WorldWideScience

Sample records for extramammary paget disease

  1. Extramammary paget disease of scrotum with oncocytic changes.

    Science.gov (United States)

    Aneiros-Fernandez, J; Arias-Santiago, S; Husein-ElAhmed, H; Nicolae, Alina; Ravassa, F O'valle; Serrano-Ortega, S; Fernandez, F Nogales; Cachaza, J Aneiros

    2010-10-01

    We report an unusual case of primary scrotal extramammary Paget disease that infiltrated reticular dermis and lymph vessels, with metastasis in inguinal lymph node. The 67-year-old patient died at 14 months due to systemic metastases. The tumor, which was located in epidermis and infiltrated the dermis, comprised cells with wide, granular, and eosinophilic cytoplasm and intense positivity for antimitochondrial antibody. This seems to be the first report of oncocytic changes in extramammary Paget disease.

  2. Photodynamic Therapy for Extramammary Paget's Disease:5 Cases Report

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective: To study the therapeutic effect of photodynamic therapy for extramammary Paget's disease.Methods: DIOMED 630 nm diode laser was used as light source and photofrin as photosensitizer. The patient's lesion was irradiated for 24-72 h after administrating of photofrin. The power density was 100-150 mW/cm2 and energy density was 150-300J/cm2. Dosage of photofrin was 2 mg/kg. Results: Lesion darkened 24 h after irradiation and formed a scar 96-120 h after irradiation. One patient's lesion disappeared, three patients' lesion diminished apparently and one patient's lesion was not controlled 3 months later. Conclusion: Photodynamic therapy is an effective modality for extramammary Paget's disease.

  3. CLINICAL ANALYSIS AND TREATMENT OF 14 CASESOF EXTRAMAMMARY PAGET'S DISEASE

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To diffrentiate extramammary Paget' s disease ( EPD ) clinically and histologically from other skin diseases. Methods Clinical analysis and excisional treatment of 14 patients with EPD were reviewed from 1987 to 1997. Results Of 14 patients, 12 involved scrotum and penis, one in the groin and the other one in the perianal region. All were positive for cytokeratin and negative for S-100 protein. Follow-up showed 3 recurrences who had positive surgical margin biopsy. One died of other disease. Conclusion Surgery is the first choice for treatment of EPD. Negative margin must be achieved to prevent local recurrence.

  4. Spinal Metastases of Extramammary Paget Disease with Radiologic-Pathologic Correlation

    Science.gov (United States)

    Little, Jason T; Lehman, Vance T; Morris, Jonathan M; Lehman, Julia S; Diehn, Felix E

    2016-01-01

    Extramammary Paget disease (EMPD) is an uncommon malignancy. It manifests either in the primary form in the skin as an intraepithelial neoplasm, or in secondary form as pagetoid (intraepithelial) spread of an underlying internal carcinoma to the skin. Although local invasion and recurrence of primary extramammary Paget disease are relatively frequent, widespread metastases are rare. As such, there are very few reports and little characterization of the radiologic features of widespread spinal metastases. To our knowledge, there are no prior reports of a metastatic extramammary Paget disease presenting as a painful pathologic vertebral body compression fracture. We report the radiological features of a case of primary extramammary Paget disease with subsequent spinal metastases presenting as a painful compression fracture. PMID:27761174

  5. Extensive Invasive Extramammary Paget Disease Evaluated by F-18 FDG PET/CT

    OpenAIRE

    Li, Zu-Gui; Qin, Xiao-Jing

    2015-01-01

    Abstract Extramammary Paget disease (EMPD) is a rare cutaneous, intraepithelial adenocarcinoma. Because of its rarity, little is known about the value of fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) in evaluating this disease. Our case report aims to increase current knowledge of FDG PET/CT in EMPD as a noninvasive imaging tool for assessing the extension of the disease and detecting distant metastases. We reported a 64-year-old Chinese man who presented ...

  6. Mapping biopsy with punch biopsies to determine surgical margin in extramammary Paget's disease.

    Science.gov (United States)

    Kato, Takeshi; Fujimoto, Noriki; Fujii, Norikazu; Tanaka, Toshihiro

    2013-12-01

    It is difficult to determine the appropriate resection margin of extramammary Paget's disease (EMPD). A high recurrence rate is reported in spite of using Mohs micrographic surgery (MMS), which is performed commonly. Preoperative mapping biopsy is easier to perform than MMS. In Japan, the following method is recommended instead of MMS: well-defined border and margins histologically confirmed by mapping biopsy should be resected with 1-cm margin and ill-defined border with 3-cm margin. This study aimed to evaluate the accuracy of the Japanese guideline and to assess our mapping biopsy method compared with MMS. Preoperative mapping biopsy specimens were obtained beyond the clinical border for at least four directions in each patient. To confirm the presence of residual Paget's cells postoperatively, narrow specimens were obtained along the surgical margin. Retrospective evaluation of 17 EMPD patients was conducted concerning histological spread of Paget's cells and recurrence ratio. There were 86 directions showing a well-defined border, and in 9.3% (8/86), Paget's cells were still observed at 1-cm resection line. On the other hand, there were 21 directions showing an ill-defined border, and unnecessary radical resection was performed in 90% (19/21) of directions with 3-cm resection line. Although postoperative histological examination showed residual Paget's cells in 47% (8/17) of patients and additional resections were not performed, recurrence rate was only 5.9% (1/17). The resection line of EMPD should be based not on clinical features, but on mapping biopsy. Mapping biopsy is equivalent to MMS concerning recurrence rate and, though conventional, is useful method to treat EMPD.

  7. Magnetic resonance imaging for extramammary Paget's disease: radiological and pathological correlations

    Energy Technology Data Exchange (ETDEWEB)

    Akaike, Gensuke; Nozaki, Taiki; Matsusako, Masaki; Saida, Yukihisa [St. Luke' s International Hospital, Department of Radiology, Tokyo (Japan); Matsui, Mizuko; Ohtake, Naoyuki [St. Luke' s International Hospital, Department of Plastic Surgery and Reconstructive Surgery, Tokyo (Japan); Eto, Hikaru [St. Luke' s International Hospital, Department of Dermatology, Tokyo (Japan); Suzuki, Koyu [St. Luke' s International Hospital, Department of Pathology, Tokyo (Japan)

    2013-03-15

    Extramammary Paget's disease (EMPD) is a rare cutaneous neoplasm that is thought to represent intraepithelial adenocarcinoma developing in an area rich in apocrine glands. Magnetic resonance imaging (MRI) findings for this disease are not well established. We report three cases of pathologically confirmed EMPD in which MRI was performed before surgery. The lesions were widespread in the epidermis and the dermis. Lesions were sharply well enhanced on gadolinium-enhanced T1-weighted imaging and appeared hyperintense on diffusion-weighted imaging in all cases. Areas with enhancement in depth corresponded well with the pathological lesion. In addition, different malignant legions were found on the same images from MRI in two cases, indicating potential associations with other malignancies. We describe the MRI findings and their pathological correlation. MRI could be useful for preoperative evaluation of disease spread and detection of associated malignancies. (orig.)

  8. Prostate-specific antigen-positive extramammary Paget's disease--association with prostate cancer

    DEFF Research Database (Denmark)

    Hammer, Anne; Hager, Henrik; Steiniche, Torben

    2008-01-01

    Extramammary Paget's disease (EMPD) is a rare intraepidermal adenocarcinoma that primarily affects the anogenital region. Cases of EMPD reacting with PSA (prostate-specific antigen) have previously been associated with underlying prostate cancer. However, a recent case of EMPD in our department has...... led us to question the value of PSA as an indicator of underlying prostate cancer. Clinical and pathological data were obtained for 16 cases of EMPD. Formalin-fixed, paraffin-embedded tissue blocks from the primary skin lesions were investigated using PSA and other immunohistochemical markers. 5...... of the 16 cases of EMPD stained positive for PSA (2 women and 3 men). However, no reactivity was seen for the prostatic marker P501S. Three of the five patients had been diagnosed with internal malignant disease-two with prostate cancer, stage 1. Immunohistochemical investigations of the tumour specimens...

  9. Unilateral Pigmented Extramammary Paget's Disease of the Axilla Associated with a Benign Mole: A Case Study and a Review of Literature

    OpenAIRE

    Ladak, Aleem; Bramley, Maria; Titi, Sami

    2014-01-01

    Pigmented extramammary Paget's disease (PEMPD) is an uncommon intraepithelial adenocarcinoma and a rare variant of Paget's disease affecting skin that is rich in apocrine sweat glands such as the axilla, perianal region and vulva. It most commonly occurs in postmenopausal women and presents as a superficial pigmented scaly macule, mimicking a melanocytic lesion. The histological presentation is adenocarcinoma in situ with an increased number of melanocytes scattered between the Paget's cells....

  10. Extensive Invasive Extramammary Paget Disease Evaluated by F-18 FDG PET/CT

    Science.gov (United States)

    Li, Zu-Gui; Qin, Xiao-Jing

    2015-01-01

    Abstract Extramammary Paget disease (EMPD) is a rare cutaneous, intraepithelial adenocarcinoma. Because of its rarity, little is known about the value of fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) in evaluating this disease. Our case report aims to increase current knowledge of FDG PET/CT in EMPD as a noninvasive imaging tool for assessing the extension of the disease and detecting distant metastases. We reported a 64-year-old Chinese man who presented with a slowly progressive, ill-margined erythematous lesion with a crusted, eroded, and scaly surface involving multiple sites of penis, scrotum, left pelvic wall, hip, groin, and thigh for >4 years, which became extensive in the past 1 year. He was referred for an FDG PET/CT examination to further evaluate the lesions. A following skin biopsy was performed to obtain a definitive histological diagnosis. FDG PET/CT imaging revealed mild FDG uptake at the extensive cutaneous lesion with subcutaneous invasion, involvement of lymph nodes, and multiple intense FDG-avid of skeletal metastases. According to the appearance of FDG PET/CT, a provisional diagnosis of advanced cutaneous malignancy was made. Histopathology findings indicated characteristic of EMPD. The patient was treated with radiation therapy and died from complications 2 months after the last dose of radiotherapy. Our case highlighted that a whole-body FDG PET/CT should be incorporated into the diagnostic algorithm of EMPD to give a comprehensive assessment of this disease. PMID:25621679

  11. Extensive invasive extramammary Paget disease evaluated by F-18 FDG PET/CT: a case report.

    Science.gov (United States)

    Li, Zu-Gui; Qin, Xiao-Jing

    2015-01-01

    Extramammary Paget disease (EMPD) is a rare cutaneous, intraepithelial adenocarcinoma. Because of its rarity, little is known about the value of fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) in evaluating this disease. Our case report aims to increase current knowledge of FDG PET/CT in EMPD as a noninvasive imaging tool for assessing the extension of the disease and detecting distant metastases.We reported a 64-year-old Chinese man who presented with a slowly progressive, ill-margined erythematous lesion with a crusted, eroded, and scaly surface involving multiple sites of penis, scrotum, left pelvic wall, hip, groin, and thigh for >4 years, which became extensive in the past 1 year. He was referred for an FDG PET/CT examination to further evaluate the lesions. A following skin biopsy was performed to obtain a definitive histological diagnosis.FDG PET/CT imaging revealed mild FDG uptake at the extensive cutaneous lesion with subcutaneous invasion, involvement of lymph nodes, and multiple intense FDG-avid of skeletal metastases. According to the appearance of FDG PET/CT, a provisional diagnosis of advanced cutaneous malignancy was made. Histopathology findings indicated characteristic of EMPD. The patient was treated with radiation therapy and died from complications 2 months after the last dose of radiotherapy.Our case highlighted that a whole-body FDG PET/CT should be incorporated into the diagnostic algorithm of EMPD to give a comprehensive assessment of this disease.

  12. Handheld Reflectance Confocal Microscopy for the Detection of Recurrent Extramammary Paget Disease.

    Science.gov (United States)

    Yélamos, Oriol; Hibler, Brian P; Cordova, Miguel; Hollmann, Travis J; Kose, Kivanc; Marchetti, Michael A; Myskowski, Patricia L; Pulitzer, Melissa P; Rajadhyaksha, Milind; Rossi, Anthony M; Jain, Manu

    2017-07-01

    Extramammary Paget disease (EMPD) is commonly refractory to surgical and nonsurgical therapies. Identifying recurrent or persistent EMPD is challenging because the disease is multifocal, and multiple blind scouting biopsies are usually performed in this setting. Handheld reflectance confocal microscopy (HRCM) has been used to diagnose and map primary EMPD and therefore may be used to identify EMPD recurrences. To evaluate HRCM's diagnostic accuracy in the setting of recurrent or persistent EMPD as well as its potential diagnostic pitfalls. This prospective case series study included patients referred to the Dermatology Service at Memorial Sloan Kettering Cancer Center between January 1, 2014, and December 31, 2016, with biopsy-proven EMPD in whom HRCM was used to monitor treatment response. Five patients were included, and 22 sites clinically concerning for recurrent or persistent disease were evaluated using HRCM and histopathologic examination. In 2 patients, video mosaics were created to evaluate large areas. Sensitivity and specificity of HRCM in identifying recurrent or persistent EMPD; causes for false-negative results according to their location, histopathologic findings, and previous treatments. Of the 22 clinically suspicious sites evaluated in 5 patients (4 men, 1 woman; median [range] age, 70 [56-77] years), 9 (40.9%) were positive for recurrent disease on HRCM and histopathologically confirmed, and 13 (59.1%) sites were negative on HRCM, but 3 of the 13 were positive for EMPD on histopathological examination. In general, HRCM had a sensitivity of 75% and a specificity of 100% in identifying recurrent or persistent EMPD. False-negative results were found in 2 patients and occurred at the margins of EMPD, close to previous biopsy sites. Creating video mosaics (or video mosaicking) seemed to improve the detection of EMPD. Handheld reflectance confocal microscopy is a useful auxiliary tool for diagnosing EMPD recurrences and can be used to guide scouting

  13. Usefulness of sentinel lymph node biopsy for prognostic prediction in extramammary Paget's disease.

    Science.gov (United States)

    Ogata, Dai; Kiyohara, Yoshio; Yoshikawa, Syusuke; Tsuchida, Tetsuya

    2016-06-01

    Complete excision of the primary lesion has long been considered the standard treatment for extramammary Paget's disease (EMPD). However, the presence of lymph node metastases has been reported as an important prognostic factor. We evaluated the association between lymph node metastasis and prognosis for EMPD using sentinel lymph node (SLN) biopsy. This retrospective study included 59 patients with histopathologically-confirmed primary EMPD. A total of 45 patients with microinvasion to the papillary dermis and deep invasion into the reticular dermis or subcutaneous tissue were included in the analysis. The survival curves of the SLN-negative group and the SLN-positive group were compared and we examined the risk factors for SLN positivity. A total of 139 SLNs were excised from one (28 patients) or both inguinal regions (31 patients). The average number of detected SLNs was 2.4. The incidence of SLN metastases was 16.9%. SLN positivity rates according to level of invasion were 0% for intraepithelial lesions, 4.1% for microinvasion, and 42.8% for dermal invasion. The five-year survival rates were 100% in the SLN-negative and 24% in the SLN-positive groups (p = 0.0001). Reticular dermis or subcutaneous tissue invasion was a significant independent risk factor for SLN positivity according to multivariate analysis. The result of SLN biopsy affected prognosis. It is extremely important to accurately ascertain the presence, i.e. the number, or absence of regional lymph node metastases in patients with EMPD. We conclude that SLN biopsy may be appropriate for cases where invasion is suspected.

  14. Perianal and Vulvar Extramammary Paget Disease: A Report of Six Cases and Mapping Biopsy of the Anal Canal

    Science.gov (United States)

    Kazama, Sinsuke; Yamada, Daisuke; Miyagawa, Takuya; Murono, Koji; Yasuda, Koji; Nishikawa, Takeshi; Tanaka, Toshiaki; Kiyomatsu, Tomomichi; Hata, Keisuke; Kawai, Kazushige; Masui, Yuri; Nozawa, Hiroaki; Yamaguchi, Hironori; Ishihara, Soichiro; Kadono, Takafumi; Watanabe, Toshiaki

    2016-01-01

    Treatment of perianal and vulvar extramammary Paget disease (EMPD), rare intraepithelial malignancies, is often challenging because of its potential to spread into the anal canal. However, there is still no consensus regarding the optimal resection margin within the anal canal. Between 2004 and 2014, six patients (three with perianal EMPD and three with vulvar EMPD) in which the spread of Paget cells into the anal canal was highly suspected were referred to our department. To evaluate the disease extent within the anal canal, preoperative mapping biopsy of the anal canal was performed in five out of six patients. Two patients were positive for Paget cells within the anal canal (one at the dentate line and the other at 0.5 cm above the dentate line), whereas in three patients, Paget cell were present only in the skin of the anal verge. Using 1 cm margin within the anal canal from the positive biopsy sites, we performed anal-preserving wide local excision (WLE), and negative resection margins within the anal canal were confirmed in all five patients. The remaining one patient with perianal EMPD did not undergo mapping biopsy of the anal canal because preoperative colonoscopy revealed that the Paget cells had spread into the lower rectum. Therefore, WLE with abdominoperineal resection was performed. During the median follow-up period of 37.3 months, no local recurrence was observed in all patients. Our small case series suggest the usefulness of mapping biopsy of the anal canal for the treatment of perianal and vulvar EMPD. PMID:27746643

  15. Clostridium difficile Colitis and Neutropenic Fever Associated with Docetaxel Chemotherapy in a Patient with Advanced Extramammary Paget's Disease.

    Science.gov (United States)

    Nonomura, Yumi; Otsuka, Atsushi; Endo, Yuichiro; Fujisawa, Akihiro; Tanioka, Miki; Kabashima, Kenji; Miyachi, Yoshiki

    2012-05-01

    Extramammary Paget's disease is a rare cutaneous malignant neoplasm. Previous studies indicated the efficacy of docetaxel in advanced cases. The common side effects of docetaxel are usually tolerable and seldom life-threatening. We experienced a case of severe pseudomembranous colitis and neutropenic fever that developed just after the first cycle of docetaxel chemotherapy. To the best of our knowledge, there are few reports of pseudomembranous colitis associated with docetaxel administration for skin cancers. The patient showed complete resolution of her symptoms within 2 weeks with an oral metronidazole therapy. During the second and third cycles, the patient received docetaxel safely with lower doses. The present case indicated that pseudomembranous colitis should be included in the differential diagnosis when assessing patients who develop severe diarrhea during systemic chemotherapy with docetaxel.

  16. Unilateral Pigmented Extramammary Paget's Disease of the Axilla Associated with a Benign Mole: A Case Study and a Review of Literature.

    Science.gov (United States)

    Ladak, Aleem; Bramley, Maria; Titi, Sami

    2014-08-01

    Pigmented extramammary Paget's disease (PEMPD) is an uncommon intraepithelial adenocarcinoma and a rare variant of Paget's disease affecting skin that is rich in apocrine sweat glands such as the axilla, perianal region and vulva. It most commonly occurs in postmenopausal women and presents as a superficial pigmented scaly macule, mimicking a melanocytic lesion. The histological presentation is adenocarcinoma in situ with an increased number of melanocytes scattered between the Paget's cells. Therefore, PEMPD may be misdiagnosed as a melanocytic tumour both clinically and histologically. The tumour cells are usually positive for cytokeratin 7, epithelial membrane antigen, Cam 5.2, HER2, and mucicarmine stain while S100 and human melanoma black-45 highlight the processes of reactive dendritic cells. The association between Paget's cells and intratumoural reactive melanocytes is still unclear. We report our first case of PEMPD associated with an intradermal naevus involving the axilla in a 63-year-old woman.

  17. Place of the radiotherapy in the care of the extra-mammary Paget disease; Place de la radiotherapie dans la prise en charge therapeutique de la maladie de Paget extramammaire

    Energy Technology Data Exchange (ETDEWEB)

    Yanes, B.; Notter, M.; Dragusanu, D. [Hopital Neuchatelois, La Chaux-De-Fonds (Switzerland)

    2007-11-15

    The cutaneous tolerance of the radiotherapy was satisfactory and the treatment took place continuously at all the patient's. A patient is always in situation of clinical forgiveness, 3 years after the irradiation and another waits after two years, and finally a extra-mammary disease of Paget did it again 1 year after the irradiation and was treated by surgery of correction. It is still too much early to estimate the last two patients, treated in 2007. (N.C.)

  18. 腋窝乳房外Paget病1例%A Case of Extramammary Paget' s Disease on the Axillary

    Institute of Scientific and Technical Information of China (English)

    单滢; 王飞

    2013-01-01

    A 83-year-old male, complaining of itch, had been suffered with erythema on the axillary fossa for 6 years, repeatedly misdiagnosed as eczema and received the Symptomatic treatment, but the symptom did not get better. He felt a little pain and much itch on the erythema with the skin disunion 3 years ago. The extent of the erythema got bigger recently and he received resection at last. Histological examnation showed; Epidermis hyperkeratosis,single or a nest of Paget cells in the epidermis and part of eecrine ductal epithelium,multiple lymphocytic infiltration in the superficial layer of dermis; AB staining( + ) ,PAS staining( — ). Immunohis-tochemistry showed: CK7 ,CK8/18 ,CEA and Ki67 ( + ) ,S100 and HMB45 ( - ). Diagnosis: extramammary Paget' s disease.%患者男,83岁.左侧腋窝红斑伴瘙痒6年.多次按湿疹治疗,无效;3年前始皮损伴轻度疼痛,瘙痒明显,反复破溃不能愈合.近日来皮损增大明显,予手术切除.切除物组织病理示:表皮轻度角化过度,表皮全层可见单个或成巢的Paget细胞,真皮浅层较多淋巴细胞浸润;AB染色(+),PAS染色(-);免疫组化示:CK7,CK8/18,CEA和Ki67均(+):S100和HM B45均(-).诊断:乳房外Paget病.

  19. A proposal for a TNM staging system for extramammary Paget disease: Retrospective analysis of 301 patients with invasive primary tumors.

    Science.gov (United States)

    Ohara, Kuniaki; Fujisawa, Yasuhiro; Yoshino, Koji; Kiyohara, Yoshio; Kadono, Takafumi; Murata, Yozo; Uhara, Hisashi; Hatta, Naohito; Uchi, Hiroshi; Matsushita, Shigeto; Takenouchi, Tatsuya; Hayashi, Toshihiko; Yoshimura, Kenichi; Fujimoto, Manabu

    2016-09-01

    Although extramammary Paget disease (EMPD) usually appears as carcinoma in situ, it sometimes becomes invasive (iEMPD) and fatal. However, a TNM staging system for iEMPD has yet to be established. The aim of this study was to establish a TNM staging system for iEMPD. We retrospectively collected iEMPD patients treated at 12 institutes in Japan. Factors reported to be associated with survival such as distant metastasis, lymph node (LN) metastasis, and primary tumor status were evaluated using the log-rank test. We enrolled 301 iEMPD patients, of whom 114 had remote metastases (49 had both distant and LN metastasis; 2, distant metastasis only; and 63, LN metastasis only) and the remaining 187 patients had no remote metastasis. Distant metastasis (M1) showed worse survival (PTNM staging system: stage I, T1N0M0; stage II, T2N0M0; stage IIIa, anyTN1M0; stage IIIb, anyTN2M0; stage IV, anyTanyNM1. Other than stages II and IIIa, each stage had a statistically distinct survival curve. We propose a TNM staging system for EMPD using simple factors for classification that could provide important prognostic information in managing EMPD. However, accumulation of more patient data and further revision of the system are required. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  20. Three-Directional Reconstruction of a Massive Perineal Defect after Wide Local Excision of Extramammary Paget's Disease

    Science.gov (United States)

    Cho, Seung Woo; Kwon, Sung Tack

    2016-01-01

    Extramammary Paget's disease (EMPD) is a rare, slow-growing intraepithelial malignancy that mainly involves the genital region, including the vulva, penis, scrotum, perianal, and periurethral areas. Although several treatment options exist, wide local excision with a safe margin is considered the treatment of choice. After resection of the lesion, it is often challenging to reconstruct the defect because defects in the perineal region require adequate volume for protection and are susceptible to infections, which is a particularly significant risk for large defects. We report a case of perivulvar EMPD that was reconstructed with three-directional local flaps after wide excision of the tumor. We covered the defect sequentially using the following 3 flaps: a gracilis myocutaneous flap from the left thigh, a bipedicled V-Y advancement flap from the lower abdomen, and an internal pudendal artery perforator-based island flap from the right buttock. To the best of our knowledge, this report is the first to describe a three-directional approach to extensive perivulvar reconstruction. PMID:27689055

  1. Serum cytokeratin 19 fragment 21-1 is a useful tumor marker for the assessment of extramammary Paget's disease.

    Science.gov (United States)

    Kato, Junji; Sumikawa, Yasuyuki; Hida, Tokimasa; Kamiya, Takafumi; Horimoto, Kohei; Kamiya, Shiori; Sato, Sayuri; Takahashi, Hitomi; Sawada, Masahide; Yamashita, Toshiharu

    2017-02-02

    Cytokeratin 19 fragment 21-1 (CYFRA 21-1) has been used as a tumor marker for several malignancies. However, to date, no studies have assessed whether CYFRA 21-1 could be a useful marker for extramammary Paget's disease (EMPD). The present study aimed to evaluate the significance of CYFRA 21-1 as a serum tumor marker for EMPD progression. Concentrations of serum CYFRA 21-1 and carcinoembryonic antigen (CEA) in 13 cases of EMPD were measured prior to undergoing treatment at Sapporo Medical University Hospital from January 2014 to May 2016. Four of the 13 patients had lymph node metastases at diagnosis, but none had distant metastases. Immunohistochemistry indicated that all 13 primary tumors and four metastatic tumors in lymph nodes were positive for cytokeratin 19. Although none of the 13 patients showed high serum CEA levels, six patients (46.2%) had elevated serum CYFRA 21-1. Furthermore, CYFRA 21-1 was reduced in association with post-treatment tumor reduction in all six patients. Among these six patients, four developed recurrence and metastasis during the follow-up period. CYFRA 21-1 was re-elevated in all four of these patients; however, serum CEA was elevated only in the patient with distant metastasis. These results suggest that CYFRA 21-1 is more sensitive compared with CEA, and can be useful as a tumor marker for evaluating tumor progression and treatment efficacy in patients with EMPD.

  2. CLINICAL ANALYSIS AND TREATMENT OF 14 CASES OF EXTRAMAMMARY PAGET S DISEASE

    Institute of Scientific and Technical Information of China (English)

    傅敏刚

    2000-01-01

    ffesum6 Objectif POur diffdrencier la Maladie de Paget extra-mammaire (MPE) des autres maladies chroniques de lacpu. ANthaeS Faire l' analySe clinique et l' etude des traitements chirurgicaux d' excision dans 14 oas de MPE da taut de1987 jusu' d 1997. theultats ~tim non de la ma ladle: 12 oas sur 14, an penis et aux hourses, 1 oas an canal ingUinal et1 oas d la region twianale. Par ies emmens biochimiques, tons etaient ~t ifs pour cytokeratine et thetifs POur Protdine S-100.Pendant ie suivi gut-opratoire, o...

  3. 手术治愈巨大乳房外Paget病%Successful surgical treatment of a case of giant extramammary Paget's disease

    Institute of Scientific and Technical Information of China (English)

    吴信峰; 王强

    2012-01-01

    报告1例发生于阴囊、阴茎、阴阜以及腹股沟区的巨大乳房外Paget病.患者男,68岁.阴囊、阴茎及阴部出现红色浸润性斑块5年余.组织病理提示:表皮角化过度,棘层增生肥厚,表皮全层及毛囊内见单个或成巢的Paget样细胞,部分肿瘤细胞沿毛囊上皮及汗腺导管侵及真皮深部,真皮浅层见大量淋巴细胞浸润.诊断:乳房外Paget病.因肿瘤侵及外阴部范围广,切除面积较大,外阴部巨大缺损分别采用局部皮瓣与植皮相结合的方法成功修复.%We report a case of giant extramammary Paget's disease on scrotum, penis, mons pubis and groin. A 68-year-old male patient presented with of infiltrating erythematous plaques on his scrotum, penis and perineal region for 5 years. Histopathology showed that epidermis was hyperkeratotic and hyperplastic. Paget cells were observed in all layers of epidermis and hair follicles, and invaded into deep dermis along the hair follicles and ducts of sweat glands. Large number of lymphocytes infiltrated the superficial layer of dermis. The diagnosis was extramammary Paget s disease. Skin flap in combination with skin grafting were adopted after extensive excision of skin lesions.

  4. Demonstration of characteristic skin surface contours of extramammary Paget's disease and parapsoriasis en plaque by image analysis of negative impression replicas.

    Science.gov (United States)

    Kikuchi, Katsuko; Aiba, Setsuya; O'Goshi, Ken-ichiro; Yanai, Motohiro; Takahashi, Motoji; Kasai, Hidefumi; Tagami, Hachiro

    2002-10-01

    The surface contours of lesional skin of certain skin diseases, such as parapsoriasis en plaque (PEP) and extramammary Paget's disease (EMPD), in which there is a massive infiltration by non-epidermal cells, looks somewhat different from that of the adjacent normal skin, needless to state that they are apparently different from that of ordinary chronic inflammatory dermatoses where we found acanthotic epidermis accompanied by hyperkeratosis. We attempted to objectively characterize these unique skin surface changes qualitatively and quantitatively using non-invasive methods. Negative impression replicas were taken from the lesional skin of patients with EMPD or PEP as well as from the adjacent uninvolved skin. The findings were confirmed histologically. The replicas were examined by using computerized image analysis. Several parameters were analyzed that correlate with the changes in the anisotropy of the skin furrows (VC1), average skin roughness (KSD), average length of skin furrows (LEN), and number of skin furrows (NUM). There were significant decreases in KSD and NUM in EMPD, indicating a smoother skin surface in the lesional skin than in the adjacent normal skin. In contrast, the PEP lesion had an increase in VC1 and LEN and a decrease in NUM, which suggests larger skin ridges in the lesional skin than in the uninvolved skin. Thus the unique skin surface of the cutaneous disorders accompanied by epidermal invasion by non-epidermal cells, such as EMPD and PEP, was characterized both qualitatively and quantitatively using computerized image analysis of negative impression replicas.

  5. Acantholytic anaplastic Paget's disease.

    Science.gov (United States)

    Mobini, Narciss

    2009-03-01

    Classic Paget's disease (PD) can be diagnosed relatively easily by histopathologic examination. 'Anaplastic' variant of this disease is a less-recognized subset that may pose as a diagnostic challenge and pitfall. We describe two cases who presented with scaly erythematous plaques on their nipple/areola. In the first patient, there was no palpable mass and imaging studies were negative. The second case presented with a lesion 5 years after a lumpectomy. Initial shave biopsies revealed histopathologic changes indistinguishable from Bowen's disease with no readily identifiable classic Paget's cells, associated with prominent superficial acantholysis. The neoplastic cells were negative for mucin, GCDFP-15, negative/minimally positive for CEA and strongly positive for CK7 markers. A high-grade ductal carcinoma in situ in the underlying breast was ultimately found in both cases. Anaplastic PD is a rare variant of this disease that histologically mimics Bowen's disease with an associated prominent superficial acantholysis. There is mucin, CEA and GCDFP-15 negativity with positive CK7 reaction. A high index of suspicion along with a complete immunohistochemical panel should be considered in evaluating any Bowenoid neoplasm of the breast skin, particularly in superficial skin shave biopsies along with negative imaging studies and no palpable mass clinically.

  6. Extramammary Paget’s Disease Versus Lichen Sclerosus

    Directory of Open Access Journals (Sweden)

    Pappova T.

