International Nuclear Information System (INIS)
Hatch, C.E.
1995-05-01
This document is the Functional Design Criteria for Project W-252. Project W-252 provides the scope to provide BAT/AKART (best available technology...) to 200 Liquid Effluent Phase II streams (B-Plant). This revision (Rev. 2) incorporates a major descoping of the project. The descoping was done to reflect a combination of budget cutting measures allowed by a less stringent regulatory posture toward the Phase II streams
Advanced conceptual design report. Phase II. Liquid effluent treatment and disposal Project W-252
International Nuclear Information System (INIS)
1995-01-01
This Advanced Conceptual Design Report (ACDR) provides a documented review and analysis of the Conceptual Design Report (CDR), WHC-SD-W252-CDR-001, June 30, 1993. The ACDR provides further design evaluation of the major design approaches and uncertainties identified in the original CDR. The ACDR will provide a firmer basis for the both the design approach and the associated planning for the performance of the Definitive Design phase of the project
Project W-049H disposal facility test report
International Nuclear Information System (INIS)
Buckles, D.I.
1995-01-01
The purpose of this Acceptance Test Report (ATR) for the Project W-049H, Treated Effluent Disposal Facility, is to verify that the equipment installed in the Disposal Facility has been installed in accordance with the design documents and function as required by the project criteria
Advanced conceptual design report solid waste retrieval facility, phase I, project W-113
International Nuclear Information System (INIS)
Smith, K.E.
1994-01-01
Project W-113 will provide the equipment and facilities necessary to retrieve suspect transuranic (TRU) waste from Trench 04 of the 218W-4C burial ground. As part of the retrieval process, waste drums will be assayed, overpacked, vented, head-gas sampled, and x-rayed prior to shipment to the Phase V storage facility in preparation for receipt at the Waste Receiving and Processing Facility (WRAP). Advanced Conceptual Design (ACD) studies focused on project items warranting further definition prior to Title I design and areas where the potential for cost savings existed. This ACD Report documents the studies performed during FY93 to optimize the equipment and facilities provided in relation to other SWOC facilities and to provide additional design information for Definitive Design
Project W-441 cold vacuum drying facility design requirements document
International Nuclear Information System (INIS)
O'Neill, C.T.
1997-01-01
This document has been prepared and is being released for Project W-441 to record the design basis for the design of the Cold Vacuum Drying Facility. This document sets forth the physical design criteria, Codes and Standards, and functional requirements that were used in the design of the Cold Vacuum Drying Facility. This document contains section 3, 4, 6, and 9 of the Cold Vacuum Drying Facility Design Requirements Document. The remaining sections will be issued at a later date. The purpose of the Facility is to dry, weld, and inspect the Multi-Canister Overpacks before transport to dry storage
340 Facility Secondary Containment and Leak Detection Project W-302 Functional Design Criteria
Energy Technology Data Exchange (ETDEWEB)
Stordeur, R.T.
1995-03-01
This functional design criteria for the upgrade to the 340 radioactive liquid waste storage facility (Project W-302) specifically addresses the secondary containment issues at the current vault facility of the 340 Complex. This vault serves as the terminus for the Radioactive Liquid Waste System (RLWS). Project W-302 is necessary in order to bring this portion of the Complex into full regulatory compliance. The project title, ``340 Facility Secondary Containment and Leak Detection``, illustrates preliminary thoughts of taking corrective action directly upon the existing vault (such as removing the tanks, lining the vault, and replacing tanks). However, based on the conclusion of the engineering study, ``Engineering Study of the 300 Area Process Wastewater Handling System``, WHC-SD-WM-ER-277 (as well as numerous follow-up meetings with cognizant staff), this FDC prescribes a complete replacement of the current tank/vault system. This offers a greater array of tanks, and provides greater operating flexibility and ease of maintenance. This approach also minimizes disruption to RLWS services during ``tie-in``, as compared to the alternative of trying to renovate the old vault. The proposed site is within the current Complex area, and maintains the receipt of RLWS solutions through gravity flow.
Immobilized low-activity waste interim storage facility, Project W-465 conceptual design report
International Nuclear Information System (INIS)
Pickett, W.W.
1997-01-01
This report outlines the design and Total Estimated Cost to modify the four unused grout vaults for the remote handling and interim storage of immobilized low-activity waste (ILAW). The grout vault facilities in the 200 East Area of the Hanford Site were constructed in the 1980s to support Tank Waste disposal activities. The facilities were to serve project B-714 which was intended to store grouted low-activity waste. The existing 4 unused grout vaults, with modifications for remote handling capability, will provide sufficient capacity for approximately three years of immobilized low activity waste (ILAW) production from the Tank Waste Remediation System-Privatization Vendors (TWRS-PV). These retrofit modifications to the grout vaults will result in an ILAW interim storage facility (Project W465) that will comply with applicable DOE directives, and state and federal regulations
Immobilized low-activity waste interim storage facility, Project W-465 conceptual design report
Energy Technology Data Exchange (ETDEWEB)
Pickett, W.W.
1997-12-30
This report outlines the design and Total Estimated Cost to modify the four unused grout vaults for the remote handling and interim storage of immobilized low-activity waste (ILAW). The grout vault facilities in the 200 East Area of the Hanford Site were constructed in the 1980s to support Tank Waste disposal activities. The facilities were to serve project B-714 which was intended to store grouted low-activity waste. The existing 4 unused grout vaults, with modifications for remote handling capability, will provide sufficient capacity for approximately three years of immobilized low activity waste (ILAW) production from the Tank Waste Remediation System-Privatization Vendors (TWRS-PV). These retrofit modifications to the grout vaults will result in an ILAW interim storage facility (Project W465) that will comply with applicable DOE directives, and state and federal regulations.
Environmental Restoration Disposal Facility (Project W-296) Safety Assessment
International Nuclear Information System (INIS)
Armstrong, D.L.
1994-08-01
This Safety Assessment is based on information derived from the Conceptual Design Report for the Environmental Restoration Disposal Facility (DOE/RL 1994) and ancillary documentation developed during the conceptual design phase of Project W-296. The Safety Assessment has been prepared to support the Solid Waste Burial Ground Interim Safety Basis document. The purpose of the Safety Assessment is to provide an evaluation of the design to determine if the process, as proposed, will comply with US Department of Energy (DOE) Limits for radioactive and hazardous material exposures and be acceptable from an overall health and safety standpoint. The evaluation considered affects on the worker, onsite personnel, the public, and the environment
Environmental Restoration Disposal Facility (Project W-296) Safety Assessment
Energy Technology Data Exchange (ETDEWEB)
Armstrong, D.L.
1994-08-01
This Safety Assessment is based on information derived from the Conceptual Design Report for the Environmental Restoration Disposal Facility (DOE/RL 1994) and ancillary documentation developed during the conceptual design phase of Project W-296. The Safety Assessment has been prepared to support the Solid Waste Burial Ground Interim Safety Basis document. The purpose of the Safety Assessment is to provide an evaluation of the design to determine if the process, as proposed, will comply with US Department of Energy (DOE) Limits for radioactive and hazardous material exposures and be acceptable from an overall health and safety standpoint. The evaluation considered affects on the worker, onsite personnel, the public, and the environment.
Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
Martin, R.C.; Laxson, R.R.; Knauer, J.B.
1996-01-01
The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252 Cf neutron source for university and research loans. Within the CF, the 252 Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests
International Nuclear Information System (INIS)
Barilo, N.F.
1995-01-01
A Fire Hazards Analysis was performed to assess the risk from fire and other related perils and the capability of the facility to withstand these hazards. This analysis will be used to support design of the facility
Design review plan for Multi-Function Waste Tank Facility (Project W-236A)
International Nuclear Information System (INIS)
Renfro, G.G.
1994-01-01
This plan describes how the Multi-Function Waste Tank Facility (MWTF) Project conducts reviews of design media; describes actions required by Project participants; and provides the methodology to ensure that the design is complete, meets the technical baseline of the Project, is operable and maintainable, and is constructable. Project W-236A is an integrated project wherein the relationship between the operating contractor and architect-engineer is somewhat different than that of a conventional project. Working together, Westinghouse Hanford Company (WHC) and ICF Karser Hanford (ICF KH) have developed a relationship whereby ICF KH performs extensive design reviews and design verification. WHC actively participates in over-the-shoulder reviews during design development, performs a final review of the completed design, and conducts a formal design review of the Safety Class I, ASME boiler and Pressure Vessel Code items in accordance with WHC-CM-6-1, Standard Engineering Practices
Project management plan for Project W-178, 219-S secondary containment
International Nuclear Information System (INIS)
Buckles, D.I.
1995-01-01
This Project Management Plan (PMP) establishes the organizational responsibilities, control systems, and procedures for managing the execution of project activities for Project W-178, the 219-S Secondary Containment Upgrade. The scope of this project will provide the 219-S Facility with secondary containment for all tanks and piping systems. Tank 103 will be replaced with a new tank which will be designated as Tank 104. Corrosion protection shall be installed as required. The cells shall be cleaned and the surface repaired as required. The 219-S Waste Handling Facility (219-S Facility), located in the 200 West Area, was constructed in 1951 to support the 222-S Laboratory Facility. The 219-S Facility has three tanks, TK-101, TK-102, and TK-103, which receive and neutralize low level radioactive wastes from the 222-S Laboratory. For purposes of the laboratory, the different low level waste streams have been designated as high activity and intermediate activity. The 219-S Facility accumulates and treats the liquid waste prior to transferring it to SY Tank Farm in the 200-W Area. Transfers are normally made by pipeline from the 219-S Facility to the 241-SY Tank Farm. Presently transfers are being made by tanker truck to the 200-E Area Tank Farms due to the diversion box catch tank which has been removed from service
Californium-252: a remarkable versatile radioisotope
International Nuclear Information System (INIS)
Osborne-Lee, I.W.; Alexander, C.W.
1995-01-01
A product of the nuclear age, Californium-252 ( 252 Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252 Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252 Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252 Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252 Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252 Cf from ORNL is summarized herein
Californium-252: a remarkable versatile radioisotope
Energy Technology Data Exchange (ETDEWEB)
Osborne-Lee, I.W.; Alexander, C.W.
1995-10-10
A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.
International Nuclear Information System (INIS)
Strehlow, M.W.B.
1994-01-01
During the next 10 years a substantial amount of work is scheduled in the K-Basin Area related to the storage and eventual removal of irradiated N-Reactor fuel. Currently, maintenance support activities are housed in existing structures that were constructed in the early 1950's. These forty-year-old facilities and their supporting services are substandard, leading to inefficiencies. Because of numerous identified deficiencies and the planned increase in the numbers of K-Basin maintenance personnel, adequate maintenance support facilities that allow efficient operations are needed. The objective of this sub-project of Project W-405 is to provide a maintenance and storage facility which meets the K-Basin Maintenance Organization requirements as defined in Attachment 1. In Reference A, existing guidelines and requirements were used to allocate space for the maintenance activities and to provide a layout concept (See Attachment 2). The design solution includes modifying the existing 190 K-E building to provide space for shops, storage, and administration support functions. The primary reason for the modification is to simplify siting/permitting and make use of existing infrastructure. In addition, benefits relative to design loads will be realized by having the structure inside 190K-E. The new facility will meet the Maintenance Organization approved requirements in Attachment 1 relating to maintenance activities, storage areas, and personnel support services. This sub-project will also resolve outstanding findings and/or deficiencies relating to building fire protection, HVAC requirements, lighting replacement/upgrades, and personnel facilities. Compliance with building codes, local labor agreements and safety standards will result
Position paper: Live load design criteria for Project W-236A Multi-Function Waste Tank Facility
International Nuclear Information System (INIS)
Giller, R.A.
1995-01-01
The purpose of this paper is to discuss the live loads applied to the underground storage tanks of the Multi Function Waste Tank Facility, and to provide the basis for Project W-236A live load criteria. Project 236A provides encompasses building a Weather Enclosure over the two underground storage tanks at the 200-West area. According to the Material Handling Study, the Groves AT 1100 crane used within the Weather Enclosure will have a gross vehicle weight of 66.5 tons. Therefore, a 100-ton concentrated live load is being used for the planning of the construction of the Weather Enclosure
Project Specific Quality Assurance Plan Project (QAPP) W-211 Initial Tank Retrieval Systems (ITRS)
International Nuclear Information System (INIS)
HALL, L.R.
2000-01-01
This Quality Assurance Program Plan (QAPP) provides information on how the Project Hanford Quality Assurance Program is implemented by CH2M HILL Hanford Group Inc (CHG) for managing the Initial Tank Retrieval Systems (ITRS), Project W-211. This QAPP is responsive to the CHG Quality Assurance Program Description (QAPD) (LMH-MP-599) which provides direction for compliance to 10 CFR 830 120, ''Nuclear Safety Management, Quality Assurance Requirements'', and DOE Order 5700 6C, ''Quality Assurance'' Project W-211 modifies existing facilities and provides systems for retrieval of radioactive wastes from selected double-shell tanks (DST). The contents of these tanks are a combination of supernatant liquids and settled solids. To retrieve waste from the tanks, it is first necessary to mix the liquid and solids prior to transferring the slurry to alternative storage or treatment facilities. The ITRS will provide systems to mobilize the settled solids and transfer the wastes out of the tanks. In so doing, ITRS provides feed for future processing plants, allows for consolidation of tank solids to manage space within existing DST storage capacity, and supports continued safe storage of tank waste. This project includes the design, procurement, construction, startup and turnover of these retrieval systems This QAPP identifies organizational structures and responsibilities. Implementing procedures used by CHG project management can be found in the CHG Quality Assurance Program (CHG QAP) Implementation Matrix located in HNF-IP-0842, Volume XI, Attachment Proposed verification and inspection activities for critical items within the scope of project W-211 are identified in Attachment 1 W-211. Project participants will identify the implementing procedures used by their organization within their QAF'Ps. This project specific QAPP is used to identify requirements in addition to the QAPD and provide, by reference, additional information to other project documents
Conceptual design report, 219-S secondary containment upgrade, Project W-178
International Nuclear Information System (INIS)
Beyer, J.J.
1993-05-01
The 219-S Facility is located in the 200-West Area on the Hanford Site and was constructed in 1951. The facility receives and treats liquid, low-level mixed waste from the 222-S Laboratory prior to transfer of that waste to the SY Tank Farm. The 219-S Facility consists of Cell A containing Tanks 101 and 102 and Cell B containing Tank 103 and a spare space. Project W-178 will modify the 219-S Facility to bring it into compliance with the tank system standards in WAC 173-303-640. The secondary containment upgrade will consist of a stainless steel cell liner in both Cell A and the spare space in Cell B. Additionally, Cell B will be modified by taking Tank 103 out of service and installing a new tank: Tank 104. The construction work will be accomplished in phases to minimize service interruption to the 222-S Laboratory. The proposed design and construction method is the most cost effective of four alternatives evaluated during a value engineering session. Project W-178 is a fiscal year 1995 Line Item. Total estimated construction costs of the project are $2,600,000; other project costs are $710,000. The total project cost is $3,300,000
Project management plan, Waste Receiving and Processing Facility, Module 1, Project W-026
Energy Technology Data Exchange (ETDEWEB)
Starkey, J.G.
1993-05-01
The Hanford Waste Receiving and Processing Facility Module 1 Project (WRAP 1) has been established to support the retrieval and final disposal of approximately 400K grams of plutonium and quantities of hazardous components currently stored in drums at the Hanford Site.
Project management plan, Waste Receiving and Processing Facility, Module 1, Project W-026
International Nuclear Information System (INIS)
Starkey, J.G.
1993-05-01
The Hanford Waste Receiving and Processing Facility Module 1 Project (WRAP 1) has been established to support the retrieval and final disposal of approximately 400K grams of plutonium and quantities of hazardous components currently stored in drums at the Hanford Site
International Nuclear Information System (INIS)
Ocampo, V.P.; Boothe, G.F.; Greager, T.M.; Johnson, K.D.; Kooiker, S.L.; Martin, J.D.
1994-11-01
This document provides additional and supplemental information to WHC-SD-W112-FDC-001, Project W-112 for radioactive and mixed waste storage. It provides additional requirements for the design and summarizes Westinghouse Hanford Company key design guidance and establishes the technical baseline agreements to be used for definitive design of the Project W-112 facilities
A new facility for non-destructive assay using a 252Cf source
International Nuclear Information System (INIS)
Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.
2013-01-01
A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques
Neutron activation analysis detection limits using 252Cf sources
International Nuclear Information System (INIS)
DiPrete, D.P.; Sigg, R.A.
2000-01-01
The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes
International Nuclear Information System (INIS)
Parazin, R.J.
1998-01-01
This Project Execution Plan (PEP) defines the overall strategy, objectives, and contractor management requirements for the execution phase of Project W-519 (98-D403), Privatization Phase 1 Infrastructure Support, whose mission is to effect the required Hanford site infrastructure physical changes to accommodate the Privatization Contractor facilities. This plan provides the project scope, project objectives and method of performing the work scope and achieving objectives. The plan establishes the work definitions, the cost goals, schedule constraints and roles and responsibilities for project execution. The plan also defines how the project will be controlled and documented
System Safety Program Plan for Project W-314, tank farm restoration and safe operations
International Nuclear Information System (INIS)
Boos, K.A.
1996-01-01
This System Safety Program Plan (SSPP) outlines the safety analysis strategy for project W-314, ''Tank Farm Restoration and Safe Operations.'' Project W-314 will provide capital improvements to Hanford's existing Tank Farm facilities, with particular emphasis on infrastructure systems supporting safe operation of the double-shell activities related to the project's conceptual Design Phase, but is planned to be updated and maintained as a ''living document'' throughout the life of the project to reflect the current safety analysis planning for the Tank Farm Restoration and Safe Operations upgrades. This approved W-314 SSPP provides the basis for preparation/approval of all safety analysis documentation needed to support the project
Functions and requirements for tank farm restoration and safe operations, Project W-314. Revision 3
International Nuclear Information System (INIS)
Garrison, R.C.
1995-01-01
This Functions and Requirements document (FRD) establishes the basic performance criteria for Project W-314, in accordance with the guidance outlined in the letter from R.W. Brown, RL, to President, WHC, ''Tank Waste Remediation System (TWRS) Project Documentation Methodology,'' 94-PRJ-018, dated 3/18/94. The FRD replaces the Functional Design Criteria (FDC) as the project technical baseline documentation. Project W-314 will improve the reliability of safety related systems, minimize onsite health and safety hazards, and support waste retrieval and disposal activities by restoring and/or upgrading existing Tank Farm facilities and systems. The scope of Project W-314 encompasses the necessary restoration upgrades of the Tank Farms' instrumentation, ventilation, electrical distribution, and waste transfer systems
International Nuclear Information System (INIS)
1993-12-01
This document constitutes the WAC 173-216 State Waste Discharge Permit application for six W-252 liquid effluent streams at the Hanford Site. Appendices B through H correspond to Section B through H in the permit application form. Within each appendix, sections correspond directly to the respective questions on the application form. The appendices include: Product or service information; Plant operational characteristics; Water consumption and waterloss; Wastewater information; Stormwater; Other information; and Site assessment
Project Execution Plan for Project W-211 Initial Tank Retrieval Systems (ITRS)
International Nuclear Information System (INIS)
VAN BEEK, J.E.
2000-01-01
This Project Execution Plan documents the methodology for managing Project W-211. Project W-211, Initial Tank Retrieval Systems (ITRS), is a fiscal year 1994 Major Systems Acquisition that will provide systems for retrieval of radioactive wastes from selected double-shell tanks (DST). The contents of these tanks are a combination of supernatant liquids and settled solids. To retrieve waste from the tanks, it is first necessary to mix the liquid and solids prior to transferring the slurry to alternative storage or treatment facilities. The ITRS will provide systems to mobilize the settled solids and transfer the wastes out of the tanks. In so doing, ITRS provides feed for the future waste treatment plant, allows for consolidation of tank solids to manage space within existing DST storage capacity, and supports continued safe storage of tank waste. The ITRS scope has been revised to include waste retrieval systems for tanks AP-102, AP-104, AN-102, AN-103, AN-104, AN-105, AY-102, AZ-102, and SY-102. This current tank selection and sequence provides retrieval systems supporting the River Protection Project (RF'P) Waste Treatment Facility and sustains the ability to provide final remediation of several watch list DSTs via treatment. The ITRS is configured to support changing program needs, as constrained by available budget, by maintaining the flexibility for exchanging tanks requiring mixer pump-based retrieval systems and shifting the retrieval sequence. Preliminary design was configured such that an adequate basis exists for initiating Title II design of a mixer pump-based retrieval system for any DST. This Project Execution Plan (PEP), derived from the predecessor Project Management Plan, documents the methodology for managing the ITRS, formalizes organizational responsibilities and interfaces, and identifies project requirements such as change control, design verification, systems engineering, and human factors engineering
International Nuclear Information System (INIS)
1975-01-01
This meeting constituted the third phase of a project initiated by the Dosimetry Section of the IAEA in 1973. The first step, early in 1973, consisted of the development of a programme for the loan of Cf-252 sources to the Member States in support of education, training and some limited research. To date, 14 institutions in 13 Member States have participated in this loan programme. In August last year, the Agency published an instructional syllabus and laboratory manual authored by Professors Eric J. Hall and Harald H. Rossi of Columbia University (Californium-252 in Teaching and Research, Technical Reports Series No. 159). The appearance of this publication, including guidance on the design and construction of a storage and use facility, was the second phase of this programme aimed at providing some support to potential users in the fields of radiation biology and dosimetry. The objective of the programme's third phase - the convening of an Educational Seminar - was to provide a forum to bring together participants in the Agency's loan programme and experts in various scientific fields. Specifically, the Seminar consisted of a series of expert presentations in spectrometry, activation and prompt gamma analyses, on-stream analysis, dosimetry, health physics, radiology and radiotherapy. (author)
Preliminary Design Requirements Document for Project W-314
Energy Technology Data Exchange (ETDEWEB)
MCGREW, D.L.
2000-04-27
This document sets forth functional requirements, performance requirements, and design constraints for the tank farm systems elements identified in Section 3.1 of this document. These requirements shall be used to develop the Design Requirements Baseline for those system elements. System Overview--The tank farm system at Hanford Site currently consists of 149 single shell tanks and 28 double shell tanks with associated facilities and equipment, located in 18 separate groupings. Each grouping is known as a tank farm. They are located in the areas designated as 200 West and 200 East. Table 1-1 shows the number of tanks in each farm. The farms are connected together through a transfer system consisting of piping, diversion boxes, Double Contained Receiver Tanks (DCRT) and other miscellaneous facilities and elements. The tank farm system also connects to a series of processing plants which generate radioactive and hazardous wastes. The primary functions of the tank farm system are to store, transfer, concentrate, and characterize radioactive and hazardous waste generated at Hanford, until the waste can be safely retrieved, processed and dispositioned. The systems provided by Project W-314 support the store and transfer waste functions. The system elements to be upgraded by Project W-314 are identified in Section 3.1.
Preliminary Design Requirements Document for Project W-314
International Nuclear Information System (INIS)
MCGREW, D.L.
2000-01-01
This document sets forth functional requirements, performance requirements, and design constraints for the tank farm systems elements identified in Section 3.1 of this document. These requirements shall be used to develop the Design Requirements Baseline for those system elements. System Overview--The tank farm system at Hanford Site currently consists of 149 single shell tanks and 28 double shell tanks with associated facilities and equipment, located in 18 separate groupings. Each grouping is known as a tank farm. They are located in the areas designated as 200 West and 200 East. Table 1-1 shows the number of tanks in each farm. The farms are connected together through a transfer system consisting of piping, diversion boxes, Double Contained Receiver Tanks (DCRT) and other miscellaneous facilities and elements. The tank farm system also connects to a series of processing plants which generate radioactive and hazardous wastes. The primary functions of the tank farm system are to store, transfer, concentrate, and characterize radioactive and hazardous waste generated at Hanford, until the waste can be safely retrieved, processed and dispositioned. The systems provided by Project W-314 support the store and transfer waste functions. The system elements to be upgraded by Project W-314 are identified in Section 3.1
Biomedical neutron research at the Californium User Facility for neutron science
International Nuclear Information System (INIS)
Martin, R.C.; Byrne, T.E.; Miller, L.F.
1997-01-01
The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy
International Nuclear Information System (INIS)
Parazin, R.J.
1998-01-01
This document describes the functional and physical interfaces between the Tank Waste Remediation System (TWRS) Privatization Phase 1 Infrastructure Project W-519 and the various other projects (i.e., Projects W-314, W-464, W-465, and W-520) supporting Phase 1 that will require the allocation of land in and about the Privatization Phase 1 Site and/or interface with the utilities extended by Project W-519. Project W-519 will identify land use allocations and upgrade/extend several utilities in the 200-East Area into the Privatization Phase 1 Site (formerly the Grout Disposal Compound) in preparation for the Privatization Contractors (PC) to construct treatment facilities. The project will upgrade/extend: Roads, Electrical Power, Raw Water (for process and fire suppression), Potable Water, and Liquid Effluent collection. The replacement of an existing Sanitary Sewage treatment system that may be displaced by Phase 1 site preparation activities may also be included
A new facility for non-destructive assay using a 252Cf source.
Stevanato, L; Caldogno, M; Dima, R; Fabris, D; Hao, Xin; Lunardon, M; Moretto, S; Nebbia, G; Pesente, S; Pino, F; Sajo-Bohus, L; Viesti, G
2013-03-01
A new laboratory facility for non-destructive analysis (NDA) using a time-tagged (252)Cf source is presented. The system is designed to analyze samples having maximum size of about 20 × 25 cm(2), the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. Copyright © 2012 Elsevier Ltd. All rights reserved.
Biomedical neutron research at the Californium User Facility for Neutron Science
International Nuclear Information System (INIS)
Martin, R.C.; Byrne, T.E.; Miller, L.F.
1998-01-01
The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy. (author)
TWRS phase 1 infrastructure project (W-519) characterization
International Nuclear Information System (INIS)
Mitchell, C.J.
1998-01-01
In order to treat the mixed radioactive and hazardous waste stored in 177 underground tanks, the Tank Waste Remediation System (TWRS) program is developing a 'demonstration' site for treatment and immobilization of these wastes by a private contractor. Project W-519 is providing the infrastructure support to this site by developing the designs and emplacing required pipelines, roads, electrical, etc. In support of the TWRS Phase 1 Infrastructure Project (W-519) Characterization, Numatec Hanford Corporation (NHC) contracted with Waste Management Federal Services, Inc., Northwest Operations (WMNW) to investigate a number of locations in and just outside the 200 East Area eastern fenceline boundary. These areas consisted of known or suspected waste lines or waste sites that could potentially impact the construction and emplacement of the proposed facility improvements, including waterlines and roads. These sites were all located subsurface and sugaring would be required to obtain sample material from the desired depth. The soils would then be sampled and submitted to the laboratory for analysis of radioactivity
Recommendation on changing interfaces of W-058 and W-236A
International Nuclear Information System (INIS)
Light, J.M.
1994-01-01
This position paper recommends changes to improve the interface between the Cross-Site Transfer System (Project W-058) and the Multi-Function Waste Tank Facility (Project W-236A) to handle planned waste retrieval and storage operations. Appendix A includes cost estimates and schedule impacts for each project. The cost estimates, schedule impacts, and this position paper will be the basis for writing a change request to formally implement these changes on Project W-236A and Project W-058/W-028. Recommendations are made on pipeline rerouting, pump and configuration, and flushing configuration
Design requirements document for project W-520, immobilized low-activity waste disposal
International Nuclear Information System (INIS)
Ashworth, S.C.
1998-01-01
This design requirements document (DRD) identifies the functions that must be performed to accept, handle, and dispose of the immobilized low-activity waste (ILAW) produced by the Tank Waste Remediation System (TWRS) private treatment contractors and close the facility. It identifies the requirements that are associated with those functions and that must be met. The functional and performance requirements in this document provide the basis for the conceptual design of the Tank Waste Remediation System Immobilized Low-Activity Waste disposal facility project (W-520) and provides traceability from the program-level requirements to the project design activity
Design requirements document for project W-520, immobilized low-activity waste disposal
Energy Technology Data Exchange (ETDEWEB)
Ashworth, S.C.
1998-08-06
This design requirements document (DRD) identifies the functions that must be performed to accept, handle, and dispose of the immobilized low-activity waste (ILAW) produced by the Tank Waste Remediation System (TWRS) private treatment contractors and close the facility. It identifies the requirements that are associated with those functions and that must be met. The functional and performance requirements in this document provide the basis for the conceptual design of the Tank Waste Remediation System Immobilized Low-Activity Waste disposal facility project (W-520) and provides traceability from the program-level requirements to the project design activity.
EnviroTeach, 1992
1992-01-01
Introduces networking projects for studying rivers and water quality. Describes two projects in South Africa (Project W.A.T.E.R and SWAP) associated with the international network, Global Rivers Environmental Education Network. Discusses water test kits and educational material developed through Project W.A.T.E.R. (Water Awareness through…
40 CFR 265.252 - Waste analysis.
2010-07-01
... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...
Laboratory-scale shielded cell for 252Cf
International Nuclear Information System (INIS)
Anderl, R.A.; Cargo, C.H.
1979-01-01
A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms
Multi-Function Waste Tank Facility Quality Assurance Program Plan, Project W-236A. Revision 2
Energy Technology Data Exchange (ETDEWEB)
Hall, L.R.
1995-05-30
This document describes the Quality Assurance (QA) program for the Multi-Function Waste Tank Facility (MWTF) Project. The purpose of this QA program is to control project activities in such a manner as to achieve the mission of the MWTF Project in a safe and reliable manner. The QA program for the MWTF Project is founded on DOE Order 5700.6C, Quality Assurance, and implemented through the use of ASME NQA-1, Quality Assurance Program Requirements for Nuclear Facilities (ASME 1989 with addenda la-1989, lb-1991 and lc-1992). This document describes the program and planned actions which the Westinghouse Hanford Company (WHC) will implement to demonstrate and ensure that the project meets the requirements of DOE Order 5700.6C through the interpretive guidance of ASME NQA-1.
Multi-Function Waste Tank Facility Quality Assurance Program Plan, Project W-236A. Revision 2
International Nuclear Information System (INIS)
Hall, L.R.
1995-01-01
This document describes the Quality Assurance (QA) program for the Multi-Function Waste Tank Facility (MWTF) Project. The purpose of this QA program is to control project activities in such a manner as to achieve the mission of the MWTF Project in a safe and reliable manner. The QA program for the MWTF Project is founded on DOE Order 5700.6C, Quality Assurance, and implemented through the use of ASME NQA-1, Quality Assurance Program Requirements for Nuclear Facilities (ASME 1989 with addenda la-1989, lb-1991 and lc-1992). This document describes the program and planned actions which the Westinghouse Hanford Company (WHC) will implement to demonstrate and ensure that the project meets the requirements of DOE Order 5700.6C through the interpretive guidance of ASME NQA-1
PROJECT W-551 DETERMINATION DATA FOR EARLY LAW INTERIM PRETREATMENT SYSTEM SELECTION
Energy Technology Data Exchange (ETDEWEB)
TEDESCHI AR
2008-08-11
This report provides the detailed assessment forms and data for selection of the solids separation and cesium separation technology for project W-551, Interim Pretreatment System. This project will provide early pretreated low activity waste feed to the Waste Treatment Plant to allow Waste Treatment Plan Low Activity Waste facility operation prior to construction completion of the Pretreatment and High Level Waste facilities. The candidate solids separations technologies are rotary microfiltration and crossflow filtration, and the candidate cesium separation technologies are fractional crystallization, caustic-side solvent extraction, and ion-exchange using spherical resorcinol-formaldehyde resin. This data was used to prepare a cross-cutting technology summary, reported in RPP-RPT-37740.
Project W-049H collection system Acceptance Test Procedure
International Nuclear Information System (INIS)
Carrigan, M.C.
1994-01-01
The purpose of this Acceptance Test Procedure (ATP) for the Project W-049H, Treated Effluent Disposal Facility, is to verify that the collection system equipment installed as Pump Station No. 1 (225-W) and Pump Station No. 2 (225-E) have been installed in accordance with the design documents and function as required by the project criteria. This will be a wet test with potable water being introduced into the pump pits to test for leakage. Potable water will also be employed in the testing of the pumps and related mechanical equipment. All Instrument and Control equipment related to the pump stations will be checked electronically with simulated inputs/outputs when actual input/output signals are unavailable. Water from Pump Station 1 will be moved through the TEDF piping system and discharged into the disposal ponds. This will check the proper function of the air/vac valves not tested during construction, and the automated samplers
Design criteria document, Fire Protection Task, K Basin Essential Systems Recovery, Project W-405
International Nuclear Information System (INIS)
Johnson, B.H.
1994-01-01
The K Basin were constructed in the early 1950's with a 20 year design life. The K Basins are currently in their third design life and are serving as a near term storage facility for irradiated N Reactor fuel until an interim fuel storage solution can be implemented. In April 1994, Project W-405, K Basin Essential Systems Recovery, was established to address (among other things) the immediate fire protection needs of the 100K Area. A Fire Barrier Evaluation was performed for the wall between the active and inactive areas of the 105KE and 105KW buildings. This evaluation concludes that the wall is capable of being upgraded to provide an equivalent level of fire resistance as a qualified barrier having a fire resistance rating of 2 hours. The Fire Protection Task is one of four separate Tasks included within the scope of Project W405, K Basin Essential systems Recovery. The other three Tasks are the Water Distribution System Task, the Electrical System Task, and the Maintenance Shop/Support Facility Task. The purpose of Project W-405's Fire Protection Task is to correct Life Safety Code (NFPA 101) non-compliances and to provide fire protection features in Buildings 105KE, 105KW and 190KE that are essential for assuring the safe operation and storage of spent nuclear fuel at the 100K Area Facilities' Irradiated Fuel Storage Basins (K Basins)
Test report for run-in acceptance testing of Project W-151 300 HP mixing pumps
International Nuclear Information System (INIS)
Berglin, B.G.
1998-01-01
This report documents the results of a performance demonstration and operational checkout of three 300 HP mixer pumps in accordance with WHC-SD-WI51-TS-001 ''Mixer Pump Test Specification for Project W-151'' and Statement of Work 8K520-EMN-95-004 ''Mixer Pump Performance Demonstration at MASF'' in the 400 Area Maintenance and Storage Facility (MASF) building. Testing of the pumps was performed by Fast Flux Test Facility (FFTF) Engineering and funded by the Tank Waste Remediation System (TWRS) Project W-151. Testing began with the first pump on 04-01-95 and ended with the third pump on 11-01-96. Prior to testing, the MASF was modified and prepared to meet the pump testing requirements set forth by the Test Specification and the Statement of Work
The rare isotope accelerator (RIA) facility project
International Nuclear Information System (INIS)
Christoph Leemann
2000-01-01
The envisioned Rare-Isotope Accelerator (RIA) facility would add substantially to research opportunities for nuclear physics and astrophysics by combining increased intensities with a greatly expanded variety of high-quality rare-isotope beams. A flexible superconducting driver linac would provide 100 kW, 400 MeV/nucleon beams of any stable isotope from hydrogen to uranium onto production targets. Combinations of projectile fragmentation, target fragmentation, fission, and spallation would produce the needed broad assortment of short-lived secondary beams. This paper describes the project's background, purpose, and status, the envisioned facility, and the key subsystem, the driver linac. RIA's scientific purposes are to advance current theoretical models, reveal new manifestations of nuclear behavior, and probe the limits of nuclear existence [3]. Figures 1 and 2 show, respectively, examples of RIA research opportunities and the yields projected for pursuing them. Figure 3 outlines a conceptual approach for delivering the needed beams
Fast Flux Test Facility, Sodium Storage Facility project-specific project management plan
International Nuclear Information System (INIS)
Shank, D.R.
1994-01-01
This Project-Specific Project Management Plan describes the project management methods and controls used by the WHC Projects Department to manage Project 03-F-031. The Sodium Storage Facility provides for storage of the 260,000 gallons of sodium presently in the FFTF Plant. The facility will accept the molten sodium transferred from the FFTF sodium systems, and store the sodium in a solid state under an inert cover gas until such time as a Sodium Reaction Facility is available for final disposal of the sodium
Fast Flux Test Facility, Sodium Storage Facility project-specific project management plan
Energy Technology Data Exchange (ETDEWEB)
Shank, D.R.
1994-12-29
This Project-Specific Project Management Plan describes the project management methods and controls used by the WHC Projects Department to manage Project 03-F-031. The Sodium Storage Facility provides for storage of the 260,000 gallons of sodium presently in the FFTF Plant. The facility will accept the molten sodium transferred from the FFTF sodium systems, and store the sodium in a solid state under an inert cover gas until such time as a Sodium Reaction Facility is available for final disposal of the sodium.
Project management plan for Project W-320, Tank 241-C-106 sluicing. Revision 2
Energy Technology Data Exchange (ETDEWEB)
Phillips, D.R.
1994-07-01
A major mission of the US Department of Energy (DOE) is the permanent disposal of Hanford Site defense wastes by utilizing safe, environmentally acceptable, and cost-effective disposal methods that meet applicable regulations. The Tank Waste Remediation System (TWRS) Program was established at the Hanford Site to manage and control activities specific to the remediation of safety watch list tanks, including high-heat-producing tanks, and for the ultimate characterization, retrieval, pretreatment, and disposal of the low- and high-level fractions of the tank waste. Project W-320, Tank 241-C-106 Sluicing, provides the methodology, equipment, utilities, and facilities necessary for retrieving the high-heat waste from single-shell tank (SST) 24-C-106. Project W-320 is a fiscal year (FY) 1993 expense-funded major project, and has a design life of 2 years. Retrieval of the waste in tank 241-C-106 will be accomplished through mobilization of the sludge into a pumpable slurry using past-practice sluicing. The waste is then transferred directly to a double-shell tank for interim storage, subsequent pretreatment, and eventual disposal. A detailed description of the management organization and responsibilities of all participants is presented in this document.
Project management plan for Project W-320, Tank 241-C-106 sluicing. Revision 2
International Nuclear Information System (INIS)
Phillips, D.R.
1994-07-01
A major mission of the US Department of Energy (DOE) is the permanent disposal of Hanford Site defense wastes by utilizing safe, environmentally acceptable, and cost-effective disposal methods that meet applicable regulations. The Tank Waste Remediation System (TWRS) Program was established at the Hanford Site to manage and control activities specific to the remediation of safety watch list tanks, including high-heat-producing tanks, and for the ultimate characterization, retrieval, pretreatment, and disposal of the low- and high-level fractions of the tank waste. Project W-320, Tank 241-C-106 Sluicing, provides the methodology, equipment, utilities, and facilities necessary for retrieving the high-heat waste from single-shell tank (SST) 24-C-106. Project W-320 is a fiscal year (FY) 1993 expense-funded major project, and has a design life of 2 years. Retrieval of the waste in tank 241-C-106 will be accomplished through mobilization of the sludge into a pumpable slurry using past-practice sluicing. The waste is then transferred directly to a double-shell tank for interim storage, subsequent pretreatment, and eventual disposal. A detailed description of the management organization and responsibilities of all participants is presented in this document
International Nuclear Information System (INIS)
Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.
1987-01-01
The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing
Conceptual design report for tank farm restoration and safe operations, project W-314
Energy Technology Data Exchange (ETDEWEB)
Briggs, S.R., Westinghouse Hanford
1996-05-02
This Conceptual Design Report (CDR) presents the conceptual level design approach that satisfies the established technical requirements for Project W-314, `Tank Farm Restoration and Safe Operations.` The CDR also addresses the initial cost and schedule baselines for performing the proposed Tank Farm infrastructure upgrades. The scope of this project includes capital improvements to Hanford`s existing tank farm facilities(primarily focused on Double- Shell Tank Farms) in the areas of instrumentation/control, tank ventilation, waste transfer, and electrical systems.
International Nuclear Information System (INIS)
Pickett, W.W.
1998-01-01
This Statement of Work outlines the deliverables and schedule for preparation of the Project W-520 Conceptual Design Report, including, work plans, site development plan, preliminary safety evaluation, and conceptual design
Permitting plan for Project W-340, Tank 241-C-106 manipulator retrieval arm
International Nuclear Information System (INIS)
Tollefson, K.S.
1995-01-01
This document describes the regulatory requirements and describes alternative strategies for obtaining permits and approvals for Project W-340, Tank 241-C-106 Manipulator Retrieval Arm. A comprehensive review of environmental regulations has indicated that several environmental reviews, permits, and approvals are required before design, construction, and operation of the facility. The environmental reviews, permits, and approvals, as well the regulatory authority potentially applicable to the Project W-340 Long Reach Manipulator Arm include the following: National Environmental Policy Act of 1969 -- US Department of Energy, Headquarters; State Environmental Policy Act of 1971 -- State of Washington Department of Ecology; Air Permitting; Dangerous Waste Permitting; Miscellaneous Reviews/Permits/Approvals. This document describes the environmental reviews, permits, and approval requirements for the project. It provides a summary of permit application data requirements, alternative strategies for permit completion and approval, as well as the estimated probability of success for each alternative strategy
International Nuclear Information System (INIS)
Hookfin, J.D.
1995-01-01
The T Plant facilities in the 200-West Area of the Hanford site were constructed in the early 1940s to produce nuclear materials in support of national defense activities. T Plant includes the 271-T facility, the 221-T facility, and several support facilities (eg, 2706-T), utilities, and tanks/piping systems. T Plant has been recommended as the primary interim decontamination facility for the Hanford site. Project W-259 will provide capital upgrades to the T Plant facilities to comply with Federal and State of Washington environmental regulations for secondary containment and leak detection. This document provides an advanced conceptual design concept that complies with functional requirements for the T Plant Secondary Containment and Leak Detection upgrades
International Nuclear Information System (INIS)
Narkhede, S.S.; Turel, Z.R.
1995-01-01
Dy, Mn, Eu, Na, Ga, W, La and Sm respond very well to INAA technique because of their favourable nuclear properties such as high thermal neutron cross-section or abundance. In the present work a method has been developed for the determination of these elements employing cycle irradiation with 252 Cf thermal neutron source. Radioassaying of the irradiated sample and standard was done employing HPGe detector in conjunction with a PC based MCA units. (author). 2 tabs
24 CFR 92.252 - Qualification as affordable housing: Rental housing.
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...
International Nuclear Information System (INIS)
Awadalla, N.G.
1994-01-01
Project W-236a, Multi-function waste Tank Facility (MWTF), was initiated to increase the safe waste storage capacity for the Tank Waste Remediation System (TWRS) by building two new one million gallon underground storage tanks in the 200 West Area and four tanks in the 200 East Area. Construction of the tanks was scheduled to begin in September 1994 with operations beginning in calendar year (CY) 1998. However, recent reviews have raised several issues regarding the mission, scope, and schedule of the MWTF. The decision to build new tanks must consider several elements, such as: Operational risk and needs -- Operational risk and flexibility must be managed such that any identified risk is reduced as soon as practicable; The amount of waste that will be generated in the future -- Additional needed tank capacity must be made available to support operations and maintain currently planned safety improvement activities; Safety issues -- The retrieval of waste from single-shell tanks (SSTs) and watch list tanks will add to the total amount of waste that must be stored in a double-shell tank (DST); Availability of existing DSTs -- The integrity of the 28 existing DSTs must be continuously managed; and Affect on other projects and programs -- Because MWTF systems have been integrated with other projects, a decision on one project will affect another. In addition the W-236a schedule is logically tied to support retrieval and safety program plans. Based on the above, two new tanks are needed for safe waste storage in the 200 West Area, and they need to be built as soon as practicable. Design should continue for the tanks in the 200 East Area with a decision made by September, on whether to construct them. Construction of the cross-site transfer line should proceed as scheduled. To implement this recommendation several actions need to be implemented
International Nuclear Information System (INIS)
Hinkle, A.W.; Jacobsen, P.H.; Lucas, D.R.
