very good concordance with those observed at regional, macro-regional and national levels. In the regions without any cancer registry, survival was coherent with that of neighboring regions with similar socioeconomic and health system resources characteristics. The models highlighted the causal correlations between socioeconomic and health system resources and cancer survival, suggesting that they could be good evaluation tools for the efficiency of the resources allocation and use.

Selected Factors Determining Inward of Foreign Direct Investment in the Czech Regions in Years 2002 to 2012

Directory of Open Access Journals (Sweden)

Ondřej Babuněk

2017-09-01

Full Text Available This study aims at the research of the influence of unemployment rate (Un, exchange rate of CZK/USD (Ex, inflation rate (Inf, expenditures on research and development (RaD, size of wages and environmental pollution on inward foreign direct investment (FDI into regions in the Czech Republic in the period 2002–2012. The study dealt with the whole period, then the pre-crisis and crisis period, altogether with the inclusion or elimination of Prague in or out of the group of Czech regions. Models without and with dynamic parameter were checked. For estimation of influence of the above mentioned parameters the fixed effects model, random effects model and pooled ordinary least squares (POLS were used. For dynamic model the generalized method of moments and POLS were applied. The results showed that Wage, appreciation of Ex and RaD positively determined the inflow of FDI to Czech regions and no negative determinant of inward FDI has been found. On the other hand, results of dynamic model imply that inward FDI in preceding year, appreciation of Ex, RaD have positive impact on inward FDI in current year. However, negative impact of Un and Inf on inward FDI were detected. Results of this research enable the policy makers or decision makers try to focus their attention on specific factors and eliminate to consume scarce funding.

Evolving flood patterns in a Mediterranean region (1301-2012) and climatic factors - the case of Catalonia

Science.gov (United States)

Barrera-Escoda, A.; Llasat, M. C.

2015-01-01

Data on flood occurrence and flood impacts for the last seven centuries in the northeastern Iberian Peninsula have been analysed in order to characterise long-term trends, anomalous periods and their relationship with different climatic factors such as precipitation, general circulation and solar activity. Catastrophic floods (those that produce complete or partial destruction of infrastructure close to the river, and major damages in the overflowed area, including some zones away from the channels) do not present a statistically significant trend, whereas extraordinary floods (the channel is overflowed and some punctual severe damages can be produced in the infrastructures placed in the rivercourse or near it, but usually damages are slight) have seen a significant rise, especially from 1850 on, and were responsible for the total increase in flooding in the region. This rise can be mainly attributed to small coastal catchments, which have experienced a marked increase in developed land and population, resulting in changes in land use and greater vulnerability. Changes in precipitation alone cannot explain the variation in flood patterns, although a certain increase was shown in late summer-early autumn, when extraordinary floods are most frequently recorded. The relationship between the North Atlantic circulation and floods is not as strong, due to the important role of mesoscale factors in heavy precipitation in the northwest of the Mediterranean region. However, it can explain the variance to some extent, mainly in relation to the catastrophic floods experienced during the autumn. Solar activity has some impact on changes in catastrophic floods, with cycles related to the quasi-biennial oscillation (QBO) and the Gleissberg solar cycle. In addition, anomalous periods of high flood frequency in autumn generally occurred during periods of increased solar activity. The physical influence of the latter in general circulation patterns, the high troposphere and the

Prevalence and risk factors associated with nutrition-related noncommunicable diseases in the Eastern Mediterranean region

Directory of Open Access Journals (Sweden)

Musaiger AO

2012-02-01

Full Text Available Abdulrahman O Musaiger1, Hazzaa M Al-Hazzaa21Nutrition and Health Studies Unit, Deanship of Scientific Research, University of Bahrain, Bahrain, and Arab Center for Nutrition, Bahrain; 2Exercise Physiology Laboratory, Department of Physical Education and Movement Science, College of Education, and Scientific Board, Obesity Research Chair, King Saud University, Riyadh, Saudi ArabiaAbstract: This paper reviews the current situation concerning nutrition-related noncommunicable diseases (N-NCDs and the risk factors associated with these diseases in the Eastern Mediterranean region (EMR. A systematic literature review of studies and reports published between January 1, 1990 and September 15, 2011 was conducted using the PubMed and Google Scholar databases. Cardiovascular disease, type 2 diabetes, metabolic syndrome, obesity, cancer, and osteoporosis have become the main causes of morbidity and mortality, especially with progressive aging of the population. The estimated mortality rate due to cardiovascular disease and diabetes ranged from 179.8 to 765.2 per 100,000 population, with the highest rates in poor countries. The prevalence of metabolic syndrome was very high, ranging from 19% to 45%. The prevalence of overweight and obesity (body mass index ≥25 kg/m2 has reached an alarming level in most countries of the region, ranging from 25% to 82%, with a higher prevalence among women. The estimated mortality rate for cancer ranged from 61.9 to 151 per 100,000 population. Osteoporosis has become a critical problem, particularly among women. Several risk factors may be contributing to the high prevalence of N-NCDs in EMR, including nutrition transition, low intake of fruit and vegetables, demographic transition, urbanization, physical inactivity, hypertension, tobacco smoking, stunting of growth of preschool children, and lack of nutrition and health awareness. Intervention programs to prevent and control N-NCDs are urgently needed, with special focus

Regional Convergence of Income: Spatial Analysis

Directory of Open Access Journals (Sweden)

Vera Ivanovna Ivanova

2014-12-01

Full Text Available Russia has a huge territory and a strong interregional heterogeneity, so we can assume that geographical factors have a significant impact on the pace of economic growth in Russian regions. Therefore the article is focused on the following issues: 1 correlation between comparative advantages of geographical location and differences in growth rates; 2 impact of more developed regions on their neighbors and 3 correlation between economic growth of regions and their spatial interaction. The article is devoted to the empirical analysis of regional per capita incomes from 1996 to 2012 and explores the dynamics of the spatial autocorrelation of regional development indicator. It is shown that there is a problem of measuring the intensity of spatial dependence: factor value of Moran’s index varies greatly depending on the choice of the matrix of distances. In addition, with the help of spatial econometrics the author tests the following hypotheses: 1 there is convergence between regions for a specified period; 2 the process of beta convergence is explained by the spatial arrangement of regions and 3 there is positive impact of market size on regional growth. The author empirically confirmed all three hypotheses

Predictors of regional Medicare expenditures for otolaryngology physician services.

Science.gov (United States)

Smith, Alden; Handorf, Elizabeth; Arjmand, Ellis; Lango, Miriam N

2017-06-01

To describe geographic variation in spending and evaluate regional Medicare expenditures for otolaryngologist services with population- and beneficiary-related factors, physician supply, and hospital system factors. Cross-sectional study. The average regional expenditures for otolaryngology physician services were defined as the total work relative value units (wRVUs) collected by otolaryngologists in a hospital referral region (HRR) per thousand Medicare beneficiaries in the HRR. A multivariable linear regression model tested associations with regional sociodemographics (age, sex, race, income, education), the physician and hospital bed supply, and the presence of an otolaryngology residency program. In 2012, the mean Medicare expenditure for otolaryngology provider services across HRRs was 224 wRVUs per thousand Medicare beneficiaries (standard deviation [SD] 104), ranging from 31 to 604 wRVUs per thousand Medicare beneficiaries. In 2013, the average Medicare expenditures for each HRR was highly correlated with expenditures collected in 2012 (Pearson correlation coefficient .997, P = .0001). Regional Medicare expenditures were independently and positively associated with otolaryngology, medical specialist, and hospital bed supply in the region, and were negatively associated with the supply of primary care physicians and presence of an otolaryngology residency program after adjusting for other factors. The magnitude of associations with physician supply and hospital factors was stronger than any population or Medicare beneficiary factor. Wide variations in regional Medicare expenditures for otolaryngology physician services, highly stable over 2 years, were strongly associated with regional health system factors. Changes in health policy for otolaryngology care may require coordination with other physician specialties and integrated hospital systems. NA. Laryngoscope, 127:1312-1317, 2017. © 2016 The American Laryngological, Rhinological and Otological Society

Parents' socioeconomic factors related to high antibiotic prescribing in primary health care among children aged 0-6 years in the Capital Region of Denmark

DEFF Research Database (Denmark)

Jensen, Jette Nygaard; Bjerrum, Lars; Boel, Jonas

2016-01-01

OBJECTIVE: To investigate the distribution of antibiotic prescriptions in primary health care among children aged 0-6 years and its association with socioeconomic factors. DESIGN: A cross-sectional study describing antibiotic prescriptions and socioeconomic factors, using different population......-based registers from Statistics Denmark. SETTING: Antibiotic prescriptions in 2012 from primary health care in the Capital Region of Denmark. SUBJECTS: The population of children aged 0-6 years (n = 139,398) in the Capital Region of Denmark. MAIN OUTCOME MEASURES: High use of antibiotics identified by number...... of antibiotic prescriptions (≥ 3 prescriptions per year) and defined daily doses (DDD). A multinomial logistic regression analysis estimating the association between high antibiotic use and parents' education, employment status, income, child's sex, and ethnic background. RESULTS: Ten percent of children...

REGIONAL DEVELOPMENT IN ROMANIA

Directory of Open Access Journals (Sweden)

Remus Gherman

2015-10-01

Full Text Available Regional development policy is a policy of investment for economic development by supporting competitiveness, increasing the standards of living, improving the quality of life, creating new jobs. Regions and regional development policy occupies in recent decades an increasingly important position in the list of the economic and social factors being found on the agendas of governments, both central and local authorities, of political groups and civil society. Regional development and regional development policy in Romania are present both in the economic reform and in social one. Development Regions from Romania are set up in 1998 by Law number 151 and supported by their own institutional framework. The applicability of regional development in Romania must take into account the fundamental elements of the possibilities of Regional Development, meaning the major indicators of reference for measuring the level of disparities, GDP per capita and unemployment.

Leadership and institutional factors in endogenous regional economic development

Directory of Open Access Journals (Sweden)

Robert J. Stimson

2005-11-01

Full Text Available This paper proposes that a virtuous circle for the sustainable developmentof a city or region is achieved through a process whereby proactive and strongleadership and effective institutions enhance the capacity and capability of a place tobetter use its resource endowments and gain an improved market fit in becomingcompetitive and being entrepreneurial. It is proposed that the performance of a city orregion at a point in time and the path of its economic development over time may berepresented by its position in a Regional Competitiveness Performance Cube. Thepaper proposes a new model framework whereby a city or region’s economic developmentand performance is an outcome dependent on how its resource endowmentsand market fit as quasi-independent variables are mediated by the interaction betweenleadership, institutions, and entrepreneurship as intervening variables. The experiencesof a number of case study cities from a variety of settings in the US, Europe,Asia and Australia are explored within that framework.

Risk Factors for Malnutrition in Seniors Aged 75+ Living in Home Environment in Selected Regions of the Czech Republic.

Science.gov (United States)

Brabcová, Iva; Trešlová, Marie; Bártlová, Sylva; Vacková, Jitka; Tóthová, Valerie; Motlová, Lenka

2016-09-01

Nutrition is an important social determinant of health that influences the ageing process. The aim of this study was to evaluate the nutritional condition of a group of seniors and identify the bio-psycho-social factors that increase the risk of malnutrition. The research was conducted using a quantitative method. The standardised scales Mini Nutritional Assessment - Short Form (MNA-SF) and the Geriatric depression scale (GDS-5) were used to evaluate the nutritional condition and tendency towards depression of the tested group. This group consisted of seniors aged 75 and above living in home environment in the České Budějovice region. The group was comprised of 320 seniors, 115 men (35.9%) and 205 women (64.1%), which corresponds to the composition of the population in the chosen region of the Czech Republic. Statistical data analysis was conducted using SASD 1.4.10 and SPSS 15.0 programs. Pearson's chi-squared test (Χ²) and Cramér's V were chosen for statistical testing. The significance level was set at 5%. The average BMI value of the seniors was 26.2 kg/m² (overweight). This value decreased with age. More than one third of the respondents were evaluated as being at risk of malnutrition (36.3%). Unintended weight loss was determined as the strongest risk factor of malnutrition. Seniors who had lowered their food intake stated unintended weight loss 10 times more often than respondents with no noticeable reduction in food intake. Seniors who showed signs of depression indicated weight loss three and a half times more often than respondents without depression. Meanwhile acute illness increased the risk by three times. Depression was found to be the cause and also the consequence of malnutrition. Despite the high prevalence of overweight and obesity, a large proportion of the respondents were running the risk of malnutrition. It was concluded that the strongest risk factors for malnutrition in the respondents were unintended weight loss, depression and

Characterization of an insulin-like growth factor-I/somatomedin-C radioimmunoassay specific for the C-peptide region

International Nuclear Information System (INIS)

Hintz, R.L.; Liu, F.; Seegan, G.

1982-01-01

Insulin-like growth factor-I (IGF-I) and somatomedin-C (SM-C) have been shown to be functionally identical by a number of criteria. We have synthesized the 12 amino acid C-peptide region of IGF-I (Gly-Tyr-Gly-Ser-Ser-Ser-Arg-Arg-Ala-Pro-Glu-Thr) and developed a RIA based on antibodies against this synthetic peptide. IGF-I and SM-C were indistinguishable in this RIA. No other peptides competed for this antiserum. The SM-C/IGF-I values of acid-chromatographed serum were strongly age dependent. The mean of children 1-5 yr old was 0.67 +/- 0.033 U/ml (mean +/- sD; n = 23), whereas the mean of children 12-17 yr old was 2.01 +/- 0.66 U/ml (n = 39) and the mean of 38 adults 26-85 yr old was 1.05 +/- 0.34. The SM-C/IGF-I values measured by this RIA were also growth hormone dependent. Thus, this region-specific RIA provides a clinically useful assessment of serum SM-C/IGF-I levels

Job satisfaction and associated factors among health care providers at public health institutions in Harari region, eastern Ethiopia: a cross-sectional study.

Science.gov (United States)

Geleto, Ayele; Baraki, Negga; Atomsa, Gudina Egata; Dessie, Yadeta

2015-09-01

Human factor is the primary resource of health care system. For optimal performance of health care system, the workforce needs to be satisfied with the job he/she is doing. This research was aimed to assess the level of job satisfaction and associated factors among health care providers at public health institutions in Harari region, Eastern Ethiopia. Health facility based cross-sectional study was conducted among 405 randomly selected health care providers in Harari regional state, Eastern Ethiopia. Data were collected by self-administered structured questionnaires. Epidata Version 3.1 was used for data entry and analysis was made with SPSS version 17. Level of job satisfaction was measured with a multi item scales derived from Wellness Council of America and Best Companies Group. The average/mean value was used as the cutoff point to determine whether the respondents were satisfied with their job or not. Multivariable logistic regression was used to analyze data and odds ratio with 95% CI at P ≤ 0.05 was used to identify associated factors with level of job satisfaction. Less than half 179 (44.2%) of the respondents were satisfied with their job. Being midwifery in profession [AOR = 1.20; 95% CI (1.11-2.23)], age less than 35 years [AOR = 2.0; 95% CI (1.67-2.88)], having good attitude to stay in the same ward for longer period [AOR = 3.21; 95 % CI (1.33, 5.41)], and safe working environment [AOR = 4.61; 95% CI (3.33, 6.92)] were found were found to be associated with job satisfaction. Less than half (44.2%) of the respondents were satisfied with their current job. Organizational management system, salary and payment and working environment were among factors that affects level of job satisfaction. Thus, regional health bureau and health facility administrators need to pay special attention to improve management system through the application of a health sector reform strategy.

Prevalence and risk factors of underweight, overweight and obesity among a geriatric population living in a high-altitude region of rural Uttarakhand, India.

Science.gov (United States)

Gupta, Aakriti; Kapil, Umesh; Khandelwal, Ritika; Khenduja, Preetika; Sareen, Neha; Pandey, Ravindra Mohan; Upadhyay, Ashish Datt

2018-03-15

To assess the prevalence and risk factors of underweight, overweight and obesity among a geriatric population living in a high-altitude region of India. Community-based cross-sectional study. Data were collected on sociodemographic profile and anthropometric parameters. Weight and height measurements were utilized for calculation of BMI. Nutrient intake data were collected using 24 h dietary recall. High-altitude region of Nainital District, Uttarakhand State, North India. Community-dwelling geriatric subjects (n 981) aged 60 years or above. We found that 26·6 % of the elderly subjects were underweight (BMI<18·5 kg/m2). Overweight (BMI 25·0-29·9 kg/m2) and obesity (BMI≥30·0 kg/m2) was seen among 18·0 % and 4·6 %, respectively. After controlling for potential cofounders, risk factors such as low level of education and income, chewing problems and lower number of daily meals were found to be associated with underweight. On the other hand, risk factors for overweight/obesity were lower age, high income and unskilled work. There is a need to develop and implement intervention strategies to prevent underweight, overweight and obesity among the geriatric population of India.

Dietary patterns derived using exploratory and confirmatory factor analysis are stable and generalizable across race, region, and gender subgroups in the REGARDS study

Directory of Open Access Journals (Sweden)

Suzanne E Judd

2015-01-01

Full Text Available Background: Examining diet as a whole using dietary patterns as exposures is a complementary method to using single food or nutrients in studies of diet and disease, but the generalizability of patterns across race, region, and gender in the United States has not been established. Objective: To employ rigorous statistical analysis to empirically derive dietary patterns in a large bi-racial, geographically diverse population and examine whether results are stable across population subgroups.Design: The present analysis utilized data from 21,636 participants in the Reasons for Geographic and Racial Differences in Stroke (REGARDS study who completed the Block98 food frequency questionnaire. We employed exploratory factor analysis and confirmatory factor analyses on 56 different food groups iteratively and examined differences by race, region, sex to determine the optimal factor solution in our sample. Results: Five dietary patterns emerged: the Convenience pattern was characterized by mixed dishes; the Plant-based pattern by fruits, vegetables, and fish; the Sweets/Fats pattern by sweet snacks, desserts, and fats and oils; the Southern pattern by fried foods, organ meat, and sweetened beverages; and the Alcohol/Salads pattern by beer, wine, liquor, and salads. Differences were most pronounced in the Southern pattern with black participants, those residing in the Southeast, and participants not completing high school having the highest scores. Conclusions: Five meaningful dietary patterns emerged in the REGARDS study and showed strong congruence across race, sex and region. Future research will examine associations between these patterns and health outcomes to better understand racial disparities in disease and inform prevention efforts.

Diabetic retinopathy in Tanzania: prevalence and risk factors at entry into a regional screening programme.

Science.gov (United States)

Cleland, Charles R; Burton, Matthew J; Hall, Claudette; Hall, Anthony; Courtright, Paul; Makupa, William U; Philippin, Heiko

2016-03-01

The number of adults with diabetes in sub-Saharan Africa (SSA) is expected to almost double by 2035. This study investigated the prevalence of diabetic retinopathy (DR) and its risk factors at entry into a community-based screening programme. All persons with diabetes screened for retinopathy at entry into a screening programme in Kilimanjaro Region, Tanzania between November 2010 and December 2014 were included. Fundus photographs were taken with a Topcon retinal camera following pupil dilation. Data were collected on BP, random blood sugar, duration of diabetes, BMI and visual acuity on entry. A total of 3187 persons were screened for DR. The prevalence of any DR was 27.9% (95%CI 26.4-29.5%) with background diabetic retinopathy (BDR), pre-proliferative diabetic retinopathy (PPDR) and proliferative diabetic retinopathy (PDR) having a prevalence of 19.1% (95% CI 17.7-20.4%), 6.0% (95%CI 5.2-6.8%) and 2.9% (95%CI 2.3-3.5%), respectively. Maculopathy was present in 16.1% (95%CI 14.8-17.4%) of participants. Multivariable logistic regression analysis for the presence of any DR found independent associations with duration of diabetes (P planning of DR screening and treatment services in the African region. The study highlights the importance of managing comorbidities within DR screening programmes. © 2015 The Authors Tropical Medicine & International Health Published by John Wiley & Sons Ltd.