    2016-12-01

    Full Text Available Burning, itching and dyspareunia are typical symptoms of many genital diseases. These subjective complaints can be misdiagnosed because of different clinical presentations. We present a case report of a postmenopausal woman treated for genital warts over a period of three years followed by the development of leukoplastic lesions in the whitish area clinical classified as Lichen sclerosus (LS. Histology of this lesion revealed carcinoma in situ. After radical surgical removal, vulvar Paget’s disease was histologically verified. LS and extramammary Paget's disease (EMPD belong to a group of uncommon dermatoses which mainly affect the skin of the genitals in postmenopausal women. Ulceration, erosions and leukoplastic lesions can signalize the development of squamous cell carcinoma in association of lichen sclerosus, on the other hand, they can be the sign of EMPD after a long period of time using different topical agents. The importance of reaching the correct diagnosis is essential and can influence current patient investigations and invasive or non-invasive treatment.

  7. Perianal Paget's disease: presentation of six cases and literature review.

    Science.gov (United States)

    Minicozzi, Annamaria; Borzellino, Giuseppe; Momo, Rostand; Steccanella, Francesca; Pitoni, Federica; de Manzoni, Giovanni

    2010-01-01

    Extramammary Paget's disease (EMPD) is frequently associated with adnexal or visceral synchronous or metachronous malignancies. Our purpose was to evaluate, retrospectively, the results obtained in six cases of EMPD and to review the literature. Six patients with the perianal Paget's disease had been treated in our division between March 1996 and December 2006. In three cases, the disease was confined in the epidermis; in one case, there was a microinvasion of the dermis, while in another one the dermis was infiltrated. The last case was associated to a low rectal adenocarcinoma. All patients underwent wide perianal excision and reconstruction with skin graft. We performed a transanal resection of the rectal adenocarcinoma. A review of the literature from 1990 to 2008 revealed 193 cases of perianal EMPD, 112 were intraepithelial/intradermal while 81 were associated with malignancies. Anorectal adenocarcinoma was already existing in two cases, synchronous in 48, and subsequent to diagnosis in 11. In three cases, the disease recurred locally, but no patient developed metastatic spread. Five patients survived and are free of disease. The review of the literature allows a clear identification of the primitive EMPD and the form associated to anorectal adenocarcinoma and little information about cases associated with synchronous adnexal adenocarcinoma. The Paget's disease can relapse after radical surgery and has a capacity of metastatic spread. Up to now, no clear guidelines have been established for the diagnosis of EMPD. The association with synchronous or metachronous carcinomas imposes a long-term follow-up with frequent clinical, radiological, and endoscopical controls.

  8. Skrotal Pagets sygdom

    DEFF Research Database (Denmark)

    Juel, Jacob; Røge, Rasmus; Petersen, Astrid;

    2014-01-01

    A patient with extramammary Paget's disease (EMPD) had a plaque of the scrotum surgically removed. Histology and immunohistochemistry was consistent with primary EMPD. EMPD is a rare intraepidermal neoplasia mostly confined to regions of the skin with apocrine sweat glands. Clinical features...

  9. PAGET'S DISEASE: CURRENT TREATMENT MODALITIES

    Directory of Open Access Journals (Sweden)

    Yulia Leonidovna Korsakova

    2010-01-01

    Full Text Available Paget's disease is a chronic local bone disease included into a group of metabolic osteopathies in which rearrangement foci emerge in one or several bones. The disease is characterized by the appearance of ostealgia, skeletal deformity, or, for example, hearing loss occurring with skull lesion or hip or knee arthrosis and, less frequently, sarcoma or giant cell tumor. There is evidence that bisphosphonates may control the activity of Paget's disease as they inhibit the function of osteoclasts. The use of these drugs reduces the intensity of osteoalgia and the level of biochemical markers for bone resorption and osteogenesis and can decelerate or reverse the early osteolytic phase of the disease. It is promising to use of zolendronic acid (Aclasta, 5 mg, a new heterocyclic amino-containing bisphosphonate that has a significantly higher efficacy than previously used antiresorptive agents.

  10. Management of Paget's Disease of the Calcaneum.

    Science.gov (United States)

    Humphrey, Joel; Pervez, Anum; Walker, Roland; Abbasian, Ali; Singh, Sam

    The calcaneum is not the most common site for Paget's disease of bone, with only a few reports of monostotic involvement. We present 2 cases of Paget's disease of bone affecting the calcaneus, present an overview of the published data, and describe our management of these interesting cases.

  11. Genetics Home Reference: juvenile Paget disease

    Science.gov (United States)

    ... Information & Resources MedlinePlus (1 link) Health Topic: Bone Diseases Genetic and Rare Diseases Information Center (1 link) Juvenile ... on PubMed Daroszewska A, Ralston SH. Mechanisms of disease: genetics of Paget's disease of bone and related disorders. ...

  12. Paget's disease of bone (osteitis deformans).

    Science.gov (United States)

    Ankrom, M A; Shapiro, J R

    1998-08-01

    Paget's disease of bone is important in geriatric populations because it is the second most common bone disorder after osteoporosis. In older people, it may be responsible for chronic back pain and joint pain, skeletal deformities, hearing loss, and cranial nerve compression. Paget's disease can reduce both function and mobility in the older people. In addition to newer tests for assessing the activity of Paget's disease, effective therapy is available in the form of salmon calcitonin for nasal administration and new third generation bisphosphonates. Frequently, treatment can reverse the course of the disease. For these reasons, it is feasible for the physician to adopt an aggressive approach to diagnosis and treatment. The objective should be to relieve pain, improve mobility, and forestall debilitating complications. This review will focus on the manifestations and clinical management of Paget's disease. Two cases are presented that illustrate common management problems in older patients.

  13. Paget disease of the male nipple

    Directory of Open Access Journals (Sweden)

    El Harroudi T

    2010-01-01

    Full Text Available Breast cancer occurring in the mammary gland of men is infrequent. It accounts for 0.8% of all breast cancers, which is less than one per cent of all newly diagnosed male cancers and 0.2% of male cancer deaths. However, Paget disease of the male nipple is extremely rare. We report a single case of Paget disease with infiltrative ductal carcinoma of the breast in a 61-year-old man.

  14. What Is Paget's Disease of Bone?

    Science.gov (United States)

    ... Size | S S M M L L Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics News Glossary ... focus(); */ } //--> Print-Friendly Page Home Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics About Us ...

  15. How Is Paget's Disease of Bone Diagnosed?

    Science.gov (United States)

    ... Size | S S M M L L Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics News Glossary ... focus(); */ } //--> Print-Friendly Page Home Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics About Us ...

  16. Genetics Home Reference: Paget disease of bone

    Science.gov (United States)

    ... Clin Pathol. 2010 Mar;63(3):199-203. doi: 10.1136/jcp.2009.064428. Epub 2009 Oct 26. Review. Citation on PubMed Ralston SH, Albagha OM. Genetics of Paget's disease of bone. Curr Osteoporos Rep. 2014 Sep;12(3):263-71. doi: 10.1007/s11914-014-0219-y. Review. Citation ...

  17. Primary extramammary Paget′s disease with extensive skeletal metastases

    Directory of Open Access Journals (Sweden)

    Indukooru Subrayalu Reddy

    2012-01-01

    Full Text Available Extramammary Paget′s disease (EMPD is an uncommon malignancy that is most commonly seen in the vulval area in postmenopausal women. Pruritus is the predominant symptom. The clinical presentation can be so nonspecific that it can be misdiagnosed as an inflammatory or infective condition. We report an elderly male patient with EMPD over the pubic area, which remained asymptomatic for 5 years; he presented with severe low backache of 5 months′ duration. Skin biopsy and immunohistochemistry showed the typical epidermal changes and deep dermal invasion. Positron emission tomography scan revealed involvement of regional lymph nodes as well as extensive skeletal metastases.

  18. Clostridium difficile Colitis and Neutropenic Fever Associated with Docetaxel Chemotherapy in a Patient with Advanced Extramammary Paget’s Disease

    Directory of Open Access Journals (Sweden)

    Yumi Nonomura

    2012-08-01

    Full Text Available Extramammary Paget's disease is a rare cutaneous malignant neoplasm. Previous studies indicated the efficacy of docetaxel in advanced cases. The common side effects of docetaxel are usually tolerable and seldom life-threatening. We experienced a case of severe pseudomembranous colitis and neutropenic fever that developed just after the first cycle of docetaxel chemotherapy. To the best of our knowledge, there are few reports of pseudomembranous colitis associated with docetaxel administration for skin cancers. The patient showed complete resolution of her symptoms within 2 weeks with an oral metronidazole therapy. During the second and third cycles, the patient received docetaxel safely with lower doses. The present case indicated that pseudomembranous colitis should be included in the differential diagnosis when assessing patients who develop severe diarrhea during systemic chemotherapy with docetaxel.

  19. Paget's disease of the nipple. A continuing enigma

    DEFF Research Database (Denmark)

    Osther, P J; Balslev, Erik; Blichert-Toft, M

    1990-01-01

    Paget's disease of the nipple, although recognized since 1874, remains in several respects enigmatic. The two main theories of its origin are 1) epidermotropic, i.e. ductal cancer cells migrating to the epidermis of the nipple, and 2) in situ appearance of malignant keratinocytes expressing......-conserving management of Paget's disease of the nipple are in progress....

  20. Giant cell tumor complicating Paget disease of long bone

    Energy Technology Data Exchange (ETDEWEB)

    Hoch, Benjamin [Mount Sinai Medical Center, Department of Pathology, New York, NY (United States); Hermann, George [Mount Sinai Medical Center, Department of Radiology, New York, NY (United States); Klein, Michael J. [University of Alabama School of Medicine, Department of Pathology, Birmingham, AL (United States); Abdelwahab, Ibrahim F. [Coney Island Hospital affiliated with CUNY Downstate School of Medicine, Department of Radiology, New York, NY (United States); Springfield, Dempsey [Massachusetts General Hospital, Department of Orthopaedic Surgery, Boston, MA (United States)

    2007-10-15

    Giant cell tumor (GCT) is a rare complication of Paget disease of bone. It usually occurs in the skull or pelvic bones of patients with long-standing polyostotic disease. This report describes a 62-year-old patient who presented with monostotic Paget disease of the distal femur complicated by GCT. He had a 2-year history of discomfort and pain in his left knee. Conventional plain films and MRI demonstrated the characteristic bone changes of Paget disease and an associated lytic lesion involving the epiphyseal and metaphyseal regions of the distal femur. A diagnostic curettage showed the characteristic histopathologic features of Paget disease and GCT. There was no evidence of malignancy. The clinicopathologic features of this rare lesion are described and correlated with a review of the literature. (orig.)

  1. A Case of Thoracic Spinal Stenosis Secondary to Paget's Disease

    Institute of Scientific and Technical Information of China (English)

    Yu Zhao; Yi-peng Wang; Gui-xing Qiu; Jian-xiong Shen; Xi-sheng Weng; Xiang Li; Nai-guo Wang

    2010-01-01

    PAGET'S disease, also called osteitis deformans, is a metabolic bone disorder. It is characterized by increased bone resorption and the compensatory formation of new bones. The increased bone conversion and remodeling lead to the incrustation of woven bones and lamellar bones and finally result in the expansion, loosening, and excessive vascularization of the affected bones, rendering them susceptible to deformity and fracture.1 Paget's disease occurs much more com-monly in Anglo-Saxons than in Asians and Africans.

  2. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    Science.gov (United States)

    ... myopathy with early-onset Paget disease and frontotemporal dementia Enable Javascript to view the expand/collapse boxes. ... myopathy with early-onset Paget disease and frontotemporal dementia ( IBMPFD ) is a condition that can affect the ...

  3. An electron microscopic study of clinical Paget's disease of the nipple

    DEFF Research Database (Denmark)

    Jahn, H; Osther, P J; Nielsen, E H

    1995-01-01

    An ultrastructural study of the epidermis from eight patients with clinical Paget's disease of the nipple supports the epidermotropic theory. There was no evidence that the Paget's cells originated from keratinocytes. We propose the hypothesis that Paget's cells represent transformed ductal cells...

  4. Asymptomatic Paget's disease of bone presenting with complete atrioventricular block

    Institute of Scientific and Technical Information of China (English)

    A.Rauoof Malik; Nazir A.Lone; Hilal A.Rather; Vicar M Jan; Javid A.Malik; Khursheed A.Khan; S.Jalal

    2008-01-01

    @@ Paget's disease of bone is a deforming bone disease (osteitis deformans) characterized by increased bone remodeling,bone hypertrophy,and abnormal bone structure,leading to bone expansion,deformities,easy fractures,and occasionally,neoplastic transformation.It is the second most common bone disorder after osteoporosis.1 The disease is relatively rare in Asia but is common in Europe and North America,affecting approximately 2% of the population over 50 years,although lately,a decline in the prevalence has been reported.2 Paget's disease commonly affects people in or past their middle age and is slightly more common in men than in women.1 The exact cause of Paget's disease is not known.Environmental agents,particularly paramyxoviral infections (measles and canine distemper viruses) have been postulated as potential etiological factors.3 Recently,a strong genetic component has been described,with candidate loci suggested at 18q,5q35-QTER,and particularly,the squestosome 1/p62.2,3 The pathological process in Paget's disease consists of one or more areas of aggressive and relentless osteoclastic activity,coupled with deposition of structurally abnormal excessive bone and matrix tissues.1,4 Most of the cases involve only one (monostotic) or few bones,particularly skull,vertebrae,pelvis,femur,and tibia.

  5. Paget's disease of the skull causing hyperprolactinemia and erectile dysfunction: a case report

    Directory of Open Access Journals (Sweden)

    Hepherd Rachel

    2008-07-01

    Full Text Available Abstract Introduction Hyperprolactinemia is an uncommon cause of erectile dysfunction in men. Paget's disease of the skull is a relatively common disease. This case proposes a rare example of a causative link between the two and how treatment of the Paget's disease with bisphosphonates helped the patient regain erectile function. Case presentation A 67-year-old man with Paget's disease of the skull presented with prostatitis, erectile dysfunction, and hyperprolactinemia. Radio-isotope scanning showed increased vascularity around the sphenoid bone. Treatment with intravenous bisphosphonates improved the active Paget's disease as indicated by declining alkaline phosphatase levels and the patient's erectile function while serum prolactin levels became normal and serum testosterone levels remained unchanged. Conclusion It is possible that hyperprolactinemia is unrecognised in other patients with Paget's disease of the skull. Normalizing elevated prolactin levels by using bisphosphonates in treating Paget's disease appears to be more appropriate than traditional treatment for hyperprolactinemia.

  6. Ubiquitin-mediated signalling and Paget's disease of bone

    Directory of Open Access Journals (Sweden)

    Shaw Barry

    2007-11-01

    Full Text Available Abstract Multiple steps in the RANK-NF-κB signalling pathway are regulated by ubiquitylation. Mutations affecting different components of this pathway, including the ubiquitin binding p62 signalling adapter protein, are found in patients with Paget's disease of bone or related syndromes. Here, we review the molecular defects and potential disease mechanisms in these conditions and conclude that the mutations may confer a common increased sensitivity of osteoclasts to cytokines, resulting in disordered NF-κB-dependent osteoclast function. Modulation of the osteoclast RANK-NF-κB signalling axis may represent a viable therapeutic strategy for Paget's disease and other conditions where excessive bone resorption or remodelling is a feature. Publication history: Republished from Current BioData's Targeted Proteins database (TPdb; http://www.targetedproteinsdb.com.

  7. Imaging Paget's disease of bone--from head to toe.

    Science.gov (United States)

    Cortis, K; Micallef, K; Mizzi, A

    2011-07-01

    Paget's disease of the bone is a common, non-inflammatory, metabolic, skeletal disorder of unknown aetiology characterized by an increase in osteoclast-mediated bone resorption and compensatory excessive osteoblast activation. Prevalence increases with age, and a pronounced geographical variation is well documented. The disease is often an incidental finding on a radiological examination requested for an unrelated indication. The osteolytic, mixed osteolytic/osteoblastic, and osteosclerotic phases may occur in the same patient and same bone in a synchronous or metachronous fashion. Radiological features in each phase mirror the histopathological appearances, and are distinctive enough to establish a diagnosis with confidence. Using multi-technique imaging, this review illustrates the most common and the not so common radiological patterns of involvement in Paget's disease of bone observed at our centre during the past 20 years.

  8. Determinants of quality of life in Paget's disease of bone.

    Science.gov (United States)

    Castro, Gláucio Ricardo Werner de; Castro, Silvania Ana Fernandes de; Pereira, Ivanio Alves; Zimmermann, Adriana Fontes; Toscano, Maria Amazile; Neves, Fabricio Souza; Scottini, Maria Aparecida; Paupitz, Juliane; Rosa, Julia Salvan da; Buss, Ziliani; Fröde, Tânia Silvia

    2017-09-26

    To evaluate the parameters associated with quality of life in patients with Paget's disease of bone. Patients with Paget's disease of bone were evaluated with SF-36 and WHOQOL-bref questionnaires. Patients with other diseases that could cause significant impairment of their quality of life were excluded. We searched for correlations between the results and: age, time from diagnosis, type of involvement, pain related to Paget's disease of bone, limitation to daily activities, deformities, bone specific alkaline phosphatase, the extent of involvement and treatment. Fifty patients were included. Results of the SF-36 total score and its domains, physical and mental health, were significantly correlated with bone pain and deformities. Marital status was significantly correlated with the SF-36 total score and Mental Health Domain. BAP levels and disease extension were significantly correlated to SF-36 Physical Health Domain. After multivariate analysis, the only parameters that remained significantly associated with the SF-36 total score and to its Mental Health and Physical Health Domains were pain and marital status. The WHOQOL-bref total score was significantly associated with pain, physical impairment and deformities. WHOQOL-bref Domain 1 (physical) score was significantly associated with marital status, pain and deformities, while Domain 2 (psychological) score was associated with marital status, physical impairment and kind of involvement. After multivariate analysis, the presence of pain, deformities, and marital status were significantly associated with results of the WHOQOL-bref total score and its Domain 1. WHOQOL-bref domain 2 results were significantly predicted by pain and marital status. The main disease-related factor associated with SF-36 results in Paget's disease of bone patients was bone pain, while bone pain and deformities were associated with WHOQOL-bref. Copyright © 2017 Elsevier Editora Ltda. All rights reserved.

  9. Angiogenesis in Paget's Disease of the Vulva and the Breast: Correlation with Microvessel Density

    Directory of Open Access Journals (Sweden)

    Patricia E. Ellis

    2012-01-01

    Full Text Available Our understanding of the pathogenesis of Paget's disease of the vulva and the breast remains limited. Current evidence supports the fact that angiogenesis plays an important role in the pathogenesis of several diseases. Therefore, we sought to define its role, as correlated with microvessel density, in Paget's disease of the vulva and the breast. Microvessels were analysed using anti-von Willebrand factor antibody in 105 cases of Paget's disease of the vulva and the breast comprising 71 cases of Paget's disease of the vulva, including 8 cases with invasive disease, and 34 cases of Paget's disease of the breast. The latter included 12 cases with DCIS, 5 cases with both DCIS and invasive carcinoma, and 6 with carcinoma alone. Eleven cases had no underlying tumour identified. Increased microvessel density was demonstrated in Paget's disease of the breast with DCIS and with carcinoma alone compared to Paget's disease of the breast alone, <0.08 and <0.013, respectively. There were no significant differences in microvessel density in the vulval cases. Neovascularisation is an important process in the development of Paget's disease of the breast. Other biological and molecular processes are more involved in the pathogenesis of Paget's disease of the vulva.

  10. Paget's disease of the vulva: A review of 89 cases

    Directory of Open Access Journals (Sweden)

    Cherry O. Onaiwu

    2017-02-01

    Full Text Available The purpose of this study was to retrospectively review the clinical characteristics and outcomes of a series of women with Paget's disease of the vulva. A retrospective review was performed of 89 women with Paget's disease of the vulva evaluated at a single institution between 1966 and 2010. Medical records were reviewed for demographic information, clinical data, pathologic findings, treatment modalities and outcomes. We found that the primary treatment was surgery for 74 (83.1% patients, with positive margins noted in 70.1% of cases. Five patients (5.6% underwent topical treatment with imiquimod and/or 5-fluorouracil, one patient (1.1% underwent laser ablation and treatment was unknown in 9 patients (10.1%. The majority of patients had multiple recurrences, with 18% having four or more recurrences. There were no significant differences in recurrence rates between patients who underwent surgery and those who did not. Furthermore, there was no association between positive margins following primary surgery and recurrence. Forty-one patients (46.1% were diagnosed with 53 synchronous or metachronous cancers. Seven patients (7.9% were found to have invasive vulvar cancer with 1 mm or more depth of invasion, but none of the patients died of Paget's disease or associated vulvar/vaginal cancer. Our findings suggest that the majority of patients with Paget's disease of the vulva develop multiple recurrences regardless of treatment modality or margin status. Alternatives to surgery are needed to better care for women with this disease.

  11. Paget's disease of the breast in a male with lymphomatoid papulosis: a case report

    Directory of Open Access Journals (Sweden)

    Fouad Dina

    2011-01-01

    Full Text Available Abstract Introduction Paget's disease is an eczematous skin change of the nipple that is usually associated with an underlying breast malignancy. Male breast cancer represents only 1-3% of all breast malignancies and Paget's disease remains very rare. Case presentation We present the case of a 67-year-old Caucasian man with lymphomatoid papulosis who was diagnosed with Paget's disease of the nipple and who was treated successfully with surgery alone. We discuss the presentation, investigations, management and pathogenesis of Paget's disease of the nipple. Conclusion The case highlights the need to be vigilant when new skin lesions arise in the context of an underlying chronic skin disorder.

  12. An electron microscopic study of clinical Paget's disease of the nipple

    DEFF Research Database (Denmark)

    Jahn, H; Osther, P J; Nielsen, E H

    1995-01-01

    An ultrastructural study of the epidermis from eight patients with clinical Paget's disease of the nipple supports the epidermotropic theory. There was no evidence that the Paget's cells originated from keratinocytes. We propose the hypothesis that Paget's cells represent transformed ductal cells......, from the subjacent lactiferous ducts of the nipple, which have migrated into the epidermis, either as neoplastic cells or as normal ductal cells with secondary in situ transformation in the epidermis....

  13. Sarcomatous degeneration of Pagets disease in the calcaneus: a case report; Degeneracao sarcomatosa de doenca de Paget do calcaneo: relato de caso

    Energy Technology Data Exchange (ETDEWEB)

    Matiotti, Simone Berwig; Tramunt, Conrado Silva; Duarte, Rogerio Dias; Duarte, Rodrigo Dias; Duarte, Wolmir Lourenco [Clinica Serdil, Porto Alegre, RS (Brazil)]. E-mail: smat2@hotmail.com; Soder, Janine Bernardi [Fundacao Saint Pastous, Porto Alegre, RS (Brazil). Clinica Serdil

    2009-01-15

    Neoplastic degeneration in Paget's disease is a rare complication (approximately 1% of cases) and, despite the treatment, presents a poor prognosis. The authors report a case of a male, 82-year-old patient with long standing Paget's disease who presented imaging findings of malignant degeneration in the calcaneus histopathologically diagnosed as sarcomatous degeneration (author)

  14. Doença de Paget invasiva da vulva e região perianal: relato de caso Invasive Paget's disease of the vulva and perianal region: a case report

    Directory of Open Access Journals (Sweden)

    Etelvino de Souza Trindade

    2004-05-01

    Full Text Available A doença de Paget extramamária (DPE é uma condição neoplásica incomum observada principalmente em áreas com numerosas glândulas apócrinas e écrinas. Na mulher é mais comum na vulva, embora possa ocorrer em outros locais. A doença de Paget vulvar (DPV pode ser classificada em primária, de origem cutânea, e secundária, de origem extracutânea, com significado clínico e implicações prognosticas importantes. Clinicamente a DPV começa insidiosamente com prurido e sensação de queimação. A lesão surge como uma placa isolada com superfície eczematosa, eritematosa e descamativa. Relatamos o caso de uma paciente de 72 anos com lesão eritematosa em placa, levemente espessada, com áreas de erosão envolvendo os grandes e os pequenos lábios à direita e à esquerda, o clitóris, o púbis e as regiões perineal e perianal. A cirurgia realizada foi vulvectomia radical com linfadenectomia inguinal. O histopatológico revelou doença de Paget invasiva. Métodos imuno-histoquímicos mostraram células de Paget positivas para CEA, EMA e citoceratina pan. A patogênese e o diagnóstico da DPE são discutidos, assim como os diagnósticos diferenciais e as referências com métodos imuno-histoquímicos. A recidiva ocorre em 30% dos casos, mesmo com o controle adequado da margem cirúrgica. A experiência com DPV é limitada e o seguimento é requerido para excluir recidivas e o desenvolvimento de um câncer associado.Extramammary Paget's disease (EPD is an uncommon neoplasic condition observed mostly in areas with numerous apocrine and or eccrine glands. In the woman it is most commonly seen on the vulva, although it can occur in other locations. Vulvar Paget's disease (VPD can be classified into primary, of cutaneous origin, and secondary, of extracutaneous origin, with significant clinical e prognostic implications. Clinically VPD begins insidiously with pruritus and burning sensation. The lesion appears as a solitary patch with an

  15. Doença de Paget com acometimento sacral: relato de caso Paget's disease with sacral involvement: a case report

    Directory of Open Access Journals (Sweden)

    Fernanda Nogueira Holanda Ferreira Braga

    2010-10-01

    Full Text Available Os autores relatam o caso de um paciente do sexo masculino, 71 anos de idade, com diagnóstico de doença de Paget óssea sacral. Foi realizado estudo com radiografia, cintilografia, tomografia computadorizada e ressonância magnética, e o diagnóstico foi confirmado por análise histopatológica. O paciente evoluiu com boa resposta ao uso de ibandronato 150 mg, mensalmente, com redução significativa dos marcadores bioquímicos da doença.The authors report a case of a 71-year-old male patient diagnosed with Paget's disease of sacrum. Imaging study was performed with radiography, scintigraphy, computed tomography and magnetic resonance imaging, and the diagnosis was confirmed by biopsy. The patient progressed with a good response to monthly treatment with ibandronate 150 mg, presenting a significant reduction in biochemical markers of disease.

  16. Mucinous breast carcinoma presenting as Paget's disease of the nipple in a man: A case report

    Directory of Open Access Journals (Sweden)

    Charalabopoulos Konstantinos

    2008-10-01

    Full Text Available Abstract Introduction Male breast cancer is rare compared to its female counterpart representing less than 1% of cancer in men. Moreover, mucinous carcinoma of the male breast is an extremely rare histological subtype of malignancy. Paget's disease of the nipple is rarely observed in males. Case report Herein, we describe a unique case of an 86 years old man with mucinous breast cancer presenting as Paget's disease of the nipple. According to the immunohistochemical evaluation the neoplastic cells were positive for estrogen (ER and progesterone receptors (PR. Conclusion To our best knowledge this is the first case of mucinous male breast cancer presenting as Paget's disease of the nipple.

  17. Pain and Paget's Disease of Bone

    Science.gov (United States)

    ... Your Doctor (NIA) Conversando con su médico (NIA) Sea miembro activo del equipo de cuidados de la Salud (FDA) '); docprint.document.close(); docprint.focus(); */ } //--> Print-Friendly Page May 2015 Types of Pain Paget’s disease can cause ...

  18. Paget's Disease is Associated with Eleven Cancerous Regions: a Case Report and Therapeutic Strategy

    Institute of Scientific and Technical Information of China (English)

    Yongxi SONG; Zhenning WANG; Huimian XU; Zhenyu YUE; Chengzhong XING

    2009-01-01

    Paget's disease of the breast is an uncommon disorder that accounts for 1% to 3% of all mammary tumors. The incidence of underlying carcinoma associated with Paget's disease has been re-ported in 82% to 100% of cases. The finding of underlying carcinoma reaches almost 100% when a palpable lump is also present. In this rare case, we described a patient presenting with Paget's disease but no palpable lump. However, we found 11 independent regions which were all invasive ductal carci-noma after the operation. Considering this patient, we should pay more attention to a multifocal and multicentric breast carcinoma associated with Paget's disease. Furthermore, we believe the mammog-raphy examination and a modified radical mastectomy are the most appropriate treatments for this population in clinical practice.

  19. The Nature of Expansion of Paget’s Disease of Bone

    Science.gov (United States)

    2013-04-01

    cell line or normal marrow from uninvolved bones from PDB (5). We obtained the PSV10 cell line from Dr. G. David Roodman (Indiana University...H, Boykin CS, Zhang H, Ishizuka S, Dempster DW, Roodman GD, Windle JJ. A SQSTM1/p62 mutation linked to Paget’s disease increases the...Singer FR, Bruder JM, Roodman GD. Enhanced RANK ligand expression and responsivity of bone marrow cells in Paget’s disease of bone. J Clin Invest

  20. Long-term trends in the incidence of Paget's disease of bone.

    Science.gov (United States)

    Tiegs, R D; Lohse, C M; Wollan, P C; Melton, L J

    2000-09-01

    Existing data on the epidemiology of Paget's disease of bone are limited by the lack of directly determined secular trends in clinically diagnosed Paget's disease. In the current study, we examine trends in Paget's disease incidence in Olmsted County, MN, using data from the Rochester Epidemiology Project medical records linkage system. During the period 1950 through 1994, 236 Olmsted County, MN residents were diagnosed for the first time with Paget's disease of bone at a mean age of 69.6 years. Overall, there were 129 (54.7%) men and 107 women, and the age-adjusted incidence of Paget's disease was 12.7 per 100,000 person-years (95% CI 10.4-14.9) among the men compared with 7.0 per 100,000 person-years (95% CI 5.6-8.3) among Olmsted County women (male/female ratio of 1.8:1). The higher incidence in males compared with females and the increase in incidence with older age were statistically significant. The incidence of Paget's disease in Olmsted County seems to have increased over the first part of the study period and then declined. This may have resulted from ascertainment bias: the introduction of a 12-test automated serum chemistry panel in 1974 might have led to a sudden increase in the apparent incidence of Paget's disease followed by a compensatory decrease. In addition, there was a decrease in the proportion of patients who were symptomatic at diagnosis, from 36% in 1950-1959 to 27% in 1980-1994. This finding also suggests that routine measurement of alkaline phosphatase may have led to more diagnosis of asymptomatic individuals. The subsequent fall in the incidence of Paget's disease is consistent with previous reports, although this apparent decline could be artifactual to the extent that the reservoir of undiagnosed cases in the population was exhausted by earlier testing.

  1. Paget disease of bone: A classic case report

    Directory of Open Access Journals (Sweden)

    Y Uday Shankar

    2013-01-01

    Full Text Available Paget disease of bone (PDB is a chronic progressive disease of the bone of uncertain etiology, characterized initially by an increase in bone resorption, followed by a disorganized and excessive formation of bone, leading to pain, fractures, and deformities. It can manifest as a monostotic or polyostotic disease. The prevalence of PDB is common in the Anglo-Saxon population, but relatively rare in India. The disease is often asymptomatic and commonly seen in an aging population. The diagnosis of the disease is mostly based on radiological examination and on biochemical markers of bone turnover. Markedly elevated serum alkaline phosphatase (SAP is a constant feature while calcium and phosphate levels are typically within normal limits. It is being successfully treated by biphosphonates, a group of anti-resorptive drugs, thereby decreasing the morbidity and mortality associated with the disease. We report a classic case of PDB with craniofacial involvement resulting in Leontiasis Ossea (lion like face, cotton wool appearance of the skull and elevated SAP.