1994-01-01
Project W-026, Waste Receiving and Processing (WRAP) Facility Module 1, a 1991 Line Item, is planned for completion and start of operations in the spring of 1997. WRAP Module 1 will have the capability to characterize and repackage newly generated, retrieved and stored transuranic (TRU), TRU mixed, and suspect TRU waste for shipment to the Waste isolation Pilot Plant (WIPP). In addition, the WRAP Facility Module 1 will have the capability to characterize low-level mixed waste for treatment in WRAP Module 2A. This report documents the assumptions and cost estimates for decontamination and clean-up of a maximum possible fire loss (MPFL) as defined by DOE Order 5480.7A, FIRE PROTECTION. The Order defines MPFL as the value of property, excluding land, within a fire area, unless a fire hazards analysis demonstrates a lesser (or greater) loss potential. This assumes failure of both automatic fire suppression systems and manual fire fighting efforts. Estimates were developed for demolition, disposal, decontamination, and rebuilding. Total costs were estimated to be approximately $98M
24 CFR 252.2 - GNMA right to assignment.
2010-04-01
... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...
International Nuclear Information System (INIS)
Harty, W.M.
1995-01-01
This supporting document establishes the As Low As Reasonable Achievable (ALARA) Plan to be followed during Sluicing Project W-320 design and construction activities to minimize personnel exposure to radiation and hazardous materials
Energy Technology Data Exchange (ETDEWEB)
Harty, W.M.
1995-06-06
This supporting document establishes the As Low As Reasonable Achievable (ALARA) Plan to be followed during Sluicing Project W-320 design and construction activities to minimize personnel exposure to radiation and hazardous materials.
Nozzle evaluation for Project W-314
International Nuclear Information System (INIS)
Galbraith, J.D.
1998-01-01
Revisions to the waste transfer system piping to be implemented by Project W-314 will eliminate the need to access a majority of interfarm jumper connections associated with specific process pits. Additionally, connections that formerly facilitated waste transfers from the Plutonium-Uranium Extraction (PUREX) Plant are no longer required. This document identified unneeded process pit jumper connections, describes former designated routing, denotes current status (i.e., open or blanked), and recommends appropriate disposition for all. Blanking of identified nozzles should be accomplished by Project W-314 upon installation of jumpers and acceptance by Tank Waste Remediation System (TWRS) Tank Farm Operations
Risk management program for the 283-W water treatment facility
International Nuclear Information System (INIS)
Green, W.E.
1999-01-01
This Risk Management (RM) Program covers the 283-W Water Treatment Facility (283W Facility), located in the 200 West Area of the Hanford Site. A RM Program is necessary for this facility because it stores chlorine, a listed substance, in excess of or has the potential to exceed the threshold quantities defined in Title 40 of the Code of Federal Regulations (CFR) Part 68 (EPA, 1998). The RM Program contains data that will be used to prepare a RM Plan, which is required by 40 CFR 68. The RM Plan is a summary of the RM Program information, contained within this document, and will be submitted to the U.S. Environmental Protection Agency (EPA) ultimately for distribution to the public. The RM Plan will be prepared and submitted separately from this document
Acceptance test procedure for Project W-049H
International Nuclear Information System (INIS)
Buckles, D.I.
1994-01-01
The Acceptance Test Procedure (ATP) program for Project W-049H (200 Area Treated Effluent Disposal Facility [TEDF]) covers three activities as follows: (1) Disposal System; (2) Collection System; and (3) Instrumentation and Control System. Each activity has its own ATP. The purpose of the ATPs is to reverify that the systems have been constructed in accordance with the construction documents and to demonstrate that the systems function as required by the Project criteria. The Disposal System ATP covers the testing of the following: disposal line flowmeters, room air temperatures in the Disposal Station Sampling Building, effluent valves and position indicators, disposal pond level monitors, automated sampler, pressure relief valves, and overflow diversion sluice gates. The Collection System ATP covers the testing of the two pump stations and all equipment installed therein. The Instrumentation and Control (I and C) ATP covers the testing of the entire TEDF I and C system. This includes 3 OCS units, modem, and GPLI cabinets in the ETC control room; 2 pump stations; disposal station sampling building; and all LCUs installed in the field
Energy Technology Data Exchange (ETDEWEB)
1994-08-01
As part of the original Hanford Federal Facility Agreement and Concent Order negotiations, US DOE, US EPA and the Washington State Department of Ecology agreed that liquid effluent discharges to the ground to the Hanford Site are subject to permitting in the State Waste Discharge Permit Program (SWDP). This document constitutes the SWDP Application for the 200 Area TEDF stream which includes the following streams discharged into the area: Plutonium Finishing Plant waste water; 222-S laboratory Complex waste water; T Plant waste water; 284-W Power Plant waste water; PUREX chemical Sewer; B Plant chemical sewer, process condensate, steam condensate; 242-A-81 Water Services waste water.
International Nuclear Information System (INIS)
1994-08-01
As part of the original Hanford Federal Facility Agreement and Concent Order negotiations, US DOE, US EPA and the Washington State Department of Ecology agreed that liquid effluent discharges to the ground to the Hanford Site are subject to permitting in the State Waste Discharge Permit Program (SWDP). This document constitutes the SWDP Application for the 200 Area TEDF stream which includes the following streams discharged into the area: Plutonium Finishing Plant waste water; 222-S laboratory Complex waste water; T Plant waste water; 284-W Power Plant waste water; PUREX chemical Sewer; B Plant chemical sewer, process condensate, steam condensate; 242-A-81 Water Services waste water
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
In recent years, Georgia Institute of Technology (Georgia Tech) has been involved in a number of neutron dosimetry research projects. Several reference neutron fields are now available for such projects. They are all based on the use of a 252 Cf source. The source can be used by itself to create a reference un-moderated 252 Cf neutron field, or it can be placed inside several different moderating assemblies. The spectra created by placing the source inside these assemblies and the un-moderated source are employed to investigate detector and dosimeter responses. Currently, the set of moderators available includes a 30-cm diam cadmium-covered D 2 O spherical shell, a 30-cm-thick iron spherical shell, a 30-cm-diam polyethylene spherical shell, an 18.3-cm-thick tungsten spherical shell, a 16-cm-thick lead spherical shell, and a 9-cm-thick tantalum spherical shell. In addition, the 252 Cf source can be placed inside a neutron howitzer recently constructed at Georgia Tech. The howitzer is a WEP cylinder loaded with boron that has a 10.16-cm-diam cylindrical opening. When the source is placed in the cylindrical penetration of the howitzer, a neutron field ∼30 cm in diameter is created at a distance of 50 cm from the californium source. Over the last few years, Bonner sphere spectrometers using LiI(Eu) scintillators and LiF thermoluminescence dosimeters have been calibrated using this facility at Georgia Tech. Recently, the Neely Nuclear Research Center (NNRC) acquired an LB 6411 neutron probe (product of EG and G Berthold). This probe is designed to measure ambient dose equivalent in accordance with International Commission on Radiological Protection Publication 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diam spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV (Ref. 5). As a test of the instrument's ability to measure ambient
W-1 Sodium Loop Safety Facility experiment centerline fuel thermocouple performance
International Nuclear Information System (INIS)
Meyers, S.C.; Henderson, J.M.
1980-05-01
The W-1 Sodium Loop Safety Facility (SLSF) experiment is the fifth in a series of experiments sponsored by the Department of Energy (DOE) as part of the National Fast Breeder Reactor (FBR) Safety Assurance Program. The experiments are being conducted under the direction of Argonne National Laboratory (ANL) and Hanford Engineering Development Laboratory (HEDL). The irradiation phase of the W-1 SLSF experiment was conducted between May 27 and July 20, 1979, and terminated with incipient fuel pin cladding failure during the final boiling transient. Experimental hardware and facility performed as designed, allowing completion of all planned tests and test objectives. This paper focuses on high temperature in-fuel thermocouples and discusses their development, fabrication, and performance in the W-1 experiment
The SPES project of INFN: Facility and detectors
Directory of Open Access Journals (Sweden)
de Angelis G.
2015-01-01
Full Text Available The SPES Radioactive Ion Beam facility at INFN-LNL is presently in the construction phase. The facility is based on the Isol (Isotope separation on-line method with an UCx Direct Target able to sustain a power of 10 kW. The primary proton beam is provided by a high current Cyclotron accelerator with energy of 35-70 MeV and a beam current of 0.2-0.5 mA. Neutron-rich radioactive ions are produced by proton induced Uranium fission at an expected fission rate of the order of 1013 fissions per second. After ionization and selection the exotic isotopes are re-accelerated by the ALPI superconducting Linac at energies of 10A MeV for masses in the region A = 130 amu. The expected secondary beam rates are of the order of 107 - 109 pps. Aim of the SPES project is to provide a facility for high intensity radioactive ion beams for nuclear physics research as well as to develop an interdisciplinary research center based on the cyclotron proton beam.
The I-35W bridge Project Website
DEFF Research Database (Denmark)
Kampf, Constance
How can websites be used to rebuild trust? In August 2007, the Interstate Highway 35-W bridge in Minneapolis, MN collapsed during rush hour. Although many people were rescued and casualties were as limited as could be expected due to quick and effective intervention, the image of a major bridge...... collapsing during rush hour damaged the Minnesota Department of Transportation's reputation and resulted in the loss of public trust for the organization. The ensuing bridge reconstruction project included a project website intended to rebuild this trust through transparency, community involvement......, and the use of multimodal features. This paper looks at the I35-W bridge reconstruction project in Minneapolis through web-based communication by the Minnesota Department of Transportation (MnDOT) about the project. The MnDOT bridge reconstruction website will be examined using a combination of 1). Weick...
Project W-420 stack monitoring system upgrades
International Nuclear Information System (INIS)
CARPENTER, K.E.
1999-01-01
This project will execute the design, procurement, construction, startup, and turnover activities for upgrades to the stack monitoring system on selected Tank Waste Remediation System (TWRS) ventilation systems. In this plan, the technical, schedule, and cost baselines are identified, and the roles and responsibilities of project participants are defined for managing the Stack Monitoring System Upgrades, Project W-420
Fire hazards analysis for the replacement cross-site transfer system, project W-058
International Nuclear Information System (INIS)
Sepahpur, J.B.
1996-01-01
The fire hazards analysis assess the risk from fire and determines compliance with the applicable criteria of DOE 5480.7A, DOE 6430.1A, and RLID 5480.7. (Project W-058 will provide encased pipelines to connect the SY Tank Farms in 200 West Area with the tank farms in 200 East Area via an interface with the 244-A lift station. Function of the cross-site transfer system will be to transfer radioactive waste from the SY Tank Farm to treatment, storage, and disposal facilities in 200 East Area.)
Nonradioactive air emissions notice of construction, Project W-320, 241-C-106 tank sluicing
International Nuclear Information System (INIS)
Hays, C.B.
1998-01-01
This document serves as a Notice of Construction for the Phase 2 activities of Project W-320, 241-C-106 Tank Sluicing, pursuant to the requirements of Washington Administrative Codes (WAC) 173-400 and 173-460. Phased permitting for Project W-320 was discussed with the Washington State Department of Ecology (Ecology) on November 2, 1993. In April 1994, it was deemed unnecessary because the Phase 1 activities did not constitute a new source of emissions and therefore did not require approval from Ecology. The 241-C-106 tank is a 2-million liter capacity, single-shell tank (SST) used for radioactive waste storage since 1947. Between mid-1963 and mid-1969, 241-C-106 tank received high-heat waste, PUREX (plutonium-uranium extraction) Facility high-level waste, and strontium-bearing solids from the strontium and cesium recovery activities. In 1971, temperatures exceeding 99 C were observed in the tank, and therefore, a ventilation system was installed to cool the tank. In addition, approximately 22,712 liters of cooling water are added to the tank each month to prevent the sludge from drying out and overheating. Excessive drying of the sludge could result in possible structural damage. The current radiolytic heat generation rate has been calculated at 32 kilowatts (kW) plus or minus 6 kW. The 241-C-106 tank was withdrawn from service in 1979 and currently is categorized as not leaking. The heat generation in 241-C-106 tank has been identified as a key safety issue on the Hanford Site. The evaporative cooling provided by the added water during operation and/or sluicing maintains the 241-C-106 tank within its specified operating temperature limits. Project W-320, 241-C-106 Tank Sluicing, will mobilize and remove the heat-generating sludge, allowing the water additions to cease. Following sludge removal, the 241-C-106 tank could be placed in a safe, interim stabilized condition. Tank-to-tank sluicing, an existing, proven technology, will provide the earliest possible
Nonradioactive air emissions notice of construction, Project W-320, 241-C-106 tank sluicing
Energy Technology Data Exchange (ETDEWEB)
Hays, C.B.
1998-01-28
This document serves as a Notice of Construction for the Phase 2 activities of Project W-320, 241-C-106 Tank Sluicing, pursuant to the requirements of Washington Administrative Codes (WAC) 173-400 and 173-460. Phased permitting for Project W-320 was discussed with the Washington State Department of Ecology (Ecology) on November 2, 1993. In April 1994, it was deemed unnecessary because the Phase 1 activities did not constitute a new source of emissions and therefore did not require approval from Ecology. The 241-C-106 tank is a 2-million liter capacity, single-shell tank (SST) used for radioactive waste storage since 1947. Between mid-1963 and mid-1969, 241-C-106 tank received high-heat waste, PUREX (plutonium-uranium extraction) Facility high-level waste, and strontium-bearing solids from the strontium and cesium recovery activities. In 1971, temperatures exceeding 99 C were observed in the tank, and therefore, a ventilation system was installed to cool the tank. In addition, approximately 22,712 liters of cooling water are added to the tank each month to prevent the sludge from drying out and overheating. Excessive drying of the sludge could result in possible structural damage. The current radiolytic heat generation rate has been calculated at 32 kilowatts (kW) plus or minus 6 kW. The 241-C-106 tank was withdrawn from service in 1979 and currently is categorized as not leaking. The heat generation in 241-C-106 tank has been identified as a key safety issue on the Hanford Site. The evaporative cooling provided by the added water during operation and/or sluicing maintains the 241-C-106 tank within its specified operating temperature limits. Project W-320, 241-C-106 Tank Sluicing, will mobilize and remove the heat-generating sludge, allowing the water additions to cease. Following sludge removal, the 241-C-106 tank could be placed in a safe, interim stabilized condition. Tank-to-tank sluicing, an existing, proven technology, will provide the earliest possible
New synchrotron radiation facility project. Panel on new synchrotron radiation facility project
Sato, S; Kimura, Y
2003-01-01
The project for constructing a new synchrotron radiation facility dedicated to the science in VUV (or EUV) and Soft X-ray (SX) region has been discussed for these two years at the Panel on New Synchrotron Radiation Facility Project. The Panel together with the Accelerator Design Working Group (WG), Beamline Design WG and Research Program WG suggested to the Ministry of Education, Science, Culture and Sports the construction of a 1.8 GeV electron storage ring suitable for 'Top-Up' operation and beamlines and monochromators designed for undulator radiation. The scientific programs proposed by nationwide scientists are summarized with their requirements of the characteristics of the beam. (author)
PROJECTIZING AN OPERATING NUCLEAR FACILITY
International Nuclear Information System (INIS)
Adams, N
2007-01-01
This paper will discuss the evolution of an operations-based organization to a project-based organization to facilitate successful deactivation of a major nuclear facility. It will describe the plan used for scope definition, staff reorganization, method estimation, baseline schedule development, project management training, and results of this transformation. It is a story of leadership and teamwork, pride and success. Workers at the Savannah River Site's (SRS) F Canyon Complex (FCC) started with a challenge--take all the hazardous byproducts from nearly 50 years of operations in a major, first-of-its-kind nuclear complex and safely get rid of them, leaving the facility cold, dark, dry and ready for whatever end state is ultimately determined by the United States Department of Energy (DOE). And do it in four years, with a constantly changing workforce and steadily declining funding. The goal was to reduce the overall operating staff by 93% and budget by 94%. The facilities, F Canyon and its adjoined sister, FB Line, are located at SRS, a 310-square-mile nuclear reservation near Aiken, S.C., owned by DOE and managed by Washington Group International subsidiary Washington Savannah River Company (WSRC). These facilities were supported by more than 50 surrounding buildings, whose purpose was to provide support services during operations. The radiological, chemical and industrial hazards inventory in the old buildings was significant. The historical mission at F Canyon was to extract plutonium-239 and uranium-238 from irradiated spent nuclear fuel through chemical processing. FB Line's mission included conversion of plutonium solutions into metal, characterization, stabilization and packaging, and storage of both metal and oxide forms. The plutonium metal was sent to another DOE site for use in weapons. Deactivation in F Canyon began when chemical separations activities were completed in 2002, and a cross-functional project team concept was implemented to successfully
Project W-320, waste retrieval sluicing system: BIO/SER implementation matrices
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This document provides verification that the safety related commitments specified in HNF-SD-WM-810-001, Addendum 1 for the Waste Retrieval Sluicing System, Project W-320 and Project W-320 Safety Evaluation Report (SER), have been implemented in the project hardware, procedures and administrative controls. Four appendices include matrices which show where the 810 commitments are implemented for limiting conditions of operation and surveillance requirements controls, administrative controls, defense-in-depth controls and controls discussed in 810 Addendum 1. A fifth appendix includes the implementation of Project W-320 SER issues and provisions
Ten years of cryo-magnetic W7-X test facility construction and operation
International Nuclear Information System (INIS)
Renard, B.; Dispau, G.; Donati, A.; Genini, L.; Gournay, J.F.; Kuster, O.; Molinie, F.; Schild, T.; Touzery, R.; Vieillard, L.; Walter, C.
2011-01-01
The construction, commissioning, and operation phases of the W7-X cryo-magnetic test facility in CEA Saclay lasted ten years. The large diversity of equipments called, specialties involved and problems solved attest the expertise that was required to operate the test facility and test the coils. Nearly one hundred cryogenic tests were performed on the seventy W7-X coils, at a rate always increasing, using two cryostats each holding two coils. This paper presents the test facility and its operation first, the cryogenic difficulties that were confronted with their solutions, the electro-magnetic difficulties encountered along with corrective actions, and finally the instrumentation and data acquisition aspects. (authors)
Use of californium-252 sources in Hungary for teaching and research
International Nuclear Information System (INIS)
Csikai, J.
1976-01-01
An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)
Graphite moderated 252Cf source
International Nuclear Information System (INIS)
Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.
2014-08-01
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
Project quality assurance plant: Sodium storage facility, project F-031
International Nuclear Information System (INIS)
Shultz, J.W.; Shank, D.R.
1994-11-01
The Sodium Storage Facility Project Quality Assurance Plan delineates the quality assurance requirements for construction of a new facility, modifications to the sodium storage tanks, and tie-ins to the FFTF Plant. This plan provides direction for the types of verifications necessary to satisfy the functional requirements within the project scope and applicable regulatory requirements determined in the Project Functional Design Criteria (FDC), WHC-SD-FF-FDC-009
Campania Region's Educational Quality Facilities Project
Ponti, Giorgio
2009-01-01
This article describes the Educational Quality Facilities project undertaken by Italy's Campania Region to provide quality facilities to all of its communities basing new spaces on the "Flexible Learning Module". The objectives of the five-year project are to: build and equip new educational spaces; improve the quality of existing…
International Nuclear Information System (INIS)
Boddy, K.
1978-11-01
A simple and cheap facility for partial body neutron activation analysis has been designed, based on the use of two 100 μg 252 Cf neutron sources. The results reported show that calcium can be measured in parts of the body such as the tibia with a precision as good as +- 1.6 % for a radiation dose of 2 rem. The uniformity of the thermal neutron flux density is better than +- 3 % over 10 cm. Some applications of this irradiation facility for studies of trace elements, in particular cadmium in liver and aluminium in liver or brain, have also been explored. However, the sensitivity attainable is not yet sufficient for the study of normal levels, but could be of interest in toxicological investigations
Project Management Plan for Initial Tank Retrieval Systems, Project W-211
International Nuclear Information System (INIS)
VAN BEEK, J.E.
1999-01-01
Project W-211, Initial Tank Retrieval Systems (ITRS), is a fiscal year 1994 Major Systems Acquisition that will provide systems for retrieval of radioactive wastes from selected double-shell tanks (DST). The contents of these tanks are a combination of supernatant liquids and settled solids. To retrieve waste from the tanks, it is first necessary to mix the liquid and solids prior to transferring the slurry to alternative storage or treatment facilities. The ITRS will provide systems to mobilize the settled solids and transfer the wastes out of the tanks. In so doing, ITRS provides feed for future processing plants, allows for consolidation of tank solids to manage space within existing DST storage capacity, and supports continued safe storage of tank waste. The ITRS scope has been revised to include waste retrieval systems for tanks AP-102, AP-104, AP-108, AN-103, AN-104, AN-105, AY-102, AZ-102, and SY-102. This current tank selection and sequence provides retrieval systems supporting the Privatized waste processing plant and sustains the ability to provide final remediation of several watch list DSTs via treatment. The ITRS is configured to support changing program needs, as constrained by available budget, by maintaining the flexibility for exchanging tanks requiring mixer pump-based retrieval systems and shifting the retrieval sequence. Preliminary design was configured such that an adequate basis exists for initiating Title II design of a mixer pump based retrieval system for any DST. This Project Management Plan (PMP) documents the methodology for managing the ITRS, formalizes organizational responsibilities and interfaces, and identifies project requirements such as change control, design verification, systems engineering, and human factors engineering
Supplemental design requirements document, Project W026
International Nuclear Information System (INIS)
Weidert, J.R.
1993-01-01
This document supplements and extends the Functional Design Criteria, SP-W026-FDC-001, for the Waste Receiving and Processing Facility (WRAP), Module 1. It provides additional detailed requirements, summarizes key Westinghouse Hanford Company design guidance, and establishes baseline technical agreements to be used in definitive design of the WRAP-1 facility. Revision 3 of the Supplemental Design Requirements Document has been assigned an Impact Level of 3ESQ based on the content of the entire revision. The actual changes made from Revision 2 have an Impact Level of 3S and the basis for these changes was previously reviewed and approved per WHC correspondence No. 9355770
W-320 Project thermal modeling
Energy Technology Data Exchange (ETDEWEB)
Sathyanarayana, K., Fluor Daniel Hanford
1997-03-18
This report summarizes the results of thermal analysis performed to provide a technical basis in support of Project W-320 to retrieve by sluicing the sludge in Tank 241-C-106 and to transfer into Tank 241-AY-102. Prior theraml evaluations in support of Project W-320 safety analysis assumed the availability of 2000 to 3000 CFM, as provided by Tank Farm Operations, for tank floor cooling channels from the secondary ventilation system. As this flow availability has no technical basis, a detailed Tank 241-AY-102 secondary ventilation and floor coating channel flow model was developed and analysis was performed. The results of the analysis show that only about 150 cfm flow is in floor cooLing channels. Tank 241-AY-102 thermal evaluation was performed to determine the necessary cooling flow for floor cooling channels using W-030 primary ventilation system for different quantities of Tank 241-C-106 sludge transfer into Tank 241-AY-102. These sludge transfers meet different options for the project along with minimum required modification of the ventilation system. Also the results of analysis for the amount of sludge transfer using the current system is presented. The effect of sludge fluffing factor, heat generation rate and its distribution between supernatant and sludge in Tank 241-AY-102 on the amount of sludge transfer from Tank 241-C-106 were evaluated and the results are discussed. Also transient thermal analysis was performed to estimate the time to reach the steady state. For a 2 feet sludge transfer, about 3 months time will be requirad to reach steady state. Therefore, for the purpose of process control, a detailed transient thermal analysis using GOTH Computer Code will be required to determine transient response of the sludge in Tank 241-AY-102. Process control considerations are also discussed to eliminate the potential for a steam bump during retrieval and storage in Tanks 241-C-106 and 241-AY-102 respectively.
48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...
Project W-211 initial tank retrieval systems year 2000 compliance assessment project plan
International Nuclear Information System (INIS)
BUSSELL, J.H.
1999-01-01
This document contains a limited assessment of Year 2000 compliance for Project W-211. Additional information is provided as a road map to project documents and other references that may be used to verify Year 2000 compliance
Tank farm restoration and safe operation, Project W-314, upgrade scope summary report (USSR)
International Nuclear Information System (INIS)
Gilbert, J.L.
1998-01-01
The revision to the Project W-314 Upgrade Scope Summary Report (USSR), incorporates changes to the project scope from customer guidance. Included are incorporation of the recommendations from HNF-2500, agreements regarding interfaces with Project W-211, and assumption of scope previously assigned to Project W-454
W-030, AY/AZ tank farm cooling and miscellaneous instrumentation
International Nuclear Information System (INIS)
Cole, D.B.
1996-01-01
This is the acceptance test report for construction functional testing of Project W-030 cooling systems and related instrumentation. Project W-030 provides a ventilation upgrade for the four Aging Waste Facility tanks. The Tank Farm Cooling System consists of four forced draft cooling towers, a chilled water system, and associated controls
International Nuclear Information System (INIS)
Roscha, V.
1994-01-01
The purpose of this report is to describe the definitive design of the Radioactive Mixed Waste (RMW) Non-Drag-Off disposal facility, Project W-025. This report presents a n of the major landfill design features and a discussion of how each of the criteria is addressed in the design. The appendices include laboratory test results, design drawings, and individual analyses that were conducted in support of the design. Revision 1 of this document incorporates design changes resulting from an increase in the required operating life of the W-025 landfill from 2 to 20 years. The rationale for these design changes is described in Golder Associates Inc. 1991a. These changes include (1) adding a 1.5-foot-thick layer of compacted admix directory-under the primary FML on the floor of the landfill to mitigate the effects of possible stress cracking in the primary flexible membrane liner (FML), and (2) increasing the operations layer thickness from two to three feet over the entire landfill area, to provide additional protection for the secondary admix layer against mechanical damage and the effects of freezing and desiccation. The design of the W-025 Landfill has also been modified in response to the results of the EPA Method 9090 chemical compatibility testing program (Golder Associates Inc. 1991b and 1991c), which was completed after the original design was prepared. This program consisted of testing geosynthetic materials and soil/bentonite admix with synthetic leachate having the composition expected during the life of the W-025 Landfill., The results of this program indicated that the polyester geotextile originally specified for the landfill might be susceptible to deterioration. On this basis, polypropylene geotextiles were substituted as a more chemically-resistant alternative. In addition, the percentage of bentonite in the admix was increased to provide sufficiently low permeability to the expected leachate
International Nuclear Information System (INIS)
Clark, R.E.
1994-01-01
This document provides the software development plan for the Waste Receiving and Processing (WRAP) Module 1 Data Management System (DMS). The DMS is one of the plant computer systems for the new WRAP 1 facility (Project W-026). The DMS will collect, store, and report data required to certify the low level waste (LLW) and transuranic (TRU) waste items processed at WRAP 1 as acceptable for shipment, storage, or disposal
Wahid, Kareem; Sanchez, Patrick; Hannan, Mohammad
2014-03-01
In the field of nuclear science, neutron flux is an intrinsic property of nuclear reaction facilities that is the basis for experimental irradiation calculations and analysis. In the Rio Grande Valley (Texas), the UTPA Neutron Research Facility (NRF) is currently the only neutron facility available for experimental research purposes. The facility is comprised of a 20-microgram californium-252 neutron source surrounded by a shielding cascade containing different irradiation cavities. Thermal and fast neutron flux values for the UTPA NRF have yet to be fully investigated and may be of particular interest to biomedical studies in low neutron dose applications. Though a variety of techniques exist for the characterization of neutron flux, neutron activation analysis (NAA) of metal and nonmetal foils is a commonly utilized experimental method because of its detection sensitivity and availability. The aim of our current investigation is to employ foil activation in the determination of neutron flux values for the UTPA NSRF for further research purposes. Neutron spectrum unfolding of the acquired experimental data via specialized software and subsequent comparison for consistency with computational models lends confidence to the results.
Implementing partnerships in nonreactor facility safety analyses
International Nuclear Information System (INIS)
Courtney, J.C.; Perry, W.H.; Phipps, R.D.
1996-01-01
Faculty and students from LSU have been participating in nuclear safety analyses and radiation protection projects at ANL-W at INEL since 1973. A mutually beneficial relationship has evolved that has resulted in generation of safety-related studies acceptable to Argonne and DOE, NRC, and state regulatory groups. Most of the safety projects have involved the Hot Fuel Examination Facility or the Fuel Conditioning Facility; both are hot cells that receive spent fuel from EBR-II. A table shows some of the major projects at ANL-W that involved LSU students and faculty
Orifice Mass Flow Calculation in NASA's W-8 Single Stage Axial Compressor Facility
Bozak, Richard F.
2018-01-01
Updates to the orifice mass flow calculation for the W-8 Single Stage Axial Compressor Facility at NASA Glenn Research Center are provided to include the effect of humidity and incorporate ISO 5167. A methodology for including the effect of humidity into the inlet orifice mass flow calculation is provided. Orifice mass flow calculations provided by ASME PTC-19.5-2004, ASME MFC-3M-2004, ASME Fluid Meters, and ISO 5167 are compared for W-8's atmospheric inlet orifice plate. Differences in expansion factor and discharge coefficient given by these standards give a variation of about +/- 75% mass flow except for a few cases. A comparison of the calculations with an inlet static pressure mass flow correlation and a fan exit mass flow integration using test data from a 2017 turbofan rotor test in W-8 show good agreement between the inlet static pressure mass flow correlation, ISO 5167, and ASME Fluid Meters. While W-8's atmospheric inlet orifice plate violates the pipe diameter limit defined by each of the standards, the ISO 5167 is chosen to be the primary orifice mass flow calculation to use in the W-8 facility.
Test and evaluation plan for Project W-314 tank farm restoration and safe operations
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
The ''Tank Farm Restoration and Safe Operations'' (TFRSO), Project W-314 will restore and/or upgrade existing Hanford Tank Farm facilities and systems to ensure that the Tank Farm infrastructure will be able to support near term TWRS Privatization's waste feed delivery and disposal system and continue safe management of tank waste. The capital improvements provided by this project will increase the margin of safety for Tank Farms operations, and will aid in aligning affected Tank Farm systems with compliance requirements from applicable state, Federal, and local regulations. Secondary benefits will be realized subsequent to project completion in the form of reduced equipment down-time, reduced health and safety risks to workers, reduced operating and maintenance costs, and minimization of radioactive and/or hazardous material releases to the environment. The original regulatory (e.g., Executive Orders, WACS, CFRS, permit requirements, required engineering standards, etc.) and institutional (e.g., DOE Orders, Hanford procedures, etc.) requirements for Project W-314 were extracted from the TWRS S/RIDs during the development of the Functions and Requirements (F and Rs). The entire family of requirements were then validated for TWRS and Project W-314. This information was contained in the RDD-100 database and used to establish the original CDR. The Project Hanford Management Contract (PHMC) team recognizes that safety, quality, and cost effectiveness in the Test and Evaluation (T and E) program is achieved through a planned systematic approach to T and E activities. It is to this end that the Test and Evaluation Plan (TEP) is created. The TEP for the TFRSO Project, was developed based on the guidance in HNF-IP-0842, and the Good Practice Guide GPG-FM-005, ''Test and Evaluation,'' which is derived from DOE Order 430.1, ''Life Cycle Asset Management.'' It describes the Test and Evaluation program for the TFRSO project starting with the definitive design phase and ending
Graphite moderated {sup 252}Cf source
Energy Technology Data Exchange (ETDEWEB)
Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)
2014-08-15
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
Facility Interface Capability Assessment (FICA) project report
International Nuclear Information System (INIS)
Pope, R.B.; MacDonald, R.R.; Viebrock, J.M.; Mote, N.
1995-09-01
The US Department of Energy's (DOE) Office of Civilian Radioactive Waste Management (OCRWM) is responsible for developing the Civilian Radioactive Waste Management System (CRWMS) to accept spent nuclear fuel from commercial facilities. The objective of the Facility Interface Capability Assessment (FICA) project was to assess the capability of each commercial spent nuclear fuel (SNF) storage facility, at which SNF is stored, to handle various SNF shipping casks. The purpose of this report is to present and analyze the results of the facility assessments completed within the FICA project. During Phase 1, the data items required to complete the facility assessments were identified and the database for the project was created. During Phase 2, visits were made to 122 facilities on 76 sites to collect data and information, the database was updated, and assessments of the cask-handling capabilities at each facility were performed. Each assessment of cask-handling capability contains three parts: the current capability of the facility (planning base); the potential enhanced capability if revisions were made to the facility licensing and/or administrative controls; and the potential enhanced capability if limited physical modifications were made to the facility. The main conclusion derived from the planning base assessments is that the current facility capabilities will not allow handling of any of the FICA Casks at 49 of the 122 facilities evaluated. However, consideration of potential revisions and/or modifications showed that all but one of the 49 facilities could be adapted to handle at least one of the FICA Casks. For this to be possible, facility licensing, administrative controls, and/or physical aspects of the facility would need to be modified
Facility Interface Capability Assessment (FICA) project report
Energy Technology Data Exchange (ETDEWEB)
Pope, R.B. [ed.] [Oak Ridge National Lab., TN (United States); MacDonald, R.R. [ed.] [Civilian Radioactive Waste Management System, Vienna, VA (United States); Viebrock, J.M.; Mote, N. [Nuclear Assurance Corp., Norcross, GA (United States)
1995-09-01
The US Department of Energy`s (DOE) Office of Civilian Radioactive Waste Management (OCRWM) is responsible for developing the Civilian Radioactive Waste Management System (CRWMS) to accept spent nuclear fuel from commercial facilities. The objective of the Facility Interface Capability Assessment (FICA) project was to assess the capability of each commercial spent nuclear fuel (SNF) storage facility, at which SNF is stored, to handle various SNF shipping casks. The purpose of this report is to present and analyze the results of the facility assessments completed within the FICA project. During Phase 1, the data items required to complete the facility assessments were identified and the database for the project was created. During Phase 2, visits were made to 122 facilities on 76 sites to collect data and information, the database was updated, and assessments of the cask-handling capabilities at each facility were performed. Each assessment of cask-handling capability contains three parts: the current capability of the facility (planning base); the potential enhanced capability if revisions were made to the facility licensing and/or administrative controls; and the potential enhanced capability if limited physical modifications were made to the facility. The main conclusion derived from the planning base assessments is that the current facility capabilities will not allow handling of any of the FICA Casks at 49 of the 122 facilities evaluated. However, consideration of potential revisions and/or modifications showed that all but one of the 49 facilities could be adapted to handle at least one of the FICA Casks. For this to be possible, facility licensing, administrative controls, and/or physical aspects of the facility would need to be modified.
The South African isotope facility project
Bark, R. A.; Barnard, A. H.; Conradie, J. L.; de Villiers, J. G.; van Schalkwyk, P. A.
2018-05-01
The South African Isotope Facility (SAIF) is a project in which iThemba LABS plans to build a radioactive-ion beam (RIB) facility. The project is divided into the Accelerator Centre of Exotic Isotopes (ACE Isotopes) and the Accelerator Centre for Exotic Beams (ACE Beams). For ACE Isotopes, a high-current, 70 MeV cyclotron will be acquired to take radionuclide production off the existing Separated Sector Cyclotron (SSC). A freed up SSC will then be available for an increased tempo of nuclear physics research and to serve as a driver accelerator for the ACE Beams project, in which protons will be used for the direct fission of Uranium, producing beams of fission fragments. The ACE Beams project has begun with "LeRIB" - a Low Energy RIB facility, now under construction. In a collaboration with INFN Legnaro, the target/ion-source "front-end" will be a copy of the front-end developed for the SPES project. A variety of targets may be inserted into the SPES front-end; a uranium-carbide target has been designed to produce up to 2 × 1013 fission/s using a 70 MeV proton beam of 150 µA intensity.
International Nuclear Information System (INIS)
1995-04-01
The purpose of the Isotopes Facilities Deactivation Project (IFDP) is to place former isotopes production facilities at the Oak Ridge National Laboratory in a safe, stable, and environmentally sound condition suitable for an extended period of minimum surveillance and maintenance (S ampersand M) and as quickly and economically as possible. Implementation and completion of the deactivation project will further reduce the already small risks to the environment and to public safety and health. Furthermore, the project should result in significant S ampersand M cost savings in the future. The IFDP management plan has been prepared to document the project objectives, define organizational relationships and responsibilities, and outline the management control systems to be employed in the management of the project. The project has adopted a strategy to deactivate the simple facilities first, to reduce the scope of the project, and to gain experience before addressing more difficult facilities. A decision support system is being developed to identify those activities, that best promote the project mission and result in largest cost savings. The Work Plan for the Isotopes Facilities Deactivation Project at Oak Ridge National Laboratory (Energy Systems 1994) defines the project schedule, the cost estimate, and the technical approach for the project
Energy Technology Data Exchange (ETDEWEB)
Klenk, Rafael; Bobien, Steffen; Neumann, Holger [KIT Campus Nord, Eggenstein-Leopoldshafen (Germany). Bereich Kryotechnik
2016-07-01
At the Institute for Technical Physics of the KIT Campus Nord helium is cooled respectively liquefied by means of the Claude process. This process is beside the Brayton and Joule-Thomson process meanwhile a standard process for the liquefaction of helium. As example here a 2 kW low-temperature helium facility shall be evaluated by means of different, superordinated failure sources. This consists of condensers, heat exchangers, expansion turbines and a Joule-Thomson valve. The facility respectively component failures are divided in failures of the condenser, turbine units and failures by external factors. For this entries of the last twelve years are token. This listing shall give information about repeating events, so that here directed facility improvements can be token up.
Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Shastry, Rohit; Thomas, Robert; Yim, John; Herman, Daniel; Williams, George; Myers, James; Hofer, Richard;
2015-01-01
NASA's Space Technology Mission Directorate (STMD) Solar Electric Propulsion Technology Demonstration Mission (SEP/TDM) project is funding the development of a 12.5-kW Hall thruster system to support future NASA missions. The thruster designated Hall Effect Rocket with Magnetic Shielding (HERMeS) is a 12.5-kW Hall thruster with magnetic shielding incorporating a centrally mounted cathode. HERMeS was designed and modeled by a NASA GRC and JPL team and was fabricated and tested in vacuum facility 5 (VF5) at NASA GRC. Tests at NASA GRC were performed with the Technology Development Unit 1 (TDU1) thruster. TDU1's magnetic shielding topology was confirmed by measurement of anode potential and low electron temperature along the discharge chamber walls. Thermal characterization tests indicated that during full power thruster operation at peak magnetic field strength, the various thruster component temperatures were below prescribed maximum allowable limits. Performance characterization tests demonstrated the thruster's wide throttling range and found that the thruster can achieve a peak thruster efficiency of 63% at 12.5 kW 500 V and can attain a specific impulse of 3,000 s at 12.5 kW and a discharge voltage of 800 V. Facility background pressure variation tests revealed that the performance, operational characteristics, and magnetic shielding effectiveness of the TDU1 design were mostly insensitive to increases in background pressure.
Project W-420 Ventilation Stack Monitoring System Year 2000 Compliance Assessment Project Plan
International Nuclear Information System (INIS)
BUSSELL, J.H.
1999-01-01
This document contains a limited assessment of Year 2000 compliance for Project W-420. Additional information is provided as a road map to project documents and other references that may be used to verify Year 2000 compliance. This assessment describes the potential Year 2000 (Y2K) problems and describes the methods for achieving Y2K Compliance for Project W-420, Ventilation Stack Monitoring Systems Upgrades. The purpose of this assessment is to give an overview of the project. This document will not be updated and any dates contained in this document are estimates and may change. The project work scope includes upgrades to ventilation stacks and generic effluent monitoring systems (GEMS) at the 244-A Double Contained Receiver Tank (DCRT), the 244-BX DCRT, the 244-CR Vault, tanks 241-C-105 and 241-C-106, the 244-S DCRT, and the 244-TX DCRT. A detailed description of system dates, functions, interfaces, potential Y2K problems, and date resolutions can not be described since the project is in the definitive design phase, This assessment will describe the methods, protocols, and practices to ensure that equipment and systems do not have Y2K problems
Vitrification facility at the West Valley Demonstration Project
International Nuclear Information System (INIS)
DesCamp, V.A.; McMahon, C.L.
1996-07-01
This report is a description of the West Valley Demonstration Project's vitrification facilities from the establishment of the West Valley, NY site as a federal and state cooperative project to the completion of all activities necessary to begin solidification of radioactive waste into glass by vitrification. Topics discussed in this report include the Project's background, high-level radioactive waste consolidation, vitrification process and component testing, facilities design and construction, waste/glass recipe development, integrated facility testing, and readiness activities for radioactive waste processing
Project W-519 TWRS privatization phase 1 infrastructure year 2000 compliance assessment project plan
International Nuclear Information System (INIS)
BUSSELL, J.H.
1999-01-01
This document contains a limited assessment of Year 2000 compliance for Project W-519. Additional information is provided as a road map to project documents and other references that may be used to verify Year 2000 compliance
Statement of work for the immobilized high-level waste transportation system, Project W-464
Energy Technology Data Exchange (ETDEWEB)
Mouette, P.
1998-06-24
The objective of this Statement of Work (SOW) is to present the scope, the deliverables, the organization, the technical and schedule expectations for the development of a Package Design Criteria (PDC), cost and schedule estimate for the acquisition of a transportation system for the Immobilized High-Level Waste (IHLW). This transportation system which includes the truck, the trailer, and a shielded cask will be used for on-site transportation of the IHLW canisters from the private vendor vitrification facility to the Hanford Site interim storage facility, i.e., vaults 2 and 3 of the Canister Storage Building (CSB). This Statement of Work asks Waste Management Federal Services, Inc., Northwest Operations, to provide Project W-464 with a Design Criteria Document, plus a life-cycle schedule and cost estimate for the acquisition of a transportation system (shielded cask, truck, trailer) for IHLW on-site transportation.
International Nuclear Information System (INIS)
Valentine, T.E.; Mihalczo, J.T.
1993-01-01
The 252 Cf-source-driven noise analysis method has been used in measurements for subcritical configurations of fissile systems for a variety of applications. Measurements of 25 fissile systems have been performed with a wide variety of materials and configurations. This method has been applied to measurements for (1) initial fuel loading of reactors, (2) quality assurance of reactor fuel elements, (3) fuel preparation facilities, (4) fuel processing facilities, (5) fuel storage facilities, (6) zero-power testing of reactors, and (7) verification of calculational methods for assemblies with the neutron k 252 Cf source and commercially available detectors was feasible and to determine if the measurement could characterize the ability of the concrete to isolate the fissile material
Project W-049H Collection System Acceptance Test
International Nuclear Information System (INIS)
Buckles, D.I.
1994-01-01
The Acceptance Test Procedure (ATP) Program for Project W-049H covers the following activities: Disposal system, Collection system, Instrumentation and control system. Each activity has its own ATP. The purpose of the ATPs is to verify that the systems have been constructed in accordance with the construction documents and to demonstrate that the systems function as required by the Project criteria. This ATP has been prepared to demonstrate that the Collection System Instrumentation functions as required by project criteria
Production, Distribution, and Applications of Californium-252 Neutron Sources
International Nuclear Information System (INIS)
Balo, P.A.; Knauer, J.B.; Martin, R.C.
1999-01-01
The radioisotope 252 Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10 11 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252 Cf to commercial reencapsulators domestically and internationally. Sealed 252 Cf sources are also available for loan to agencies and subcontractors of the U.S. government and to universities for educational, research, and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252 Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments, and irradiation of rice to induce genetic mutations
Design of 500kW grate fired test facility using CFD
DEFF Research Database (Denmark)
Rosendahl, Lasse Aistrup; Kær, Søren Knudsen; Jørgensen, K.
2005-01-01
A 500kW vibrating grate fired test facility for solid biomass fuels has been designed using numerical models including CFD. The CFD modelling has focussed on the nozzle layout and flowpatterns in the lower part of the furnace, and the results have established confidence in the chosen design...
Acceptance test procedure: RMW Land Disposal Facility Project W-025
International Nuclear Information System (INIS)
Roscha, V.
1994-01-01
This ATP establishes field testing procedures to demonstrate that the electrical/instrumentation system functions as intended by design for the Radioactive Mixed Waste Land Disposal Facility. Procedures are outlined for the field testing of the following: electrical heat trace system; transducers and meter/controllers; pumps; leachate storage tank; and building power and lighting
The National Ignition Facility Project
International Nuclear Information System (INIS)
Paisner, J.A.; Campbell, E.M.; Hogan, W.J.