Smoking is the most frequent risk factor for cardiovascular diseases in Croatian Western region: findings of the Croatian health survey 2003

Directory of Open Access Journals (Sweden)

Henrietta Benčević-Striehl,

2009-08-01

Full Text Available Aim To estimate the prevalence of selected behavioral risk factorsfor cardiovascular diseases in the western region of Croatia and todetermine the differences based on age and gender.Methods A national survey on health status and health behavior ofthe adult population has been conducted. The representative sampleof 10,766 households for six officially defined regions of Croatiahas been determined, and Western region has been included with1,562 inhabitants, aged 18 years and older. The overall responserate of administered face-to-face questionnaire was 85-6%. Prevalencerates per 100 inhabitants (smoking, eating habits, alcoholconsumption, physical activity, socio-economic characteristics,chronic conditions have been determined.Results Nearly half (46.3% of the adults were smokers or hadquit smoking less than 10 years ago. Prevalence of high bloodpressure was high amounting to 40.6% and it was higher in middleaged males (46.7%, p<0.01 and young males (13.7%, p<0.01.Prevalence of obesity was 38.9%, highest in females aged 35-64(51.2%, p<0.001 and 65 and older (73.8%, p<0.01.Almost a quarter of respondents (23.3% has been insufficientlyphysically active, especially young females 22.5%, p<0.01.Conclusion There was a significant difference in the prevalenceof all observed behavioral risk factors according to the gender andage. Moreover, smoking tobacco has been found as the most frequentrisk factor in the observed population.

Generalised Batho correction factor

International Nuclear Information System (INIS)

Siddon, R.L.

1984-01-01

There are various approximate algorithms available to calculate the radiation dose in the presence of a heterogeneous medium. The Webb and Fox product over layers formulation of the generalised Batho correction factor requires determination of the number of layers and the layer densities for each ray path. It has been shown that the Webb and Fox expression is inefficient for the heterogeneous medium which is expressed as regions of inhomogeneity rather than layers. The inefficiency of the layer formulation is identified as the repeated problem of determining for each ray path which inhomogeneity region corresponds to a particular layer. It has been shown that the formulation of the Batho correction factor as a product over inhomogeneity regions avoids that topological problem entirely. The formulation in terms of a product over regions simplifies the computer code and reduces the time required to calculate the Batho correction factor for the general heterogeneous medium. (U.K.)

Infections and risk factors for livestock with species of Anaplasma, Babesia and Brucella under semi-nomadic rearing in Karamoja Region, Uganda.

Science.gov (United States)

Lolli, Chiara; Marenzoni, Maria Luisa; Strona, Paolo; Lappo, Pier Giorgio; Etiang, Patrick; Diverio, Silvana

2016-03-01

A survey was conducted to estimate the prevalence of Anaplasma, Babesia and Brucella spp. infections in cattle, goats and sheep in the Karamoja Region of Uganda and to identify possible risk factors existing in this semi-nomadic and pastoral area. Low cost laboratory tests were used to diagnose infections (Rose Bengal test for Brucella spp. antibodies and direct microscopic examination for Anaplasma and Babesia spp.). Multivariable logistic regression models were applied to identify possible risk factors linked to gender, animal species, age (only for cattle) and districts. A total of 3935 cattle, 729 goats and 306 sheep of five districts of the Karamoja Region were tested. Seroprevalence for Brucella was 9.2 % (CI, 95 %: 8.4-10), for Anaplasma 19.5 % (CI 95 %: 18.4-20.6) and for Babesia 16 % (CI 95 %: 15-17.1). Significant differences in infections prevalence were observed against risk factors associated with districts and species. Cattle were the species with higher risk of the infections. Female gender was identified as at risk only for Brucella spp. infection. Cattle more than one year old had greater likelihood to be Brucella seropositive. Co-infections of Anaplasma and Babesia spp. were statistically associated, especially in goats and sheep. Further studies to identify risk factors related to host species and geographical districts are needed. The influence on the semi-nomadic agro-pastoral system in Karamoja of animal raids and animal mixing should be further investigated. Findings were important to sensitize Karamojong undertaking measures on infection control, especially on cattle, which are their main source of food.

Regional Variability of Lifestyle Factors and Hypertension with Prediabetes and Newly Diagnosed Type 2 Diabetes Mellitus: The Population-Based KORA-F4 and SHIP-TREND Studies in Germany.

Science.gov (United States)

Stöckl, Doris; Rückert-Eheberg, Ina-Maria; Heier, Margit; Peters, Annette; Schipf, Sabine; Krabbe, Christine; Völzke, Henry; Tamayo, Teresa; Rathmann, Wolfgang; Meisinger, Christa

2016-01-01

Type 2 diabetes mellitus (T2D) shows regional differences in Germany. The purpose of the project was to compare the prevalence of prediabetes and undiagnosed T2D in two regions in Germany, the Northeast and the South, and to evaluate their associations with regional variations in lifestyle factors and hypertension. Data from the KORA-F4 study (South Germany, 2006-2008) and the SHIP-TREND study (Northeast Germany, 2008-2012) were used. Participants aged 35-79 years without T2D with an overnight fasting of more than 8 hours and an oral glucose tolerance test were included: KORA-F4: n = 2,616 and SHIP-TREND: n = 1,968. The prevalence of prediabetes/newly diagnosed T2D was especially high in men (about 60%) and women (about 50%) in the Northeast, followed by men (about 50%) and women (about 30%) in the South. Lifestyle factors associated with T2D varied between the regions: more participants in the Northeast were active smokers and the percentages of people with overweight or obesity were greater than in their southern counterparts. However, these differences could not explain the striking disparity in prediabetes/newly diagnosed T2D. The frequency of hypertension was also distinctly higher in the Northeast than in the South and clearly associated with prediabetes/newly diagnosed T2D. Especially in men living in the Northeast, screening individuals with blood pressure ≥ 140/90mmHg might reveal up to 70% of those with prediabetes/newly diagnosed T2D. Knowledge about regional variability in T2D and related risk factors is important for the planning of diabetes prevention programs. In our analyses, common lifestyle factors did not nearly explain these variations between the northern SHIP-TREND and the southern KORA-F4 studies. Further examinations of regional socioeconomic, political, environmental and other aspects are needed. Meanwhile, targeted diabetes prevention strategies with a special focus on men living in the northern parts of Germany are reasonable.

Monte Carlo correction factors for a Farmer 0.6 cm3 ion chamber dose measurement in the build-up region of the 6 MV clinical beam

International Nuclear Information System (INIS)

Pena, J; Sanchez-Doblado, F; Capote, R; Terron, J A; Gomez, F

2006-01-01

Reference dosimetry of photon fields is a well-established subject and currently available protocols (such as the IAEA TRS-398 and AAPM TG-51) provide methods for converting the ionization chamber (IC) reading into dose to water, provided reference conditions of charged particle equilibrium (CPE) are fulfilled. But these protocols cannot deal with the build-up region, where the lack of CPE limits the applicability of the cavity theorems and so the chamber correction factors become depth dependent. By explicitly including the IC geometry in the Monte Carlo simulations, depth-dependent dose correction factors are calculated for a PTW 30001 0.6 cm 3 ion chamber in the build-up region of the 6 MV photon beam. The corrected percentage depth dose (PDD) agrees within 2% with that measured using the NACP 02 plane-parallel ion chamber in the build-up region at depths greater than 0.4 cm, where the Farmer chamber wall reaches the phantom surface

Modelling crop land use change derived from influencing factors selected and ranked by farmers in North temperate agricultural regions.

Science.gov (United States)

Mehdi, Bano; Lehner, Bernhard; Ludwig, Ralf

2018-08-01

To develop meaningful land use scenarios, drivers that affect changes in the landscape are required. In this study, driving factors that influence farmers to change crops on their farm were determined. A questionnaire was administered to four independent groups of farmers who identified and ranked influencing factors pertaining to their choices of crops. The farmers were located in two mid-latitude agricultural watersheds (in Germany and Canada). The ranked influencing factors were used to develop a "farmer driven" scenario to 2040 in both watersheds. Results showed that the most important influencing factors for farmers to change crops were the "economic return of the crop" and "market factors". Yet, when the drivers of crop land use change were grouped into two categories of "financial" and "indirectly-related financial" factors, the "financial" factors made up approximately half of the influencing factors. For some responses, the "indirectly-related financial" factors (i.e. "access to farm equipment", the "farm experience", and "climate") ranked higher than or just as high as the financial factors. Overall, in the four farmer groups the differences between the rankings of the influencing factors were minor, indicating that drivers may be transferable between farms if the farmers are full-time and the farming regions have comparable growing seasons, access to markets, similar technology, and government programs for farm income. In addition to the "farmer driven" scenario, a "policy driven" scenario was derived for each watershed based only on available information on the financial incentives provided to farmers (i.e. agricultural subsidies, income support, crop insurance). The influencing factors ranked by the farmers provided in-depth information that was not captured by the "policy driven" scenario and contributed to improving predictions for crop land use development. This straight-forward method to rank qualitative data provided by farmers can easily be

Renewable generation across Italian regions: Spillover effects and effectiveness of European Regional Fund

International Nuclear Information System (INIS)

Carfora, Alfonso; Romano, Antonio A.; Ronghi, Monica; Scandurra, Giuseppe

2017-01-01

This paper investigates on the determinant factors that drive the Italian regions toward a sustainable development path and evaluates the effectiveness of European Regional Development incentives in promoting investments in renewable energy sources (RES). Starting from the consideration that there are spillover effects between similar regions, first we identify the factors that capture these similarities, then we use them to evaluate their relevance in determining the success of the investments in RES. An econometric analysis, based on the use of spatial panel specification model, is implemented to support the hypotheses. Two important results emerge from the study. The first is the identification of regional determinants of RES production, that are driven by the similarities between regions, and that can be interpreted as guidelines in the policy choices in support of investments. The second is the lack of effectiveness of the incentives in support of RES. Results indicate that the capacity of some regional governments to direct the funds allocated by the central government or European Commission towards efficient production of renewable energy is likely limited, and these incentives have been undone. - Highlights: • Investments in renewable energies makes a remarkable contribution to reduce unemployment. • In Italy there is a lack of effectiveness of the incentives in support of renewable energies. • To attract energy investments regions must reduce the burden of taxation. • Highly deprived areas incentivize more than the developed ones renewable energies. • Production of renewable energies is directly influenced by the production in similar regions.

The first year experience of occupational therapy students at an Australian regional university: Promoting student retention and developing a regional and remote workforce.

Science.gov (United States)

Boehm, Jackie; Cordier, Reinie; Thomas, Yvonne; Tanner, Bronwyn; Salata, Karen

2017-02-01

Student retention at regional universities is important in addressing regional and remote workforce shortages. Students attending regional universities are more likely to work in regional areas. First year experience at university plays a key role in student retention. This study aimed to explore factors influencing the first year experience of occupational therapy students at a regional Australian university. Surveys were administered to 58 second year occupational therapy students in the first week of second year. Data were analysed using descriptive statistics, inferential statistics (Pearson χ 2 ; Spearman rho) and summarising descriptive responses. An Australian regional university. Second year undergraduate occupational therapy students. Factors influencing students' decisions to study and continue studying occupational therapy; factors enhancing first year experience of university. Fifty-four students completed the survey (93.1%). A quarter (25.9%) of students considered leaving the course during the first year. The primary influence for continuing was the teaching and learning experience. Most valued supports were orientation week (36.7%) and the first year coordinator (36.7%). The importance of the first year experience in retaining occupational therapy students is highlighted. Engagement with other students and staff and academic support are important factors in facilitating student retention. It is important to understand the unique factors influencing students' decisions, particularly those from regional and remote areas, to enter and continue in tertiary education to assist in implementing supports and strategies to improve student retention. © 2015 National Rural Health Alliance Inc.

Political parties in the Sverdlovsk region: stages of development

Directory of Open Access Journals (Sweden)

Mukhametov Ruslan Salikhovich

2013-12-01

Full Text Available This article analyzes the processes of party building in the Russian Federation. On the example of a single region – the Sverdlovsk region – we study the evolution of political parties. The factors favoring the process of formation and functioning of regional political parties and political movements in the Middle Urals are identified and classified. Much attention is paid to such factors of development of the parties in the region as a party-electoral law and the electoral system view.

Regional Business Cycles in East Asia: Synchronization and its Determinants

Directory of Open Access Journals (Sweden)

Young-Joon Park

2013-06-01

Full Text Available This paper analyzes the dynamics and nature of regional business cycle synchronization for East Asian countries in the period of 2000:Q1-2011:Q4. Estimating a dynamic two-factor model extracts the common factor and the nation- specific factor from both the macroeconomic aggregates and plausible driving forces of regional business cycles. Evidence for regional business cycle synchronization is particularly strong for Korea, Malaysia and the Philippines, while Japan shows weak evidence of regional synchronization. On the other hand, Indonesia, Thailand, Singapore and China are decoupling from regional business cycles. The driver of monetary aggregate is the most significant determinant of regional fluctuations of macroeconomic aggregates, whereas oil price and productivity are on average important driving forces of nation-specific fluctuations of real economic activities.

HIV prevalence and correlated factors of female sex workers and male clients in a border region of Yunnan Province, China.

Science.gov (United States)

Zhu, Jing; Yuan, Rui; Hu, Dan; Zhu, Zhibin; Wang, Ning; Wang, Bei

2018-04-01

Female sex workers (FSWs) and their male clients are vulnerable to HIV infection and serve as a bridge in HIV transmission from the high-risk population to the general, low-risk population. To examine the factors of FSWs and male clients that correlate with the prevalence of HIV infection in the Chinese-Vietnamese border region, a cross-sectional survey was conducted in 2014 in the Hekou county of the Yunnan province of China. We performed a questionnaire survey to collect data on demographics, sexual behavior, and drug use. Blood and urine samples were collected for testing of HIV/sexually transmitted infections and drug use. We found that the prevalence of HIV infection among FSWs was 2.74%, and 15 male clients (2.62%) were HIV-positive. Multivariate logistic regression analysis revealed that herpes simplex virus type 2 infection was a risk factor for HIV infection in FSWs and male clients, suggesting the increased role of sexual transmission in the HIV epidemic in the Chinese-Vietnamese border region. Positive urinalysis result for amphetamine-type stimulants was observed in FSWs with HIV infection. History of drug use was correlated with HIV infection, which increased the HIV infection risk of male clients, confirming that drug use is an important target in future interventions for HIV prevention.

An international comparison of risk factors between two regions with distinct differences in asthma prevalence.

Science.gov (United States)

Madani, K; Vlaski, E; Rennie, D C; Sears, M; Lawson, J A

2018-03-24

Investigation of the geographic variation in asthma prevalence can improve our understanding of asthma etiology and management. The purpose of our investigation was to compare the prevalence of asthma and wheeze among adolescents living in two distinct international regions and to investigate reasons for observed differences. A cross-sectional survey of 13-14 year olds was completed in Saskatoon, Canada (n=1200) and Skopje, Republic of Macedonia (n=3026), as part of the International Study of Asthma and Allergies in Childhood (ISAAC) Phase 3 study. Surveys were self-completed by students following the ISAAC protocol. Multiple logistic regression models were used to investigate associations with reports of asthma and current wheeze. A mediation analysis was then completed. Asthma prevalence was much higher in Saskatoon than Skopje (21.3% vs. 1.7%) as was the prevalence of current wheeze (28.2% vs. 8.8%). Higher paracetamol (acetaminophen) use was a consistent risk factor for asthma and wheeze in both locations and showed dose-response relationships. In both countries, paracetamol use and physical activity mediated some of the association for both asthma and wheeze. In Saskatoon, among those with current wheeze, 42.6% reported ever having a diagnosis of asthma compared to 10.2% among Skopje adolescents. The results suggest that the variation in risk factors between the two locations may explain some of the differences in the prevalence of asthma and wheeze between these two study sites. However, diagnostic labeling patterns should not be ruled out as another potential explanatory factor. Copyright © 2018 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

Social determinants of common metabolic risk factors (high blood pressure, high blood sugar, high body mass index and high waist-hip ratio) of major non-communicable diseases in South Asia region: a systematic review protocol.

Science.gov (United States)

Sharma, Sudesh Raj; Mishra, Shiva Raj; Wagle, Kusum; Page, Rachel; Matheson, Anna; Lambrick, Danielle; Faulkner, James; Lounsbury, David; Vaidya, Abhinav

2017-09-07

Prevalence of non-communicable diseases has been increasing at a greater pace in developing countries and, in particular, the South Asia region. Various behavioral, social and environmental factors present in this region perpetuate common metabolic risk factors of non-communicable diseases. This study will identify social determinants of common metabolic risk factors of major non-communicable diseases in the context of the South Asian region and map their causal pathway. A systematic review of selected articles will be carried out following Cochrane guidelines. Review will be guided by Social Determinants of Health Framework developed by the World Health Organization to extract social determinants of metabolic risk factors of non-communicable diseases from studies. A distinct search strategy will be applied using key words to screen relevant studies from online databases. Primary and grey literature published from the year 2000 to 2016 and studies with discussion on proximal and distal determinants of non-communicable risk factors among adults of the South Asia region will be selected. They will be further checked for quality, and a matrix illustrating contents of selected articles will be developed. Thematic content analysis will be done to trace social determinants and their interaction with metabolic risk factors. Findings will be illustrated in causal loop diagrams with social determinants of risk factors along with their interaction (feedback mechanism). The review will describe the interplay of social determinants of common NCD metabolic risk factors in the form of causal loop diagram. Findings will be structured in two parts: the first part will explain the linkage between proximal determinants with the metabolic risk factors and the second part will describe the linkage among the risk factors, proximal determinants and distal determinants. Evidences across different regions will be discussed to compare and validate and/or contrast the findings. Possible

Understanding the natural and social factors behind regional longevity in Guangxi, China—Is centenarian ratio a good enough indicator for assessing the longevity level?

Science.gov (United States)

Deng, Q.; Wei, Y.; Zhao, Y.

2017-12-01

Despite a number of longevity indicators having been used in previous longevity studies, few studies have critically evaluated whether these indicators are suitable. In addition, an increasing number of studies have attempted to determine the influence of socio-economic and natural factors on regional longevity, but only certain factors were considered. The present study bridges this gap by determining the relationship between the seven longevity indicators and selecting 24 natural and socio-economic indicators in the 91 selected counties and districts in Guangxi, China. The seven longevity indicators here refer to Centenarian ratio, Longevity index, Longevity level, Aging tendency, 80+ ratio, 90+ ratio and 95+ ratio. Natural indicators in this study mainly refer to climatic ones. Socio-economic indicators can be categorized into those related to economic, education, local infrastructure, and health care facilities. These data were mainly drawn from the Meteorological Data Sharing Service System and Guangxi's sixth population census. Stepwise regression analysis has been used as the primary research method to determine the relationship between the longevity indicators and the natural, social, and economic indicators. The results show that the climate factors regarding atmospheric pressure, humidity, and rainfall are the most significant contributors to the longevity of the 60- to 90-year-old elderly in Guangxi, while the difference of mean annual temperature could have negative impacts. Also, the natural and socioeconomic factors that impact the extremely old population (those over 95 years old) in Guangxi are still not clear. This study reveals that the longevity index and longevity level are useful supplementary indexes to the centenarian ratio for assessing the regional longevity as they could help reflect the regional longevity regarding the proportion of young-old and old-old population and not just limit to those over 100 years old. The elderly (those from 60

Regional Business Cycles in East Asia: Synchronization and its Determinants

OpenAIRE

Young-Joon Park

2013-01-01

This paper analyzes the dynamics and nature of regional business cycle synchronization for East Asian countries in the period of 2000:Q1-2011:Q4. Estimating a dynamic two-factor model extracts the common factor and the nation- specific factor from both the macroeconomic aggregates and plausible driving forces of regional business cycles. Evidence for regional business cycle synchronization is particularly strong for Korea, Malaysia and the Philippines, while Japan shows weak evidence of regio...