  2. Primary perianal extramammary Paget’s disease: Case report with review

    Directory of Open Access Journals (Sweden)

    Anshuman Pandey

    2016-07-01

    Full Text Available Extramammary Paget’s disease (EMPD is a rare cancer which involves the skin and apocrine glands. It involves the vulva, perianal region, scrotum, penis and axilla. Primary disease originates from intraepidermal cells and secondary originates from underlying neoplasm. The disease presents with thickened plaque like lesion with erythema or white scaly appearance. The cancers of urinary tract like the bladder, urethra and prostrate are associated with EPMD involving the genitalia and rectal tumours are associated with perianal disease. The disease affects females more than males with the median age being 72 years. Primary perianal EMPD is even rare in presentation. It is a slow growing tumour and the prognosis is usually favourable other than advanced stage and old age. The surgical resection with clear margins is considered to be the standard of care and provides good outcomes. However, if surgery is not feasible other treatment options like imiquimod 5% topical cream and radiation therapy may be offered. We present a young male with perianal EMPD who was managed with surgical resection with clear margins with split skin graft leading to a favourable outcome.

  3. Tumor Wide Horizontal Invasion Predicts Local Recurrence for Scrotal Extramammary Paget’s Disease

    Science.gov (United States)

    Wang, Lujia; Feng, Chenchen; Zhou, Minwei; Zhou, Zhongwen; Ding, Guanxiong; Gao, Peng; Ding, Qiang; Wu, Zhong

    2017-01-01

    Extramammary Paget’s disease (EMPD) is a rare malignancy, and little was known about its prognostic factors and optimal treatment. In the current study, we aimed to discuss clinical and pathological features of scrotal EMPD and determine the prognostic factors for cancer-specific survival and local recurrence. A total of 206 patients with scrotal EMPD lesions surgically treated at our institute were studied. All clinical and pathological data were reviewed. Immunohistochemical staining of TP53 and Ki67 was examined as well. At the last follow-up, 175 patients (84.95%) were alive. Twelve patients (5.83%) had died of the disease due to distant metastases. Fifteen patients (7.28%) developed local recurrences of scrotal EMPD. Ki67 expression was significantly elevated in patients with wide horizontal invasion (P = 0.003). In univariate analysis, high invasion level, presence of nodule, presence of lymphovascular invasion, adnexa invasion, lymph node metastasis and high p53 expression were significant factors for poor cancer-specific survival. In multivariate analysis, high p53 expression was significantly correlated with poor cancer-specific survival. Wide horizontal invasion was independently correlated with local recurrence-free survival of scrotal EMPD. In conclusion, wide horizontal invasion is an independent risk factor for local recurrence-free survival in the patients with scrotal EMPD. PMID:28322288

  4. Extramammary Paget’s Disease: 20 Years of Experience in Chinese Population

    Directory of Open Access Journals (Sweden)

    Jimmy Yu Wai Chan

    2012-01-01

    Full Text Available Background. To examine the results of treatment of Extramammary Paget’s disease (EMPD in ethnic Chinese. Method. Between 1990 and 2010, patients treated for EMPD were reviewed. Data were analyzed retrospectively. Results. Forty-eight patients were treated by surgical resection. Local recurrence rate was 14.6%. The postresection defects were repaired by primary closure (8.3%, partial thickness skin graft (72.9%, or local/regional flaps (18.8%. Dermal invasion was found in 9 patients (18.8%. Seven patients (14.6% developed regional lymph node metastasis (concurrent with surgery, =1; subsequent to surgery, =6, and 3 patients (6.3% had systemic metastasis after surgery. The presence of dermal invasion was associated with significantly higher incidence of regional lymph nodes and systemic metastasis. The incidence of associated internal malignancy was 8.3%. Conclusion. The mainstay of treatment for EMPD is surgery. Pathological dermal invasion increases the chance of regional lymph node as well as systemic metastasis. The association with internal malignancy warrants preoperative endoscopic examination in all patients.

  5. On the Nature of Expansion of Paget’s Disease of Bone

    Science.gov (United States)

    2012-10-01

    PDB patients (7). We obtained the PSV10 cell line from Dr. G. David Roodman (Indiana University School of Medicine) and tested the cells for a SQSTM1...Zhou H, Boykin CS, Zhang H, Ishizuka S, Dempster DW, Roodman GD, Windle JJ. A SQSTM1/p62 mutation linked to Paget’s disease increases the...JM, Roodman GD. Enhanced RANK ligand expression and responsivity of bone marrow cells in Paget’s disease of bone. J Clin Invest. 2000;105(12):1833

  6. Pathological fracture of the femur in a patient with Paget's disease of bone: a case report.

    Science.gov (United States)

    Petrescu, Pompiliu HoraŢiu; Izvernariu, Dragoş Andrei; Iancu, Cătălina; Dinu, Gabriel Ovidiu; Berceanu-Văduva, Marcel Mihai; Crişan, Dan; Iacob, Mihaela; Bucur, Venera Margareta; RăuŢia, Ion Călin; Prejbeanu, Ion Radu; Dema, Sorin; DuŢă, Ciprian Constantin

    2016-01-01

    Paget's disease of bone is a benign disease characterized by exaggerated remodeling of the bone matrix after osteoclast-mediated bone destruction. Its etiology is still unknown, despite the fact that it was discovered and described in 1877, but genetic factors and environmental triggers were shown to play their part in the pathogenesis of the disease. The main clinical presentations of the disease are related to bone pain and deformities. Radiological diagnosis is the main detection tool, though many monostotic Paget's disease cases may remain undiagnosed. We present the case of an 81-year-old male patient admitted to the Clinic of Orthopedics, Emergency County Hospital, Timisoara, Romania, with intense pain and deformity of the upper left thigh. Radiological examination performed shows a complete fracture of the upper third diaphysis of the left femur with suggestive signs for Paget's disease of the bone therefore a biopsy was taken and the patient was treated by surgical realignment with favorable evolution. He was discharged 13 days after surgery. The biopsy of the bone revealed extensive bone remodeling with numerous osteoclasts and extensive bone matrix deposition, unevenly stained and unevenly mineralized and reverse cement lines, which are consistent with the diagnosis of Paget's disease of the bone. Histomorphometric analysis show intense matrix deposition with a highly active remodeling process. Computed tomography (CT) scans were performed three years later and show the extension of the disease into the lower half of the left femur.

  7. Photon-deficient bone scan lesion as a precursor of active Paget's disease

    Energy Technology Data Exchange (ETDEWEB)

    Jaspers, M.M.J.R.; Pauwels, E.K.J.; Blom, J. (Department of Diagnostic Radiology, Division of Nuclear Medicine, University Hospital Leiden (Netherlands)); Harinck, H.I.J. (Clinical Investigation Unit, Department of Endocrinology, University Hospital Leiden, Netherands)

    1984-05-15

    A case is presented in which a Pagetoid lesion was demonstrated as a photon-deficient area (cold spot) on the bone scan. This area changed into a hot spot 3 years after its discovery. Clinical and radiological observations provide evidence that a scintigraphically photon-deficient area may represent a precursor of active Paget's disease.

  8. [Was Beethoven's deafness caused by Paget's disease? Report of findings and study of skull fragments of Ludwig van Beethoven].

    Science.gov (United States)

    Jesserer, H; Bankl, H

    1986-10-01

    Paget's disease of bone (osteitis deformans) has been repeatedly named as a possible cause for Ludwig van Beethoven's deafness. In 1985 a descendent of Franz Romeo Seligmann (a Viennese medical historian who in 1863 had studied Beethoven's mortal remains on the occasion of their relocation) presented to us three bone fragments allegedly from Beethoven's cranium. They represented fragments of the left parietal bone and the occiputum. It was possible to prove nearly with certainty that these bone fragments actually are Beethoven's. They did not show signs of Paget's disease of bone. It must therefore be concluded that Beethoven's deafness was not caused by Paget's osteitis deformans.

  9. Understanding the Delay in Onset of Pagets Disease of Bone

    Science.gov (United States)

    2015-09-01

    change from last funding period) Contribution to Project Ms Alander performed routine cell culture and RNA preparation as well as stock maintenance...the measles virus nucleocapsid gene display a pagetic phenotype. J Clin Invest . 2000;105(5):607-14. PubMed PMID: 10712432.http://www.ncbi.nlm.nih.gov...alpha/ beta and IL-6 in the human lung epithelial cell line A549. Virology. 2001;290(1):1-10. PubMed PMID: 11882993.http://www.ncbi.nlm.nih.gov/pubmed

  10. Case report 438: Osteolytic phase of Paget disease affecting the ulna in case 1 and the humerus in case 2

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, M.L.; Ackermann, L.V.; Tsutsumi, Akira

    1987-08-01

    The two cases reported here are examples of monostotic Paget disease occurring in the unusual sites of the humerus and ulna. Sinse biopsy of osteolytic Paget disease may increase the likelihood of fracture, expecially in a weight-bearing long bone, an accurate radiographic diagnosis is important. Observation of a flame-shaped front of osteolysis or other radiographic features of Paget disease may be helpful. Exacerbation of radiographic osteopenia with immobilization, and remineralization with mobilization of the affected extremity, are findings which would also support the diagnosis of Paget disease. If the patient presents with a pathological fracture, as occurred in the two cases described here, a biopsy is appropriate to help establish the diagnosis, and to exclude sarcomatous transformation. A similar histological appearance might be found in patients with hyperparathyroidism, but the absence of the appropriate serological abnormalities and the characteristic radiographic findings in other bones, should exclude that diagnosis. (orig./SHA).

  11. Paget's disease of the breast: Clinical, mammographic, sonographic and pathologic findings in 52 cases

    Energy Technology Data Exchange (ETDEWEB)

    Guenhan-Bilgen, Isil [Ege University Hospital, Department of Radiology, Bornova 35100, Izmir (Turkey)]. E-mail: isilbilgen@hotmail.com; Oktay, Aysenur [Ege University Hospital, Department of Radiology, Bornova 35100, Izmir (Turkey)

    2006-11-15

    Purpose: To determine and quantitate radiologic characteristics of Paget's disease of the breast and to report clinical and pathologic findings. Materials and methods: A retrospective review of records of 2872 women who received a diagnosis of breast carcinoma between January 1988 and January 2006 revealed 52 histologicallly proved Paget's disease of the breast. Analysis included history, findings at physical examination, mammography and sonography (US) and histologic type of Paget's disease. Results: At physical examination, palpable mass (n = 33, 63%), nipple erythema-eczema-ulceration (n = 17, 33%) and blood-stained nipple discharge (n = 5, 10%) were noted. Among 17 patients who had clinically evident Paget's disease, the mammographic findings were isolated microcalcifications in 3 (18%), mass associated with microcalcifications in 5 (29%), mass in 2 (12%) and negative in 7 (41%) patients. In the 35 patients with clinically inevident Paget's disease, these mammographic findings were 43% (n = 15), 34% (n = 12), 20% (n = 7) and 3% (n = 1), respectively. US depicted 43 masses in 35 patients, all of which were lobulated or irregularly contoured, mostly (n = 41, 95%) without posterior acoustic shadowing. The cancer was clinically occult in 10% (n = 5), mammographically occult in 15% (n = 8) and radiologically occult in 13% (n = 7) of the 52 patients. Histologically, the tumor was multifocal and/or multicentric in 11 (21%) patients. Conclusion: The clinical features of Paget's disease are characteristic and should alert the clinician to the likelihood of an underlying carcinoma, which should be evaluated radiologically. However, as Paget's disease is primarily a clinical diagnosis and mammograms may be negative, screening programs without clinical examination may result with delay in diagnosis. As a result, both clinical and imaging findings are complementary and should be correlated to confirm or exclude a diagnosis of Paget

  12. Paget's Disease of the Breast in a Man. A Case Report

    Directory of Open Access Journals (Sweden)

    Lidia Torres Aja

    2014-01-01

    Full Text Available Paget’s disease of the breast is rare, accounting for only 1 to 1.5 % of all reported breast cancers cases. It frequently occurs in females in a 99:1 ratio compared to male, during the fourth or fifth decades of life in pre- or postmenopausal women. A case of Paget's disease of the breast clinically manifested by an eczematous lesion in a 76-year-old male patient is presented. This is the first case of Paget's disease of the breast in men diagnosed in the province of Cienfuegos. Due to the unusual presentation of this disease in males, the present case report is considered important for health professionals.

  13. Imaging Paget's disease of bone-from head to toe

    Energy Technology Data Exchange (ETDEWEB)

    Cortis, K.; Micallef, K. [Medical Imaging Department, Mater Dei Hospital, Msida (Malta); Mizzi, A., E-mail: adrian.mizzi@gov.mt [Medical Imaging Department, Mater Dei Hospital, Msida (Malta)

    2011-07-15

    Paget's disease of the bone is a common, non-inflammatory, metabolic, skeletal disorder of unknown aetiology characterized by an increase in osteoclast-mediated bone resorption and compensatory excessive osteoblast activation. Prevalence increases with age, and a pronounced geographical variation is well documented. The disease is often an incidental finding on a radiological examination requested for an unrelated indication. The osteolytic, mixed osteolytic/osteoblastic, and osteosclerotic phases may occur in the same patient and same bone in a synchronous or metachronous fashion. Radiological features in each phase mirror the histopathological appearances, and are distinctive enough to establish a diagnosis with confidence. Using multi-technique imaging, this review illustrates the most common and the not so common radiological patterns of involvement in Paget's disease of bone observed at our centre during the past 20 years.

  14. Diagnostic scope of computer tomography in hip disease - Paget's disease, femoral head necrosis, coxarthrosis, coxarthritis

    Energy Technology Data Exchange (ETDEWEB)

    Nebel, G.; Lingg, G.; Reid, W.

    1982-10-01

    The value of computer tomography was investigated in Paget's disease of the hip, femoral head necrosis (adult avascular and osteoradionecrosis), coxarthrosis and coxarthritis (bacterial and rheumatoid). The greatest value of CT is in the diagnosis of adult avascular necrosis of the femoral head and is valuable for localising the necrotic area in the axial plane. This is of value in planning surgical treatment (displacement osteotomy or endoprosthesis). In Paget's disease, coxarthrosis and coxarthritis, CT provides only additional or more precise information.

  15. Periprosthetic fracture of the acetabulum during total hip arthroplasty in a patient with Paget's disease.

    Science.gov (United States)

    McGrory, B J

    1999-04-01

    The case of a patient with Paget's disease of the pelvis (acetabulum) who had an intraoperative posterior wall fracture during the insertion of a noncemented acetabular component into an under-reamed acetabular bed of sclerotic Pagetoid bone is reported. This unusual complication has not, to my knowledge, been previously reported. Patients with sclerotic bone, like those with osteoporotic bone, may also be at risk for periprosthetic acetabular fractures when an under-reaming technique is used.

  16. Contributions of the Measles Virus Nucleocapsid Gene and the SQSTM1/p62P392L Mutation to Paget's Disease

    Science.gov (United States)

    Kurihara, Noriyoshi; Hiruma, Yuko; Yamana, Kei; Michou, Laëtitia; Rousseau, Côme; Morissette, Jean; Galson, Deborah L.; Teramachi, Jumpei; Zhou, Hua; Dempster, David W.; Windle, Jolene J.; Brown, Jacques P.; Roodman, G. David

    2011-01-01

    Summary Paget's Disease (PD) is characterized by abnormal osteoclasts (OCL) that secrete high IL-6 levels and induce exuberant bone formation. Because measles virus nucleocapsid gene (MVNP) and the p62P392L mutation are implicated in PD, marrows from 12 PD patients harboring p62P392L and 8 normals were tested for MVNP expression and pagetic OCL formation. 8/12 patients expressed MVNP and formed pagetic OCL in vitro, which were inhibited by antisense-MVNP. 4/12 patients lacked MVNP and formed normal OCL that were hyper-responsive to RANKL but unaffected by antisense-MVNP. Similarly, mice expressing only p62P394L formed normal OCL, while mice expressing MVNP in OCL, with or without p62P394L, developed pagetic OCL and expressed high IL-6 levels dependent on p38MAPK activation. IL-6 deficiency in MVNP mice abrogated pagetic OCL development in vitro. Mice co-expressing MVNP and p62P394L developed dramatic Paget's-like bone lesions. These results suggest that p62P394L and IL-6 induction by MVNP play key roles in PD. PMID:21195346

  17. Contributions of the measles virus nucleocapsid gene and the SQSTM1/p62(P392L) mutation to Paget's disease.

    Science.gov (United States)

    Kurihara, Noriyoshi; Hiruma, Yuko; Yamana, Kei; Michou, Laëtitia; Rousseau, Côme; Morissette, Jean; Galson, Deborah L; Teramachi, Jumpei; Zhou, Hua; Dempster, David W; Windle, Jolene J; Brown, Jacques P; Roodman, G David

    2011-01-05

    Paget's disease (PD) is characterized by abnormal osteoclasts (OCL) that secrete high IL-6 levels and induce exuberant bone formation. Because measles virus nucleocapsid gene (MVNP) and the p62(P392L) mutation are implicated in PD, marrows from 12 PD patients harboring p62(P392L) and eight normals were tested for MVNP expression and pagetic OCL formation. Eight out of twelve patients expressed MVNP and formed pagetic OCL in vitro, which were inhibited by antisense-MVNP. Four out of twelve patients lacked MVNP and formed normal OCL that were hyperresponsive to RANKL but unaffected by antisense-MVNP. Similarly, mice expressing only p62(P394L) formed normal OCL, while mice expressing MVNP in OCL, with or without p62(P394L), developed pagetic OCL and expressed high IL-6 levels dependent on p38MAPK activation. IL-6 deficiency in MVNP mice abrogated pagetic OCL development in vitro. Mice coexpressing MVNP and p62(P394L) developed dramatic Paget's-like bone lesions. These results suggest that p62(P394L) and IL-6 induction by MVNP play key roles in PD.

  18. ZNF687 Mutations in Severe Paget Disease of Bone Associated with Giant Cell Tumor.

    Science.gov (United States)

    Divisato, Giuseppina; Formicola, Daniela; Esposito, Teresa; Merlotti, Daniela; Pazzaglia, Laura; Del Fattore, Andrea; Siris, Ethel; Orcel, Philippe; Brown, Jacques P; Nuti, Ranuccio; Strazzullo, Pasquale; Benassi, Maria Serena; Cancela, M Leonor; Michou, Laetitia; Rendina, Domenico; Gennari, Luigi; Gianfrancesco, Fernando

    2016-02-04

    Paget disease of bone (PDB) is a skeletal disorder characterized by focal abnormalities of bone remodeling, which result in enlarged and deformed bones in one or more regions of the skeleton. In some cases, the pagetic tissue undergoes neoplastic transformation, resulting in osteosarcoma and, less frequently, in giant cell tumor of bone (GCT). We performed whole-exome sequencing in a large family with 14 PDB-affected members, four of whom developed GCT at multiple pagetic skeletal sites, and we identified the c.2810C>G (p.Pro937Arg) missense mutation in the zinc finger protein 687 gene (ZNF687). The mutation precisely co-segregated with the clinical phenotype in all affected family members. The sequencing of seven unrelated individuals with GCT associated with PDB (GCT/PDB) identified the same mutation in all individuals, unravelling a founder effect. ZNF687 is highly expressed during osteoclastogenesis and osteoblastogenesis and is dramatically upregulated in the tumor tissue of individuals with GCT/PDB. Interestingly, our preliminary findings showed that ZNF687, indicated as a target gene of the NFkB transcription factor by ChIP-seq analysis, is also upregulated in the peripheral blood of PDB-affected individuals with (n = 5) or without (n = 6) mutations in SQSTM1, encouraging additional studies to investigate its potential role as a biomarker of PDB risk.

  19. Ultrasonography in Paget's disease of the breast: Comparison with Mammographic findings

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Sang Hee; Chung, Soo Young; Lee, Kyung Won; Yang, Ik; Kim, Hong Dae; Shin, Sang June; Chung, Bong Wha; Shin, Jung Weon [Hallym University College of Medicine, Chuncheon (Korea, Republic of); Kim, Hak Hee; Kim, Hyeon Sook [Catholic University College of Medicine, Seoul (Korea, Republic of)

    2001-06-15

    To evaluate sonographic and mammographic findings in Paget's disease of the breast and to assess the usefulness of sonography. Sonographic (n=13) and mammographic findings (n=12) of thirteen patients (age ranged from 25 and 86 years with the mean age of 56) with pathologically proven Paget's disease of the breast were retrospectively reviewed and compared. Clinical manifestations of the subjects were reviewed using patients' medical records. On sonography, any change in subareolar, the presence of mass, the configuration of the mass if present, the changes of the main lactiferous ducts and the presence of calcification were analyzed. On mammography, the subareolar density, parenchymal distortion, the presence of mass and the presence and type of calcifications were analyzed. The frequent clinical manifestations of Paget's disease were nipple retraction (7/13), bloody nipple discharge (7/13), nipple eczema (4/13) and subareolar mass (4/13). On sonography, mass was the most common (12/13) feature, and the mass was seen as an irregular hypoechoic mass. The irregularly dilated major lactiferous duct associated with a mass (3/13), calcification (2/13), subareolar low echogenicity (1/13) and parenchymal distortion (1/13) were also observed. The most frequent mammographic findings was increased subareolar density(9/12), followed by parenchymal distortion (8/12), microcalcification (6/12) and the presence of mass (3/12). The types of microcalcification seen on mammography were branching (4/6) and granular (2/6) shapes. Mass in the breast was more frequent detected on sonography (12/13) than on mammography (4/12). The irregularly dilated major lactiferous duct (3/12) associated with the mass could not be demonstrated on mammography. On the other hand, breast sonography was inferior to mammography in the detection rate of microcalcification. In diagnosis of Paget's disease in the breast, sonography was more useful than mammography in the detection of

  20. Paget's Disease of Bone and Osteoarthritis: Different Yet Related

    Science.gov (United States)

    ... and Other Conditions Paget’s Disease of Bone and Osteoarthritis: Different Yet Related Publication available in: PDF (59 ... for sure what causes Paget’s disease. What Is Osteoarthritis? Osteoarthritis is a condition that causes changes in ...

  1. Increased IL-6 expression in osteoclasts is necessary but not sufficient for the development of Paget's disease of bone.

    Science.gov (United States)

    Teramachi, Jumpei; Zhou, Hua; Subler, Mark A; Kitagawa, Yukiko; Galson, Deborah L; Dempster, David W; Windle, Jolene J; Kurihara, Noriyoshi; Roodman, G David

    2014-06-01

    Measles virus nucleocapsid protein (MVNP) expression in osteoclasts (OCLs) and mutation of the SQSTM1 (p62) gene contribute to the increased OCL activity in Paget's disease (PD). OCLs expressing MVNP display many of the features of PD OCLs. Interleukin-6 (IL-6) production is essential for the pagetic phenotype, because transgenic mice with MVNP targeted to OCLs develop pagetic OCLs and lesions, but this phenotype is absent when MVNP mice are bred to IL-6(-/-) mice. In contrast, mutant p62 expression in OCL precursors promotes receptor activator of NF-κB ligand (RANKL) hyperresponsivity and increased OCL production, but OCLs that form have normal morphology, are not hyperresponsive to 1,25-dihydroxyvitamin D3 (1,25-(OH)2 D3 ), nor produce elevated levels of IL-6. We previously generated p62(P394L) knock-in mice (p62KI) and found that although OCL numbers were increased, the mice did not develop pagetic lesions. However, mice expressing both MVNP and p62KI developed more exuberant pagetic lesions than mice expressing MVNP alone. To examine the role of elevated IL-6 in PD and determine if MVNP mediates its effects primarily through elevation of IL-6, we generated transgenic mice that overexpress IL-6 driven by the tartrate-resistant acid phosphatase (TRAP) promoter (TIL-6 mice) and produce IL-6 at levels comparable to MVNP mice. These were crossed with p62KI mice to determine whether IL-6 overexpression cooperates with mutant p62 to produce pagetic lesions. OCL precursors from p62KI/TIL-6 mice formed greater numbers of OCLs than either p62KI or TIL-6 OCL precursors in response to 1,25-(OH)2 D3 . Histomorphometric analysis of bones from p62KI/TIL-6 mice revealed increased OCL numbers per bone surface area compared to wild-type (WT) mice. However, micro-quantitative CT (µQCT) analysis did not reveal significant differences between p62KI/TIL-6 and WT mice, and no pagetic OCLs or lesions were detected in vivo. Thus, increased IL-6 expression in OCLs from p62KI mice

  2. Clinical report of 19 cases of paget's disease of the male urinogenital system%男性泌尿生殖系Paget's病19例临床报道

    Institute of Scientific and Technical Information of China (English)

    郑安; 吕文成; 林俊; 郝钢跃

    2013-01-01

    Objectives To study the diagnosis and treatment of Paget's disease of the male urinogenital system.Methods Between 1994 and 2012,we treated 19 male patients with Paget's disease,aged 43 ~ 85 years with an average of 66.2 years.17 of 9 cases of are scrotum Paget's disease,2 is urethra skin nipple after radical cystoctomy for bladder transitional cell carcinoma.The most common presenting symptom of Paget' disease is erubescence,papula and pruritis.Lesions occasionally show hyperpigmentation or hypopigmentation,some lesions show ulceration or areas of leukoplakia.Results The local surgical excision,ideally with 1 ~ 2 cm margin of normal skin,were pursued for all patients.16 patients were followed up,who survive 12 ~ 158 months after operation,and 8 survivals.One of them was recurrent 13 months after operation and pursued with a second operation and the outcome is satisfying.8 patients died,5 patients succumbed to nontumorous factor,2 patients with other system tumor,1 patient was dysoemia.Conclusions Early diagnosis and prompt treatment are essential to Paget's disease.Enough intraoperative section may ensure no residual disease and diminished recurrence rate and there was no influence of patient 's survival time post operation with early Paget's disease.%目的 提高男性泌尿生殖系Paget's病的诊治水平.方法 总结19例男性泌尿生殖系Paget's病患者的临床资料.19例中17例为阴囊Paget's病,2例为膀胱癌膀胱全切术后输尿管皮肤乳头Paget's病.最常见的症状是阴囊处皮肤潮红、红色丘疹及皮肤瘙痒症.病变通常表现为皮肤色素过渡沉着或色素沉着不足,也有的表现为溃疡和黏膜白斑症.结果 19例均选择手术治疗,手术切除范围距皮损处l ~2cm.16例随访者中,术后存活时间为12个月~158个月,目前存活8例.l例于术后13个月复发,仍采用手术治疗,效果良好.8例死亡,其中5例死于非肿瘤疾病,2例合并其他系统恶性肿瘤,1

  3. Desarrollo de hiperparatiroidismo primario en el seguimiento de un paciente con enfermedad de Paget Development of primary hyperparathyroidism in the follow-up of a patient with Paget´s disease

    Directory of Open Access Journals (Sweden)

    Francisco R Spivacow

    2009-02-01

    Full Text Available La asociación de hiperparatiroidismo primario y enfermedad de Paget varía entre 2.2 y 6%. Hasta el año 2006 se habían descripto 73 casos con simultaneidad de ambos diagnósticos. Se presenta el caso de un paciente varón de 68 años con un Paget poliostótico activo medicado durante 10 años con bisfosfonatos, con buena evolución. A los 10 años de seguimiento se observan elevados niveles de calcemia, calcio iónico, la fosfatasa alcalina (FAL, su isoenzima ósea (FAIO, e intactos los valores de parathormona (PTHi. Se establece el diagnóstico de hiperparatiroidismo primario. Dado el inestable estado general se decide postergar la cirugía y tratarlo con zoledronato IV con buena respuesta.According to the medical literature, the association of primary hyperparathyroidism and Paget's disease varies from 2.2 to 6%. Up to the year 2006, a total of 73 cases had been described, where both diagnoses occurred simultaneously. However, no manifestation of primary hyperparathyroidism during the follow- up of Paget's disease has been reported in the revised literature. We report the case of a well-controlled patient, who developed primary hyperparathyroidism during the 10-year follow-up of Paget's disease. A 68-yearold male patient with active polyostotic Paget's disease was successfully treated with bisphosphonates for ten years. During follow-up, increased levels of calcemia, ionic calcium, alkaline phosphatase, bone alkaline phosphatase and intact parathyroid hormone values were registered. The patient was diagnosed with primary hyperparathyroidism. As a result of his unstable general health condition, surgery was postponed and intravenous zoledronic acid was prescribed, with a favorable outcome.

  4. Life-threatening hyperkalemia following zoledronic acid infusion for Paget's disease: a case report

    Directory of Open Access Journals (Sweden)

    Naysmith Morag

    2011-08-01

    Full Text Available Abstract Introduction Zoledronic acid is a highly effective treatment in Paget's disease for persistent bone pain and prevention of further progression of the disease. The commonest electrolyte abnormality is hypocalcemia. To the best of our knowledge this is the first case of hyperkalemia secondary to zoledronic acid to be published in the world literature. The commonest arrhythmia related to zoledronic acid is atrial fibrillation. Case presentation We describe the case of an 80-year-old Caucasian man, with a history of ischemic heart disease, who had an in-hospital cardiac arrest related to hyperkalemia. Increasing potassium levels were noted following his first zoledronic acid infusion for symptomatic control of bone pain secondary to Paget's disease. Our patient suffered a cardiac arrest 10 days following the zoledronic acid infusion. Our patient's biochemistry and electrocardiogram output were monitored until his death 26 days after his cardiac arrest. Our patient developed paroxysmal atrial fibrillation in the post-resuscitation period and there was persistent hyperkalemia that required prolonged treatment with calcium resonium. All other possible causes of hyperkalemia were excluded. Conclusion In our patient's case persistent hyperkalemia and life-threatening arrhythmias were associated with use of zoledronic acid. These side effects have not been reported before and the causative mechanism is far from clear as there are no obvious systemic effects of zoledronic acid. The combination of zoledronic acid with predisposing factors such as structural heart disease might account for the clinical picture we witnessed. As a result, electrolyte monitoring should be adopted early in zoledronic acid use. Further studies are required to elucidate the underlying mechanism of hyperkalemia and identify the target group of patients where zoledronic acid can be safely administered. Great caution is advised in patients with underlying heart conditions.

  5. Renal Cell Carcinoma Metastasized to Pagetic Bone.

    Science.gov (United States)

    Ramirez, Ashley; Liu, Bo; Rop, Baiywo; Edison, Michelle; Valente, Michael; Burt, Jeremy

    2016-01-01

    Paget's disease of the bone, historically known as osteitis deformans, is an uncommon disease typically affecting individuals of European descent. Patients with Paget's disease of the bone are at increased risk for primary bone neoplasms, particularly osteosarcoma. Many cases of metastatic disease to pagetic bone have been reported. However, renal cell carcinoma metastasized to pagetic bone is extremely rare. A 94-year-old male presented to the emergency department complaining of abdominal pain. A computed tomography scan of the abdomen demonstrated a large mass in the right kidney compatible with renal cell carcinoma. The patient was also noted to have Paget's disease of the pelvic bones and sacrum. Within the pagetic bone of the sacrum, there was an enhancing mass compatible with renal cell carcinoma. A subsequent biopsy of the renal lesion confirmed renal cell carcinoma. Paget's disease of the bone places the patient at an increased risk for bone neoplasms. The most commonly reported sites for malignant transformation are the femur, pelvis, and humerus. In cases of malignant transformation, osteosarcoma is the most common diagnosis. Breast, lung, and prostate carcinomas are the most common to metastasize to pagetic bone. Renal cell carcinoma associated with Paget's disease of the bone is very rare, with only one prior reported case. Malignancy in Paget's disease of the bone is uncommon with metastatic disease to pagetic bone being extremely rare. We report a patient diagnosed with concomitant renal cell carcinoma and metastatic disease within Paget's disease of the sacrum. Further research is needed to assess the true incidence of renal cell carcinoma associated with pagetic bone.