1994-01-01
The mission of the National Ignition Facility is to achieve ignition and gain in ICF targets in the laboratory. The facility will be used for defense applications such as weapons physics and weapons effect testing, and for civilian applications such as fusion energy development and fundamental studies of matter at high temperatures and densities. This paper reviews the design, schedule and costs associated with the construction project
Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields
Directory of Open Access Journals (Sweden)
Simakov Stanislav
2016-01-01
Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.
340 Facility secondary containment and leak detection
International Nuclear Information System (INIS)
Bendixsen, R.B.
1995-01-01
This document presents a preliminary safety evaluation for the 340 Facility Secondary Containment and Leak Containment system, Project W-302. Project W-302 will construct Building 340-C which has been designed to replace the current 340 Building and vault tank system for collection of liquid wastes from the Pacific Northwest Laboratory buildings in the 300 Area. This new nuclear facility is Hazard Category 3. The vault tank and related monitoring and control equipment are Safety Class 2 with the remainder of the structure, systems and components as Safety Class 3 or 4
The National Ignition Facility Project
International Nuclear Information System (INIS)
Paisner, J.A.; Campbell, E.M.; Hogan, W.J.
1994-01-01
The mission of the National Ignition Facility is to achieve ignition and gain in inertial confinement fusion targets in the laboratory. The facility will be used for defense applications such as weapons physics and weapons effects testing, and for civilian applications such as fusion energy development and fundamental studies of matter at high temperatures and densities. This paper reviews the design, schedule, and costs associated with the construction project
Project W-151 Tank 101-AZ Waste Retrieval System Year 2000 Compliance Assessment Project Plan
International Nuclear Information System (INIS)
BUSSELL, J.H.
1999-01-01
This document contains a limited assessment of Year 2000 compliance for Project W-151. Additional information is provided as a road map to project documents and other references that may be used to verify Year 2000 compliance
Project W-030 safety class upgrade summary report
International Nuclear Information System (INIS)
Kriskovich, J.R.
1998-01-01
This document presents a summary of safety class criteria for the 241-AY/AZ Tank Farm primary ventilation system upgrade under Project W-030, and recommends acceptance of the system as constructed, based on a review of supporting documentation
Study on archive management for nuclear facility decommissioning projects
International Nuclear Information System (INIS)
Huang Ling; Gong Jing; Luo Ning; Liao Bing; Zhou Hao
2011-01-01
This paper introduces the main features and status of the archive management for nuclear facility decommissioning projects, and explores and discusses the countermeasures in its archive management. Taking the practice of the archive management system of a reactor decommissioning project as an example, the paper illustrates the establishment of archive management system for the nuclear facility decommissioning projects. The results show that the development of a systematic archive management principle and system for nuclear decommissioning projects and the construction of project archives for the whole process from the design to the decommissioning by digitalized archive management system are one effective route to improve the complete, accurate and systematic archiving of project documents, to promote the standardization and effectiveness of the archive management and to ensure the traceability of the nuclear facility decommissioning projects. (authors)
National Ignition Facility project acquisition plan
International Nuclear Information System (INIS)
Callaghan, R.W.
1996-04-01
The purpose of this National Ignition Facility Acquisition Plan is to describe the overall procurement strategy planned for the National Ignition Facility (NIF) Project. The scope of the plan describes the procurement activities and acquisition strategy for the following phases of the NIF Project, each of which receives either plant and capital equipment (PACE) or other project cost (OPC) funds: Title 1 and 2 design and Title 3 engineering (PACE); Optics manufacturing facilitization and pilot production (OPC); Convention facility construction (PACE); Procurement, installation, and acceptance testing of equipment (PACE); and Start-up (OPC). Activities that are part of the base Inertial Confinement Fusion (ICF) Program are not included in this plan. The University of California (UC), operating Lawrence Livermore National Laboratory (LLNL) and Los Alamos National Laboratory, and Lockheed-Martin, which operates Sandia National Laboratory (SNL) and the University of Rochester Laboratory for Laser Energetics (UR-LLE), will conduct the acquisition of needed products and services in support of their assigned responsibilities within the NIF Project structure in accordance with their prime contracts with the Department of Energy (DOE). LLNL, designated as the lead Laboratory, will have responsibility for all procurements required for construction, installation, activation, and startup of the NIF
International Nuclear Information System (INIS)
Zaborowski, H.L.
1976-10-01
The project 252 Cf-D 2 O is articulated upon the utilization of a 200μg nominal 252 Cf spontaneous neutron fission source, used bare and under D 2 O spherical moderators, giving leakage neutron spectra experimentally known and/or calculated. This project has for objective the applications of those sources to Health Physics, in dosimetry (calibration of ''rad'' and ''rem-meters'') and in spectrometry, associated with the experimental system of measurements made by the generalization of the BONNER Spheres, known as ''the Multisphere System''. This communication describes the normalization method used and the results obtained leading to the adoption of a reference matrix called ''the Log-Normal Multisphere Matrix'' (LN-MM) giving the energies response functions of the generalized system for all the spheres diameters between 40 and 400 millimeters and for all the energies between 0.4eV and 15MeV [fr
Project W-058 monitor and control system logic
International Nuclear Information System (INIS)
ROBERTS, J.B.
1999-01-01
This supporting document contains the printout of the control logic for the Project W-058 Monitor and Control System, as developed by Programmable Control Services, Inc. The logic is arranged in five appendices, one for each programmable logic controller console
Project W-340 tank 241-C-106 manipulator system closeout summary
International Nuclear Information System (INIS)
McDaniel, L.B.
1995-02-01
This document summarizes the work that was ongoing when Project W-340 was put on hold. Project W-340: Tank 241-C-106 Manipulator Retrieval System, was a candidate FY98 Major System Acquisition. The project was to develop, procure and deploy a Long Reach Manipulator (LRM) waste retrieval system to provide an alternate method to completing the in-tank demonstration of Single Shell Tank waste retrieval technology. The need for enhanced capabilities derives from (1) the inability of the baseline technology to retrieve certain hard waste forms; (2) uncertainty in the quantity of leakage which will be allowed. Numerous studies over the years have identified an arm architecture as a promising retrieval technology to overcome these concerns. The W340 project was intended to further develop and demonstrate this alternative, as part of selecting the best approach for all tanks. Prior to completing the effort, it was determined that an LRM system was too architecture specific and was envisioned to be too expensive for a one time demonstration of retrieval technology. At the time the work was stopped, an effort was underway to broaden the project scope to allow alternatives to an arm-based system
Risk Management Plan for Tank Farm Restoration and Safe Operations, Project W-314
International Nuclear Information System (INIS)
MCGREW, D.L.
2000-01-01
The Risk Management Plan for Project W-314 describes the systems, processes and procedures for implementation of applicable risk management practices described in HNF-0842, Volume IV, Section 2.6, ''Risk Management''. This plan is tailored specifically for use by Project W-314
Quality Assurance program plan - plutonium stabilization and handling project W-460
International Nuclear Information System (INIS)
SCHULTZ, J.W.
1999-01-01
This Quality Assurance Program Plan (QAPP) identifies Project Quality Assurance (QA) program requirements for all parties participating in the design, procurement, demolition, construction, installation, inspection and testing for Project W-460
Japan Hadron Facility (JHF) project
International Nuclear Information System (INIS)
Nagamiya, S.
1999-01-01
The Japan Hadron Facility (JHF) is the next accelerator project proposed at KEK to promote exciting sciences by utilising high-intensity proton beams. The project is characterised by three unique features: hadronic beams of the world's highest intensity; a variety of beams from one accelerator complex; frontier sciences to cover a broad research area including nuclear physics, particle physics, material sciences and life sciences by utilising a common accelerator complex. (author)
W.A. Parish Post Combustion CO2 Capture and Sequestration Project Final Public Design Report
Energy Technology Data Exchange (ETDEWEB)
Armpriester, Anthony [Petra Nova Parish Holdings, Washington, DC (United States)
2017-02-17
The Petra Nova Project is a commercial scale post-combustion carbon dioxide capture project that is being developed by a joint venture between NRG Energy (NRG) and JX Nippon Oil and Gas Exploration (JX). The project is designed to separate and capture carbon dioxide from an existing coal-fired unit's flue gas slipstream at NRG's W.A. Parish Generation Station located southwest of Houston, Texas. The captured carbon dioxide will be transported by pipeline and injected into the West Ranch oil field to boost oil production. The project, which is partially funded by financial assistance from the U.S. Department of Energy will use Mitsubishi Heavy Industries of America, Inc.'s Kansai Mitsubishi Carbon Dioxide Recovery (KM-CDR(R)) advanced amine-based carbon dioxide absorption technology to treat and capture at least 90% of the carbon dioxide from a 240 megawatt equivalent flue gas slipstream off of Unit 8 at W.A. Parish. The project will capture approximately 5,000 tons of carbon dioxide per day or 1.5 million tons per year that Unit 8 would otherwise emit, representing the largest commercial scale deployment of post-combustion carbon dioxide capture at a coal power plant to date. The joint venture issued full notice to proceed in July 2014 and when complete, the project is expected to be the world's largest post-combustion carbon dioxide capture facility on an existing coal plant. The detailed engineering is sufficiently complete to prepare and issue the Final Public Design Report.
Accident consequence calculations for project W-058 safety analysis
International Nuclear Information System (INIS)
Van Keuren, J.C.
1997-01-01
This document describes the calculations performed to determine the accident consequences for the W-058 safety analysis. Project W-058 is the replacement cross site transfer system (RCSTS), which is designed to transort liquid waste between the 200 W and 200 E areas. Calculations for RCSTS safety analyses used the same methods as the calculations for the Tank Waste Remediation System (TWRS) Basis for Interim Operation (BIO) and its supporting calculation notes. Revised analyses were performed for the spray and pool leak accidents since the RCSTS flows and pressures differ from those assumed in the TWRS BIO. Revision 1 of the document incorporates review comments
Solid Waste Operations Complex W-113: Project cost estimate. Preliminary design report. Volume IV
International Nuclear Information System (INIS)
1995-01-01
This document contains Volume IV of the Preliminary Design Report for the Solid Waste Operations Complex W-113 which is the Project Cost Estimate and construction schedule. The estimate was developed based upon Title 1 material take-offs, budgetary equipment quotes and Raytheon historical in-house data. The W-113 project cost estimate and project construction schedule were integrated together to provide a resource loaded project network
The radioactive ion beams facility project for the legnaro laboratories
Tecchio, Luigi B.
1999-04-01
In the frame work of the Italian participation to the project of a high intensity proton facility for the energy amplifier and nuclear waste transmutations, LNL is involving in the design and construction of prototypes of the injection system of the 1 GeV linac that consists of a RFQ (5 MeV, 30 mA) followed by a 100 MeV linac. This program has been already financially supported and the work is actually in progress. In this context, the LNL has been proposed a project for the construction of a second generation facility for the production of radioactive ion beams (RIBs) by using the ISOL method. The final goal consists in the production of neutron rich RIBs with masses ranging from 80 to 160 by using primary beams of protons, deuterons and light ions with energy of 100 MeV and 100 kW power. This project is proposed to be developed in about 10 years from now and intermediate milestones and experiments are foreseen and under consideration for the next INFN five year plan (1999-2003). In such period of time is proposed the construction of a proton/deuteron accelerator of 10 MeV energy and 10 mA current, consisting of a RFQ (5 MeV, 30 mA) and a linac (10 MeV, 10 mA), and of a neutron area dedicated to the RIBs production, to the BNCT applications and to the neutron physics. Some remarks on the production methods will be presented. The possibility of producing radioisotopes by means of the fission induced by neutrons will be investigated and the methods of production of neutrons will be discussed.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC
2010-01-01
... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...
Reactor production of 252Cf and transcurium isotopes
International Nuclear Information System (INIS)
Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.
1990-01-01
Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs
DSN Aperture Enhancement Project Office
Marina, Miguel
2012-01-01
All contracts are underway for antennas, associated facilities modifications and new transmitters. High risk CPI 100kW klystron and JPL high power uplink microwave components have been designed, prototyped and successfully tested at GDSCC to support the 80kW transmitter implementation and testing at vendor facility. Open issues, which might affect project delivery date, have plans in place or are being created, to maintain DSS-35 Operational Date. There are no known open issues that affect performance. Overall good progress has been made in all areas (procurements, contracts, design and development) and the project is confident that DSS-35 & 36 antennas and the three 80kW Uplink systems will be delivered according to plan.
Teams : M. Brice, JC Gadmer
2010-01-01
6th July 2010 - United Kingdom Science and Technology Facilities Council W. Whitehorn signing the guest book with Head of International relations F. Pauss, visiting the Computing Centre with Information Technology Department Head Deputy D. Foster, the LHC superconducting magnet test hall with Technology Department P. Strubin,the Centre Control Centre with Operation Group Leader M. Lamont and the CLIC/CTF3 facility with Project Leader J.-P. Delahaye.
78 FR 28627 - TA-W-80,340; TA-W-80,340A; TA-W-80,340B
2013-05-15
...] Bush Industries, Inc., Mason Drive Facility, Including On-Site Leased Workers From Morris Security...., Mason Drive Facility, Jamestown, New York (TA-W-80,340) and Bush Industries, Inc., Allen Street Facility... applicable to TA-W-80,340 is hereby issued as follows: All workers of Bush Industries, Inc., Mason Drive...
International Nuclear Information System (INIS)
1995-01-01
The purpose of the Isotopes Facilities Deactivation Project (IFDP) is to place nineteen former isotopes production facilities at the Oak Ridge National Laboratory in a safe, stable, and environmentally sound condition suitable for an extended period of minimum surveillance and maintenance (S ampersand M) and as quickly and economically as possible. Implementation and completion of the deactivation project win further reduce the already small risks to the environment and to public safety and health. Furthermore, the project should result in significant S ampersand M cost savings in the future. The IFDP management plan has been prepared to document the project objectives, define organizational relationships and responsibilities, and outline the management control systems to be employed in the management of the project. The project has adopted a strategy to deactivate the simple facilities first, to reduce the scope of the project, and to gain experience before addressing more difficult facilities. A decision support system is being developed to identify those activities that best promote the project mission and result in largest cost savings. The Work Plan for the Isotopes Facilities Deactivation Project at Oak Ridge National Laboratory (Energy Systems 1994) defines the project schedule, the cost estimate, and the technical approach for the project
The 400W at 1.8K Test Facility at CEA-Grenoble
Roussel, P.; Girard, A.; Jager, B.; Rousset, B.; Bonnay, P.; Millet, F.; Gully, P.
2006-04-01
A new test facility with a cooling capacity respectively of 400W at 1.8K or 800W at 4.5K, is now under nominal operation in SBT (Low Temperature Department) at CEA Grenoble. It has been recently used for thermohydraulic studies of two phase superfluid helium in autumn 2004. In the near future, this test bench will allow: - to test industrial components at 1.8K (magnets, cavities of accelerators) - to continue the present studies on thermohydraulics of two phase superfluid helium - to develop and simulate new cooling loops for ITER Cryogenics, and other applications such as high Reynolds number flows This new facility consists of a cold box connected to a warm compressor station (one subatmospheric oil ring pump in series with two screw compressors). The cold box, designed by AIR LIQUIDE, comprises two centrifugal cold compressors, a cold turbine, a wet piston expander, counter flow heat exchangers and two phase separators at 4.5K and 1.8K. The new facility uses a Programmable Logic Controller (PLC) connected to a bus for the measurements. The design is modular and will allow the use of saturated fluid flow (two phase flow at 1.8K or 4.5K) or single phase fluid forced flow. Experimental results and cooling capacity in different operation modes are detailed.
Project W-420 Stack Monitoring system upgrades conceptual design report
International Nuclear Information System (INIS)
TUCK, J.A.
1998-01-01
This document describes the scope, justification, conceptual design, and performance of Project W-420 stack monitoring system upgrades on six NESHAP-designated, Hanford Tank Farms ventilation exhaust stacks
Project W-420 Stack Monitoring system upgrades conceptual design report
Energy Technology Data Exchange (ETDEWEB)
TUCK, J.A.
1998-11-06
This document describes the scope, justification, conceptual design, and performance of Project W-420 stack monitoring system upgrades on six NESHAP-designated, Hanford Tank Farms ventilation exhaust stacks.
Energy Technology Data Exchange (ETDEWEB)
Ušpuras, E.; Kaliatka, A.; Kaliatka, T., E-mail: tadas@mail.lei.lt
2013-06-15
Highlights: • The accident with water ingress into the plasma vessel in Wendelstein nuclear fusion device W7-X was analyzed. • The analysis of the processes in the plasma vessel and ventilation system was performed using thermal-hydraulic RELAP5 Mod3.3 code. • The suitability of pressure increase prevention system was assessed. • All analyses results will be used for the optimization of W7-X design and to ensure safe operation of this nuclear fusion device. -- Abstract: Fusion is the energy production technology, which could potentially solve problems with growing energy demand of population in the future. Starting 2007, Lithuanian Energy Institute (LEI) is a member of European Fusion Development Agreement (EFDA) organization. LEI is cooperating with Max Planck Institute for Plasma Physics (IPP, Germany) in the frames of EFDA project by performing safety analysis of fusion device W7-X. Wendelstein 7-X (W7-X) is an experimental stellarator facility currently being built in Greifswald, Germany, which shall demonstrate that in the future energy could be produced in such type of fusion reactors. In this paper the safety analysis of 40 mm inner diameter coolant pipe rupture in cooling circuit and discharge of steam–water mixture through the leak into plasma vessel during the W7-X no-plasma “baking” operation mode is presented. For the analysis the model of W7-X cooling system (pumps, valves, pipes, hydro-accumulators, and heat exchangers) and plasma vessel was developed by employing system thermal-hydraulic state-of-the-art RELAP5 Mod3.3 code. This paper demonstrated that the developed RELAP5 model enables to analyze the processes in divertor cooling system and plasma vessel. The results of analysis demonstrated that the proposed burst disc, connecting the plasma vessel with venting system, opens and pressure inside plasma vessel does not exceed the limiting 1.1 × 10{sup 5} Pa absolute pressure. Thus, the plasma vessel remains intact after loss
International Nuclear Information System (INIS)
Mendoza, D.P.
1995-01-01
This BCR compares the Project W-058 Functional Design Criteria with the Project W-058 Preliminary Design Requirements Document, and identifies the differences between the two documents in the mission definition, project requirements, system functions, and interfaces. Impacts these differences have on current project design are also discussed
International Nuclear Information System (INIS)
1997-05-01
The mission of the TWRS program is to store, treat, and immobilize highly radioactive tank waste in an environmentally sound, safe, and cost-effective manner. Within this program, Project W-314, Tank Farm Restoration and Safe Operations, has been established to provide upgrades in the areas of instrumentation and control, tank ventilation, waste transfer, and electrical distribution for existing tank farm facilities. Requirements for tank farm infrastructure upgrades to support safe storage were being developed under Project W-314 at the same time that the TWRS EIS alternative analysis was being performed. Project W-314 provides essential tank farm infrastructure upgrades to support continued safe storage of existing tank wastes until the wastes can be retrieved and disposed of through follow-on TWRS program efforts. Section4.0 provides a description of actions associated with Project W-314. The TWRS EIS analyzes the environmental consequences form the entire TWRS program, including actions similar to those described for Project W-314 as a part of continued tank farm operations. The TWRS EIS preferred alternative was developed to a conceptual level of detail to assess bounding impact areas. For this Supplement Analysis, in each of the potential impact areas for Project W-314, the proposed action was evaluated and compared to the TWRS EIS evaluation of the preferred alternative (Section 5.0). Qualitative and/or quantitative comparisons are then provided in this Supplement Analysis to support a determination on the need for additional National Environmental Policy Act (NEPA) analysis. Based on this Supplement Analysis, the potential impacts for Project W-314 would be small in comparison to and are bounded by the impacts assessed for the TWRS EIS preferred alternative, and therefore no additional NEPA analysis is required (Section 7.0)
200 Area Deactivation Project Facilities Authorization Envelope Document
International Nuclear Information System (INIS)
DODD, E.N.
2000-01-01
Project facilities as required by HNF-PRO-2701, Authorization Envelope and Authorization Agreement. The Authorization Agreements (AA's) do not identify the specific set of environmental safety and health requirements that are applicable to the facility. Therefore, the facility Authorization Envelopes are defined here to identify the applicable requirements. This document identifies the authorization envelopes for the 200 Area Deactivation
National Ignition Facility project acquisition plan revision 1
International Nuclear Information System (INIS)
Clobes, A.R.
1996-01-01
The purpose of this National Ignition Facility Acquisition Plan is to describe the overall procurement strategy planned for the National Ignition Facility M Project. It was prepared for the NIP Prood Office by the NIF Procurement Manager
International Nuclear Information System (INIS)
1996-08-01
Purpose of the deactivation project is to place former isotopes production facilities at ORNL in a safe, stable, and environmentally sound condition suitable for an extended period of minimum surveillance and maintenance. This management plan was prepared to document project objectives, define organizational relationships and responsibilities, and outline the management control systems. The project has adopted the strategy of deactivating the simple facilities first. The plan provides a road map for the quality assurance program and identifies other documents supporting the Isotopes Facilities Deactivation Project
Project and feedback experience on nuclear facility decommissioning
Energy Technology Data Exchange (ETDEWEB)
Santiago, J.L. [ENRESA (Spain); Benest, T.G. [United Kingdom Atomic Energy Authority, Windscale, Cumbria (United Kingdom); Tardy, F.; Lefevre, Ph. [Electricite de France (EDF/CIDEN), 69 - Villeurbanne (France); Willis, A. [VT Nuclear Services (United Kingdom); Gilis, R.; Lewandowski, P.; Ooms, B.; Reusen, N.; Van Laer, W.; Walthery, R. [Belgoprocess (Belgium); Jeanjacques, M. [CEA Saclay, 91 - Gif sur Yvette (France); Bohar, M.P.; Bremond, M.P.; Poyau, C.; Mandard, L.; Boissonneau, J.F.; Fouquereau, A.; Pichereau, E.; Binet, C. [CEA Fontenay aux Roses, 92 (France); Fontana, Ph.; Fraize, G. [CEA Marcoule 30 (France); Seurat, Ph. [AREVA NC, 75 - Paris (France); Chesnokov, A.V.; Fadin, S.Y.; Ivanov, O.P.; Kolyadin, V.I.; Lemus, A.V.; Pavlenko, V.I.; Semenov, S.G.; Shisha, A.D.; Volkov, V.G.; Zverkov, Y.A. [Russian Research Centre Kurchatov Inst., Moscow (Russian Federation)
2008-11-15
This series of 6 short articles presents the feedback experience that has been drawn from various nuclear facility dismantling and presents 3 decommissioning projects: first, the WAGR project that is the UK demonstration project for power reactor decommissioning (a review of the tools used to dismantle the reactor core); secondly, the dismantling project of the Bugey-1 UNGG reactor for which the dismantling works of the reactor internals is planned to be done underwater; and thirdly, the decommissioning project of the MR reactor in the Kurchatov Institute. The feedback experience described concerns nuclear facilities in Spain (Vandellos-1 and the CIEMAT research center), in Belgium (the Eurochemic reprocessing plant), and in France (the decommissioning of nuclear premises inside the Fontenay-aux-roses Cea center and the decommissioning of the UP1 spent fuel reprocessing plant at the Marcoule site). (A.C.)
Project and feedback experience on nuclear facility decommissioning
International Nuclear Information System (INIS)
Santiago, J.L.; Benest, T.G.; Tardy, F.; Lefevre, Ph.; Willis, A.; Gilis, R.; Lewandowski, P.; Ooms, B.; Reusen, N.; Van Laer, W.; Walthery, R.; Jeanjacques, M.; Bohar, M.P.; Bremond, M.P.; Poyau, C.; Mandard, L.; Boissonneau, J.F.; Fouquereau, A.; Pichereau, E.; Binet, C.; Fontana, Ph.; Fraize, G.; Seurat, Ph.; Chesnokov, A.V.; Fadin, S.Y.; Ivanov, O.P.; Kolyadin, V.I.; Lemus, A.V.; Pavlenko, V.I.; Semenov, S.G.; Shisha, A.D.; Volkov, V.G.; Zverkov, Y.A.
2008-01-01
This series of 6 short articles presents the feedback experience that has been drawn from various nuclear facility dismantling and presents 3 decommissioning projects: first, the WAGR project that is the UK demonstration project for power reactor decommissioning (a review of the tools used to dismantle the reactor core); secondly, the dismantling project of the Bugey-1 UNGG reactor for which the dismantling works of the reactor internals is planned to be done underwater; and thirdly, the decommissioning project of the MR reactor in the Kurchatov Institute. The feedback experience described concerns nuclear facilities in Spain (Vandellos-1 and the CIEMAT research center), in Belgium (the Eurochemic reprocessing plant), and in France (the decommissioning of nuclear premises inside the Fontenay-aux-roses Cea center and the decommissioning of the UP1 spent fuel reprocessing plant at the Marcoule site). (A.C.)
7 CFR 3565.252 - Housing types.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...
Permitting plan for project W-320 tank 241-C-106 waste retrieval sluicing system (WRSS)
International Nuclear Information System (INIS)
Symons, G.A.
1997-01-01
This document describes the permitting plan for Project W-320, Tank 241-C-106 Waste Retrieval Sluicing System (WRSS). A comprehensive review of environmental regulations have indicated that several environmental reviews [e.g. National Environmental Policy Act (NEPA), State Environmental Policy Act (SEPA)], permits, and approvals are required prior to construction or operation of the facility. The environmental reviews, permits and approvals, as well the regulatory authority, potentially applicable to the Tank 241-C-106 WRSS include the following: for NEPA - U.S. Department of Energy-Headquarters: Action Description Memorandum, Environmental Assessment, Categorical Exclusion, and Environmental Impact Statement; and for SEPA - State of Washington Department of Ecology (Ecology) Determination of Nonsignificance, Mitigated Determination of Nonsignificance, Determination of Significance, and SEPA Environmental Checklist
14 CFR 252.9 - Ventilation systems.
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...
FY-1981 project status for the Transuranic Waste Treatment Facility
International Nuclear Information System (INIS)
Benedetti, R.L.; Tait, T.D.
1981-11-01
The primary objective of the Transuranic Waste Treatment Facility (TWTF) Project is to provide a facility to process low-level transuranic waste stored at the Idaho National Engineering Laboratory (INEL) into a form acceptable for disposal at the Waste Isolation Pilot Plant. This report provides brief summary descriptions of the project objectives and background, project status through FY-1981, planned activities for FY-1982, and the EG and G TWTF Project office position on processing INEL transuranic waste
Sodium Loop Safety Facility W-2 experiment fuel pin rupture detection system
International Nuclear Information System (INIS)
Hoffman, M.A.; Kirchner, T.L.; Meyers, S.C.
1980-05-01
The objective of the Sodium Loop Safety Facility (SLSF) W-2 experiment is to characterize the combined effects of a preconditioned full-length fuel column and slow transient overpower (TOP) conditions on breeder reactor (BR) fuel pin cladding failures. The W-2 experiment will meet this objective by providing data in two technological areas: (1) time and location of cladding failure, and (2) early post-failure test fuel behavior. The test involves a seven pin, prototypic full-length fast test reactor (FTR) fuel pin bundle which will be subjected to a simulated unprotected 5 cents/s reactivity transient overpower event. The outer six pins will provide the necessary prototypic thermal-hydraulic environment for the center pin
Project W-320, 241-C-106 sluicing: Civil/structural calculations. Volume 6
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-07-24
This supporting document has been prepared to make the FDNW calculations for Project W-320 readily retrievable. The purpose of this calculation is to conservatively estimate the weight of equipment and structures being added over Tank 241-C-106 as a result of Project W-320 and combine these weights with the estimated weights of existing structures and equipment as calculated in Attachment 1. The combined weights will be compared to the allowable live load limit to provide a preliminary assessment of loading conditions above Tank 241-C-106.
Project W-236A, work plan for preparation of a design requirements document
International Nuclear Information System (INIS)
Groth, B.D.
1995-01-01
This work plan outlines the tasks necessary, and defines the organizational responsibilities for preparing a Design Requirements Document (DRD) for project W-236A, Multi-Function Waste Tank Facility (MWTF). A DRD is a Systems Engineering document which bounds, at a high level, the requirements of a discrete system element of the Tank Waste Remediation System (TWRS) Program. This system element is usually assigned to a specific project, in this case the MWTF. The DRD is the document that connects the TWRS program requirements with the highest level projects requirements and provides the project's link to the overall TWRS mission. The MWTF DRD effort is somewhat unique in that the project is already in detailed design, whereas a DRO is normally prepared prior to preliminary design. The MWTF design effort was initiated with a Functional Design Criteria (FDC) and a Supplemental Design Requirements Document (SDRD) bounding the high level requirements. Another unique aspect of this effort is that some of the TWRS program requirements are still in development. Because of these unique aspects of the MWTF DRD development, the MWTF will be developed from existing TWRS Program requirements and project specific requirements contained in the FDC and SDRD. The following list describes the objectives of the MWTF DRD: determine the primary functions of the tanks through a functional decomposition of the TWRS Program high level functions; allocate the primary functions to a sub-system architecture for the tanks; define the fundamental design features in terms of performance requirements for the system and subsystems; identify system interfaces and design constraints; and document the results in a DRD
Project W-314 specific test and evaluation plan 241-AN-B valve pit
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made to the 241-AN-B Valve Pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)
Cold Vacuum Drying (CVD) Facility, Diesel Generator Fire Protection
Singh, G
2000-01-01
This Acceptance Test Procedure (ATP) has been prepared to demonstrate that the Fire Protection and Detection System installed by Project W-441 (Cold Vacuum Drying Facility and Diesel Generator Building) functions as required by project specifications.
Cold Vacuum Drying (CVD) Facility, Diesel Generator Fire Protection
International Nuclear Information System (INIS)
SINGH, G.
2000-01-01
This Acceptance Test Procedure (ATP) has been prepared to demonstrate that the Fire Protection and Detection System installed by Project W-441 (Cold Vacuum Drying Facility and Diesel Generator Building) functions as required by project specifications
Project W-320, tank 241-C-106 sluicing acceptance for beneficial use
International Nuclear Information System (INIS)
BAILEY, J.W.
1999-01-01
The purpose of this document is to identify the Project W-320 Chiller Documentation required to be turned over from the Projects Organization to Tank Farm Operations as part of the acceptance of the new equipment for beneficial use
Fast Flux Test Facility project plan. Revision 2
Energy Technology Data Exchange (ETDEWEB)
Hulvey, R.K.
1995-11-01
The Fast Flux Test Facility (FFTF) Transition Project Plan, Revision 2, provides changes to the major elements and project baseline for the deactivation activities necessary to transition the FFTF to a radiologically and industrially safe shutdown condition.
Fast Flux Test Facility project plan. Revision 2
International Nuclear Information System (INIS)
Hulvey, R.K.
1995-11-01
The Fast Flux Test Facility (FFTF) Transition Project Plan, Revision 2, provides changes to the major elements and project baseline for the deactivation activities necessary to transition the FFTF to a radiologically and industrially safe shutdown condition
International Nuclear Information System (INIS)
MAUSER, R.W.
2001-01-01
This Engineering Test report outlines the results obtained from testing polyurea on its decon factor, tank waste compatibility, and adhesion strength when subjected to a high level of gamma radiation. This report is used in conjunction with RPP-7187 Project W-314 Pit Coatings Repair Requirements Analysis, to document the fact polyurea meets the project W-314 requirements contained in HNF-SD-W314-PDS-005 and is therefore an acceptable SPC for use in W-314 pit refurbishments
International Nuclear Information System (INIS)
MCLELLAN, G.W.
2007-01-01
CH2M HILL Hanford Group, Inc. (CH2M HILL) is pleased to nominate the Integrated Disposal Facility (IDF) project for the Project Management Institute's consideration as 2007 Project of the Year, Built for the U.S, Department of Energy's (DOE) Office of River Protection (ORP) at the Hanford Site, the IDF is the site's first Resource Conservation and Recovery Act (RCRA)-compliant disposal facility. The IDF is important to DOE's waste management strategy for the site. Effective management of the IDF project contributed to the project's success. The project was carefully managed to meet three Tri-Party Agreement (TPA) milestones. The completed facility fully satisfied the needs and expectations of the client, regulators and stakeholders. Ultimately, the project, initially estimated to require 48 months and $33.9 million to build, was completed four months ahead of schedule and $11.1 million under budget. DOE directed construction of the IDF to provide additional capacity for disposing of low-level radioactive and mixed (i.e., radioactive and hazardous) solid waste. The facility needed to comply with federal and Washington State environmental laws and meet TPA milestones. The facility had to accommodate over one million cubic yards of the waste material, including immobilized low-activity waste packages from the Waste Treatment Plant (WTP), low-level and mixed low-level waste from WTP failed melters, and alternative immobilized low-activity waste forms, such as bulk-vitrified waste. CH2M HILL designed and constructed a disposal facility with a redundant system of containment barriers and a sophisticated leak-detection system. Built on a 168-area, the facility's construction met all regulatory requirements. The facility's containment system actually exceeds the state's environmental requirements for a hazardous waste landfill. Effective management of the IDF construction project required working through highly political and legal issues as well as challenges with
W.A. Parish Post-Combustion CO{sub 2} Capture and Sequestration Project Phase 1 Definition
Energy Technology Data Exchange (ETDEWEB)
Armpriester, Anthony; Smith, Roger; Scheriffius, Jeff; Smyth, Rebecca; Istre, Michael
2014-02-01
For a secure and sustainable energy future, the United States (U.S.) must reduce its dependence on imported oil and reduce its emissions of carbon dioxide (CO{sub 2}) and other greenhouse gases (GHGs). To meet these strategic challenges, the U.S. wiU have to create fundamentally new technologies with performance levels far beyond what is now possible. Developing advanced post-combustion clean coal technologies for capturing CO{sub 2} from existing coal-fired power plants can play a major role in the country's transition to a sustainable energy future, especially when coupled with CO{sub 2}-enhanced oil recovery (CO{sub 2}-EOR). Pursuant to these goals, NRG Energy, Inc. (NRG) submitted an application and entered into a cost-shared collaboration with the U.S. Department of Energy (DOE) under Round 3 of the Clean Coal Power Initiative (CCPI) to advance low-emission coal technologies. The objective of the NRG W A Parish Post-Combustion CO{sub 2} Capture and Sequestration Demonstration Project is to establish the technical feasibility and economic viability of post-combustion CO{sub 2} capture using flue gas from an existing pulverized coal-fired boiler integrated with geologic sequestration via an enhanced oil recovery (EOR) process. To achieve these objectives, the project will be executed in three phases. Each phase represents a distinct aspect of the project execution. The project phases are: • Phase I. Project Definition/Front-End Engineering Design (FEED) • Phase ll. Detailed Engineering, Procurement & Construction • Phase III. Demonstration and Monitoring The purpose of Phase I is to develop the project in sufficient detail to facilitate the decision-making process in progressing to the next stage of project delivery. Phase n. This report provides a complete summary of the FEED study effort, including pertinent project background information, the scope of facilities covered, decisions, challenges, and considerations made regarding configuration and
Undergraduate experiments using the neutron radiation from californium-252
International Nuclear Information System (INIS)
Rossel, J.; Golecki, I.
1976-01-01
Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)
Mixed and Low-Level Waste Treatment Facility Project
International Nuclear Information System (INIS)
1992-04-01
Mixed and low-level wastes generated at the Idaho National Engineering Laboratory (INEL) are required to be managed according to applicable State and Federal regulations, and Department of Energy Orders that provide for the protection of human health and the environment. The Mixed and Low-Level Waste Treatment Facility Project was chartered in 1991, by the Department of Energy to provide treatment capability for these mixed and low-level waste streams. The first project task consisted of conducting engineering studies to identify the waste streams, their potential treatment strategies, and the requirements that would be imposed on the waste streams and the facilities used to process them. This report documents those studies so the project can continue with an evaluation of programmatic options, system tradeoff studies, and the conceptual design phase of the project. This report, appendix B, comprises the engineering design files for this project study. The engineering design files document each waste steam, its characteristics, and identified treatment strategies
Project W-320, 241-C-106 sluicing: Construction specification W-320-C2
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits
Project W-320, 241-C-106 sluicing: Construction specification W-320-C2
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-07-20
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits.
Project W-320, 241-C-106 sluicing: Construction specification W-320-C6
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits
Project W-320, 241-C-106 sluicing: Construction specification W-320-C5
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits
Project W-320, 241-C-106 sluicing: Construction specification W-320-C7
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits
Project W-320, 241-C-106 sluicing: Construction specification W-320-C5
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-07-20
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits.
Project W-320, 241-C-106 sluicing: Construction specification W-320-C7
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-07-20
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits.
Project W-320, 241-C-106 sluicing: Construction specification W-320-C6
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-07-20
This supporting document has been prepared to make the construction specifications for Project W-320 readily available. Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits.
Decontamination and decommissioning project for the nuclear facilities
Energy Technology Data Exchange (ETDEWEB)
Park, J. H.; Paik, S. T.; Park, S. W. (and others)
2007-02-15
The final goal of this project is to complete the decommissioning of the Korean Research Reactor no.1 and no. 2(KRR-1 and 2) and uranium conversion plant safely and successfully. The goal of this project in 2006 is to complete the decontamination of the inside reactor hall of the KRR-2 which will be operating as a temporary storage for the radioactive waste until the construction and operation of the national repository site. Also the decommissioning work of the KRR-1 and auxiliary facilities is being progress. As the compaction of decommissioning project is near at hand, a computer information system was developed for a systematically control and preserve a technical experience and decommissioning data for the future reuse. The nuclear facility decommissioning, which is the first challenge in Korea, is being closed to the final stages. We completed the decommissioning of all the bio-shielding concrete for KRR-2 in 2005 and carried out the decontamination and waste material grouping of the roof, wall and bottom of the reactor hall of the KRR-2. The decommissioning for nuclear facility were demanded the high technology, remote control equipment and radioactivity analysis. So developed equipment and experience will be applied at the decommissioning for new nuclear facility in the future.
Project W-320, backup: 1000 CFM portable exhausters acceptance for beneficial use
International Nuclear Information System (INIS)
Nelson, O.D.
1998-01-01
This document is to identify the Project W-320 1000 CFM portable exhauster documentation required to be turned over from the Projects Organization to the Tank Farm Operations as part of the acceptance of the 1000 CFM portable exhausters for beneficial use
Californium-252 radiotherapy sources for interstitial afterloading
International Nuclear Information System (INIS)
Permar, P.H.; Walker, V.W.
1976-01-01
Californium-252 neutron sources for interstitial afterloading were developed to investigate the value of this radionuclide in cancer therapy. Californium-252 seed assemblies contain essentially point sources of 252 Cf permanently sealed on 1-cm centers within a flexible plastic tube. The seed assemblies are fabricated with remotely operated, specially designed machines. The fabrication process involves the production of a Pt-10 percent Ir-clad wire with a 252 Cf 2 O 3 -Pd cermet core. The wire is swaged and drawn to size, cut to length, and welded in a Pt-10 percent Ir capsule 0.8 mm in diameter and 6 mm long. Each seed capsule contains approximately 0.5 microgram of 252 Cf. Because the effective half-life of 252 Cf is 2.6 years, the seed assemblies are not disposable and must be reused until their activities have decreased to unsuitable levels. The flexible plastic components must therefore have sufficient resistance to radiation damage to survive the neutron-plus-gamma radiation from 252 Cf. On the basis of accelerated irradiation tests with a large 252 Cf source, a recently developed fluoropolymer, ''Tefzel'' (trademark of E. I. du Pont de Nemours and Company) has adequate radiation resistance for this application. Californium-252 seed assembly systems are loaned by the United States Energy Research and Development Administration for clinical investigations under a protocol of the Radiation Therapy Oncology Group, U.S. National Cancer Institute
National Biomedical Tracer Facility: Project definition study
International Nuclear Information System (INIS)
Heaton, R.; Peterson, E.; Smith, P.
1995-01-01
The Los Alamos National Laboratory is an ideal institution and New Mexico is an ideal location for siting the National Biomedical Tracer Facility (NBTF). The essence of the Los Alamos proposal is the development of two complementary irradiation facilities that combined with our existing radiochemical processing hot cell facilities and waste handling and disposal facilities provide a low cost alternative to other proposals that seek to satisfy the objectives of the NBTF. We propose the construction of a 30 MeV cyclotron facility at the site of the radiochemical facilities, and the construction of a 100 MeV target station at LAMPF to satisfy the requirements and objectives of the NBTF. We do not require any modifications to our existing radiochemical processing hot cell facilities or our waste treatment and disposal facilities to accomplish the objectives of the NBTF. The total capital cost for the facility defined by the project definition study is $15.2 M. This cost estimate includes $9.9 M for the cyclotron and associated facility, $2.0 M for the 100 MeV target station at LAMPF, and $3.3 M for design
National Biomedical Tracer Facility: Project definition study
Energy Technology Data Exchange (ETDEWEB)
Heaton, R.; Peterson, E. [Los Alamos National Lab., NM (United States); Smith, P. [Smith (P.A.) Concepts and Designs (United States)
1995-05-31
The Los Alamos National Laboratory is an ideal institution and New Mexico is an ideal location for siting the National Biomedical Tracer Facility (NBTF). The essence of the Los Alamos proposal is the development of two complementary irradiation facilities that combined with our existing radiochemical processing hot cell facilities and waste handling and disposal facilities provide a low cost alternative to other proposals that seek to satisfy the objectives of the NBTF. We propose the construction of a 30 MeV cyclotron facility at the site of the radiochemical facilities, and the construction of a 100 MeV target station at LAMPF to satisfy the requirements and objectives of the NBTF. We do not require any modifications to our existing radiochemical processing hot cell facilities or our waste treatment and disposal facilities to accomplish the objectives of the NBTF. The total capital cost for the facility defined by the project definition study is $15.2 M. This cost estimate includes $9.9 M for the cyclotron and associated facility, $2.0 M for the 100 MeV target station at LAMPF, and $3.3 M for design.
Mixed and Low-Level Waste Treatment Facility project
International Nuclear Information System (INIS)
1992-04-01
Mixed and low-level wastes generated at the Idaho National Engineering Laboratory (INEL) are required to be managed according to applicable State and Federal regulations, and Department of Energy Orders that provide for the protection of human health and the environment. The Mixed and Low-Level Waste Treatment Facility Project was chartered in 1991, by the Department of Energy to provide treatment capability for these mixed and low-level waste streams. The first project task consisted of conducting engineering studies to identify the waste streams, their potential treatment strategies, and the requirements that would be imposed on the waste streams and the facilities used to process them. This report, Appendix A, Environmental ampersand Regulatory Planning ampersand Documentation, identifies the regulatory requirements that would be imposed on the operation or construction of a facility designed to process the INEL's waste streams. These requirements are contained in five reports that discuss the following topics: (1) an environmental compliance plan and schedule, (2) National Environmental Policy Act requirements, (3) preliminary siting requirements, (4) regulatory justification for the project, and (5) health and safety criteria
The National Ignition Facility Project. Revision 1
International Nuclear Information System (INIS)
Paisner, J.A.; Campbell, E.M.; Hogan, W.J.
1994-01-01
The mission of the National Ignition Facility is to achieve ignition and gain in inertial confinement fusion targets in the laboratory. The facility will be used for defense applications such as weapons physics and weapons effects testing, and for civilian applications such as fusion energy development and fundamental studies of matter at high temperatures and densities. This paper reviews the design, schedule, and costs associated with the construction project
Integrated assessment of thermal hydraulic processes in W7-X fusion experimental facility
Energy Technology Data Exchange (ETDEWEB)
Kaliatka, T., E-mail: tadas.kaliatka@lei.lt; Uspuras, E.; Kaliatka, A.