[Factors associated with early weaning in a Spanish region].

Science.gov (United States)

Rius, J M; Ortuño, J; Rivas, C; Maravall, M; Calzado, M A; López, A; Aguar, M; Vento, M

2014-01-01

Breastfeeding has undoubtedly great benefits. Previous studies have foundan early dropout. Only a few studies have investigated related factors. Our aim was to find out on-going breastfeeding rates along the first 12 months after birth and analyse factors associated with early weaning. This is a prospective study including consecutive pairs (mother and newborn) till completion of the required sample. Variables were collected performing a structured program of surveys to the mothers. Bivariate and multivariate analysis of the data was performed. A total of 452 pairs were recruited. It was found that 81% of them started breastfeeding, with a prevalence of breastfeeding of 39% and 21% at 3 and 6 months after birth, respectively. Factors associated with early discontinuation of breastfeeding were: pregnancy induced by assisted reproduction methods (OR=5.58; 95% CI: 2.62-11.91), maternal smoking (OR=1.56; 95% CI: 1.10-2.22), poor maternal expectations about the duration of breastfeeding (OR=2.19; 95% CI: 1.49-3.23), use of nipple shields for breastfeeding (OR=2.57; 95% CI: 1.69-3.90), pacifier use on a regular basis during the first month after delivery (OR=1.39; 95% CI: 1.02-1.91), maternal university educational level (OR=0,59; 95% CI: 0,40-0,88), attending birth preparation programs during pregnancy (OR=0,68; 95% CI: 0,49-0,94), and believing having enough milk output at the time of discharge (OR=0,66; 95% CI: 0,47-0,92). International recommendations about duration of breastfeeding are not achieved in our country because of high rates of early weaning. We describe the known factors involved and other novel factors. The implementation of interventions to increase breastfeeding rates and to prevent early weaning are strongly recommended. Copyright © 2012 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Regional frontal gray matter volume associated with executive function capacity as a risk factor for vehicle crashes in normal aging adults.

Directory of Open Access Journals (Sweden)

Hiroyuki Sakai

Full Text Available Although low executive functioning is a risk factor for vehicle crashes among elderly drivers, the neural basis of individual differences in this cognitive ability remains largely unknown. Here we aimed to examine regional frontal gray matter volume associated with executive functioning in normal aging individuals, using voxel-based morphometry (VBM. To this end, 39 community-dwelling elderly volunteers who drove a car on a daily basis participated in structural magnetic resonance imaging, and completed two questionnaires concerning executive functioning and risky driving tendencies in daily living. Consequently, we found that participants with low executive function capacity were prone to risky driving. Furthermore, VBM analysis revealed that lower executive function capacity was associated with smaller gray matter volume in the supplementary motor area (SMA. Thus, the current data suggest that SMA volume is a reliable predictor of individual differences in executive function capacity as a risk factor for vehicle crashes among elderly persons. The implication of our results is that regional frontal gray matter volume might underlie the variation in driving tendencies among elderly drivers. Therefore, detailed driving behavior assessments might be able to detect early neurodegenerative changes in the frontal lobe in normal aging adults.

Perioperative factors affecting the occurrence of acute complex regional pain syndrome following limb bone fracture surgery: data from the Japanese Diagnosis Procedure Combination database.

Science.gov (United States)

Sumitani, Masahiko; Yasunaga, Hideo; Uchida, Kanji; Horiguchi, Hiromasa; Nakamura, Masaya; Ohe, Kazuhiko; Fushimi, Kiyohide; Matsuda, Shinya; Yamada, Yoshitsugu

2014-07-01

Complex regional pain syndrome (CRPS) describes a broad spectrum of symptoms that predominantly localize to the extremities. Although limb fracture is one of the most frequently reported triggering events, few large-scale studies have shown the occurrence of and factors associated with CRPS following limb fracture. This study aimed to show the occurrence and identify of those factors. Using the Japanese Diagnosis Procedure Combination database, we identified 39 patients diagnosed with CRPS immediately after open reduction and internal fixation (ORIF) for limb fracture from a cohort of 185 378 inpatients treated with ORIF between 1 July and 31 December of each year between 2007 and 2010. Patient and clinical characteristics such as age, gender, fracture site, duration of anaesthesia and use of regional anaesthesia were investigated by logistic regression analyses to examine associations between these factors and the in-hospital occurrence of CRPS after ORIF. The occurrence of CRPS was relatively high in fractures of the distal forearm, but low in fractures of the lower limb and in patients with multiple fractures. Generally females are considered to be at high risk of CRPS; however, we found a comparable number of male and female patients suffering from CRPS after ORIF for limb fracture. In terms of perioperative factors, a longer duration of anaesthesia, but not regional anaesthesia, was significantly associated with a higher incidence of CRPS. Although a limited number of CRPS patients were analysed in this study, reduced operative time might help to prevent the development of acute CRPS following limb fracture. © The Author 2013. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Determinants of health disparities between Italian regions

Directory of Open Access Journals (Sweden)

Giannoni Margherita

2010-06-01

Full Text Available Abstract Background Among European countries, Italy is one of the countries where regional health disparities contribute substantially to socioeconomic health disparities. In this paper, we report on regional differences in self-reported poor health and explore possible determinants at the individual and regional levels in Italy. Methods We use data from the "Indagine Multiscopo sulle Famiglie", a survey of aspects of everyday life in the Italian population, to estimate multilevel logistic regressions that model poor self-reported health as a function of individual and regional socioeconomic factors. Next we use the causal step approach to test if living conditions, healthcare characteristics, social isolation, and health behaviors at the regional level mediate the relationship between regional socioeconomic factors and self-rated health. Results We find that residents living in regions with more poverty, more unemployment, and more income inequality are more likely to report poor health and that poor living conditions and private share of healthcare expenditures at the regional level mediate socioeconomic disparities in self-rated health among Italian regions. Conclusion The implications are that regional contexts matter and that regional policies in Italy have the potential to reduce health disparities by implementing interventions aimed at improving living conditions and access to quality healthcare.

Tissue-specific expression of insulin-like growth factor II mRNAs with distinct 5' untranslated regions

International Nuclear Information System (INIS)

Irminger, J.C.; Rosen, K.M.; Humble, R.E.; Villa-Komaroff, L.

1987-01-01

The authors have used RNA from human hypothalamus as template for the production of cDNAs encoding insulin-like growth factor II (IGF-II). The prohormone coding sequence of brain IGF-II RNA is identical to that found in liver; however, the 5' untranslated sequence of the brain cDNA has no homology to the 5' untranslated sequence of the previously reported liver cDNAs. By using hybridization to specific probes as well as a method based on the properties of RNase H, they found that the human IGF-II gene has at least three exons that encode alternative 5' untranslated regions and that are expressed in a tissue-specific manner. A probe specific to the brain cDNA 5' untranslated region hybridizes to a 6.0-kilobase transcript present in placenta, hypothalamus, adrenal gland, kidney, Wilms tumor, and a pheochromocytoma. The 5' untranslated sequence of the brain cDNA does not hybridize to a 5.3-kilobase transcript found in liver or to a 5.0-kb transcript found in pheochromocytoma. By using RNase H to specifically fragment the IGF-II transcripts into 3' and 5' fragments, they found that the RNAs vary in size due to differences in the 5' end but not the 3' end

Factors affecting distribution patterns of organic carbon in sediments at regional and national scales in China.

Science.gov (United States)

Cao, Qingqing; Wang, Hui; Zhang, Yiran; Lal, Rattan; Wang, Renqing; Ge, Xiuli; Liu, Jian

2017-07-14

Wetlands are an important carbon reservoir pool in terrestrial ecosystems. Light fraction organic carbon (LFOC), heavy fraction organic carbon (HFOC), and dissolved organic carbon (DOC) were fractionated in sediment samples from the four wetlands (ZR: Zhaoniu River; ZRCW: Zhaoniu River Constructed Wetland; XR: Xinxue River; XRCW: Xinxue River Constructed Wetland). Organic carbon (OC) from rivers and coasts of China were retrieved and statistically analyzed. At regional scale, HFOC stably dominates the deposition of OC (95.4%), whereas DOC and LFOC in ZR is significantly higher than in ZRCW. Concentration of DOC is significantly higher in XRCW (30.37 mg/l) than that in XR (13.59 mg/l). DOC and HFOC notably distinguish between two sampling campaigns, and the deposition of carbon fractions are limited by low nitrogen input. At the national scale, OC attains the maximum of 2.29% at precipitation of 800 mm. OC has no significant difference among the three climate zones but significantly higher in river sediments than in coasts. Coastal OC increases from Bohai Sea (0.52%) to South Sea (0.70%) with a decrease in latitude. This study summarizes the factors affecting organic carbon storage in regional and national scale, and have constructive implications for carbon assessment, modelling, and management.

Factors associated with induced abortion at selected hospitals in the Volta Region, Ghana.

Science.gov (United States)

Klutsey, Ellen Eyi; Ankomah, Augustine

2014-01-01

Induced abortion rates remained persistently high in the Volta Region of Ghana in the 5 years from 2006 to 2011. Some hospitals, both rural and urban, report induced abortion-related complications as one of the top ten conditions in hospital admissions. This study explored demographic and other factors associated with induced abortion, and also assessed awareness of abortion-related complications among women of reproductive age in the Volta Region. A quantitative, hospital-based, unmatched case-control study was performed. The Volta Region was stratified into two health administration zones, ie, north and south. For each zone, hospitals were stratified into government and private hospitals. Employing simple random sampling, one private and three government hospitals were selected from each zone. This study is therefore based on eight hospitals, ie, six government hospitals and two private hospitals. Marital status, employment status, number of total pregnancies, and knowledge about contraception were found to be associated with induced abortion. Multiple logistic regression showed a 4% reduction in the odds of induced abortion in married women compared with women who were single (odds ratio [OR] 0.11, 95% confidence interval [CI] 0.07-0.22). Unemployed women of reproductive age were found to be 0.35 times less likely to seek induced abortion compared with their employed counterparts (OR 0.35, CI 0.19-0.65). It was also observed that women with their second pregnancies were 3.8 times more likely to seek induced abortion and women with more than two pregnancies were 6.6 times more likely to do so (OR 3.81, CI 1.94-7.49 and OR 6.58, CI 2.58-16.79, respectively). Women with no knowledge of contraceptive methods were 4.6 times likely to seek induced abortion (OR 4.64, CI 1.39-15.4). Compared with women who had not had induced abortion, women with a high number of pregnancies and no contraceptive knowledge were more likely to have induced abortion. It was found that lack

Factors Associated with Fatal Outcomes Following Cholera-Like Syndrome in Far North Region of Cameroon: A Community-Based Survey.

Science.gov (United States)

Djouma, Fabrice N; Ateudjieu, Jerome; Ram, Malathi; Debes, Amanda K; Sack, David A

2016-12-07

This study demonstrates that most cholera deaths in this region of Cameroon occur out of hospital. This is a region which is prone to cholera, and interventions are needed to improve access to emergency medical care, especially during cholera outbreaks. Cameroon has experienced 14 cholera epidemics during the last 20 years, and these have had high case fatality rates. This study attempted to assess the effect of delays in seeking care and the locations of care as possible risk factors for cholera mortality. The study used data from a community-based survey regarding the circumstances of 97 fatal cases and 197 control (nonfatal) cases following a cholera-like syndrome in villages with cholera-like diseases during cholera outbreaks in Cameroon during 2009-2011. Deaths occurred in one of four environments: the community, in a temporary community treatment center (TCTC), in transit to a treatment center, or in a hospital (39%, 32%, 5%, and 24%, respectively). Using a case-control analysis, factors associated with deaths included the nonuse of a cholera treatment center, receiving health care in a TCTC instead of a hospital, and greater than 4 hours delay between the onset of symptoms and the decision to go to a treatment center (odds ratios of 17.1 [confidence interval (CI): 7.0-41.8], 2.5 [CI: 1.2-5.0], and 2.2 [CI: 1.0-4.6], respectively). During cholera epidemics, a higher proportion of deaths are still occurring in communities. The nonuse and delays in deciding to go a treatment center, and treatment at TCTC rather than a hospital were risk factors for death among patients with cholera-like syndrome in Cameroon. Informing people on community management of cholera-like syndrome and improving care in all health facilities are needed to reduce deaths during cholera epidemics. © The American Society of Tropical Medicine and Hygiene.

Factors associated with childhood ocular morbidity and blindness in three ecological regions of Nepal: Nepal pediatric ocular disease study.

Science.gov (United States)

Adhikari, Srijana; Shrestha, Mohan Krishna; Adhikari, Kamala; Maharjan, Nhukesh; Shrestha, Ujjowala Devi

2014-10-23

Nepal Pediatric Ocular Diseases Study is a three year longitudinal population based study. Here we present the baseline survey report which aims to investigate various risk factors associated with childhood ocular morbidity and blindness in three ecological regions of Nepal. This baseline survey is a population based cross sectional study. The investigation was conducted in a district from each of the following regions: Terai, Hill and Mountain. The Village Development Committees (VDCs) from each district were selected by random sampling. Three Community health workers were given training on vision screening and identification of abnormal ocular signs in children. They conducted a house to house survey in their respected districts examining the children and gathering a standardized set of data variables. Children with abnormal vision or ocular signs were then further examined by pediatric ophthalmologists. A total of 10950 children aged 0-10 years (5403 from Terai, 3204 from the hills, 2343 from the mountains) were enrolled in the study. However 681 (6.2%) were non responders. The male to female ratio was 1.03. The overall prevalence of ocular morbidity was 3.7% (95% CI of 3.4%-4%) and blindness was 0.07% (95% CI of 0.02%-0.12%). Ocular morbidity was more prevalent in the mountain region whereas blindness was more prevalent in the Terai region.Children from the Terai region were more likely to suffer from congenital ocular anomalies compared to the other regions. Children whose mother smoked, drank alcohol, or was illiterate were significantly afflicted with ocular diseases (p Blindness was more prevalent in children who suffered from a systemic illness. Females and under-nourished children were more likely to have ocular morbidity and blindness. It was found that childhood blindness was more prevalent in the Terai region, the undernourished, females and in those with co-morbid systemic illnesses. This study strongly suggests that prevention of childhood

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

Directory of Open Access Journals (Sweden)

Matsutani Sachiko

2004-08-01

Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

Science.gov (United States)

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

Menstrual and reproductive factors and risk of breast cancer: A case-control study in the Fez region, Morocco.

Directory of Open Access Journals (Sweden)

Mohamed Khalis

Full Text Available Breast cancer is the most common cancer in women worldwide. In the Moroccan context, the role of well-known reproductive factors in breast cancer remains poorly documented. The aim of this study was to explore the relationship between menstrual and reproductive factors and breast cancer risk in Moroccan women in the Fez region.A case-control study was conducted at the Hassan II University Hospital of Fez between January 2014 and April 2015. A total of 237 cases of breast cancer and 237 age-matched controls were included. Information on sociodemographic characteristics, menstrual and reproductive history, family history of breast cancer, and lifestyle factors was obtained through a structured questionnaire. Conditional logistic regression models were used to estimate odds ratios and 95% confidence intervals for breast cancer by menstrual and reproductive factors adjusted for potential confounders.Early menarche (OR = 1.60, 95% CI: 1.08-2.38 and nulliparity (OR = 3.77, 95% CI: 1.98-7.30 were significantly related to an increased risk of breast cancer, whereas an early age at first full-term pregnancy was associated with a decreased risk of breast cancer (OR = 0.41, 95% CI: 0.25-0.65.The results of this study confirm the role of established reproductive factors for breast cancer in Moroccan women. It identified some susceptible groups at high risk of breast cancer. Preventive interventions and screening should focus on these groups as a priority. These results should be confirmed in a larger, multicenter study.

Regions Competitiveness Increase by Improving Conditions for Industry and Services

Directory of Open Access Journals (Sweden)

Jiraskova Eliska

2013-03-01

Full Text Available The main field of study regarding location theories is to define location factors and to determine the optimal location assuming rational behaviour of economic entities. The issue is to find outwhat place is suitable for localization of the economic entity in order to maximize its profits in relation to its spatial orientation. In the theoretical part, location theories for industry andservices with the impact of location factors are first briefly described. Mainly their development and significance in the competitive environment is discussed because the right selection of location factors can actually help to increase the competitiveness of regions. This paper analyses the actual soft regional and local location factors in individual economic sectors and focuses on thesecondary and tertiary sector because the primary sector is affected by other than the examined factors. The aim of this paper is to identify factors that affect industry and are more important to the service sector. Identifying these factors can actually help to attract new businesses and to increase regions competitiveness. It is, therefore, necessary to determine the key factors that have stimulating effects on the development of individual regions.

Precision Measurements of the Proton Electromagnetic Form Factors in the Time-Like Region and Vector Meson Spectroscopy

CERN Multimedia

2002-01-01

The aim of this experiment is to measure with precision the electromagnetic form factors of the proton in the time-like region via the reaction: .ce @*p @A e|+e|- with antiprotons of momenta between 0 and 2 GeV/c. Up to @= 800 MeV/c, a continuous energy scan in @= 2 MeV (@]s) bins will be performed. The form factor !G(E)! and !G(M)! will be determined separately since large statistics can be collected with LEAR antiproton beams, so that angular distributions can be obtained at many momenta.\\\\ \\\\ In addition, e|+e|- pairs produced via the reaction: .ce @*p @A V|0 + neutrals, .ce !@A e|+e|- where the antiprotons are at rest, will be detected allowing the vector meson mass spectrum between @= 1 GeV and @= 1.7 GeV to be obtained with high statistics and in one run. \\\\ \\\\ The proposed apparatus consists of a central detector, surrounded by a gas Cerenkov counter, wire chambers, hodoscopes, and an electromagnetic calorimeter. The central detector consists of several layers of proportional chambers around a liquid-h...

Environmental management on the basis of Complex Regional Indicators Concept: case of the Murmansk region

Science.gov (United States)

Kozlov, A.; Gutman, S.; Zaychenko, I.; Rytova, E.; Nijinskaya, P.

2015-09-01

The article presents an approach to sustainable environmental development of the Murmansk region of the Russian Federation based on the complex regional indicators as a transformation of a balance scorecard method. The peculiarities of Murmansk region connected with sustainable environmental development are described. The complex regional indicators approach allows to elaborate the general concept of complex regional development taking into consideration economic and non-economic factors with the focus on environmental aspects, accumulated environmental damage in particular. General strategic chart of sustainable environmental development of the Murmansk region worked out on the basis of complex regional indicators concept is composed. The key target indicators of sustainable ecological development of the Murmansk region are presented for the following strategic chart components: regional finance; society and market; industry and entrepreneurship; training, development and innovations. These charts are to be integrated with international environmental monitoring systems.

Towards a regional electricity market in Southeast Europe

International Nuclear Information System (INIS)

Ichord, R.F. Jr.

2002-01-01

Historical evolution of the region's electric power policy is overviewed. The regional characteristics of Southern Europe's electric power market are summarized. The reform indicators of the region's electricity markets are discussed. The status of privatization is presented. Factors in developing regional electricity market are considered. (R.P.)