  6. Skeletal blood flow in Paget's disease of bone and its response to calcitonin therapy.

    Science.gov (United States)

    Wootton, R; Reeve, J; Spellacy, E; Tellez-Yudilevich, M

    1978-01-01

    1. Blood flow to the skeleton was measured by the 18F clearance method of Wooton, Reeve & Veall (1976) in 24 patients with untreated Paget's disease. In every patient but one, resting skeletal blood flow was increased. There was a significant positive correlation between skeletal blood flow and serum alkaline phosphatase and between skeletal blood flow and urinary total hydroxyproline excretion. 2. Fourteen patients were re-studied after they had received short-term (7 days or less) or long-term (7 weeks or more) calcitonin. Skeletal blood flow, alkaline phosphatase and urinary hydroxy-proline excretion fell towards normal in every case. There was some evidence from the short-term studies that calcitonin produced a more rapid fall in skeletal blood flow than in alkaline phosphatase. 3. Glomerular filtration rate appeared to increase transiently in response to calcitonin.

  7. Penile intraepithelial neoplasia with pagetoid features: report of an unusual variant mimicking Paget disease.

    Science.gov (United States)

    Amin, Ali; Griffith, Rogers C; Chaux, Alcides

    2014-04-01

    Precancerous lesions of the penis frequently share the morphologic features of the invasive counterpart. We have recently subclassified penile intraepithelial neoplasia into differentiated, warty, and basaloid subtypes, each one with distinctive microscopic morphology. Nevertheless, in our experience, some cases depart from this classification scheme and show unusual morphologic features, hindering the proper diagnosis on routine morphology alone. Herein we present a case of penile intraepithelial neoplasia with a pagetoid growth pattern, closely mimicking Paget disease. We describe the necessary steps to reach the final diagnose, including the use of immunohistochemistry for cytokeratin (CK) 7, CK20, CK34βE12, CAM 5.2, AE1/AE3, CEA, S100, Melan-A, and p63. We also discuss other differential diagnoses that should be considered such as malignant melanoma and urothelial carcinoma in situ with pagetoid spread and less common lesions such as pagetoid dyskeratosis, clear cell papulosis, and mucinous metaplasia.

  8. Osteitis deformans (Paget's disease) in a Burmese python (Python molurus bivittatus)--a case report.

    Science.gov (United States)

    Preziosi, Rosario; Diana, Alessia; Florio, Daniela; Gustinelli, Andrea; Nardini, Giordano

    2007-11-01

    Osteitis deformans (Paget's disease of bone) is a chronic focal disorder of bone remodelling characterized by an initial increase in osteoclast-mediated bone resorption, with subsequent compensatory increase in new bone formation, resulting in a disorganized mosaic of woven and lamellar bone. In the Burmese python (Python molurus bivittatus) of this report, multifocal gross swellings involving the proximal third of the vertebral spine were observed and associated with anorexia, a relative inability to move or to fully extend the body, and to strike at prey. Serum biochemistry revealed elevated alkaline-phosphatase activity. Radiographic changes (irregular bone proliferation along the vertebral margins), computed tomography scan results (abnormal mineral density), and histopathological features (generalized thickening of the bony trabeculae at the expense of the intertrabecular spaces and irregular patches of lamellar bone with a characteristic "mosaic" pattern) indicated osteitis deformans.

  9. Treatment of a vulvar Paget's disease by photodynamic therapy with a new light emitting fabric based device.

    Science.gov (United States)

    Vicentini, Claire; Carpentier, Olivier; Lecomte, Fabienne; Thecua, Elise; Mortier, Laurent; Mordon, Serge R

    2017-02-01

    The non-invasive vulvar Paget's disease is an intra-epidermal carcinoma with glandular characteristics. It appears like an erythematous plaque. The main symptoms are pruritus and pain. The standard treatment is surgical excision in depth. This treatment is complicated with a severe morbidity and photodynamic therapy can be an alternative choice. However, the pain experienced during the photodynamic treatment of vulvar lesion is intense and leads to a premature interruption of the treatment. The light emitting fabric is a part of a device under clinical evaluation for the treatment of actinic keratosis with photodynamic therapy. We report the observation of a vulvar Paget's disease treated by this device with a satisfactory result and an excellent tolerance. The patient has been diagnosed with non-invasive vulvar Paget's disease for 25 years. The disease recurred constantly despite several imiquimod applications, LASER treatments and conventional photodynamic therapy. These procedures were complicated with intense pain. To improve the tolerance, we performed three PDT sessions a month apart using a 16% methyl-aminolevulinate cream (Metvixia® Galderma, Lausanne, Switzerland) with the light emitting fabric at low irradiance (irradiance = 6 mW/cm(2) -fluence = 37 J/cm(2) ) with a satisfactory result and an excellent tolerance. There are no controlled trials evaluating the efficacy of photodynamic therapy in the treatment of vulvar Paget's disease. The treatment and follow-up protocols in the literature are heterogeneous. Pain is the most common side effect with greater intensity for perineal locations where photodynamic therapy is impractical outside of anesthesia or hypnosis. We report the case of a multirecidivant non-invasive vulvar Paget's disease treated with a satisfactory result and an excellent tolerance by the new light emitting fabric device. A specific study is required but the light emitting fabric could be indicated for the treatment of Paget

  10. Protocol for stage 2 of the GaP study (genetic testing acceptability for Paget's disease of bone: A questionnaire study to investigate whether relatives of people with Paget's disease would accept genetic testing and preventive treatment if they were available

    Directory of Open Access Journals (Sweden)

    McCallum Marilyn

    2008-05-01

    Full Text Available Abstract Background Paget's disease of bone (PDB disrupts normal bone architecture and causes pain, deformity, deafness, osteoarthritis, and fractures. Genetic factors play a role in PDB and genetic tests are now conducted for research purposes. It is thus timely to investigate the potential for a clinical programme of genetic testing and preventative treatment for people who have a family history of PDB. This study examines the beliefs of relatives of people with PDB. It focuses particularly on illness and treatment representations as predictors of the acceptability and uptake of potential clinical programmes. Illness representations are examined using Leventhal's Common Sense Self-Regulation Model while cognitions about treatment behaviours (acceptance of testing and treatment uptake are conceptualised within the Theory of Planned Behaviour. Methods/Design A postal questionnaire of non-affected relatives of people with Paget's disease. The sample will include relatives of Paget's patients with a family history of Paget's disease and relatives of Paget's patients without a family history of Paget's disease. The questionnaire will explore whether a range of factors relate to acceptability of a programme of genetic testing and preventive treatment in relatives of Paget's disease sufferers. The questionnaire will include several measures: illness representations (as measured by the Brief Illness Perceptions Questionnaire; treatment representations (as measured by Theory of Planned Behaviour-based question items, informed by a prior interview elicitation study; descriptive and demographic details; and questions exploring family environment and beliefs of other important people. Data will also be collected from family members who have been diagnosed with Paget's disease to describe the disease presentation and its distribution within a family. Discussion The answers to these measures will inform the feasibility of a programme of genetic testing and

  11. Radiological features of Paget disease of bone associated with VCP myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

    2012-03-15

    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  12. Inclusion body myopathy, Paget's disease of the bone and fronto-temporal dementia: a disorder of autophagy

    OpenAIRE

    Ju, Jeong-Sun; Weihl, Conrad C

    2010-01-01

    Inclusion body myopathy associated with Paget's disease of the bone and fronto-temporal dementia (IBMPFD) is a progressive autosomal dominant disorder caused by mutations in p97/VCP (valosin-containing protein). p97/VCP is a member of the AAA+ (ATPase associated with a variety of activities) protein family and participates in multiple cellular processes. One particularly important role for p97/VCP is facilitating intracellular protein degradation. p97/VCP has traditionally been thought to med...

  13. Doença de Paget óssea monostótica em vértebra lombar: uma localização atípica Monostotic Paget's disease of the lumbar vertebrae: an atypical location

    Directory of Open Access Journals (Sweden)

    Alexandre Dias Carvalho

    2010-01-01

    Full Text Available Paciente do sexo feminino, 41 anos, cor branca, com queixa de dor lombar há mais de três anos, sem irradiações, submetida há vários exames radiográficos sendo diagnosticada, por biópsia, doença de Paget monostótica na terceira vértebra lombar. Trata-se de uma localização incomum.Female patient, 41 years, Caucasian, with lumbar pain for more than three years, without irradiation, submitted to various radiological exams and diagnosed by biopsy with monostotic Paget's disease of the third lumbar vertebrae, which is an uncommon location.

  14. A rare case report of a primary large-cell neuroendocrine carcinoma of the breast with coexisting Paget disease.

    Science.gov (United States)

    Psoma, Elizabeth; Nikolaidou, Olga; Stavrogianni, Thomai; Mavromati, Areti; Lytras, Konstantinos; Xirou, Persefoni; Koumbanaki, Melanie; Panagiotopoulou, Dimitra

    2012-01-01

    Neuroendocrine carcinomas are malignancies deriving from neuroendocrine cells existing in various sites of the body, most commonly in the lungs and gastrointestinal tract. Primary neuroendocrine carcinomas of the breast are extremely rare, and their diagnosis is confirmed by positive neuroendocrine markers. We describe a case of a 46-year-old woman with a palpable mass in her left breast for the previous 3 months. The tumor was resected and a primary large-cell neuroendocrine tumor of the breast was confirmed by histopathologic examination. Paget disease of the nipple was noted as well.

  15. Usefulness of MRI in detecting occult breast cancer associated with Paget's disease of the nipple-areolar complex.

    Science.gov (United States)

    Echevarria, J J; Lopez-Ruiz, J A; Martin, D; Imaz, I; Martin, M

    2004-12-01

    MRI allows for the detection of mammographically and clinically occult breast neoplasms. We analysed the ability of MRI to detect occult breast cancer in three patients with Paget's disease of the nipple-areolar complex, proven histologically. In all three cases we observed differences in the morphological and dynamic features of healthy and pathological nipples, and we also found enhancement foci in breast tissue, with suspicious kinetic and morphological characteristics, which in the case of two patients corresponded to ductal carcinoma in situ. The detection and location with MRI of underlying neoplastic foci may be of help in choosing the most reasonable and conservative treatment in these patients.

  16. Gene expression profile in osteoclasts from patients with Paget's disease of bone.

    Science.gov (United States)

    Michou, Laetitia; Chamoux, Estelle; Couture, Julie; Morissette, Jean; Brown, Jacques P; Roux, Sophie

    2010-03-01

    Paget's disease of bone (PDB) is a common metabolic bone disorder with a significant genetic component. To date, only one gene associated with PDB has been identified, the p62-Sequestosome1 gene (SQSTM1), and more than 20 mutations of this gene have been reported in PDB, the most common being the P392L substitution. In order to search for differentially expressed genes in PDB, we investigated the relative gene expression profile of candidate genes in osteoclast (OCL) cultures from 12 PDB patients and six unmatched healthy controls with known genetic status regarding p62, including healthy carriers of the P392L mutation. We selected 48 OCL-expressed candidate genes that may be involved in relevant pathways of PDB pathogenesis, such as OCL signaling, survival, bone resorption activity, or adhesion. In OCL cultures derived from peripheral blood mononuclear cells, total RNA extraction was performed, followed by real-time PCR experiments. Relative quantification analysis utilized the qBase method where relative expression levels were normalized with respect to a set of reference primer pairs for three housekeeping genes. When compared to non-mutated healthy controls, OCL cultures from PDB patients displayed a significant down-regulation in genes involved in apoptosis (CASP3 and TNFRSF10A), in cell signaling (TNFRSF11A), in the OCL bone resorbing function (ACP5 and CTSK) and in the gene coding for Tau protein (MAPT) (all comparisons, pOCL, and highlight the role of altered apoptosis pathways in these cells. They also suggest that the SQSTM1 P392L mutation plays a role in PDB pathogenesis, even at early preclinical stages in healthy carriers of the P392L mutation.

  17. Mutant p62P392L stimulation of osteoclast differentiation in Paget's disease of bone.

    Science.gov (United States)

    Sundaram, Kumaran; Shanmugarajan, Srinivasan; Rao, D Sudhaker; Reddy, Sakamuri V

    2011-11-01

    Paget's disease of the bone (PDB) is an autosomal dominant trait with genetic heterogeneity, characterized by abnormal osteoclastogenesis. Sequestosome 1 (p62) is a scaffold protein that plays an important role in receptor activator of nuclear factor κB (RANK) signaling essential for osteoclast (OCL) differentiation. p62P392L mutation in the ubiquitin-associated (UBA) domain is widely associated with PDB; however, the mechanisms by which p62P392L stimulate OCL differentiation in PDB are not completely understood. Deubiquitinating enzyme cylindromatosis (CYLD) has been shown to negatively regulate RANK ligand-RANK signaling essential for OCL differentiation. Here, we report that CYLD binds with the p62 wild-type (p62WT), non-UBA mutant (p62A381V) but not with the UBA mutant (p62P392L) in OCL progenitor cells. Also, p62P392L induces expression of c-Fos (2.8-fold) and nuclear factor of activated T cells c1 (6.0-fold) transcription factors critical for OCL differentiation. Furthermore, p62P392L expression results in accumulation of polyubiquitinated TNF receptor-associated factor (TRAF)6 and elevated levels of phospho-IκB during OCL differentiation. Retroviral transduction of p62P392L/CYLD short hairpin RNA significantly increased TRAP positive multinucleated OCL formation/bone resorption activity in mouse bone marrow cultures. Thus, the p62P392L mutation abolished CYLD interaction and enhanced OCL development/bone resorption activity in PDB.

  18. Efecto de una sola dosis de ácido zoledrónico en un caso de enfermedad de Paget ósea Effect of a single dose of zoledronic acid in a case of Paget bone disease

    Directory of Open Access Journals (Sweden)

    Melina Sabán

    2010-10-01

    Full Text Available La enfermedad de Paget es un trastorno crónico del remodelado óseo, caracterizado por un aumento de la resorción ósea producido por osteoclastos atípicos, seguido por un incremento acelerado de la formación ósea, lo que resulta en la formación de hueso en mosaico desorganizado. Un excelente marcador bioquímico para orientar el diagnóstico y seguimiento es la fosfatasa alcalina (FAL. Se presenta el caso de un paciente de 90 años, de sexo masculino, con diagnóstico de enfermedad de Paget. Se inicia tratamiento con pamidronato vía oral con respuesta parcial, por lo que se rota a pamidronato endovenoso. Disminuyen el dolor y la concentración plasmática de FAL, persistiendo con centellograma óseo patológico. Luego de varios años de tratamiento, con adecuado aporte de calcio y vitamina D, comienza nuevamente con dolor y valores elevados de FAL. Se decide iniciar tratamiento con ácido zoledrónico endovenoso 4 mg, única aplicación, obteniéndose remisión clínica y bioquímica desde hace cuatro años y mejoría de la imagen centellográfica. Este informe refiere la buena respuesta, sostenida en el tiempo, al tratamiento con única dosis de ácido zoledrónico en un paciente que presentó resistencia al pamidronato.Paget's disease is a chronic disorder of bone remodeling characterized by increase of bone resorption by atypical osteoclasts, followed by rapid increase in bone formation resulting in a disorganized mosaic bone. The biochemical marker for early diagnosis and monitoring is serum alkaline phosphatase (ALP. We report the case of a 90 year old male, with diagnose of Paget's disease. Pamidronate treatment was started orally with partial response, so it was switched to intravenous pamidronate. Pain intensity and FAL levels diminished. The scyntigraphic scan, however, though improved, persisted abnormal. After several years of treatment, with adequate calcium and vitamin D support, the patient presents pain and increase of FAL

  19. Dual photon absorptiometry in patients with Paget disease (bone mineral contents of lumbar spine and femoral neck)

    Energy Technology Data Exchange (ETDEWEB)

    Talbot, J.N.; Piketty, C.; Kiffel, T.; Coutris, G.; Milhaud, G.

    1988-01-01

    The bone mineral contents (BMC) of the lumbar spine (84 cases) and of one femoral neck (53 cases) were measured by dual photon absorptiometry (DPA) in patients suffering from Paget's disease of bone. The BMC of the patients and of 53 controls were compared, taking into account the occurrence of a scintigraphic hyperfixation, in each patient. A hyperfixation of the technetium labelled diphosphonate in the lumbar spine, more frequent in males, was associated with an elevated mean BMC value. The difference versus controls was significant in men but not in women. A hyperfixation of the femoral neck was associated with an elevated mean BMC value in both sexes. BMC values greater than the mean BMC of controls + 2 SD were observed in 83 per cent of these male patients and 50 per cent of the females. In contrast, BMC values lower than in controls were observed in non-pagetic areas. DPA allows the quantification of these abnormalities which cannot be evidenced by bone scintigraphy even if alkaline phosphatases levels are assayed.

  20. Morbus paget of the skeleton

    Energy Technology Data Exchange (ETDEWEB)

    Ziegler, R.; Baldauf, M.

    1984-09-01

    Paget's disease of bone seems to be a slow virus infection of a single or several areas of the skeleton. Pagetic lesions are rather common among elderly people, but the disease does not manifest very often. Compared to the incidence of Paget's disease in England, it seems to be rarer in this country. The pelvis is most frequently involved, followed by bones of the leg, skull, lumbar spine. The patients suffer from pains and deformities, arthroses of the adhering ankles, increased temperature of the area, nerval irritation and nerve damage due to increased bone growth (e.g. hearing loss due to Paget's disease of the skull). The development of sarcoma is rare and is only seen in severe cases. Diagnosis is made by X-ray, confirmed by bone biopsy, if necessary. Asymptomatic lesions are detected by bone scintigraphy. The activity of the disease is expressed by increased alkaline serum phosphatase and urinary hydroxyproline excretion. For treatment calcitonins and diphosphonates (especially EHDP, Diphos) are used. Both inhibit the overactive osteoclasts, and the increased bone turnover is normalized. The patients feel considerable relief, the elevated biochemical parameters fall to about 50% of initial values after calcitonin- or EHDP monotherapy. In severe cases the combination of both substances may be profitable. The cytostatic drug mithramycin which can also be effective is only needed exceptionally.

  1. Doença de Paget pigmentada do mamilo simulando melanoma cutâneo: importância da imuno-histoquímica na diferenciação dessas doenças Pigmented Paget's disease of the nipple mimicking cutaneous melanoma: importance of the immunohistochemical profile to differentiate between these diseases

    Directory of Open Access Journals (Sweden)

    Tatiana Villas Boas Gabbi

    2006-10-01

    Full Text Available A variante pigmentada da doença de Paget mamária é rara, com cerca de 12 casos relatados, e pode mimetizar clínica e histologicamente o melanoma. Como na forma clássica, em geral associa-se à neoplasia da mama acometida, com origem principalmente no carcinoma intraductal que se estende à epiderme através de ducto lactóforo. A fisiopatologia da hiperpigmentação permanece desconhecida. Relata-se o caso de paciente de 49 anos que apresentou lesão pigmentada do mamilo, suspeita de melanoma. O exame histológico não foi suficiente para confirmar o diagnóstico, sendo necessária realização de perfil imuno-histoquímico. Apesar de incomum, o diagnóstico de doença de Paget deve ser lembrado como diferencial de melanoma em lesões pigmentadas dessa região, em ambos os sexos.Pigmented mammary Paget's disease is a rare dermatosis, with approximately 12 reported cases in the literature, which can mimic cutaneous melanoma both clinically and histologically. As for classical mammary Paget's disease, the pigmented variant is associated with neoplasia of the breast, originating mainly from intraductal mammary carcinoma that extends to the epidermis of the nipple and areola through a lactiferous duct. Physiopathology of hyperpigmentation remains unknown. We present a 49-year-old female patient who presented with a pigmented lesion of the nipple suspected of melanoma. Histological examination was not sufficient to confirm diagnosis. Immunohistochemical examination confirmed the diagnosis of Paget's disease. Although uncommon, pigmented Paget's disease must be reminded as a differential diagnosis of melanoma in pigmented lesions of the nipple, in both genders.

  2. Radiography, Bone Scan, and F-18 FDG PET/CT Imaging Findings in a Patient with Paget's Disease

    Energy Technology Data Exchange (ETDEWEB)

    Park, Eun Tae; Kim, Sung Eun [Korea University Guro Hospital, Seoul (Korea, Republic of)

    2010-04-15

    Background A 52-year-old female patient sought evaluation at our hospital for an incidental abnormal finding on an abdominal radiograph. The initial radiograph showed irregular sclerotic changes involving the right pelvic bone. At the same time, bone scintigraphy showed intense hot uptake in the right iliac and pubic bones. CT images showed characteristic thickening of the pelvic brim, suggesting the mixed phase of Paget's disease. The level of alkaline phosphatase (ALP) was 266 IU/I. {sup 18}F-FDG PET/CT images also showed diffusely increased {sup 18}F-FDG uptake in the right pelvic bone. However, the findings of {sup 18}F-FDG PET/CT were less notable than those of bone scintigraphy. We report the imaging findings of a patient with Paget's disease evaluated by radiography, bone scintigraphy, and {sup 18}F-FDG PET/CT.

  3. Prostate carcinoma metastatic to the skin as an extrammamary Paget’s disease

    Directory of Open Access Journals (Sweden)

    Petcu Eugen

    2012-08-01

    Full Text Available Abstract Aim The current paper describes a case of prostatic adenocarcinoma metastatic to the skin presenting as an extrammamary Paget's disease, a very rare and poorly characterised morphological entity. We report a case of prostatic carcinoma metastatic to skin showing a pattern of extramammary Paget's disease which has not been clearly illustrated in the literature Case presentation: A 63 year-old man with prostatic adenocarcinoma developed cutaneous metastases after 16 years. The inguinal metastases were sessile and 'keratotic.' The tumour displayed solid, glandular areas as well as a polypoid region suggestive of extramammary Paget's disease were identified. Discussion and conclusions We review the diagnostic criteria that have led to the correct histopathological diagnosis in this case. A differential diagnosis of the pagetoid spread in the skin and various forms of cutaneous metastases determined by a prostatic adenocarcinoma as well as the role of immunohistochemistry in establishing the prostatic origin are presented in the context of this case. Although, morphologically the cells presented in the skin deposits were not characteristic for adenocarcinoma of prostate, immunohistochemistry for PSA and PSAP suggested a prostatic origin. Virtual Slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1395450057455276

  4. VCP associated inclusion body myopathy and paget disease of bone knock-in mouse model exhibits tissue pathology typical of human disease.

    Directory of Open Access Journals (Sweden)

    Mallikarjun Badadani

    Full Text Available Dominant mutations in the valosin containing protein (VCP gene cause inclusion body myopathy associated with Paget's disease of bone and frontotemporal dementia (IBMPFD. We have generated a knock-in mouse model with the common R155H mutation. Mice demonstrate progressive muscle weakness starting approximately at the age of 6 months. Histology of mutant muscle showed progressive vacuolization of myofibrils and centrally located nuclei, and immunostaining shows progressive cytoplasmic accumulation of TDP-43 and ubiquitin-positive inclusion bodies in quadriceps myofibrils and brain. Increased LC3-II staining of muscle sections representing increased number of autophagosomes suggested impaired autophagy. Increased apoptosis was demonstrated by elevated caspase-3 activity and increased TUNEL-positive nuclei. X-ray microtomography (uCT images show radiolucency of distal femurs and proximal tibiae in knock-in mice and uCT morphometrics shows decreased trabecular pattern and increased cortical wall thickness. Bone histology and bone marrow derived macrophage cultures in these mice revealed increased osteoclastogenesis observed by TRAP staining suggestive of Paget bone disease. The VCP(R155H/+ knock-in mice replicate the muscle, bone and brain pathology of inclusion body myopathy, thus representing a useful model for preclinical studies.

  5. Psychological Impact of Predictive Genetic Testing in VCP Inclusion Body Myopathy, Paget Disease of Bone and Frontotemporal Dementia.

    Science.gov (United States)

    Surampalli, Abhilasha; Khare, Manaswitha; Kubrussi, Georgette; Wencel, Marie; Tanaja, Jasmin; Donkervoort, Sandra; Osann, Kathryn; Simon, Mariella; Wallace, Douglas; Smith, Charles; M McInerney-Leo, Aideen; Kimonis, Virginia

    2015-10-01

    Inclusion Body Myopathy associated with Paget's disease of bone and Fronto-temporal Dementia, also known as multisystem proteinopathy is an autosomal dominant, late onset neurodegenerative disorder caused by mutations in Valosin containing protein (VCP) gene. This study aimed to assess uptake and decision making for predictive genetic testing and the impact on psychological well-being. Individuals who had participated in the gene discovery study with a 50 % a priori risk of inheriting VCP disease were sent a letter of invitation offering genetic counseling and testing and were also invited to participate in this psychosocial study. A total of 102 individuals received an invitation and 33 individuals participated in genetic counseling and testing (32.3 %) with 29 completing baseline questionnaires. Twenty completed the follow-up post-test Hospital Anxiety and Depression Scale questionnaire including 13 of the 18 who had tested positive. Mean risk perception at baseline was 50.1 %. Reasons for testing included planning for the future, relieving uncertainty, informing children and satisfying curiosity. At baseline, one quarter of the participants had high levels of anxiety. However, scores were normal one year following testing. In this small cohort, one third of individuals at 50 % risk chose pre-symptomatic testing. Although one quarter of those choosing testing had high anxiety at baseline, this was not evident at follow-up.

  6. Inclusion body myopathy, Paget's disease of the bone and fronto-temporal dementia: a disorder of autophagy.

    Science.gov (United States)

    Ju, Jeong-Sun; Weihl, Conrad C

    2010-04-15

    Inclusion body myopathy associated with Paget's disease of the bone and fronto-temporal dementia (IBMPFD) is a progressive autosomal dominant disorder caused by mutations in p97/VCP (valosin-containing protein). p97/VCP is a member of the AAA+ (ATPase associated with a variety of activities) protein family and participates in multiple cellular processes. One particularly important role for p97/VCP is facilitating intracellular protein degradation. p97/VCP has traditionally been thought to mediate the ubiquitin-proteasome degradation of proteins; however, recent studies challenge this dogma. p97/VCP clearly participates in the degradation of aggregate-prone proteins, a process principally mediated by autophagy. In addition, IBMPFD mutations in p97/VCP lead to accumulation of autophagic structures in patient and transgenic animal tissue. This is likely due to a defect in p97/VCP-mediated autophagosome maturation. The following review will discuss the evidence for p97/VCP in autophagy and how a disruption in this process contributes to IBMPFD pathogenesis.

  7. Novel, near-infrared spectroscopic, label-free, techniques to assess bone abnormalities such as Paget's disease, osteoporosis and bone fractures

    Science.gov (United States)

    Sordillo, Diana C.; Sordillo, Laura A.; Shi, Lingyan; Budansky, Yury; Sordillo, Peter P.; Alfano, Robert R.

    2015-02-01

    Near- infrared (NIR) light with wavelengths from 650 nm to 950 nm (known as the first NIR window) has conventionally been used as a non-invasive technique that can reach deeper penetration depths through media than light at shorter wavelengths. Recently, several novel, NIR, label-free, techniques have been developed to assess Paget's disease of bone, osteoporosis and bone microfractures. We designed a Bone Optical Analyzer (BOA) which utilizes the first window to measure changes of Hb and HbO2. Paget's disease is marked by an increase in vascularization in bones, and this device can enable easy diagnosis and more frequent monitoring of the patient's condition, without exposing him to a high cumulative dose of radiation. We have also used inverse imaging algorithms to reconstruct 2D and 3D maps of the bone's structure. This device could be used to assess diseases such as osteoporosis. Using 800 nm femtosecond excitation with two-photon (2P) microscopy, we acquired 2PM images of the periosteum and spatial frequency spectra (based on emission of collagen) from the periosteal regions. This technique can provide information on the structure of the periosteum and can detect abnormalities which may be an indication of disease. Most recently, we showed that longer NIR wavelengths in the second and third NIR windows (1100 nm-1350 nm, 1600 nm-1870 nm), could be used to image bone microfractures. Use of NIR light could allow for repeated studies in patients with diseases such as Paget's and osteoporosis quickly and non-invasively, and could impact the current management for these diseases.

  8. Giant cell tumor occurring in familial Paget's disease of bone: report of clinical characteristics and linkage analysis of a large pedigree.

    Science.gov (United States)

    Gianfrancesco, Fernando; Rendina, Domenico; Merlotti, Daniela; Esposito, Teresa; Amyere, Mustapha; Formicola, Daniela; Muscariello, Riccardo; De Filippo, Gianpaolo; Strazzullo, Pasquale; Nuti, Ranuccio; Vikkula, Mikka; Gennari, Luigi

    2013-02-01

    Neoplastic degeneration represents a rare but serious complication of Paget's disease of bone (PDB). Although osteosarcomas have been described in up to 1% of PDB cases, giant cell tumors are less frequent and mainly occur in patients with polyostotic disease. We recently characterized a large pedigree with 14 affected members of whom four developed giant cell tumors at pagetic sites. The high number of affected subjects across multiple generations allowed us to better characterize the clinical phenotype and look for possible susceptibility loci. Of interest, all the affected members had polyostotic PDB, but subjects developing giant cell tumors showed an increased disease severity with a reduced clinical response to bisphosphonate treatment and an increased prevalence of bone pain, deformities, and fractures. Together with an increased occurrence of common pagetic complications, affected patients of this pedigree also evidenced a fivefold higher prevalence of coronary artery disease with respect to either the unaffected family members or a comparative cohort of 150 unrelated PDB cases from the same geographical area. This association was further enhanced in the four cases with PDB and giant cell tumors, all of them developing coronary artery disease before 60 years of age. Despite the early onset and the severe phenotype, PDB patients from this pedigree were negative for the presence of SQSTM1 or TNFRSF11A mutations, previously associated with enhanced disease severity. Genome-wide linkage analysis identified six possible candidate regions on chromosomes 1, 5, 6, 8, 10, and 20. Because the chromosome 8 and 10 loci were next to the TNFRSF11B and OPTN genes, we extended the genetic screening to these two genes, but we failed to identify any causative mutation at both the genomic and transcription level, suggesting that a different genetic defect is associated with PDB and potentially giant cell tumor of bone in this pedigree. Copyright © 2013 American Society for

  9. Breast Metastases from Extramammary Malignancies: Typical and Atypical Ultrasound Features

    Energy Technology Data Exchange (ETDEWEB)

    Mun, Sung Hee [Department of Radiology and Center for Imaging Science, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 135-710 (Korea, Republic of); Department of Radiology, Catholic University of Daegu College of Medicine, Daegu 712-702 (Korea, Republic of); Ko, Eun Young; Han, Boo-Kyung; Shin, Jung Hee [Department of Radiology and Center for Imaging Science, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 135-710 (Korea, Republic of); Kim, Suk Jung [Department of Radiology, Inje University College of Medicine, Busan Paik Hospital, Busan 614-735 (Korea, Republic of); Cho, Eun Yoon [Department of Pathology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 135-710 (Korea, Republic of)

    2014-07-01

    Breast metastases from extramammary malignancies are uncommon. The most common sources are lymphomas/leukemias and melanomas. Some of the less common sources include carcinomas of the lung, ovary, and stomach, and infrequently, carcinoid tumors, hypernephromas, carcinomas of the liver, tonsil, pleura, pancreas, cervix, perineum, endometrium and bladder. Breast metastases from extramammary malignancies have both hematogenous and lymphatic routes. According to their routes, there are common radiological features of metastatic diseases of the breast, but the features are not specific for metastases. Typical ultrasound (US) features of hematogenous metastases include single or multiple, round to oval shaped, well-circumscribed hypoechoic masses without spiculations, calcifications, or architectural distortion; these masses are commonly located superficially in subcutaneous tissue or immediately adjacent to the breast parenchyma that is relatively rich in blood supply. Typical US features of lymphatic breast metastases include diffusely and heterogeneously increased echogenicities in subcutaneous fat and glandular tissue and a thick trabecular pattern with secondary skin thickening, lymphedema, and lymph node enlargement. However, lesions show variable US features in some cases, and differentiation of these lesions from primary breast cancer or from benign lesions is difficult. In this review, we demonstrate various US appearances of breast metastases from extramammary malignancies as typical and atypical features, based on the results of US and other imaging studies performed at our institution. Awareness of the typical and atypical imaging features of these lesions may be helpful to diagnose metastatic lesions of the breast.