2017-02-15
Highlights: • The model of Ingress of Coolant Event experiment facility was developed using the RELAP5 code. • Calculation results were compared with Ingress of Coolant Event experiment data. • Using gained experience, the numerical model of Wendelstein 7-X facility was developed. • Performed analysis approved pressure increase protection system for LOCA event. - Abstract: Energy received from the nuclear fusion reaction is one of the most promising options for generating large amounts of carbon-free energy in the future. However, physical and technical problems existing in this technology are complicated. Several experimental nuclear fusion devices around the world have already been constructed, and several are under construction. However, the processes in the cooling system of the in-vessel components, vacuum vessel and pressure increase protection system of nuclear fusion devices are not widely studied. The largest amount of radioactive materials is concentrated in the vacuum vessel of the fusion device. Vacuum vessel is designed for the vacuum conditions inside the vessel. Rupture of the in-vessel components of the cooling system pipe may lead to a sharp pressure increase and possible damage of the vacuum vessel. To prevent the overpressure, the pressure increase protection system should be designed and implemented. Therefore, systematic and detailed experimental and numerical studies, regarding the thermal-hydraulic processes in cooling system, vacuum vessel and pressure increase protection system, are important and relevant. In this article, the numerical investigation of thermal-hydraulic processes in cooling systems of in-vessel components, vacuum vessels and pressure increase protection system of fusion devices is presented. Using the experience gained from the modelling of “Ingress of Coolant Event” experimental facilities, the numerical model of Wendelstein 7-X (W7-X) experimental fusion device was developed. The integrated analysis of the
Congressional hearing reviews NSF major research and facilities projects
Showstack, Randy
2012-03-01
An 8 March congressional hearing about the U.S. National Science Foundation's Major Research Equipment and Facilities Construction (NSF MREFC) account focused on fiscal management and accountability of projects in that account and reviewed concerns raised by NSF's Office of Inspector General (OIG). NSF established the MREFC account in 1995 to better plan and manage investments in major equipment and facilities projects, which can cost from tens of millions to hundreds of millions of dollars, and the foundation has funded 17 MREFC projects since then. The Obama administration's proposed fiscal year (FY) 2013 budget includes funding for four MREFC projects: Advanced Laser Gravitational-Wave Observatory (AdvLIGO), Advanced Technology Solar Telescope (ATST), National Ecological Observatory (NEON), and Ocean Observatories Initiative (OOI). The hearing, held by a subcommittee of the House of Representatives' Committee on Science, Space, and Technology, reviewed management oversight throughout the life cycles of MREFC projects and concerns raised in recent OIG reports about the use of budget contingency funds. NSF's February 2012 manual called "Risk management guide for large facilities" states that cost contingency is "that portion of the project budget required to cover `known unknowns,'" such as planning and estimating errors and omissions, minor labor or material price fluctuations, and design developments and changes within the project scope. Committee members acknowledged measures that NSF has made to improve the MREFC oversight process, but they also urged the agency to continue to take steps to ensure better project management.
International Nuclear Information System (INIS)
Barnett, D.B.; Davis, J.D.; Collard, L.B.; Freeman, P.B.; Chou, C.J.
1995-05-01
This report consists of the groundwater screening evaluation required by Section S.8 of the State Waste Discharge Permit for the 200 Area TEDF. Chapter 1.0 describes the purpose of the groundwater monitoring plan. The information in Chapter 2.0 establishes a water quality baseline for the facility and is the groundwater screening evaluation. The following information is included in Chapter 2.0: Facility description;Well locations, construction, and development data; Geologic and hydrologic description of the site and affected area; Ambient groundwater quality and current use; Water balance information; Hydrologic parameters; Potentiometric map, hydraulic gradients, and flow velocities; Results of infiltration and hydraulic tests; Groundwater and soils chemistry sampling and analysis data; Statistical evaluation of groundwater background data; and Projected effects of facility operation on groundwater flow and water quality. Chapter 3.0 defines, based on the information in Chapter 2.0, how effects of the TEDF on the environment will be evaluated and how compliance with groundwater quality standards will be documented in accordance with the terms and conditions of the permit. Chapter 3.0 contains the following information: Media to be monitored; Wells proposed as the point of compliance in the uppermost aquifer; Basis for monitoring well network and evidence of monitoring adequacy; Contingency planning approach for vadose zone monitoring wells; Which field parameters will be measured and how measurements will be made; Specification of constituents to be sampled and analyzed; and Specification of the sampling and analysis procedures that will be used. Chapter 4.0 provides information on how the monitoring results will be reported and the proposed frequency of monitoring and reporting. Chapter 5.0 lists all the references cited in this monitoring plan. These references should be consulted for additional or more detailed information
Decontamination and Decommissioning Project for the Nuclear Facilities
Energy Technology Data Exchange (ETDEWEB)
Park, J. H.; Paik, S. T.; Park, S. W. and others
2006-02-15
The final goal of this project is to complete safely and successfully the decommissioning of the Korean Research Reactor no.1 (KRR-1) and the Korean Research Reactor no.2 (KRR-2), and uranium conversion plant (UCP). The dismantling of the reactor hall of the KRR-2 was planned to complete till the end of 2004, but it was delayed because of a few unexpected factors such as the development of a remotely operated equipment for dismantling of the highly radioactive parts of the beam port tubes. In 2005, the dismantling of the bio-shielding concrete structure of the KRR-2 was finished and the hall can be used as a temporary storage space for the radioactive waste generated during the decommissioning of the KRR-1 and KRR-2. The cutting experience of the shielding concrete by diamond wire saw and the drilling experience by a core boring machine will be applied to another nuclear facility dismantling. An effective management tool of the decommissioning projects, named DECOMIS, was developed and the data from the decommissioning projects were gathered. This system provided many information on the daily D and D works, waste generation, radiation dose, etc., so an effective management of the decommissioning projects is expected from next year. The operation experience of the uranium conversion plant as a nuclear fuel cycle facility was much contributed to the localization of nuclear fuels for both HWR and PWR. It was shut down in 1993 and a program for its decontamination and dismantling was launched in 2001 to remove all the contaminated equipment and to achieve the environment restoration. The decommissioning project is expected to contribute to the development of the D and D technologies for the other domestic fuel cycle facilities and the settlement of the new criteria for decommissioning of the fuel cycle related facilities.
Quality Assurance Project Plan for Facility Effluent Monitoring Plan activities
International Nuclear Information System (INIS)
Nickels, J.M.
1991-06-01
This Quality Assurance Project Plan addresses the quality assurance requirements for the Facility Monitoring Plans of the overall site-wide environmental monitoring plan. This plan specifically applies to the sampling and analysis activities and continuous monitoring performed for all Facility Effluent Monitoring Plan activities conducted by Westinghouse Hanford Company. It is generic in approach and will be implemented in conjunction with the specific requirements of individual Facility Effluent Monitoring Plans. This document is intended to be a basic road map to the Facility Effluent Monitoring Plan documents (i.e., the guidance document for preparing Facility Effluent Monitoring Plans, Facility Effluent Monitoring Plan determinations, management plan, and Facility Effluent Monitoring Plans). The implementing procedures, plans, and instructions are appropriate for the control of effluent monitoring plans requiring compliance with US Department of Energy, US Environmental Protection Agency, state, and local requirements. This Quality Assurance Project Plan contains a matrix of organizational responsibilities, procedural resources from facility or site manuals used in the Facility Effluent Monitoring Plans, and a list of the analytes of interest and analytical methods for each facility preparing a Facility Effluent Monitoring Plan. 44 refs., 1 figs., 2 tabs
Project W-320, 241-C-106 sluicing: Piping calculations. Volume 8
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the FDNW calculations for Project W-320 readily retrievable. The objective of this calculation is to perform the hydraulic analysis on the slurry line and the supernate line for W-320. This calculation will use the As-Built conditions of the slurry line and the supernate line. Booster Pump Curves vs System Curves shall be generated for the supernate system and the slurry system
Design considerations for the Yucca Mountain project exploratory shaft facility
International Nuclear Information System (INIS)
Bullock, R.L. Sr.
1990-01-01
This paper reports on the regulatory/requirements challenges of this project which exist because this is the first facility of its kind to ever be planned, characterized, designed, and built under the purview of a U.S. Nuclear Regulatory Agency. The regulations and requirements that flow down to the Architect/Engineer (A/E) for development of the Exploratory Shaft Facility (ESF) design are voluminous and unique to this project. The subsurface design and construction of the ESF underground facility may eventually become a part of the future repository facility and, if so, will require licensing by the Nuclear Regulatory Commission (NRC). The Fenix and Scisson of Nevada-Yucca Mountain Project (FSN-YMP) group believes that all of the UMP design and construction related activities, with good design/construct control, can be performed to meet all engineering requirements, while following a strict quality assurance program that will also meet regulatory requirements
Cold vacuum drying facility design requirements
Energy Technology Data Exchange (ETDEWEB)
Irwin, J.J.
1997-09-24
This release of the Design Requirements Document is a complete restructuring and rewrite to the document previously prepared and released for project W-441 to record the design basis for the design of the Cold Vacuum Drying Facility.
Cold vacuum drying facility design requirements
International Nuclear Information System (INIS)
Irwin, J.J.
1997-01-01
This release of the Design Requirements Document is a complete restructuring and rewrite to the document previously prepared and released for project W-441 to record the design basis for the design of the Cold Vacuum Drying Facility
Energy Technology Data Exchange (ETDEWEB)
MCLELLAN, G.W.
2007-02-07
CH2M HILL Hanford Group, Inc. (CH2M HILL) is pleased to nominate the Integrated Disposal Facility (IDF) project for the Project Management Institute's consideration as 2007 Project of the Year, Built for the U.S, Department of Energy's (DOE) Office of River Protection (ORP) at the Hanford Site, the IDF is the site's first Resource Conservation and Recovery Act (RCRA)-compliant disposal facility. The IDF is important to DOE's waste management strategy for the site. Effective management of the IDF project contributed to the project's success. The project was carefully managed to meet three Tri-Party Agreement (TPA) milestones. The completed facility fully satisfied the needs and expectations of the client, regulators and stakeholders. Ultimately, the project, initially estimated to require 48 months and $33.9 million to build, was completed four months ahead of schedule and $11.1 million under budget. DOE directed construction of the IDF to provide additional capacity for disposing of low-level radioactive and mixed (i.e., radioactive and hazardous) solid waste. The facility needed to comply with federal and Washington State environmental laws and meet TPA milestones. The facility had to accommodate over one million cubic yards of the waste material, including immobilized low-activity waste packages from the Waste Treatment Plant (WTP), low-level and mixed low-level waste from WTP failed melters, and alternative immobilized low-activity waste forms, such as bulk-vitrified waste. CH2M HILL designed and constructed a disposal facility with a redundant system of containment barriers and a sophisticated leak-detection system. Built on a 168-area, the facility's construction met all regulatory requirements. The facility's containment system actually exceeds the state's environmental requirements for a hazardous waste landfill. Effective management of the IDF construction project required working through highly political and legal
Project W-314 specific test and evaluation plan for 241-AY-02A pump pit upgrade
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
This Specific Test and Evaluation Plan (STEP) defines the test and evaluation activities encompassing the upgrade of the 241-AY-02A Pump Pit for the W-314 Project. The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made to the 241-AY-02A Pump Pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)
Project W-314 specific test and evaluation plan for 241-AY-01A pump pit upgrade
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
This Specific Test and Evaluation Plan (STEP) defines the test and evaluation activities encompassing the upgrade of the 241-AY-0IA Pump Pit for the W-314 Project. The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made to the 241-AY-01A Pump Pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...
Project W-314 specific test and evaluation plan for 241-AN-A valve pit
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made to the 241-AN-A Valve Pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)
Sodium Loop Safety Facility W-2 experiment fuel pin rupture detection system. [LMFBR
Energy Technology Data Exchange (ETDEWEB)
Hoffman, M.A.; Kirchner, T.L.; Meyers, S.C.
1980-05-01
The objective of the Sodium Loop Safety Facility (SLSF) W-2 experiment is to characterize the combined effects of a preconditioned full-length fuel column and slow transient overpower (TOP) conditions on breeder reactor (BR) fuel pin cladding failures. The W-2 experiment will meet this objective by providing data in two technological areas: (1) time and location of cladding failure, and (2) early post-failure test fuel behavior. The test involves a seven pin, prototypic full-length fast test reactor (FTR) fuel pin bundle which will be subjected to a simulated unprotected 5 cents/s reactivity transient overpower event. The outer six pins will provide the necessary prototypic thermal-hydraulic environment for the center pin.
Work plan for the Isotopes Facilities Deactivation Project at Oak Ridge National Laboratory
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-05-01
The purpose of the Isotopes Facilities Deactivation Project (IFDP) is to place former isotopes production facilities at the Oak Ridge National Laboratory in a safe, stable, and environmentally sound condition; suitable for an extended period of minimum surveillance and maintenance (S&M) and as quickly and economical as possible. Implementation and completion of the deactivation project will further reduce the risks to the environment and to public safety and health. Furthermore, completion of the project will result in significant S&M cost savings in future years. The IFDP work plan defines the project schedule, the cost estimate, and the technical approach for the project. A companion document, the IFDP management plan, has been prepared to document the project objectives, define organizational relationships and responsibilities, and outline the management control systems to be employed in the management of the project. The project has adopted the strategy of deactivating the simple facilities first, to reduce the scope of the project and to gain experience before addressing more difficult facilities. A decision support system is being developed to identify the activities that best promote the project mission and result in the largest cost savings. This work plan will be reviewed and revised annually. Deactivation of IFDP facilities was initiated in FY 1994 and will be completed in FY 1999. The schedule for deactivation of facilities is shown. The total cost of the project is estimated to be $36M. The costs are summarized. Upon completion of deactivation, annual S&M costs of these facilities will be reduced from the current level of $5M per year to less than $1M per year.
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...
Project No. 4 - Waste incineration facility
International Nuclear Information System (INIS)
2000-01-01
There are currently 12000 m 3 of combustible waste stored at the Ignalina NPP site. It is estimated that by 2005 the volume will have increase to 15000 m 3 (filters, personnel protection, clothing and plastics). As a part of the preparation for the closure of the Ignalina NPP an incineration facility will be required to process combustible wastes to reduce the overall volume of short-lived radioactive wastes stored at the Ignalina NPP site, thus reducing the overall risk to the environment. Project activities includes the design, construction and commissioning of the proposed facility, including all licensing documentation
Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy
International Nuclear Information System (INIS)
Maruyama, Y.
1984-01-01
The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)
Project W-420 Ventilation Stack Monitoring System Year 2000 Compliance Assessment Project Plan
International Nuclear Information System (INIS)
BUSSELL, J.H.
1999-01-01
This assessment describes the potential Year 2000 (Y2K) problems and describes the methods for achieving Y2K Compliance for Project W-420, Ventilation Stack Monitoring Systems Upgrades. The purpose of this assessment is to give an overview of the project. This document will not be updated and any dates contained in this document are estimates and may change. The project work scope includes upgrades to ventilation stacks and generic effluent monitoring systems (GEMS) at the 244-A Double Contained Receiver Tank (DCRT), the 244-BX DCRT, the 244-CR Vault, tanks 241-C-105 and 241-C-106, the 244-S DCRT, and the 244-TX DCRT. A detailed description of system dates, functions, interfaces, potential Y2K problems, and date resolutions can not be described since the project is in the definitive design phase, This assessment will describe the methods, protocols, and practices to ensure that equipment and systems do not have Y2K problems
Californium-252 progress, report No. 7, April 1971
Energy Technology Data Exchange (ETDEWEB)
1971-12-31
This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.
River Protection Project (RPP) Immobilized Low- Ativity Waste (ILAW) Disposal Plan
International Nuclear Information System (INIS)
BRIGGS, M.G.
2000-01-01
This document replaces HNF-1517, Rev 2 which is deleted. It incorporates updates to reflect changes in programmatic direction associated with the vitrification plant contract change and associated DOE/ORP guidance. In addition it incorporates the cancellation of Project W-465, Grout Facility, and the associated modifications to Project W-520, Immobilized High-Level Waste Disposal Facility. It also includes document format changes and section number modifications consistent with CH2M HILL Hanford Group, Inc. procedures
Physics of the 252Cf-source-driven noise analysis measurement
International Nuclear Information System (INIS)
Valentine, T.E.; Mihalczo, J.T.; Perez, R.B.; Mattingly, J.K.
1997-01-01
The 252 Cf-source-driven noise analysis method is a versatile measurements tool that has been applied to measurements for initial loading of reactors, quality assurance of reactor fuel elements, fuel processing facilities, fuel reprocessing facilities, fuel storage facilities, zero-power testing of reactors, verification of calculational methods, process monitoring, characterization of storage vaults, and nuclear weapons identification. This method's broad range of application is due to the wide variety of time- and frequency domain signatures, each with unique properties, obtained from the measurement. The following parameters are obtained from this measurement: average detector count rates, detector multiplicities, detector autocorrelations, cross-correlation between detectors, detector autopower spectral densities, cross-power spectral densities between detectors, coherences, and ratios of spectral densities. All of these measured parameters can also be calculated using the MCNP-DSP Monte Carlo code. This paper presents a review of the time-domain signatures obtained from this measurement
Project W-521, waste feed delivery systems environmental permits and approvals plan
International Nuclear Information System (INIS)
TOLLEFSON, K.S.
1999-01-01
This document has been prepared to define the specific environmental requirements applicable to Project W-521. The document describes the permits and approvals necessary for the project to design, construct, and install planned upgrades, and provides a schedule of activities and provides cost estimates to complete the required permitting and approval activities
Project Plan Remote Target Fabrication Refurbishment Project
International Nuclear Information System (INIS)
Bell, Gary L.; Taylor, Robin D.
2009-01-01
was received in July 2009 under the Remote Target Fabrication Refurbishment Task of the Enhanced Utilization of Isotope Facilities project (Project Identification Code 2005230) funded by the American Recovery and Reinvestment Act of 2009. The goal of this project is to recover the capability to produce 4-5 curium targets for the irradiation period starting with HFIR cycle 427, currently scheduled to begin 2/17/10. Assuming success, the equipment would then be used to fabricate 6-7 additional targets to hold for the next irradiation campaign specified by the program. Specific objectives are the return to functionality of the Cubicle 3 Pellet Fabrication Line; Cubicle 2 Target Assembly equipment; and Cubicle 1 Target Inspection and Final Assembly system.
International Nuclear Information System (INIS)
VAN BEEK, J.E.
2000-01-01
This systems Engineering Management and Implementation Plan (SEMIP) describes the Project W-211 implementation of the Tank Farm Contractor Systems Engineering Management Plan (TFC SEMP). The SEMIP defines the systems engineering products and processes used by the project to comply with the TFC SEMP, and provides the basis for tailoring systems engineering processes by applying a graded approach to identify appropriate systems engineering requirements for W-211
Energy Technology Data Exchange (ETDEWEB)
VAN BEEK, J.E.
2000-05-05
This systems Engineering Management and Implementation Plan (SEMIP) describes the Project W-211 implementation of the Tank Farm Contractor Systems Engineering Management Plan (TFC SEMP). The SEMIP defines the systems engineering products and processes used by the project to comply with the TFC SEMP, and provides the basis for tailoring systems engineering processes by applying a graded approach to identify appropriate systems engineering requirements for W-211.
Project specific quality assurance plan for Project W-178, 219-S secondary containment
International Nuclear Information System (INIS)
Buckles, D.I.
1994-01-01
The scope of this Quality Assurance Program Plan (QAPP) is to provide a system of Quality Assurance reviews and verifications on the design, procurement and construction of the 219-S Secondary Containment Upgrade. The reviews and verifications will be on activities associated with design, procurement, and construction of the Secondary Containment Upgrade which includes, but is not limited to demolition, removal, new tank installation, tank 103 isolation, tank cell refurbishment, electrical, instrumentation, piping/tubing including supports, pump and valves, and special coatings. The full project scope is defined in the project Functional Design Criteria (FDC), SD-W178-FDC-001, and all activities must be in compliance with this FDC and related design documentation
Discussion on the post-project assessment of environmental impact for nuclear facilities
International Nuclear Information System (INIS)
Shang Zhaorong
2013-01-01
The paper introduces the background of post-project assessment of environmental impact in the world and focuses on the characteristic of environmental impact assessment for Chinese nuclear facilities construction projects, analyzes the necessity, principle and contents of post-project assessment of environmental impact on current Chinese nuclear facilities operation. It is considered that to start the post-project assessment of environmental impact, perfect the post-project assessment mechanism, introduce the post-project assessment into environmental impact assessment system are just at the night time. (author)
Project W-320, 241-C-106 sluicing supporting documentation bibliography
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the listing of documentation used to develop, or in support of Project W-320, readily retrievable. All documents are sorted by document number and list the document type. Tank 241-C-106 has been included on the High Heat Load Watch List
Design criteria tank farm storage and staging facility. Revision 1
International Nuclear Information System (INIS)
Lott, D.T.
1994-01-01
Tank Farms Operations must store/stage material and equipment until work packages are ready to work. Consumable materials are also required to be stored for routine and emergency work. Connex boxes and open storage is currently used for much of the storage because of the limited space at 272AW and 272WA. Safety issues based on poor housekeeping and material deteriorating due to weather damage has resulted from this inadequate storage space. It has been determined that a storage building in close proximity to the Tank Farm work force would be cost effective. Project W-402 and W-413 will provide a storage/staging area in 200 East and West Areas by the construction of two new storage facilities. The new facilities will be used by Operations, Maintenance and Materials groups to adequately store material and equipment. These projects will also furnish electrical services to the facilities for lighting and HVAC. Fire Protection shall be extended to the 200 East facility from 272AW if necessary
International Nuclear Information System (INIS)
DEFFENBAUGH, M.L.
2000-01-01
The purpose of this document is to revise Document HNF-SD-ENV-EE-003, ''Permitting Plan for the Immobilized Low-Activity Waste Project, which was submitted on September 4, 1997. That plan accounted for the interim storage and disposal of Immobilized-Low Activity Waste at the existing Grout Treatment Facility Vaults (Project W-465) and within a newly constructed facility (Project W-520). Project W-520 was to have contained a combination of concrete vaults and trenches. This document supersedes that plan because of two subsequent items: (1) A disposal authorization that was received on October 25, 1999, in a U. S. Department of Energy-Headquarters, memorandum, ''Disposal Authorization Statement for the Department of Energy Hanford site Low-Level Waste Disposal facilities'' and (2) ''Breakthrough Initiative Immobilized Low-Activity Waste (ILAW) Disposal Alternative,'' August 1999, from Lucas Incorporated, Richland, Washington. The direction within the U. S. Department of Energy-Headquarters memorandum was given as follows: ''The DOE Radioactive Waste Management Order requires that a Disposal authorization statement be obtained prior to construction of new low-level waste disposal facility. Field elements with the existing low-level waste disposal facilities shall obtain a disposal authorization statement in accordance with the schedule in the complex-wide Low-Level Waste Management Program Plan. The disposal authorization statement shall be issued based on a review of the facility's performance assessment and composite analysis or appropriate CERCLA documentation. The disposal authorization shall specify the limits and conditions on construction, design, operations, and closure of the low-level waste facility based on these reviews. A disposal authorization statement is a part of the required radioactive waste management basis for a disposal facility. Failure to obtain a disposal authorization statement or record of decision shall result in shutdown of an operational
The muon science facility at the JAERI/KEK joint project
International Nuclear Information System (INIS)
Miyake, Y.; Nishiyama, K.; Makimura, S.; Kawamura, N.; Shimomura, K.; Kadono, R.; Higemoto, W.; Fukuchi, K.; Beveridge, J.L.; Ishida, K.; Matsuzaki, T.; Watanabe, I.; Matsuda, Y.; Sakamoto, S.; Nakamura, S.N.; Nagamine, K.
2003-01-01
The Muon Science Facility is one of the experimental arenas of the JAERI/KEK Joint Project, which also includes neutron science, particle and nuclear physics, neutrino physics and nuclear transmutation science. Following the recommendations by the review committees, the Joint Project was finally approved for construction at the end of December, 2000. The approval is for Phase 1 of 1335 Oku Yen out of the total project cost of 1890 Oku Yen. It is planned to locate the muon science experimental area together with the neutron facility in an integrated building, as a facility for materials and life science studies. Because its construction will be started in April 2003, we are now working to complete the detailed design of the building structure, shielding, electrical services, cooling water, primary proton beam line, one muon target and secondary beam lines
PROJECT EXPERIENCE REPORT DEMOLITION OF HANFORDS 233-S PLUTONIUM CONCENTRATION FACILITY
International Nuclear Information System (INIS)
BERLIN, G.T.; ORGILL, T.K.
2004-01-01
This report provides a summary of the preparation, operations, innovative work practices, and lessons learned associated with demolition of the 2334 Plutonium Concentration Facility. This project represented the first open-air demolition of a highly-contaminated plutonium facility at the Hanford Site. This project may also represent the first plutonium facility in the US. Department of Energy (DOE) complex to have been demolished without first decontaminating surfaces to near ''free release'' standards. Demolition of plutonium contaminated structures, if not properly managed, can subject cleanup personnel and the environment to significant risk. However, with proper sequencing and innovative use of commercially available equipment, materials, and services, this project demonstrated that a plutonium processing facility can be demolished while avoiding the need to perform extensive decontamination or to construct large enclosures. This project utilized an excavator with concrete shears, diamond circular saws, water misting and fogging equipment, commercially available fixatives and dust suppressants, conventional mobile crane and rigging services, and near real-time modeling of meteorological and radiological conditions. Following a significant amount of preparation, actual demolition of the 233-S Facility began in October 2003 and was completed in late April 2004. The knowledge and experience gained on this project are important to the Hanford Site as additional plutonium processing facilities are scheduled for demolition in the near future. Other sites throughout the DOE Complex may also be faced with similar challenges. Numerous innovations and effective work practices were implemented on this project. Accordingly, a series of ''Lessons Learned and Innovative Practices Fact Sheets'' were developed and are included as an appendix to this report. This collection of fact sheets is not intended to capture every innovative work practice and lesson learned, but rather
PROJECT EXPERIENCE REPORT DEMOLITION OF HANFORDS 233-S PLUTONIUM CONCENTRATION FACILITY
International Nuclear Information System (INIS)
BERLIN, G.T.
2004-01-01
This report provides a summary of the preparation, operations, innovative work practices, and lessons learned associated with demolition of the 2334 Plutonium Concentration Facility. This project represented the first open-air demolition of a highly-contaminated plutonium facility at the Hanford Site. This project may also represent the first plutonium facility in the US. Department of Energy (DOE) complex to have been demolished without first decontaminating surfaces to near ''free release'' standards. Demolition of plutonium contaminated structures, if not properly managed, can subject cleanup personnel and the environment to significant risk. However, with proper sequencing and innovative use of commercially available equipment, materials, and services, this project demonstrated that a plutonium processing facility can be demolished while avoiding the need to perform extensive decontamination or to construct large enclosures. This project utilized an excavator with concrete shears, diamond circular saws, water misting and fogging equipment, commercially available fixatives and dust suppressants, conventional mobile crane and rigging services, and near real-time modeling of meteorological and radiological conditions. Following a significant amount of preparation, actual demolition of the 2333 Facility began in October 2003 and was completed in late April 2004. The knowledge and experience gained on this project are important to the Hanford Site as additional plutonium processing facilities are scheduled for demolition in the near future. Other sites throughout the DOE Complex may also be faced with similar challenges. Numerous innovations and effective work practices were implemented on this project. Accordingly, a series of ''Lessons Learned and Innovative Practices Fact Sheets'' were developed and are included as an appendix to this report. This collection of fact sheets is not intended to capture every innovative work practice and lesson learned, but rather to
Design of the 50 kW neutron converter for SPIRAL2 facility
Energy Technology Data Exchange (ETDEWEB)
Avilov, M.S. [Budker Institute of Nuclear Physics, 630090 Novosibirsk, SB RAS (Russian Federation); Tecchio, L.B., E-mail: tecchio@lnl.infn.i [Laboratori Nazionali di Legnaro, 35020 Legnaro (Italy); Titov, A.T. [Boreskov Institute of Catalysis, 630090 Novosibirsk, SB RAS (Russian Federation); Tsybulya, V.S. [Trofimuk Institute of Geology, 630090 Novosibirsk, SB RAS (Russian Federation); Zhmurikov, E.I. [Budker Institute of Nuclear Physics, 630090 Novosibirsk, SB RAS (Russian Federation)
2010-06-21
SPIRAL2 is a facility for the study of fundamental nuclear physics and multidisciplinary research. SPIRAL2 represents a major advance for research on exotic nuclei. The radioactive ion beam (RIB) production system is comprised of a neutron converter, a target and an ion source. This paper is dedicated to the designing of the 50 kW neutron converter for the SPIRAL2 facility. Among the different variants of the neutron converter, the one based on a rotating solid disk seems quite attractive due to its safety, ease in production and relatively low cost. Dense graphite used as the converter's material allows the production of high-intensity neutron flux and, at the same time, the heat removal from the converter by means of radiation cooling. Thermo-mechanical simulations performed in order to determine the basic geometry and physical characteristics of the neutron production target for SPIRAL2 facility, to define the appropriate beam power distribution, and to predict the target behaviour under the deuteron beam of nominal parameters (40 MeV, 1.2 mA, 50 kW) are presented. To study the main physical and mechanical properties and serviceability under operating conditions, several kinds of graphite have been analyzed and tested. The paper reports the results of such measurements. Radiation damage is the most important issue for the application of graphite as neutron converter. It is well known that the thermal conductivity of the neutron-irradiated graphite is reduced by a factor of 10 from the initial value after irradiation. Difference in volume expansions between the matrix and the fiber results in serious damage of neutron-irradiated C/C composites. Calculations showed that at high temperature the effect of neutron radiation is not so critical and that the change in thermal conductivity does not prevent the use of graphite as neutron converter.
Design of the 50 kW neutron converter for SPIRAL2 facility
International Nuclear Information System (INIS)
Avilov, M.S.; Tecchio, L.B.; Titov, A.T.; Tsybulya, V.S.; Zhmurikov, E.I.
2010-01-01
SPIRAL2 is a facility for the study of fundamental nuclear physics and multidisciplinary research. SPIRAL2 represents a major advance for research on exotic nuclei. The radioactive ion beam (RIB) production system is comprised of a neutron converter, a target and an ion source. This paper is dedicated to the designing of the 50 kW neutron converter for the SPIRAL2 facility. Among the different variants of the neutron converter, the one based on a rotating solid disk seems quite attractive due to its safety, ease in production and relatively low cost. Dense graphite used as the converter's material allows the production of high-intensity neutron flux and, at the same time, the heat removal from the converter by means of radiation cooling. Thermo-mechanical simulations performed in order to determine the basic geometry and physical characteristics of the neutron production target for SPIRAL2 facility, to define the appropriate beam power distribution, and to predict the target behaviour under the deuteron beam of nominal parameters (40 MeV, 1.2 mA, 50 kW) are presented. To study the main physical and mechanical properties and serviceability under operating conditions, several kinds of graphite have been analyzed and tested. The paper reports the results of such measurements. Radiation damage is the most important issue for the application of graphite as neutron converter. It is well known that the thermal conductivity of the neutron-irradiated graphite is reduced by a factor of 10 from the initial value after irradiation. Difference in volume expansions between the matrix and the fiber results in serious damage of neutron-irradiated C/C composites. Calculations showed that at high temperature the effect of neutron radiation is not so critical and that the change in thermal conductivity does not prevent the use of graphite as neutron converter.
Near-facility environmental monitoring quality assurance project plan
International Nuclear Information System (INIS)
McKinney, S.M.
1997-01-01
This Quality Assurance Project Plan addresses the quality assurance requirements for the activities associated with the preoperational and near facility environmental monitoring performed by Waste Management Federal Services, Inc., Northwest Operations and supersedes WHC-EP-0538-2. This plan applies to all sampling and monitoring activities performed by waste management Federal Services, Inc., Northwest Operations in implementing facility environmental monitoring at the Hanford Site
Project W-314 phase I environmental permits and approvals plan
International Nuclear Information System (INIS)
TOLLEFSON, K.S.
1999-01-01
This document describes the range of environmental actions, including required permits and other agency approvals, for Project W-314 activities in the Hanford Site's Tank Waste Remediation System. This document outlines alternative approaches to satisfying applicable environmental standards, and describes selected strategies for acquiring permits and other approvals needed for waste feed delivery to proceed. This document also includes estimated costs and schedule to obtain the required permits and approvals based on the selected strategy. It also provides estimated costs for environmental support during design and construction based on the preliminary project schedule provided
Groundwater monitoring plan: 200 Areas treated effluent disposal facility (Project W-049H)
International Nuclear Information System (INIS)
Barnett, D.B.; Davis, J.D.; Collard, L.B.; Freeman, P.B.; Chou, C.J.
1995-04-01
This groundwater monitoring plan provides information that supports the US Department of Energy's application (DOE-RL 1994) for waste water discharge permit No. WA-ST-4502 from the State of Washington, under the auspices of Washington Administrative Code 173-216. The monitoring plan has two functions: (1) to summarize the results of a 3-yr characterization of the current hydrogeology and groundwater quality of the discharge site and (2) to provide plans for evaluating the effects of the facility's operation on groundwater quality and document compliance with applicable groundwater quality standards. Three wells were drilled to define the stratigraphy, evaluate sediment characteristics, and establish a groundwater monitoring net work for the discharge facility. These wells monitor groundwater quality upgradient and downgradient in the uppermost aquifer. This report proposes plans for continuing the monitoring of groundwater quality and aquifer characteristics after waste water discharges begin
48 CFR 252.231-7000 - Supplemental cost principles.
2010-10-01
... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...
Pre-Project planning of Capital Facilities at NASA
Barrow, Benjamin John
1999-01-01
This thesis details the development of a NASA specific Project Definition Rating Index (PDRI) tool. This tool is to be used as a checklist for determining the necessary steps to follow in defining project scope and as a means to monitor progress and assess scope definition completeness at various stages during the NASA Pre-Project Planning process. This thesis also describes and identifies specific points in the NASA Capital Facility Programming Cycle for the performance of PDRI assessments ...
International Nuclear Information System (INIS)
Dorr, Kent A.; Ostrom, Michael J.; Freeman-Pollard, Jhivaun R.
2012-01-01
CH2M Hill Plateau Remediation Company (CHPRC) designed, constructed, commissioned, and began operation of the largest groundwater pump and treatment facility in the U.S. Department of Energy's (DOE) nationwide complex. This one-of-a-kind groundwater pump and treatment facility, located at the Hanford Nuclear Reservation Site (Hanford Site) in Washington State, was built in an accelerated manner with American Recovery and Reinvestment Act (ARRA) funds and has attained Leadership in Energy and Environmental Design (LEED) GOLD certification, which makes it the first non-administrative building in the DOE Office of Environmental Management complex to earn such an award. There were many contractual, technical, configuration management, quality, safety, and LEED challenges associated with the design, procurement, construction, and commissioning of this $95 million, 52,000 ft groundwater pump and treatment facility. This paper will present the Project and LEED accomplishments, as well as Lessons Learned by CHPRC when additional ARRA funds were used to accelerate design, procurement, construction, and commissioning of the 200 West Groundwater Pump and Treatment (2W PandT) Facility to meet DOE's mission of treating contaminated groundwater at the Hanford Site with a new facility by June 28, 2012
Energy Technology Data Exchange (ETDEWEB)
Dorr, Kent A. [CH2M HILL Plateau Remediation Company, Richland, WA (United States); Ostrom, Michael J. [CH2M HILL Plateau Remediation Company, Richland, WA (United States); Freeman-Pollard, Jhivaun R. [CH2M HILL Plateau Remediation Company, Richland, WA (United States)
2012-11-14
CH2M Hill Plateau Remediation Company (CHPRC) designed, constructed, commissioned, and began operation of the largest groundwater pump and treatment facility in the U.S. Department of Energy's (DOE) nationwide complex. This one-of-a-kind groundwater pump and treatment facility, located at the Hanford Nuclear Reservation Site (Hanford Site) in Washington State, was built in an accelerated manner with American Recovery and Reinvestment Act (ARRA) funds and has attained Leadership in Energy and Environmental Design (LEED) GOLD certification, which makes it the first non-administrative building in the DOE Office of Environmental Management complex to earn such an award. There were many contractual, technical, configuration management, quality, safety, and LEED challenges associated with the design, procurement, construction, and commissioning of this $95 million, 52,000 ft groundwater pump and treatment facility. This paper will present the Project and LEED accomplishments, as well as Lessons Learned by CHPRC when additional ARRA funds were used to accelerate design, procurement, construction, and commissioning of the 200 West Groundwater Pump and Treatment (2W P&T) Facility to meet DOE's mission of treating contaminated groundwater at the Hanford Site with a new facility by June 28, 2012.
Project W-320, 241-C-106 sluicing piping calculations, Volume 7
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
The object of this report is to calculate the hydraulic forces imposed at the sluicer nozzle. This is required by Project W-320 waste retrieval for tank 241-C-106. The method of analysis used is Bernoulli's momentum equation for stead flow
Ross In Situ Uranium Recovery Project NESHAP Subpart W Construction Approval
On May 5, 2015, EPA issued a Construction Approval under the National Emission Standards for Hazardous Air Pollutants (NESHAPs) at 40 CFR Part 61, subpart W, to Strata Energy, Inc., for their Ross In Situ Recovery (ISR) Uranium Project in Crook County, WY.
Nuclear facility projects in Finland: quality of environmental impact assessment (EIA) processes
International Nuclear Information System (INIS)
Vaatainen, A.
2001-01-01
In Finland, three public EIA hearings arranged by the contact authority concerning nuclear facilities were organised in 1999: the EIAs of two reactors planned to be constructed in Eurajoki (Olkiluoto) and in Loviisa, and the EIA of a final disposal facility of spent nuclear fuel, to be situated either in Olkiluoto, Loviisa, Romuvaara or Kivetty. Additionally, an application for a decision-in-principle concerning a final disposal facility to be constructed in Olkiluoto was submitted. The Ministry of Trade and Industry is the contact authority in all nuclear projects in Finland. Probably due to the simultaneity of the processes and the great importance of nuclear facility projects to the whole of society, the public opinions did not include only views about environmental impacts of each project, but also opposing and overall views about the use of nuclear energy and its safety. As for the final disposal project, alternative methods were introduced and opposition to the project itself was expressed instead of or in addition to the environmental impacts. (author)
G.W. Ritchey's Optical Work for the Army during WWI.
Abrahams, Peter
2015-01-01
During the first World War, the Mount Wilson optical shop was remodeled into a production facility, making lenses and prisms for military optics. G.W. Ritchey, H.S. Kinney, and J.S. Dalton managed the project, joined by Ritchey's son Willis and a large team of workers. Tens of thousands of lenses and prisms were produced, notably the exacting roof prisms needed for altimeters.This sizeable project is documented in correspondence and a 'Report on Technical Details of Optical Work', authored by G.W. Ritchey and reproduced in typewriter carbon copy with tipped-in photographs. The retrofitting of the MWO optical shop, and the complicated production methods, are detailed in the report.
SOLAR PANELS ON HUDSON COUNTY FACILITIES
Energy Technology Data Exchange (ETDEWEB)
BARRY, KEVIN
2014-06-06
This project involved the installation of an 83 kW grid-connected photovoltaic system tied into the energy management system of Hudson County's new 60,000 square foot Emergency Operations and Command Center and staff offices. Other renewable energy features of the building include a 15 kW wind turbine, geothermal heating and cooling, natural daylighting, natural ventilation, gray water plumbing system and a green roof. The County intends to seek Silver LEED certification for the facility.
46 CFR 252.33 - Hull and machinery insurance.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...
Tritium Facilities Modernization and Consolidation Project Process Waste Assessment (Project S-7726)
Energy Technology Data Exchange (ETDEWEB)
Hsu, R.H. [Westinghouse Savannah River Company, AIKEN, SC (United States); Oji, L.N.
1997-11-14
Under the Tritium Facility Modernization {ampersand} Consolidation (TFM{ampersand}C) Project (S-7726) at the Savannah River Site (SS), all tritium processing operations in Building 232-H, with the exception of extraction and obsolete/abandoned systems, will be reestablished in Building 233-H. These operations include hydrogen isotopic separation, loading and unloading of tritium shipping and storage containers, tritium recovery from zeolite beds, and stripping of nitrogen flush gas to remove tritium prior to stack discharge. The scope of the TFM{ampersand}C Project also provides for a new replacement R&D tritium test manifold in 233-H, upgrading of the 233- H Purge Stripper and 233-H/234-H building HVAC, a new 234-H motor control center equipment building and relocating 232-H Materials Test Facility metallurgical laboratories (met labs), flow tester and life storage program environment chambers to 234-H.
Power spectral density measurements with 252Cf for a light water moderated research reactor
International Nuclear Information System (INIS)
King, W.T.; Mihalczo, J.T.
1979-01-01
A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented
Near-Facility Environmental Monitoring Quality Assurance Project Plan
International Nuclear Information System (INIS)
MCKINNEY, S.M.
2000-01-01
This Quality Assurance Project Plan addresses the quality assurance requirements for the activities associated with the preoperational and near-facility environmental monitoring directed by Waste Management Technical Services and supersedes HNF-EP-0538-4. This plan applies to all sampling and monitoring activities performed by Waste Management Technical Services in implementing near-facility environmental monitoring at the Hanford Site. This Quality Assurance Project Plan is required by U.S. Department of Energy Order 5400.1 (DOE 1990) as a part of the Environmental Monitoring Plan (DOE-RL 1997) and is used to define: Environmental measurement and sampling locations used to monitor environmental contaminants near active and inactive facilities and waste storage and disposal sites; Procedures and equipment needed to perform the measurement and sampling; Frequency and analyses required for each measurement and sampling location; Minimum detection level and accuracy; Quality assurance components; and Investigation levels. Near-facility environmental monitoring for the Hanford Site is conducted in accordance with the requirements of U.S. Department of Energy Orders 5400.1 (DOE 1990), 5400.5 (DOE 1993), 5484.1 (DOE 1990), and 435.1 (DOE 1999), and DOE/EH-O173T (DOE 1991). It is Waste Management Technical Services' objective to manage and conduct near-facility environmental monitoring activities at the Hanford Site in a cost-effective and environmentally responsible manner that is in compliance with the letter and spirit of these regulations and other environmental regulations, statutes, and standards
Final Design Report for the RH LLW Disposal Facility (RDF) Project, Revision 3
International Nuclear Information System (INIS)
Austad, Stephanie Lee
2015-01-01
The RH LLW Disposal Facility (RDF) Project was designed by AREVA Federal Services (AFS) and the design process was managed by Battelle Energy Alliance (BEA) for the Department of Energy (DOE). The final design report for the RH LLW Disposal Facility Project is a compilation of the documents and deliverables included in the facility final design.
Preliminary safety evaluation for 241-C-106 waste retrieval, project W-320
International Nuclear Information System (INIS)
Conner, J.C.
1994-01-01
This document presents the Preliminary Safety Evaluation for Project W-320, Tank 241-C-106 Waste Retrieval Sluicing System (WRSS). The US DOE has been mandated to develop plans for response to safety issues associated with the waste storage tanks at the Hanford Site, and to report the progress of implementing those plans to Congress. The objectives of Project W-230 are to design, fabricate, develop, test, and operate a new retrieval system capable of removing a minimum of about 75% of the high-heat waste contained in C-106. It is anticipated that sluicing operations can remove enough waste to reduce the remaining radiogenic heat load to levels low enough to resolve the high-heat safety issue as well as allow closure of the tank safety issue
International Nuclear Information System (INIS)
RIECK, C.A.
1999-01-01
This Software Configuration Management Plan (SCMP) provides the instructions for change control of the W-211 Project, Retrieval Control System (RCS) software after initial approval/release but prior to the transfer of custody to the waste tank operations contractor. This plan applies to the W-211 system software developed by the project, consisting of the computer human-machine interface (HMI) and programmable logic controller (PLC) software source and executable code, for production use by the waste tank operations contractor. The plan encompasses that portion of the W-211 RCS software represented on project-specific AUTOCAD drawings that are released as part of the C1 definitive design package (these drawings are identified on the drawing list associated with each C-1 package), and the associated software code. Implementation of the plan is required for formal acceptance testing and production release. The software configuration management plan does not apply to reports and data generated by the software except where specifically identified. Control of information produced by the software once it has been transferred for operation is the responsibility of the receiving organization
Project W320 52-inch diameter equipment container load test: Test report
International Nuclear Information System (INIS)
Bellomy, J.R.