EVALUATION OF ECONOMIC SECURITY NOVOSIBIRSK REGION (FOR EXAMPLE, A REGIONAL ENGINEERING

Directory of Open Access Journals (Sweden)

Lugacheva L. I.

2014-12-01

Full Text Available The article shows the importance of regional engineering for the Russian economy, it clarifies the factors of economic security of the Novosibirsk region (NSO. Analyzed the characteristics prevailing in the engineering industry, its competitive advantages. The research results of the export orientation of the regional engineering VAT: its direction and priorities; discusses the trends that influence the growth during the recovery has formed a new profile of its foreign economic relations. Threats identified in the development of engineering and to propose measures to overcome them to ensure the economic security of the region. The article deals with the problem-tional institutes provide for the sustainable development of regional engineering, discusses the possibility of using pub-lic-private partnerships. Sharing of risks and responsibilities between the subject of the Russian Federation, municipalities and entrepreneurs - one of the priorities in the creation of the necessary conditions for the economic security of the NSO.

Measurement of weak meson form factors in spacelike regions

CERN Document Server

Brene, N

1973-01-01

With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

Dietary Patterns Derived Using Exploratory and Confirmatory Factor Analysis are Stable and Generalizable Across Race, Region, and Gender Subgroups in the REGARDS Study

Science.gov (United States)

Judd, Suzanne E.; Letter, Abraham J.; Shikany, James M.; Roth, David L.; Newby, P. K.

2015-01-01

Background: Examining diet as a whole using dietary patterns as exposures is a complementary method to using single food or nutrients in studies of diet and disease, but the generalizability of intake patterns across race, region, and gender in the United States has not been established. Objective: To employ rigorous statistical analysis to empirically derive dietary patterns in a large bi-racial, geographically diverse population and examine whether results are stable across population subgroups. Design: The present analysis utilized data from 21,636 participants in the Reasons for Geographic and Racial Differences in Stroke (REGARDS) study who completed the Block 98 food frequency questionnaire. We employed exploratory factor analysis and confirmatory factor analyses on 56 different food groups iteratively and examined differences by race, region, and sex to determine the optimal factor solution in our sample. Results: Five dietary patterns emerged: the “Convenience” pattern was characterized by mixed dishes; the “Plant-based” pattern by fruits, vegetables, and fish; the “Sweets/Fats” pattern by sweet snacks, desserts, and fats and oils; the “Southern” pattern by fried foods, organ meat, and sweetened beverages; and the “Alcohol/Salads” pattern by beer, wine, liquor, and salads. Differences were most pronounced in the Southern pattern with black participants, those residing in the Southeast, and participants not completing high school having the highest scores. Conclusion: Five meaningful dietary patterns emerged in the REGARDS study and showed strong congruence across race, sex, and region. Future research will examine associations between these patterns and health outcomes to better understand racial disparities in disease and inform prevention efforts. PMID:25988129

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

[Internal migration trends and regional dynamics].

Science.gov (United States)

Trabelsi, M

1992-01-01

This study concerns aspects of regional development in Tunisia. It specifically considers how economic factors affect income differentials among regions, and ways in which these in turn influence trends in internal migration. The effect of these trends on urbanization is also explored.

Factors controlling regional grain yield in China over the last 20 years

NARCIS (Netherlands)

wang, Xiaobin; Cai, D.X.; Grant, C.; Hoogmoed, W.B.; Oenema, O.

2015-01-01

Food production is highly dependent on regional yields of crops. Regional differences in grain yields could be due to fertilizer management and climate variability. Here, we analyze trends of grain yields in North China, Northeast China, East China, and Central and Southwest China from 1992 to 2012,

Spatial Analysis of Regional Factors and Lung Cancer Mortality in China, 1973-2013.

Science.gov (United States)

Shen, Xiaoping; Wang, Limin; Zhu, Li

2017-04-01

Background: China's lung cancer crude death rate has increased 6.9-fold from 1973 to 2014. During this time, the country experienced extremely rapid economic growth and social change. It is important to understand the effects of risk factors on lung cancer mortality (LCM) for better allocation of limited resources of cancer prevention and control in China. Methods: Using three nationwide mortality surveys from 1973 to 2005, Global Health Data Exchange data in 2013, three nationwide smoking surveys from 1984 to 2013, four population censuses from 1964 to 2000, and other datasets, we have compiled datasets and developed spatial random effect models to assess the association of various area-level-contributing factors on LCM. Spatial scan statistics are used to detect high-risk clusters of LCM. Results: LCM is higher in urban and more industrialized areas (RR = 1.17) compared with those in rural areas. The level of industrial development's effect is higher for men, which accounts for about 70% of all LCM. Smoking is positively associated with regional variation of LCM rates, and the effect is higher for women than for men. Conclusions: The geographic pattern of high LCM in China is different from that of Western countries. LCM is positively associated with higher socioeconomic status, with more urbanized areas at a higher level of industrial development. Impact: There is a need to further explore additional risk in the high-risk clusters. The study is about China, but this situation may happen in other countries experiencing rapid industrialization and other developing countries. Cancer Epidemiol Biomarkers Prev; 26(4); 569-77. ©2017 AACR See all the articles in this CEBP Focus section, "Geospatial Approaches to Cancer Control and Population Sciences." ©2017 American Association for Cancer Research.

NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1989-01-01

The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

Distribution of intermediate host snails of schistosomiasis and fascioliasis in relation to environmental factors during the dry season in the Tchologo region, Côte d'Ivoire

Science.gov (United States)

Krauth, Stefanie J.; Wandel, Nathalie; Traoré, Seïdinan I.; Vounatsou, Penelope; Hattendorf, Jan; Achi, Louise Y.; McNeill, Kristopher; N'Goran, Eliézer K.; Utzinger, Jürg

2017-10-01

Snail-borne trematodiases, such as fascioliasis and schistosomiasis, belong to the neglected tropical diseases; yet, millions of people and livestock are affected. The spatial and temporal distribution of intermediate host snails plays an important role in the epidemiology and control of trematodiases. Snail distribution is influenced by numerous environmental and anthropomorphic factors. The aim of this study was to assess the distribution and constitution of the snail fauna during the dry season in constructed and natural water bodies in the Tchologo region, northern Côte d'Ivoire, and to relate these findings to environmental factors and human infections. Snails were collected using standard procedures and environmental parameters were assessed from a total of 50 water bodies in and around 30 randomly selected villages. A canonical correspondence analysis was performed to establish the relationship between snail occurrence and environmental factors. Furthermore, a total of 743 people from the same 30 villages and nearby settlements were invited for stool and urine examination for the diagnosis of Fasciola spp., Schistosoma haematobium and Schistosoma mansoni. Snails of medical importance of the genera Biomphalaria, Bulinus, Lymnaea and Physa were found. Differences in snail occurrence from sites sampled in December 2014 and snails sampled in February 2015, as well as between the northern and southern part of the study area, were revealed. Various environmental factors, such as temperature and human activities, were related to the occurrence of intermediate host snail species in the region. Only 2.3% of human participants tested positive for schistosomiasis, while no Fasciola eggs were found in stool samples. We conclude that intermediate host snails of Fasciola and Schistosoma co-occur in water bodies in the Tchologo region and that the distribution of these snails correlates not only with environmental factors, but also with the presence of humans and animals

The importance of cultural factors in the distribution of medicinal plant knowledge: a case study in four Basque regions.

Science.gov (United States)

Menendez-Baceta, Gorka; Aceituno-Mata, Laura; Reyes-García, Victoria; Tardío, Javier; Salpeteur, Matthieu; Pardo-de-Santayana, Manuel

2015-02-23

Previous research suggests that the use of medicinal plants by a given group is mainly driven by biological variables such as the chemical composition or the ecological distribution of plants. However, other studies highlight the importance of cultural aspects such as the curative meaning given to a plant, beliefs, religion or the historical context. Such aspects could play an important role in the use, diffusion or even in the effectiveness of a plant remedy. Fieldwork consisted of 233 orally consented semi-structured interviews with 178 informants about medicinal uses of plants. Interviews were conducted in four historically and geographycally delimited regions of Alava and Biscay with similar environmental conditions but different sociolinguistic backgrounds: two regions were Basque- and two Spanish-speaking. Data were structured in use-reports. A Between Class Analysis was conducted to assess the intercultural and intracultural variability of medicinal plants knowledge. The results show the existence of four clearly different medicinal ethnofloras. While the four ethnofloras share remedies widely distributed through the territory, each of them also includes remedies that are only shared among closely related communities. The ecological availability and chemical composition of the plants may explain why there are widely used plant remedies. On the contrary, the distribution of the locally shared remedies matches up with the cultural heterogeneity of the territory, so cultural factors, such as, language, social networks or the meaning response of the plants seem to explain the use of many traditional plant remedies. In Addition, we also found that Basque speaking territories show higher knowledge levels than Spanish speaking territories. In this sense, the development and reinforcement of Basque identity by Basque nationalism seems to have contributed to maintain the traditional knowledge in the Basque speaking regions. Despite the fact that pharmacological

Mothers' factors associated with female genital mutilation in daughters in the Iraqi Kurdistan Region.

Science.gov (United States)

Shabila, Nazar P

2017-03-01

An important proactive factor for the continuation of female genital mutilation (FGM) is tradition and customs inherited in the family from mothers to daughters. Therefore, the aim of this study was to determine mothers' factors associated with the occurrence of FGM among their daughters. The datasets from the Iraq Multiple Indicator Cluster Survey 2011, on 5,184 women aged 15 to 49 years having at least one daughter, was used. Multivariate analysis based on a binary logistic regression model was applied. Mothers' age (adjusted odds ratio [aOR] = 8.18 at ages 25-34 years, aOR = 22.64 at ages 35-44 years, and aOR = 29.78 at ages 45-49 years, compared to the age group 15-24 years), educational level (aOR = 0.52 for primary education, aOR = 0.26 for secondary education, and aOR = 0.03 for higher education compared to uneducated), employment status (aOR = 0.55 for women having office work compared with unemployed), FGM status (aOR = 27.44 for circumcised mothers compared to uncircumcised), the governorate of residence (aOR = 18.73 for Suleimaniya and aOR = 33.23 for Erbil compared with Dohuk), and the wealth index of the household (aOR = 0.55 for richest group compared to the poorest) were significantly associated with the occurrence of FGM in daughters. Strategies aimed at preventing this harmful practice in the Iraqi Kurdistan Region should include female education and empowerment.

Regional scale soil salinity assessment using remote sensing based environmental factors and vegetation indicators

Science.gov (United States)

Ma, Ligang; Ma, Fenglan; Li, Jiadan; Gu, Qing; Yang, Shengtian; Ding, Jianli

2017-04-01

Land degradation, specifically soil salinization has rendered large areas of China west sterile and unproductive while diminishing the productivity of adjacent lands and other areas where salting is less severe. Up to now despite decades of research in soil mapping, few accurate and up-to-date information on the spatial extent and variability of soil salinity are available for large geographic regions. This study explores the po-tentials of assessing soil salinity via linear and random forest modeling of remote sensing based environmental factors and indirect indicators. A case study is presented for the arid oases of Tarim and Junggar Basin, Xinjiang, China using time series land surface temperature (LST), evapotranspiration (ET), TRMM precipitation (TRM), DEM product and vegetation indexes as well as their second order products. In par-ticular, the location of the oasis, the best feature sets, different salinity degrees and modeling approaches were fully examined. All constructed models were evaluated for their fit to the whole data set and their performance in a leave-one-field-out spatial cross-validation. In addition, the Kruskal-Wallis rank test was adopted for the statis-tical comparison of different models. Overall, the random forest model outperformed the linear model for the two basins, all salinity degrees and datasets. As for feature set, LST and ET were consistently identified to be the most important factors for two ba-sins while the contribution of vegetation indexes vary with location. What's more, models performances are promising for the salinity ranges that are most relevant to agricultural productivity.

Productive Regions: Criteria and Classification

Directory of Open Access Journals (Sweden)

Vlasyuk L. I.

2012-03-01

Full Text Available An official statistical dataset for 80 territorial subjects of the Russian Federation for 2000, 2007 and 2009 has proved the hypothesis that, under the neoclassical concept, the resources move to regions with the highest marginal productivity of the factors of production, which leads to the accumulation of investment resources, while providing financial and social efficiency. Based on cluster analysis by three performance criteria, productive regions are identified, which are dominated by regions productive in the extraction of minerals. It is shown that the stability of the factors’ distribution in space determines the current and future specialization of regional economies

Automated geographic atrophy segmentation for SD-OCT images using region-based C-V model via local similarity factor.

Science.gov (United States)

Niu, Sijie; de Sisternes, Luis; Chen, Qiang; Leng, Theodore; Rubin, Daniel L

2016-02-01

Age-related macular degeneration (AMD) is the leading cause of blindness among elderly individuals. Geographic atrophy (GA) is a phenotypic manifestation of the advanced stages of non-exudative AMD. Determination of GA extent in SD-OCT scans allows the quantification of GA-related features, such as radius or area, which could be of important value to monitor AMD progression and possibly identify regions of future GA involvement. The purpose of this work is to develop an automated algorithm to segment GA regions in SD-OCT images. An en face GA fundus image is generated by averaging the axial intensity within an automatically detected sub-volume of the three dimensional SD-OCT data, where an initial coarse GA region is estimated by an iterative threshold segmentation method and an intensity profile set, and subsequently refined by a region-based Chan-Vese model with a local similarity factor. Two image data sets, consisting on 55 SD-OCT scans from twelve eyes in eight patients with GA and 56 SD-OCT scans from 56 eyes in 56 patients with GA, respectively, were utilized to quantitatively evaluate the automated segmentation algorithm. We compared results obtained by the proposed algorithm, manual segmentation by graders, a previously proposed method, and experimental commercial software. When compared to a manually determined gold standard, our algorithm presented a mean overlap ratio (OR) of 81.86% and 70% for the first and second data sets, respectively, while the previously proposed method OR was 72.60% and 65.88% for the first and second data sets, respectively, and the experimental commercial software OR was 62.40% for the second data set.

The economic performance of regions in the Czech Republic

Directory of Open Access Journals (Sweden)

Lenka Procházková

2013-01-01

Full Text Available Regional development in the Czech Republic contributed to the fact that at present none of the regions is significant backward compared to other. Individual regions have shown among themselves certain differences. This applies in particular to the economic performance of regions. This paper introduce results of our research. Main aim of the work was to indentify economic performace affecting factors of regions NUTS 3 in Czech Republic. It was necessary to define quantity of economic performance to meet this goal. We used them to create method of valuating economic performance of regions. We weighed quantities (e.g. GDP, unemployment rate, net disposable income according to their importance. This procedure was applied to individual regions. We determined the level of economic performance of Czech regions. We present overview of factors and using statistical methods we test their importance to the economic performance of Czech regions.

A preliminary regional assessment of earthquake-induced landslide susceptibility for Vrancea Seismic Region

Science.gov (United States)

Micu, Mihai; Balteanu, Dan; Ionescu, Constantin; Havenith, Hans; Radulian, Mircea; van Westen, Cees; Damen, Michiel; Jurchescu, Marta

2015-04-01

In seismically-active regions, earthquakes may trigger landslides enhancing the short-to-long term slope denudation and sediment delivery and conditioning the general landscape evolution. Co-seismic slope failures present in general a low frequency - high magnitude pattern which should be addressed accordingly by landslide hazard assessment, with respect to the generally more frequent precipitation-triggered landslides. The Vrancea Seismic Region, corresponding to the curvature sector of the Eastern Romanian Carpathians, represents the most active sub-crustal (focal depth > 50 km) earthquake province of Europe. It represents the main seismic energy source throughout Romania with significant transboundary effects recorded as far as Ukraine and Bulgaria. During the last 300 years, the region featured 14 earthquakes with M>7, among which seven events with magnitude above 7.5 and three between 7.7 and 7.9. Apart from the direct damages, the Vrancea earthquakes are also responsible for causing numerous other geohazards, such as ground fracturing, groundwater level disturbances and possible deep-seated landslide occurrences (rock slumps, rock-block slides, rock falls, rock avalanches). The older deep-seated landslides (assumed to have been) triggered by earthquakes usually affect the entire slope profile. They often formed landslide dams strongly influencing the river morphology and representing potential threats (through flash-floods) in case of lake outburst. Despite the large potential of this research issue, the correlation between the region's seismotectonic context and landslide predisposing factors has not yet been entirely understood. Presently, there is a lack of information provided by the geohazards databases of Vrancea that does not allow us to outline the seismic influence on the triggering of slope failures in this region. We only know that the morphology of numerous large, deep-seated and dormant landslides (which can possibly be reactivated in future

Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

Science.gov (United States)

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

Calculation of self-shielding factors for cross-sections in the unresolved resonance region using the GRUCON applied program package

International Nuclear Information System (INIS)

Sinitsa, V.V.

1984-11-01

The author gives a scheme for the calculation of the self-shielding factors in the unresolved resonance region using the GRUCON applied program package. This package is especially created to be used in the conversion of evaluated neutron cross-section data, as available in existing data libraries, into multigroup microscopic constants. A detailed description of the formulae and algorithms used in the programs is given. Some typical examples of calculation are considered and the results are compared with those of other authors. The calculation accuracy is better than 2%

Analysis of regional climate strategies in the Barents region

Energy Technology Data Exchange (ETDEWEB)

Himanen, S.; Inkeroeinen, J.; Latola, K.; Vaisanen, T.; Alasaarela, E.

2012-11-15

Climate change is a global phenomenon with especially harsh effects on the Arctic and northern regions. The Arctic's average temperature has risen at almost twice the rate as elsewhere in the past few decades. Since 1966, the Arctic land area covered by snow in early summer has shrunk by almost a fifth. The Barents Region consists of the northern parts of Norway, Sweden, Finland and Russia (i.e. the European part of Russia). Climate change will cause serious impacts in the Barents Region because of its higher density of population living under harsh climatic conditions, thus setting it apart from other Arctic areas. In many cases, economic activities, like tourism, rely on certain weather conditions. For this reason, climate change and adaptation to it is of special urgency for the region. Regional climate change strategies are important tools for addressing mitigation and adaptation to climate change as they can be used to consolidate the efforts of different stakeholders of the public and private sectors. Regional strategies can be important factors in achieving the national and international goals. The study evaluated how the national climate change goals were implemented in the regional and local strategies and programmes in northern Finland. The specific goal was to describe the processes by which the regional strategies were prepared and implemented, and how the work was expanded to include the whole of northern Finland. Finally, the Finnish preparatory processes were compared to case examples of processes for preparing climate change strategies elsewhere in the Barents Region. This analysis provides examples of good practices in preparing a climate change strategy and implementing it. (orig.)

Rates and factors associated with major modifications to first-line combination antiretroviral therapy: results from the Asia-Pacific region.