  10. Genetic epidemiology of Paget's disease of bone in italy: sequestosome1/p62 gene mutational test and haplotype analysis at 5q35 in a large representative series of sporadic and familial Italian cases of Paget's disease of bone.

    Science.gov (United States)

    Falchetti, Alberto; Di Stefano, Marco; Marini, Francesca; Ortolani, Sergio; Ulivieri, Massimo Fabio; Bergui, Simona; Masi, Laura; Cepollaro, Chiara; Benucci, Maurizio; Di Munno, Ombretta; Rossini, Maurizio; Adami, Silvano; Del Puente, Antonio; Isaia, Giancarlo; Torricelli, Francesca; Brandi, Maria Luisa

    2009-01-01

    Families affected by Paget's disease of bone frequently harbor mutations in the SQSTM1/p62 gene. In this multicentric study we collected 345 sporadic and 12 familial PDB cases throughout Italy, identifying 12 different mutations, 5 of which are newly reported and 3, D335E, A381V, and Y383X, external to the UBA domain. Subjects with truncating mutations, E396X, showed a significantly younger age at clinical diagnosis, while the Y383X subjects had a higher average number of affected skeletal sites. All the mutants exhibited the CGTG-H2 haplotype. In two pairs and one triad of unrelated Italian PDB families from different Italian regions, we detected a common SQSTM1/p62 mutation for each P392L, M404V, and G425R group. Since the CGTG-H2 haplotype frequency was also high in normal subjects, and genetic influence due to migratory fluxes of different ethnic groups exists in the Italian population, to refine the search for a more geographically specific founder effect, we extended the haplotype analysis in these families using polymorphic microsatellite repeat markers, within and flanking the SQSTM1/p62 locus, from chromosome 5q35, other than the exon 6 and 3'UTR polymorphisms. All mutant carriers from two of the three M404V families and from the G425R families exhibited common extended chromosome 5q35 haplotypes, IT01 and IT02, respectively, which may be reflecting influences of past migrations. This may be helpful in estimating the true rate of de novo mutations. We confirm the data on the existence of both a mutational hotspot at the UBA domain of SQSTM1/p62 and a founder effect in the PDB population.

  11. Paget disease of bone-associated UBA domain mutations of SQSTM1 exert distinct effects on protein structure and function

    Science.gov (United States)

    Goode, Alice; Long, Jed E.; Shaw, Barry; Ralston, Stuart H.; Visconti, Micaela Rios; Gianfrancesco, Fernando; Esposito, Teresa; Gennari, Luigi; Merlotti, Daniela; Rendina, Domenico; Rea, Sarah L.; Sultana, Melanie; Searle, Mark S.; Layfield, Robert

    2014-01-01

    SQSTM1 mutations are common in patients with Paget disease of bone (PDB), with most affecting the C-terminal ubiquitin-associated (UBA) domain of the SQSTM1 protein. We performed structural and functional analyses of two UBA domain mutations, an I424S mutation relatively common in UK PDB patients, and an A427D mutation associated with a severe phenotype in Southern Italian patients. Both impaired SQSTM1's ubiquitin-binding function in pull-down assays and resulted in activation of basal NF-κB signalling, compared to wild-type, in reporter assays. We found evidence for a relationship between the ability of different UBA domain mutants to activate NF-κB signalling in vitro and number of affected sites in vivo in 1152 PDB patients from the UK and Italy, with A427D-SQSTM1 producing the greatest level of activation (relative to wild-type) of all PDB mutants tested to date. NMR and isothermal titration calorimetry studies were able to demonstrate that I424S is associated with global structural changes in the UBA domain, resulting in 10-fold weaker UBA dimer stability than wild-type and reduced ubiquitin-binding affinity of the UBA monomer. Our observations provide insights into the role of SQSTM1-mediated NF-κB signalling in PDB aetiology, and demonstrate that different mutations in close proximity within loop 2/helix 3 of the SQSTM1 UBA domain exert distinct effects on protein structure and stability, including indirect effects at the UBA/ubiquitin-binding interface. PMID:24642144

  12. The implications of the Sequestosome 1 mutation P392L in patients with Paget's disease in a United States cohort

    Science.gov (United States)

    Seton, Margaret; Hansen, Marc; Solomon, Daniel H.

    2016-01-01

    Background Paget's disease of bone (PDB) is associated with a germline mutation in Sequestosome1 /p62 (SQSTM1) found in ≤ 16% of sporadic cases worldwide, and in 19-46% of those studied with familial PDB. The P392L is the most prevalent mutation identified to date. This mutation by itself does not confer PDB or define the phenotype of PDB in a given person. Environmental determinants remain elusive, although increasing age of the individual, other gene polymorphisms in the context of SQSTM1 mutations, and measles virus have been implicated. Measles exposure has been unexamined in this context. Objectives The goal of this study is to compare the background history and phenotype of patients with PDB carrying the SQSTM1 P392L mutation to those patients without. Focusing on age, ancestry, P329L mutation, family history, measles exposure, distribution of PDB and age of onset, we examined outcomes at 10 years. We postulated that aging may play a role in defining phenotype, and that this may become more visible in a well characterized cohort. Methods This is an observational study focused on a cohort of patients with PDB drawn from the New England Registry in whom environmental and family history has been catalogued, linked to radiographic data. Of the 217 persons who were enrolled in the Registry, 42 (19%) responded to a letter inviting them to participate in testing for the presence of the measles antibody, and in genetic testing for the P392L mutation. Results The mean age of the cohort in 2001 was 70 years (range 55-79); 27 were men (64%). The measles antibody was found in all cases tested. Nine patients had the P392L mutation (21%), 2 with familial PDB. In these persons, early diagnosis of disease and spinal stenosis marked the male phenotype only. European ancestry was noted in the minority of those with P392L mutation. Most deaths recorded occurred in the 9th decade of life or later. Conclusions Spinal stenosis emerges as a prominent phenotype in SQSTM1 P392L

  13. Management of Adenocarcinoma in the Setting of Recently Operated Perianal Paget's Disease

    Directory of Open Access Journals (Sweden)

    Margaret E. Clark

    2013-01-01

    Full Text Available Perianal Paget’s disease only rarely presents with a synchronous invasive anal or rectal cancer. The purpose of this study is to present a case of an otherwise healthy patient who developed perianal Paget’s disease. He was then found to have an invasive rectal adenocarcinoma, after having undergone an extensive resection and reconstruction with a bilateral V-to-Y reconstruction. This report describes an overview of perianal Paget’s disease, the management of this disease in association with anal or rectal cancer, and our patient’s outcome.

  14. Evaluation of /sup 99m/Tc diphosphonate kinetics and bone scans in patients with Paget's disease before and after calcitonin treatment

    Energy Technology Data Exchange (ETDEWEB)

    Waxman, A.D.; Ducker, S.; McKee, D.; Siemsen, J.K.; Singer, F.R.

    1977-12-01

    Eleven patients with Paget's disease of bone underwent serial total body bone scans before and after therapy with calcitonin. All patients studied showed improvement clinically as well as biochemically. Scan improvement was noted in patients with mild disease. Patients with severe disease showed either no change or only slight improvement on the serial bone scans. The scan was of greatest value in determining the extent of disease, especially in 3 patients in whom biochemical values were normal. A single pulse injection of 50 M.R.C. units of salmon calcitonin produced a significant increase in the blood clearance of /sup 99m/Tc diphosphonate. The mechanism of this effect is not clear from this study.

  15. Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

    Science.gov (United States)

    2014-10-01

    November 25, 2013. Accepted manuscript online December 11, 2013. Address correspondence to: G David Roodman , MD, PhD, Department of Medicine, Hematology...Yukiko Kitagawa,1 Deborah L Galson,4 David W Dempster,2 Jolene J Windle,3 Noriyoshi Kurihara,1 and G David Roodman1,5 1Department of Medicine, Hematology...turnover in Paget’s disease of bone. Clin Orthop. 1987;217:26–36. 3. Siris ES, Roodman GD. Paget’s Disease of Bone, Primer on the Metabolic Bone Diseases

  16. Role of ATF7-TAF12 interactions in the vitamin D response hypersensitivity of osteoclast precursors in Paget's disease.

    Science.gov (United States)

    Teramachi, Jumpei; Hiruma, Yuko; Ishizuka, Seiichi; Ishizuka, Hisako; Brown, Jacques P; Michou, Laëtitia; Cao, Huiling; Galson, Deborah L; Subler, Mark A; Zhou, Hua; Dempster, David W; Windle, Jolene J; Roodman, G David; Kurihara, Noriyoshi

    2013-06-01

    Osteoclast (OCL) precursors from many Paget's disease (PD) patients express measles virus nucleocapsid protein (MVNP) and are hypersensitive to 1,25-dihydroxyvitamin D₂ (1,25-(OH)₂D₃; also know as calcitriol). The increased 1,25-(OH)₂D₃ sensitivity is mediated by transcription initiation factor TFIID subunit 12 (TAF12), a coactivator of the vitamin D receptor (VDR), which is present at much higher levels in MVNP-expressing OCL precursors than normals. These results suggest that TAF12 plays an important role in the abnormal OCL activity in PD. However, the molecular mechanisms underlying both 1,25-(OH)₂D₃'s effects on OCL formation and the contribution of TAF12 to these effects in both normals and PD patients are unclear. Inhibition of TAF12 with a specific TAF12 antisense construct decreased OCL formation and OCL precursors' sensitivity to 1,25-(OH)₂D₃ in PD patient bone marrow samples. Further, OCL precursors from transgenic mice in which TAF12 expression was targeted to the OCL lineage (tartrate-resistant acid phosphatase [TRAP]-TAF12 mice), formed OCLs at very low levels of 1,25-(OH)₂D₃, although the OCLs failed to exhibit other hallmarks of PD OCLs, including receptor activator of NF-κB ligand (RANKL) hypersensitivity and hypermultinucleation. Chromatin immunoprecipitation (ChIP) analysis of OCL precursors using an anti-TAF12 antibody demonstrated that TAF12 binds the 24-hydroxylase (CYP24A1) promoter, which contains two functional vitamin D response elements (VDREs), in the presence of 1,25-(OH)₂D₃. Because TAF12 directly interacts with the cyclic adenosine monophosphate-dependent activating transcription factor 7 (ATF7) and potentiates ATF7-induced transcriptional activation of ATF7-driven genes in other cell types, we determined whether TAF12 is a functional partner of ATF7 in OCL precursors. Immunoprecipitation of lysates from either wild-type (WT) or MVNP-expressing OCL with an anti-TAF12 antibody, followed by blotting with an

  17. Facts a New Patient Needs to Know about Paget's Disease of Bone

    Science.gov (United States)

    ... Your Doctor (NIA) Conversando con su médico (NIA) Sea miembro activo del equipo de cuidados de la Salud (FDA) '); docprint.document.close(); docprint.focus(); */ } //--> Print-Friendly Page May 2015 What Is Paget’s Disease of Bone? Paget’s ...

  18. Protocol for stage 1 of the GaP study (Genetic testing acceptability for Paget's disease of bone: an interview study about genetic testing and preventive treatment: would relatives of people with Paget's disease want testing and treatment if they were available?

    Directory of Open Access Journals (Sweden)

    Marteau Theresa M

    2006-06-01

    Full Text Available Abstract Background Paget's disease of bone (PDB is characterised by focal increases in bone turnover, affecting one or more bones throughout the skeleton. This disrupts normal bone architecture and causes pain, deformity, deafness, osteoarthritis, and fractures. Genetic factors are recognised to play a role in PDB and it is now possible to carry out genetic tests for research. In view of this, it is timely to investigate the clinical potential for a programme of genetic testing and preventative treatment for people who have a family history of PDB, to prevent or delay the development of PDB. Evidence from non-genetic conditions, that have effective treatments, demonstrates that patients' beliefs may affect the acceptability and uptake of treatment. Two groups of beliefs (illness and treatment representations are likely to be influential. Illness representations describe how people see their illness, as outlined in Leventhal's Self-Regulation Model. Treatment representations describe how people perceive potential treatment for their disease. People offered a programme of genetic testing and treatment will develop their own treatment representations based on what is offered, but the beliefs rather than the objective programme of treatment are likely to determine their willingness to participate. The Theory of Planned Behaviour is a theoretical model that predicts behaviours from people's beliefs about the consequences, social pressures and perceived control over the behaviour, including uptake of treatment. Methods/design This study aims to examine the acceptability of genetic testing, followed by preventative treatment, to relatives of people with PDB. We aim to interview people with Paget's disease, and their families, from the UK. Our research questions are: 1. What do individuals with Paget's disease think would influence the involvement of their relatives in a programme of genetic testing and preventative treatment? 2. What do relatives of

  19. Enfermedad de Paget extramamaria perianal Extrammary Paget - perianal carcinoma

    Directory of Open Access Journals (Sweden)

    N Grinspan Bozza

    2010-12-01

    Full Text Available Presentamos el caso de un paciente de sexo masculino de 60 años de edad, con enfermedad de Paget extramamaria primaria cutánea, de localización perianal, extensa, de un año y medio de evolución. Se describen los hallazgos clínicos, histológicos, inmunohistoquímicos y tratamientos de elección. Se destaca que a través de la clínica, se debe realizar un diagnóstico precoz y se remarca la importancia de efectuar, una búsqueda exhaustiva de neoplasias internas próximas a la lesión cutánea.We report a 60 year-old male patient with and extense perianal primary cutaneous extramamary Paget´s disease which began one and half years before. We also describe its clinical, histological, inmunohistochemical and treatments options. To remark the importance of an exhaustive search of internal tumours with regional proximity to the lesion.

  20. Spinal-cord syndrome due to non-compressive Paget's disease of bone: a spinal-artery steal phenomenon reversible with calcitonin.

    Science.gov (United States)

    Herzberg, L; Bayliss, E

    1980-07-05

    A 76-year-old man had progressive low back pain, leg weakness, and sensory loss. Radiology showed changes consistent with wide-spread Paget's disease, but no cord compression or involvement of nerve roots was detected by myelography or computerised axial tomography. His symptoms were relieved within 12 days of starting 100 MRC units of subcutaneous salmon calcitonin and recurred when calcitonin was discontinued for 5 days. The improvement continued on calcitonin treatment for 1 year, with falls in serum alkaline phosphatase and urinary hydroxyproline excretion. It is suggested that calcitonin treatment, in reducing the abnormally high metabolic activity of the diseased bone, and hence its vascular perfusion, allows more blood to reach the spinal cord.

  1. Dynamic contrast-enhanced MRI in Paget's disease of bone-correlation of regional microcirculation and bone turnover

    Energy Technology Data Exchange (ETDEWEB)

    Libicher, M. [University of Cologne, Department of Radiology, Cologne (Germany); Klinikum der Universitaet zu Koeln, Radiologische Klinik, Koeln (Germany); Kasperk, C. [University of Heidelberg, Department of Medicine, Division of Osteology, Heidelberg (Germany); Daniels, M.; Hosch, W. [University of Heidelberg, Department of Radiology, Heidelberg (Germany); Kauczor, H.U.; Delorme, S. [German Cancer Research Center, Department of Radiology, Heidelberg (Germany)

    2008-05-15

    The purpose of this study was to evaluate regional microcirculation in Paget's disease of bone (PD) with dynamic contrast-enhanced MR imaging (DCE-MRI). Additionally, we correlated regional bone perfusion with alkaline phosphatase as serum marker of bone turnover. We examined 71 patients with PD (27 men, 44 women, 67{+-}10 years) localized at the axial and appendicular skeleton. Contrast uptake was analyzed using a two-compartment model with the output variables amplitude A and exchange rate constant k{sub ep}. Color-coded parametric images were generated to visualize microcirculation. Serum levels of alkaline phosphatase (AP) were compared with DCE-MRI parameters. Amplitude A and exchange rate constant k{sub ep} were significantly increased in PD compared to unaffected bone (A{sub PD} 0.81{+-}0.24 vs. A{sub control} 0.34{+-}0.1 and k{sub ep} {sub PD} 4.0 {+-}2.86 vs. k{sub ep} {sub control} 1.73 {+-}0.88, p <0.001). There was a significant correlation (r{sub s}=0.5-0.7) of DCE-MRI parameters and AP at the axial (pelvis, spine) and appendicular skeleton (femur, tibia). The long bones showed increased circulation of the advancing peripheral zones and no vascularization of the central part, which had been replaced by fatty tissue. Regional microcirculation in PD is inhomogeneous with focal areas of excessive hypervascularity, especially in the advancing peripheral zone. There is a significant correlation of bone circulation and bone turnover in PD. DCE-MRI might therefore be a diagnostic tool for monitoring therapeutic effects of bisphoshonates in Paget's disease of bone. (orig.)

  2. 畸形性骨炎八例的临床诊治分析%Diagnosis and treatment for 8 cases with Paget disease

    Institute of Scientific and Technical Information of China (English)

    鲍春华; 章振林

    2012-01-01

    目的 对8例畸形性骨炎患者的临床诊治情况进行分析,旨在提高对该病的认识.方法 确诊的畸形性骨炎患者8例,比较其临床表现、X线片特征、骨转换生化指标及用二膦酸盐治疗的情况.结果 男5例,女3例,年龄46~76岁,平均年龄为(60.0±12.2)岁.病程1~15年,平均病程为(5.1±5.0)年.临床症状表现为受累骨骼疼痛7例,其中2例伴小腿皮温升高.病变范围:单骨性损害3例,多处骨骼受累4例,1例未能明确.病变累及部位以骨盆、股骨和脊柱最常见,其次为头颅、胫骨、腓骨和肱骨.X线片显示受损骨的骨小梁结构粗大和紊乱、皮质显著增厚、髓腔缩小及骨骼变形等典型的Paget's骨损害.骨扫描检查显示,受累骨骼的核素异常浓聚.8例患者的血清碱性磷酸酶(ALP)水平为93~1 366 U/L,中位数为326 U/L,其中1例患者的血清ALP水平在正常范围内.7例患者予二膦酸盐治疗,3个月后疼痛缓解,活动功能改善,血清ALP水平下降显著,疗效明显.结论 畸形性骨炎在我国罕见,常被误诊.X线摄片和骨核素扫描等影像学检查的表现结合骨转换生化指标的显著改变是诊断的重要依据,经静脉途径应用二膦酸盐治疗的疗效显著.%Objective To retrospectively analyze the diagnosis and treatment for 8 patients with Paget disease, so as to enhance the understanding of the disease. Methods Eight patients were diagnosed as Paget disease and were enrolled in this study. The clinical manifestations, X-ray features, biochemical marker of bone turnover and bisphosphonates treatment were evaluated. Results There were 5 males and 3 females with an average age of (60.0± 12.2) years (range 46-76 years). The average course of disease was (5.1 ±5.0) years (range 1-15 years). Pain, deformity of the involved bones were seen in seven cases, and local skin temperature increase was found in two of them. There were 3 patients with single bone lesion and 4

  3. Enfermedad de Paget perianal

    OpenAIRE

    POLANCO,DIEGO; MANZANEDO,ISRAEL; EL BOUAYADI,LILIAM; NÚÑEZ,GEMA; TARTAS,AUREA

    2010-01-01

    La enfermedad de Paget de localización extramamaria (EPEM) es una patología infrecuente que afecta preferentemente a zonas perianal y vulvar en pacientes de ambos sexos y desde la sexta década de vida. Presentamos un caso clínico tratado en conjunto por los Servicios de Cirugía General, Cirugía Plástica, Ginecología y Anatomía Patológica del Hospital Universitario de Getafe.

  4. Role of imaging in the investigation of a painful Paget's bone (excluding axial sites)

    Energy Technology Data Exchange (ETDEWEB)

    Martin, B.; Tordjman, G.; Tubiana, J.M.

    1988-01-01

    Several possible aetiologies should be considered in a patient with Paget's disease presenting with pain: sarcomatous degeneration, metastasis in a pagetic bone, lymphoma, cortical fracture or cortical fissure, site of osteomyelitis, osteoarthrosis of the hip or even an active episode of Paget's disease. These different causes are recalled and the strategic role of radiological investigation in the discussion is stressed.

  5. Pathologie des Morbus Paget

    Directory of Open Access Journals (Sweden)

    Sulzbacher I

    2012-01-01

    Full Text Available Der Morbus Paget (MP ist eine fortschreitende, mono- oder polyostotische Knochenerkrankung mit pathologischem Remodeling, gekennzeichnet durch umschriebenen Knochenabbau mit Riesenosteoklasten und darauffolgendem unkoordiniertem Knochenaufbau. Die Erkrankung tritt generell nach dem 50. Lebensjahr auf und entspricht nach der Osteoporose der zweithäufigsten metabolischen Osteopathie. Im Mittelpunkt der heutigen ätiopathogenetischen Überlegungen stehen genetische Veränderungen, und zwar Mutationen, welche den osteoklastären RANK-NF-κB-Signalweg beeinträchtigen, sowohl bei Patienten mit familiärem als auch sporadischem MP. Inwieweit diese Mutationen eine kausale Rolle spielen oder lediglich zu einer gesteigerten bzw. abnormen Suszeptibilität gegenüber Umweltfaktoren wie Viren und anderen exogenen Noxen führen, bleibt jedoch weiter zu klären.

  6. Extra-mammary findings in breast MRI

    Energy Technology Data Exchange (ETDEWEB)

    Rinaldi, Pierluigi; Costantini, M.; Belli, P.; Giuliani, M.; Bufi, E.; Fubelli, R.; Distefano, D.; Romani, M.; Bonomo, L. [Catholic University - Policlinic A. Gemelli, Department of Bio-Imaging and Radiological Sciences, Rome (Italy)

    2011-11-15

    Incidental extra-mammary findings in breast Magnetic Resonance Imaging (MRI) may be benign in nature, but may also represent a metastasis or another important lesion. We aimed to analyse the prevalence and clinical relevance of these unexpected findings. A retrospective review of 1535 breast MRIs was conducted. Only axial sequences were reassessed. Confirmation examinations were obtained in all cases. 285 patients had a confirmed incidental finding, which were located in the liver (51.9%), lung (11.2%), bone (7%), mediastinal lymph nodes (4.2%) or consisted of pleural/pericardial effusion (15.4%). 20.4% of incidental findings were confirmed to be malignant. Positive predictive value for MRI to detect a metastatic lesion was high if located within the bone (89%), lymph nodes (83%) and lung (59%), while it was low if located within the liver (9%) or if it consisted of pleural/pericardial effusion (6%). The axial enhanced sequence showed superior sensitivity to unenhanced images in detecting metastatic lesions, especially if only smaller ({<=}10 mm.) lesions were considered. The prevalence of metastatic incidental extra-mammary findings is not negligible. Particular attention should be to incidental findings located within the lung, bone and mediastinal lymph nodes. (orig.)

  7. Early onset Paget's disease of bone caused by a novel mutation (78dup27) of the TNFRSF11A gene in a Chinese family

    Institute of Scientific and Technical Information of China (English)

    Yao-hua KE; Hua YUE; Jin-wei HE; Yu-juan LIU; Zhen-lin ZHANG

    2009-01-01

    Aim: A previous study showed that individuals of Japanese descent affected by early onset familial Paget's disease of bone (PDB) car-ried a 27-bp duplication at position 75 (75dup27) in the TNFRSF11A gene encoding RANK. Here we report the identification of a novel mutation (78dup27) in exon 1 of TNFRSF11A in a Chinese family with early onset PDB. Methods: We conducted clinical and genetic studies in a non-consanguineous Chinese family with early onset PDB. The entire coding region of TNFRSF11A was amplified and directly sequenced directly.Results: A novel 27-bp duplication in exon 1 (78dup27) in TNFRSF11A was found in four affected individuals and one asymptomatic individual. Although this duplication was the same length as the previously identified mutation (27 bp, from bases 78 to 104), in our patients the nine duplicated amino acids in the RANK signal peptide were LLLLCALLA. The phenotypes of affected individuals in this family overlapped with both early onset PDB and classic PDB, but several distinguishing features were found in our patients. The key difference between our familial PDB and the Japanese early onset PDB was the age of onset, which in most of our patients was during their late 20s (except for the propositus' niece). Another notable difference was that the propositus' son (24 years old), who carried the 78dup27 mutation, had no clinical symptoms or bone abnormalities, except for increased serum ALP, OC and CTX.Conclusion: Our findings may provide a better understanding of the clinical features of early onset PDB and support the notion of a hot spot for mutations in exon 1 of the TNFRSF11A gene.

  8. Disease: H00437 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H00437 Paget's disease of bone and related disorders, including: ; Paget's disease ...eletal hyperphosphatasia (ESH); Juvenile Paget's disease (JPD) Paget's disease of bone and related disorders... are rare inherited osteolytic disorders that show phenotypic overlap. Patients w...MP Paget's disease of bone and genetic disorders of RANKL/OPG/RANK/NF-kappaB signaling. Ann N Y Acad Sci 106...47:175-84 (2002) PMID:18328984 Ralston SH Juvenile Paget's disease, familial expansile osteolysis and other genetic osteolytic disord

  9. Paget disease of the bone

    Science.gov (United States)

    ... may develop a cancer of the bone called osteosarcoma. Some people will need joint replacement surgery. Possible ... any medical emergency or for the diagnosis or treatment of any medical condition. A licensed physician should ...

  10. Paget Disease of the Breast

    Science.gov (United States)

    ... Breast Cancer Breast Cancer Patient Breast Cancer Treatment Male Breast Cancer Treatment Breast Cancer Treatment & Pregnancy Breast Cancer Prevention Breast Cancer Screening Health Professional Breast Cancer Treatment Male ... Treatment Breast Cancer Treatment & Pregnancy Breast Cancer Prevention ...

  11. Nuclear inclusions mimicking poly(A)-binding protein nuclear 1 inclusions in a case of inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia with a novel mutation in the valosin-containing protein gene.

    Science.gov (United States)

    Matsubara, Shiro; Shimizu, Toshio; Komori, Takashi; Mori-Yoshimura, Madoka; Minami, Narihiro; Hayashi, Yukiko K

    2016-07-01

    A middle-aged Japanese man presented with slowly progressive asymmetric weakness of legs and arm but had neither ptosis nor dysphagia. He had a family history of similar condition suggestive of autosomal dominant inheritance. A muscle biopsy showed mixture of neurogenic atrophy and myopathy with rimmed vacuoles. Furthermore we found intranuclear inclusions that had a fine structure mimicking that of inclusions reported in oculopharyngeal muscular dystrophy (OPMD). Immunohistochemical staining for polyadenylate-binding nuclear protein 1, which is identified within the nuclear inclusions of OPMD, demonstrated nuclear positivity in this case. However, OPMD was thought unlikely based on the clinical features and results of genetic analyses. Instead, a novel mutation in valosin-containing protein, c.376A>T (p.Ile126Phe), was revealed. A diagnosis of inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia was made. This is the first report of polyadenylate-binding nuclear protein 1-positive nuclear inclusions in the muscle of this condition.

  12. [Diagnosis of ivory vertebra. Bibliographic study, report of 2 cases of pagetic ivory vertebra].

    Science.gov (United States)

    Durot, J F; Gatfosse, M; Lerais, J M; Baudrillard, J C; Auquier, F

    1986-04-01

    Two cases are reported of ivory vertebra, an isolated lesion difficult to diagnose clinically or radiologically. Tomographic and if necessary computed tomographic analysis should provide a precise diagnosis of a Paget's disease origin, biopsy being reserved for cases for which a doubt exists.

  13. Metastases to the breast from extramammary malignancies−sonographic features.

    Science.gov (United States)

    Lee, Ji Hye; Kim, Sung Hun; Kang, Bong Joo; Cha, Eun Suk; Kim, Hyun Suk; Choi, Jae Jeong

    2011-06-01

    To evaluate the clinical and sonographic (US) features of metastatic tumors from extramammary malignancies to the breast. This study included 23 patients with pathologically proven metastases in the breast. Two radiologists retrospectively analyzed the images from US (n = 23), mammography (n = 11), and MRI (n = 5) examinations according to BIRADS. Patients presented with a palpable mass or diffuse breast swelling (21/23) or were asymptomatic (2/23). Eighteen patients had solitary or multiple breast masses on US. The common US finding was an ovoid hypoechoic mass with a noncircumscribed margin. The final assessment categories were BIRADS 3 (probably benign finding) in 6 cases (25%) and BIRADS 4 (suspicious abnormality) in 18 cases (75%). In five patients, US displayed a diffuse infiltrative pattern without a focal lesion, which was categorized as BIRADS 4. Metastatic tumors in the breast have a wide range of sonographic appearances, with some resembling benign lesions. Any newly developed mass in a patient with a known history of extramammary malignancy, even with a probably benign US appearance, should undergo biopsy for pathologic confirmation. Copyright © 2011 Wiley Periodicals, Inc.

  14. TBK1 Mediates Critical Effects of Measles Virus Nucleocapsid Protein (MVNP) on Pagetic Osteoclast Formation

    Science.gov (United States)

    Sun, Quanhong; Sammut, Bénédicte; Wang, Feng-Ming; Kurihara, Noriyoshi; Windle, Jolene J.; Roodman, G. David; Galson, Deborah L.

    2013-01-01

    Paget’s disease of bone (PDB) is characterized by abnormal osteoclasts with unique characteristics that include: increased sensitivity of osteoclast progenitors to 1,25(OH)2D3, RANKL and TNF-α, increased osteoclast numbers, increased expression of IL-6 and several transcription factors. We recently reported that measles virus nucleocapsid protein (MVNP) plays a key role in the development of these abnormal osteoclasts. MVNP can induce the pagetic osteoclast phenotype in vitro and in vivo in TRAP-MVNP transgenic mice. However, the molecular mechanisms by which MVNP generates pagetic osteoclasts have not been determined. TANK-binding kinase 1 (TBK1) and IκB kinase-ɛ (IKKɛ) are IKK family members which complex with MVNP and activate both IRF3 and NF-κB pathways. MVNP increases the amount of TBK1 protein in bone marrow monocytes (BMM). Interestingly, we found that RANKL increased TBK1 and IKKɛ early in osteoclast differentiation, suggesting a possible role in normal osteoclastogenesis. However, only TBK1 is further increased in osteoclasts formed by TRAP-MVNP BMM due to increased TBK1 protein stability. TBK1 over-expression induced IL6 promoter reporter activity, and elevated endogenous IL6 mRNA and p65 NF-κB, TAF12 and ATF7 proteins in several cell lines. Over-expression of TBK1 was insufficient to induce pagetic osteoclasts from WT BMM, but synergized with MVNP to increase pagetic osteoclast formation from TRAP-MVNP BMM. BX795 inhibition of TBK1 impaired MVNP-induced IL-6 expression in both NIH3T3 cells and BMM, and shRNA knockdown of Tbk1 in NIH3T3 cells impaired IL-6 secretion induced by MVNP and decreased TAF12 and ATF7, factors involved in 1,25(OH)2D3 hypersensitivity of pagetic osteoclasts. Similarly, Tbk1 knockdown in BMM from TRAP-MVNP and WT mice specifically impaired development of the MVNP-induced osteoclast pagetic phenotype. These results demonstrate that TBK1 plays a critical role in mediating the effects of MVNP on osteoclast differentiation

  15. Spectrum of Extramammary Malignant Neoplasms in the Breast With Radiologic-Pathologic Correlation.

    Science.gov (United States)

    Kalli, Sirishma; Lanfranchi, Michael; Alexander, Andrew; Makim, Shital; Freer, Phoebe E

    Although primary breast cancer is the most common malignancy identified by breast imaging, extramammary malignancies may also rarely be encountered. These uncommon lesions may reflect primary neoplasms of nonmammary origin as well as secondary metastatic lesions, and include lymphoma, melanoma, neuroendocrine tumors, gastrointestinal tract malignancies, and angiosarcoma among other entities. Malignant extramammary breast lesions may be encountered during routine mammographic screening, identified during the diagnostic evaluation of a palpable breast abnormality, or may be detected incidentally during imaging of other organs of interest. As such, the radiologist should have familiarity with the appearance of these lesions. This article focuses on a review of several of the most common extramammary metastases to the breast, as well as a few lesions that may develop as either primary or secondary lesions. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Paget-Schroetter Syndrome in a Baseball Pitcher.