1995-01-01
This test report summarizes testing activities and documents the results of the load tests performed on-site and off-site to structural qualify the 52-inch equipment containers designed and fabricated under Project W-320
Energy Technology Data Exchange (ETDEWEB)
DEFFENBAUGH, M.L.
2000-08-01
The purpose of this document is to revise Document HNF-SD-ENV-EE-003, ''Permitting Plan for the Immobilized Low-Activity Waste Project, which was submitted on September 4, 1997. That plan accounted for the interim storage and disposal of Immobilized-Low Activity Waste at the existing Grout Treatment Facility Vaults (Project W-465) and within a newly constructed facility (Project W-520). Project W-520 was to have contained a combination of concrete vaults and trenches. This document supersedes that plan because of two subsequent items: (1) A disposal authorization that was received on October 25, 1999, in a U. S. Department of Energy-Headquarters, memorandum, ''Disposal Authorization Statement for the Department of Energy Hanford site Low-Level Waste Disposal facilities'' and (2) ''Breakthrough Initiative Immobilized Low-Activity Waste (ILAW) Disposal Alternative,'' August 1999, from Lucas Incorporated, Richland, Washington. The direction within the U. S. Department of Energy-Headquarters memorandum was given as follows: ''The DOE Radioactive Waste Management Order requires that a Disposal authorization statement be obtained prior to construction of new low-level waste disposal facility. Field elements with the existing low-level waste disposal facilities shall obtain a disposal authorization statement in accordance with the schedule in the complex-wide Low-Level Waste Management Program Plan. The disposal authorization statement shall be issued based on a review of the facility's performance assessment and composite analysis or appropriate CERCLA documentation. The disposal authorization shall specify the limits and conditions on construction, design, operations, and closure of the low-level waste facility based on these reviews. A disposal authorization statement is a part of the required radioactive waste management basis for a disposal facility. Failure to obtain a disposal authorization statement
48 CFR 252.217-7010 - Performance.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...
Historical review of californium-252 discovery and development
International Nuclear Information System (INIS)
Stoddard, D.H.
1985-01-01
This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252 Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed
Tritium Facilities Modernization and Consolidation Project Process Waste Assessment (Project S-7726)
International Nuclear Information System (INIS)
Hsu, R.H.; Oji, L.N.
1997-01-01
Under the Tritium Facility Modernization ampersand Consolidation (TFM ampersand C) Project (S-7726) at the Savannah River Site (SS), all tritium processing operations in Building 232-H, with the exception of extraction and obsolete/abandoned systems, will be reestablished in Building 233-H. These operations include hydrogen isotopic separation, loading and unloading of tritium shipping and storage containers, tritium recovery from zeolite beds, and stripping of nitrogen flush gas to remove tritium prior to stack discharge. The scope of the TFM ampersand C Project also provides for a new replacement R ampersand D tritium test manifold in 233-H, upgrading of the 233- H Purge Stripper and 233-H/234-H building HVAC, a new 234-H motor control center equipment building and relocating 232-H Materials Test Facility metallurgical laboratories (met labs), flow tester and life storage program environment chambers to 234-H
Project W-320, 241-C-106 sluicing: Piping calculations. Volume 4
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the FDNW calculations for Project W-320 readily retrievable. The objective of this calculation is to perform the structural analysis of the Pipe Supports designed for Slurry and Supernate transfer pipe lines in order to meet the requirements of applicable ASME codes. The pipe support design loads are obtained from the piping stress calculations W320-27-I-4 and W320-27-I-5. These loads are the total summation of the gravity, pressure, thermal and seismic loads. Since standard typical designs are used for each type of pipe support such as Y-Stop, Guide and Anchors, each type of support is evaluated for the maximum loads to which this type of supports are subjected. These loads are obtained from the AutoPipe analysis and used to check the structural adequacy of these supports
Project W-320, 241-C-106 sluicing: Piping calculations. Volume 4
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-07-24
This supporting document has been prepared to make the FDNW calculations for Project W-320 readily retrievable. The objective of this calculation is to perform the structural analysis of the Pipe Supports designed for Slurry and Supernate transfer pipe lines in order to meet the requirements of applicable ASME codes. The pipe support design loads are obtained from the piping stress calculations W320-27-I-4 and W320-27-I-5. These loads are the total summation of the gravity, pressure, thermal and seismic loads. Since standard typical designs are used for each type of pipe support such as Y-Stop, Guide and Anchors, each type of support is evaluated for the maximum loads to which this type of supports are subjected. These loads are obtained from the AutoPipe analysis and used to check the structural adequacy of these supports.
Tank farm restoration and safe operation, project W-314, upgrade scope summary report (USSR)
International Nuclear Information System (INIS)
Jacobson, R.W.
1997-01-01
This revision to the Project W-314 Upgrade Scope Summary Report (USSR), incorporates changes to the project scope from Alternative Generation Analysis (AGA), customer guidance, and changing requirements. It defines the actual upgrades currently in scope, and provides traceability to the requirements and/or drivers
Facile Oxidative Desulfurisation of Benzothiophene Using Polyoxometalate H4[α-SiW12O40]/Zr Catalyst
Directory of Open Access Journals (Sweden)
Aldes Lesbani
2015-07-01
Full Text Available A highly active catalyst H4[α-SiW12O40]/Zr based polyoxometalete Keggin type was prepared by wet impregnation method and was characterized by FTIR spectroscopy, X-ray diffractometer, surface textural property by SEM, and analysis of porosity by BET method. H4[α-SiW12O40]/Zr was successfully synthesized and showed uniform properties with block solid structure which was applied as heterogeneous stable catalyst for oxidative desulfurization of benzothiophene under simple and mild condition using H2O2 as oxidant. Facile conversion of benzothiophene to sulfone by using heterogeneus H4[α-SiW12O40]/Zr catalyst up to 99% was observed to show the active catalytically. Keggin H4[α-SiW12O40]/Zr cage structure after reaction was different from fresh catalyst which was indicated by the instability of H4[α-SiW12O40]/Zr under reaction condition. © 2015 BCREC UNDIP. All rights reservedReceived: 9th November 2014; Revised: 31st March 2015; Accepted: 23rd April 2015How to Cite: Lesbani, A., Agnes, A., Saragih, R.O., Verawaty, M., Mohadi, R., Zulkifli, H. (2015. Facile Oxidative Desulfurisation of Benzothiophen Using Polyoxometalate H4[α-SiW12O40]/Zr Catalyst. Bulletin of Chemical Reaction Engineering & Catalysis, 10 (2, 185-191. (doi:10.9767/bcrec.10.2.7734.185-191 Permalink/DOI: http://dx.doi.org/10.9767/bcrec.10.2.7734.185-191
48 CFR 252.217-7009 - Default.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...
Facility Effluent Monitoring Plan for the 284-E and 284-W power plants
International Nuclear Information System (INIS)
Herman, D.R.
1991-11-01
A facility effluent monitoring plan is required by the US Department of Energy in DOE Order 5400.1 for any operations that involve hazardous materials and radioactive substances that could impact employee or public safety or the environment. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility Effluent Monitoring Plans, WHC-EP- 0438. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements. This facility effluent monitoring plan is the first annual report. It shall ensure long-range integrity of the effluent monitoring systems by requiring an update whenever a new process or operation introduces new hazardous materials or significant radioactive materials. This document must be reviewed annually even if there are no operational changes, and it must be updated as a minimum every three years. The 284-E and 284-W Power Plants are coal-fired plants used to generate steam. Electricity is not generated at these facilities. The maximum production of steam is approximately 159 t (175 tons)/h at 101 kg (225 lb)/in 2 . Steam generated at these facilities is used in other process facilities (i. e., the B Plant, Plutonium-Uranium Extraction Plant, 242-A Evaporator) for heating and process operations. The functions or processes associated with these facilities do not have the potential to generate radioactive airborne effluents or radioactive liquid effluents, therefore, radiation monitoring equipment is not used on the discharge of these streams. The functions or processes associated with the production of steam result in the use, storage, management and disposal of hazardous materials
Conceptual design report, plutonium stabilization and handling,project W-460
Energy Technology Data Exchange (ETDEWEB)
Weiss, E.V.
1997-03-06
Project W-460, Plutonium Stabilization and Handling, encompasses procurement and installation of a Stabilization and Packaging System (SPS) to oxidize and package for long term storage remaining plutonium-bearing special nuclear materials currently in inventory at the Plutonium Finishing Plant (PFP), and modification of vault equipment to allow storage of resulting packages of stabilized SNM for up to fifty years. This Conceptual Design Report (CDR) provides conceptual design details for the vault modification, site preparation and site interface with the purchased SPS. Two concepts are described for vault configuration; acceleration of this phase of the project did not allow completion of analysis which would clearly identify a preferred approach.
200 Area Liquid Effluent Facilities -- Quality assurance program plan
International Nuclear Information System (INIS)
Fernandez, L.
1995-01-01
This Quality Assurance Program Plan (QAPP) describes the quality assurance and management controls used by the 200 Area Liquid Effluent Facilities (LEF) to perform its activities in accordance with DOE Order 5700.6C. The 200 Area LEF consists of the following facilities: Effluent Treatment Facility (ETF); Treated Effluent Disposal Facility (TEDF); Liquid Effluent Retention facility (LERF); and Truck Loading Facility -- (Project W291). The intent is to ensure that all activities such as collection of effluents, treatment, concentration of secondary wastes, verification, sampling and disposal of treated effluents and solids related with the LEF operations, conform to established requirements
5 MeV 300 kW electron accelerator project
International Nuclear Information System (INIS)
Auslender, V.L.; Cheskidov, V.G.; Gornakov, I.V.
2004-01-01
The paper presents a project of a high power linear accelerator for industrial applications. The accelerator has a modular structure and consists of the chain of accelerating cavities connected by the axis-located coupling cavities with coupling slots in the common walls. Main parameters of the accelerator are: operating frequency of 176 MHz, electron energy of up to 5 MeV, average beam power of 300 kW. The required RF pulse power can be supplied by the TH628 diacrode
48 CFR 252.236-7000 - Modification proposals-price breakdown.
2010-10-01
...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...
International Nuclear Information System (INIS)
BOEHNKE, W.M.
2001-01-01
A plan is currently in place to process the high-level radioactive wastes that resulted from uranium and plutonium recovery operations from Spent Nuclear Fuel at the Hanford Site, Richland, Washington. Currently, millions of gallons of high-level radioactive waste in the form of liquids, sludges, and saltcake are stored in many large underground tanks onsite. This waste will be processed and separated into high-level and low-activity fractions. Both fractions will then be vitrified (i.e., blended with molten borosilicate glass) in order to encapsulate the toxic radionuclides. The immobilized low-activity waste (ILAW) glass will be poured into LAW canisters, allowed to cool and harden to solid form, sealed by welding, and then transported to a double-lined trench in the 200 East Area for permanent disposal. This document presents the packaging design criteria (PDC) for an onsite LAW transportation system, which includes the ILAW canister, ILAW package, and transport vehicle and defines normal and accident conditions. This PDC provides the basis for the ILAW onsite transportation system design and fabrication and establishes the transportation safety criteria that the design will be evaluated against in the Package Specific Safety Document (PSSD). It provides the criteria for the ILAW canister, cask and transport vehicles and defines normal and accident conditions. The LAW transportation system is designed to transport stabilized waste from the vitrification facility to the ILAW disposal facility developed by Project W-520. All ILAW transport will take place within the 200 East Area (all within the Hanford Site)
Argonne-West facility requirements for a radioactive waste treatment demonstration
International Nuclear Information System (INIS)
Dwight, C.C.; Felicione, F.S.; Black, D.B.; Kelso, R.B.; McClellan, G.C.
1995-01-01
At Argonne National Laboratory-West (ANL-W), near Idaho Falls, Idaho, facilities that were originally constructed to support the development of liquid-metal reactor technology are being used and/or modified to meet the environmental and waste management research needs of DOE. One example is the use of an Argonne-West facility to conduct a radioactive waste treatment demonstration through a cooperative project with Science Applications International Corporation (SAIC) and Lockheed Idaho Technologies Company. The Plasma Hearth Process (PBP) project will utilize commercially-adapted plasma arc technology to demonstrate treatment of actual mixed waste. The demonstration on radioactive waste will be conducted at Argonne's Transient Reactor Test Facility (TREAT). Utilization of an existing facility for a new and different application presents a unique set of issues in meeting applicable federal state, and local requirements as well as the additional constraints imposed by DOE Orders and ANL-W site requirements. This paper briefly describes the PHP radioactive demonstrations relevant to the interfaces with the TREAT facility. Safety, environmental design, and operational considerations pertinent to the PHP radioactive demonstration are specifically addressed herein. The personnel equipment, and facility interfaces associated with a radioactive waste treatment demonstration are an important aspect of the demonstration effort. Areas requiring significant effort in preparation for the PBP Project being conducted at the TREAT facility include confinement design, waste handling features, and sampling and analysis considerations. Information about the facility in which a radioactive demonstration will be conducted, specifically Argonne's TREAT facility in the case of PHP, may be of interest to other organizations involved in developing and demonstrating technologies for mixed waste treatment
IAEA Nuclear Security Assessment Methodologies (NUSAM) Project for Regulated Facilities
International Nuclear Information System (INIS)
Jang, Sung Soon
2016-01-01
Nuclear Security Assessment Methodologies (NUSAM) is a coordinate research project. The objectives of the NUSAM project is to establish a risk informed, performance-based methodological framework in a systematic, structured, comprehensive and appropriately transparent manner; to provide an environment for the sharing and transfer of knowledge and experience; and to provide guidance on, and practical examples of good practices in assessing the security of nuclear and other radioactive materials, as well as associated facilities and activities. The author worked as an IAEA scientific secretary of the NUAM project from 2013 to 2015. IAEA launched this project in 2013 and performed many activities: meetings, document development, table-top exercises and computer simulations. Now the project is in the final stage and will be concluded in the late 2016. The project will produce documents on NUSAM assessment methods and case study documents on NPP, Irradiator Facility and Transport. South Korea as a main contributor to this project will get benefits from the NUSAM. In 2014, South Korea introduced force-on-force exercises, which could be used as the assessment of physical protection system by the methods of NUSAM
IAEA Nuclear Security Assessment Methodologies (NUSAM) Project for Regulated Facilities
Energy Technology Data Exchange (ETDEWEB)
Jang, Sung Soon [Korea Nuclear Non-proliferation and Control, Daejeon (Korea, Republic of)
2016-05-15
Nuclear Security Assessment Methodologies (NUSAM) is a coordinate research project. The objectives of the NUSAM project is to establish a risk informed, performance-based methodological framework in a systematic, structured, comprehensive and appropriately transparent manner; to provide an environment for the sharing and transfer of knowledge and experience; and to provide guidance on, and practical examples of good practices in assessing the security of nuclear and other radioactive materials, as well as associated facilities and activities. The author worked as an IAEA scientific secretary of the NUAM project from 2013 to 2015. IAEA launched this project in 2013 and performed many activities: meetings, document development, table-top exercises and computer simulations. Now the project is in the final stage and will be concluded in the late 2016. The project will produce documents on NUSAM assessment methods and case study documents on NPP, Irradiator Facility and Transport. South Korea as a main contributor to this project will get benefits from the NUSAM. In 2014, South Korea introduced force-on-force exercises, which could be used as the assessment of physical protection system by the methods of NUSAM.
48 CFR 252.217-7002 - Offering property for exchange.
2010-10-01
... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...
Project W-320, 241-C-106 sluicing HVAC calculations, Volume 4
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-07-30
This supporting document has been prepared to make the FDNW calculations for Project W-320, readily retrievable. The report contains the following design calculations: Cooling load in pump pit 241-AY-102; Pressure relief seal loop design; Process building piping stress analysis; Exhaust skid maximum allowable leakage criteria; and Recirculation heat, N509 duct requirements.
International Nuclear Information System (INIS)
Braun, D.R.
1992-11-01
The ANL-W 779 sanitary wastewater treatment ponds are located on the Idaho National Engineering Laboratory (INEL), north of the Argonne National Laboratory -- West (ANL-W) site A seepage test was performed for two Argonne National Laboratory -- West (ANL-W) sanitary wastewater treatment ponds, Facility 779. Seepage rates were measured to determine if the ponds are a wastewater land application facility. The common industry standard for wastewater land application facilities is a field-measured seepage rate of one quarter inch per day or greater
Project W-320, operational test procedure OTP-320-003 test report
International Nuclear Information System (INIS)
Bevins, R.R.
1998-01-01
This report documents and summarizes the results of OTP-320-003 Project W-320 Operational Testing of the WRSS Supernate Transfer System. Project W-320 Operational Test OTP-320-003 was performed to verify components of the Waste Retrieval Sluicing System (WRSS) supernate transfer system functioned as designed following construction completion and turnover to operations. All equipment operation was performed by Tank Farms Operations personnel following the operational test procedure and referenced operating procedures. Supernate Transfer line Flushing System Testing was completed over the course of approximately 4 weeks as tank farm conditions and configuration, equipment availability, and operations resources allowed. All testing was performed with the 702-AZ ventilation system and the 296-P-16 ventilation systems in operation. Test procedure OTP-320-003 required two revisions during testing to incorporate Procedure Changes Authorizations (PCAs) necessary to facilitate testing. Various sections of testing are documented on each procedure revision. The completed test procedure is included as Attachment A. Exception Reports generated during the course of testing are included as Attachment B
Quality Assurance Project Plan for Facility Effluent Monitoring Plan activities
International Nuclear Information System (INIS)
Frazier, T.P.
1994-01-01
This Quality Assurance Project Plan addresses the quality assurance requirements for the activities associated with the Facility Effluent Monitoring Plans, which are part of the overall Hanford Site Environmental Protection Plan. This plan specifically applies to the sampling and analysis activities and continuous monitoring performed for all Facility Effluent Monitoring Plan activities conducted by Westinghouse Hanford Company. It is generic in approach and will be implemented in conjunction with the specific requirements of the individual Facility Effluent Monitoring Plans
5W intracavity frequency-doubled green laser for laser projection
Yan, Boxia; Bi, Yong; Li, Shu; Wang, Dongdong; Wang, Dongzhou; Qi, Yan; Fang, Tao
2014-11-01
High power green laser has many applications such as high brightness laser projection and large screen laser theater. A compact and high power green-light source has been developed in diode-pumped solid-state laser based on MgO doped periodically poled LiNbO3 (MgO:PPLN). 5W fiber coupled green laser is achieved by dual path Nd:YVO4/MgO:PPLN intra-cacity frequency-doubled. Single green laser maximum power 2.8W at 532nm is obtained by a 5.5W LD pumped, MgO:PPLN dimensions is 5mm(width)×1mm(thickness)×2mm(length), and the optical to optical conversion efficiency is 51%. The second LD series connected with the one LD, the second path green laser is obtained using the same method. Then the second path light overlap with the first path by the reflection mirrors, then couple into the fiber with a focus mirror. Dual of LD, Nd:YVO4, MgO:PPLN are placed on the same heat sink using a TEC cooling, the operating temperature bandwidth is about 12°C and the stablity is 5% in 96h. A 50×50×17mm3 laser module which generated continuous-wave 5 W green light with high efficiency and width temperature range is demonstrated.
Isotopes facilities deactivation project at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
Eversole, R.E.
1997-01-01
The production and distribution of radioisotopes for medical, scientific, and industrial applications has been a major activity at Oak Ridge National Laboratory (ORNL) since the late 1940s. As the demand for many of these isotopes grew and their sale became profitable, the technology for the production of the isotopes was transferred to private industry, and thus, many of the production facilities at ORNL became underutilized. In 1989, the U.S. Department of Energy (DOE) instructed ORNL to identify and prepare various isotopes production facilities for safe shutdown. In response, ORNL identified 19 candidate facilities for shutdown and established the Isotopes Facilities Shutdown Program. In 1993, responsibility for the program was transitioned from the DOE Office of Nuclear Energy to the DOE Office of Environmental Management and Uranium Enrichment Operation's Office of Facility Transition and Management. The program was retitled the Isotopes Facilities Deactivation Project (IFDP), and implementation responsibility was transferred from ORNL to the Lockheed Martin Energy Systems, Inc. (LMES), Environmental Restoration (ER) Program
Isotopes facilities deactivation project at Oak Ridge National Laboratory
Energy Technology Data Exchange (ETDEWEB)
Eversole, R.E.
1997-05-01
The production and distribution of radioisotopes for medical, scientific, and industrial applications has been a major activity at Oak Ridge National Laboratory (ORNL) since the late 1940s. As the demand for many of these isotopes grew and their sale became profitable, the technology for the production of the isotopes was transferred to private industry, and thus, many of the production facilities at ORNL became underutilized. In 1989, the U.S. Department of Energy (DOE) instructed ORNL to identify and prepare various isotopes production facilities for safe shutdown. In response, ORNL identified 19 candidate facilities for shutdown and established the Isotopes Facilities Shutdown Program. In 1993, responsibility for the program was transitioned from the DOE Office of Nuclear Energy to the DOE Office of Environmental Management and Uranium Enrichment Operation`s Office of Facility Transition and Management. The program was retitled the Isotopes Facilities Deactivation Project (IFDP), and implementation responsibility was transferred from ORNL to the Lockheed Martin Energy Systems, Inc. (LMES), Environmental Restoration (ER) Program.
Project W-314 specific test and evaluation plan for 241-AN-A valve pit
International Nuclear Information System (INIS)
Hays, W.H.
1997-01-01
The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made to the 241-AN-A Valve Pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a ''lower tier'' document based on the W-314 Test and Evaluation Plan (TEP) This STEP encompasses all testing activities required to demonstrate compliance to the project design criteria as it relates to the modifications of the AN-A valve pit. The Project Design Specifications (PDS) identify the specific testing activities required for the Project. Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the modifications to the 241-AN-A Valve Pit. The STEP will be utilized in conjunction with the TEP for verification and validation
Mixed and Low-Level Waste Treatment Facility project
International Nuclear Information System (INIS)
1992-04-01
Mixed and low-level wastes generated at the Idaho National Engineering Laboratory (INEL) are required to be managed according to applicable State and Federal regulations, and Department of Energy Orders that provide for the protection of human health and the environment. The Mixed and Low-Level Waste Treatment Facility Project was chartered in 1991, by the Department of Energy to provide treatment capability for these mixed and low-level waste streams. The first project task consisted of conducting engineering studies to identify the waste streams, their potential treatment strategies, and the requirements that would be imposed on the waste streams and the facilities used to process them. The engineering studies, initiated in July 1991, identified 37 mixed waste streams, and 55 low-level waste streams. This report documents the waste stream information and potential treatment strategies, as well as the regulatory requirements for the Department of Energy-owned treatment facility option. The total report comprises three volumes and two appendices. This report consists of Volume 1, which explains the overall program mission, the guiding assumptions for the engineering studies, and summarizes the waste stream and regulatory information, and Volume 2, the Waste Stream Technical Summary which, encompasses the studies conducted to identify the INEL's waste streams and their potential treatment strategies
46 CFR 252.31 - Wages of officers and crews.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...
Teratogenic effect of Californium-252 irradiation in rats
International Nuclear Information System (INIS)
Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro
1989-01-01
The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)
International Nuclear Information System (INIS)
1995-08-01
The purpose of the Isotopes Facilities Deactivation Project (IFDP) is to place former isotopes production facilities at the Oak Ridge National Laboratory in a safe, stable, and environmentally sound condition; suitable for an extended period of minimum surveillance and maintenance (S and M) and as quickly and economical as possible. Implementation and completion of the deactivation project will further reduce the risks to the environment and to public safety and health. Furthermore, completion of the project will result in significant S and M cost savings in future years. The IFDP work plan defines the project schedule, the cost estimate, and the technical approach for the project. A companion document, the EFDP management plan, has been prepared to document the project objectives, define organizational relationships and responsibilities, and outline the management control systems to be employed in the management of the project. The project has adopted the strategy of deactivating the simple facilities first, to reduce the scope of the project and to gain experience before addressing more difficult facilities. A decision support system is being developed to identify the activities that best promote the project mission and result in the largest cost savings. This work plan will be reviewed and revised annually. Deactivation of EFDP Facilities was initiated in FY 1994 and will be completed in FY 2000. The schedule for deactivation of facilities is shown. The total cost of the project is estimated to be $51M. The costs are summarized. Upon completion of deactivation, annual S and M costs of these facilities will be reduced from the current level of $5M per year to less than $1M per year
48 CFR 252.237-7011 - Preparation history.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...
48 CFR 252.217-7016 - Plant protection.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...
48 CFR 252.227-7000 - Non-estoppel.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...
Systems Engineering Management Plan for Tank Farm Restoration and Safety Operations, Project W-314
International Nuclear Information System (INIS)
MCGREW, D.L.
2000-01-01
The Systems Engineering Management Plan for Project W-314 has been prepared within the guidelines of HNF-SD-WM-SEMP-002, TWRS Systems Engineering Management Plan. The activities within this SEMP have been tailored, in accordance with the TWRS SEMP and DOE Order 430.1, Life Cycle Asset Management, to meet the needs of the project
International Nuclear Information System (INIS)
Sharma, S.
1986-01-01
A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields
Development of moderated neutron calibration fields simulating workplaces of MOX fuel facilities
International Nuclear Information System (INIS)
Tsujimura, Norio; Yoshida, Tadayoshi; Takada, Chie
2005-01-01
It is important for the MOX fuel facilities to control neutrons produced by the spontaneous fission of plutonium isotopes and those from (α,n) reactions between 18 O and α particles emitted by 238 Pu. Neutron dose meters should be calibrated for measuring these neutrons. We have developed moderated-neutron calibration fields employing a 252 Cf neutron source and moderators mainly for the characteristics evaluation and the calibration of neutron detectors used in MOX fuel facilities. Neutron energy spectrum can be adjusted by changing the position of the 252 Cf neutron source and combining different moderators to simulate the neutron field of the MOX fuel facility. This performance is realized owing to using an existing neutron irradiation room. (K. Yoshida)
Environmental permits and approvals plan for high-level waste interim storage, Project W-464
International Nuclear Information System (INIS)
Deffenbaugh, M.L.
1998-01-01
This report discusses the Permitting Plan regarding NEPA, SEPA, RCRA, and other regulatory standards and alternatives, for planning the environmental permitting of the Canister Storage Building, Project W-464
International Nuclear Information System (INIS)
Muhammad Fakhrurreza; Kusminanto; Y Sardjono
2014-01-01
In this research has made a reflector design to provide beams of Neutron for BNCT with Californium-252 radioactive source. This collimator is useful to obtain optimum epithermal neutron flux with the smallest impurity radiation (thermal neutron, fast neutron, and gamma). The design process is done using Monte Carlo N-Particle simulation version 5 (MCNP5) code to calculate the neutron flux tally form. The chosen reflector design is the reflectors which use material such as BeO ceramic with 13 cm thick. Moderator use sulfur material with the slope angle of the cone is 30°. From the calculation result, it is obtained that Reflector with 1 gram Californium-252 source can produce a neutron output thermal which has thermal neutron specification 2.23189 x 10 9 n/s.cm 2 , epithermal neutron 3.51548 x 10 9 n/s.cm 2 , and fast neutron 4.82241 x 10 9 n/s.cm 2 From the result, it needs additional collimator because the BNCT requirement. (author)
48 CFR 252.217-7001 - Surge option.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...
48 CFR 252.225-7025 - Restriction on acquisition of forgings.
2010-10-01
... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...
48 CFR 252.225-7031 - Secondary Arab boycott of Israel.
2010-10-01
... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...
48 CFR 252.235-7011 - Final scientific or technical report.
2010-10-01
... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...
Californium-252 interstitial implants in carcinoma of the tongue
International Nuclear Information System (INIS)
Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.
1985-01-01
A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy
Application of demography to energy facility development projects. Working Paper No. 39
International Nuclear Information System (INIS)
Krannich, R.S.; Stanfield, G.G.
1977-01-01
The emergence of concern regarding socioeconomic consequences of large-scale development projects has resulted in a growing literature directed as estimating the types and levels of various impact dimensions which can be expected to result in human communities experiencing such development. Among these dimensions, a focus on population change has been prevalent. Accurate demographic predictions may be viewed as critical for the adequate comprehension of and preparation for impacts deriving from projects such as energy facility developments. Unfortunately, the state of the art in projecting demographic consequences of energy projects has been generally inadequate. Several of the more influential prior methods for estimating local demographic effects of developing energy facilities are critiqued, although their specific prediction figures are not summarized. The studies reviewed were found to be of dubious practical utility, probably due in part to the failure of basic demography to provide a base of support for applied demographic research. This report sets forth recommendations for the development of a theoretical perspective which would more adequately serve the needs of practitioners attempting to predict local demographic effects of energy facility development
The Sanford underground research facility at Homestake
International Nuclear Information System (INIS)
Heise, J.
2014-01-01
The former Homestake gold mine in Lead, South Dakota is being transformed into a dedicated laboratory to pursue underground research in rare-process physics, as well as offering research opportunities in other disciplines such as biology, geology and engineering. A key component of the Sanford Underground Research Facility (SURF) is the Davis Campus, which is in operation at the 4850-foot level (4300 m.w.e) and currently hosts three projects: the LUX dark matter experiment, the MAJORANA DEMONSTRATOR neutrinoless double-beta decay experiment and the CUBED low-background counter. Plans for possible future experiments at SURF are well underway and include long baseline neutrino oscillation experiments, future dark matter experiments as well as nuclear astrophysics accelerators. Facility upgrades to accommodate some of these future projects have already started. SURF is a dedicated facility with significant expansion capability
48 CFR 252.235-7002 - Animal welfare.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...
48 CFR 252.229-7001 - Tax relief.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...
Test and evaluation results of the 252Cf shuffler at the Savannah River Plant
International Nuclear Information System (INIS)
Crane, T.W.
1981-03-01
The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant
Project W-320 thermal hydraulic model benchmarking and baselining
International Nuclear Information System (INIS)
Sathyanarayana, K.
1998-01-01
Project W-320 will be retrieving waste from Tank 241-C-106 and transferring the waste to Tank 241-AY-102. Waste in both tanks must be maintained below applicable thermal limits during and following the waste transfer. Thermal hydraulic process control models will be used for process control of the thermal limits. This report documents the process control models and presents a benchmarking of the models with data from Tanks 241-C-106 and 241-AY-102. Revision 1 of this report will provide a baselining of the models in preparation for the initiation of sluicing
Project W-314 specific test and evaluation plan for AZ tank farm upgrades
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-631 transfer line from the AZ-O1A pit to the AZ-02A pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation P1 an (TEP). Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities, etc), Factory Tests and Inspections (FTIs), installation tests and inspections, Construction Tests and Inspections (CTIs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). The STEP will be utilized in conjunction with the TEP for verification and validation
FAIR - Facility, Research Program and Status of the Project
International Nuclear Information System (INIS)
Majka, Z.
2011-01-01
The international Facility for Antiproton and Ion Research (FAIR) in Europe will provide a worldwide science community with a unique and technically innovative accelerator system to perform forefront research in the sciences concerned with the basic structure of matter, and in intersections with other fields. The facility will deliver an extensive range of primary and secondary particle beams from protons and their antimatter partners, antiprotons, to ion beams of all chemical elements up to the heaviest, uranium, with in many respects unique properties and intensities. The paper will include overview of the new facility design and research programs to be carried out there. The current status of the FAIR project will be also presented. (author)
Improvements of present radioactive beam facilities and new projects
International Nuclear Information System (INIS)
Mueller, A.C.
1995-01-01
A short overview is given over scheduled improvements of present radioactive beam facilities and of new projects. In order to put these into a coherent context the paper starts with a general section about the making of radioactive beams. (author)
Solid Waste Operations Complex W-113, Detail Design Report (Title II). Volume 3: Specifications
International Nuclear Information System (INIS)
1995-09-01
The Solid Waste Retrieval Facility--Phase 1 (Project W113) will provide the infrastructure and the facility required to retrieve from Trench 04, Burial ground 4C, contact handled (CH) drums and boxes at a rate that supports all retrieved TRU waste batching, treatment, storage, and disposal plans. This includes (1) operations related equipment and facilities, viz., a weather enclosure for the trench, retrieval equipment, weighing, venting, obtaining gas samples, overpacking, NDE, NDA, shipment of waste and (2) operations support related facilities, viz., a general office building, a retrieval staff change facility, and infrastructure upgrades such as supply and routing of water, sewer, electrical power, fire protection, roads, and telecommunication. Title I design for the operations related equipment and facilities was performed by Raytheon/BNFL, and that for the operations support related facilities including infrastructure upgrade was performed by KEH. These two scopes were combined into an integrated W113 Title II scope that was performed by Raytheon/BNFL. Volume 3 is a compilation of the construction specifications that will constitute the Title II materials and performance specifications. This volume contains CSI specifications for non-equipment related construction material type items, performance type items, and facility mechanical equipment items. Data sheets are provided, as necessary, which specify the equipment overall design parameters
Solid Waste Operations Complex W-113, Detail Design Report (Title II). Volume 3: Specifications
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-09-01
The Solid Waste Retrieval Facility--Phase 1 (Project W113) will provide the infrastructure and the facility required to retrieve from Trench 04, Burial ground 4C, contact handled (CH) drums and boxes at a rate that supports all retrieved TRU waste batching, treatment, storage, and disposal plans. This includes (1) operations related equipment and facilities, viz., a weather enclosure for the trench, retrieval equipment, weighing, venting, obtaining gas samples, overpacking, NDE, NDA, shipment of waste and (2) operations support related facilities, viz., a general office building, a retrieval staff change facility, and infrastructure upgrades such as supply and routing of water, sewer, electrical power, fire protection, roads, and telecommunication. Title I design for the operations related equipment and facilities was performed by Raytheon/BNFL, and that for the operations support related facilities including infrastructure upgrade was performed by KEH. These two scopes were combined into an integrated W113 Title II scope that was performed by Raytheon/BNFL. Volume 3 is a compilation of the construction specifications that will constitute the Title II materials and performance specifications. This volume contains CSI specifications for non-equipment related construction material type items, performance type items, and facility mechanical equipment items. Data sheets are provided, as necessary, which specify the equipment overall design parameters.
International Nuclear Information System (INIS)
Boes, K.A.
1998-01-01
This Design Review Report (DRR) documents the contractor design verification methodology and records associated with project W-314's AN Valve Pit Upgrades design package. The DRR includes the documented comments and their respective dispositions for this design. Acceptance of the comment dispositions and closure of the review comments is indicated by the signatures of the participating reviewers. Project W-314, Tank Farm Restoration and Safe Operations, is a project within the Tank Waste Remediation System (TWRS) Tank Waste Retrieval Program. This project provides capital upgrades for the existing Hanford tank farms' waste transfer, instrumentation, ventilation, and electrical infrastructure systems. To support established TWRS programmatic objectives, the project is organized into two distinct phases. The initial focus of the project (i.e., Phase 1) is on waste transfer system upgrades needed to support the TWRS Privatization waste feed delivery system. Phase 2 of the project will provide upgrades to support resolution of regulatory compliance issues, improve tank infrastructure reliability, and reduce overall plant operating/maintenance costs. Within Phase 1 of the W-314 project, the waste transfer system upgrades are further broken down into six major packages which align with the project's work breakdown structure. Each of these six sub-elements includes the design, procurement, and construction activities necessary to accomplish the specific tank farm upgrades contained within the package. The first package to be performed is the AN Valve Pit Upgrades package. The scope of the modifications includes new pit cover blocks, valve manifolds, leak detectors, transfer line connections (for future planned transfer lines), and special protective coating for the 241-AN-A and 241-AN-B valve pits
A new cryogenic test facility for large superconducting devices at CERN
Perin, A; Serio, L; Stewart, L; Benda, V; Bremer, J; Pirotte, O
2015-01-01
To expand CERN testing capability to superconducting devices that cannot be installed in existing test facilities because of their size and/or mass, CERN is building a new cryogenic test facility for large and heavy devices. The first devices to be tested in the facility will be the S-FRS superconducting magnets for the FAIR project that is currently under construction at the GSI Research Center in Darmstadt, Germany. The facility will include a renovated cold box with 1.2 kW at 4.5 K equivalent power with its compression system, two independent 15 kW liquid nitrogen precooling and warm-up units, as well as a dedicated cryogenic distribution system providing cooling power to three independent test benches. The article presents the main input parameters and constraints used to define the cryogenic system and its infrastructure. The chosen layout and configuration of the facility is presented and the characteristics of the main components are described.
Spent Nuclear Fuel Project Cold Vacuum Drying Facility Operations Manual
International Nuclear Information System (INIS)
IRWIN, J.J.
1999-01-01
This document provides the Operations Manual for the Cold Vacuum Drying Facility (CVDF). The Manual was developed in conjunction with HNF-553, Spent Nuclear Fuel Project Final Safety Analysis Report Annex B--Cold Vacuum Drying Facility. The HNF-SD-SNF-DRD-002, 1999, (Cold Vacuum Drying Facility Design Requirements), Rev. 4. and the CVDF Final Design Report. The Operations Manual contains general descriptions of all the process, safety and facility systems in the CVDF, a general CVD operations sequence and references to the CVDF System Design Descriptions (SDDs). This manual has been developed for the SNFP Operations Organization and shall be updated, expanded, and revised in accordance with future design, construction and startup phases of the CVDF until the CVDF final ORR is approved
International Nuclear Information System (INIS)
Skillern, C.G.
1986-05-01
In 1980, Congress passed Public Law 96-368, the West Valley Demonstration Project (WVDP) Act. As a primary objective, the Act authorized the US Department of Energy (DOE) to solidify the high-level waste (HLW) stored at the Western New York Nuclear Service Center (WNYNSC) into a form suitable for transportation and disposal in a federal repository. This report will describe how WVDP proposes to use the existing WNYNSC Facilities in an efficient and technically effective manner to comply with Public Law 96-368. In support of the above cited law, the DOE has entered into a ''Cooperative agreement between the United States Department of Energy and the New York State Energy Research and Development Authority on the Western New York Nuclear Service Center at West Valley, New York.'' The state-owned areas turned over to the DOE for use are as follows: Process Plant, Waste Storage, Low-Level Waste Treatment Facility, Service Facilities, Plant Security, and Additional Facilities. The Facilities Utilization Plan (FUP) describes how the state-owned facilities will be utilized to complete the Project; it is divided into five sections as follows: Executive Summary - an overview; Introduction - the WVDP approach to utilizing the WNYNSC Facilities; WVDP Systems - a brief functional description of the system, list of equipment and components to be used and decontamination and decommissioning (D and D) support; WVDP Support Facilities; and Caveats that could effect or change the potential usage of a particular area
Quality assurance program plan for cesium legacy project
International Nuclear Information System (INIS)
Tanke, J.M.
1997-01-01
This Quality Assurance Program Plan (QAPP) provides information on how the Quality Assurance Program is implemented for the Cesium Legacy Project. It applies to those items and tasks which affect the completion of activities identified in the work breakdown structure of the Project Management Plan (PMP). These activities include all aspects of cask transportation, project related operations within the 324 Building, and waste management as it relates to the specific activities of this project. General facility activities (i.e. 324 Building Operations, Central Waste Complex Operations, etc.) are covered in other appropriate QAPPs. The 324 Building is currently transitioning from being a Pacific Northwest National Laboratory (PNNL) managed facility to a B and W Hanford Company (BWHC) managed facility. During this transition process existing PNNL procedures and documents will be utilized until replaced by BWHC procedures and documents
Facility effluent monitoring plan for the 2724-W Protective Equipment Decontamination Facility
International Nuclear Information System (INIS)
Nickels, J.M.; Lavey, G.H.
1992-12-01
A facility effluent monitoring plan is required by the US Department of Energy in DOE Order 5400.1* for any operations that involve hazardous materials and radioactive substances that could impact employee or public safety or the environment. A facility effluent monitoring plan determination was performed during Calendar Year 1991 and the evaluation requires the need for a facility effluent monitoring plan. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility Effluent Monitoring Plans, WHC-EP-0438**. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements
International Nuclear Information System (INIS)
Groth, B.D.
1995-01-01
The Multi-Function Waste Tank Facility (MWTF) consists of four, nominal 1 million gallon, underground double-shell tanks, located in the 200-East area, and two tanks of the same capacity in the 200-West area. MWTF will provide environmentally safe storage capacity for wastes generated during remediation/retrieval activities of existing waste storage tanks. This document delineates in detail the information to be used for effective implementation of the Functional Design Criteria requirements
Survey of potential markets for devices using Californium-252
International Nuclear Information System (INIS)
Permar, P.H.
1975-01-01
Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US
Identification of new neutron-rich rare-earth nuclei produced in /sup 252/Cf spontaneous fission
Greenwood, R C; Gehrke, R J; Meikrantz, D H
1981-01-01
A program of systematic study of the decay properties of neutron-rich rare-earth nuclei with 30 s
International Nuclear Information System (INIS)
Nelson, Jerel; Castillo, Carlos; Huntsman, Julie; Lucek, Heather; Marks, Tim
2012-01-01
Document available in abstract form only. Full text of publication follows: Faced with the DOE Complex Transformation, NNSA was tasked with developing an integrated plan for the decommissioning of over 400 facilities and 300 environmental remediation units, as well as the many reconfiguration and modernization projects at the Oak Ridge National Laboratory (ORNL) and Y-12 Complex. Manual scheduling of remediation activities is time-consuming, labor intensive, and inherently introduces bias and unaccounted for aspects of the scheduler or organization in the process. Clearly a tool was needed to develop an objective, unbiased baseline optimized project sequence and schedule with a sound technical foundation for the Integrated Facility Disposition Project (IFDP). In generating an integrated disposition schedule, each project (including facilities, environmental sites, and remedial action units) was identified, characterized, then ranked relative to other projects. Risk matrices allowed for core project data to be extrapolated into probable contamination levels, relative risks to the public, and other technical and risk parameters to be used in the development of an overall ranking. These matrices ultimately generated a complete data set that were used in the Ranking and Sequencing Model (RSM), commonly referred to as the SUPER model, for its numerous abilities to support D and D planning, prioritization, and sequencing
National Ignition Facility Project Site Safety Program
International Nuclear Information System (INIS)
Dun, C
2003-01-01
This Safety Program for the National Ignition Facility (NIF) presents safety protocols and requirements that management and workers shall follow to assure a safe and healthful work environment during activities performed on the NIF Project site. The NIF Project Site Safety Program (NPSSP) requires that activities at the NIF Project site be performed in accordance with the ''LLNL ES and H Manual'' and the augmented set of controls and processes described in this NIF Project Site Safety Program. Specifically, this document: (1) Defines the fundamental NIF site safety philosophy. (2) Defines the areas covered by this safety program (see Appendix B). (3) Identifies management roles and responsibilities. (4) Defines core safety management processes. (5) Identifies NIF site-specific safety requirements. This NPSSP sets forth the responsibilities, requirements, rules, policies, and regulations for workers involved in work activities performed on the NIF Project site. Workers are required to implement measures to create a universal awareness that promotes safe practice at the work site and will achieve NIF management objectives in preventing accidents and illnesses. ES and H requirements are consistent with the ''LLNL ES and H Manual''. This NPSSP and implementing procedures (e.g., Management Walkabout, special work procedures, etc.,) are a comprehensive safety program that applies to NIF workers on the NIF Project site. The NIF Project site includes the B581/B681 site and support areas shown in Appendix B
Design review report: 200 East upgrades for Project W-314, tank farm restoration and safe operations
International Nuclear Information System (INIS)
Boes, K.A.