Directory of Open Access Journals (Sweden)

Stephen Wright

Full Text Available In the Asia-Pacific region many countries have adopted the WHO's public health approach to HIV care and treatment. We performed exploratory analyses of the factors associated with first major modification to first-line combination antiretroviral therapy (ART in resource-rich and resource-limited countries in the region.We selected treatment naive HIV-positive adults from the Australian HIV Observational Database (AHOD and the TREAT Asia HIV Observational Database (TAHOD. We dichotomised each country's per capita income into high/upper-middle (T-H and lower-middle/low (T-L. Survival methods stratified by income were used to explore time to first major modification of first-line ART and associated factors. We defined a treatment modification as either initiation of a new class of antiretroviral (ARV or a substitution of two or more ARV agents from within the same ARV class.A total of 4250 patients had 961 major modifications to first-line ART in the first five years of therapy. The cumulative incidence (95% CI of treatment modification was 0.48 (0.44-0.52, 0.33 (0.30-0.36 and 0.21 (0.18-0.23 for AHOD, T-H and T-L respectively. We found no strong associations between typical patient characteristic factors and rates of treatment modification. In AHOD, relative to sites that monitor twice-yearly (both CD4 and HIV RNA-VL, quarterly monitoring corresponded with a doubling of the rate of treatment modifications. In T-H, relative to sites that monitor once-yearly (both CD4 and HIV RNA-VL, monitoring twice-yearly corresponded to a 1.8 factor increase in treatment modifications. In T-L, no sites on average monitored both CD4 & HIV RNA-VL concurrently once-yearly. We found no differences in rates of modifications for once- or twice-yearly CD4 count monitoring.Low-income countries tended to have lower rates of major modifications made to first-line ART compared to higher-income countries. In higher-income countries, an increased rate of RNA-VL monitoring was

Physical activity and associated socio-demographic factors in adolescents from the eastern region of Poland

Science.gov (United States)

Wasilewska, Małgorzata; Bergier, Józef

The introduction and maintenance of healthy habits in the field of physical activity at the early stage of life is particularly important for public health. With increasing of public awareness in physical activity, researchers are increasingly questioning its determinants in different age groups. In this paper we focus on variables such as age, sex and place of residence. To determine what selected socio-demographic factors influence the level of physical activity of school youth from the eastern region of Poland in different domains of daily life. A random sample of 916 Polish school youth from Secondary Schools from Eastern Region of Poland aged 16-18 was interviewed in spring 2016 by diagnostic survey method with the use of the official Polish long version of the International Physical Activity Questionnaire (IPAQ). Analysing the relationship between gender and the level of physical activity statistically significant differences were found in all domains in favour of boys. The level of total physical activity in girls was 5345.5 MET-min./week, whereas in boys – 6556.6 MET-min./week. In the area of total physical activity, the highest values were observed in pupils from small towns and villages, with lower values in the youth living in large and medium-sized cities. When the relationship of age with the level of physical activity in particular domains was examined, only the activity in the work/ school domain (p = 0.0129) spoke in favour of the youngest pupils (2578.7 MET-min./week) when compared to the oldest ones (2226.4 MET-min./week). The level of physical activity in young people from the Eastern region of Poland is decreasing with age, both in girls and boys. It is therefore important, especially for the group emerging adulthood, to offer a wide variety of updated, involving, age and gender-oriented school physical activity classes that could be easily practised outside the school environment to improve the level of physical activity in leisure domain

Factors controlling accumulation of soil organic carbon along vegetation succession in a typical karst region in Southwest China

Energy Technology Data Exchange (ETDEWEB)

Liu, Shujuan [Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125 (China); Huanjiang Observation and Research Station of Karst Ecosystem, Chinese Academy of Sciences, Huanjiang, Guangxi Zhuang Autonomous Region 547100 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhang, Wei [Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125 (China); Huanjiang Observation and Research Station of Karst Ecosystem, Chinese Academy of Sciences, Huanjiang, Guangxi Zhuang Autonomous Region 547100 (China); Wang, Kelin, E-mail: kelin@isa.ac.cn [Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125 (China); Huanjiang Observation and Research Station of Karst Ecosystem, Chinese Academy of Sciences, Huanjiang, Guangxi Zhuang Autonomous Region 547100 (China); Pan, Fujing [Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125 (China); Huanjiang Observation and Research Station of Karst Ecosystem, Chinese Academy of Sciences, Huanjiang, Guangxi Zhuang Autonomous Region 547100 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Yang, Shan [Changsha university, Changsha 410003 (China); Shu, Shiyan [Changjiang Project Supervision & Consultancy Co. Ltd, Wuhan 430010 (China); Changjiang Ecology (Hubei) Technology Development LLC, Wuhan 430010 (China)

2015-07-15

Vegetation succession enhances the accumulation of carbon in the soil. However, little is known about the mechanisms underlying soil organic carbon (SOC) accumulation in different vegetation types in the karst region of Southwest China. The goal of this study was to identify and prioritize the effects of environmental parameters, including soil physico-chemical properties, microbial biomass, enzyme activities, and litter characteristics, on SOC accumulation along a vegetation succession sere (grassland, shrubland, secondary forest, and primary forest) in the karst landscape of Southwest China. Relationships between these parameters and SOC were evaluated by redundancy analysis. The results showed that SOC accumulation was significantly different among vegetation types (P < 0.01) and increased with vegetation succession (from 29.10 g·kg{sup −1} in grassland to 73.92 g·kg{sup −1} in primary forest). Soil biochemistry and physical characteristics significantly affected the accumulation of SOC. Soil microbial biomass showed a predominant effect on SOC in each of the four vegetation types. In addition, the soil physical property (especially the silt content) was another controlling factor in the early stages (grassland), and urease activity and saccharase activity were important controlling factors in the early-middle and middle-late stages, respectively. Litter characteristics only showed mild effects on SOC accumulation. Variation partitioning analysis showed that the contribution of sole main factors to SOC variation decreased, while the interaction effect among parameters increased along the succession gradient. - Highlights: • Vegetation restoration is conducive to soil carbon sequestration in karst areas. • The factors controlling SOC accumulation differed along vegetation succession. • The interaction effect among significant factors became more and more prominent along succession.

Regional cluster policies: learning by comparing?

NARCIS (Netherlands)

Hospers, Gerrit J.; Beugelsdijk, Sjoerd

2002-01-01

This paper deals with an intriguing paradox that can be observed in today’s regional economic policy making: whereas unique local factors are increasingly seen as the determinants of regional economic success, simultaneously more and more governments try to copy policy experiences that proved to be

Application of the Method of Statistical Equations of Dependences to Assess the Dynamics of Regional Human Development Index for Khmelnytsk Region

Directory of Open Access Journals (Sweden)

R. О.

2017-12-01

Full Text Available A statistical approach to assessment of the factor values required to have necessary (planned, predicted levels of a resulting indicator achieved, including for purposes of regional socio-economic programs, is developed, by applying the method of statistical equations of dependences. The main problems that can be solved by use of the method of statistical equations of dependences are: direct and inverse problem; computing the factors’ contributions in the resulting indicator; constructing graphs of multiple relation and computing the shares of influence (the weights of selected factors; analysis of functional and correlation dependences, etc. The developed approach is used to assess the dynamics of Regional Human Development Index (RHDI for Khmelnytsk region (Ukraine and its constituent factors, in 2011–2015. The computations show that the factors with the largest contribution in RHDI of Khmelnytsk region are as follows: “number of minimal food baskets that can be purchased for average per capita income in the region” (62.91%, “housing in cities (square area per person” (20.27%, and “total birth rate” (5.33%. The contributions of factors like “planned capacity of ambulatories and policlinics per 10 thousand population” or “coverage of children in school age by secondary education” range from 5.26 to 0.14%. It is concluded that the proposed approach to the application of the method of statistical equations of dependences for modeling of factor and resulting indicators contributing to human development parameters at regional level can be used for assessments at sectoral level, with modifying the nomenclature of indicators measuring the socio-economic development and the financial and economic performance of business entities in an economic sector.

Socio-ecological factors and hand, foot and mouth disease in dry climate regions: a Bayesian spatial approach in Gansu, China

Science.gov (United States)

Gou, Faxiang; Liu, Xinfeng; Ren, Xiaowei; Liu, Dongpeng; Liu, Haixia; Wei, Kongfu; Yang, Xiaoting; Cheng, Yao; Zheng, Yunhe; Jiang, Xiaojuan; Li, Juansheng; Meng, Lei; Hu, Wenbiao

2017-01-01

The influence of socio-ecological factors on hand, foot and mouth disease (HFMD) were explored in this study using Bayesian spatial modeling and spatial patterns identified in dry regions of Gansu, China. Notified HFMD cases and socio-ecological data were obtained from the China Information System for Disease Control and Prevention, Gansu Yearbook and Gansu Meteorological Bureau. A Bayesian spatial conditional autoregressive model was used to quantify the effects of socio-ecological factors on the HFMD and explore spatial patterns, with the consideration of its socio-ecological effects. Our non-spatial model suggests temperature (relative risk (RR) 1.15, 95 % CI 1.01-1.31), GDP per capita (RR 1.19, 95 % CI 1.01-1.39) and population density (RR 1.98, 95 % CI 1.19-3.17) to have a significant effect on HFMD transmission. However, after controlling for spatial random effects, only temperature (RR 1.25, 95 % CI 1.04-1.53) showed significant association with HFMD. The spatial model demonstrates temperature to play a major role in the transmission of HFMD in dry regions. Estimated residual variation after taking into account the socio-ecological variables indicated that high incidences of HFMD were mainly clustered in the northwest of Gansu. And, spatial structure showed a unique distribution after taking account of socio-ecological effects.

Factors affecting regional pulmonary blood flow in chronic ischemic heart disease

International Nuclear Information System (INIS)

Pistolesi, M.; Miniati, M.; Bonsignore, M.

1988-01-01

To assess the effect of left heart disease on pulmonary blood flow distribution, we measured mean pulmonary arterial and wedge pressures, cardiac output, pulmonary vascular resistance, pulmonary blood volume, and arterial oxygen tension before and after treatment in 13 patients with longstanding ischemic heart failure and pulmonary edema. Pulmonary edema was evaluated by a radiographic score, and regional lung perfusion was quantified on a lung scan by the upper to lower third ratio (U:L ratio) of pulmonary blood flow per unit of lung volume. In all cases, redistribution of lung perfusion toward the apical regions was observed; this pattern was not affected by treatment. After treatment, pulmonary vascular pressures, resistance, and edema were reduced, while pulmonary blood volume did not change. At this time, pulmonary vascular resistance showed a positive correlation with the U:L ratio (r = 0.78; P less than 0.01), whereas no correlation was observed between U:L ratio and wedge pressure, pulmonary edema, or arterial oxygen tension. Hence, redistribution of pulmonary blood flow, in these patients, reflects chronic structural vascular changes prevailing in the dependent lung regions

Analyze the factors effecting the development of hydro power projects in hydro rich regions of India

Directory of Open Access Journals (Sweden)

Ameesh Kumar Sharma

2016-09-01

Full Text Available Power is considered as the major back bone for all the nations throughout the world including India on the basis of which development of the country depends. If a country has the resources to generate the power at competitive price in that case the people of the country get the benefits in terms of improvement in their social and economical life. When we talk about India, various locations in the country where still there is no electricity people are living in dark without having the access of the modern technology. The total hydro power potential of India is 1, 50,000 MW out of this total hydro potential only 40,195 MW is exploited till 2014. More than 80% of the total hydro potential of the country is lying in the western Himalayan states (Jammu and Kashmir, Himachal Pradesh, Uttrakhand and Arunachal Pradesh. Small hydro projects are also playing a very important role in the modern world for the development of the remote areas which are not main grid connected specially in western Himalayan region of India. India has a total potential 19,749 MW of small hydro projects and of this total potential only 3990.9 MW harnessed till 2014. Ministry of new and renewable energy in India is also providing special incentives to hydro rich states of India. In this research article we are taken the case study of the small hydro projects in the western Himalayan region because theses states are having vast small hydro potential which is still needed to be harnessed. So, it is very important to identify the factors which are effecting the development of these small ventures especially in western Himalayan region in India.

Hot regions of labile and stable soil organic carbon in Germany - Spatial variability and driving factors

Science.gov (United States)

Vos, Cora; Jaconi, Angélica; Jacobs, Anna; Don, Axel

2018-06-01

Atmospheric carbon dioxide levels can be mitigated by sequestering carbon in the soil. Sequestration can be facilitated by agricultural management, but its influence is not the same on all soil carbon pools, as labile pools with a high turnover may be accumulated much faster but are also more vulnerable to losses. The aims of this study were to (1) assess how soil organic carbon (SOC) is distributed among SOC fractions on a national scale in Germany, (2) identify factors influencing this distribution and (3) identify regions with high vulnerability to SOC losses. The SOC content and proportion of two different SOC fractions were estimated for more than 2500 mineral topsoils (soil texture, bulk soil C / N ratio, total SOC content and pH. For some regions, the drivers were linked to the land-use history of the sites. Arable topsoils in central and southern Germany were found to contain the highest proportions and contents of stable SOC fractions, and therefore have the lowest vulnerability to SOC losses. North-western Germany contains an area of sandy soils with unusually high SOC contents and high proportions of light SOC fractions, which are commonly regarded as representing a labile carbon pool. This is true for the former peat soils in this area, which have already lost and are at high risk of losing high proportions of their SOC stocks. Those black sands can, however, also contain high amounts of stable SOC due to former heathland vegetation and need to be treated and discussed separately from non-black sand agricultural soils. Overall, it was estimated that, in large areas all over Germany, over 30 % of SOC is stored in easily mineralisable forms. Thus, SOC-conserving management of arable soils in these regions is of great importance.

Investment attractiveness as a factor in the tourism industry development in Zaporozhye region

OpenAIRE

Анастасія Павлівна Безхлібна

2016-01-01

The article examines the concept of investment attractiveness of the tourism industry in Zaporozhye region; soft and hard impacts of investment attractiveness of the tourism industry in Zaporozhye region are revealed and analyzed. The SWOT-analysis of investment attractiveness of the tourism industry is revealed; recommendations are given for revealed weaknesses and threats to the prospects of tourism development in Zaporozhye region by the attracting investment mechanisms, using SWOT-analysis 

Regional Technolgy Policy and Factors Shaping Local Innovation Networks in Small German Cities

OpenAIRE

Gebauer, Andrea; Nam, Chang Woon; Parsche, Rüdiger

2003-01-01

Local innovation networks have been considered to be particularly important to innovation and technological change and to the growth prospects of regions and cities in Germany. Accordingly, innovation is a process that results from various (economic and social) interactions of different institutions located in a given region. Consequently, when analysing the local (or regional) innovation system, one should not only investigate the (horizontal and vertical) relations among firms but also the ...

A Dynamic Multi-Level Factor Model with Long-Range Dependence

DEFF Research Database (Denmark)

Ergemen, Yunus Emre; Rodríguez-Caballero, Carlos Vladimir

A dynamic multi-level factor model with stationary or nonstationary global and regional factors is proposed. In the model, persistence in global and regional common factors as well as innovations allows for the study of fractional cointegrating relationships. Estimation of global and regional...

The Streptococcus pyogenes serotype M49 Nra-Ralp3 transcriptional regulatory network and its control of virulence factor expression from the novel eno ralp3 epf sagA pathogenicity region.

Science.gov (United States)

Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O; Podbielski, Andreas

2007-12-01

Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known

Study of the pion electromagnetic form factor in the timelike region, from the production threshold to 900 MeV in the center of mass

International Nuclear Information System (INIS)

Quenzer, A.

1977-01-01

The pion form factor is measured in the reaction e + e - →π + π - for center of mass energies in the range 480-900 MeV. The results are first analysed in terms of the conventional Vector Meson Dominance formalism, and then taking into account the ωπ inelastic channel. The results of this later formalisms is a pion form factor (F) which fits quite well all the existing data on F both in the timelike and spacelike regions, and a pion mean square radius [fr

Creativity and Entrepreneurship: A Regional Analysis of New Firm Formation

OpenAIRE

Lee, Sam Youl; Florida, Richard; Ács, Zoltán J.

2004-01-01

Understanding the factors that promote or mitigate new firm birth is crucial to regional economic development efforts, since a high level of new firm creation significantly contributes to regional economic vitality and is a major signal of a dynamic economy. The literature suggest that various factors such as unemployment, population density/growth, industrial structure, human capital, the availability of financing, and entrepreneurial characteristics significantly influence regional variatio...

INVESTMENT AND INNOVATION FACTORS IN THE MECHANICAL ENGINEERING OF THE REGIONS IN THE IMPLEMENTATION OF THE PROGRAMME OF DEVELOPMENT OF THE ARCTIC ZONE OF THE RUSSIAN FEDERATION

Directory of Open Access Journals (Sweden)

V. N. Borisov

2017-01-01

Full Text Available Purpose: in the article we have carried out research of efficiency of investment and innovative-technological activity in the mechanical engineering of the regions involved in the Program development of the Arctic zone of the Russian Federation. Presented the approach to the assessment of efficiency of investment and technological innovation activities in these regions and influence the development of mechanical engineering.Purpose: in the article we have carried out research of efficiency of investment and innovative-technological activity in the mechanical engineering of the regions involved in the Program development of the Arctic zone of the Russian Federation. Presented the approach to the assessment of efficiency of investment and technological innovation activities in these regions and influence the development of mechanical engineering.Methods: suggested and used the tools of forecasting and analytical studies of the effects that result from the impact of the investment and innovative-technological factors on the development of industry in the regions, with priority mechanical engineering.Results: as a result, we have got a quantitative evaluation of investment and innovative factors for the development of regional economies. We also have built integrated indicators of economic and technological effects arising from the investment and innovative-technological activity involving machinery production in these regions.Conclusions and relevance: interpretation of the results shows that in most regions innovation and investment activities have a significant impact on the competitiveness of manufactured machinery products and on the export potential of the region. The potential of regional economic development lies in the interaction of domestic production and the innovative technological component. In the course of the implementation of the Arctic project, the demand for new technologies and scientific results is formed, the specific

Innovative Technological Development of Russian Mining Regions (on Example of Kemerovo Region)

Science.gov (United States)

Shavina, Evgeniya; Kalenov, Oleg

2017-11-01

A characteristic trend of many countries modern development is the transition to an innovative economy. At present, this is the only opportunity to secure and maintain a high standard of living for the population. Moreover, innovative development of Russian can be achieved during technological progress in its regions. In this regard, it is necessary to assess the innovative potential of the region and identify the most actual problems that impede the transition to the trajectory of innovative development. The authors outline several main indicators that help to determine the level of innovation and technological development of one of the largest industrial areas of Russia - Kemerovo region. The special economic role of Kemerovo region as a large territorial old-industrial complex of Western Siberia requires a large-scale work to solve the most acute problems of regional development. It is necessary to find the answer for existing problems through the implementation of a system of state regulation aimed at making the innovation component a leading factor of the regional economy competitiveness.

The Regional Heterogeneity of Productivity Determinants: Evidence from Ukrainian Firms

Directory of Open Access Journals (Sweden)

Cieślik Andrzej

2017-03-01

Full Text Available This paper studies the determinants of the total factor productivity (TFP for Ukrainian firms in the manufacturing sector across macro-regions using recent micro-level datasets for 2013. Our empirical results show some degree of heterogeneity across Ukrainian macro-regions; in particular, the link between the total factor productivity, firm size, imports and the level of competition seems to be valid for all macro regions. However, the effects of private ownership status, capital intensity and exports seems to be region specific. In addition, we found no relationship between firm productivity and foreign ownership for any of the regions.

HIV/AIDS in Russia: determinants of regional prevalence

Directory of Open Access Journals (Sweden)

Jordaan Jacob A

2007-06-01

Full Text Available Abstract Background The motivation for this paper is to inform the selection of future policy directions for tackling HIV/AIDS in Russia. The Russian Federation has more people living with HIV/AIDS than any other country in Europe, and nearly 70% of the known infections in Eastern Europe and Central Asia. The epidemic is particularly young, with 80% of those infected aged less than thirty, and no Russian region has escaped the detection of infections. However, measures to address the epidemic in Russia have been hampered by late recognition of the scale of the problem, poor data on HIV prevalence, potentially counterproductive narcotics legislation, and competing health priorities. An additional complication has been the relative lack of research into the spatial heterogeneity of the Russian HIV/AIDS epidemic, investigating the variety of prevalence rates in the constituent regions and questioning assumptions about the links between the epidemic and the circumstances of post-Soviet transformation. In the light of these recent developments, this paper presents research into the determinants of regional HIV prevalence levels in Russia. Results Statistical empirical research on HIV and other infectious diseases has identified a variety of factors that influence the spread and development of these diseases. In our empirical analysis of determinants of HIV prevalence in Russia at the regional level, we identify factors that are statistically related to the level of HIV prevalence in Russian regions, and obtain some indication of the relative importance of these factors. We estimate an empirical model that includes factors which describe economic and socio-cultural characteristics. Conclusion Our analysis statistically identifies four main factors that influence HIV prevalence in Russian regions. Given the different nature of the factors that we identify to be of importance, we conclude that successful HIV intervention policies will need to be

A comparative risk assessment of burden of disease and injury attributable to 67 risk factors and risk factor clusters in 21 regions, 1990-2010: a systematic analysis for the Global Burden of Disease Study 2010.