    Science.gov (United States)

    Yagi, Shusuke; Mitsugi, Minoru; Sangawa, Teruaki; Akaike, Masashi; Sata, Masataka

    2017-08-03

    Paget-Schroetter syndrome (PSS) is thrombosis of the deep veins draining the upper extremity due to anatomic abnormalities of the thoracic outlet that cause subclavian compression and subsequent thrombosis, leading to thrombus formation in the subclavian vein. Vigorous arm activity in sports is a known risk factor. Here, we report a case of Paget-Schroetter syndrome in a 31-year-old male non-professional baseball pitcher.

  17. Frequency and Clinical Significance of Extramammary Findings on Breast Magnetic Resonance Imaging.

    Science.gov (United States)

    Phadke, Sneha; Thomas, Alexandra; Yang, Limin; Moore, Catherine; Xia, Chang; Schroeder, Mary C

    2016-10-01

    Use of breast magnetic resonance imaging (MRI) for screening and local staging of breast cancer has increased. With this, questions have emerged regarding the management and effect of extramammary findings (EMFs) reported on breast MRI. Breast MRI studies performed between January 1, 2007 and December 31, 2012 at the University of Iowa were analyzed. Data were collected regarding number and location of EMFs, characteristics of the patients who had a breast MRI, and time to first treatment among the patients who had a breast MRI for stage I-III breast cancer. During the study period, 1305 breast MRIs were obtained in 772 women. An EMF was found in 140 studies (10.7%) and 113 women (14.6%). EMFs were more likely in MRIs of older patients (50 vs. 54 years, P = .004) and postmenopausal women (P = .001). Anatomically, most EMFs were seen in the liver (89 of 140) or bone (21 of 140). Eight women (0.6%) had an EMF on breast MRI that led to upstaging to stage IV breast cancer. For patients with stage I-III breast cancer, the finding of an EMF on breast MRI did not affect time to initial cancer treatment (13 vs. 14 days; P = .586). EMFs on breast MRI are seen with some frequency and occur more commonly in older, postmenopausal women. In our study, most EMFs were benign and did not affect patient outcome with regard to upstaging to stage IV disease or time to cancer treatment. A very small portion of studies revealed subclinical advanced breast cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. An evaluation of factors predicting breast recurrence and prognosis after recurrence, on distinguishing intramammary and extramammary recurrence, in breast-conserving surgery

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, Reiki; Nagao, Kazuharu; Miyayama, Haruhiko [Kumamoto City Hospital (Japan)] (and others)

    2001-06-01

    Recurrence of cancer in the breast is an important problem in breast-conserving therapy. We evaluated risk factors for recurrence from the viewpoint of recurrence type and outcome after recurrence. Of 533 cases of breast cancer treated with breast-conserving surgery from April 1989 through July 2000, disease in 66 recurred (12.4%) and were classified as 23 cases of breast recurrence only, 16 cases of both breast recurrence and distant metastasis, and 27 cases of distant metastasis only. The clinical factors examined included age, lymphatic invasion, nodal status, extensive intraductal component (EIC), proliferative activity, and estrogen receptor (ER) status. Of the 39 cases of breast recurrence, 19 had intramammary tumors and 20 had extramammary tumors of the skin, subcutaneous tissue, or muscle, including 8 cases with inflammatory breast recurrence. Multivariate analysis showed that factors correlated with breast recurrence were age, ER status, proliferative activity, and surgical margin. EIC-comedo was related to intramammary recurrence, whereas lymphatic invasion and nodal status were related to extramammary recurrence. Postoperative irradiation was an effective treatment for tumors in young women and tumors with positive margins or a comedo component. Outcome after breast recurrence depended on nodal status at primary operation, and survival rates were worst in patients with inflammatory breast recurrence. In conclusion, age, EIC-comedo status, the surgical margin, and negative ER status were correlated with breast recurrence. Countermeasures against these factors should be investigated. (author)

  19. Síndrome de Paget-Schroetter asociado a hiperhomocisteinemia Paget-Schroetter síndrome associated with hyperhomocsyteinemia

    Directory of Open Access Journals (Sweden)

    C.I. González

    2007-12-01

    Full Text Available La enfermedad tromboembólica venosa (ETEV en extremidades superiores es una entidad poco frecuente, si bien su incidencia ha aumentado en relación con el empleo de catéteres venosos centrales. La etiología puede ser primaria (idiopática, espontánea, de esfuerzo o traumática o secundaria (relacionada con tumores, catéteres venosos centrales, etc.. Presentamos un caso de trombosis venosa primaria de extremidad superior derecha, también llamada síndrome de Paget-Schroetter. Este cuadro suele asociarse a ejercicios o esfuerzos intensos y/o repetitivos de la extremidad afecta, alteraciones anatómicas en la zona, o bien puede ser la primera manifestación de un estado trombofílico desconocido hasta ese momento, como en el caso que nos ocupa. La clínica suele consistir en dolor en extremidad afecta, acompañado frecuentemente de edema y circulación colateral. La ecografía-doppler presenta con frecuencia falsos negativos, recomendando la realización de TAC por su mayor especificidad y para valoración de las estructuras vecinas, aunque la flebografía continúa siendo la prueba oro para el diagnóstico de este cuadro. No existe unanimidad acerca del tratamiento, recomendándose individualizar de acuerdo con las características propias de cada caso.Venous thromboembolic disease (VTED in the upper extremities is an infrequent entity, although its incidence has increased in relation to the use of central venous catheters. Its etiology can be primary (idiopathic, spontaneous, due to effort or traumatic or secondary (related to tumours, central venous catheters, etc.. We present a case of primary venous thrombosis of the upper right extremity, also called the Paget-Schroetter syndrome. This clinical picture is usually associated with intensive and/or repetitive exercise or effort of the affected extremity, anatomical alterations in the zone, or it can be the first manifestation of a previously unknown thrombophilic state, as in the case that

  20. Disease: H00506 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available impairment also manifest in indivisuals with osteogenesis imperfecta. Mutations in the CRTAP, LEPRE1, and P...ption, gene) Michou L, Brown JP Genetics of bone diseases: Paget's disease, fibrous dysplasia, osteopetrosis, and osteogenesis

  1. Paget-Schroetter syndrome in the absence of common predisposing factors: a case report.

    Science.gov (United States)

    Ibrahim, Ramy; Dashkova, Irina; Williams, Myia; Kozikowski, Andrzej; Abrol, Neeraj; Gandhi, Anjula; Pekmezaris, Renee

    2017-01-01

    Paget-Schrotter Syndrome (PSS) also known as "effort thrombosis" is a form of primary thrombosis in the subclavian vein at the costoclavicular junction is usually seen in younger patients after repeated strenuous activity of the shoulders and arms. When occurring in younger patients, PSS presents itself with predisposing factors such as unilateral dull, aching pain in the shoulder or axilla and swelling of the arm and hand. We report a rare case of unusual left axillo-subclavian vein thrombosis in absence of clear risk factors and a negative hypercoagulable workup in a 36-year-old Hispanic woman who presented with 2 days duration of left upper extremity pain and swelling after a week of heavy exercise in aerobic class. Very few documented cases of primary or spontaneous ASVT in absence of clear factors and in such anatomical location have been previously reported. The patient was started on strict precautions of left upper extremity immobilization, analgesics in the form of Tylenol 650 mg every 6 h for pain as well as cold compresses. Lovenox 90 mg subcutaneous twice daily (1 mg/kg BID) was started together with warfarin to keep INR 2-3. In addition to the unusual location in the left upper extremity in our case, the absence of common etiologic factors makes our case of Paget-Schroetter Syndrome a very unique one. Presently, there is a lack of guided management of rare conditions such as our case, or consensus among the sources. Physicians should be aware of this rare disease since untreated conditions may be debilitating for the patient and very costly especially if diagnosed with a delay.

  2. Estudio molecular de la enfermedad ósea de Paget

    OpenAIRE

    2016-01-01

    [ES]La Enfermedad Ósea de Paget es una enfermedad que se define como un trastorno esquelético, focal y crónico. Se produce debido a que los osteoclastos aumentan en número, tamaño y actividad. El recambio óseo se acelera, con un gran aumento de la resorción ósea acoplada a una formación excesiva y desorganizada de hueso; lo que genera un hueso no laminar (plexiforme) muy vascularizado, aumentado de volumen y con resistencia disminuida. Sus principales manifestaciones clínicas son el dolor, la...

  3. Telangiectatic osteosarcoma of the skull. A post-Paget case.

    Science.gov (United States)

    Donato, G; Lavano, A; Volpentesta, G; Chirchiglia, D; Veraldi, A; De Rose, F; Iannello, A N; Stroscio, C; Signorelli, C D

    1997-01-01

    We report a case of post-Paget telangiectatic osteosarcoma of the skull in a 75-year-old woman. Such a neoplasia is a rare variant of osteosarcoma, a tumor rare in the cranic bones. The patient was submitted for a careful analysis by the following procedures: technetium scintigram, X-rays, CT scan, and MRI. After the surgical procedure, pathological examination confirmed the diagnosis. Both radiological and pathological pattern of this tumor are discussed in relation to the differential diagnosis. Our report shows that benign lesions may represent a possible cause of diagnostic errors. They must be excluded by histological analysis.

  4. Imaging diagnostics of breast metastases from extramammary tumors; Bildgebende Diagnostik bei Brustmetastasen extramammaerer Tumoren

    Energy Technology Data Exchange (ETDEWEB)

    Wienbeck, S.; Lotz, J. [Georg-August-Universitaet Goettingen, Institut fuer Diagnostische und Interventionelle Radiologie, Goettingen (Germany); Nemat, S. [Universitaet Homburg/Saar, Institut fuer Diagnostische und Interventionelle Radiologie, Homburg/Saar (Germany); Surov, A. [Universitaet Leipzig, Institut fuer Diagnostische und Interventionelle Radiologie, Leipzig (Germany)

    2017-06-15

    Breast metastases of solid extramammary tumors are very rare in comparison to primary malignancies of the breast and account for only 0.33-6.3% of all malignant neoplasms of the breast. The most common primary tumors are malignant melanoma, distant sarcomas, lung cancer, ovarian cancer, renal cell cancer and thyroid cancer in decreasing order of frequency. This review article summarizes the clinical features and the different imaging findings of breast metastases from different extramammary solid tumors. Breast metastases are often incidental findings in computed tomography (CT) or positron emission tomography CT (PET-CT) imaging. Mammography shows two different imaging patterns, namely focal lesions and diffuse architectural distortion with skin thickening. Breast metastases presenting as focal masses usually occur as solitary and more rarely as multiple round lesions with a smooth edge boundary. Associated calcifications are rare findings. Diffuse architectural distortion with skin thickening is more common in breast metastases from most gastric tumors, ovarian cancer and rhabdomyosarcoma. Using ultrasound most lesions are hypoechoic, oval or round with smooth boundaries and posterior acoustic enhancement. The magnetic resonance imaging (MRI) criteria of breast metastases show an inconstant signal behavior that cannot be safely classified as benign or malignant. In summary, in patients with known malignancies the presence of breast metastases should be considered even with imposing clinically and radiologically benign findings. (orig.) [German] Brustmetastasen solider extramammaerer Tumoren sind im Vergleich zu primaeren Malignomen der Brust mit einer Praevalenz von 0,33-6,3 % aller boesartigen Neubildungen in der Brust sehr selten. Die haeufigsten Primaertumoren sind dabei das maligne Melanom, ferner Sarkome, Bronchial-, Ovarial-, Nierenzell- und Schilddruesenkarzinome mit einer absteigenden Haeufigkeit ihres Auftretens. In dieser Uebersichtsarbeit werden die

  5. Expanding Disease Spectrum Associated With Puerperal Mastitis

    Directory of Open Access Journals (Sweden)

    Gregg L. McAdoo

    1997-01-01

    Full Text Available Background: Staphylococcus aureus and the β-hemolytic streptococci are the commonest causes of puerperal mastitis which tends to be a localized disease process. This report describes 2 cases attributable to these bacteria that resulted in extramammary involvement and augmented morbidity.

  6. Osteoclast Inhibitory Peptide-1 Therapy for Paget’s Disease

    Science.gov (United States)

    2010-08-01

    of the murine Ly-6 family, is induced by retinoic acid during the differentiation of acute promyelocytic leukemia cell. Proc Natl Acad Sci USA 93:5910...and Maloney murine leukemia virus reverse transcriptase (Applied Biosystems). The resulting cDNAs were subjected to quantitative real-time RT-PCR

  7. Osteoclast Inhibitory Peptide-1 Therapy for Paget’s Disease

    Science.gov (United States)

    2011-08-01

    autosomal dominant trait with genetic heterogeneity and characterized by highly localized areas of bone turnover with increased osteoclast ( OCL ) actively followed by an exaggerated osteoblast response.

  8. Acute phase protein concentrations in serum and milk from healthy cows, cows with clinical mastitis and cows with extramammary inflammatory conditions

    NARCIS (Netherlands)

    Nielsen, B.H.; Jacobsen, S.; Andersen, P.H.; Niewold, T.A.; Heegaard, P.M.H.

    2004-01-01

    The concentrations of the two acute phase proteins, serum amyloid A and haptoglobin, in serum and milk were compared in 10 cows with clinical mastitis, 11 cows with extramammary inflammatory conditions and 10 clinically healthy control cows. The concentrations of both acute phase proteins were highe

  9. Acute phase protein concentrations in serum and milk from healthy cows, cows with clinical mastitis and cows with extramammary inflammatory conditions

    DEFF Research Database (Denmark)

    Nielsen, B.H.; Jacobsen, S.; Andersen, P.H.

    2004-01-01

    The concentrations of the two acute phase proteins, serum amyloid A and haptoglobin, in serum and milk were compared in 10 cows with clinical mastitis, 11 cows with extramammary inflammatory conditions and 10 clinically healthy control cows. The concentrations of both acute phase proteins were...... higher in the serum and milk of the cows with mastitis than in the cows in the other two groups. Four of the cows with extramammary inflammatory conditions had serum amyloid A concentrations in serum above 100 mug/ml, but negligible concentrations in milk, indicating that a pathogen must be present...... in the mammary gland for serum amyloid A to accumulate in milk. The acute phase protein concentrations in milk increased significantly with increasing somatic cell count, suggesting that they may be indicators of the severity of an infection....

  10. Unbiased Stereologic Estimation of the Spatial Distribution of Paget’s Disease in the Human Temporal Bone

    DEFF Research Database (Denmark)

    Bloch, Sune Land; Sørensen, Mads Sølvsten

    2014-01-01

    BACKGROUND: It has been suggested that Paget's disease of bone and otosclerosis may share a myxoviral etiology. However, the association between virus infection and pathologic bone remodeling is still controversial. The aim of this study was to estimate the spatial distribution of pagetic bone...... remodeling around the inner ear space and to compare it with that of otosclerosis in a contemporary context of temporal bone dynamics. MATERIALS AND METHODS: From the temporal bone collection of Massachusetts Eye and Ear Infirmary, 15 of 29 temporal bones with Paget's disease were selected to obtain...... is similar to the normal distribution of perilabyrinthine bone remodeling but entirely different from the spatial location of otosclerosis, which are focal and centripetally distributed around the inner ear space. CONCLUSION: In Paget's disease, the antiresorptive barrier around the inner ear space becomes...

  11. Metastases to the breast from extramammary malignancies – PET/CT findings

    Energy Technology Data Exchange (ETDEWEB)

    Benveniste, Ana P., E-mail: apbenveniste@mdanderson.org [Department of Diagnostic Radiology, The University of Texas MD Anderson Cancer Center, Houston, TX (United States); Marom, Edith M., E-mail: emarom@mdanderson.org [Department of Diagnostic Radiology, The University of Texas MD Anderson Cancer Center, Houston, TX (United States); Benveniste, Marcelo F., E-mail: mfbenveniste@mdanderson.org [Department of Diagnostic Radiology, The University of Texas MD Anderson Cancer Center, Houston, TX (United States); Mawlawi, Osama R., E-mail: omawlawi@mdanderson.org [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, Houston, TX (United States); Miranda, Roberto N., E-mail: Roberto.miranda@mdanderson.org [Department of Hematopathology, The University of Texas MD Anderson Cancer Center, Houston, TX (United States); Yang, Wei, E-mail: wyang@mdanderson.org [Department of Diagnostic Radiology, The University of Texas MD Anderson Cancer Center, Houston, TX (United States)

    2014-07-15

    Detection of incidental malignant lesions in the breast has a significant clinical impact not only on healthy individuals but also on patients with known malignant disease. This review describes a spectrum of metastatic breast lesions incidentally detected by FDG PET-CT at staging that may be misinterpreted as second primary malignancy. The common non-mammary malignancies that metastasize to the breast include melanoma, hematopoietic malignancies and epithelial cancers. We present the FDG PET-CT features of incidental non-mammary metastases to the breast that may help distinguish primary breast cancer from metastatic disease and aid in the management of patients with a known malignancy.

  12. Paget-Schroetter syndrome and pulmonary thromboembolism: clinical follow-up over 5 years.

    Science.gov (United States)

    Kobayashi, Hideo; Mimura, Satoshi; Motoyoshi, Kazuo

    2005-09-01

    A scaffold constructor lost consciousness at work, leading to emergency admission to our hospital. He had noted gradual worsening of exertional dyspnea over the previous 1 month. Chest radiography showed localized oligemia and enlarged hilar vessels. Pulmonary perfusion scintigraphy confirmed the existence of multiple perfusion defects, so a diagnosis of pulmonary thromboembolism was made. Upper and lower limb venography disclosed interruption of the right subclavian vein (so-called Paget-Schroetter syndrome). However, there was no difference in appearance between the right and left upper extremities. Five years after starting anticoagulant therapy, his symptoms have resolved, but serial perfusion scintigraphy and upper extremity venography revealed the persistence of abnormalities. In patients with pulmonary thromboembolism, lifestyle factors (especially heavy manual labor) should be considered and the possibility of subclavian vein thrombosis should be kept in mind.

  13. Founders lecture 2007. Metabolic bone disease: what has changed in 30 years?

    Energy Technology Data Exchange (ETDEWEB)

    Sundaram, Murali [Cleveland Clinic, Diagnostic Radiology, MSK, Cleveland, OH (United States)

    2009-09-15

    To provide an update on imaging of metabolic bone disease based on new developments, findings, and changing practices over the past 30 years. Literature review of osteoporosis, osteomalacia, renal osteodystrophy, Paget's disease, bisphosphonates, with an emphasis on imaging. Cited references and pertinent findings. Significant developments have occurred in the imaging of metabolic bone disease over the past 30 years. (orig.)

  14. Let's go out of the breast: Prevalence of extra-mammary findings and their characterization on breast MRI

    Energy Technology Data Exchange (ETDEWEB)

    Moschetta, Marco, E-mail: marco.moschetta@gmail.com; Telegrafo, Michele, E-mail: mikitele@hotmail.it; Rella, Leonarda, E-mail: lea.rella@gmail.com; Stabile Ianora, Amato Antonio, E-mail: a.stabile@radiologia.uniba.it; Angelelli, Giuseppe, E-mail: g.angellelli@radiologia.uniba.it

    2014-06-15

    Purpose: The aim of this study is to assess the prevalence, the site and the nature of extra-mammary findings on breast magnetic resonance imaging (MRI) and to determine its accuracy in the characterization of the discovered lesions. Materials and methods: A retrospective review of 308 female patients (mean age 50 ± 20) who underwent breast MRI with 1.5 T device was performed. 125 out of 308 (40.5%) had a positive personal history of breast cancer (pre-operative n = 80; follow-up n = 45), while the remaining 183 without history of breast cancer (high familiar risk for breast cancer n = 80; dense breast n = 103). All incidental findings were characterized by means of additional imaging (US; Bone scintigraphy-MRI; CT-PET-CT). Results: 59 incidental findings were found in 53/308 (17%) examined patients. 9/59 incidental findings (15%) were confirmed to be malignant while the remaining 50/59 (84%) benign. The most common site was the liver (33/59; 55.8%), followed by the lung (6/59; 10.1%), bone (6/59; 10.1%), diaphragm (6/59; 10.1%) spleen (3/59; 5%), kidney (2/59; 3.4%), gall bladder (1/5; 1.5%), ascending aorta (1/59; 1.5%), thyroid (1/59; 1.5%). The incidence of malignant incidental findings resulted to be higher in the group of patients with personal breast cancer (36%) than in the other one (8%). By comparing MRI findings with the additional definitive imaging tools, breast MRI allowed a correct diagnosis in 58/59 cases with a diagnostic accuracy value of 98%. Conclusion: Incidental extramammary findings on breast MRI are common. Benign lesions represent the most frequent findings, however malignant ones need to be searched especially in patients with personal history of breast cancer because they could influence the clinical patient management. Breast MRI can characterize incidental findings with high accuracy value.

  15. Paget-Schroetter syndrome after a dental procedure in a patient with factor V Leiden (R506Q) heterozygosity.

    Science.gov (United States)

    Sharma, Prabin

    2017-04-01

    : Paget-Schroetter syndrome or effort thrombosis is characterized by spontaneous thrombosis of the upper extremity venous system, commonly seen in a young healthy patient after repetitive use of the upper extremities. It is rarely associated with coagulopathy and thus, hypercoagulable work-up is not usually a part of the investigation. We present a first case of a young woman, who was diagnosed with left upper extremity effort thrombosis following a dental procedure. Interestingly, she was also noted to be heterozygous for factor V Leiden mutation.

  16. Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

    Science.gov (United States)

    2013-10-01

    WT T/L-6 p62KI p62KI MVNP WT T/L-6 p62KI p62KI MVNP IT/L-6 ITIL -6 p62KVfiL-6 3±1 22±3 26±3 RANKL 5±3 16±3 8±2 31±5 MVNP 32±2 100 26...MVNP RANKL(ng/ml) RANKL (100ng/ml) 0 u_L_i_L_LJ~~~-L-L~-L~~L-~L-L-L D WT TIL -6 p62KI p62KI MVNP WT T/L-6 p62KI p62KI MVNP WT TAF12 TFIIB ITIL -6... ITIL -6 TIL-6 p62KI p62KI IT/L-6 T AF12/TFIIB 1.0 2.5 1.0 5.1 27 c Figure 3 A p62KI WT p62KI TIL-6 IT/L-6 WT MVNP p62KI RANKLI

  17. Calcitonin treatment in osteoectasia with hyperphosphatasia (juvenile Paget's disease): radiographic changes after treatment

    Energy Technology Data Exchange (ETDEWEB)

    Tueysuez, B. [Div. of Genetics and Teratology, Univ. of Istanbul (Turkey); Serencebey, Istanbul (Turkey); Mercimek, S.; Uenguer, S. [Dept. of Paediatrics, Univ. of Istanbul (Turkey); Deniz, M. [Dept. of Paediatrics, Haseki Hospital, Istanbul (Turkey)

    1999-11-01

    Osteoectasia with hyperphosphatasia is a rare skeletal disorder, characterised by demineralisation and expansion of tubular bones and elevated serum alkaline phosphatase. We present a girl diagnosed as having osteoectasia with hyperphosphatasia who had swelling of phalanges of both hands and motor retardation. She was treated with synthetic human calcitonin. Clinical and radiological findings showed remarkable improvement after 2 years' treatment. (orig.)

  18. Understanding the Delay in Onset of Paget’s Disease of Bone

    Science.gov (United States)

    2014-09-01

    of the measles virus   5 genome in which all three reading frames encode distinct genes (MVP, MVV and MVC ) using the same sequence. Our problem...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

  19. Evaluation of the Role of Vibrational Spectroscopy in the Assessment of Vulval Disease

    Science.gov (United States)

    2016-02-10

    Normal Vulval Skin; Lichen Sclerosus; High Grade Dysplasia - Usual Type ('VIN 2-3'); High Grade Dysplasia - Differentiated Type ('VIN 2-3'); Squamous Cell Carcinoma; Epithelial Hyperplasia Without Atypia; Atypia Not Otherwise Specified/ Low Grade Dysplasia ('VIN 1'); Pagets Disease of the Vulva

  20. Breast manifestations of systemic diseases

    Directory of Open Access Journals (Sweden)

    Dilaveri CA

    2012-02-01

    Full Text Available Christina A Dilaveri, Maire Brid Mac Bride, Nicole P Sandhu, Lonzetta Neal, Karthik Ghosh, Dietlind L Wahner-RoedlerDivision of General Internal Medicine, Mayo Clinic, Rochester, MN, USAAbstract: Although much emphasis has been placed on the primary presentations of breast cancer, little focus has been placed on how systemic illnesses may affect the breast. In this article, we discuss systemic illnesses that can manifest in the breast. We summarize the clinical features, imaging, histopathology, and treatment recommendations for endocrine, vascular, systemic inflammatory, infectious, and hematologic diseases, as well as for the extramammary malignancies that can present in the breast. Despite the rarity of these manifestations of systemic disease, knowledge of these conditions is critical to the appropriate evaluation and treatment of patients presenting with breast symptoms.Keywords: breast, endocrine, hematologic, infectious, vascular

  1. Manifestações clínicas e procedimentos diagnósticos da Doença de Paget do osso

    Directory of Open Access Journals (Sweden)

    Leticia Sales Nascimento

    2011-03-01

    Full Text Available A doença de Paget do osso (DPO é uma patologia osteometabólica caracterizada pelo aumento da remodelação óssea, tornando o osso mais espesso, frágil, suscetível a fraturas e complicações clínicas. A DPO normalmente é assintomática, tornando-se uma patologia de diagnóstico tardio ou com achados acidentais por exames laboratoriais e imaginológicos. Portanto o objetivo deste trabalho é analisar as manifestações clínicas da Doença de Paget do osso avaliando qual o melhor procedimento diagnóstico para cada caso. Para isso o trabalho baseia-se numa pesquisa não sistemática de revisão bibliográfica por meio da consulta aos indexadores de pesquisa nas bases de dados eletrônicos (Medline, Lilacs, Scielo e PubMed até o ano de 2010. Concluímos que o diagnóstico, geralmente, encontra-se alicerçado nas manifestações clínicas, exames radiográficos e bioquímicos, mas dar-se escolha para os métodos por imagem, dando ênfase para a radiografia convencional e cintilografia de corpo inteiro.

  2. Measles Virus Nucleocapsid (MVNP) Gene Expression and RANK Receptor Signaling in Osteoclast Precursors, Osteoclast Inhibitors Peptide Therapy for Pagets Disease

    Science.gov (United States)

    2008-10-01

    re- sult in upregulation of p62 expression in osteoclast pre- cursor cells, and the genetic inactivation of p62 in mice impaired PTHrP -induced...cells and that the genetic inactivation of p62 in mice impaired PTHrP induced osteoclastogenesis in vivo. However, p62 null mice have grossly normal

  3. Identification of a Major Locus for Paget's Disease on Chromosome 10p13 in Families of British Descent

    National Research Council Canada - National Science Library

    Lucas, Gavin JA; Riches, Phillip L; Hocking, Lynne J; Cundy, Tim; Nicholson, Geoff C; Walsh, John P; Ralston, Stuart H

    2008-01-01

    .... A major susceptibility locus for PDB was identified on chromosome 10p13 by a genome‐wide linkage scan in families of British descent, which accounted for the vast majority of cases not caused by SQSTM1 mutations. Introduction...

  4. Paget's Disease of the Breast: Clinical Analvsis of 45 Patients

    Institute of Scientific and Technical Information of China (English)

    MingtianYang; HaoLong; JiehuaHe; XiWang; ZemingXie

    2004-01-01

    OBJECTIVE Paget's disease is an uncommon breast malignancy and often misdiagnosed. If the patient is treated at an early stage, the prognos is is satisfactory. Our study analyzed the clinical characteristics of the disease and the factors influencing the prognosis.METHOOS Fourty-five patients with Paget's disease who were admitted to our hospital were analyzed retrospectively.RESULTS The most common symptoms of the disease were erosion and a bleeding-like eczematoid change at the nipple/areola. Qf the 40 patients with an eczematoid change, 11 patients had verified Paget's disease with a palpable mass on physical examination, and 29 patients had verified Paget's disease with a nonpalpable mass. Only 5 patients manifested a mass with no eczematiod change. Thirteen patients had ipsilateral axillary lymphadenopathy. In this study, 25 cases were treated by radical mastectomy and 20 cases were treated by modified radical mastectomy.Five and 10-year survival rates for the patients with nonpalpable massesand for those with palpable masses were 95.5%, 78.6%, and 53.8%, 36.4% respectively. The former were significantly higher than the latter (P <0.01 and <0.05 respectively). Five and 10-year survival rates for the patients without underlying carcinoma (DClS/IDC) and for the patients with underlyingcarcinoma were 100%, 88.9% and 69.6%, 43.8% respectively. The former were significantly higher than the latter (P<0.05) Five and 10-year survival rates for the patients with negative lymph nodes and for the patients with positive lymph nodes were 92.0%, 76.5% and 50.0%, 25.0% respectively.The former were also significantly higher than the latter (P <0.05).CONCLUSION Treatment at an early stage is very important and influences the prognosis directly for Paget's disease of the breast. The survival rates of patients with nonpalpable masses without underlying carcinoma and without lymphadenopathy, were significantly higher than patients with palpable masses with underlying carcinoma

  5. Efecto de una sola dosis de ácido zoledrónico en un caso de enfermedad de Paget ósea

    Directory of Open Access Journals (Sweden)

    Melina Sabán

    2010-10-01

    Full Text Available La enfermedad de Paget es un trastorno crónico del remodelado óseo, caracterizado por un aumento de la resorción ósea producido por osteoclastos atípicos, seguido por un incremento acelerado de la formación ósea, lo que resulta en la formación de hueso en mosaico desorganizado. Un excelente marcador bioquímico para orientar el diagnóstico y seguimiento es la fosfatasa alcalina (FAL. Se presenta el caso de un paciente de 90 años, de sexo masculino, con diagnóstico de enfermedad de Paget. Se inicia tratamiento con pamidronato vía oral con respuesta parcial, por lo que se rota a pamidronato endovenoso. Disminuyen el dolor y la concentración plasmática de FAL, persistiendo con centellograma óseo patológico. Luego de varios años de tratamiento, con adecuado aporte de calcio y vitamina D, comienza nuevamente con dolor y valores elevados de FAL. Se decide iniciar tratamiento con ácido zoledrónico endovenoso 4 mg, única aplicación, obteniéndose remisión clínica y bioquímica desde hace cuatro años y mejoría de la imagen centellográfica. Este informe refiere la buena respuesta, sostenida en el tiempo, al tratamiento con única dosis de ácido zoledrónico en un paciente que presentó resistencia al pamidronato.