1998-01-01
This Design Review Report (DRR) documents the contractor design verification methodology and records associated with project W-314's 200 East (200E) Upgrades design package. The DRR includes the documented comments and their respective dispositions for this design. Acceptance of the comment dispositions and closure of the review comments is indicated by the signatures of the participating reviewers. Project W-314 is a project within the Tank Waste Remediation System (TWRS) Tank Waste Retrieval Program. This project provides capital upgrades for the existing Hanford tank farm waste transfer, instrumentation, ventilation, and electrical infrastructure systems. To support established TWRS programmatic objectives, the project is organized into two distinct phases. The initial focus of the project (i.e., Phase 1) is on waste transfer system upgrades needed to support the TWRS Privatization waste feed delivery system. Phase 2 of the project will provide upgrades to support resolution of regulatory compliance issues, improve tank infrastructure reliability, and reduce overall plant operating/maintenance costs. Within Phase 1 of the W-314 project, the waste transfer system upgrades are further broken down into six major packages which align with the project's work breakdown structure. Each of these six sub-elements includes the design, procurement, and construction activities necessary to accomplish the specific tank farm upgrades contained within the package. The first design package (AN Valve Pit Upgrades) was completed in November 1997, and the associated design verification activities are documented in HNF-1893. The second design package, 200 East (200E) Upgrades, was completed in March 1998. This design package identifies modifications to existing valve pits 241-AX-B and 241-A-B, as well as several new waste transfer pipelines to be constructed within the A Farm Complex of the 200E Area. The scope of the valve pit modifications includes new pit cover blocks, valve
The SARAF Project - Soreq Applied Research Accelerator Facility
International Nuclear Information System (INIS)
Nagler, A.; Mardor, I.; Berkovits, D.; Piel, C.
2004-01-01
The relevance of particle accelerators to society, in the use of their primary and secondary beams for the analysis of physical, chemical and biological samples and for modification of properties of materials, is well recognized and documented. Nevertheless, apart of the construction of small accelerators for nuclear research in the 1960's and 70's, Israel has so far neglected this important and growing field. Furthermore, there is an urgent need in Israel for a state of the art research facility to attract and introduce students to current advanced physics techniques and technologies and to train the next generation of experimental scientists in various branches and disciplines. Therefore, Soreq NRC recently initiated the establishment of a new accelerator facility, named SARAF Soreq Applied Research Accelerator Facility. SARAF will be a continuous wave (CW), proton and deuteron RF superconducting linear accelerator with variable energy (5 - 40 MeV) and current (0.04 -2 mA). SARAF is designed to enable hands-on maintenance, which means that its beam loss will be below 10 -5 for the entire accelerator. These specifications will place SARAF in line with the next generation of accelerators world wide. Soreq expects that this fact will attract the Israeli and international research communities to use this facility extensively. Soreq NRC intends to use SARAF for basic, medical and biological research, and non-destructive testing (NDT). Another major activity will be the research and development of radio-isotopes production techniques. Given the availability of high current (up to 2 mA) protons and deuterons, a major activity will be research and development of high power density (up to 80 kW on a few cm 2 ) irradiation targets
The Implications of the Excited Rotation of Comet 252P/2000 G1 (LINEAR)
Li, Jian-Yang; Samarasinha, Nalin H.; Kelley, Michael S. P.; Farnocchia, Davide; Mutchler, Max J.; Ren, Yanqiong; Lu, Xiaoping; Tholen, David J.; Lister, Tim; Micheli, Marco
2018-01-01
Jupiter Family comet (JFC) 252P/LINEAR had a close encounter to Earth on 2016 March 21. We imaged the comet with the Hubble Space Telescope Wide Field Camera 3 UVIS channel through the V- and r’-band filters spanning ~8 hours on 2016 April 4. The pixel scale of 2.7 km/pixel allowed us to study the structure of the cometary coma at scales of a few kilometers to a few hundred kilometers from the nucleus, a characteristic that is unique to our data. The dust coma of 252P showed a strong, well defined, narrow and nearly linear feature in the sunward direction, and its projected position angle moved about the nucleus for ~60 deg in 8 hours, consistent with an apparent periodicity of ~7.24 hours. On the other hand, the lightcurve measured in both V- and r’-band images from a 13 km radius aperture, after corrected for color term, showed a variability of >0.14 mag that is consistent with an apparent periodicity of ~5.4 hours or its multiples. We suggest that the two different periodicities derived from coma morphology and the lightcurve is a strong indication that the nucleus of 252P is in a non-principal axis (NPA) rotation, joining two other confirmed NPA rotators (1P/Halley and 103P/Hartley 2) and comets that are potentially in NPA rotational states (e.g., 2P/Encke). However, this apparition has been unusual for 252P. In the past three perihelion passages since discovery, the comet was very weakly active compared to other JFCs. Meteor evidence also exists that it probably has been very weakly active for a few hundred years. But in our data, we saw a very active comet in this 2016 apparition with an active fraction of 40% to >100%, representing an increase of 100x with respect to its recent past. Based on our observations, 252P has a small nucleus with a radius of ~0.3 km, which suggests that its rotational state could be relatively easily changed by torques caused by outgassing. Since the very weak outgassing in the past is not likely to change the rotational state
48 CFR 252.222-7002 - Compliance with local labor laws (overseas).
2010-10-01
... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...
24 CFR 252.6 - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...
24 CFR 236.252 - First, second, and third mortgage insurance premiums.
2010-04-01
... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...
Application of californium-252 neutron sources for analytical chemistry
International Nuclear Information System (INIS)
Ishii, Daido
1976-01-01
The researches made for the application of Cf-252 neutron sources to analytical chemistry during the period from 1970 to 1974 including partly 1975 are reviewed. The first part is the introduction to the above. The second part deals with general review of symposia, publications and the like. Attention is directed to ERDA publishing the periodical ''Californium-252 Progress'' and to a study group of Cf-252 utilization held by Japanese Radioisotope Association in 1974. The third part deals with its application for radio activation analysis. The automated absolute activation analysis (AAAA) of Savannha River is briefly explained. The joint experiment of Savannha River operation office with New Brunswick laboratory is mentioned. Cf-252 radiation source was used for the non-destructive analysis of elements in river water. East neutrons of Cf-252 were used for the quantitative analysis of lead in paints. Many applications for industrial control processes have been reported. Attention is drawn to the application of Cf-252 neutron sources for the field search of neutral resources. For example, a logging sonde for searching uranium resources was developed. the fourth part deals with the application of the analysis with gamma ray by capturing neutrons. For example, a bore hole sonde and the process control analysis of sulfur in fuel utilized capture gamma ray. The prompt gamma ray by capturing neutrons may be used for the nondestructive analysis of enrivonment. (Iwakiri, K.)
Noxious facility impact projection: Incorporating the effects of risk aversion
International Nuclear Information System (INIS)
Nieves, L.A.
1993-01-01
Developing new sites for noxious facilities has become a complex process with many potential pitfalls. In addition to the need to negotiate conditions acceptable to the host community, siting success may depend on the facility proposer's ability to identify a candidate site that not only meets technical requirements, but that is located in a community or region whose population is not highly averse to the risks associated with the type of facility being proposed. Success may also depend on the proposer accurately assessing potential impacts of the facility and offering an equitable compensation package to the people affected by it. Facility impact assessments, as typically performed, include only the effects of changes in population, employment and economic activity associated with facility construction and operation. Because of their scope, such assessments usually show a short-run, net economic benefit for the host region, making the intensely negative public reaction to some types and locations of facilities seem unreasonable. The impact component excluded from these assessments is the long-run economic effect of public perceptions of facility risk and nuisance characteristics. Recent developments in psychological and economic measurement techniques have opened the possibility of correcting this flaw by incorporating public perceptions in projections of economic impacts from noxious facilities
Project W-320, 241-C-106 sluicing HVAC calculations, Volume 1
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the FDNW calculations for Project W-320, readily retrievable. The report contains the following calculations: Exhaust airflow sizing for Tank 241-C-106; Equipment sizing and selection recirculation fan; Sizing high efficiency mist eliminator; Sizing electric heating coil; Equipment sizing and selection of recirculation condenser; Chiller skid system sizing and selection; High efficiency metal filter shielding input and flushing frequency; and Exhaust skid stack sizing and fan sizing
Project W-320, 241-C-106 sluicing HVAC calculations, Volume 1
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-08-07
This supporting document has been prepared to make the FDNW calculations for Project W-320, readily retrievable. The report contains the following calculations: Exhaust airflow sizing for Tank 241-C-106; Equipment sizing and selection recirculation fan; Sizing high efficiency mist eliminator; Sizing electric heating coil; Equipment sizing and selection of recirculation condenser; Chiller skid system sizing and selection; High efficiency metal filter shielding input and flushing frequency; and Exhaust skid stack sizing and fan sizing.
Ternary-fragmentation-driving potential energies of 252Cf
Karthikraj, C.; Ren, Zhongzhou
2017-12-01
Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.
Californium-252 sales and loans at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
King, L.J.
1987-01-01
The production and distribution in the United States of 252 Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252 Cf Industrial Sales/Loan Program and the 252 Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252 Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point
Phase V storage (Project W-112) Central Waste Complex operational readiness review, final report
International Nuclear Information System (INIS)
Wight, R.H.
1997-01-01
This document is the final report for the RFSH conducted, Contractor Operational Readiness Review (ORR) for the Central Waste Complex (CWC) Project W-112 and Interim Safety Basis implementation. As appendices, all findings, observations, lines of inquiry and the implementation plan are included
Phase 5 storage (Project W-112) Central Waste Complex operational readiness review, final report
Energy Technology Data Exchange (ETDEWEB)
Wight, R.H.
1997-05-30
This document is the final report for the RFSH conducted, Contractor Operational Readiness Review (ORR) for the Central Waste Complex (CWC) Project W-112 and Interim Safety Basis implementation. As appendices, all findings, observations, lines of inquiry and the implementation plan are included.
International Nuclear Information System (INIS)
Parazin, R.J.
1998-01-01
This supplement to the Project W-519 Conceptual Design will identify a means to provide RW and Electrical services to serve the needs of the TWRS Privatization Contractor (PC) at AP Tank Farm as directed by DOE-RL. The RW will serve the fire suppression and untreated process water requirements for the PC. The purpose of this CDR supplement is to identify Raw Water (RW) and Electrical service line routes to the TWRS Privatization Contractor (PC) feed delivery tanks, AP-106 and/or AP-108, and establish associated cost impacts to the Project W-519 baseline
Defense waste processing facility project at the Savannah River Plant
International Nuclear Information System (INIS)
Baxter, R.G.; Maher, R.; Mellen, J.B.; Shafranek, L.F.; Stevens, W.R. III.
1984-01-01
The Du Pont Company is building for the Department of Energy a facility to vitrify high-level waste at the Savannah River Plant near Aiken, South Carolina. The Defense Waste Processing Facility (DWPF) will solidify existing and future radioactive wastes produced by defense activities at the site. At the present time engineering and design are 45% complete, the site has been cleared, and startup is expected in 1989. This paper will describe project status as well as features of the design. 9 figures
Scrap of gloveboxes No. 801-W and No. 802-W
Ohuchi, S; Kurosawa, M; Okane, S; Usui, T
2002-01-01
Both gloveboxes No. 801-W for measuring samples of uranium or plutonium and No. 802-W for analyzing the quantity of uranium or plutonium are established at twenty five years ago in the analyzing room No. 108 of Plutonium Fuel Research Facility. It was planned to scrap the gloveboxes and to establish new gloveboxes. This report describes the technical view of the scrapping works.
Recycling entire DOE facilities: The National Conversion Pilot Project
International Nuclear Information System (INIS)
Floyd, D.R.
1996-01-01
The Mission of the National Conversion Pilot Project - to demonstrate, at the Rocky Flats Site, the feasibility of economic conversion of DOE Sites - is succeeding. Contaminated facilities worth $92 million are being cleaned and readied for reuse by commercial industry to manufacture products needed in the DOE cleanup and elsewhere. Former Rocky Flats workers have been hired, recultured, are conducting the cleanup and are expected to perform the future manufacturing by recycling DOE RSM and other metals requiring special environmental controls. Stakeholder sway over project activities is welcome and strong
Project W-151 flexible receiver radiation detector system acceptance test plan. Revision 1
International Nuclear Information System (INIS)
Troyer, G.L.
1994-01-01
The attached document is the Acceptance Test Plan for the portion of Project W-151 dealing with acceptance of gamma-ray detectors and associated electronics manufactured at the Idaho National Engineering Laboratory (INEL). The document provides a written basis for testing the detector system, which will take place in the 305 building (300 Area)
Project W-314 performance mock-up test procedure
International Nuclear Information System (INIS)
CARRATT, R.T.
1999-01-01
The purpose of this Procedure is to assist construction in the pre-operational fabrication and testing of the pit leak detection system and the low point drain assembly by: (1) Control system testing of the pit leak detection system will be accomplished by actuating control switches and verifying that the control signal is initiated, liquid testing and overall operational requirements stated in HNF-SD-W314-PDS-003, ''Project Development Specification for Pit Leak Detection''. (2) Testing of the low point floor drain assembly by opening and closing the drain to and from the ''retracted'' and ''sealed'' positions. Successful operation of this drain will be to verify that the seal does not leak on the ''sealed'' position, the assembly holds liquid until the leak detector actuates and the assembly will operate from on top of the mock-up cover block
International Nuclear Information System (INIS)
Wecks, M.D.
1998-01-01
The Systems Engineering Management and Implementation Plan (SEMIP) for TWRS Project W-46 describes the project implementation of the Tank Waste Remediation System Systems Engineering Management Plan. (TWRS SEMP), Rev. 1. The SEMIP outlines systems engineering (SE) products and processes to be used by the project for technical baseline development. A formal graded approach is used to determine the products necessary for requirements, design, and operational baseline completion. SE management processes are defined, and roles and responsibilities for management processes and major technical baseline elements are documented
International Nuclear Information System (INIS)
Kaspar, J.R.; Latray, D.A.
1998-01-01
The Systems Engineering Management and Implementation Plan (SEMIP) for TWRS Project W-465 describes the project implementation of the Tank Waste Remediation System Systems Engineering Management Plan (TWRS SEMP), Rev. 1. The SEMIP outlines systems engineering (SE) products and processes to be used by the project for technical baseline development. A formal graded approach is used to determine the products necessary for requirements, design, and operational baseline completion. SE management processes are defined, and roles and responsibilities for management processes and major technical baseline elements are documented
Highlights from the Future Earth Water-Energy-Food (W-E-F) Nexus Cluster Project Consultations
Lawford, R. G.
2017-12-01
Future Earth launched its W-E-F Nexus project in 2015. The focus of the project was to explore how improved governance and integrated information systems could support sustainability in the W-E-F Nexus. Workshops were held in four regions of the world (North America, Europe, Eastern Asia, and Southern Africa) which facilitated a better understanding of the current role of information in decision-making within the W-E-F Nexus. In each of these workshops, needs and options for improving the provision of relevant integrated data and information to support decision-making were discussed. The workshops provided distinct perspectives on W-E-F issues for each region and each sector. Regional differences arise from climate, geomorphology, natural resources and existing infrastructure as well as the economic and social policies within each country. While the needs associated with this diversity are large, it is still possible to identify unifying themes and requirements for data and information which appeared very similar in all the regions. Important themes involve developing a common rigorous definition of the Nexus, ensuring the availability of data of all types are available in the scales, frequencies, and accuracies needed to support better decision making; and promoting the gathering, analysis and use of information to break down the silos associated with the three sectors are made. Information is also needed to monitor the effects of land ownership and land management on W-E-F issues, to maximize the efficiencies that can be realized from joint planning and increased coherence in the sectoral policy approaches to address climate and environmental issues. After commenting on these opportunities the presentation will outline possible elements of a research agenda for moving the W-E-F Nexus approach forward.
7 CFR 766.252 - Unauthorized assistance resulting from submission of false information.
2010-01-01
... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...
Prompt neutron spectrum of the spontaneous fission of californium-252
International Nuclear Information System (INIS)
Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.
1976-01-01
The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references
System control for the modulated 252Cf source ''Shuffler''
International Nuclear Information System (INIS)
Stephens, M.M.
1975-06-01
The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)
Operational test report - Project W-320 cathodic protection systems
International Nuclear Information System (INIS)
Bowman, T.J.
1998-01-01
Washington Administrative Code (WAC) 173-303-640 specifies that corrosion protection must be designed into tank systems that treat or store dangerous wastes. Project W-320, Waste Retrieval Sluicing System (WRSS), utilizes underground encased waste transfer piping between tanks 241-C-106 and 241-AY-102. Corrosion protection is afforded to the encasements of the WRSS waste transfer piping through the application of earthen ionic currents onto the surface of the piping encasements. Cathodic protection is used in conjunction with the protective coatings that are applied upon the WRSS encasement piping. WRSS installed two new two rectifier systems (46 and 47) and modified one rectifier system (31). WAC 173-303-640 specifies that the proper operation of cathodic protection systems must be confirmed within six months after initial installation. The WRSS cathodic protection systems were energized to begin continuous operation on 5/5/98. Sixteen days after the initial steady-state start-up of the WRSS rectifier systems, the operational testing was accomplished with procedure OTP-320-006 Rev/Mod A-0. This operational test report documents the OTP-320-006 results and documents the results of configuration testing of integrated piping and rectifier systems associated with the W-320 cathodic protection systems
International Nuclear Information System (INIS)
1994-01-01
This quarterly technical progress report presents progress on the projects at the Component Development and Integration Facility (CDIF) during the third quarter of FY94. The CDIF is a major Department of Energy test facility in Butte, Montana, operated by MSE, Inc. Projects in progress include: Biomass Remediation Project; Heavy Metal-Contaminated Soil Project; MHD Shutdown; Mine Waste Technology Pilot Program; Plasma Projects; Resource Recovery Project; and Spray Casting Project
International Nuclear Information System (INIS)
1990-01-01
The Special Committee for Future Project of the Japanese Society for Synchrotron Radiation Research investigated the construction-projects of the large-scaled synchrotron radiation facilities which are presently in progress in Japan. As a result, the following both projects are considered the very valuable research-project which will carry the development of Japan's next-generation synchrotron radiation science: 1. the 8 GeV synchrotron radiation facilities (SPring-8) projected to be constructed by Japan Atomic Energy Research Institute and the Institute of Physical and Chemical Research under the sponsorship of Science Technology Agency at Harima Science Park City, Hyogo Pref., Japan. 2. The project to utilize the Tristan Main Ring (MR) of the National Laboratory for High Energy Physics as the radiation source. Both projects are unique in research theme and technological approach, and complemental each other. Therefore it has been concluded that both projects should be aided and ratified by the Society. (M.T.)
International Nuclear Information System (INIS)
HUSTON, J.J.
1999-01-01
This document has been prepared to identify the quality requirements for all products/activities developed by or for Project W-519. This plan is responsive to the Numatec Hanford Corporation, Quality Assurance Program Plan, NHC-MP-001
International Nuclear Information System (INIS)
Ocampo, V.P.
1994-11-01
This Supplemental Design Requirements Document (SDRD) is used to communicate Project W-113 specific plant design information from Westinghouse Hanford Company (WHC) to the United States Department of Energy (DOE) and the cognizant Architect Engineer (A/E). The SDRD is prepared after the completion of the project Conceptual Design report (CDR) and prior to the initiation of definitive design. Information in the SDRD serves two purposes: to convey design requirements that are too detailed for inclusion in the Functional Design Criteria (FDC) report and to serve as a means of change control for design commitments in the Title I and Title II design. The Solid Waste Retrieval Project (W-113) SDRD has been restructured from the equipment based outline used in previous SDRDs to a functional systems outline. This was done to facilitate identification of deficiencies in the information provided in the initial draft SDRD and aid design confirmation. The format and content of this SDRD adhere as closely as practicable to the requirements of WHC-CM-6-1, Standard Engineering Practices for Functional Design Criteria
International Nuclear Information System (INIS)
Batandjieva, B.; Metcalf, P.
2003-01-01
Safety of near surface disposal facilities is a primary focus and objective of stakeholders involved in radioactive waste management of low and intermediate level waste and safety assessment is an important tool contributing to the evaluation and demonstration of the overall safety of these facilities. It plays significant role in different stages of development of these facilities (site characterization, design, operation, closure) and especially for those facilities for which safety assessment has not been performed or safety has not been demonstrated yet and the future has not been decided. Safety assessments also create the basis for the safety arguments presented to nuclear regulators, public and other interested parties in respect of the safety of existing facilities, the measures to upgrade existing facilities and development of new facilities. The International Atomic Energy Agency (IAEA) has initiated a number of research coordinated projects in the field of development and improvement of approaches to safety assessment and methodologies for safety assessment of near surface disposal facilities, such as NSARS (Near Surface Radioactive Waste Disposal Safety Assessment Reliability Study) and ISAM (Improvement of Safety Assessment Methodologies for Near Surface Disposal Facilities) projects. These projects were very successful and showed that there is a need to promote the consistent application of the safety assessment methodologies and to explore approaches to regulatory review of safety assessments and safety cases in order to make safety related decisions. These objectives have been the basis of the IAEA follow up coordinated research project--ASAM (Application of Safety Assessment Methodologies for Near Surface Disposal Facilities), which will commence in November 2002 and continue for a period of three years
A survey of uses and users of 252Cf
International Nuclear Information System (INIS)
Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.
1989-01-01
Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL
Getting the most D and D ''know how'' before starting to plan your decommissioning project
International Nuclear Information System (INIS)
Boing, L. E.
1999-01-01
Over the last 20 years, the Decommissioning Program of the ANL-East Site has successfully decommissioned numerous facilities including: three research reactors (a 100 MW BWR, a smaller 250 kW biological irradiation reactor and a 10 kW research reactor), a critical assembly, a suite of 61 plutonium gloveboxes in 9 laboratories, a fuels fabrication facility and several non-reactor (waste management and operations) facilities. In addition, extensive decontamination work was performed on 5 hot cells formerly used in a joint ANL/US Navy R and D program. Currently the D and D of the CP-5 research reactor is underway as is planning for several other future D and D projects. The CP-5 facility was also used as a test bed for the evaluation of select evolving D and D technologies to ascertain their value for use in future D and D projects
46 CFR 252.23 - Financial and other reporting requirements.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...
Mine subsidence control projects associated with solid waste disposal facilities
International Nuclear Information System (INIS)
Wood, R.M.
1994-01-01
Pennsylvania environmental regulations require applicant's for solid waste disposal permits to provide information regarding the extent of deep mining under the proposed site, evaluations of the maximum subsidence potential, and designs of measures to mitigate potential subsidence impact on the facility. This paper presents three case histories of deep mine subsidence control projects at solid waste disposal facilities. Each case history presents site specific mine grouting project data summaries which include evaluations of the subsurface conditions from drilling, mine void volume calculations, grout mix designs, grouting procedures and techniques, as well as grout coverage and extent of mine void filling evaluations. The case studies described utilized basic gravity grouting techniques to fill the mine voids and fractured strata over the collapsed portions of the deep mines. Grout mixtures were designed to achieve compressive strengths suitable for preventing future mine subsidence while maintaining high flow characteristics to penetrate fractured strata. Verification drilling and coring was performed in the grouted areas to determine the extent of grout coverage and obtain samples of the in-place grout for compression testing. The case histories presented in this report demonstrate an efficient and cost effective technique for mine subsidence control projects
International Nuclear Information System (INIS)
Choe, D.; Xiao, S.; Jevremovic, T.; Yang, X.
2010-01-01
The University of Utah 100 kW TRIGA (UUTR) reactor provides usable neutron yields for neutron radiography. Currently, UUTR reactor has three irradiators (Central, Pneumatic, and Thermal irradiators) and one Fast neutron Irradiation Facility (FNIF). These irradiators are very small so they are not suitable for neutron radiography. UUTR has three beam ports but they are not available due to the structure of the core. All sides of the core are occupied by FNIF, Thermal Irradiator, and three ion chambers. The only available position for underwater vertical beam port is on the top of the FNIF. There are two factors necessary to fulfill to be able to realize vertical underwater beam port: noninterruption to other facilities and radiation shielding. Designing the vertical beam port as movable ensures good access to the core and pool, while still providing a good neutron radiography environment. Keeping the top of the beam port below the surface of the pool the water represents biological shield. Neutron radiographs, with a simple setup of efficient neutron converters and digital camera systems, can produce acceptable resolution with an exposure time as short as a few minutes. It is important to validate the design with calculations before constructing the beam port. The design of the beam port is modeled using the MCNP5 transport code. A minimum of 10 5 neutrons/cm 2 -sec thermal neutron flux is required for high resolution neutron radiography. Currently, the UUTRIGA is in the process of upgrading its power from 100 kW to 250 kW. Upon the completion of the upgrading, the maximum neutron flux in the core will be ∼7x10 12 neutrons/cm 2 -sec. This paper discusses a modeling and evaluation of capability for a neutron radiography facility. (author)
48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting.
2010-10-01
... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...
48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam.
2010-10-01
... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...
24 CFR 207.252e - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...
International Nuclear Information System (INIS)
CONRAD EA
2008-01-01
This report provides the conclusions of the tank farm interim pretreatment technology decision process. It documents the methodology, data, and results of the selection of cross-flow filtration and ion exchange technologies for implementation in project W-551, Interim Pretreatment System. This selection resulted from the evaluation of specific scope criteria using quantitative and qualitative analyses, group workshops, and technical expert personnel
The Hanford Site solid waste treatment project; Waste Receiving and Processing (WRAP) Facility
International Nuclear Information System (INIS)
Roberts, R.J.
1991-01-01
The Waste Receiving and Processing (WRAP) Facility will provide treatment and temporary storage (consisting of in-process storage) for radioactive and radioactive/hazardous mixed waste. This facility must be constructed and operated in compliance with all appropriate US Department of Energy (DOE) orders and Resource Conservation and Recovery Act (RCRA) regulations. The WRAP Facility will examine and certify, segregate/sort, and treat for disposal suspect transuranic (TRU) wastes in drums and boxes placed in 20-yr retrievable storage since 1970; low-level radioactive mixed waste (RMW) generated and placed into storage at the Hanford Site since 1987; designated remote-handled wastes; and newly generated TRU and RMW wastes from high-level waste (HLW) recovery and processing operations. In order to accelerated the WRAP Project, a partitioning of the facility functions was done in two phases as a means to expedite those parts of the WRAP duties that were well understood and used established technology, while allowing more time to better define the processing functions needed for the remainder of WRAP. The WRAP Module 1 phase one, is to provide the necessary nondestructive examination and nondestructive assay services, as well as all transuranic package transporter (TRUPACT-2) shipping for both WRAP Project phases, with heating, ventilation, and air conditioning; change rooms; and administrative services. Phase two of the project, WRAP Module 2, will provide all necessary waste treatment facilities for disposal of solid wastes. 1 tab
International Nuclear Information System (INIS)
Nelson, J.G.; Castillo, C.; Huntsman, J.; Killoy, S.; Lucek, H.; Marks, T.C.
2011-01-01
Faced with the Department of Energy (DOE) Complex Transformation, National Nuclear Security Administration (NNSA) was tasked with developing an integrated plan for the decommissioning of over 400 facilities and 300 environmental remediation units, as well as the many reconfiguration and modernization projects at the Oak Ridge National Laboratory (ORNL) and Y-12 Complex. Manual scheduling of remediation activities is time-consuming and inherently introduces bias of the scheduler or organization into the process. Clearly a well-defined process, quantitative risk-based tool was needed to develop an objective, unbiased baseline sequence and schedule with a sound technical foundation for the Integrated Facility Disposition Project (IFDP). Faced with limited available data, innovation was needed to extrapolate intelligent relative data for key risk parameters based on known data elements. The IFDP Supermodel was customized and expanded to provide this capability for conceptual planning of diverse project portfolios and multiple sites. (author)
A californium-252 source for radiobiological studies at Hiroshima University
International Nuclear Information System (INIS)
Kato, Kazuo; Takeoka, Seiji; Kuroda, Tokue; Tsujimura, Tomotaka; Kawami, Masaharu; Hoshi, Masaharu; Sawada, Shozo
1987-01-01
A 1.93 Ci (3.6 mg) californium-252 source was installed in the radiation facility of the Research Institute for Nuclear Medicine and Biology, Hiroshima University. This source produces fission neutrons (8.7 x 10 9 n/s at the time of its installation), which are similar to neutron spectrum of the atomic bombs. It is useful for studying biological effects of fission neutrons and neutron dosimetry. An apparatus was dosigned to accomodate this source and to apply it to such studies. It has resulted in profitable fission neutron exposures, while suppressing scattered neutrons and secondary gamma rays. This apparatus incorporates many safety systems, including one which interlocks with all of doors and an elevator serving the exposure room, so as to prevent accidents involving users. (author)
International Nuclear Information System (INIS)
1994-01-01
The Southeast Regional Wastewater Treatment Plant (SERWTP) Facilities Improvement Plan and Geysers Effluent Pipeline and Effluent Injection Project are proposed as a plan to provide expanded wastewater treatment capabilities and to dispose of the effluent by injection in The Geysers geothermal field for purposes of power production. The project is located predominantly in the County of Lake, California, and also in part of Sonoma County. The plan includes various conventional facilities improvements in wastewater treatment to a secondary level of treatment at the SWERWTP. The plan includes facilities to convey the treated effluent in a 26-mile, 24-inch inside diameter pipeline to the Southeast Geysers. The wastewater from the SERWTP would be supplemented by raw lake water diverted from nearby Clear Lake. At The Geysers, the effluent would be directed into a system of distribution lines to wells. In the geothermal reservoir, the water will be converted to steam and collected in production wells that will direct the steam to six existing power plants. This document is a summary of a combined full Environmental Impact Report (EIR) and Environmental Impact Statement (EIS). The EIR/EIS describes the environmental impacts of the various components of the project. Mitigation measures are suggested for reducing impacts to a less than significant level
Californium-252 Program Equipment Evaluation
Energy Technology Data Exchange (ETDEWEB)
Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-12-01
To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.
A new type-B cask design for transporting 252Cf
International Nuclear Information System (INIS)
Simmons, C.M.
2000-01-01
A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask
Manhattan Project buildings and facilities at the Hanford Site: A construction history
Energy Technology Data Exchange (ETDEWEB)
Gerber, M.S.
1993-09-01
This document thoroughly examines the role that the Hanford Engineer Works played in the Manhattan project. The historical aspects of the buildings and facilities are characterized. An in depth look at the facilities, including their functions, methods of fabrication and appearance is given for the 100 AREAS, 200 AREAS, 300 AREAS, 500, 800 and 900 AREAS, 600 AREA, 700 AREA, 1100 AREA and temporary construction structures.
Manhattan Project buildings and facilities at the Hanford Site: A construction history
International Nuclear Information System (INIS)
Gerber, M.S.
1993-09-01
This document thoroughly examines the role that the Hanford Engineer Works played in the Manhattan project. The historical aspects of the buildings and facilities are characterized. An in depth look at the facilities, including their functions, methods of fabrication and appearance is given for the 100 AREAS, 200 AREAS, 300 AREAS, 500, 800 and 900 AREAS, 600 AREA, 700 AREA, 1100 AREA and temporary construction structures
Facility Effluent Monitoring Plan for the 2724-W Protective Equipment Decontamination Facility
International Nuclear Information System (INIS)
Carter, G.J.
1991-11-01
A facility effluent monitoring plan is required by the US Department of Energy in DOE Order 5400.1* for any operations that involve hazardous materials and radioactive substances that could impact employee or public safety or the environment. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility Effluent Monitoring Plans, WHC-EP-0438. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements. This facility effluent monitoring plan is the first annual report. It shall ensure long-range integrity of the effluent monitoring systems by requiring an update whenever a new process or operation introduces new hazardous materials or significant radioactive materials. This document must be reviewed annually even if there are no operational changes, and it must be updates as a minimum every three years
Facilities projects performance measurement system
International Nuclear Information System (INIS)
Erben, J.F.
1979-01-01
The two DOE-owned facilities at Hanford, the Fuels and Materials Examination Facility (FMEF), and the Fusion Materials Irradiation Test Facility (FMIT), are described. The performance measurement systems used at these two facilities are next described
International Nuclear Information System (INIS)
Stine, M.D.
1995-01-01
The purpose of this paper is to develop and document a proposed position on the performance of independent peer reviews on selected design and analysis components of the Title 1 [Preliminary] and Title 2 [Final] design phases of the Multi-Function Waste Tank Facility [MWTF] project. An independent, third-party peer review is defined as a documented critical review of documents, data, designs, design inputs, tests, calculations, or related materials. The peer review should be conducted by persons independent of those who performed the work, but who are technically qualified to perform the original work. The peer review is used to assess the validity of assumptions and functional requirements, to assess the appropriateness and logic of selected methodologies and design inputs, and to verify calculations, analyses and computer software. The peer review can be conducted at the end of the design activity, at specific stages of the design process, or continuously and concurrently with the design activity. This latter method is often referred to as ''Continuous Peer Review.''
The DE-PHARM Project: A Pharmacist-Driven Deprescribing Initiative in a Nursing Facility.
Pruskowski, Jennifer; Handler, Steven M
2017-08-01
Many residents with life-limiting illnesses are being prescribed and taking potentially inappropriate medications (PIMs) and questionably beneficial medications either near or at the end of life. These medications can contribute to adverse drug reactions, increase morbidity, and increase unnecessary burden and cost. It is crucial that the process of deprescribing be incorporated into the care of these residents. After developing a clinical pharmacist-driven deprescribing initiative in the nursing facility, the objective of this project was to reduce the number of PIMs via accepted recommendations from the clinical pharmacist to the primary team. The Discussion to Ensure the Patient-centered, Health-focused, prognosis-Appropriate, and Rational Medication regimen (DE-PHARM) quality improvement-approved project was conducted in an urban, academic nursing facility in Pittsburgh, Pennsylvania. The pilot phase occurred between October 2015 and April 2016. To be included in this study, participants had to be a custodial resident of the nursing facility with a previously documented comfort-focused treatment plan. All medications used for the management of chronic comorbid diseases were eligible for review. Forty-seven residents managed by eight different primary teams met inclusion criteria. Thirty-nine recommendations for 23 residents were made by the clinical pharmacist, with an average of 0.82 and range of 0-5 recommendations per resident, respectively. Of those, only 10 (26%) were accepted, 1 (3%) was modified, 3 (7%) were rejected, and 25 (64%) had no response within the 120-day response period. Additionally, two residents died during the project, and one resident was readmitted to the hospital for a prolonged period of time. The pilot phase of the DE-PHARM project, a clinical pharmacist-driven deprescribing initiative, was designed and assessed. This project demonstrated the feasibility of such an initiative. Because of the complexity of such a process, special
Evaluation of Nuclear Facility Decommissioning Projects program
International Nuclear Information System (INIS)
Baumann, B.L.
1983-01-01
The objective of the Evaluation of Nuclear Facility Decommissioning Projects (ENFDP) program is to provide the NRC licensing staff with data which will allow an assessment of radiation exposure during decommissioning and the implementation of ALARA techniques. The data will also provide information to determine the funding level necessary to ensure timely and safe decommissioning operations. Actual decommissioning costs, methods and radiation exposures are compared with those estimated by the Battelle-PNL and ORNL NUREGs on decommissioning. Exposure reduction techniques applied to decommissioning activities to meet ALARA objectives are described. The lessons learned concerning various decommissioning methods are evaluated
Preoperational Environmental Survey for the Spent Nuclear Fuel (SNF) Project Facilities
International Nuclear Information System (INIS)
MITCHELL, R.M.
2000-01-01
This document represents the report for environmental sampling of soil, vegetation, litter, cryptograms, and small mammals at the Spent Nuclear Fuel Project facilities located in 100 K and 200 East Areas in support of the preoperational environmental survey
Preoperational Environmental Survey for the Spent Nuclear Fuel (SNF) Project Facilities
Energy Technology Data Exchange (ETDEWEB)
MITCHELL, R.M.
2000-10-12
This document represents the report for environmental sampling of soil, vegetation, litter, cryptograms, and small mammals at the Spent Nuclear Fuel Project facilities located in 100 K and 200 East Areas in support of the preoperational environmental survey.
Preoperational Environmental Survey for the Spent Nuclear Fuel (SNF) Project Facilities
Energy Technology Data Exchange (ETDEWEB)
MITCHELL, R.M.
2000-09-28
This document represents the report for environmental sampling of soil, vegetation, litter, cryptograms, and small mammals at the Spent Nuclear Fuel Project facilities located in 100 K and 200 East Areas in support of the preoperational environmental survey.
48 CFR 252.227-7012 - Patent license and release contract.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...
International Nuclear Information System (INIS)
Turnbaugh, J.E.
1996-01-01
This document provides information regarding the source and the estimated quantity of potential airborne radionuclide emissions resulting from the operation of the Cold Vacuum Drying (CVD) Facility. The construction of the CVD Facility is scheduled to commence on or about December 1996, and will be completed when the process begins operation. This document serves as a Notice of Construction (NOC) pursuant to the requirements of 40 Code of Federal Regulations (CFR) 61 for the CVD Facility. About 80 percent of the U.S. Department of Energy's spent nuclear fuel (SNF) inventory is stored under water in the Hanford Site K Basins. Spent nuclear fuel in the K West Basin is contained in closed canisters, while the SNF in the K East Basin is in open canisters, which allow release of corrosion products to the K East Basin water. Storage of the current inventory in the K Basins was originally intended to be on an as-needed basis to sustain operation of the N Reactor while the Plutonium-Uranium Extraction (PUREX) Plant was refurbished and restarted. The decision in December 1992 to deactivate the PURF-X Plant left approximately 2,100 MT (2,300 tons) of uranium as part of the N Reactor SNF in the K Basins with no means for near-term removal and processing. The CVD Facility will be constructed in the 100 Area northwest of the 190 K West Building, which is in close proximity to the K East and K West Basins (Figures 1 and 08572). The CVD Facility will consist of five processing bays, with four of the bays fully equipped with processing equipment and the fifth bay configured as an open spare bay. The CVD Facility will have a support area consisting of a control room, change rooms, and other functions required to support operations
Operating test report for project W-417, T-plant steam removal upgrade, waste transfer portion
International Nuclear Information System (INIS)
Myers, N.K.
1997-01-01
This Operating Test Report (OTR) documents the performance results of the Operating Test Procedure HNF-SD-W417-OTP-001 that provides steps to test the waste transfer system installed in the 221-T Canyon under project W-417. Recent modifications have been performed on the T Plant Rail Car Waste Transfer System. This Operating Test Procedure (OTP) will document the satisfactory operation of the 221-T Rail Car Waste Transfer System modified by project W-417. Project W-417 installed a pump in Tank 5-7 to replace the steam jets used for transferring liquid waste. This testing is required to verify that operational requirements of the modified transfer system have been met. Figure 2 and 3 shows the new and existing system to be tested. The scope of this testing includes the submersible air driven pump operation in Tank 5-7, liquid waste transfer operation from Tank 5-7 to rail car (HO-IOH-3663 or HO-IOH-3664), associated line flushing, and the operation of the flow meter. This testing is designed to demonstrate the satisfactory operation-of the transfer line at normal operating conditions and proper functioning of instruments. Favorable results will support continued use of this system for liquid waste transfer. The Functional Design Criteria for this system requires a transfer flow rate of 40 gallons per minute (GPM). To establish these conditions the pump will be supplied up to 90 psi air pressure from the existing air system routed in the canyon. An air regulator valve will regulate the air pressure. Tank capacity and operating ranges are the following: Tank No. Capacity (gal) Operating Range (gal) 5-7 10,046 0 8040 (80%) Rail car (HO-IOH-3663 HO-IOH-3664) 097219,157 Existing Tank level instrumentation, rail car level detection, and pressure indicators will be utilized for acceptance/rejection Criteria. The flow meter will be verified for accuracy against the Tank 5-7 level indicator. The level indicator is accurate to within 2.2 %. This will be for information only
International Nuclear Information System (INIS)
Burns, M.L.; Durrer, R.E.; Kennicott, M.A.
1996-07-01
The Los Alamos National Laboratory (LANL) Chemistry and Metallurgy Research (CMR) Facility, constructed in 1952, is currently undergoing a major, multi-year construction project. Many of the operations required under this project (i.e., design, demolition, decontamination, construction, and waste management) mimic the processes required of a large scale decontamination and decommissioning (D ampersand D) job and are identical to the requirements of any of several upgrades projects anticipated for LANL and other Department of Energy (DOE) sites. For these reasons the CMR Upgrades Project is seen as an ideal model facility - to test the application, and measure the success of - waste minimization techniques which could be brought to bear on any of the similar projects. The purpose of this paper will be to discuss the past, present, and anticipated waste minimization applications at the facility and will focus on the development and execution of the project's open-quotes Waste Minimization/Pollution Prevention Strategic Plan.close quotes
International Nuclear Information System (INIS)
1995-09-01
The Solid Waste Retrieval Facility--Phase 1 (Project W113) will provide the infrastructure and the facility required to retrieve from Trench 04, Burial ground 4C, contact handled (CH) drums and boxes at a rate that supports all retrieved TRU waste batching, treatment, storage, and disposal plans. This includes (1) operations related equipment and facilities, viz., a weather enclosure for the trench, retrieval equipment, weighing, venting, obtaining gas samples, overpacking, NDE, NDA, shipment of waste and (2) operations support related facilities, viz., a general office building, a retrieval staff change facility, and infrastructure upgrades such as supply and routing of water, sewer, electrical power, fire protection, roads, and telecommunication. Title I design for the operations related equipment and facilities was performed by Raytheon/BNFL, and that for the operations support related facilities including infrastructure upgrade was performed by KEH. These two scopes were combined into an integrated W113 Title II scope that was performed by Raytheon/BNFL. Volume 1 provides a comprehensive narrative description of the proposed facility and systems, the basis for each of the systems design, and the engineering assessments that were performed to support the technical basis of the Title II design. The intent of the system description presented is to provide WHC an understanding of the facilities and equipment provided and the A/E's perspective on how these systems will operate
Energy Technology Data Exchange (ETDEWEB)
Kačegavičius, Tomas, E-mail: Tomas.Kacegavicius@lei.lt; Povilaitis, Mantas, E-mail: Mantas.Povilaitis@lei.lt
2015-12-15
Highlights: • The analysis of loss-of-coolant accident (LOCA) in W7-X facility. • Burst disc is sufficient to prevent pressure inside the plasma vessel exceeding 110 kPa. • Developed model of the cooling system adequately represents the expected phenomena. - Abstract: Fusion is the energy production technology, which could potentially solve problems with growing energy demand of population in the future. Wendelstein 7-X (W7-X) is an experimental facility of stellarator type, which is currently being built at the Max-Planck-Institute for Plasmaphysics located in Greifswald, Germany. W7-X shall demonstrate that in future the energy could be produced in such type of fusion reactors. The safety analysis is required before the operation of the facility could be started. A rupture of 40 mm diameter pipe, which is connected to the divertor unit (module for plasma cooling) to ensure heat removal from the vacuum vessel in case of no-plasma operation mode “baking” is one of the design basis accidents to be investigated. During “baking” mode the vacuum vessel structures and working fluid – water are heated to the temperature 160 °C. This accident was selected for the detailed analysis using integral code ASTEC, which is developed by IRSN (France) and GRS mbH (Germany). This paper presents the integral analysis of W7-X response to a selected accident scenario. The model of the main cooling circuit and “baking” circuit was developed for ASTEC code. There were analysed two cases: (1) rupture of a pipe connected to the upper divertor unit and (2) rupture of a pipe connected to the lower divertor unit. The results of analysis showed that in both cases the water is almost completely released from the units into the plasma vessel. In both cases the pressure in the plasma vessel rapidly increases and in 28 s the set point for burst disc opening is reached preventing further pressurisation.
Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf
International Nuclear Information System (INIS)
Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.
1999-01-01
A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society
Fabrication of californium-252 sources in the United Kingdom
International Nuclear Information System (INIS)
Ainsworth, A.; Brady, M.W.; Thornett, W.H.