Science.gov (United States)

Lim, Stephen S; Vos, Theo; Flaxman, Abraham D; Danaei, Goodarz; Shibuya, Kenji; Adair-Rohani, Heather; Amann, Markus; Anderson, H Ross; Andrews, Kathryn G; Aryee, Martin; Atkinson, Charles; Bacchus, Loraine J; Bahalim, Adil N; Balakrishnan, Kalpana; Balmes, John; Barker-Collo, Suzanne; Baxter, Amanda; Bell, Michelle L; Blore, Jed D; Blyth, Fiona; Bonner, Carissa; Borges, Guilherme; Bourne, Rupert; Boussinesq, Michel; Brauer, Michael; Brooks, Peter; Bruce, Nigel G; Brunekreef, Bert; Bryan-Hancock, Claire; Bucello, Chiara; Buchbinder, Rachelle; Bull, Fiona; Burnett, Richard T; Byers, Tim E; Calabria, Bianca; Carapetis, Jonathan; Carnahan, Emily; Chafe, Zoe; Charlson, Fiona; Chen, Honglei; Chen, Jian Shen; Cheng, Andrew Tai-Ann; Child, Jennifer Christine; Cohen, Aaron; Colson, K Ellicott; Cowie, Benjamin C; Darby, Sarah; Darling, Susan; Davis, Adrian; Degenhardt, Louisa; Dentener, Frank; Des Jarlais, Don C; Devries, Karen; Dherani, Mukesh; Ding, Eric L; Dorsey, E Ray; Driscoll, Tim; Edmond, Karen; Ali, Suad Eltahir; Engell, Rebecca E; Erwin, Patricia J; Fahimi, Saman; Falder, Gail; Farzadfar, Farshad; Ferrari, Alize; Finucane, Mariel M; Flaxman, Seth; Fowkes, Francis Gerry R; Freedman, Greg; Freeman, Michael K; Gakidou, Emmanuela; Ghosh, Santu; Giovannucci, Edward; Gmel, Gerhard; Graham, Kathryn; Grainger, Rebecca; Grant, Bridget; Gunnell, David; Gutierrez, Hialy R; Hall, Wayne; Hoek, Hans W; Hogan, Anthony; Hosgood, H Dean; Hoy, Damian; Hu, Howard; Hubbell, Bryan J; Hutchings, Sally J; Ibeanusi, Sydney E; Jacklyn, Gemma L; Jasrasaria, Rashmi; Jonas, Jost B; Kan, Haidong; Kanis, John A; Kassebaum, Nicholas; Kawakami, Norito; Khang, Young-Ho; Khatibzadeh, Shahab; Khoo, Jon-Paul; Kok, Cindy; Laden, Francine; Lalloo, Ratilal; Lan, Qing; Lathlean, Tim; Leasher, Janet L; Leigh, James; Li, Yang; Lin, John Kent; Lipshultz, Steven E; London, Stephanie; Lozano, Rafael; Lu, Yuan; Mak, Joelle; Malekzadeh, Reza; Mallinger, Leslie; Marcenes, Wagner; March, Lyn; Marks, Robin; Martin, Randall; McGale, Paul; McGrath, John; Mehta, Sumi; Mensah, George A; Merriman, Tony R; Micha, Renata; Michaud, Catherine; Mishra, Vinod; Mohd Hanafiah, Khayriyyah; Mokdad, Ali A; Morawska, Lidia; Mozaffarian, Dariush; Murphy, Tasha; Naghavi, Mohsen; Neal, Bruce; Nelson, Paul K; Nolla, Joan Miquel; Norman, Rosana; Olives, Casey; Omer, Saad B; Orchard, Jessica; Osborne, Richard; Ostro, Bart; Page, Andrew; Pandey, Kiran D; Parry, Charles D H; Passmore, Erin; Patra, Jayadeep; Pearce, Neil; Pelizzari, Pamela M; Petzold, Max; Phillips, Michael R; Pope, Dan; Pope, C Arden; Powles, John; Rao, Mayuree; Razavi, Homie; Rehfuess, Eva A; Rehm, Jürgen T; Ritz, Beate; Rivara, Frederick P; Roberts, Thomas; Robinson, Carolyn; Rodriguez-Portales, Jose A; Romieu, Isabelle; Room, Robin; Rosenfeld, Lisa C; Roy, Ananya; Rushton, Lesley; Salomon, Joshua A; Sampson, Uchechukwu; Sanchez-Riera, Lidia; Sanman, Ella; Sapkota, Amir; Seedat, Soraya; Shi, Peilin; Shield, Kevin; Shivakoti, Rupak; Singh, Gitanjali M; Sleet, David A; Smith, Emma; Smith, Kirk R; Stapelberg, Nicolas J C; Steenland, Kyle; Stöckl, Heidi; Stovner, Lars Jacob; Straif, Kurt; Straney, Lahn; Thurston, George D; Tran, Jimmy H; Van Dingenen, Rita; van Donkelaar, Aaron; Veerman, J Lennert; Vijayakumar, Lakshmi; Weintraub, Robert; Weissman, Myrna M; White, Richard A; Whiteford, Harvey; Wiersma, Steven T; Wilkinson, James D; Williams, Hywel C; Williams, Warwick; Wilson, Nicholas; Woolf, Anthony D; Yip, Paul; Zielinski, Jan M; Lopez, Alan D; Murray, Christopher J L; Ezzati, Majid; AlMazroa, Mohammad A; Memish, Ziad A

2012-12-15

Quantification of the disease burden caused by different risks informs prevention by providing an account of health loss different to that provided by a disease-by-disease analysis. No complete revision of global disease burden caused by risk factors has been done since a comparative risk assessment in 2000, and no previous analysis has assessed changes in burden attributable to risk factors over time. We estimated deaths and disability-adjusted life years (DALYs; sum of years lived with disability [YLD] and years of life lost [YLL]) attributable to the independent effects of 67 risk factors and clusters of risk factors for 21 regions in 1990 and 2010. We estimated exposure distributions for each year, region, sex, and age group, and relative risks per unit of exposure by systematically reviewing and synthesising published and unpublished data. We used these estimates, together with estimates of cause-specific deaths and DALYs from the Global Burden of Disease Study 2010, to calculate the burden attributable to each risk factor exposure compared with the theoretical-minimum-risk exposure. We incorporated uncertainty in disease burden, relative risks, and exposures into our estimates of attributable burden. In 2010, the three leading risk factors for global disease burden were high blood pressure (7·0% [95% uncertainty interval 6·2-7·7] of global DALYs), tobacco smoking including second-hand smoke (6·3% [5·5-7·0]), and alcohol use (5·5% [5·0-5·9]). In 1990, the leading risks were childhood underweight (7·9% [6·8-9·4]), household air pollution from solid fuels (HAP; 7·0% [5·6-8·3]), and tobacco smoking including second-hand smoke (6·1% [5·4-6·8]). Dietary risk factors and physical inactivity collectively accounted for 10·0% (95% UI 9·2-10·8) of global DALYs in 2010, with the most prominent dietary risks being diets low in fruits and those high in sodium. Several risks that primarily affect childhood communicable diseases, including unimproved

Factors associated with quality of life among the elderly in the community of the southern triangle macro-region, Minas Gerais, Brazil.

Science.gov (United States)

Paiva, Michelle Helena Pereira de; Pegorari, Maycon Sousa; Nascimento, Janaína Santos; Santos, Álvaro da Silva

2016-11-01

This study sought to establish the socioeconomic and health factors associated with quality of life among the elderly in the community. An analytical study with a cross-sectional and quantitative approach was conducted in 2012 and 2013 with 3430 senior citizens in 24 municipalities in the Southern Triangle Macro-region of the State of Minas Gerais in Brazil. A structured questionnaire was used for socioeconomic and health variables, as well as the Katz scale, the World Health Organization Quality of Life-Bref (WHOQOL-BREF) and the World Health Organization Quality of Life Assessment for Older Adults (WHOQOL-OLD). Descriptive, bivariate statistical analysis was performed and a multiple linear regression model (p environmental domain and from the aspect of autonomy, a key influencing factor being negative health perception.

Taq I polymorphism in the 5' region of the von Willebrand Factor (vWF) gene

Energy Technology Data Exchange (ETDEWEB)

Lavergne, J M; Bahnak, B R; Assouline, Z; Pietu, G; Kerbiriou-Nabias, D; Meulien, P; Pavirani, A; Meyer, D

1988-03-25

pvWFIPC8 is a 2.28 Kb partial cDNA clone for human von Willebrand factor (vWF) isolated from a human lung cDNA library and inserted into the EcoRI site of pUC9. The sequence includes the last 1330 nucleotides that encode for vWF propeptide and 950 nucleotides that encode for mature vWF. Taq I (TCGA) identifies plural invariant bands and two variant bands with alleles at 2.3 (Al) and 1.0 (A2). The frequency was determined in 33 unrelated European and North American caucasians. The extreme 3' region of pvWFIPC8 corresponds to the 5' boundary of an area that could possibly hybridize with similar sequences on human chromosome 22. The 5' 1.74 Kb portion of pvWFIPC8 generated by Bam HI digestion that corresponds to sequences only on chromosome 12 also demonstrates the polymorphism. Co-dominant segregation was demonstrated in 6 families of 48 individuals.

COMBINATION OF GOALS STRATEGY REGION

Directory of Open Access Journals (Sweden)

Denys Yu. Lapigin

2015-01-01

Full Text Available Currently the tools to identify strategicallyimportant objectives of regional development is not enough to build a developmentperspective, relying on something special,what distinguishes each region from therest. The article discusses approaches to the formation of the regional developmentstrategy, which is based on goals set by the results of the analysis of the main factors inthe development of the region. The study is based on the methodology of systems theoryand methods of strategic management. The most important results should include tools tobuild the tree of strategic objectives resultingfrom the implementation of the algorithm forconstructing planes of analysis and development of the region. The results can be used to develop a strategy for the developmentof socio-economic systems of various typesand forms.

Regional differences in antihyperglycemic medication are not explained by individual socioeconomic status, regional deprivation, and regional health care services. Observational results from the German DIAB-CORE consortium.

Directory of Open Access Journals (Sweden)

Christina Bächle

Full Text Available This population-based study sought to extend knowledge on factors explaining regional differences in type 2 diabetes mellitus medication patterns in Germany.Individual baseline and follow-up data from four regional population-based German cohort studies (SHIP [northeast], CARLA [east], HNR [west], KORA [south] conducted between 1997 and 2010 were pooled and merged with both data on regional deprivation and regional health care services. To analyze regional differences in any or newer anti-hyperglycemic medication, medication prevalence ratios (PRs were estimated using multivariable Poisson regression models with a robust error variance adjusted gradually for individual and regional variables.The study population consisted of 1,437 people aged 45 to 74 years at baseline, (corresponding to 49 to 83 years at follow-up with self-reported type 2 diabetes. The prevalence of receiving any anti-hyperglycemic medication was 16% higher in KORA (PR 1.16 [1.08-1.25], 10% higher in CARLA (1.10 [1.01-1.18], and 7% higher in SHIP (PR 1.07 [1.00-1.15] than in HNR. The prevalence of receiving newer anti-hyperglycemic medication was 49% higher in KORA (1.49 [1.09-2.05], 41% higher in CARLA (1.41 [1.02-1.96] and 1% higher in SHIP (1.01 [0.72-1.41] than in HNR, respectively. After gradual adjustment for individual variables, regional deprivation and health care services, the effects only changed slightly.Neither comprehensive individual factors including socioeconomic status nor regional deprivation or indicators of regional health care services were able to sufficiently explain regional differences in anti-hyperglycemic treatment in Germany. To understand the underlying causes, further research is needed.

Predictive factors of local-regional recurrences following parotid sparing intensity modulated or 3D conformal radiotherapy for head and neck cancer

International Nuclear Information System (INIS)

Feng, Mary; Jabbari, Siavash; Lin, Alexander; Bradford, Carol R.; Chepeha, Douglas B.; Teknos, Theodoros N.; Worden, Francis P.; Tsien, Christina; Schipper, Matthew J.; Wolf, Gregory T.; Dawson, Laura A.; Eisbruch, Avraham

2005-01-01

Background and purpose: Predictive factors for local-regional (LR) failures after parotid-sparing, Intensity modulated (IMRT) or 3D conformal radiotherapy for head and neck (HN) cancers were assessed. Patients and methods: One hundred and fifty-eight patients with mostly stages III-IV HN squamous cell carcinoma underwent curative bilateral neck irradiation aimed at sparing the parotid glands. Patient, tumor, and treatment factors were analyzed as predictive factors for LR failure. Results: Twenty-three patients had LR recurrence (19 in-field and four marginal). No differences were found in the doses delivered to the PTVs of patients with or without in-field recurrences. In univariate analysis, tumor site was highly predictive for LR failure in both postoperative and definitive RT patients. In postoperative RT patients, pathologic tumor size, margin status, extracapsular extension (ECE) and number of lymph node metastases, were also significantly predictive. Multivariate analysis showed tumor site (oropharynx vs. other sites) to be a significant predictor in all patients, and involved margins and number of involved lymph nodes in postoperative patients. Conclusions: Clinical rather than dosimetric factors predicted for LR failures in this series, and were similar to those reported following standard RT. These factors may aid in the selection of patients for studies of treatment intensification using IMRT

Fiscality - A Relevant Factor Influencing Regional Development in Romania and the European Union

Directory of Open Access Journals (Sweden)

Vlad Cristina

2016-06-01

Full Text Available The paper aims to examine taxation in the EU in correlation with regional development measures implemented. We started with the EU vision on regional development. If during the 2007-2013 period, were pursued three major objectives (convergence, regional competitiveness and territorial cooperation, in the current 2014-2020 funding period, money is allocated differently between countries that are deemed to be more developed, in transition and less developed. These categories are set according to GDP per capita. Next we exposed the fiscal changes made in the EU in 2010-2011 period and then we corelate them with the strategy for regional development for five member states: Romania, Bulgaria, Czech Republic , Hungary and Poland. We used data reported by Eurostat regarding the evolution of unemployment rate and for the foreign direct investments in 2007-2012 period. We also brought up and changes required by the new Romanian Fiscal Code. According to it, measures such as reduction of income tax for new micro enterprises or extending the VAT reverse charge mechanism in many sectors of activity, are meant to encourage foreign capital inflows and also to increase the level of regional development. As a general conclusion, we found that there is a direct link between fiscal policy and regional development; fiscal measures implemented influence the level of unemployment, economic growth, and competitiveness in the private sector.

Factors associated with unintentional injury among the paediatric age population in the hospitals of Amhara National Regional State, Ethiopia

Directory of Open Access Journals (Sweden)

Bewket Tadesse Tiruneh

Full Text Available Background: Childhood unintentional injuries cause nearly 875,000 deaths each year. The aim of this study was to assess the prevalence and factors associated with unintentional injury of children presenting to the hospitals of Amhara Regional State, Ethiopia. Methods: In a hospital-based, cross-sectional study undertaken in one month, from April 1 to 30th 2016, 893 children less than 18 years of age were included. Data were collected using an interviewer-administered questionnaire. Training was given to all data collectors and supervisors. Data was entered into EPI info version 7 and then exported to SPSS version 20, for further analysis. Results: Unintentional injury caused 62% (554 of all injuries in attending children. Several factors affected the likelihood of injuries, namely the age of the child, age of the parents or guardians, sex of the child, and whether the child lived with the parents. Modifiable factors were the child’s behaviour, awareness of danger, the child’s level of educational, if the child’s parent had received adequate injury counselling, and whether a child was left in the care of another child. The source of light in the house, and house floor material were also significant factors at p < 0.05. Conclusion: The prevalence of unintentional injury was high. Many of the factors associated with injuries are modifiable and safety issues for children need urgent attention. Keywords: Unintentional injury, Paediatric, Ethiopia, Low resource

A Declining Region: Provincial Renaissance Revisited (Case of Volgograd Region

Directory of Open Access Journals (Sweden)

Drozdova Yuliya

2014-12-01

exceeds incoming migrants. Young people under 35 showed the highest rate of willingness to leave the region – 57.6 % of respondents, which arouses concern about the region’s future as this cohort capable of developing the region is the target of all plans about boosting the regional image, and these people are not going to cast in their lot with the Volgograd region. For the moment, we can point out that the region shows poor attractiveness for the main target groups in the region, which encumbers the formation of the region’s image and regional identity, indicates negative tendencies and implies great effort on the part of management entities if they want to change the situation in the Volgograd region. Our study revealed the main trends in building a positive image of the region and changing the local context; these are traditional (centre of war and history memorials – 38 % of respondents, industrial – 46.0 % of respondents, tourism – 26.8 % of respondents, and innovative (centre for training and education – 35.5 %, centre for culture – 37.9 % of respondents. The regional image and local context do not change spontaneously; they are rather a product of conscious, well-regulated conceptualization, a product of artificially organized public reflection and projection. According to the surveyed people residing in the region, the region’s development and change in local context can be helped along by such factors as “active cooperation of the authorities and business – 49.3 % of respondents; “honesty among regional and municipal officials – 38.6 % of respondents; “safety of business operations” – 34.3 % of respondents; “presence of a regional strategy that meets the region’s needs” – 33.9 % of respondents; “social and tax benefits” – 33.0 % of respondents; “the people should be informed about the project of regional development and take part in them” – 26.8 % of respondents. Revealing the factors that determine the local

Factors associated with the successful aging of the socially-active elderly in the metropolitan region of Porto Alegre.

Science.gov (United States)

de Moraes, João Feliz Duarte; de Azevedo e Souza, Valdemarina Bidone

2005-12-01

To identify the factors associated with aging of the socially-active elderly in the metropolitan region of Porto Alegre. A cross-sectional study was conducted involving a sample of 400 elderly subjects. Through a conglomerate analysis using the combined results of the Flanagan Scale and the quality of life assessment instrument developed by the World Health Organization (WHOQOL-100), the subjects classified as presenting a higher quality of life were considered to have aged successfully. After having been adjusted for the variables gender, age, level of depression, despair, perceived health status, meaning that personal beliefs give to life, satisfaction with social activities and relations, the following factors maintained their independent and meaningful effect on successful aging: family relations and friendships (OR = 4.93; 95% CI: 2.83-8.60), health and perceived well being (OR = 1.66; 95% CI: 1.07-2.59), functional capacity (OR = 23.70; 95% CI: 10.98-51.06) and psychosocial support (OR = 7.36; 95% CI: 4.00-13.54). Independence in performing daily life activities and autonomy, as well as satisfaction with family relations and friendships, were independent predictive factors of successful aging for both men and women. For women in particular, there were various predictive factors: material comfort; feeling physically well; body image and appearance; self-esteem; positive feelings; interpersonal relationships; social support; participation in recreational activities; sexuality; spirituality; and beliefs. The elderly maintain a relationship with themselves, with others and with their beliefs. Family is the main social support system.