  6. Increased IL-6 Expression in Osteoclasts Is Necessary But Not Sufficient for the Development of Paget’s Disease of Bone

    Science.gov (United States)

    Teramachi, Jumpei; Zhou, Hua; Subler, Mark A; Kitagawa, Yukiko; Galson, Deborah L; Dempster, David W; Windle, Jolene J; Kurihara, Noriyoshi; Roodman, G David

    2015-01-01

    Measles virus nucleocapsid protein (MVNP) expression in osteoclasts (OCLs) and mutation of the SQSTM1 (p62) gene contribute to the increased OCL activity in Paget’s disease (PD). OCLs expressing MVNP display many of the features of PD OCLs. Interleukin-6 (IL-6) production is essential for the pagetic phenotype, because transgenic mice with MVNP targeted to OCLs develop pagetic OCLs and lesions, but this phenotype is absent when MVNP mice are bred to IL-6−/− mice. In contrast, mutant p62 expression in OCL precursors promotes receptor activator of NF-κB ligand (RANKL) hyperresponsivity and increased OCL production, but OCLs that form have normal morphology, are not hyperresponsive to 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3), nor produce elevated levels of IL-6. We previously generated p62P394L knock-in mice (p62KI) and found that although OCL numbers were increased, the mice did not develop pagetic lesions. However, mice expressing both MVNP and p62KI developed more exuberant pagetic lesions than mice expressing MVNP alone. To examine the role of elevated IL-6 in PD and determine if MVNP mediates its effects primarily through elevation of IL-6, we generated transgenic mice that overexpress IL-6 driven by the tartrate-resistant acid phosphatase (TRAP) promoter (TIL-6 mice) and produce IL-6 at levels comparable to MVNP mice. These were crossed with p62KI mice to determine whether IL-6 overexpression cooperates with mutant p62 to produce pagetic lesions. OCL precursors from p62KI/TIL-6 mice formed greater numbers of OCLs than either p62KI or TIL-6 OCL precursors in response to 1,25-(OH)2D3. Histomorphometric analysis of bones from p62KI/TIL-6 mice revealed increased OCL numbers per bone surface area compared to wild-type (WT) mice. However, micro-quantitative CT (μQCT) analysis did not reveal significant differences between p62KI/TIL-6 and WT mice, and no pagetic OCLs or lesions were detected in vivo. Thus, increased IL-6 expression in OCLs from p62KI mice

  7. Apocrine gland carcinoma on the right thigh

    Directory of Open Access Journals (Sweden)

    Sergio Renato Pais Costa

    2008-12-01

    Full Text Available The authors report a case of cutaneous apocrine ductal carcinomaof the right thigh in a 78-year-old female. Histological examinationrevealed a solid, ductal and glandular tumor with a significantdesmoplastic reaction. The tumor cells showed high-grade cellularatypia, and occasional peritumoral inflammatory infiltration wasalso observed. There were no characteristics of extramammaryPaget´s Disease on the overlying skin. The neoplastic cells wereimmunohistochemically positive for S-100 protein, lysozyme andalpha-chymotrypsin, but negative for CEA, EMA, and HMB-45. On thebasis of these findings, the diagnosis of apocrine ductal carcinomawas confirmed. The patient then underwent wide resection of thetumor plus en-bloc radical inguinal lymphadenectomy. The localreconstruction was done by means of a tensor fascia lata flap, noadjuvant treatment was performed. To date, one year on, the patientremains healthy, there being no evidence of tumor recurrence.

  8. 乳腺外实体瘤乳腺转移患者的临床病理特征和预后%Clinicopathological features and prognosis of metastases to the breast from extramammary solid tumors

    Institute of Scientific and Technical Information of China (English)

    罗扬; 徐兵河; 李青; 张频; 袁芃; 王佳玉; 马飞; 蔡锐刚; 樊英

    2014-01-01

    目的 探讨乳腺外实体瘤乳腺转移患者的临床病理特征和预后.方法 回顾性分析2001年1月至2012年12月间中国医学科学院肿瘤医院诊治的24例乳腺外实体瘤乳腺转移患者的临床资料,乳腺外原发实体肿瘤和乳腺病灶均经病理细胞学证实.结果 24例患者中,女性22例,男性2例,中位年龄54岁.原发肿瘤为非小细胞肺癌10例,小细胞肺癌4例,鼻腔横纹肌肉瘤3例,嗅神经母细胞瘤3例,卵巢癌2例,恶性黑色素瘤1例,胃癌1例.15例(62.5%)患者可自行扪及乳腺结节,2例患者乳腺弥漫增大伴有炎性改变,7例(29.2%)患者在检查CT时发现乳腺结节.乳腺转移灶多为增长较快的单发结节,可以伴有腋窝淋巴结肿大,少见微小钙化,病理细胞学检查可以区分乳腺转移和原发乳腺癌,83.3%(20/24)的患者同时存在其他器官和淋巴结转移.乳腺外实体瘤乳腺转移患者的预后差,中位生存时间仅为9.2个月.结论 恶性肿瘤患者出现乳腺结节均应考虑乳腺转移可能,应对乳腺结节进行病理细胞学检查以明确诊断.正确的诊断不仅可以避免不必要的乳腺切除术,更重要的是可以给予患者及时和正确的系统治疗.%Objective To discuss the clinicopathological features and prognosis of metastases to the breast from extramammary solid tumors.Methods The databases of Cancer Hospital of Chinese Academy of Medical Sciences from January 2001 to December 2012 were reviewed.24 patients were identified with a diagnosis of metastasis to the breast from extramammary solid tumors and their clinical data were collected and analyzed.All the primary solid tumors and breast lesions were confirmed by pathology or cytology.Results Of the 24 patients,22 were women and two were men.The median age was 54 years.The primary malignancies included non-small cell lung cancer (n =10),small cell lung cancer (n =4),rhabdomyosarcoma (n =3),olfactory neuroblastoma (n =3),ovarian cancer

  9. 乳腺外淋巴结转移为首发症状的乳腺癌临床手术疗效观察%Clinical Analysis of Extramammary Lymph Node Metastasis for the First Symptom of Breast Cancer

    Institute of Scientific and Technical Information of China (English)

    董春富; 赵成会; 张晕生; 尚华; 刘丽梅; 张学惠; 李振宇; 刘志伟; 何文婿

    2012-01-01

    Objective To study the clinical analysis of extramammary lymph node metastasis as the first symptom of breast cancer. Methods Retrospective study was concluded inl5 cases of occult breast cancer from Mar 2006 to Mar 2012. All of the 15 cases preoperative armpit lumpectomy or line of fine needle aspiration are lymphatic metastatic cancer by pathological examination. 2 cases had the simple surgical treatment in 14 cases,1 case had the chemotherapy only,surgery plus radiotherapy 5 cases,surgery plus postoperative adjuvant chemotherapy in 4 cases,surgery plus postoperative adjuvant chemotherapy and radiotherapy 3 cases. To be supplemented with endocrine abnormalities in patients with endocrine conditioning. Results This group was followed up 15 cases,10 cases survived,which 6 cases survived for 3 years and not more than 6 years,2 cases more than five years. Conclusion Auxiliary lumps in clinical practice for women should be given a high degree of vigilance,to consider the possibility of occult breast cancer.%目的 研究乳腺外淋巴结转移为首发症状的乳腺癌手术治疗临床观察.方法 回顾性分析两院收治的15例隐匿性乳腺癌患者的临床资料.15例患者在术前都行腋下肿块切除或行细针穿刺,经病理检查证实均为乳腺癌淋巴转移.对本组14例患者行乳腺癌根治术或改良根治术,1例因拒绝行根治术,仅行单侧淋巴结肿物切除术.14例中单纯行手术治疗者2例;单纯化疗1例;手术+放疗5例;手术+术后辅助化疗4例;手术+术后辅助化疗+放疗3例.对于伴有雌、孕激素受体阳性患者再辅以内分泌治疗.结果 本组随访15例,1、2、3、4、5年存活分别为15例、14例、12例、11例、10例.结论 在临床上对女性的腋窝肿块需给予高度警惕,应考虑隐匿性乳腺癌的可能.

  10. DISEASES

    DEFF Research Database (Denmark)

    Pletscher-Frankild, Sune; Pallejà, Albert; Tsafou, Kalliopi;

    2015-01-01

    Text mining is a flexible technology that can be applied to numerous different tasks in biology and medicine. We present a system for extracting disease-gene associations from biomedical abstracts. The system consists of a highly efficient dictionary-based tagger for named entity recognition...... of human genes and diseases, which we combine with a scoring scheme that takes into account co-occurrences both within and between sentences. We show that this approach is able to extract half of all manually curated associations with a false positive rate of only 0.16%. Nonetheless, text mining should...... not stand alone, but be combined with other types of evidence. For this reason, we have developed the DISEASES resource, which integrates the results from text mining with manually curated disease-gene associations, cancer mutation data, and genome-wide association studies from existing databases...

  11. A novel mutation in VCP causes Charcot-Marie-Tooth Type 2 disease.

    Science.gov (United States)

    Gonzalez, Michael A; Feely, Shawna M; Speziani, Fiorella; Strickland, Alleene V; Danzi, Matt; Bacon, Chelsea; Lee, Youjin; Chou, Tsui-Fen; Blanton, Susan H; Weihl, Conrad C; Zuchner, Stephan; Shy, Michael E

    2014-11-01

    Mutations in VCP have been reported to account for a spectrum of phenotypes that include inclusion body myopathy with Paget's disease of the bone and frontotemporal dementia, hereditary spastic paraplegia, and 1-2% of familial amyotrophic lateral sclerosis. We identified a novel VCP mutation (p.Glu185Lys) segregating in an autosomal dominant Charcot-Marie-Tooth disease type 2 family. Functional studies showed that the Glu185Lys variant impaired autophagic function leading to the accumulation of immature autophagosomes. VCP mutations should thus be considered for genetically undefined Charcot-Marie-Tooth disease type 2. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Exercise training reverses skeletal muscle atrophy in an experimental model of VCP disease.

    Directory of Open Access Journals (Sweden)

    Angèle Nalbandian

    Full Text Available The therapeutic effects of exercise resistance and endurance training in the alleviation of muscle hypertrophy/atrophy should be considered in the management of patients with advanced neuromuscular diseases. Patients with progressive neuromuscular diseases often experience muscle weakness, which negatively impact independence and quality of life levels. Mutations in the valosin containing protein (VCP gene lead to Inclusion body myopathy associated with Paget's disease of bone and frontotemporal dementia (IBMPFD and more recently affect 2% of amyotrophic lateral sclerosis (ALS-diagnosed cases.The present investigation was undertaken to examine the effects of uphill and downhill exercise training on muscle histopathology and the autophagy cascade in an experimental VCP mouse model carrying the R155H mutation. Progressive uphill exercise in VCP(R155H/+ mice revealed significant improvement in muscle strength and performance by grip strength and Rotarod analyses when compared to the sedentary mice. In contrast, mice exercised to run downhill did not show any significant improvement. Histologically, the uphill exercised VCP(R155H/+ mice displayed an improvement in muscle atrophy, and decreased expression levels of ubiquitin, P62/SQSTM1, LC3I/II, and TDP-43 autophagy markers, suggesting an alleviation of disease-induced myopathy phenotypes. There was also an improvement in the Paget-like phenotype.Collectively, our data highlights that uphill exercise training in VCP(R155H/+ mice did not have any detrimental value to the function of muscle, and may offer effective therapeutic options for patients with VCP-associated diseases.

  13. Possible mechanisms in the induction of vitiligo-like hypopigmentation by topical imiquimod.

    Science.gov (United States)

    Mashiah, J; Brenner, S

    2008-01-01

    The pathogenesis of vitiligo was examined for clues to the pigmentary changes that may occur after treatment with topical imiquimod. The literature varies on the pigmentary changes induced by topical use of imiquimod. The US Food and Drugs Administration lists 68 reports of pigmentary changes out of a total of 1257 reports related to imiquimod lodged from 1997 to 2003. Some studies describe vitiligo-like hypopigmentation associated with imiquimod treatment of genital warts (as with the patient described in this report), molluscum contagiosum, basal cell carcinoma, extramammary Paget's disease and murine melanoma. Other studies report hyperpigmentation associated with imiquimod. The possible mechanisms of hypopigmentation associated with imiquimod treatment are discussed, including antibodies found in sera of patients with vitiligo to nonpigment cell antigens, cytoplasmic pigment cell antigens and pigment cell-surface antigens; stimulation by imiquimod of both the innate immune response and cell-mediated adaptive immunity; and increased sensitivity of melanocytes to oxidative stress. The vitiligo-like hypopigmentation following topical imiquimod treatment is in line with the mode of action of this drug.

  14. Valosin-containing protein (VCP/p97) inhibitors relieve Mitofusin-dependent mitochondrial defects due to VCP disease mutants

    Science.gov (United States)

    Zhang, Ting; Mishra, Prashant; Hay, Bruce A; Chan, David; Guo, Ming

    2017-01-01

    Missense mutations of valosin-containing protein (VCP) cause an autosomal dominant disease known as inclusion body myopathy, Paget disease with frontotemporal dementia (IBMPFD) and other neurodegenerative disorders. The pathological mechanism of IBMPFD is not clear and there is no treatment. We show that endogenous VCP negatively regulates Mitofusin, which is required for outer mitochondrial membrane fusion. Because 90% of IBMPFD patients have myopathy, we generated an in vivo IBMPFD model in adult Drosophila muscle, which recapitulates disease pathologies. We show that common VCP disease mutants act as hyperactive alleles with respect to regulation of Mitofusin. Importantly, VCP inhibitors suppress mitochondrial defects, muscle tissue damage and cell death associated with IBMPFD models in Drosophila. These inhibitors also suppress mitochondrial fusion and respiratory defects in IBMPFD patient fibroblasts. These results suggest that VCP disease mutants cause IBMPFD through a gain-of-function mechanism, and that VCP inhibitors have therapeutic value. DOI: http://dx.doi.org/10.7554/eLife.17834.001

  15. Current options for the treatment of Paget’s disease of the bone

    Directory of Open Access Journals (Sweden)

    Daniela Merlotti

    2009-07-01

    Full Text Available Daniela Merlotti, Luigi Gennari, Giuseppe Martini, Ranuccio NutiDepartment of Internal Medicine, Endocrine-Metabolic Sciences and Biochemistry, University of Siena, Siena, ItalyAbstract: Paget’s disease of bone (PDB is a chronic bone remodeling disorder characterized by increased osteoclast-mediated bone resorption, with subsequent compensatory increases in new bone formation, resulting in a disorganized mosaic of woven and lamellar bone at affected skeletal sites. This disease is most often asymptomatic but can be associated with bone pain or deformity, fractures, secondary arthritis, neurological complications, deafness, contributing to substantial morbidity and reduced quality of life. Neoplastic degeneration of pagetic bone is a relatively rare event, occurring with an incidence of less than 1%, but has a grave prognosis. Specific therapy for PDB is aimed at decreasing the abnormal bone turnover and bisphosphonates are currently considered the treatment of choice. These treatments are associated with a reduction in plasma alkaline phosphatase (ALP activity and an improvement in radiological and scintigraphic appearance and with a reduction in bone pain and bone deformity, Recently, the availability of newer, more potent nitrogen-containing bisphosphonates has improved treatment outcomes, allowing a more effective and convenient management of this debilitating disorder.Keywords: Paget’s disease of bone, bisphosphonates, aminobisphosphonates, bone remodeling

  16. Lesions of anogenital mammary-like glands: an update.

    Science.gov (United States)

    Kazakov, Dmitry V; Spagnolo, Dominic V; Kacerovska, Denisa; Michal, Michal

    2011-01-01

    Long considered to be ectopic breast tissue representing the caudal remnants of the milk ridges, anogenital mammary-like glands are nowadays thought to represent a normal constituent of the anogenital area. Lesions involving these glands, benign or malignant, epithelial or stromal manifest a striking similarity to their mammary counterparts. This review addresses the recent literature on lesions of anogenital mammary-like glands and our personal experience with various lesions related to these structures. Discussed are the normal anatomy and histology of these glands as well as the clinical presentation, histopathological and immunohistochemical features, molecular biological aspects, and differential diagnosis of various lesions involving anogenital mammary-like glands, including lactating adenoma, hidradenoma papilliferum, hidradenocarcinoma papilliferum, fibroadenomas, phyllodes tumor, pseudoangiomatous stromal hyperplasia, extramammary Paget disease, and other carcinomas. In addition, "nonspecific" epithelial or stromal changes some of which can be likened to similar changes occurring in a range of benign breast disease, including sclerosing adenosis, columnar cell lesions, ductal lesions and various metaplastic changes affecting epithelium and myoepithelium are discussed. Although lesions of anogenital mammary-like glands are often discussed in many dermatopathology textbooks in the context of cutaneous adnexal neoplasms we advocate that the best approach to the diagnosis of these lesions is to relate them to analogous well recognized lesions occurring in the breast, that is, through the eyes of a breast pathologist. This will enable their recognition, precise classification and should introduce greater uniformity in how they are reported in the literature so that more meaningful clinicopathological comparisons and correlations may be made.

  17. The homozygote VCP(R¹⁵⁵H/R¹⁵⁵H mouse model exhibits accelerated human VCP-associated disease pathology.

    Directory of Open Access Journals (Sweden)

    Angèle Nalbandian

    Full Text Available Valosin containing protein (VCP mutations are the cause of hereditary inclusion body myopathy, Paget's disease of bone, frontotemporal dementia (IBMPFD. VCP gene mutations have also been linked to 2% of isolated familial amyotrophic lateral sclerosis (ALS. VCP is at the intersection of disrupted ubiquitin proteasome and autophagy pathways, mechanisms responsible for the intracellular protein degradation and abnormal pathology seen in muscle, brain and spinal cord. We have developed the homozygous knock-in VCP mouse (VCP(R155H/R155H model carrying the common R155H mutations, which develops many clinical features typical of the VCP-associated human diseases. Homozygote VCP(R155H/R155H mice typically survive less than 21 days, exhibit weakness and myopathic changes on EMG. MicroCT imaging of the bones reveal non-symmetrical radiolucencies of the proximal tibiae and bone, highly suggestive of PDB. The VCP(R155H/R155H mice manifest prominent muscle, heart, brain and spinal cord pathology, including striking mitochondrial abnormalities, in addition to disrupted autophagy and ubiquitin pathologies. The VCP(R155H/R155H homozygous mouse thus represents an accelerated model of VCP disease and can be utilized to elucidate the intricate molecular mechanisms involved in the pathogenesis of VCP-associated neurodegenerative diseases and for the development of novel therapeutic strategies.

  18. Measles virus nucleocapsid protein, a key contributor to Paget’s disease, increases IL-6 expression via down-regulation of FoxO3/Sirt1signaling

    Science.gov (United States)

    Wang, Feng-Ming; Sarmasik, Aliye; Hiruma, Yuko; Sun, Quanhong; Sammut, Benedicte; Windle, Jolene J.; Roodman, G. David; Galson, Deborah L.

    2012-01-01

    Measles virus plays an important role as an environmental factor in the pathogenesis of Paget’s disease (PD). Previous studies have shown that IL-6 is increased in the bone marrow of Paget’s patients and that measles virus nucleocapsid protein (MVNP) induces IL-6 secretion by pagetic osteoclasts. Further, IL-6 plays a critical role in the development of pagetic osteoclasts and bone lesions induced by PD, but the mechanisms regulating IL-6 production by MVNP remain unclear. Our current studies revealed that MVNP expression in osteoclast precursors down-regulated Sirt1 mRNA and protein, a negative regulator of NF-κB activity, which is a key factor for IL-6 expression. MVNP expression in NIH3T3 cells also elevated Il-6 transcription and impaired the expression of Sirt1 mRNA both under basal conditions and upon activation of the Sirt1 upstream regulator FoxO3 by LY294002 (a PI3K/AKT inhibitor). Luciferase activity assays showed that constitutively active FoxO3 abolished the repressive effect of MVNP on reporters driven by either FoxO3 response elements or the Sirt1 promoter. Further, protein stability assays revealed that FoxO3 was degraded more rapidly in MVNP-expressing cells than in control cells following the addition of cycloheximide. Similarly, co-transfection of MVNP and FoxO3 into HEK293 cells demonstrated that MVNP decreased the protein levels of over-expressed FoxO3 in a dose-dependent manner. Treatment with the proteasome inhibitor, MG132, blocked the MVNP-triggered decrease of FoxO3, and the treatment with the serine/threonine phosphatase inhibitor, Calyculin A, revealed that MVNP increased phosphorylation of FoxO3. Further, over-expression of Sirt1 or treatment with the Sirt1 activator resveratrol blocked the increase in Il-6 transcription by MVNP. Finally, resveratrol reduced the numbers of TRAP positive multi-nuclear cells in bone marrow cultures from TRAP-MVNP transgenic mice to wild type levels. These results indicate that MVNP decreases FoxO3

  19. Brain expression genome-wide association study (eGWAS identifies human disease-associated variants.

    Directory of Open Access Journals (Sweden)

    Fanggeng Zou

    Full Text Available Genetic variants that modify brain gene expression may also influence risk for human diseases. We measured expression levels of 24,526 transcripts in brain samples from the cerebellum and temporal cortex of autopsied subjects with Alzheimer's disease (AD, cerebellar n=197, temporal cortex n=202 and with other brain pathologies (non-AD, cerebellar n=177, temporal cortex n=197. We conducted an expression genome-wide association study (eGWAS using 213,528 cisSNPs within ± 100 kb of the tested transcripts. We identified 2,980 cerebellar cisSNP/transcript level associations (2,596 unique cisSNPs significant in both ADs and non-ADs (q<0.05, p=7.70 × 10(-5-1.67 × 10(-82. Of these, 2,089 were also significant in the temporal cortex (p=1.85 × 10(-5-1.70 × 10(-141. The top cerebellar cisSNPs had 2.4-fold enrichment for human disease-associated variants (p<10(-6. We identified novel cisSNP/transcript associations for human disease-associated variants, including progressive supranuclear palsy SLCO1A2/rs11568563, Parkinson's disease (PD MMRN1/rs6532197, Paget's disease OPTN/rs1561570; and we confirmed others, including PD MAPT/rs242557, systemic lupus erythematosus and ulcerative colitis IRF5/rs4728142, and type 1 diabetes mellitus RPS26/rs1701704. In our eGWAS, there was 2.9-3.3 fold enrichment (p<10(-6 of significant cisSNPs with suggestive AD-risk association (p<10(-3 in the Alzheimer's Disease Genetics Consortium GWAS. These results demonstrate the significant contributions of genetic factors to human brain gene expression, which are reliably detected across different brain regions and pathologies. The significant enrichment of brain cisSNPs among disease-associated variants advocates gene expression changes as a mechanism for many central nervous system (CNS and non-CNS diseases. Combined assessment of expression and disease GWAS may provide complementary information in discovery of human disease variants with functional implications. Our findings

  20. Heart Disease

    Science.gov (United States)

    ... type of heart disease you have. Symptoms of heart disease in your blood vessels (atherosclerotic disease) Cardiovascular disease ... can sometimes be found early with regular evaluations. Heart disease symptoms caused by abnormal heartbeats (heart arrhythmias) A ...

  1. Bone x-ray

    Science.gov (United States)

    ... or broken bone Bone tumors Degenerative bone conditions Osteomyelitis (inflammation of the bone caused by an infection) ... Multiple myeloma Osgood-Schlatter disease Osteogenesis imperfecta Osteomalacia Osteomyelitis Paget disease of the bone Rickets X-ray ...

  2. Bone Markers

    Science.gov (United States)

    ... markers may be seen in conditions such as: Osteoporosis Paget disease Cancer that has spread to the bone (metastatic bone disease) Hyperparathyroidism Hyperthyroidism Osteomalacia in adults and rickets in children—lack of bone mineralization, ...

  3. Calcitonin Salmon Injection

    Science.gov (United States)

    Calcitonin salmon injection is used to treat osteoporosis in postmenopausal women. Osteoporosis is a disease that causes bones to weaken and break more easily. Calcitonin salmon injection is also used to treat Paget's disease ...

  4. 光动力治疗炎症性及感染性皮肤病的进展%Photodynamic therapy of inflammatory and infectious skin diseases

    Institute of Scientific and Technical Information of China (English)

    徐俊涛; 王新; 钟雪莲; 陈宏翔

    2016-01-01

    光动力治疗在皮肤科领域应用广泛,如治疗鳞状细胞癌、基底细胞癌、Paget病、Bowen病、光线性角化病、痤疮、鲜红斑痣及尖锐湿疣等取得了满意疗效.目前关于光动力治疗适应证的研究已扩展到银屑病、口腔扁平苔藓及部分局部感染性皮肤病中,取得了一定的疗效,尤其是对面部扁平疣及皮肤利什曼病等几种炎症/感染性皮肤病,更显示出高效率、低复发及美容效果好等优点,值得进一步研究.%Photodynamic therapy (PDT) is widely applied in the field of dermatololgy, and has shown satisfactory therapeutic effect in the treatment of squamous cell carcinoma, basal cell carcinoma, Paget's disease, Bowen's disease, actinic keratosis, acne, port-wine stain and condyloma acuminatum.At present, PDT has been attempted to treat psoriasis, oral lichen planus and some localized infectious skin diseases, and has displayed favoring efficacy in the treatment of these diseases, particularly in that of several inflammatory or infectious diseases (such as facial verruca planae and cutaneous leishmaniasis) with low recurrence and good cosmetic effects.PDT is worthy of further studies.

  5. Lung disease

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000066.htm Lung disease To use the sharing features on this page, ... fibrosis and sarcoidosis are examples of lung tissue disease. Lung circulation diseases -- These diseases affect the blood vessels ...

  6. Gaucher disease

    OpenAIRE

    POSPÍŠILOVÁ, Iva

    2012-01-01

    This thesis is about the disease called Gaucher disease, or Morbus Gaucher. There is described the history of the disease, various forms of disease, effect of bones, visceral organs, hematological changes, changes in metabolism etc.; differential diagnosis, diagnosis and therapy.

  7. Measles virus nucleocapsid protein increases osteoblast differentiation in Paget’s disease

    Science.gov (United States)

    Teramachi, Jumpei; Nagata, Yuki; Mohammad, Khalid; Inagaki, Yuji; Ohata, Yasuhisa; Guise, Theresa; Michou, Laëtitia; Brown, Jacques P.; Windle, Jolene J.; Kurihara, Noriyoshi; Roodman, G. David

    2016-01-01

    Paget’s disease (PD) is characterized by focal and dramatic bone resorption and formation. Treatments that target osteoclasts (OCLs) block both pagetic bone resorption and formation; therefore, PD offers key insights into mechanisms that couple bone resorption and formation. Here, we evaluated OCLs from 3 patients with PD and determined that measles virus nucleocapsid protein (MVNP) was expressed in 70% of these OCLs. Moreover, transgenic mice with OCL-specific expression of MVNP (MVNP mice) developed PD-like bone lesions that required MVNP-dependent induction of high IL-6 expression levels in OCLs. In contrast, mice harboring a knockin of p62P394L (p62-KI mice), which is the most frequent PD-associated mutation, exhibited increased bone resorption, but not formation. Evaluation of OCLs from MVNP, p62-KI, and WT mice revealed increased IGF1 expression in MVNP-expressing OCLs that resulted from the high IL-6 expression levels in these cells. IL-6, in turn, increased the expression of coupling factors, specifically ephrinB2 on OCLs and EphB4 on osteoblasts (OBs). IGF1 enhanced ephrinB2 expression on OCLs and OB differentiation. Importantly, ephrinB2 and IGF1 levels were increased in MVNP-expressing OCLs from patients with PD and MVNP-transduced human OCLs compared with levels detected in controls. Further, anti-IGF1 or anti-IGF1R blocked Runx2 and osteocalcin upregulation in OBs cocultured with MVNP-expressing OCLs. These results suggest that in PD, MVNP upregulates IL-6 and IGF1 in OCLs to increase ephrinB2-EphB4 coupling and bone formation. PMID:26878170

  8. Radionuclide conjugates of calcitonin for imaging bone disease and cancer

    Energy Technology Data Exchange (ETDEWEB)

    Greenland, William Edward Peverell

    2002-07-01

    Salmon calcitonin (sCt) is a peptide with a higher affinity for human calcitonin receptors (hCtR) than human calcitonin. It has been used for treating osteoporosis, Paget's disease and bone pain. High levels of hCtRs are expressed on osteoclasts, bone metastases and primary breast and prostate cancers. The peptide was chosen for radiolabelling as a possible imaging agent. Direct labelling with {sup 99m}Tc via simultaneous reduction of the indigenous disulfide bond and {sup 99m}TcO{sub 4}{sup -} (VII) with the water soluble phenyl phosphine (TPPDS) was performed. The radiolabelled peptide was not suitable for use as a radiopharmaceutical due to the heterogeneity of the product as observed by reverse phase HPLC and due to poor binding to the human breast cancer cell line MCF7. The electospray MS suggested a {sup 99}Tc-TPPDS (III) core instead of the expected {sup 99}Tc=O (V) core. Normal sCt has 3 conjugatible primary amines leading to a mixture of 8 possible products. A sCt analogue (sCtA) with a single primary amine was produced and conjugated to the chelator TETA to produce a single conjugated species. The sCtA-TETA was labelled with cold Cu and characterised by electospray MS. The monodentate ligand Hynic was synthesised directly into the peptide using N-{alpha}-Fmoc-N-{epsilon}-(Hynic-Boc)-Lys a novel orthogonally protected amino acid. The peptide was labelled with {sup 99m}Tc with tricine coligands. The radiolabelled peptide produced a single peak as observed by reverse phase HPLC and bound to MCF7 cell in a specific manner. The electospray MS suggested that one of the tricine coligands is lost due to the heating effect and possibly replaced by an adjacent histidine acting as a ternary ligand. The sCtLys{sup 18}-Hynic{sup 99m}Tc(tricine){sub 2} labelled peptide is the lead radiolabelled peptide and could be used for a normal biodistribution animal study, followed by clinical evaluation in humans. (author)

  9. Hashimoto's Disease

    Science.gov (United States)

    ... is Hashimoto’s disease? Hashimoto’s disease, also called chronic lymphocytic thyroiditis or autoimmune thyroiditis, is an autoimmune disease. An ... Points to Remember • Hashimoto’s disease, also called chronic lymphocytic thyroiditis or autoimmune thyroiditis, is an autoimmune disease. • Hashimoto’s ...

  10. Kawasaki Disease

    Science.gov (United States)

    Kawasaki disease is a rare childhood disease. It makes the walls of the blood vessels in the ... veins, and capillaries. No one knows what causes Kawasaki disease. Symptoms include High fever that lasts longer ...

  11. Alzheimer Disease

    Science.gov (United States)

    ... CPR: A Real Lifesaver Kids Talk About: Coaches Alzheimer Disease KidsHealth > For Kids > Alzheimer Disease Print A A ... slow it down. When Someone You Love Has Alzheimer Disease You might feel sad or angry — or both — ...

  12. Crohn's Disease

    Science.gov (United States)

    Crohn's disease causes inflammation of the digestive system. It is one of a group of diseases called inflammatory ... small intestine called the ileum. The cause of Crohn's disease is unknown. It may be due to an ...

  13. Crohn disease

    Science.gov (United States)

    ... from doing your everyday activities. You have side effects from medicines you are taking for your condition. Alternative Names Crohn's disease; Inflammatory bowel disease - Crohn's disease; Regional enteritis; Ileitis; ...

  14. Meniere's Disease

    Science.gov (United States)

    ... Meniere's disease can affect your social life, your productivity and the overall quality of your life. Learn ... www.mayoclinic.org/diseases-conditions/menieres-disease/basics/definition/CON-20028251 . Mayo Clinic Footer Legal Conditions and ...

  15. Kawasaki disease

    Science.gov (United States)

    ... lymph node syndrome; Infantile polyarteritis Images Kawasaki's disease - edema of the hand Kawasaki's disease, peeling of the fingertips References Dominguez SR, Anderson MS. Advances in the treatment of Kawasaki disease. Curr Opin Pediatr . 2013;25( ...

  16. Gaucher's Disease

    Science.gov (United States)

    ... of developing the most common variety of Gaucher's disease. Gaucher's disease may increase the risk of: Growth delays ... illness can be difficult, but having a rare disease like Gaucher's may be even harder. Few people know about ...