1975-01-01
The advent of californium-252 in weighable quantities and at a reasonable price has caused some rethinking among neutron source suppliers. To explore this market the Radiochemical Center Ltd. has purchased 2 mg of californium-252, and subdivided this into a wide range of sources. To take advantage of its high specific neutron emission, a small double welded stainless steel capsule 7.8mm diameter x 10mm high was chosen for stock sources and this entailed the use of a microdispensing technique which had to be specially developed. The apparatus and procedure for subdividing milligram amounts of californium-252 are described. Some details of our experience in processing these one milligram shipments are given. 100 sources with activities from 200 microgram to 0.01 microgram have been produced. Losses have been small. Measurement of neutron spectra gamma spectra and dose rates from encapsulated sources has confirmed published data. Though it is early days, little industrial interest in californium-252 sources has been detected, most of the sources have so far been required for research into activation analysis and two examples of this are given. (U.S.)
Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated
Accelerator technical design report for high-intensity proton accelerator facility project, J-PARC
Energy Technology Data Exchange (ETDEWEB)
NONE
2003-03-01
This report presents the detail of the technical design of the accelerators for the High-Intensity Proton Accelerator Facility Project, J-PARC. The accelerator complex comprises a 400-MeV room-temperature linac (600-MeV superconducting linac), 3-GeV rapid-cycling synchrotron (RCS), and a 50-GeV synchrotron (MR). The 400-MeV beam is injected to the RCS, being accelerated to 3 GEV. The 1-MW beam thus produced is guided to the Materials Life Science Experimental Facility, with both the pulsed spallation neutron source and muon source. A part of the beam is transported to the MR, which provides the 0.75-MW beam to either the Nuclear and Fundamental Particle Experimental Facility or the Neutrino Production Target. On the other hand, the beam accelerated to 600 MeV by the superconducting linac is used for the Nuclear Waster Transmutation Experiment. In this way, this facility is unique, being multipurpose one, including many new inventions and Research and Development Results. This report is based upon the accomplishments made by the Accelerator Group and others of the Project Team, which is organized on the basis of the Agreement between JAERI and KEK on the Construction and Research and Development of the High-Intensity Proton Accelerator Facility. (author)
Spent Nuclear Fuel (SNF) Project Cold Vacuum Drying (CVD) Facility Operations Manual
Energy Technology Data Exchange (ETDEWEB)
IRWIN, J.J.
2000-02-03
This document provides the Operations Manual for the Cold Vacuum Drying Facility (CVDF). The Manual was developed in conjunction with HNF-SD-SNF-SAR-002, Safety Analysis Report for the Cold Vacuum Drying Facility, Phase 2, Supporting Installation of the Processing Systems (Garvin 1998) and, the HNF-SD-SNF-DRD-002, 1997, Cold Vacuum Drying Facility Design Requirements, Rev. 3a. The Operations Manual contains general descriptions of all the process, safety and facility systems in the CVDF, a general CVD operations sequence, and has been developed for the spent nuclear fuel project (SNFP) Operations Organization and shall be updated, expanded, and revised in accordance with future design, construction and startup phases of the CVDF until the CVDF final ORR is approved.
Spent Nuclear Fuel (SNF) Project Cold Vacuum Drying (CVD) Facility Operations Manual
International Nuclear Information System (INIS)
IRWIN, J.J.
2000-01-01
This document provides the Operations Manual for the Cold Vacuum Drying Facility (CVDF). The Manual was developed in conjunction with HNF-SD-SNF-SAR-002, Safety Analysis Report for the Cold Vacuum Drying Facility, Phase 2, Supporting Installation of the Processing Systems (Garvin 1998) and, the HNF-SD-SNF-DRD-002, 1997, Cold Vacuum Drying Facility Design Requirements, Rev. 3a. The Operations Manual contains general descriptions of all the process, safety and facility systems in the CVDF, a general CVD operations sequence, and has been developed for the spent nuclear fuel project (SNFP) Operations Organization and shall be updated, expanded, and revised in accordance with future design, construction and startup phases of the CVDF until the CVDF final ORR is approved
Facilities management innovation in public-private collaborations: Danish ESCO projects
DEFF Research Database (Denmark)
Nardelli, Giulia; Jensen, Jesper Ole; Nielsen, Susanne Balslev
2015-01-01
The purpose of the article is to investigate how Facilities Management (FM) units navigate Energy Service Company (ESCO) collaborations, here defined as examples of public collaborative innovation within the context of FM. The driving motivation is to inform and inspire internal FM units of local...... institutions on how to navigate and manage collaboration of different, intra- and inter-organisational actors throughout ESCO projects.......The purpose of the article is to investigate how Facilities Management (FM) units navigate Energy Service Company (ESCO) collaborations, here defined as examples of public collaborative innovation within the context of FM. The driving motivation is to inform and inspire internal FM units of local...
Overhead remote handling systems for the process facility modifications project
International Nuclear Information System (INIS)
Wiesener, R.W.; Grover, D.L.
1987-01-01
Each of the cells in the process facility modifications (PFM) project complex is provided with a variety of general purpose remote handling equipment including bridge cranes, monorail hoist, bridge-mounted electromechanical manipulator (EMM) and an overhead robot used for high efficiency particulate air (HEPA) filter changeout. This equipment supplements master-slave manipulators (MSMs) located throughout the complex to provide an overall remote handling system capability. The overhead handling equipment is used for fuel and waste material handling operations throughout the process cells. The system also provides the capability for remote replacement of all in-cell process equipment which may fail or be replaced for upgrading during the lifetime of the facility
International Nuclear Information System (INIS)
Irons, L.G.
1995-01-01
This report presents the lessons learned from a project that involved modification to the existing burial grounds at the Hanford Reservation. This project has been focused on the development and operation of a Resource Conservation and Recovery Act compliant landfill which will accept low-level radioactive wastes that have been placed in proper containers
The AGP-Project conceptual design for a Spanish HLW final disposal facility
International Nuclear Information System (INIS)
Biurrun, E.; Engelmann, H.-J.; Huertas, F.; Ulibarri, A.
1992-01-01
Within the framework of the AGP Project a Conceptual Design for a HLW Final Disposal Facility to be eventually built in an underground salt formation in Spain has been developed. The AGP Project has the character of a system analysis. In the current project phase I several alternatives has been considered for different subsystems and/or components of the repository. The system variants, developed to such extent as to allow a comparison of their advantages and disadvantages, will allow the selection of a reference concept, which will be further developed to technical maturity in subsequent project phases. (author)
Highlights of the ISOLDE Facility and the HIE-ISOLDE Project
Borge, M.J.G.
2016-01-01
The ISOLDE radioactive beam facility is the dedicated CERN installation for the production and acceleration of radioactive nuclei. Exotic nuclei of most chemical elements are available for the study of nuclear structure, nuclear astrophysics, fundamental symmetries and atomic physics, as well as for applications in condensed matter and life sciences. In order to broaden the scientific opportunities beyond the reach of the present facility, the on-going HIE-ISOLDE (High Intensity and Energy) project provides major improvements in energy range, beam intensity and beam quality. A major element of the project is the increase of the final energy of the post-accelerated beams to 10 MeV/u throughout the periodic table. Physics with post-accelerated beams at 4 MeV/u has started this autumn. The increase in energy up to 10 MeV/u is fully funded and it will be implemented at the rate of one cryo-module per year reaching 10 MeV/u for A∕q = 4.5 at the start of 2018. In this contribution, a description of the ISOLDE fac...
Benchmarking the Remote-Handled Waste Facility at the West Valley Demonstration Project
International Nuclear Information System (INIS)
Mendiratta, O.P.; Ploetz, D.K.
2000-01-01
ABSTRACT Facility decontamination activities at the West Valley Demonstration Project (WVDP), the site of a former commercial nuclear spent fuel reprocessing facility near Buffalo, New York, have resulted in the removal of radioactive waste. Due to high dose and/or high contamination levels of this waste, it needs to be handled remotely for processing and repackaging into transport/disposal-ready containers. An initial conceptual design for a Remote-Handled Waste Facility (RHWF), completed in June 1998, was estimated to cost $55 million and take 11 years to process the waste. Benchmarking the RHWF with other facilities around the world, completed in November 1998, identified unique facility design features and innovative waste processing methods. Incorporation of the benchmarking effort has led to a smaller yet fully functional, $31 million facility. To distinguish it from the June 1998 version, the revised design is called the Rescoped Remote-Handled Waste Facility (RRHWF) in this topical report. The conceptual design for the RRHWF was completed in June 1999. A design-build contract was approved by the Department of Energy in September 1999
Benchmarking the Remote-Handled Waste Facility at the West Valley Demonstration Project
Energy Technology Data Exchange (ETDEWEB)
O. P. Mendiratta; D. K. Ploetz
2000-02-29
ABSTRACT Facility decontamination activities at the West Valley Demonstration Project (WVDP), the site of a former commercial nuclear spent fuel reprocessing facility near Buffalo, New York, have resulted in the removal of radioactive waste. Due to high dose and/or high contamination levels of this waste, it needs to be handled remotely for processing and repackaging into transport/disposal-ready containers. An initial conceptual design for a Remote-Handled Waste Facility (RHWF), completed in June 1998, was estimated to cost $55 million and take 11 years to process the waste. Benchmarking the RHWF with other facilities around the world, completed in November 1998, identified unique facility design features and innovative waste pro-cessing methods. Incorporation of the benchmarking effort has led to a smaller yet fully functional, $31 million facility. To distinguish it from the June 1998 version, the revised design is called the Rescoped Remote-Handled Waste Facility (RRHWF) in this topical report. The conceptual design for the RRHWF was completed in June 1999. A design-build contract was approved by the Department of Energy in September 1999.
Design requirements document for Project W-465, immobilized low-activity waste interim storage
International Nuclear Information System (INIS)
Burbank, D.A.
1998-01-01
The scope of this Design Requirements Document (DRD) is to identify the functions and associated requirements that must be performed to accept, transport, handle, and store immobilized low-activity waste (ILAW) produced by the privatized Tank Waste Remediation System (TWRS) treatment contractors. The functional and performance requirements in this document provide the basis for the conceptual design of the TWRS ILAW Interim Storage facility project and provides traceability from the program level requirements to the project design activity. Technical and programmatic risk associated with the TWRS planning basis are discussed in the Tank Waste Remediation System Decisions and Risk Assessment (Johnson 1994). The design requirements provided in this document will be augmented by additional detailed design data documented by the project
International Nuclear Information System (INIS)
1995-09-01
The Solid Waste Retrieval Facility--Phase 1 (Project W113) will provide the infrastructure and the facility required to retrieve from Trench 04, Burial ground 4C, contact handled (CH) drums and boxes at a rate that supports all retrieved TRU waste batching, treatment, storage, and disposal plans. This includes (1) operations related equipment and facilities, viz., a weather enclosure for the trench, retrieval equipment, weighing, venting, obtaining gas samples, overpacking, NDE, NDA, shipment of waste and (2) operations support related facilities, viz., a general office building, a retrieval staff change facility, and infrastructure upgrades such as supply and routing of water, sewer, electrical power, fire protection, roads, and telecommunication. Title I design for the operations related equipment and facilities was performed by Raytheon/BNFL, and that for the operations support related facilities including infrastructure upgrade was performed by KEH. These two scopes were combined into an integrated W113 Title II scope that was performed by Raytheon/BNFL. The following Code Evaluation analyzes the applicable sections of the National Fire Protection Association (NFPA) 101, Life Safety Code, 1994 Edition and the 1994 Edition of the Uniform Building Code (UBC) to the W113 Trench Enclosure. A Building Code Analysis generally establishes four primary design criteria: occupancy classification; separation requirements; egress requirements; and construction type. The UBC establishes requirements for all criteria. This analysis is limited to the Trench Enclosure Building. The General Office Building and the Retrieval Staff Change Building is not within the scope of this analysis
International Nuclear Information System (INIS)
Adamson, M. G.
1997-01-01
The re-baseline of the Expedited Technology Demonstration Project (Revised Mixed Waste Facility Project) is designated as Project Baseline Revision 4.0. The last approved baseline was identified as Project Baseline Revision 3.0 and was issued in October 1996. Project Baseline Revision 4.0 does not depart from the formal DOE guidance followed by, and contained in, Revision 3.0. This revised baseline document describes the MSO and Final Forms testing activities that will occur during FY98, the final year of the ETD Project. The cost estimate for work during FY98 continues to be $2.OM as published in Revision 3.0. However, the funds will be all CENRTC rather than the OPEX/CENTRC split previously anticipated. LLNL has waived overhead charges on ETD Project CENRTC funds since the beginning of project activities. By requesting the $2.OM as all CENTRC a more aggressive approach to staffing and testing can be taken. Due to a cost under- run condition during FY97 procurements were made and work was accomplished, with the knowledge of DOE, in the Feed Preparation and Final Forms areas that were not in the scope of Revision 3.0. Feed preparation activities for FY98 have been expanded to include the drum opening station/enclosure previously deleted
International Nuclear Information System (INIS)
RYAN GW
2008-01-01
In complying with direction from the U.S. Department of Energy (DOE), Richland Operations Office (RL) (07-KBC-0055, 'Direction Associated with Implementation of DOE-STD-1189 for the Sludge Treatment Project,' and 08-SED-0063, 'RL Action on the Safety Design Strategy (SDS) for Obtaining Additional Solid Waste Processing Capabilities (M-91 Project) and Use of Draft DOE-STD-I 189-YR'), it has been determined that the seismic design requirements currently in the Project Hanford Management Contract (PHMC) will be modified by DOE-STD-1189, Integration of Safety into the Design Process (March 2007 draft), for these two key PHMC projects. Seismic design requirements for other PHMC facilities and projects will remain unchanged. Considering the current early Critical Decision (CD) phases of both the Sludge Treatment Project (STP) and the Solid Waste Processing Facilities (M-91) Project and a strong intent to avoid potentially costly re-work of both engineering and nuclear safety analyses, this document describes how Fluor Hanford, Inc. (FH) will maintain compliance with the PHMC by considering both the current seismic standards referenced by DOE 0 420.1 B, Facility Safety, and draft DOE-STD-1189 (i.e., ASCE/SEI 43-05, Seismic Design Criteria for Structures, Systems, and Components in Nuclear Facilities, and ANSI ANS 2.26-2004, Categorization of Nuclear Facility Structures, Systems and Components for Seismic Design, as modified by draft DOE-STD-1189) to choose the criteria that will result in the most conservative seismic design categorization and engineering design. Following the process described in this document will result in a conservative seismic design categorization and design products. This approach is expected to resolve discrepancies between the existing and new requirements and reduce the risk that project designs and analyses will require revision when the draft DOE-STD-1189 is finalized
Energy Technology Data Exchange (ETDEWEB)
Joshi, Jay Prakash [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-05-01
The objectives of this project are to calibrate the Advanced Experimental Fuel Counter (AEFC), benchmark MCNP simulations using experimental results, investigate the effects of change in fuel assembly geometry, and finally to show the boost in doubles count rates with 252Cf active soruces due to the time correlated induced fission (TCIF) effect.
Radiography using californium-252 neutron sources
International Nuclear Information System (INIS)
Ray, J.W.
1975-01-01
The current status in the technology of neutron radiography using californium-252 neutron sources is summarized. Major emphasis is on thermal neutron radiography since it has the widest potential applicability at the present time. Attention is given to four major factors which affect the quality and useability of thermal neutron radiography: source neutron thermalization, neutron beam extraction geometry, neutron collimator dimensions, and neutron imaging methods. Each of these factors has a major effect on the quality of the radiographs which are obtained from a californium source neutron radiography system and the exposure times required to obtain the radiographs; radiograph quality and exposure time in turn affect the practicality of neutron radiography for specific nondestructive inspection applications. A brief discussion of fast neutron radiography using californium-252 neutron sources is also included. (U.S.)
Evolution of Safeguards over Time: Past, Present, and Projected Facilities, Material, and Budget
Energy Technology Data Exchange (ETDEWEB)
Kollar, Lenka; Mathews, Caroline E.
2009-07-01
This study examines the past trends and evolution of safeguards over time and projects growth through 2030. The report documents the amount of nuclear material and facilities under safeguards from 1970 until present, along with the corresponding budget. Estimates for the future amount of facilities and material under safeguards are made according to non-nuclear-weapons states’ (NNWS) plans to build more nuclear capacity and sustain current nuclear infrastructure. Since nuclear energy is seen as a clean and economic option for base load electric power, many countries are seeking to either expand their current nuclear infrastructure, or introduce nuclear power. In order to feed new nuclear power plants and sustain existing ones, more nuclear facilities will need to be built, and thus more nuclear material will be introduced into the safeguards system. The projections in this study conclude that a zero real growth scenario for the IAEA safeguards budget will result in large resource gaps in the near future.
Evolution of Safeguards over Time: Past, Present, and Projected Facilities, Material, and Budget
International Nuclear Information System (INIS)
Kollar, Lenka; Mathews, Caroline E.
2009-01-01
This study examines the past trends and evolution of safeguards over time and projects growth through 2030. The report documents the amount of nuclear material and facilities under safeguards from 1970 until present, along with the corresponding budget. Estimates for the future amount of facilities and material under safeguards are made according to non-nuclear-weapons states (NNWS) plans to build more nuclear capacity and sustain current nuclear infrastructure. Since nuclear energy is seen as a clean and economic option for base load electric power, many countries are seeking to either expand their current nuclear infrastructure, or introduce nuclear power. In order to feed new nuclear power plants and sustain existing ones, more nuclear facilities will need to be built, and thus more nuclear material will be introduced into the safeguards system. The projections in this study conclude that a zero real growth scenario for the IAEA safeguards budget will result in large resource gaps in the near future.
International Nuclear Information System (INIS)
Soares, W.A.
1984-01-01
This paper presents an analysis of preliminary plans of standard 'seismic actions for nuclear facilities project'. This document presents since seismic event characterization up to details of structural project of nuclear facilities construction. (C.M.)
Accident consequence calculations for project W-058 safetyanalysis
Energy Technology Data Exchange (ETDEWEB)
Van Keuren, J.C.
1997-06-10
Accident consequence analyses have been performed for Project W-058, the Replacement Cross Site Transfer System. using the assumption and analysis techniques developed for the Tank Remediation Waste system Basis for Interim Operation. most potential accident involving the FISTS are bounded by the TWRS BIO analysis. However, the spray leak and pool leak scenarios require revised analyses since the RCSTS design utilizes larger diameter pipe and higher pressures than those analyzed in the TWRS BIO. Also the volume of diversion box and vent station are larger than that assumed for the valve pits in the TWRS BIO, which effects results of sprays or spills into the pits. the revised analysis for the spray leak is presented in Section 2, for the above ground spill in Section 3, for the presented in Section 2, for the above ground spill in Section 3, for the subsurface spill forming a pool in Section 4, and for the subsurface pool remaining subsurface in Section 5. The conclusion from these sections are summarized below.
Radiation ulcers in patients with cancer of the torgue after 252Cf therapy
International Nuclear Information System (INIS)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.
1984-01-01
Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf
Quality assurance program plan fuel supply shutdown project
International Nuclear Information System (INIS)
Metcalf, I.L.
1998-01-01
This Quality Assurance Program plan (QAPP) describes how the Fuel Supply Shutdown (FSS) project organization implements the quality assurance requirements of HNF-MP-599, Project Hanford Quality Assurance Program Description (QAPD) and the B and W Hanford Company Quality Assurance Program Plan (QAPP), FSP-MP-004. The QAPP applies to facility structures, systems, and components and to activities (e.g., design, procurement, testing, operations, maintenance, etc.) that could affect structures, systems, and components. This QAPP also provides a roadmap of applicable Project Hanford Policies and Procedures (PHPP) which may be utilized by the FSS project organization to implement the requirements of this QAPP
The Sanford Underground Research Facility at Homestake
International Nuclear Information System (INIS)
Heise, J.
2015-01-01
The former Homestake gold mine in Lead, South Dakota, has been transformed into a dedicated facility to pursue underground research in rare-process physics, as well as offering research opportunities in other disciplines such as biology, geology and engineering. A key component of the Sanford Underground Research Facility (SURF) is the Davis Campus, which is in operation at the 4850-foot level (4300 m.w.e.) and currently hosts two main physics projects: the LUX dark matter experiment and the MAJORANA DEMONSTRATOR neutrinoless double-beta decay experiment. In addition, two low-background counters currently operate at the Davis Campus in support of current and future experiments. Expansion of the underground laboratory space is underway at the 4850L Ross Campus in order to maintain and enhance low-background assay capabilities as well as to host a unique nuclear astrophysics accelerator facility. Plans to accommodate other future experiments at SURF are also underway and include the next generation of direct-search dark matter experiments and the Fermilab-led international long-baseline neutrino program. Planning to understand the infrastructure developments necessary to accommodate these future projects is well advanced and in some cases have already started. SURF is a dedicated research facility with significant expansion capability
The Sanford Underground Research Facility at Homestake
International Nuclear Information System (INIS)
Heise, J
2015-01-01
The former Homestakegold mine in Lead, South Dakota has been transformed into a dedicated facility to pursue underground research in rare-process physics, as well as offering research opportunities in other disciplines such as biology, geology and engineering. A key component of the Sanford Underground Research Facility (SURF) is the Davis Campus, which is in operation at the 4850-foot level (4300 m.w.e.) and currently hosts two main physics projects: the LUX dark matter experiment and the MAJORANA DEMONSTRATOR neutrinolessdouble-beta decay experiment. In addition, two low-background counters currently operate at the Davis Campus in support of current and future experiments. Expansion of the underground laboratory space is underway at the 4850L Ross Campus in order to maintain and enhance low- background assay capabilities as well as to host a unique nuclear astrophysics accelerator facility. Plans to accommodate other future experiments at SURF are also underway and include the next generation of direct-search dark matter experiments and the Fermilab-led international long- baseline neutrino program. Planning to understand the infrastructure developments necessary to accommodate these future projects is well advanced and in some cases have already started. SURF is a dedicated research facility with significant expansion capability. (paper)
2010-04-01
... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...
Healy Clean Coal Project: Healy coal firing at TRW Cleveland Test Facility
Energy Technology Data Exchange (ETDEWEB)
Koyama, T.; Petrill, E.; Sheppard, D.
1991-08-01
A test burn of two Alaskan coals was conducted at TRW's Cleveland test facility in support of the Healy Clean Coal Project, as part of Clean Coal Technology III Program in which a new power plant will be constructed using a TRW Coal Combustion System. This system features ash slagging technology combined with NO{sub x} and SO{sub x} control. The tests, funded by the Alaska Industrial Development and Export Authority (AIDEA) and TRW, were conducted to verify that the candidate Healy station coals could be successfully fired in the TRW coal combustor, to provide data required for scale-up to the utility project size requirements, and to produce sufficient flash-calcined material (FCM) for spray dryer tests to be conducted by Joy/NIRO. The tests demonstrated that both coals are viable candidates for the project, provided the data required for scale-up, and produced the FCM material. This report describes the modifications to the test facility which were required for the test burn, the tests run, and the results of the tests.
International Nuclear Information System (INIS)
Wogman, N.A.
1976-12-01
Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables
Project W-314 241-AN-A valve pit upgrade acceptance for beneficial use
Energy Technology Data Exchange (ETDEWEB)
HAMMERS, J.S.
1999-07-21
This report identifies the responsibilities and requirements, applicable to the 241-AN-A Valve Pit Upgrades portion of Project W-314, for Acceptance for Beneficial Use in accordance with HNF-IP-0842, Vol IV, Sec 3.12. At project turnover, the end user accepts the affected Structures, Systems, and Components (SSCs) for beneficial use. This checklist is used to help the end user ensure that all documentation, training, and testing requirements are met prior to turnover. This checklist specifically identifies those items related to the upgrading of the 241-AN-A valve pit. The upgrades include: the installation of jumper/valve manifolds with position sensors, replacement pit leak detection systems, construction of replacement cover blocks, and electrical upgrades to support the instrumentation upgrades.
Project W-314 241-AN-A valve pit upgrade acceptance for beneficial use
International Nuclear Information System (INIS)
HAMMERS, J.S.
1999-01-01
This report identifies the responsibilities and requirements, applicable to the 241-AN-A Valve Pit Upgrades portion of Project W-314, for Acceptance for Beneficial Use in accordance with HNF-IP-0842, Vol IV, Sec 3.12. At project turnover, the end user accepts the affected Structures, Systems, and Components (SSCs) for beneficial use. This checklist is used to help the end user ensure that all documentation, training, and testing requirements are met prior to turnover. This checklist specifically identifies those items related to the upgrading of the 241-AN-A valve pit. The upgrades include: the installation of jumper/valve manifolds with position sensors, replacement pit leak detection systems, construction of replacement cover blocks, and electrical upgrades to support the instrumentation upgrades
International Nuclear Information System (INIS)
Sullivan, N.
1995-01-01
This document provides the Functional Design Criteria (FDC) for Project C-018H, the 242-A Evaporator and Plutonium-Uranium Extraction (PUREX) Plant Condensate Treatment Facility (Also referred to as the 200 Area Effluent Treatment Facility [ETF]). The project will provide the facilities to treat and dispose of the 242-A Evaporator process condensate (PC), the Plutonium-Uranium Extraction (PUREX) Plant process condensate (PDD), and the PUREX Plant ammonia scrubber distillate (ASD)
Iraq nuclear facility dismantlement and disposal project
Energy Technology Data Exchange (ETDEWEB)
Cochran, J R; Danneels, J [Sandia National Laboratories, Albuquerque, NM (United States); Kenagy, W D [U.S. Department of State, Bureau of International Security and Nonproliferation, Office of Nuclear Energy, Safety and Security, Washington, DC (United States); Phillips, C J; Chesser, R K [Center for Environmental Radiation Studies, Texas Tech University, Lubbock, TX (United States)
2007-07-01
The Al Tuwaitha nuclear complex near Baghdad contains a significant number of nuclear facilities from Saddam Hussein's dictatorship. Because of past military operations, lack of upkeep and looting there is now an enormous radioactive waste problem at Al Tuwaitha. Al Tuwaitha contains uncharacterised radioactive wastes, yellow cake, sealed radioactive sources, and contaminated metals. The current security situation in Iraq hampers all aspects of radioactive waste management. Further, Iraq has never had a radioactive waste disposal facility, which means that ever increasing quantities of radioactive waste and material must be held in guarded storage. The Iraq Nuclear Facility Dismantlement and Disposal Program (the NDs Program) has been initiated by the U.S. Department of State (DOS) to assist the Government of Iraq (GOI) in eliminating the threats from poorly controlled radioactive materials, while building human capacities so that the GOI can manage other environmental cleanups in their country. The DOS has funded the International Atomic Energy Agency (IAEA) to provide technical assistance to the GOI via a Technical Cooperation Project. Program coordination will be provided by the DOS, consistent with U.S. and GOI policies, and Sandia National Laboratories will be responsible for coordination of participants and for providing waste management support. Texas Tech University will continue to provide in-country assistance, including radioactive waste characterization and the stand-up of the Iraq Nuclear Services Company. The GOI owns the problems in Iraq and will be responsible for the vast majority of the implementation of the NDs Program. (authors)
Functional design criteria radioactive liquid waste line replacement, Project W-087. Revision 3
International Nuclear Information System (INIS)
McVey, C.B.
1994-01-01
This document provides the functional design criteria for the 222-S Laboratory radioactive waste drain piping and transfer pipeline replacement. The project will replace the radioactive waste drain piping from the hot cells in 222-S to the 219-S Waste Handling Facility and provide a new waste transfer route from 219-S to the 244-S Catch Station in Tank Farms
PNC/DOE Remote Monitoring Project at Japan's Joyo Facility
International Nuclear Information System (INIS)
Ross, M.; Hashimoto, Yu; Sonnier, C.; Dupree, S.; Ystesund, K.; Hale, W.
1996-01-01
The Power Reactor and Nuclear Fuel Development Corporation (PNC) of Japan and the US Department of Energy (DOE) are cooperating on the development of a remote monitoring system for nuclear nonproliferation efforts. This cooperation is part of a broader safeguards agreement between PNC and DOE. A remote monitoring system is being installed in a spent fuel storage area at PNC's experimental reactor facility Joyo in Oarai. The system has been designed by Sandia National Laboratories (SNL) and is closely related to those used in other SNL remote monitoring projects. The Joyo project will particularly study the unique aspects of remote monitoring in contribution to nuclear nonproliferation. The project will also test and evaluate the fundamental design and implementation of the remote monitoring system in its application to regional and international safeguards efficiency. This paper will present a short history of the cooperation, the details of the monitoring system and a general schedule of activities
Results of high heat flux qualification tests of W monoblock components for WEST
Greuner, H.; Böswirth, B.; Lipa, M.; Missirlian, M.; Richou, M.
2017-12-01
One goal of the WEST project (W Environment in Steady-state Tokamak) is the manufacturing, quality assessment and operation of ITER-like actively water-cooled divertor plasma facing components made of tungsten. Six W monoblock plasma facing units (PFUs) from different suppliers have been successfully evaluated in the high heat flux test facility GLADIS at IPP. Each PFU is equipped with 35 W monoblocks of an ITER-like geometry. However, the W blocks are made of different tungsten grades and the suppliers applied different bonding techniques between tungsten and the inserted Cu-alloy cooling tubes. The intention of the HHF test campaign was to assess the manufacturing quality of the PFUs on the basis of a statistical analysis of the surface temperature evolution of the individual W monoblocks during thermal loading with 100 cycles at 10 MW m-2. These tests confirm the non-destructive examinations performed by the manufacturer and CEA prior to the installation of the WEST platform, and no defects of the components were detected.
Results of high heat flux qualification tests of W monoblock components for WEST
International Nuclear Information System (INIS)
Greuner, H; Böswirth, B; Lipa, M; Missirlian, M; Richou, M
2017-01-01
One goal of the WEST project (W Environment in Steady-state Tokamak) is the manufacturing, quality assessment and operation of ITER-like actively water-cooled divertor plasma facing components made of tungsten. Six W monoblock plasma facing units (PFUs) from different suppliers have been successfully evaluated in the high heat flux test facility GLADIS at IPP. Each PFU is equipped with 35 W monoblocks of an ITER-like geometry. However, the W blocks are made of different tungsten grades and the suppliers applied different bonding techniques between tungsten and the inserted Cu-alloy cooling tubes. The intention of the HHF test campaign was to assess the manufacturing quality of the PFUs on the basis of a statistical analysis of the surface temperature evolution of the individual W monoblocks during thermal loading with 100 cycles at 10 MW m −2 . These tests confirm the non-destructive examinations performed by the manufacturer and CEA prior to the installation of the WEST platform, and no defects of the components were detected. (paper)
Mission Need Statement: Idaho Spent Fuel Facility Project
Energy Technology Data Exchange (ETDEWEB)
Barbara Beller
2007-09-01
Approval is requested based on the information in this Mission Need Statement for The Department of Energy, Idaho Operations Office (DOE-ID) to develop a project in support of the mission established by the Office of Environmental Management to "complete the safe cleanup of the environmental legacy brought about from five decades of nuclear weapons development and government-sponsored nuclear energy research". DOE-ID requests approval to develop the Idaho Spent Fuel Facility Project that is required to implement the Department of Energy's decision for final disposition of spent nuclear fuel in the Geologic Repository at Yucca Mountain. The capability that is required to prepare Spent Nuclear Fuel for transportation and disposal outside the State of Idaho includes characterization, conditioning, packaging, onsite interim storage, and shipping cask loading to complete shipments by January 1,2035. These capabilities do not currently exist in Idaho.
Project No.3 - Cement solidification facility for spent ion exchange resins
International Nuclear Information System (INIS)
2000-01-01
The existing storage capacity remaining for radioactive liquid wastes at the Ignalina NPP site is approximately 800 m 3 . The condition of the tanks is not fully known; however, recent engineering assessments have indicated that the tanks are unsuitable for interim storage of the liquid waste. The liquid waste currently stored in the tanks will need to be immobilised and the storage tanks emptied before they begin to deteriorate. The potential environment impact of these facilities must be reduced significantly. Project activities includes the design, construction and commissioning of the proposed facility, including all licensing documentation
International Nuclear Information System (INIS)
Wogman, N.A.; Rieck, H.G. Jr.; Laul, J.C.; MacMurdo, K.W.
1976-09-01
A 252 Cf activation analysis facility has been developed for routine multielement analysis of a wide variety of solid and liquid samples. The facility contains six sources of 252 Cf totaling slightly over 100 mg. These sources are placed in a 93 percent 235 U-enriched uranium core which is subcritical with a K effective of 0.985 (multiplication factor of 66). The system produces a thermal flux on the order of 10 +1 neutrons per square centimeter per second. A pneumatic rabbit system permits automatic irradiation, decay, and counting regimes to be performed unattended on the samples. The activated isotopes are analyzed through their photon emissions with state-of-the-art intrinsic Ge detectors, Ge(Li) detectors, and NaI(Tl) multidimensional gamma ray spectrometers. High efficiency (25 percent), low background, anticoincidence shielded Ge(Li) gamma ray detector systems have been constructed to provide the lowest possible background, yet maintain a peak to Compton ratio of greater than 1000 to 1. The multidimensional gamma ray spectrometer systems are composed of 23 cm diameter x 20 cm thick NaI(Tl) crystals surrounded by NaI(Tl) anticoincidence shields. The detection limits for over 65 elements have been determined for this system. Over 40 elements are detectable at the 1 part per million level at a precision of +-10 percent
Neutron shielding for a 252 Cf source
International Nuclear Information System (INIS)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente
2006-01-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
48 CFR 252.225-7044 - Balance of Payments Program-Construction Material.
2010-10-01
... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...
International Nuclear Information System (INIS)
Gramotkin, F.; Kuzmyak, I.; Kravtsov, V.
2015-01-01
The paper considers the possibility of using the project management methodology developed by the Project Management Institute (USA) in nuclear security in terms of modernization or development of physical protection system at nuclear facility. It was demonstrated that this methodology allows competent and flexible management of the projects on physical protection, ensuring effective control of their timely implementation in compliance with the planned budget and quality
Project W-320, 241-C-106 sluicing: Construction specification W-320-C1
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
Project W-320, Waste Retrieval Sluicing System (WRSS), specification is for procurement, fabrication and installation of equipment at the C Tank Farm, including Operator Station and some equipment just outside the C Tank Farm fence, necessary to support the sluicing operation. Work consists of furnishing labor, equipment, and materials to provide the means to procure materials and equipment, fabricate items, excavate and place concrete, and install equipment, piping, wiring, and structures in accordance with the Contract Documents. Major work elements include: Excavation for process and fire protection piping, electrical conduit trenches, and foundations for small structures; Placement of concrete cover blocks, foundations, and equipment pads; Procurement and installation of double walled piping, electrical conduit, fire and raw water piping, chilled water piping, and electrical cable; Procurement and installation of above-ground ventilation system piping between the (HVAC) Process building and Tank C-106; Core drill existing concrete; Furnish and installation of electrical distribution equipment; Installation of the concrete foundation, and assembly installation of the two Seismic Shutdown Systems with Environmental Enclosures; Fabrication and installation of in-pit pipe jumpers, including related valves, instruments and wiring; and Installation of a vertical submersible pump, horizontal booster pump, and winch assembly into tank access riser pits
Neves, Celine A.
2012-01-01
The federal government spends much money on information technology (IT) projects each year, yet numerous IT projects continue to underperform. For instance, in Fiscal Year 2008, OMB and federal agencies identified approximately 413 IT projects ($25.2 billion) as being poorly planned, poorly performing, or both. Agencies struggle to implement sound…
International Nuclear Information System (INIS)
1996-08-01
This HASP describes the process for identifying the requirements, written safety documentation, and procedures for protecting personnel involved in the Isotopes Facilities Deactivation Project. Objective of this project is to place 19 former isotope production facilities at ORNL in a safe condition in anticipation of an extended period of minimum surveillance and maintenance
International Nuclear Information System (INIS)
1993-07-01
The Uranium Mill Tailings Remedial Action (UMTRA) hydrochemistry facility is used to perform a limited but important set of services for the UMTRA Project. Routine services include support of field-based hydrological and geochemical operations and water sampling activities. Less commonly, the hydrology and geochemistry staff undertake special studies and site characterization studies at this facility. It is also used to train hydrologists, geochemists, and groundwater sampling crews. A review of this Quality Assurance Project Plan (QAPP) shall be accomplished once each calendar year. This review will be targeted to be accomplished not sooner than 6 months and not later than 18 months after the last review
38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods.
2010-07-01
...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...
Project summary plan for HTGR recycle reference facility
International Nuclear Information System (INIS)
Baxter, B.J.
1979-11-01
A summary plan is introduced for completing conceptual definition of an HTGR Recycle Reference Facility (HRRF). The plan describes a generic project management concept, often referred to as the requirements approach to systems engineering. The plan begins with reference flow sheets and provides for the progressive evolution of HRRF requirements and definition through feasibility, preconceptual, and conceptual phases. The plan lays end-to-end all the important activities and elements to be treated during each phase of design. Identified activities and elements are further supported by technical guideline documents, which describe methodology, needed terminology, and where relevant a worked example
Proceedings of the workshops on 'JAEA project researches at J-PARC/MLF'
International Nuclear Information System (INIS)
Kajimoto, Ryoichi; Maekawa, Fujio; Arima, Hiroshi; Yoshinari, Shizuka; Arai, Masatoshi
2011-06-01
The operation for public use of Materials and Life Science Experimental Facility (MLF) at Japan Proton Accelerator Research Complex (J-PARC) has started since the end of 2008. Rather stable neutron and muon beams at 120 kW are being supplied throughout 2010. Some of the instruments have already produced several good scientific outputs. Furthermore, operation at 200 kW, which exceeds the beam power of the ISIS facility in UK, has started since December 2010. In this promising situation for MLF, we hold three workshops for five neutron instruments which conducted researches for projects by Japan Atomic Energy Agency (JAEA) (project researches): 'Workshop on BL19 (Sep. 29)', 'Workshop on BL04+BL10 (Oct. 28)', and 'Workshop on BL01+BL14 (Oct. 29)'. There, status of the instruments and recent results of the project researches as well as a part of researches by general users were reported, and future directions and issues to be solved of the researches were discussed. This report includes abstracts, materials of the presentations and summary of discussions in the workshops. (author)
24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act.
2010-04-01
.... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...
50 CFR 14.252 - What definitions do I need to know?
2010-10-01
... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...
Feasibility Investigation for a Solar Power Generation Facility
Nathan, Lakshmi
2010-01-01
The Energy Policy Act of 2005 states that by fiscal year 2013, at least 7.5% of the energy consumed by the government must be renewable energy. In an effort to help meet this goal, Johnson Space Center (JSC) is considering installing a solar power generation facility. The purpose of this project is to conduct a feasibility investigation for such a facility. Because Kennedy Space Center (KSC) has a solar power generation facility, the first step in this investigation is to learn about KSC's facility and obtain information on how it was constructed. After collecting this information, the following must be determined: the amount of power desired, the size of the facility, potential locations for it, and estimated construction and maintenance costs. Contacts with JSC's energy provider must also be established to determine if a partnership would be agreeable to both parties. Lastly, all of this data must be analyzed to decide whether or not JSC should construct the facility. The results from analyzing the data collected indicate that a 200 kW facility would provide enough energy to meet 1% of JSC's energy demand. This facility would require less than 1 acre of land. In the map below, potential locations are shown in green. The solar power facility is projected to cost $2 M. So far, the information collected indicates that such a facility could be constructed. The next steps in this investigation include contacting JSC's energy provider, CenterPoint Energy, to discuss entering a partnership; developing a life cycle cost analysis to determine payback time; developing more detailed plans; and securing funding.
J-PARC Transmutation Experimental Facility Programme
International Nuclear Information System (INIS)
Sasa, T.; Takei, H.; Saito, S.; Obayashi, H.; Nishihara, K.; Sugawara, T.; Iwamoto, H.; Yamaguchi, K.; Tsujimoto, K.; Oigawa, H.
2015-01-01
Since the Fukushima accident, nuclear transmutation is considered as an option for waste management. Japan Atomic Energy Agency proposes the transmutation of minor actinides (MA) in accelerator-driven system (ADS) using lead-bismuth eutectic alloy (LBE) as a spallation target and a coolant of subcritical core. To obtain the data required for ADS design, we plan the building of a transmutation experimental facility (TEF) is planned within the J-PARC project. TEF consists of an ADS target test facility (TEF-T), which will be installed 400 MeV-250 kW LBE spallation target for material irradiations, and a transmutation physics experimental facility (TEF-P), which set up a fast critical/subcritical assembly driven by low power proton beam with MA fuel to study ADS neutronics. At TEF-T, various research plans to use emitted neutrons from LBE target are discussed. The paper summarises a road-map to establish the ADS transmuter and latest design activities for TEF construction. (authors)
Higher dimensional uniformisation and W-geometry
International Nuclear Information System (INIS)
Govindarajan, S.
1995-01-01
We formulate the uniformisation problem underlying the geometry of W n -gravity using the differential equation approach to W-algebras. We construct W n -space (analogous to superspace in supersymmetry) as an (n-1)-dimensional complex manifold using isomonodromic deformations of linear differential equations. The W n -manifold is obtained by the quotient of a Fuchsian subgroup of PSL(n,R) which acts properly discontinuously on a simply connected domain in bfCP n-1 . The requirement that a deformation be isomonodromic furnishes relations which enable one to convert non-linear W-diffeomorphisms to (linear) diffeomorphisms on the W n -manifold. We discuss how the Teichmueller spaces introduced by Hitchin can then be interpreted as the space of complex structures or the space of projective structures with real holonomy on the W n -manifold. The projective structures are characterised by Halphen invariants which are appropriate generalisations of the Schwarzian. This construction will work for all ''generic'' W-algebras. (orig.)
The status of low dose rate and future of high dose rate Cf-252 brachytherapy
International Nuclear Information System (INIS)
Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.
1997-12-01
This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly
International Nuclear Information System (INIS)
Mihalczo, J.T.
1987-01-01
The 252 Cf-source-driven neutron noise analysis method was evaluated to determine if it could be used to measure the subcriticality of storage casks of burnt LWR fuel submerged in fuel storage pools, fully loaded and as they are being loaded. The motivation for this evaluation was that measurements of k/sub eff/ would provide the parameter most directly related to the criticality safety of storage cask configurations of LWR fuel and could allow proper credit for fuel burnup without reliance on calculations. This in turn could lead to more cost-effective cask designs. Evaluation of the method for this application was based on (1) experiments already completed at a critical experiments facility using arrays of PWR fuel pins typical of the size of storage cask configurations, (2) the existence of neutron detectors that can function in shipping cask environments, and (3) the ability to construct ionization chambers containing 252 Cf of adequate intensity for these measurements. These three considerations are discussed
Waste Receiving and Processing Facility, Module 1: Volume 7, Project design criteria
International Nuclear Information System (INIS)
1992-03-01
This Project Design Criteria document for the WRAP facility at the Hanford Site is presented within a systems format. The WRAP Module 1 facility has been categorized into eight (8) engineering systems for design purposes. These systems include: receiving, shipping and storage, nondestructive assay/nondestructive examination (NDA/NDE), waste process, internal transportation, building, heating ventilation and air conditioning (HVAC), process control, and utilities. Within each system section of this document, the system-specific requirements are identified. The scope of the system is defined, the design goals are identified and the functional requirements are detailed
48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts).
2010-10-01
... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...
Integration of a functionally graded W/Cu transition for divertor components of fusion facilities
International Nuclear Information System (INIS)
Pintsuk, G.
2004-01-01
/Cu-interlayer, OFHC-Cu (Oxygen free high conductivity) and CuCrZr will be done by hot isostatic pressing. Parameters are a temperature of 550 C an a pressure of 195 MPa. Electrochemical deposited copper and nickel are added. Copper is used as surface layer of the graded W/Cu-composite and nickel for the strengthening of the diffusion bonding. Ultra-sonic-testing revealed narrow areas with inhomogeneous bonding at the interface, mainly nearby the outer surface of the module. The module containing the macro-brush has been tested at the electron-beam test facility JUDITH. It survived power loads at steady state operation of 23.8 MW/m 2 and 150 cycles at 20 MW/m 2 during thermal fatigue experiments. These results verify, that the insertion of a graded W/Cu-interlayer increases the resistance against thermal loads. Especially in the combination with the castellated structure. (orig.)
Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources
Energy Technology Data Exchange (ETDEWEB)
Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-04-01
A new, stronger 252Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing 252Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger 252Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our 252Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.
Experimental determination of the transient heat absorption of W divertor materials
International Nuclear Information System (INIS)
Greuner, H; Böswirth, B; Eich, T; Herrmann, A; Maier, H; Sieglin, B
2014-01-01
Fast infrared (IR) thermography resolves the transient edge localized mode (ELM) induced heat fluxes on divertor components on time scales of a few hundred microseconds. These heat loads range from 10 to several 100 MW m −2 and energy densities of 15–200 kJ m −2 . The calculation of the local ELM heat flux depends on the so-called surface heat transfer coefficient very sensitively. Therefore we performed dedicated experiments in the high heat flux test facility GLADIS with well-defined temporal and spatial shape of heat fluxes to reduce the uncertainties of the ELM heat flux calculations in JET. We have experimentally determined the surface heat transfer coefficient for the W components used as divertor components of the JET ILW project. Based on the results of the measured transient heat absorption, the coefficient was deduced in a temperature range from 400 to 1200 °C for the bulk W lamella and for 10 and 20 μm W-coated carbon fibre reinforced carbon tiles, respectively. The measurements allow an improved estimation of ELM heat loads in JET on W and W-coated tiles and an error estimate of the absorbed heat flux. (paper)
Education & Collection Facility GSHP Demonstration Project
Energy Technology Data Exchange (ETDEWEB)
Joplin, Jeff [Denver Museum of Nature and Science, Denver, CO (United States)
2015-03-28
The Denver Museum of Nature & Science (DMNS) designed and implemented an innovative ground source heat pump (GSHP) system for heating and cooling its new Education and Collection Facility (ECF) building addition. The project goal was to successfully design and install an open-loop GSHP system that utilized water circulating within an underground municipal recycled (non-potable) water system as the heat sink/source as a demonstration project. The expected results were to significantly reduce traditional GSHP installation costs while increasing system efficiency, reduce building energy consumption, require significantly less area and capital to install, and be economically implemented wherever access to a recycled water system is available. The project added to the understanding of GSHP technology by implementing the first GSHP system in the United States utilizing a municipal recycled water system as a heat sink/source. The use of this fluid through a GSHP system has not been previously documented. This use application presents a new opportunity for local municipalities to develop and expand the use of underground municipal recycled (non-potable) water systems. The installation costs for this type of technology in the building structure would be a cost savings over traditional GSHP costs, provided the local municipal infrastructure was developed. Additionally, the GSHP system functions as a viable method of heat sink/source as the thermal characteristics of the fluid are generally consistent throughout the year and are efficiently exchanged through the GSHP system and its components. The use of the recycled water system reduces the area required for bore or loop fields; therefore, presenting an application for building structures that have little to no available land use or access. This GSHP application demonstrates the viability of underground municipal recycled (non-potable) water systems as technically achievable, environmentally supportive, and an efficient
The ISOL exotic beam facility at LNS: the EXCYT project
International Nuclear Information System (INIS)
Ciavola, G.; Calabretta, L.; Cuttone, G.; Di Bartolo, G.; Finocchiaro, P.; Gammino, S.; Gu, M.; Migneco, E.; Raia, G.; Rifuggiato, D.; Rovelli, A.; Vinciguerra, D.; Qin, J.; Wollnik, H.
1997-01-01
The aim of the EXCYT project (exotics with cyclotron and tandem) is the development of a facility for producing and accelerating exotic beams from 0.2 up to 8 MeV/amu. EXCYT is based on the ''two accelerators'' method. A K=800 superconducting cyclotron, axially injected by the ECR ion source SERSE, will deliver the primary beam. Such a beam will produce the required nuclear species in a modified ISOLDE type target-source complex. When required, a 15 MV tandem Van der Graaff will accelerate the secondary beams. Both accelerators are existing and operational at Laboratorio Nazionale del Sud. Concerning the status of the project, progress has been made in most of the key issues of the project, like the construction of SERSE, cyclotron upgrading, modification of the existing building, high resolution mass separator, and diagnostic equipment for low energy, low intensity beams. (orig.)
The ISOL exotic beam facility at LNS: the EXCYT project
Energy Technology Data Exchange (ETDEWEB)
Ciavola, G.; Calabretta, L.; Cuttone, G.; Di Bartolo, G.; Finocchiaro, P.; Gammino, S.; Gu, M.; Migneco, E.; Raia, G.; Rifuggiato, D.; Rovelli, A.; Vinciguerra, D. [Istituto Nazionale di Fisica Nucleare, Catania (Italy); Qin, J. [Institute of Atomic Energy, Beijing (China); Wollnik, H. [Giessen Univ. (Germany)
1997-04-01
The aim of the EXCYT project (exotics with cyclotron and tandem) is the development of a facility for producing and accelerating exotic beams from 0.2 up to 8 MeV/amu. EXCYT is based on the ``two accelerators`` method. A K=800 superconducting cyclotron, axially injected by the ECR ion source SERSE, will deliver the primary beam. Such a beam will produce the required nuclear species in a modified ISOLDE type target-source complex. When required, a 15 MV tandem Van der Graaff will accelerate the secondary beams. Both accelerators are existing and operational at Laboratorio Nazionale del Sud. Concerning the status of the project, progress has been made in most of the key issues of the project, like the construction of SERSE, cyclotron upgrading, modification of the existing building, high resolution mass separator, and diagnostic equipment for low energy, low intensity beams. (orig.). 8 refs.
International Nuclear Information System (INIS)
1995-01-01
The Nuclear Materials Storage Facility (NMSF) at the Los Alamos National Laboratory (LANL) was a Fiscal Year (FY) 1984 line-item project completed in 1987 that has never been operated because of major design and construction deficiencies. This renovation project, which will correct those deficiencies and allow operation of the facility, is proposed as an FY 97 line item. The mission of the project is to provide centralized intermediate and long-term storage of special nuclear materials (SNM) associated with defined LANL programmatic missions and to establish a centralized SNM shipping and receiving location for Technical Area (TA)-55 at LANL. Based on current projections, existing storage space for SNM at other locations at LANL will be loaded to capacity by approximately 2002. This will adversely affect LANUs ability to meet its mission requirements in the future. The affected missions include LANL's weapons research, development, and testing (WRD ampersand T) program; special materials recovery; stockpile survelliance/evaluation; advanced fuels and heat sources development and production; and safe, secure storage of existing nuclear materials inventories. The problem is further exacerbated by LANL's inability to ship any materials offsite because of the lack of receiver sites for mate rial and regulatory issues. Correction of the current deficiencies and enhancement of the facility will provide centralized storage close to a nuclear materials processing facility. The project will enable long-term, cost-effective storage in a secure environment with reduced radiation exposure to workers, and eliminate potential exposures to the public. This document provides Part I - Design Concept which describes the selected solution, and Part II - Project Management which describes the management system organization, the elements that make up the system, and the control and reporting system
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-07-14
The Nuclear Materials Storage Facility (NMSF) at the Los Alamos National Laboratory (LANL) was a Fiscal Year (FY) 1984 line-item project completed in 1987 that has never been operated because of major design and construction deficiencies. This renovation project, which will correct those deficiencies and allow operation of the facility, is proposed as an FY 97 line item. The mission of the project is to provide centralized intermediate and long-term storage of special nuclear materials (SNM) associated with defined LANL programmatic missions and to establish a centralized SNM shipping and receiving location for Technical Area (TA)-55 at LANL. Based on current projections, existing storage space for SNM at other locations at LANL will be loaded to capacity by approximately 2002. This will adversely affect LANUs ability to meet its mission requirements in the future. The affected missions include LANL`s weapons research, development, and testing (WRD&T) program; special materials recovery; stockpile survelliance/evaluation; advanced fuels and heat sources development and production; and safe, secure storage of existing nuclear materials inventories. The problem is further exacerbated by LANL`s inability to ship any materials offsite because of the lack of receiver sites for mate rial and regulatory issues. Correction of the current deficiencies and enhancement of the facility will provide centralized storage close to a nuclear materials processing facility. The project will enable long-term, cost-effective storage in a secure environment with reduced radiation exposure to workers, and eliminate potential exposures to the public. This document provides Part I - Design Concept which describes the selected solution, and Part II - Project Management which describes the management system organization, the elements that make up the system, and the control and reporting system.
K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase
International Nuclear Information System (INIS)
Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.
1988-01-01
Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase
Energy Technology Data Exchange (ETDEWEB)
1992-12-31
The possible environmental impacts from the construction and operation of a waste water treatment facility for the West Valley Demonstration Project are presented. The West Valley Project is a demonstration project on the solidification of high-level radioactive wastes. The need for the facility is the result of a rise in the work force needed for the project which rendered the existing sewage treatment plant incapable of meeting the nonradioactive waste water treatment needs.
International Nuclear Information System (INIS)
1992-01-01
The possible environmental impacts from the construction and operation of a waste water treatment facility for the West Valley Demonstration Project are presented. The West Valley Project is a demonstration project on the solidification of high-level radioactive wastes. The need for the facility is the result of a rise in the work force needed for the project which rendered the existing sewage treatment plant incapable of meeting the nonradioactive waste water treatment needs
Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy
Energy Technology Data Exchange (ETDEWEB)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)
1984-01-01
Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.
2017-06-01
As part of an Urban Partnership Agreement project, the Minnesota Department of Transportation added lanes : and began operating a priced dynamic shoulder lane (PDSL) on parts of Interstate 35W. Following the opening of : these improvements, the frequ...
Project W-320, 241-C-106 sluicing electrical calculations, Volume 2
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
This supporting document has been prepared to make the FDNW calculations for Project W-320, readily retrievable. These calculations are required: To determine the power requirements needed to power electrical heat tracing segments contained within three manufactured insulated tubing assemblies; To verify thermal adequacy of tubing assembly selection by others; To size the heat tracing feeder and branch circuit conductors and conduits; To size protective circuit breaker and fuses; and To accomplish thermal design for two electrical heat tracing segments: One at C-106 tank riser 7 (CCTV) and one at the exhaust hatchway (condensate drain). Contents include: C-Farm electrical heat tracing; Cable ampacity, lighting, conduit fill and voltage drop; and Control circuit sizing and voltage drop analysis for the seismic shutdown system
W-320 Department of Health documentation
International Nuclear Information System (INIS)
Bailey, J.W.
1998-01-01
The purpose of this document is to gather information required to show that Project W-320 is in compliance with Washington State Department of Health requirements as specified in Radioactive Air Emissions Notice of Construction Project W-320, Tank 241-C-106 Sluicing, DOE/RL-95-45. Specifically, that W-320 is in compliance with ASME N509-1989 (Nuclear Power Plant Air-Cleaning Units and Components) and ASME N5 10-1989 (Testing of Nuclear Air Treatment Systems) for the 296-C-006 exhaust system
W-320 Department of Health documentation
Energy Technology Data Exchange (ETDEWEB)
Bailey, J.W.
1998-08-07
The purpose of this document is to gather information required to show that Project W-320 is in compliance with Washington State Department of Health requirements as specified in Radioactive Air Emissions Notice of Construction Project W-320, Tank 241-C-106 Sluicing, DOE/RL-95-45. Specifically, that W-320 is in compliance with ASME N509-1989 (Nuclear Power Plant Air-Cleaning Units and Components) and ASME N5 10-1989 (Testing of Nuclear Air Treatment Systems) for the 296-C-006 exhaust system.
Readiness assessment plan for the Radioactive Mixed Waste Land Disposal Facility (Trench 31)
International Nuclear Information System (INIS)
Irons, L.G.
1994-01-01
This document provides the Readiness Assessment Plan (RAP) for the Project W-025 (Radioactive Mixed Waste Land Disposal Facility) Readiness Assessment (RA). The RAP documents prerequisites to be met by the operating organization prior to the RA. The RAP is to be implemented by the RA Team identified in the RAP. The RA Team is to verify the facility's compliance with criteria identified in the RAP. The criteria are based upon the open-quotes Core Requirementsclose quotes listed in DOE Order 5480.31, open-quotes Startup and Restart of Nuclear Facilitiesclose quotes
48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property.
2010-10-01
... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...
48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330).
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...
Conceptual Design Report: Nevada Test Site Mixed Waste Disposal Facility Project
International Nuclear Information System (INIS)
2009-01-01
Environmental cleanup of contaminated nuclear weapons manufacturing and test sites generates radioactive waste that must be disposed. Site cleanup activities throughout the U.S. Department of Energy (DOE) complex are projected to continue through 2050. Some of this waste is mixed waste (MW), containing both hazardous and radioactive components. In addition, there is a need for MW disposal from other mission activities. The Waste Management Programmatic Environmental Impact Statement Record of Decision designates the Nevada Test Site (NTS) as a regional MW disposal site. The NTS has a facility that is permitted to dispose of onsite- and offsite-generated MW until November 30, 2010. There is not a DOE waste management facility that is currently permitted to dispose of offsite-generated MW after 2010, jeopardizing the DOE environmental cleanup mission and other MW-generating mission-related activities. A mission needs document (CD-0) has been prepared for a newly permitted MW disposal facility at the NTS that would provide the needed capability to support DOE's environmental cleanup mission and other MW-generating mission-related activities. This report presents a conceptual engineering design for a MW facility that is fully compliant with Resource Conservation and Recovery Act (RCRA) and DOE O 435.1, 'Radioactive Waste Management'. The facility, which will be located within the Area 5 Radioactive Waste Management Site (RWMS) at the NTS, will provide an approximately 20,000-cubic yard waste disposal capacity. The facility will be licensed by the Nevada Division of Environmental Protection (NDEP)
Test and User Facilities | NREL
Test and User Facilities Test and User Facilities Our test and user facilities are available to | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z B Battery Thermal and Life Test Facility Biochemical Conversion Pilot Plant C Controllable Grid Interface Test System D Dynamometer Test Facilities
Radionuclide 252Cf neutron source
International Nuclear Information System (INIS)
Kolevatov, Yu.I.; Trykov, L.A.
1979-01-01
Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV
International Nuclear Information System (INIS)
Fruland, R.M.; Lundgren, R.E.
1989-04-01
This report describes the progress during 1988 of 14 Hanford Site ground-water monitoring projects covering 16 hazardous waste facilities and 1 nonhazardous waste facility (the Solid Waste Landfill). Each of the projects is being conducted according to federal regulations based on the Resource Conservation and Recovery Act (RCRA) of 1976 and the State of Washington Administrative Code. 21 refs., 23 figs., 8 tabs
International Nuclear Information System (INIS)
Guskov, A.; Batanjieva, B.; Kozak, M.W.; Torres-Vidal, C.
2002-01-01
The ISAM safety assessment methodology was applied to RADON-type facilities. The assessments conducted through the ISAM project were among the first conducted for these kinds of facilities. These assessments are anticipated to lead to significantly improved levels of safety in countries with such facilities. Experience gained though this RADON-type Safety Case was already used in Russia while developing national regulatory documents. (author)
International Nuclear Information System (INIS)
Torres-Vidal, C.; Graham, D.; Batandjieva, B.
2002-01-01
The International Atomic Energy Agency (IAEA) Research Coordinated Project on Improvement of Safety Assessment Methodologies for Near Surface Disposal Facilities (ISAM) was launched in November 1997 and it has been underway for three years. The ISAM project was developed to provide a critical evaluation of the approaches and tools used in long-term safety assessment of near surface repositories. It resulted in the development of a harmonised approach and illustrated its application by way of three test cases - vault, borehole and Radon (a particular range of repository designs developed within the former Soviet Union) type repositories. As a consequence, the ISAM project had over 70 active participants and attracted considerable interest involving around 700 experts from 72 Member States. The methodology developed, the test cases, the main lessons learnt and the conclusions have been documented and will be published in the form of an IAEA TECDOC. This paper presents the work of the IAEA on improvement of safety assessment methodologies for near surface waste disposal facilities and the application of these methodologies for different purposes in the individual stages of the repository development. The paper introduces the main objectives, activities and outcome of the ISAM project and summarizes the work performed by the six working groups within the ISAM programme, i.e. Scenario Generation and Justification, Modelling, Confidence Building, Vault, Radon Type Facility and Borehole test cases. (author)
International Nuclear Information System (INIS)
MCGREW, D.L.
1999-01-01
This Requirements Verification Report (RVR) for Project W-314 ''AN Farm to 200E Waste Transfer System'' package provides documented verification of design compliance to all the applicable Project Development Specification (PDS) requirements. Additional PDS requirements verification will be performed during the project's procurement, construction, and testing phases, and the RVR will be updated to reflect this information as appropriate
International Nuclear Information System (INIS)
1995-08-01
The scope of this Activity Data Sheet (ADS) is to provide a detailed plan for the Isotopes Facilities Deactivation Project (IFDP) at the Oak Ridge National Laboratory (ORNL). This project places the former isotopes production facilities in a safe, stable, and environmentally sound condition suitable for an extended period of minimum surveillance and maintenance (S ampersand M) until the facilities are included in the Decontamination and Decommissioning (D ampersand D) Program. The facilities included within this deactivation project are Buildings 3026-C, 3026-D, 3028, 3029, 3038-AHF, 3038-E, 3038-M, 3047, 3517, 7025, and the Center Circle Facilities (Buildings 3030, 3031, 3032, 3033, 3033-A, 3034, and 3118). The scope of deactivation identified in this Baseline Report include surveillance and maintenance activities for each facility, engineering, contamination control and structural stabilization of each facility, radioluminescent (RL) light removal in Building 3026, re-roofing Buildings 3030, 3118, and 3031, Hot Cells Cleanup in Buildings 3047 and 3517, Yttrium (Y) Cell and Barricades Cleanup in Building 3038, Glove Boxes ampersand Hoods Removal in Buildings 3038 and 3047, and Inventory Transfer in Building 3517. For a detailed description of activities within this Work Breakdown Structure (WBS) element, see the Level 6 and Level 7 Element Definitions in Section 3.2 of this report
Accident consequence calculations for project W-058 safety analysis
International Nuclear Information System (INIS)
Van Keuren, J.C.
1997-01-01
Accident consequence analyses have been performed for Project W-058, the Replacement Cross Site Transfer System. using the assumption and analysis techniques developed for the Tank Remediation Waste system Basis for Interim Operation. most potential accident involving the FISTS are bounded by the TWRS BIO analysis. However, the spray leak and pool leak scenarios require revised analyses since the RCSTS design utilizes larger diameter pipe and higher pressures than those analyzed in the TWRS BIO. Also the volume of diversion box and vent station are larger than that assumed for the valve pits in the TWRS BIO, which effects results of sprays or spills into the pits. the revised analysis for the spray leak is presented in Section 2, for the above ground spill in Section 3, for the presented in Section 2, for the above ground spill in Section 3, for the subsurface spill forming a pool in Section 4, and for the subsurface pool remaining subsurface in Section 5. The conclusion from these sections are summarized below
Project W-320 SAR and process control thermal analyses
International Nuclear Information System (INIS)
Sathyanarayana, K.
1997-01-01
This report summarizes the results of thermal hydraulic computer modeling supporting Project W-320 for process control and SAR documentation. Parametric analyses were performed for the maximum steady state waste temperature. The parameters included heat load distribution, tank heat load, fluffing factor and thermal conductivity. Uncertainties in the fluffing factor and heat load distribution had the largest effect on maximum waste temperature. Safety analyses were performed for off normal events including loss of ventilation, loss of evaporation and loss of secondary chiller. The loss of both the primary and secondary ventilation was found to be the most limiting event with saturation temperature in the bottom waste reaching in just over 30 days. An evaluation was performed for the potential lowering of the supernatant level in tank 241-AY-102. The evaluation included a loss of ventilation and steam bump analysis. The reduced supernatant level decreased the time to reach saturation temperature in the waste for the loss of ventilation by about one week. However, the consequence of a steam bump were dramatically reduced
Project W-314 specific test and evaluation plan for SN-633 transfer line (241-AX-B to 241-AY-02A)
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-633 transfer line by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP). This STEP encompasses all testing activities required to demonstrate compliance to the project design criteria as it relates to the addition of transfer line SN-633. The Project Design Specifications (PDS) identify the specific testing activities required for the Project. Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the transfer line addition. The STEP will be utilized in conjunction with the TEP for verification and validation
International Nuclear Information System (INIS)
Widdop, M.R.
1996-08-01
The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission's domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, also is the remedial action contractor. Building 36 was found to be radiologically contaminated and was demolished in 1996. The soil beneath the building was remediated in accordance with identified standards and can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building
International Nuclear Information System (INIS)
Krabacher, J.E.
1996-08-01
The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7-acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission's domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the GJPO Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, also was the remedial action contractor. Building 52 was found to be radiologically contaminated and was demolished in 1994. The soil area within the footprint of the building has been remediated in accordance with the identified standards and the area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building
Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas
International Nuclear Information System (INIS)
Maruyama, J.; Beach, J.L.; Nagell, J.R. van
1984-01-01
Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de
A pneumatic transfer system for special form 252Cf
International Nuclear Information System (INIS)
Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.
1996-09-01
A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole
Neutron shielding for a {sup 252} Cf source
Energy Technology Data Exchange (ETDEWEB)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com
2006-07-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
Energy Technology Data Exchange (ETDEWEB)
Howerton, Jack; Hwang, Diana
1984-11-01
This report reviews the status of past, present, and proposed future wildlife planning and mitigation programs at existing hydroelectric projects in the Columbia River Basin. The project evaluations will form the basis for determining any needed remedial measures or additional project analysis. Each hydropower facility report is abstracted separately for inclusion in the Energy Data Base.
International Nuclear Information System (INIS)
Melhus, C. S.; Rivard, M. J.; KurKomelis, J.; Liddle, C. B.; Masse, F. X.
2005-01-01
In support of the effort to begin high-dose rate 252 Cf brachytherapy treatments at Tufts-New England Medical Center, the shielding capabilities of a clinical accelerator vault against the neutron and photon emissions from a 1.124 mg 252 Cf source were examined. Outside the clinical accelerator vault, the fast neutron dose equivalent rate was below the lower limit of detection of a CR-39 etched track detector and below 0.14 ± 0.02 μSv h -1 with a proportional counter, which is consistent, within the uncertainties, with natural background. The photon dose equivalent rate was also measured to be below background levels (0.1 μSv h -1 ) using an ionisation chamber and an optically stimulated luminescence dosemeter. A Monte Carlo simulation of neutron transport through the accelerator vault was performed to validate measured values and determine the thermal-energy to low-energy neutron component. Monte Carlo results showed that the dose equivalent rate from fast neutrons was reduced by a factor of 100,000 after attenuation through the vault wall, and the thermal-energy neutron dose equivalent rate would be an additional factor of 1000 below that of the fast neutrons. Based on these findings, the shielding installed in this facility is sufficient for the use of at least 5.0 mg of 252 Cf. (authors)
Latest development in project site radwaste treatment facility (SRTF) Sanmen
International Nuclear Information System (INIS)
Mennicken, K.; Lohmann, P.
2015-01-01
Westinghouse Electric Germany GmbH (WEG) was successful in being awarded a contract as to the planning, delivery, installation and commissioning of radwaste treatment systems for the AP1000 units at Sanmen site, PR China. Operational low and intermediate level radioactive waste will be processed in the Site Radwaste Treatment Facility (SRTF). This paper explains the latest developments of the project, especially the experience with customer-hired Chinese planning partners, installation companies and Customer operating personnel. (authors)
The Advanced Neutron Source (ANS) project: A world-class research reactor facility
International Nuclear Information System (INIS)
Thompson, P.B.; Meek, W.E.
1993-01-01
This paper provides an overview of the Advanced Neutron Source (ANS), a new research facility being designed at Oak Ridge National Laboratory. The facility is based on a 330 MW, heavy-water cooled and reflected reactor as the neutron source, with a thermal neutron flux of about 7.5x10 19 m -2 ·sec -1 . Within the reflector region will be one hot source which will serve 2 hot neutron beam tubes, two cryogenic cold sources serving fourteen cold neutron beam tubes, two very cold beam tubes, and seven thermal neutron beam tubes. In addition there will be ten positions for materials irradiation experiments, five of them instrumented. The paper touches on the project status, safety concerns, cost estimates and scheduling, a description of the site, the reactor, and the arrangements of the facilities
Ceramic Technology Project data base: September 1992 summary report
Energy Technology Data Exchange (ETDEWEB)
Keyes, B.L.P.
1993-06-01
Data presented in this report represent an intense effort to improve processing methods, testing methods, and general mechanical properties (rupture modulus, tensile, creep, stress-rupture, dynamic and cyclic fatigue, fracture toughness) of candidate ceramics for use in advanced heat engines. This work was performed by many facilities and represents only a small part of the data generated by the Ceramic Technology Project (CTP) since 1986. Materials discussed include GTE PY6, GN-10, NT-154, NT-164, SN-260, SN-251, SN-252, AY6, silicon nitride combined with rare-earth oxides, Y-TZP, ZTA, NC-433, NT-230, Hexoloy SA, MgO-PSZ-to-MgO-PSZ joints, MgO-PSZ-to-cast iron, and a few whisker/fiber-reinforced ceramics. Information in this report was taken from the project`s semiannual and bimonthly progress reports and from final reports summarizing the results of individual studies. Test results are presented in tabular form and in graphs. All data, including test rig descriptions and material characterizations, are stored in the CTP data base and are available to all project participants on request. The objective of this report is to make available the test results from these studies but not to draw conclusions from those data.
International Nuclear Information System (INIS)
Widdop, M.R.
1996-07-01
The U.S. Department of Energy (DOE) Junction Projects Office (GJPO) occupies a 61.7 acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission's domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the Grand Junction Projects Office Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, is also the remedial action contractor. Building 44 was radiologically contaminated and the building was demolished in 1994. The soil area within the footprint of the building was not contaminated; it complies with the identified standards and the area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual final report for each contaminated GJPO building
International Nuclear Information System (INIS)
Widdop, M.R.
1996-08-01
The U.S. Department of Energy (DOE) Grand Junction Projects Office (GJPO) occupies a 61.7 acre facility along the Gunnison River near Grand Junction, Colorado. This site was contaminated with uranium ore and mill tailings during uranium refining activities of the Manhattan Engineer District and during pilot milling experiments conducted for the U.S. Atomic Energy Commission's domestic uranium procurement program. The DOE Defense Decontamination and Decommissioning Program established the Grand Junction Projects Office Remedial Action Project to clean up and restore the facility lands, improvements, and the underlying aquifer. The site contractor for the facility, Rust Geotech, was also the remedial action contractor. Building 34 was radiologically contaminated and the building was demolished in 1996. The soil area within the footprint of the building was analyzed and found to be not contaminated. The area can be released for unlimited exposure and unrestricted use. This document was prepared in response to a DOE request for an individual closeout report for each contaminated GJPO building
A status report on the SURF II synchrotron radiation facility at NBS
International Nuclear Information System (INIS)
Madden, R.P.
1980-01-01
Recent work to upgrade the SURF II (Synchrotron Ultraviolet Radiation Facility) storage ring is described, resulting in reliable operation up to 252 MeV at currents in the range 10-20 mA. A wide variety of experiments is now in progress at the facility, encompassing solid state physics, atomic and molecular physics and molecular biology, as well as the all-important radiometric standards work. The instrumentation used for these experiments is described; brief details of the experiments themselves are also given. (orig.)
2010-01-01
... 7 Agriculture 14 2010-01-01 2009-01-01 true Alcohol Production Facilities Planning, Performing... of Part 1980—Alcohol Production Facilities Planning, Performing, Development and Project Control (I..., without recourse to the Government, for the settlement and satisfaction of all contractual and...
International Nuclear Information System (INIS)
Bilal, A.; Kogan, I.I.
1991-01-01
We show that the complex and projective structures on 2D Riemann surfaces are determined by the solutions to the linear differential equations obtained by the hamiltonian reduction of Sl(2,C) connections by the gauge parabolic subgroup. The compatibility of complex (μ) and projective (T) structures appears as the associated zero-curvature condition on the reduced symplectic manifold and is nothing but the conformal Ward identity. Generalizing this construction to the reduction of Sl(n,C) connections by the maximal parabolic gauge subgroup, we obtain generalized complex (μ,ρ,...) and projective (T,W,...) structures. From their compatibility conditions we explicitly obtain the Ward identities of W n -gravity and the operator product expansions of the W n -algebras. The associated linear differential equations (one of which involves the basic differential operator of the nth reduction of the KP hierarchy) allow for a geometric interpretation of the W-symmetries in terms of deformations of flag configurations in the jet bundle Γ (n-1) . We also show how to derive the W n -Ward identities from the quantization of the (2+1)-dimensional Chern-Simons theory. (orig.)
Mohammadpour, Atefeh; Anumba, Chimay J; Messner, John I
2016-07-01
There is a growing focus on enhancing energy efficiency in healthcare facilities, many of which are decades old. Since replacement of all aging healthcare facilities is not economically feasible, the retrofitting of these facilities is an appropriate path, which also provides an opportunity to incorporate energy efficiency measures. In undertaking energy efficiency retrofits, it is vital that the safety of the patients in these facilities is maintained or enhanced. However, the interactions between patient safety and energy efficiency have not been adequately addressed to realize the full benefits of retrofitting healthcare facilities. To address this, an innovative integrated framework, the Patient Safety and Energy Efficiency (PATSiE) framework, was developed to simultaneously enhance patient safety and energy efficiency. The framework includes a step -: by -: step procedure for enhancing both patient safety and energy efficiency. It provides a structured overview of the different stages involved in retrofitting healthcare facilities and improves understanding of the intricacies associated with integrating patient safety improvements with energy efficiency enhancements. Evaluation of the PATSiE framework was conducted through focus groups with the key stakeholders in two case study healthcare facilities. The feedback from these stakeholders was generally positive, as they considered the framework useful and applicable to retrofit projects in the healthcare industry. © The Author(s) 2016.
Lessons Learned from the On-Site Disposal Facility at Fernald Closure Project
International Nuclear Information System (INIS)
Kumthekar, U.A.; Chiou, J.D.
2006-01-01
The On-Site Disposal Facility (OSDF) at the U.S. Department of Energy's (DOE) Fernald Closure Project near Cincinnati, Ohio is an engineered above-grade waste disposal facility being constructed to permanently store low level radioactive waste (LLRW) and treated mixed LLRW generated during Decommissioning and Demolition (D and D) and soil remediation performed in order to achieve the final land use goal at the site. The OSDF is engineered to store 2.93 million cubic yards of waste derived from the remediation activities. The OSDF is intended to isolate its LLRW from the environment for at least 200 years and for up to 1,000 years to the extent practicable and achievable. Construction of the OSDF started in 1997 and waste placement activities will complete by the middle of April 2006 with the final cover (cap) placement over the last open cell by the end of Spring 2006. An on-site disposal alternative is considered critical to the success of many large-scale DOE remediation projects throughout the United States. However, for various reasons this cost effective alternative is not readily available in many cases. Over the last ten years Fluor Fernald Inc. has cumulated many valuable lessons learned through the complex engineering, construction, operation, and closure processes of the OSDF. Also in the last several years representatives from other DOE sites, State agencies, as well as foreign government agencies have visited the Fernald site to look for proven experiences and practices, which may be adapted for their sites. This paper present a summary of the major issues and lessons leaned at the Fernald site related to engineering, construction, operation, and closure processes for the disposal of remediation waste. The purpose of this paper is to share lessons learned and to benefit other projects considering or operating similar on-site disposal facilities from our successful experiences. (authors)
Transition plan: Project C-018H, 200-E Area Effluent Treatment Facility
International Nuclear Information System (INIS)
Connor, M.D.
1994-01-01
The purpose of this transition plan is to ensure an orderly transfer of project information to operations to satisfy Westinghouse Hanford Company (WHC) operational requirements and objectives, and ensure safe and efficient operation of Project C-018H, the 200-E Area Effluent Treatment Facility (ETF). This plan identifies the deliverables for Project C-018H upon completion of construction and turnover to WHC for operations, and includes acceptance criteria to objectively assess the adequacy of the contract deliverables in relation to present requirements. The scope of this plan includes a general discussion of the need for complete and accurate design basis documentation and design documents as project deliverables. This plan also proposes that a configuration management plan be prepared to protect and control the transferred design documents and reconstitute the design basis and design requirements, in the event that the deliverables and project documentation received from the contractor are less than adequate at turnover
Final report of the HFIR [High Flux Isotope Reactor] irradiation facilities improvement project
International Nuclear Information System (INIS)
Montgomery, B.H.; Thoms, K.R.; West, C.D.
1987-09-01
The High-Flux Isotope Reactor (HFIR) has outstanding neutronics characteristics for materials irradiation, but some relatively minor aspects of its mechanical design severely limited its usefulness for that purpose. In particular, though the flux trap region in the center of the annular fuel elements has a very high neutron flux, it had no provision for instrumentation access to irradiation capsules. The irradiation positions in the beryllium reflector outside the fuel elements also have a high flux; however, although instrumented, they were too small and too few to replace the facilities of a materials testing reactor. To address these drawbacks, the HFIR Irradiation Facilities Improvement Project consisted of modifications to the reactor vessel cover, internal structures, and reflector. Two instrumented facilities were provided in the flux trap region, and the number of materials irradiation positions in the removable beryllium (RB) was increased from four to eight, each with almost twice the available experimental space of the previous ones. The instrumented target facilities were completed in August 1986, and the RB facilities were completed in June 1987
International Nuclear Information System (INIS)
Hagen, S.; Hofmann, P.; Noack, V.; Schanz, G.; Schumacher, G.; Sepold, L.
1994-10-01
The 'Severe Fuel Damage' (SFD) experiments of the Kernforschungszentrum Karlsruhe (KfK), Federal Republic of Germany, were carried out in the out-of-pile facility 'CORA' as part of the international Severe Fuel Damage (SFD) research. The experimental program was set up to provide information on the failure mechanisms of Light Water Reactor (LWR) fuel elements in a temperature range from 1200 C to 2000 C and in few cases up to 2400 C. Between 1987 and 1992 a total of 17 CORA experiments with two different bundle configurations, i.e. PWR (Pressurized Water Reactor) and BWR (Boiling Water Reactor) bundles were performed. These assemblies represented 'Western-type' fuel elements with the pertinent materials for fuel, cladding, grid spacer, and absorber rod. At the end of the experimental program two VVER-1000 specific tests were run in the CORA facility with identical objectives but with genuine VVER-type materials. The experiments, designated CORA-W1 and CORA-W2 were conducted on February 18, 1993 and April 21, 1993, respectively. Test bundle CORA-W1 was without absorber material whereas CORA-W2 contained one absorber rod (boron carbide/steel). As in the earlier CORA tests the test bundles were subjected to temperature transients of a slow heatup rate in a steam environment. The transient phases of the tests were initiated with a temperature ramp rate of 1 K/s. With these conditions a so-called small-break LOCA was simulated. The temperature escalation due to the exothermal zircon/niobium-steam reaction started at about 1200 C, leading the bundles to maximum temperatures of approximately 1900 C. The thermal response of bundle CORA-W2 is comparable to that of CORA-W1. In test CORA-W2, however, the temperature front moved faster from the top to the bottom compared to test CORA-W1 [de
Design, Construction, and Modeling of a 252Cf Neutron Irradiator
Directory of Open Access Journals (Sweden)
Blake C. Anderson
2016-01-01
Full Text Available Neutron production methods are an integral part of research and analysis for an array of applications. This paper examines methods of neutron production, and the advantages of constructing a radioisotopic neutron irradiator assembly using 252Cf. Characteristic neutron behavior and cost-benefit comparative analysis between alternative modes of neutron production are also examined. The irradiator is described from initial conception to the finished design. MCNP modeling shows a total neutron flux of 3 × 105 n/(cm2·s in the irradiation chamber for a 25 μg source. Measurements of the gamma-ray and neutron dose rates near the external surface of the irradiator assembly are 120 μGy/h and 30 μSv/h, respectively, during irradiation. At completion of the project, total material, and labor costs remained below $50,000.
Determination of the average number of neutrons per fission event for californium-252
International Nuclear Information System (INIS)
Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.
1982-01-01
By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)
State Waste Discharge Permit application: 200-W Powerhouse Ash Pit
Energy Technology Data Exchange (ETDEWEB)
Atencio, B.P.
1994-06-01
As part of the Hanford Federal Facility Agreement and Consent Order negotiations; the US Department of Energy, Richland Operations Office, the US Environmental Protection Agency, and the Washington State Department of Ecology agreed that liquid effluent discharges to the ground on the Hanford Site which affect groundwater or have the potential to affect groundwater would be subject to permitting under the structure of Chapter 173-216 (or 173-218 where applicable) of the Washington Administrative Code, the State Waste Discharge Permit Program. This document constitutes the State Waste Discharge Permit application for the 200-W Powerhouse Ash Pit. The 200-W Powerhouse Ash Waste Water discharges to the 200-W Powerhouse Ash Pit via dedicated pipelines. The 200-W Powerhouse Ash Waste Water is the only discharge to the 200-W Powerhouse Ash Pit. The 200-W Powerhouse is a steam generation facility consisting of a coal-handling and preparation section and boilers.
International Nuclear Information System (INIS)
1994-01-01
The Southeast Regional Wastewater Treatment Plant (SERWTP) Facilities Improvement Plan and Geysers Effluent Pipeline and Effluent Injection Project are proposed as a plan to provide expanded wastewater treatment capabilities and to dispose of the effluent by injection in The Geysers geothermal field for purposes of power production. The project is located predominantly in the County of Lake, California, and also in part of Sonoma County. The plan includes various conventional facilities improvements in wastewater treatment to a secondary level of treatment at the SWERWTP. The plan includes facilities to convey the treated effluent in a 26-mile, 24-inch inside diameter pipeline to the Southeast Geysers. The wastewater from the SERWTP would be supplemented by raw lake water diverted from nearby Clear Lake. At The Geysers, the effluent would be directed into a system of distribution lines to wells. In the geothermal reservoir, the water will be converted to steam and collected in production wells that will direct the steam to six existing power plants. This document is a summary of a combined full Environmental Impact Report (EIR) and Environmental Impact Statement (EIS). The EIR/EIS describes the environmental impacts of the various components of the project. Mitigation measures are suggested for reducing impacts to a less than significant level. This report contains appendices A and B. Appendix A contains notices of preparation/notices of intent and EIR/EIS scoping comments. Appendix B contains GeothermEx, Inc., analysis of Geothermal Reservoir Effects and Induced Seismicity
Healy Clean Coal Project: Healy coal firing at TRW Cleveland Test Facility. Final report
Energy Technology Data Exchange (ETDEWEB)
Koyama, T.; Petrill, E.; Sheppard, D.
1991-08-01
A test burn of two Alaskan coals was conducted at TRW`s Cleveland test facility in support of the Healy Clean Coal Project, as part of Clean Coal Technology III Program in which a new power plant will be constructed using a TRW Coal Combustion System. This system features ash slagging technology combined with NO{sub x} and SO{sub x} control. The tests, funded by the Alaska Industrial Development and Export Authority (AIDEA) and TRW, were conducted to verify that the candidate Healy station coals could be successfully fired in the TRW coal combustor, to provide data required for scale-up to the utility project size requirements, and to produce sufficient flash-calcined material (FCM) for spray dryer tests to be conducted by Joy/NIRO. The tests demonstrated that both coals are viable candidates for the project, provided the data required for scale-up, and produced the FCM material. This report describes the modifications to the test facility which were required for the test burn, the tests run, and the results of the tests.
Rotation and Morphology of Comet 252P/LINEAR
Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.
2017-10-01
Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.
Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u758i delayed whole p
Energy Technology Data Exchange (ETDEWEB)
Widdop, M.R.
1995-09-01
The US Department of Energy (DOE) Grand Junction Projects Office (GJPO) facility occupies approximately 56.4 acres (22.8 hectares) along the Gunnison River near Grand Junction, Colorado. The site was contaminated with uranium ore and mill tailings during uranium-refining activities conducted by the Manhattan Engineer District and during pilot-milling experiments conducted for the US Atomic Energy Commission`s (AEC`s) domestic uranium procurement program. The GJPO facility was the collection and assay point for AEC uranium and vanadium oxide purchases until the early 1970s. The DOE Decontamination and Decommissioning Program sponsored the Grand Junction Projects Office Remedial Action Project (GJPORAP) to remediate the facility lands, site improvements, and the underlying aquifer. The site contractor, Rust Geotech, was the Remedial Action Contractor for GJPORAP. The exterior land areas of the facility assessed as contaminated have been remediated in accordance with identified standards and can be released for unrestricted use. Restoration of the aquifer will be accomplished through the natural flushing action of the aquifer during the next 50 to 80 years. The remediation of the DOE-GJPO facility buildings is ongoing and will be described in a separate report.
International Nuclear Information System (INIS)
Ikeda, Yujiro
2001-01-01
A status of the JAERI/KEK joint project on High Intensity Proton Accelerator is overviewed. It is highlighted that Experimental facilities for development of the accelerator driven system (ADS) for nuclear transmutation technology is proposed under the project. (author)
International Nuclear Information System (INIS)
WEISS, E.V.
2000-01-01
This report provides estimates of the expected whole body and extremity radiological dose, expressed as dose equivalent (DE), to workers conducting planned plutonium (Pu) stabilization processes at the Hanford Site Plutonium Finishing Plant (PFP). The report is based on a time and motion dose study commissioned for Project W-460, Plutonium Stabilization and Handling, to provide personnel exposure estimates for construction work in the PFP storage vault area plus operation of stabilization and packaging equipment at PFP
Weiss, E V
2000-01-01
This report provides estimates of the expected whole body and extremity radiological dose, expressed as dose equivalent (DE), to workers conducting planned plutonium (Pu) stabilization processes at the Hanford Site Plutonium Finishing Plant (PFP). The report is based on a time and motion dose study commissioned for Project W-460, Plutonium Stabilization and Handling, to provide personnel exposure estimates for construction work in the PFP storage vault area plus operation of stabilization and packaging equipment at PFP.
National Research Council Canada - National Science Library
Geertsema, Cameron
2003-01-01
.... Specifically, this document will focus on how the outcome of capital facility projects are affected by human resources practices, and the management principles and practices of the contractor-owner...
100 mg 251Cf activation analysis facility at the Savannah River Laboratory
International Nuclear Information System (INIS)
MacMurdo, K.W.; Bowman, W.W.
1975-01-01
The 252 Cf Activation Analysis Facility at the Savannah River Laboratory (SRL) is used routinely for multielement analyses of a wide variety of solid and liquid samples (e.g., metal alloys, fly ash and other airborne particles, rocks, and aqueous and nonaqueous solutions). An automated absolute activation analysis technique, developed to use neutron transport codes to calculate multienergy group neutron spectra and fluxes, converts counting data directly into elemental concentrations expressed in parts per million. The facility contains four sources of 252 Cf totaling slightly over 100 mg. A pneumatic ''rabbit'' system permits automatic irradiation/decay/counting regimes to be performed unattended on up to 100 samples. Detection sensitivities of less than or equal to 400 ppb natural uranium and less than or equal to 0.5 nCi/g for 239 Pu are observed. Detection limits for over 65 elements have been determined. Over 40 elements are detectable at the one part per million level or less. Overall accuracies of +- 10 percent are observed for most elements. (auth)
International Nuclear Information System (INIS)
1994-01-01
On May 26, 1994, the Lake County Sanitation District and the US Bureau of Land Management released for public review a Draft Environmental Impact Report/Environmental Impact Statement (EIR/EIS) on the proposed Southeast Regional Wastewater Treatment Plant Facilities Improvements Project and Geysers Effluent Pipeline Project. A minimum 45-day review and comment period began on that date and notices were published in the Federal Register. The public review and comment period closed on July 26, 1994. Public hearings on the Draft EIMIS were held in Lakeport, CA, on June 30 and July 14, 1994. The first part of this document contains copies of the written comments submitted on the Draft EIR/EIS. It also contains summary paraphrased comments of the public hearings. The second part of this document contains responses to the comments
48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings.
2010-10-01
... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...
48 CFR 252.227-7027 - Deferred ordering of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...
48 CFR 252.227-7026 - Deferred delivery of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...