Khat Chewing among Students of Higher Education in Jazan Region, Saudi Arabia: Prevalence, Pattern, and Related Factors

Directory of Open Access Journals (Sweden)

Rashad Mohammed Alsanosy

2013-01-01

Full Text Available Objectives. (1 To estimate the prevalence and behavioral patterns of Khat chewing and (2 to investigate factors that influenced the pattern of Khat use among undergraduate students in different higher education institutions in Jazan region, Saudi Arabia. Materials and Methods. A cross-sectional study using a pretested structured self-administered quantitative questionnaire was used to collect data. SPSS version 17 software program was used for data analysis. Results. The overall current Khat chewing prevalence among higher education students was found to be 23.1%, significantly higher among males at 38.5% than among females at 2.1% . Lifetime Khat chewer students were 24.8% for males at 40.5%, significantly higher compared with females at 3.7% . Univariate analysis revealed that the gender of student, smoking status of student, a friend’s smoking, and Khat chewing were associated with a significant high risk of Khat chewing (   for all. Conclusions. The use of Khat trend is increasing among higher education students in Jazan region. A multilevel, value based, comprehensive, and strategic long-term intervention plan is needed. The comprehensive plan may include social interventions geared by creating recreations alternatives and opportunities for youth and a critical review for current authorities’ interventions and services.

Prevalence and Factors Associated with Hydatidiform Mole among Patients Undergoing Uterine Evacuation at Mbarara Regional Referral Hospital

Directory of Open Access Journals (Sweden)

Olivier Mulisya

2018-01-01

Full Text Available Objective. We sought to determine the prevalence of and factors associated with hydatidiform molar gestations amongst patients undergoing uterine evacuation at Mbarara Regional Referral Hospital (MRRH, Mbarara, Uganda. Methods. This was a cross-sectional study carried out from November 2016 to February 2017. All patients admitted for uterine evacuation for nonviable pregnancy were included. The study registered 181 patients. Data were collected on sociodemographics, medical conditions, obstetrics, and gynecological factors. The evacuated tissue received a full gross and histopathologic examination. Cases of pathologically suspected complete hydatidiform mole were confirmed by p57 immunohistochemistry. Data were analyzed using STATA 13. Results. The prevalence of hydatidiform mole was 6.1% (11/181. All detected moles were complete hydatidiform moles, and there were no diagnosed partial hydatidiform moles. Clinical diagnosis of molar pregnancy was suspected in 13 patients, but only 69.2% (9/13 were confirmed as molar pregnancies histologically. Two cases were clinically unsuspected. Factors that had a significant relationship with complete hydatidiform mole included maternal age of 35 years and above (aOR 13.5; CI: 1.46–125.31; p=0.00, gestational age beyond the first trimester at the time of uterine evacuation (aOR 6.2; CI: 1.07–36.14; p=0.04, and history of previous abortion (aOR 4.3; CI: 1.00–18.57; p=0.05. Conclusion. The prevalence of complete hydatidiform mole was high at 6.1%. Associated risk factors included advanced maternal age (35 years and above, history of previous abortions, and gestational age beyond the first trimester at the time of evacuations. Recommendations. We recommend putting in place capacity to do routine histopathological examination of all products of conception especially those at high risk for a molar gestation either by clinical suspicion or by risk factors including advanced maternal age, advanced gestational

Region-to-area screening methodology for the Crystalline Repository Project

International Nuclear Information System (INIS)

1985-04-01

The purpose of this document is to describe the Crystalline Repository Project's (CRP) process for region-to-area screening of exposed and near-surface crystalline rock bodies in the three regions of the conterminous United States where crystalline rock is being evaluated as a potential host for the second nuclear waste repository (i.e., in the North Central, Northeastern, and Southeastern Regions). This document indicates how the US Department of Energy's (DOE) General Guidelines for the Recommendation of Sites for Nuclear Waste Repositories (10 CFR 960) were used to select and apply factors and variables for the region-to-area screening, explains how these factors and variable are to be applied in the region-to-area screening, and indicates how this methodology relates to the decision process leading to the selection of candidate areas. A brief general discussion of the screening process from the national survey through area screening and site recommendation is presented. This discussion sets the scene for detailed discussions which follow concerning the region-to-area screening process, the guidance provided by the DOE Siting Guidelines for establishing disqualifying factors and variables for screening, and application of the disqualifying factors and variables in the screening process. This document is complementary to the regional geologic and environmental characterization reports to be issued in the summer of 1985 as final documents. These reports will contain the geologic and environmental data base that will be used in conjunction with the methodology to conduct region-to-area screening

Factors Affecting Successful use of Erythropoietin in the Treatment of Anemia in Patients on Hemodialysis: Experience in Hajjah Region, Yemen

Directory of Open Access Journals (Sweden)

AL-Rohani Muhamed

2001-01-01

Full Text Available The use of recombinant human erythropoietin (rHuEpo became an essential part of the treatment of anemia in patients with end stage renal failure (ESRF. Our experience at the Hajjah region, Yemen, confirms that the use of rHuEpo significantly increases the level of hemoglobin (HB and hematocrit (Hct, improves work tolerance and overall quality of life of patients on hemodialysis. The observable improvement occurred in 87.5% of patients. The most prominent factors that caused deterioration in the increment of HB and Hct were infection with malaria and chronic infection. Failure of patients′ compliance, largely due to lack of education, was another important factor effecting the results. Many of our patients did not understand the importance of diet and drug regime. It is very important to spend more time on educating such patients.

The Factor Mobility in the Russian Economy

Directory of Open Access Journals (Sweden)

Lyudmila Ivanovna Vlasyuk

2012-12-01

Full Text Available On the basis of regional economic data of the Russian Federation the authors implement an empirical test of the theoretical concept according to which factors of production – labour and capital – try to get to the region where their incomings – wages and returns on capital – are the highest, revealing the tendency to their spatial equalization. The result is ambiguous. On the one hand, there are the highest growth rates of wages in regions with the highest growth rates of capital as a consequence of the increase in the marginal product of labor. On the other hand, the initial differences in regional endowments of capital and labour do not generate resource movements. This reveals the paradox: the capital growth rates are the highest in regions with relatively high (in comparison with national median level initial wages which imply a comparatively high capitallabour ratio and a small marginal product of capital. One of such regions, Khabarovsky Krai, is analyzed in details. The authors study two economic sectors in the region – capital-intensive and labour-intensive. It is found that the demand for output of the labour-intensive sector grows faster than that of the capital-intensive sector, resulting in such a reallocation of resources among sectors, which causes the increase of capital-labour ratio and wages in both sectors and in region as a whole. So the paradox can be explained by intra-regional factor movements which were not taken into account in testing of spatial (inter-regional factor movements and of production factor incomings

Kinematics of current region fragmentation in semi-inclusive deeply inelastic scattering

Energy Technology Data Exchange (ETDEWEB)

Boglione, M., E-mail: elena.boglione@to.infn.it [Dipartimento di Fisica, Università di Torino, INFN - Sezione Torino, Via P. Giuria 1, 10125 Torino (Italy); Collins, J., E-mail: jcc8@psu.edu [Department of Physics, Penn State University, University Park, PA 16802 (United States); Gamberg, L., E-mail: lpg10@psu.edu [Science Division, Penn State University Berks, Reading, PA 19610 (United States); Gonzalez-Hernandez, J.O., E-mail: jogh@jlab.org [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Rogers, T.C., E-mail: trogers@odu.edu [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Sato, N., E-mail: nsato@jlab.org [Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States)

2017-03-10

Different kinematical regions of semi-inclusive deeply inelastic scattering (SIDIS) processes correspond to different underlying partonic pictures, and it is important to understand the transition between them. We find criteria in semi-inclusive deeply inelastic scattering (SIDIS) for identifying the current fragmentation region — the kinematical region where a factorization picture with fragmentation functions is appropriate, especially for studies of transverse-momentum-dependent (TMD) functions. This region is distinguished from the central (soft) and target fragmentation regions. The basis of our argument is in the errors in approximations used in deriving factorization. As compared with previous work, we show that it is essential to take account of the transverse momentum of the detected hadron, and we find a much more restricted range for genuine current fragmentation. We show that it is important to develop an extended factorization formulation to treat hadronization in the central region, as well as the current and target fragmentation regions, and to obtain a unified formalism spanning all rapidities for the detected hadron.

Household risk factors associated to infestation of Triatoma dimidiata, the Chagas disease vector in Central Region of Veracruz, Mexico

Directory of Open Access Journals (Sweden)

César A Sandoval-Ruiz

2014-03-01

Full Text Available Objective. To evaluate risk factors facilitating the colonization of dwellings by Triatoma dimidiata in the central region of the state of Veracruz. Materials and methods. We applied socioeconomic questionnaires and entomologic surveys in three localities (Chavarrillo, Soyacuautla and Arroyo Agrio in central Veracruz involving 115 households. Results. We found that the main risk factors were the predominance of unplastered walls and particularly those made of light weight aggregate concrete blocks and wood. At Chavarrillo, houses usually have unplastered walls, whereas in Soyocuautla walls are commonly manufactured with wood. In Arroyo Agrio, the phenomenon was seasonal, and bugs were commonly found in the dry season, particularly in relatively new houses, less than 20 years old. Conclusions. These results help to improve the surveillance capacity for this vector and the control strategies to reduce the transmission of Chagas disease in the state of Veracruz and other sites where this species is present.

Revised draft: Northeastern Regional environmental characterization report. Volume 1

International Nuclear Information System (INIS)

1984-11-01

This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in Maine, New Hampshire, Vermont, northeastern and southeastern New York, Massachusetts, Rhode Island, Connecticut, northern New Jersey, and eastern Pennsylvania. For each of the states within the Northeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed federal protected lands, proximity to federal protected lands, existing state protected lands, proximity to state protected lands, population density and distribution, proximity to highly populated areas, national and state forest lands, state wildlife lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that may be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy (DOE) Siting Guidelines and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process

Revised draft: Southeastern Regional environmental characterization report. Volume 1

International Nuclear Information System (INIS)

1984-11-01

This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in central Maryland; noncoastal Virginia, North Carolina, and South Carolina; and northern Georgia. For each of the states within the Southeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed federal protected lands, proximity to federal protected lands, existing state protected lands, proximity to state protected lands, population density and distribution, proximity to highly populated areas, national and state forest lands, state wild-life lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that may be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy (DOE) Siting Guidelines and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process

Southeastern Regional Environmental Characterization Report. Volume 1. Final report

International Nuclear Information System (INIS)

1985-08-01

This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in central Maryland; noncoastal Virginia, North Carolina, and South Carolina; and northern Georgia. For each of the States within the Southeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposd Federal-protected lands, components of National Forest Lands, proximity to Federal-protected lands, existing State-protected lands, proximity to State-protected lands, population density and distribution, proximity to highly populated areas, or to 1-mile-square areas with 1000 or more persons, national and State forest lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that will be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy Siting Guidelines (10 CFR 960) and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process

An empirical research on the influencing factors of regional CO2 emissions: Evidence from Beijing city, China

International Nuclear Information System (INIS)

Wang, Zhaohua; Yin, Fangchao; Zhang, Yixiang; Zhang, Xian

2012-01-01

Highlights: ► We adapt STIRPAT model to regional context and conduct PLS regress analysis. ► Energy technology related patent is innovatively used to measure technical factors. ► Urbanization level has the greatest interpretative ability for CO 2 emissions. ► We do not find evidence of Environmental Kuznets Curve in Beijing. ► Beijing should focus more on tertiary industry and residential energy consumption. -- Abstract: In order to further study the realization of carbon intensity target, find the key influencing factors of CO 2 emissions, and explore the path of developing low-carbon economy, this paper empirically studied the influences of urbanization level, economic level, industry proportion, tertiary industry proportion, energy intensity and R and D output on CO 2 emissions in Beijing using improved STIRPAT (stochastic impacts by regression on population, affluence and technology) model. The model is examined using partial least square regression. Results show that urbanization level, economic level and industry proportion positively influence the CO 2 emissions, while tertiary industry proportion, energy intensity and R and D output negatively do. Urbanization level is the main driving factor of CO 2 emissions, and tertiary industry proportion is the main inhibiting factor. In addition, along with the growth of per capita GDP, the increase of CO 2 emissions does not follow the Environmental Kuznets Curve model. Based on these empirical findings and the specific circumstances of Beijing, we provide some policy recommendations on how to reduce carbon intensity. Beijing should pay more attention to tertiary industry and residential energy consumption for carbon emission reduction. It is necessary to establish a comprehensive evaluation index of social development. Investing more capital on carbon emission reduction science and technology, and promoting R and D output is also an efficient way to reduce CO 2 emissions.

[INCIDENCE, PREDISPOSING RISK FACTORS FOR THE DEVELOPMENT AND SPREADING OF ACUTE INTESTINAL INFECTIONS IN THE NORTH-EASTERN REGION OF UKRAINE].

Science.gov (United States)

Malysh, N G; Chemych, N D; Zaritsky, A M

2016-01-01

Using data of the branch statistical reporting of the State Sanitary and Epidemiological Service in Sumy region and Sumy Regional State Laboratory of Veterinary Medicine, the incidence rate, modern risk factors for the development and spreading of acute infectious diarrheas were determined in the North-Eastern region of Ukraine. Under the current conditions incidence rate indices of acute intestinal infections and food toxicoinfections are within the range of 159.8-193.6 per 100 thousands. pop. Seasonal and epidemical rises are associated with a species of the agent. In the etiological structure of acute diarrheal infections there are dominated viruses, of food toxicoinfections--Klebsiellae pneumoniae, Staphylococcus aureus and Enterobacter cloacae (p < 0.05). Predictors of the complication of epidemiological situation of Shigella infections are the gain in the detection of bacterially contaminated samples of milk and dairy products (r = 0.75), for food toxicoinfections caused by Klebsiellae pneumoniae and Enterobacter cloacae--pastry with cream and cooking meat products (r = 0.64; r = 0.75). Epizootic situation in the region affects on the salmonellosis incidence rate of the population (r = 0.89). There were revealed correlations between the selection of E. coli bacteria from swabs taken from the enterprises of catering, in child care centers and the levels of incidence rates of salmonellosis, acute intestinal infections of unknown etiology (r = 0.59; r = 0.60). Timely detection and sanitation of Shigella carriers are a powerful instrument to reduce the incidence rate of shigellosis (r = 0.83).

Analysis of factors which limited the spatial variation of barley yield on the forest-steppe chernozems of Kursk region

Science.gov (United States)

Belik, Anton; Vasenev, Ivan; Jablonskikh, Lidia; Bozhko, Svetlana

2017-04-01

The crop yield is the most important indicator of the efficiency of agricultural production. It is the function that depends on a large number of groups of independent variables, such as the weather, soil fertility and overall culture agriculture. A huge number of combinations of these factors contribute to the formation of high spatial variety of crop yields within small areas, includes the slope agrolandscapes in Kursk region. Spatial variety of yield leads to a significant reduction in the efficiency of agriculture. In this connection, evaluation and analysis of the factors, which limits the yield of field crops is a very urgent proble in agroecology. The research was conducted in the period of 2003-2004 on a representative field. The typical and leached chernozems with the varying thickness and of erosion degree are dominated in soil cover. At the time of field research studied areas were busy by barley. The reseached soils have an average and increased fertility level. Chernozem typical full-face, and the leached contain an average of 4.5-6% humus, close to neutral pH, favorable values of physico-chemical parameters, medium and high content of nutrients. The eroded chernozems differs agrogenic marked declining in fertility parameters. The diversity of meso- and micro-relief in the fields and soil cover influence to significant spatial variety of fertility. For example the content of nutrients in the soil variation can be up to 5-fold level. High spatial heterogeneity of soils fertility ifluence to barley yield variety. During research on the productivity of the field varied in the range of 20-43 c/ha, and 7-44 c/ha (2004). Analysis of the factors, which limited the yield of barley, showed that the first priorities occupy unregulated characterises: slope angle and the classification of soils (subtype and race of chernozem and the difference in the degree of erosion), which determines the development of erosion processes and redistribution available to plants

Factors Influencing the Improved Academic Success in Literacy at the Knowledge Is Power Program (KIPP) Schools in the Delta Region According to Adult Perceptions

Science.gov (United States)

Brown, Kimberly J.; Holt, Carleton R.

2014-01-01

This qualitative case study explored factors that have influenced literacy success of Knowledge is Power Program (KIPP) students in the low-income, poverty stricken Delta Region of Arkansas. The study examined progress made since implementation of the KIPP Program and the influence the program had made upon student achievement in literacy at the…

Identifying risk factors of avian infectious diseases at household level in Poyang Lake region, China.

Science.gov (United States)

Jiang, Qian; Zhou, Jieting; Jiang, Zhiben; Xu, Bing

2014-09-01

Poultry kept in backyard farms are susceptible to acquiring and spreading infectious diseases because of free ranging and poor biosecurity measures. Since some of these diseases are zoonoses, this is also a significant health concern to breeders and their families. Backyard farms are common in rural regions of China. However, there is lack of knowledge of backyard poultry in the country. To obtain first-hand information of backyard poultry and identify risk factors of avian infectious diseases, a cross-sectional study was carried out at household level in rural regions around Poyang Lake. A door-to-door survey was conducted to collect data on husbandry practices, trading practices of backyard farmers, and surrounding environments of backyard farms. Farms were categorized into cases and controls based on their history of poultry death. Data were collected for 137 farms, and the association with occurrence of poultry death event was explored by chi-square tests. Results showed that vaccination implementation was a protective factor (odds ratio OR=0.40, 95% confidence interval CI: 0.20-0.80, p=0.01), while contact with other backyard flocks increased risk (OR=1.72, 95% CI: 0.79-3.74, p=0.16). A concept of "farm connectivity" characterized by the density of particular land-use types in the vicinity of the farm was proposed to characterize the degree of contact between poultry in one household farm and those in other household farms. It was found that housing density in a 20-m buffer zone of the farmhouse was most significantly associated with poultry death occurrence (OR=1.08, 95% CI: 1.02-1.17, p=0.03), and was in agreement with observation of villagers. Binary logistic regression was applied to evaluate the relationship between poultry death event and density of land-use types in all buffer zones. When integrated with vaccination implementation for poultry, prediction accuracy of poultry death event reached 72.0%. Results combining questionnaire survey with

Impairment of interferon regulatory factor-3 activation by hepatitis C virus core protein basic amino acid region 1.

Science.gov (United States)

Inoue, Kazuaki; Tsukiyama-Kohara, Kyoko; Matsuda, Chiho; Yoneyama, Mitsutoshi; Fujita, Takashi; Kuge, Shusuke; Yoshiba, Makoto; Kohara, Michinori

2012-11-30

Interferon regulatory factor-3 (IRF-3), a key transcriptional factor in the type I interferon system, is frequently impaired by hepatitis C virus (HCV), in order to establish persistent infection. However, the exact mechanism by which the virus establishes persistent infection has not been fully understood yet. The present study aimed to investigate the effects of various HCV proteins on IRF-3 activation, and elucidate the underlying mechanisms. To achieve this, full-length HCV and HCV subgenomic constructs corresponding to structural and each of the nonstructural proteins were transiently transfected into HepG2 cells. IFN-β induction, plaque formation, and IRF-3 dimerization were elicited by Newcastle disease virus (NDV) infection. The expressions of IRF-3 homodimer and its monomer, Ser386-phosphorylated IRF-3, and HCV core protein were detected by immunofluorescence and western blotting. IFN-β mRNA expression was quantified by real-time PCR (RT-PCR), and IRF-3 activity was measured by the levels of IRF-3 dimerization and phosphorylation, induced by NDV infection or polyriboinosinic:polyribocytidylic acid [poly(I:C)]. Switching of the expression of the complete HCV genome as well as the core proteins, E1, E2, and NS2, suppressed IFN-β mRNA levels and IRF-3 dimerization, induced by NDV infection. Our study revealed a crucial region of the HCV core protein, basic amino acid region 1 (BR1), to inhibit IRF-3 dimerization as well as its phosphorylation induced by NDV infection and poly (I:C), thus interfering with IRF-3 activation. Therefore, our study suggests that rescue of the IRF-3 pathway impairment may be an effective treatment for HCV infection. Copyright © 2012 Elsevier Inc. All rights reserved.

Human polyomavirus JCV late leader peptide region contains important regulatory elements

International Nuclear Information System (INIS)

Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh; Khalili, Kamel; Safak, Mahmut

2006-01-01

Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

Revised draft: North Central Regional environmental characterization report. Volume 1

International Nuclear Information System (INIS)

1984-11-01

This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in Minnesota, Wisconsin, and the Upper Peninsula of Michigan. For each of the states within the North Central Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed federal protected lands, proximity to federal protected lands, existing state protected lands, proximity to state protected lands, population density and distribution, proximity to highly populated areas, national and state forest lands, state wildlife lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that may be of use at later phases of screening. Also included is a discussion of the relationship between the DOE Siting Guidelines and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process

Second region of stability

International Nuclear Information System (INIS)

Greene, J.M.; Chance, M.S.

1980-10-01

A new type of axisymmetric magnetohydrodynamic equilibrium is presented. It is characterized by a region of pressure and safety factor variation with a short scale length imposed as a perturbation. The equilibrium consistent with these profile variations can be calculated by means of an asymptotic expansion. The flexibility obtained by generating such equilibria allows for a close examination of the mechanisms that are relevant to ballooning instabilities - ideal MHD modes with large toroidal mode number. The so-called first and second regions of stability against these modes are seen well within the limits of validity of the asymptotic expansion. It appears that the modes must be localized in regions with small values of the local shear of the magnetic field. The second region of stability occurs where the local shear is large throughout the range where the magnetic field line curvature is destabilizing

Epidemiology of bovine fascioliasis in the Nile Delta region of Egypt: Its prevalence, evaluation of risk factors, and its economic significance.

Science.gov (United States)

El-Tahawy, Abdelgawad S; Bazh, Eman K; Khalafalla, Reda E

2017-10-01

This study focuses on the risk factors associated with the prevalence of Fasciola affecting cattle population in three provinces belonging to the Nile Delta of Egypt and to estimate the economic losses as a result of fascioliasis. From January 2015 to end of December 2015, records of 21 farms (4976 cattle) were analyzed to screen the prevalence of fascioliasis among cattle farms, to identify its associated risk factors and its economic impacts on Nile Delta region of Egypt. The overall prevalence of fascioliasis in the Nile Delta region of Egypt was 9.77%. The prevalence of fascioliasis was found to be statistically significantly associated with age, sex, breed, and type of farms. The highest prevalence was observed in 3 age groups (8.35%). In terms of body condition scores, cattle with medium and poor conditions were associated with fascioliasis more than those with good body condition. Besides, cattle raised in organic farms were associated with lower risk of fascioliasis than those in conventional farms. The prevalence of fascioliasis was noted more prominent in districts with moderate temperatures and with relative humidity (>60%). The annual overall costs for fascioliasis were estimated to be 221.2 USD/cow due to the significant reduction in body weight, reduction in milk production, and the treatment costs for fascioliasis. The results provided could be helpful for improving the control and preventive strategies.

Population parameters and the relationships between environmental factors and abundance of the Acetes americanus shrimp (Dendrobranchiata: Sergestidae near a coastal upwelling region of Brazil

Directory of Open Access Journals (Sweden)

Ana Paula Freitas dos Santos

2015-09-01

Full Text Available AbstractThe population dynamics of Acetes americanus was investigated, focusing on the sex ratio, individual growth, longevity, recruitment and relationship between abundance and environmental factors in the region of Macaé, strongly influenced by coastal upwelling. Otter trawl net samplings were performed from July 2010 to June 2011 at two points (5 m and 15 m. Nearly 19,500 specimens, predominantly females (77.15%, were captured. Their sizes, larger than that of males, indicated sexual dimorphism. Shrimps at lower latitudes present larger sizes and longer longevity than those from higher latitudes. This difference is probably due to low temperatures and high primary productivity. Though no statistical correlation was found between abundance and environmental factors, the species was more abundant in temperatures closer to 20.0º C and in months with high chlorophyll-a levels. Due to the peculiar characteristics of this region, A. americanusshowed greater differences in size and longevity than individuals sampled in other studies undertaken in the continental shelf of Southeast Brazil.

[Evolution of Asthma Prevalence and Sociodemographic and Health Factors Associated in Madrid Region (1996-2013)].

Science.gov (United States)

López Pereira, Patricia; Gandarillas Grande, Ana María; Díez Gañán, Lucía; Ordobás Gavín, María

2017-05-25

Asthma is an important public health issue. The goal of this study is to analyse the trends in self-reported asthma prevalence in the Madrid Region and its association with socio-demographic and health factors. Data from the "Non-Communicable Disease Risk Factor Surveillance System" in adult population (SIVFRENT-A) 1996-2013 were used. Prevalences and 95% CI were estimated for: current asthma, cumulative prevalence of asthma and asthma attack in the last 12 months, in five periods. Changes in inter-period prevalence were estimated by calculating prevalence ratios (PR) with 95% CI by Poisson regression. The association between asthma prevalence socio-demographic and health variables was evaluated by multivariate logistic regression. Current prevalence of asthma and cumulative prevalence of asthma increased per study period an average of 14%. Asthma attack prevalence in the last 12 months increased an average of 19%. It was associated (statistically significant) to an increase of current prevalence of asthma, cumulative prevalence of asthma and asthma attack prevalence in the last 12 months: being a woman, ORa: 1.55; ORa: 1.35 and ORa: 1.46 respectively; have poor self-perceived health, ORa: 3.09; ORa: 2.63 and ORa: 2.89; and intense physical activity, ORa: 1.48; ORa: 1.32 and ORa: 1.49. In the case of current prevalence of asthma and cumulative prevalence of asthma also be studying, ORa: 1.34 and ORa: 1.46 respectively. Self-reported asthma prevalence increased in the last decades. The prevalence was higher in woman, persons with poor self-perceived health and adults with intense physical activity.

Factors associated with public awareness of the Crown Health Program in the Al-Jouf Region.

Science.gov (United States)

Memish, Ziad A; Saeedi, Mohammad Y; Al Madani, Ahmed J; Junod, Bernard; Jamo, Abdelgadier; Abid, Omer; Alanazi, Faisal M; Alrewally, Fayez G; Mandil, Ahmed M A

2015-01-01

A community-based intervention, the Crown Health Project (CHP), was developed by the Ministry of Health. It was implemented on a small-scale in Al-Jouf Region in Northern Kingdom of Saudi Arabia to assess its feasibility and effectiveness so that it can be scaled up. This study primarily aimed at investigating factors associated with the awareness of CHP in order to improve subsequent campaigns for the program in Al-Jouf and other regions. A secondary aim was to assess possible changes of public awareness during intensification of the awareness campaign between October 2011 and May 2012. A pre- and post-questionnaire cross-sectional approach was undertaken, and the intervention was an awareness campaign. Variables collected included demographic characteristics (e.g., age, gender, education, occupation, urban/rural residence) and CHP awareness (its existence, sources of knowledge about CHP, its goals and objectives, its target diseases, location of activities, participation in such activities). Logistic regression was used to analyze the awareness of the program according to participant characteristics, with a time of the survey as a variable. Awareness of the program was found to be 11 times higher among postsurvey respondents than presurvey respondents. Respondents of the second survey were better at correctly identifying "health education" as the main goal of the CHP (odds ratio [OR], 4.1; 95% confidence interval [CI], 3.1-5.5), "noncommunicable diseases" as the main diseases targeted (OR, 4.8; 95% CI, 3.6-6.4) and "attention to health" as the purpose (OR, 6.0; 95% CI, 4.0-8.9). The different activities of the CHP were successful in dramatically increasing awareness of the CHP program in Al-Jouf.

Regional differences in the expression of brain-derived neurotrophic factor (BDNF) pro-peptide, proBDNF and preproBDNF in the brain confer stress resilience.

Science.gov (United States)

Yang, Bangkun; Yang, Chun; Ren, Qian; Zhang, Ji-Chun; Chen, Qian-Xue; Shirayama, Yukihiko; Hashimoto, Kenji

2016-12-01

Using learned helplessness (LH) model of depression, we measured protein expression of brain-derived neurotrophic factor (BDNF) pro-peptide, BDNF precursors (proBDNF and preproBDNF) in the brain regions of LH (susceptible) and non-LH rats (resilience). Expression of preproBDNF, proBDNF and BDNF pro-peptide in the medial prefrontal cortex of LH rats, but not non-LH rats, was significantly higher than control rats, although expression of these proteins in the nucleus accumbens of LH rats was significantly lower than control rats. This study suggests that regional differences in conversion of BDNF precursors into BDNF and BDNF pro-peptide by proteolytic cleavage may contribute to stress resilience.

[Early child development inequalities and associated factors between public and private providers at metropolitan region in Chile].

Science.gov (United States)

Bedregal, Paula; Hernández, Viviana; Mingo, M Verónica; Castañón, Carla; Valenzuela, Patricia; Moore, Rosario; de la Cruz, Rolando; Castro, Daniela

Early child development is a population determinant of physical, mental and social health. To know the base line situation prior to the implementation of "Chile grows with you" (Chile Crece Contigo) is key to its evaluation. To compare early child development and associated factors at baseline in pre-school children from public and private health sectors. The sample consisted of 1045 children aged 30-58 months, 52% male, and 671 from the public and 380 from the private sector of the metropolitan region in Chile were evaluated using Battelle Developmental Inventory-1 and a household interview of primary carer. Abnormal child development was found in 14.4% of children in the private sector compared to 30.4% in the public sector. There were no differences in adaptive area (26.3% vs 29.2%), but there were statistically significant differents in cognitive (8.8% vs 12.1%), social-personal (13.2% vs 32.5%), motor (19.2% vs 35.3%), and communication (19% vs 36.8%) development. The logistic regression showed that, independent of socioeconomic level, the risk factors are: Apgarsocial policy. Copyright © 2016 Sociedad Chilena de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

Global MYCN transcription factor binding analysis in neuroblastoma reveals association with distinct E-box motifs and regions of DNA hypermethylation.

LENUS (Irish Health Repository)

Murphy, Derek M

2009-01-01

BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the

Iodine Support of Population in Vinnytsa Region

Directory of Open Access Journals (Sweden)

M.V. Vlasenko

2016-03-01

Full Text Available In 9 localities in Vinnitsa region the study of iodine support of population was conducted. 810 persons were examined including 540 children aged 7–12 years old living under the conditions of combined influence of geochemical and anthropogenic ecological factors. Vinnitsa region was found to be the territory with the mild iodine deficiency. Schoolboys with endemic increase of thyroid gland appeared to have typically higher prevalence of chronic somatic pathology. The peculiarities of goitrous endemia confirm complex pathogenesis of thyromegaly in children under conditions of combined influence of anthropogenic and geochemical factors, caused not only by the absolute iodine insufficiency but also by influence of additional goiterous factors. These peculiarities determine the necessity of complex approach to perform preventive antithyroid measures.

Northeastern Regional environmental characterization report. Volume 1. Final report

International Nuclear Information System (INIS)

1985-08-01

This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in Maine, New Hampshire, Vermont, northeastern and southeastern New York, Massachusetts, Rhode Island, Connecticut, northern New Jersey, and eastern Pennsylvania. For each of the States within the Northeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed Federal-protected lands, components of National Forest Lands, proximity to Federal-protected lands, existing State-protected lands, proximity to State-protected lands, population density and distribution, proximity to highly populated areas, or to 1-mile-square areas with 1000 or more persons, National and State forest lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that will be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy Siting Guidelines (10 CFR 960) and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process

A promotora de salud model for addressing cardiovascular disease risk factors in the US-Mexico border region.

Science.gov (United States)

Balcázar, Héctor; Alvarado, Matilde; Cantu, Frank; Pedregon, Veronica; Fulwood, Robert

2009-01-01

In 2002, the National Heart, Lung, and Blood Institute partnered with the Health Resources and Services Administration's (HRSA's) Bureau of Primary Health Care and Office of Rural Health Policy to address cardiovascular health in the US-Mexico border region. From 2003 through 2005, the 2 agencies agreed to conduct an intervention program using Salud para su Corazón with promotores de salud (community health workers) in high-risk Hispanic communities served by community health centers (CHCs) in the border region to reduce risk factors and improve health behaviors. Promotores de salud from each CHC delivered lessons from the curriculum Your Heart, Your Life. Four centers implemented a 1-group pretest-posttest study design. Educational sessions were delivered for 2 to 3 months. To test Salud para su Corazón-HRSA health objectives, the CHCs conducted the program and assessed behavioral and clinical outcomes at baseline, 3 months, 6 months, and 12 months after the intervention. A 2-sample paired t test and analyses of variance were used to evaluate differences from baseline to postintervention. Changes in heart-healthy behaviors were observed, as they have been in previous Salud para su Corazón studies, lending credibility to the effectiveness of a promotores de salud program in a clinical setting. Positive changes were also observed in low-density lipoprotein cholesterol level, triglyceride level, waist circumference, diastolic blood pressure, weight, and glycated hemoglobin (HbA1c). Results suggest that integrating promotores de salud into clinical practices is a promising strategy for culturally competent and effective service delivery. Promotores de salud build coalitions and partnerships in the community. The Salud para su Corazón-HRSA initiative was successful in helping to develop an infrastructure to support a promotores de salud workforce in the US-Mexico border region.

Investigation of nucleon electromagnetic form factors in the unphysical region by means of the N bar N → πl+l- reactions

International Nuclear Information System (INIS)

Dubnickova, A.Z.; Dubnicka, S.; Rekalo, M.P.

1995-01-01

A theoretical investigation of N bar N → πl + l - processes is carried out. First, the general structure of the differential probability of annihilation of very slow antinucleons on nucleons at rest into pion and lepton pairs is derived, then the structure of the electromagnetic current of N bar N → πγ * transition in case of the S-state annihilation is restored and general properties of the corresponding form factors are demonstrated. Next, by using the three-diagram approximation of the amplitude, those form factors are calculated explicitly and for the special process (p bar p) → π 0 γ * → π 0 l + l - they are shown to be completely described by the magnetic form factor of the proton in the unphysical region. Finally, the effective mass spectra of lepton pairs and the integral coefficients of internal conversion for the p bar p → π 0 l + l - and p bar n → π - l + l - processes are predicted. 15 refs., 7 figs

Energy absorption build-up factors in teeth

International Nuclear Information System (INIS)

Manjunatha, H.C.; Rudraswamy, B.

2012-01-01

Geometric progression fitting method has been used to compute energy absorption build-up factor of teeth [enamel outer surface, enamel middle, enamel dentin junction towards enamel, enamel dentin junction towards dentin, dentin middle and dentin inner surface] for wide energy range (0.015-15 MeV) up to the penetration depth of 40 mean free path. The dependence of energy absorption build-up factor on incident photon energy, penetration depth, electron density and effective atomic number has also been studied. The energy absorption build-up factors increases with the penetration depth and electron density of teeth. So that the degree of violation of Lambert-Beer (I = I 0 e -μt ) law is less for least penetration depth and electron density. The energy absorption build-up factors for different regions of teeth are not same hence the energy absorbed by the different regions of teeth is not uniform which depends on the composition of the medium. The relative dose of gamma in different regions of teeth is also estimated. Dosimetric implication of energy absorption build-up factor in teeth has also been discussed. The estimated absorption build up factors in different regions of teeth may be useful in the electron spin resonance dosimetry. (author)

Multinational enterprises in regional innovation systems: attraction factors and integration mechanisms = Les entreprises multinationales dans les systèmes régionaux d'innovation: facteurs d'attraction et mécanismes d'intégration

OpenAIRE

Baier, Elisabeth

2011-01-01

This work explains mutual influences between MNEs and regional innovation networks during innovation processes. An analytical framework integrates different research perspectives and allows analysing the integration of MNEs in regional innovation networks through the identification of attraction factors and interaction mechanisms between regional and organisational learning.

Identification of risk factors for plague in the West Nile Region of Uganda.

Science.gov (United States)

Eisen, Rebecca J; MacMillan, Katherine; Atiku, Linda A; Mpanga, Joseph T; Zielinski-Gutierrez, Emily; Graham, Christine B; Boegler, Karen A; Enscore, Russell E; Gage, Kenneth L

2014-06-01

Plague is an often fatal, primarily flea-borne rodent-associated zoonosis caused by Yersinia pestis. We sought to identify risk factors for plague by comparing villages with and without a history of human plague cases within a model-defined plague focus in the West Nile Region of Uganda. Although rat (Rattus rattus) abundance was similar inside huts within case and control villages, contact rates between rats and humans (as measured by reported rat bites) and host-seeking flea loads were higher in case villages. In addition, compared with persons in control villages, persons in case villages more often reported sleeping on reed or straw mats, storing food in huts where persons sleep, owning dogs and allowing them into huts where persons sleep, storing garbage inside or near huts, and cooking in huts where persons sleep. Compared with persons in case villages, persons in control villages more commonly reported replacing thatch roofing, and growing coffee, tomatoes, onions, and melons in agricultural plots adjacent to their homesteads. Rodent and flea control practices, knowledge of plague, distance to clinics, and most care-seeking practices were similar between persons in case villages and persons in control villages. Our findings reinforce existing plague prevention recommendations and point to potentially advantageous local interventions. © The American Society of Tropical Medicine and Hygiene.

SPECIES COMPOSITION OF MALARIAL MOSQUITOES KHARKIV REGION. NATURAL FACTORS OF MALARIA TRANSMISSION

Directory of Open Access Journals (Sweden)

Gazzawi - Rogozinа L. V.

2015-05-01

Full Text Available Introduction. This article describes the species composition of the dominant Anopheles mosquitoes in the Kharkiv region, the season of their possible effective infection, as well as ongoing anti-malaria activities . Key words: malaria , mosquitoes, p . Anopheles, epidemiology, census, hydraulic events. Material & methods. The analysis of entomological and meteorological situation in Ukraine and in the Kharkiv region according to data of the Ukrainian Center of control and monitoring of diseases of the Ministry of Health of Ukraine and Kharkiv regional laboratory center. Collection of material (imaginal and larval was carried out on the territory of natural and artificial water bodies of Kharkiv region in the period 2013 - 2014. When collecting the material used conventional accounting methods mosquito populations. On the territory of the region under study, we have found 30 species of mosquitoes three genera: Anopheles, Culex, Aedes. Results & discussion. Epidemiological role of each species of mosquitoes depends on several conditions. Dangerous vector species can only be found in large numbers, a significant percentage of individuals in a population that feeds on the blood of man, having a sufficiently long season activity and a sufficient number of females surviving to age possible maturation of sporozoites in their body. In Ukraine, the major carriers - Anopheles maculipennis, An. m. messeae, An. m. atroparvus, An. claviger, An. plumbeus, An. hyrcanus. Mosquito species registered in the territory of the Kharkiv region are susceptible to currently known types of human malaria parasites . Moreover, the dominant species in terms of urban landscapes are An.maculipennis and An.messeae . These species possess all the qualities necessary to be considered dangerous malaria vector control. They are well infected with the three main types of human parasites. In the study area , in terms of urban landscapes, gonoaktivnye females occurs within 3

Caesarean Risk Factors in Northern Region of Bangladesh: A ...

African Journals Online (AJOL)