  17. Huntington's Disease

    Science.gov (United States)

    Huntington's disease (HD) is an inherited disease that causes certain nerve cells in the brain to waste ... express emotions. If one of your parents has Huntington's disease, you have a 50 percent chance of ...

  18. Sever's Disease

    Science.gov (United States)

    ... take place on hard surfaces, such as track, basketball, soccer, and gymnastics. Sever's disease also can result ... diagnosing Sever's disease, some doctors order them to rule out other problems, such as fractures. Sever's disease ...

  19. Celiac Disease

    Science.gov (United States)

    ... digestive problems called inflammatory bowel disease (IBD) or lactose intolerance . And in some cases, a kid won't ... for Kids With Celiac Disease Inflammatory Bowel Disease Lactose Intolerance Are Your Bowels Moving? Indigestion Nut and Peanut ...

  20. Ribbing disease

    Directory of Open Access Journals (Sweden)

    Mukkada Philson

    2010-01-01

    Full Text Available Ribbing disease is a rare sclerosing dysplasia that involves long tubular bones, especially the tibia and femur. It occurs after puberty and is reported to be more common in women. In this article we describe how Ribbing disease can be differentiated from diseases like Engelmann-Camurati disease, van Buchem disease, Erdheim-Chester disease, osteoid osteoma, chronic osteomyelitis, stress fracture, etc.

  1. Bladder Diseases

    Science.gov (United States)

    ... frequent, urgent urination Bladder cancer Doctors diagnose bladder diseases using different tests. These include urine tests, x- ... National Institute of Diabetes and Digestive and Kidney Diseases

  2. ALP (Alkaline Phosphatase) Test

    Science.gov (United States)

    ... Paget's disease or other bone conditions, such as vitamin D deficiency. If ALP results are increased but ... be seen temporarily after blood transfusions or heart bypass surgery. A deficiency in zinc may cause decreased ...

  3. NIHSeniorHealth

    Medline Plus

    Full Text Available ... ago CC 5:03 Play next Play now Eating for Your Health - Duration: 5 minutes, 3 seconds. ... next Play now One Man's Experience with Paget's Disease of Bone - Duration: 3 minutes, 59 seconds. 5, ...

  4. NIHSeniorHealth

    Medline Plus

    Full Text Available ... CC 5:32 Play next Play now My Experience with Shingles - Duration: 5 minutes, 32 seconds. 7, ... 3:59 Play next Play now One Man's Experience with Paget's Disease of Bone - Duration: 3 minutes, ...

  5. Optical Biopsy of Human Skin in Conjunction With Laser Treatment

    Science.gov (United States)

    2017-02-08

    Malignant Melanoma; Merkel Cell Carcinoma; Basal Cell Carcinoma; Squamous Cell Carcinoma; Atypical Nevi; Congenital Nevi; Seborrheic Keratosis; Paget's Disease; Dermatofibroma; Kaposi's Sarcoma; Port Wine Stain; Hemangioma; Tattoos; Scleroderma; Burns

  6. Treatment of traumatic conditions of the femur using the Huckstep nail

    African Journals Online (AJOL)

    Key words: Huckstep, intramedullary nail, femoral fracture. The Huckstep ... largely superseded the Huckstep nail, it remains useful for ... Of the 7 patients with malunion or non-union is in1 ... pathological fractures were due to Paget's disease'.

  7. Cutaneous hamartoma with pagetoid cells.

    Science.gov (United States)

    Piérard-Franchimont, C; Dosal, F L; Estrada, J A; Piérard, G E

    1991-04-01

    We report an unusual cutaneous hamartoma with pagetoid cells characterized by the presence of intraepidermal cells resembling Toker's cells of the nipple. These cells were EMA positive and could be related to the histogenesis of some Paget's disease.

  8. Bisphosphonate effects in cancer and inflammatory diseases: in vitro and in vivo modulation of cytokine activities.

    Science.gov (United States)

    Santini, Daniele; Fratto, Maria E; Vincenzi, Bruno; La Cesa, Annalisa; Dianzani, Caterina; Tonini, Giuseppe

    2004-01-01

    Bisphosphonates are endogenous pyrophosphate analogs in which a carbon atom replaces the central atom of oxygen. They are indicated in non-neoplastic diseases including osteoporosis, corticosteroid-induced bone loss, Paget disease, and in cancer-related diseases such as neoplastic hypercalcemia, multiple myeloma and bone metastases secondary to breast and prostate cancer. There is now extensive in vitro evidence suggesting a direct antitumor effect of bisphosphonates at different levels of action. Some new in vitro and in vivo studies support the cytostatic effects of bisphosphonates on tumor cells, and the effects on the regulation of cell growth, apoptosis, angiogenesis, cell adhesion, and invasion, with particular attention to biological properties. Well designed clinical trials are necessary to investigate whether the antitumor potential of bisphosphonates may be clinically relevant. On the basis of their effects on macrophages, we may divide bisphosphonates into two distinct categories: aminobisphosphonates, which sensitize macrophages to an inflammatory stimulus inducing an acute-phase response, and non-aminobisphosphonates that can be metabolized into macrophages and that may inhibit the inflammatory response of macrophages. There is evidence of aminobisphosphonate-induced pro-inflammatory response, in particular, related to modifications of the cytokine network. Several in vivo studies have demonstrated an acute-phase reaction after the first administration of aminobisphosphonates, with a significant increase in the main pro-inflammatory cytokines. However, a peculiar aspect concerning the action of non-aminobisphosphonates seems to be an anti-inflammatory activity caused by the inhibition of the release of inflammatory mediators from activated macrophages, such as interleukin (IL)-6, tumor necrosis factor-alpha and IL-1. The inhibition of inflammatory responses is demonstrated in both in vivo and in vitro models. This activity suggests the use of non

  9. Fifth Disease

    Science.gov (United States)

    ... roseola. Fifth disease is sometimes called “slapped cheek disease.” The illness’s bright red rash on the face looks like ... disease Most children and adults who get fifth disease experience only mild illness. They recover completely and have no complications. But ...

  10. Heart Diseases

    Science.gov (United States)

    ... you're like most people, you think that heart disease is a problem for others. But heart disease is the number one killer in the U.S. ... of disability. There are many different forms of heart disease. The most common cause of heart disease is ...

  11. Whipple's Disease

    Science.gov (United States)

    ... more common conditions with similar symptoms, including inflammatory rheumatic disease—characterized by inflammation and loss of function in ... Management Liver Disease Urologic Diseases Endocrine Diseases Diet & Nutrition Blood Diseases Diagnostic Tests La información de la salud en ...

  12. Addison disease

    Science.gov (United States)

    ... amounts of some or all of its hormones ( hypopituitarism ) Autoimmune disorder that affects the nerves and the ... disease) Dermatitis herpetiformis Diabetes Graves disease Hyperthyroidism Hypoparathyroidism Hypopituitarism Immune response Myasthenia gravis Ovarian hypofunction Pernicious anemia ...

  13. Fifth disease

    Science.gov (United States)

    Parvovirus B19; Erythema infectiosum; Slapped cheek rash ... Fifth disease is caused by human parvovirus B19. It often affects preschoolers or school-age children during the spring. The disease spreads through the fluids in the nose and ...

  14. Rh Disease

    Science.gov (United States)

    ... Loss > Birth defects & other health conditions > Rh disease Rh disease E-mail to a friend Please fill ... Rh-negative with a blood test. What is Rh factor? Rh factor is a protein that’s found ...

  15. Binswanger's Disease

    Science.gov (United States)

    ... Craniosynostosis Information Page Creutzfeldt-Jakob Disease Information Page Cushing's Syndrome Information Page Dandy-Walker Syndrome Information Page Deep Brain Stimulation for Parkinson's Disease Information Page Dementia Information ...

  16. Batten Disease

    Science.gov (United States)

    ... Craniosynostosis Information Page Creutzfeldt-Jakob Disease Information Page Cushing's Syndrome Information Page Dandy-Walker Syndrome Information Page Deep Brain Stimulation for Parkinson's Disease Information Page Dementia Information ...

  17. Behcet's Disease

    Science.gov (United States)

    ... Craniosynostosis Information Page Creutzfeldt-Jakob Disease Information Page Cushing's Syndrome Information Page Dandy-Walker Syndrome Information Page Deep Brain Stimulation for Parkinson's Disease Information Page Dementia Information ...

  18. Krabbe Disease

    Science.gov (United States)

    ... Craniosynostosis Information Page Creutzfeldt-Jakob Disease Information Page Cushing's Syndrome Information Page Dandy-Walker Syndrome Information Page Deep Brain Stimulation for Parkinson's Disease Information Page Dementia Information ...

  19. Crohn's Disease

    Science.gov (United States)

    ... prognosis of Crohn's disease in adults. http://www.uptodate.com/home. Accessed June 2, 2014. Smoking and ... cancer surveillance in inflammatory bowel disease. http://www.uptodate.com/home. Accessed June 9, 2014. Inflammatory bowel ...

  20. Addison Disease

    Science.gov (United States)

    ... your blood pressure and water and salt balance. Addison disease happens if the adrenal glands don't make ... A problem with your immune system usually causes Addison disease. The immune system mistakenly attacks your own tissues, ...

  1. Liver Diseases

    Science.gov (United States)

    Your liver is the largest organ inside your body. It helps your body digest food, store energy, and remove poisons. There are many kinds of liver diseases: Diseases caused by viruses, such as hepatitis ...

  2. Valve Disease

    Science.gov (United States)

    ... heart valves, valve insufficiency, valve regurgitation, valve stenosis, valvular heart disease Every time your heart beats, blood flows into, ... removed from the market after being linked to heart valve disease. An infection in the lining of the heart's ...

  3. Wilson Disease

    Science.gov (United States)

    Wilson disease is a rare inherited disorder that prevents your body from getting rid of extra copper. You ... extra copper into bile, a digestive fluid. With Wilson disease, the copper builds up in your liver, and ...

  4. Gaucher disease

    Science.gov (United States)

    ... doesn't have the disease is called a silent carrier. The lack of the glucocerebrosidase enzyme causes ... liver Fatigue Heart valve problems Lung disease (rare) Seizures Severe swelling at birth Skin changes

  5. Legionnaire disease

    Science.gov (United States)

    ... features on this page, please enable JavaScript. Legionnaire disease is an infection of the lungs and airways. It is caused by Legionella bacteria. Causes The bacteria that cause Legionnaire disease have ...

  6. Parkinson's Disease

    Science.gov (United States)

    ... messages it needs to move normally. continue What Causes Parkinson's Disease? Experts agree that low dopamine levels in ... or other chemicals. No one knows the exact cause of Parkinson's disease, but we do know that it has ...

  7. Fabry Disease

    Science.gov (United States)

    ... Foundation National Organization for Rare Disorders (NORD) National Tay-Sachs and Allied Diseases Association See all related ... Foundation National Organization for Rare Disorders (NORD) National Tay-Sachs and Allied Diseases Association See all related ...

  8. Canavan Disease

    Science.gov (United States)

    ... Foundation, Inc. Canavan Research Foundation Genetic Alliance National Tay-Sachs and Allied Diseases Association See all related ... Foundation, Inc. Canavan Research Foundation Genetic Alliance National Tay-Sachs and Allied Diseases Association See all related ...

  9. Digestive Diseases

    Science.gov (United States)

    ... Celiac Disease Bowel Control Problems (Fecal Incontinence) Gas Lactose Intolerance Diarrhea Diverticulosis & Diverticulitis Acid Reflux (GER & GERD) More Digestive Disease Topics Children and Teens Acid Reflux (GER & GERD) in Infants Acid Reflux (GER & GERD) in Children & Teens Chronic ...

  10. Gaucher Disease

    Science.gov (United States)

    Gaucher disease is a rare, inherited disorder. It is a type of lipid metabolism disorder. If you have ... affected. It usually starts in childhood or adolescence. Gaucher disease has no cure. Treatment options for types 1 ...

  11. Liver disease

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000205.htm Liver disease To use the sharing features on this page, please enable JavaScript. The term "liver disease" applies to many conditions that stop the ...

  12. Wilson Disease

    Science.gov (United States)

    ... in copper, such as –shellfish –liver –mushrooms –nuts –chocolate • A person cannot prevent Wilson disease; however, people with a family history of Wilson disease, especially those with an affected ...

  13. Chagas Disease

    Science.gov (United States)

    Chagas disease is caused by a parasite. It is common in Latin America but not in the United ... There are no vaccines or medicines to prevent Chagas disease. If you travel to areas where it occurs, ...

  14. Legionnaires' Disease

    Science.gov (United States)

    ... Disease Sources Investigation Protocol Outbreak Response What is Legionella? Exposure and Transmission Disease Symptoms Incidence and Risk ... form of pneumonia. More than 43 species of Legionella have been identified and more than 20 linked ...

  15. Heart Disease

    Science.gov (United States)

    ... daily aspirin to prevent heart attack? Does taking birth control pills increase my risk for heart disease? Does using ... tells you to. Return to top Does taking birth control pills increase my risk for heart disease? Taking birth ...

  16. Liver Disease

    Science.gov (United States)

    ... stay still. Liver disease has many causes. Infection Parasites and viruses can infect the liver, causing inflammation ... beyond. National Institute of Diabetes and Digestive and Kidney Diseases. http://digestive.niddk.nih.gov/ddiseases/pubs/ ...

  17. Kidney Diseases

    Science.gov (United States)

    ... until you go to the bathroom. Most kidney diseases attack the nephrons. This damage may leave kidneys ... medicines. You have a higher risk of kidney disease if you have diabetes, high blood pressure, or ...

  18. Eye Diseases

    Science.gov (United States)

    ... the back of the eye Macular degeneration - a disease that destroys sharp, central vision Diabetic eye problems ... defense is to have regular checkups, because eye diseases do not always have symptoms. Early detection and ...

  19. Parasitic Diseases

    Science.gov (United States)

    ... water, a bug bite, or sexual contact. Some parasitic diseases are easily treated and some are not. Parasites ... can be seen with the naked eye. Some parasitic diseases occur in the United States. Contaminated water supplies ...

  20. Kawasaki Disease

    Science.gov (United States)

    ... Life7. Questions8. Resources What is Kawasaki disease? Kawasaki disease is a rare illness. It can occur in infants and children younger ... may have diarrhea, vomiting, and stomach pain. Kawasaki disease might make your child irritable. The illness can last for a few weeks. What causes ...

  1. Lyme Disease.

    Science.gov (United States)

    Taylor, George C.

    1991-01-01

    This overview of the public health significance of Lyme disease includes the microbiological specifics of the infectious spirochete, the entomology and ecology of the ticks which are the primary disease carrier, the clinical aspects and treatment stages, the known epidemiological patterns, and strategies for disease control and for expanded public…

  2. [Gaucher Disease].

    Science.gov (United States)

    Okuyama, Torayuki

    2015-09-01

    Gaucher disease is an autosomal recessive disorder caused by congenital deficiency of lysosomal glucocerebrosidase. Gaucher disease is classified into three types. In addition to enzyme replacement therapy, substrate reduction therapy, chemical chaperon therapy, and hematopoietic stem cell transplantation therapy are considered for the effective treatment of Gaucher disease.

  3. Menetrier's Disease

    Science.gov (United States)

    ... producing cells in the stomach, which decreases stomach acid. Ménétrier’s disease is also called Ménétrier disease or hypoproteinemic hypertrophic ... Alternate Versions PDF Version (102 KB) Additional Links Peptic Ulcer Disease Upper GI Endoscopy This content is provided as ...

  4. Glomerular Diseases

    Science.gov (United States)

    ... Disease Mineral & Bone Disorder Diabetes Inspidus Glomerular Diseases Goodpasture Syndrome Henoch-Schönlein Purpura IgA Nephropathy Kidney Disease in ... effective as cyclophosphamide and has milder side effects. Goodpasture's Syndrome involves an autoantibody that specifically targets the kidneys ...

  5. A retrospective analysis of real-life practice of off-label photodynamic therapy using methyl aminolevulinate (MAL-PDT) in 20 Italian dermatology departments. Part 2: oncologic and infectious indications.

    Science.gov (United States)

    Calzavara-Pinton, Pier Giacomo; Rossi, Maria Teresa; Sala, Raffaella

    2013-01-01

    Photodynamic therapy (PDT) with methyl aminolevulinate (MAL) has been suggested as a useful treatment option in a number of skin tumors, other than approved indications, and infections. However, evidence is poor because it is mainly supported by isolated case reports or small case series, often with conflicting results. To assess the effectiveness, tolerability and safety of off-label MAL-PDT in daily clinical practice in 20 Italian hospitals, a retrospective observational study of medical records of patients treated for off-label oncologic and infectious skin conditions was carried out. In all patients standard treatment options had been either ineffective, unacceptably toxic, or medically contraindicated. Clinical data from 145 patients were analyzed. Actinic cheilitis showed a complete remission (CR) in 27 out of 43 treated patients and CR was maintained at follow-up. CR was registered in 3 of 8, 5 of 8 and 10 of 17 treated patients who were affected by extra-mammary Paget's disease (EMPD), erythroplasia of Queyrat (QD), and invasive squamous cell carcinoma (SCC), respectively. Five out of 19 patients with cutaneous T cell lymphoma had a complete remission. Cutaneous B-cell lymphoma, malignant fibrous histiocytoma, mastocytosis and nevus sebaceous were not responsive. Warts were treated in 30 patients and 15 had a complete remission. However, periungueal and plantar lesions were much more responsive than flat and common lesions. Condylomata showed a CR in 2 out of 5 male patients but treatment was painful. Bowenoid papulosis showed only a partial improvement. Atypical mycobacteriosis and chronic cutaneous leishmaniasis were successfully treated. Submammary candidal intertrigo and interdigital intertrigo with Pseudomonas aeruginosa did not improve. Among off-label oncological uses of MAL-PDT, the therapy of actinic cheilitis was the most investigated and showed the best results. In addition, MAL-PDT was used successfully in the majority of patients with QD, EMPD

  6. Carcinoma apócrino na glândula parótida e na região submandibular Apocrine carcinoma in the parotid gland and in the submandibular region

    Directory of Open Access Journals (Sweden)

    Jairo S. Francisco

    2005-04-01

    Full Text Available Os objetivos deste trabalho consistem na apresentação de um caso de carcinoma apócrino e na discussão de aspectos relacionados ao seu diagnóstico, tratamento e prognóstico. Os carcinomas com diferenciação apócrina que não correspondem aos casos de doença extramamária de Paget, de carcinoma ductal de mama, de adenocarcinoma das glândulas de Moll e de carcinoma ceruminal são tumores muito raros. Relatamos o caso de uma paciente do sexo feminino, negra, com 51 anos, na qual duas lesões de carcinoma apócrino acometeram a parótida esquerda (processo inicial e recidiva e uma lesão envolveu a pele da região submandibular do mesmo lado. O exame histopatológico destas lesões mostrou a presença de neoplasia epitelial glandular infiltrativa com pleomorfismo celular e nuclear moderados; apresentando células poligonais ou arredondadas, com núcleos grandes e citoplasma eosinofílico e granular. Destacou-se a presença de secreção por decapitação apical na maior parte das células tumorais voltadas para a luz das estruturas císticas neoplásicas. Adicionalmente, foi encontrada a presença de focos de comedo-necrose e de material corado pelo PAS com e sem diastase. Apesar de não podermos definir com certeza qual a sede do tumor primário, com base nos aspectos histopatológicos compatíveis com o carcinoma apócrino cutâneo, consideramos que tenha sido, provavelmente, a lesão retirada da pele da região submandibular. A paciente foi submetida a tratamentos cirúrgicos e não apresentou alterações após um ano de acompanhamento, depois da retirada do tumor recidivante na parótida.The objectives of this paper are to report a case of apocrine carcinoma and the discussion of aspects related to its diagnosis, treatment, and prognosis. Carcinomas with apocrine differentiation not related to extramammary Paget's disease, ductal breast carcinoma, Moll's glands adenocarcinoma and ceruminous glands carcinoma are very uncommon tumors. We

  7. Morgellons Disease

    OpenAIRE

    Ohn, Jungyoon; Park, Seon Yong; Moon, Jungyoon; Choe, Yun Seon; Kim, Kyu Han

    2017-01-01

    Morgellons disease is a rare disease with unknown etiology. Herein, we report the first case of Morgellons disease in Korea. A 30-year-old woman presented with a 2-month history of pruritic erythematous patches and erosions on the arms, hands, and chin. She insisted that she had fiber-like materials under her skin, which she had observed through a magnifying device. We performed skin biopsy, and observed a fiber extruding from the dermal side of the specimen. Histopathological examination sho...

  8. Celiac Disease

    Directory of Open Access Journals (Sweden)

    Hero Brokalaki

    2008-07-01

    Full Text Available Celiac disease is a small intestine disease caused by the immunological response to gluten, a component of wheat, rye and barley. The worldwide prevalence of celiac disease ranges between 0.2% and 2.2 %. The clinical features of celiac disease includes diarrhea, steatorrhea, flatulence, abdominal pain and weight loss. The asymptomatic type of celiac disease is characterized by soft or normally shaped stool, weakness, lassitude and moderate weight loss. In children, celiac disease usually arises between the first and the third year of age, with diarrhea, flatulence and low weight. The malabsorption in small intestine causes many extaintestinal manifestations, such us anemia, bone abnormalities, hemorrhage and neuropathy. Celiac disease is diagnosed by histological examination of tissue samples taken by duodenum due gastroscopy and by the detection of certain antibodies in blood (anti-GL-IgG, anti-GL-IgA, ΕΜΑ-IgA και anti-tTg-IgA. The only therapeutic approach to celiac disease is a gluten-free diet and, if it is necessary, the administration of iron, folic acid, calcium and vitamins (K, B12. The prognosis of celiac disease is excellent, if there is an early diagnosis and the patient keeps for life a gluten free diet.

  9. Celiac disease

    Directory of Open Access Journals (Sweden)

    Holtmeier Wolfgang

    2006-03-01

    Full Text Available Abstract Celiac disease is a chronic intestinal disease caused by intolerance to gluten. It is characterized by immune-mediated enteropathy, associated with maldigestion and malabsorption of most nutrients and vitamins. In predisposed individuals, the ingestion of gluten-containing food such as wheat and rye induces a flat jejunal mucosa with infiltration of lymphocytes. The main symptoms are: stomach pain, gas, and bloating, diarrhea, weight loss, anemia, edema, bone or joint pain. Prevalence for clinically overt celiac disease varies from 1:270 in Finland to 1:5000 in North America. Since celiac disease can be asymptomatic, most subjects are not diagnosed or they can present with atypical symptoms. Furthermore, severe inflammation of the small bowel can be present without any gastrointestinal symptoms. The diagnosis should be made early since celiac disease causes growth retardation in untreated children and atypical symptoms like infertility or neurological symptoms. Diagnosis requires endoscopy with jejunal biopsy. In addition, tissue-transglutaminase antibodies are important to confirm the diagnosis since there are other diseases which can mimic celiac disease. The exact cause of celiac disease is unknown but is thought to be primarily immune mediated (tissue-transglutaminase autoantigen; often the disease is inherited. Management consists in life long withdrawal of dietary gluten, which leads to significant clinical and histological improvement. However, complete normalization of histology can take years.

  10. Leigh's Disease

    Science.gov (United States)

    ... Related Dementias Bioengineering Epilepsy Health Disparities Neural Interfaces Parkinson's Disease Spinal Cord Injury Stem Cells Traumatic Brain Injury Trans-Agency Activities Interagency Research ...

  11. Celiac disease

    Directory of Open Access Journals (Sweden)

    Radlović Nedeljko

    2013-01-01

    Full Text Available Celiac disease is a multysystemic autoimmune disease induced by gluten in wheat, barley and rye. It is characterized by polygenic predisposition, high prevalence (1%, widely heterogeneous expression and frequent association with other autoimmune diseases, selective deficit of IgA and Down, Turner and Williams syndrome. The basis of the disease and the key finding in its diagnostics is symptomatic or asymptomatic inflammation of the small intestinal mucosa which resolves by gluten-free diet. Therefore, the basis of the treatment involves elimination diet, so that the disorder, if timely recognized and adequately treated, also characterizes excellent prognosis.

  12. Is "Parkinson's disease" one disease?

    OpenAIRE

    Calne, D B

    1989-01-01

    Consideration is given to how and why categories of ill health are divided into diseases. Aetiology is a fundamental criterion for the delineation of individual diseases. The same clinical and pathological picture may have many different causes; for example meningococcal meningitis and pneumococcal meningitis are distinct diseases that may display the same symptoms and signs. On the other hand, a single aetiology may lead to quite separate clinical and pathological phenomena; for example, neu...

  13. Endocrine Diseases

    Science.gov (United States)

    ... high or too low, you may have an endocrine disease or disorder. Endocrine diseases and disorders also occur if your body does not respond to hormones the way it is supposed to. Featured Topics Adrenal Insufficiency ... Topics Research Discoveries & News Children with Cushing ...

  14. Batten Disease

    Science.gov (United States)

    ... children with Batten disease who were treated with vitamins C and E and with diets low in vitamin A. However, these treatments did not prevent the ... Complications of AIDS Information Page Neurological Complications of Lyme Disease ... Page Neuromyelitis Optica Information Page Neuronal Migration ...

  15. Myocardial disease

    Institute of Scientific and Technical Information of China (English)

    1997-01-01

    970309 Myocardial injury of Keshan disease andapoptosis. ZHONG Xuekuan(钟学宽), et al. KeshanDis Instit, Harbin Med Univ, Harbin, 150086. Chin JEndemiol 1997, 16(2): 81-82. Objective: To discuss the relationship between my-ocardial injury Of Keshan disease and apoptosis. Meth-

  16. Wilson Disease

    Science.gov (United States)

    ... individuals with WD is liver disease, appearing in late childhood or early adolescence as acute hepatitis, liver failure, or progressive chronic ... individuals with WD is liver disease, appearing in late childhood or early adolescence as acute hepatitis, liver failure, or progressive chronic ...

  17. Kidney Disease

    Science.gov (United States)

    ... version of this page please turn Javascript on. Kidney Disease What is Kidney Disease? What the Kidneys Do Click for more information You have two ... damaged, wastes can build up in the body. Kidney Function and Aging Kidney function may be reduced ...

  18. Hartnup disease

    Directory of Open Access Journals (Sweden)

    Jerajani Hemangi

    1994-01-01

    Full Text Available A rare case of Hartnup disease is presented - the patient being an 11 year old school girl suffering from a typically pellagroid rash in the absence of any other signs of malnutrition. No accompanying neurological or psychiatric features are seen, but electro-encephalography revealed abnormal baseline activity. Investigations and management are detailed and the literature on Hartnup disease reviewed.

  19. Disease Lab

    OpenAIRE

    Powell, Jim; Lewis, Matt

    2016-01-01

    Students use transparencies and dry erase markers to simulate the spread of a zombie virus among a fixed population. Students are then challenged to create their own "disease" and develop an ODE model for the resulting data. From this exercise students gain greater understanding of population and SIR models, disease dynamics, parameter estimation and compartment modeling.

  20. Alzheimer's Disease

    Science.gov (United States)

    ... to note that Alzheimer's disease is not a normal part of aging. What Is Alzheimer's Disease? Video length: 2 min 29 sec Click to watch this video The course of Alzheimer’s disease—which symptoms appear and how quickly changes occur—varies from person to person. The time ...

  1. Facioscapulohumeral disease

    NARCIS (Netherlands)

    Padberg, George Waltherus Adrianus Maria

    1982-01-01

    The purpose of this study is to discuss several aspects of facioscapulohumeral disease, also called "autosomal dominant facioscapulohumeral muscular dystrophy" or "Landouzy-Dejerine type of muscular dystrophy" or "Landouzy-Dejerine' s disease" . We consider this disorder well defined and

  2. Whipple Disease

    Science.gov (United States)

    ... more common conditions with similar symptoms, including • inflammatory rheumatic disease— characterized by inflammation and loss of function in ... way to prevent Whipple disease. Eating, Diet, and Nutrition A person with Whipple disease and malabsorption may need • a diet high in ...

  3. Krabbe Disease

    Science.gov (United States)

    ... books/NBK1238/. Accessed Feb. 28, 2014. Krabbe disease. Genetics Home Reference. http://ghr.nlm.nih.gov/condition/krabbe-disease. Accessed Feb, 28. 2014. Ropper AH, et al. Adams & Victor's Principles of Neurology. 9th ed. New York, N.Y.: ...

  4. Periodontal Disease and Systemic Health

    Science.gov (United States)

    ... Gum Disease and Other Diseases Gum Disease and Diabetes Gum Disease and Heart Disease Gum Disease and Other Systemic ... Gum Disease and Other Diseases Gum Disease and Diabetes Gum Disease and Heart Disease Gum Disease and Other Systemic ...

  5. Vascular Disease Foundation

    Science.gov (United States)

    ... Contact Us Vascular Disease What is Vascular Disease? Education and Awareness Vascular Diseases Abdominal Aortic Aneurysm Aortic Dissection Arteriovenous Malformation Atherosclerosis Buerger's Disease Carotid Artery Disease ...

  6. What Is Vascular Disease?

    Science.gov (United States)

    ... Contact Us Vascular Disease What is Vascular Disease? Education and Awareness Vascular Diseases Abdominal Aortic Aneurysm Aortic Dissection Arteriovenous Malformation Atherosclerosis Buerger's Disease Carotid Artery Disease ...

  7. Celiac Disease

    Directory of Open Access Journals (Sweden)

    Manoochehr Karjoo

    2014-08-01

    Full Text Available Celiac disease also known as gluten-sensitive enteropathy is characterized by intestinal mucosal damage and malabsorption from dietary intake of wheat, rye or barley. Symptoms may appear with introduction of cereal in the first 3 years of life. A second peak in symptoms occurs in adults during the third or forth decade and even as late as eight decade of life. The prevalence of this disease is approximately 1 in 250 adults. The disease is more prevalent in Ireland as high as 1 in 120 adults. The disorder occurs in Arab, Hispanics, Israeli Jews, Iranian and European but is rare in Chinese and African American. To have celiac disease the patient should have the celiac disease genetic markers as HLA DQ 2 and HLA DQ 8. Patient with celiac disease may have 95 per cent for DQ 2 and the rest is by DQ 8. Someone may have the genetic marker and never develops the disease. In general 50 percent with markers may develop celiac disease. To develop the disease the gene needs to become activated. This may happen with a viral or bacterial infection, a surgery, delivery, accident, or psychological stress. After activation of gene cause the tight junction to opens with the release of Zonulin This results in passage of gluten through the tight junction and formation of multiple antibodies and autoimmune disease. This also allows entrance of other proteins and development of multiple food allergies. As a result is shortening, flattening of intestinal villi resulting in food, vitamins and minerals malabsorption.

  8. Pompe's disease.

    Science.gov (United States)

    van der Ploeg, Ans T; Reuser, Arnold J J

    2008-10-11

    Pompe's disease, glycogen-storage disease type II, and acid maltase deficiency are alternative names for the same metabolic disorder. It is a pan-ethnic autosomal recessive trait characterised by acid alpha-glucosidase deficiency leading to lysosomal glycogen storage. Pompe's disease is also regarded as a muscular disorder, but the generalised storage of glycogen causes more than mobility and respiratory problems. The clinical spectrum is continuous and broad. First symptoms can present in infants, children, and adults. Cardiac hypertrophy is a key feature of classic infantile Pompe's disease. For a long time, there was no means to stop disease progression, but the approval of enzyme replacement therapy has substantially changed the prospects for patients. With this new development, the disease is now among the small but increasing number of lysosomal storage disorders, for which treatment has become a reality. This review is meant to raise general awareness, to present and discuss the latest insights in disease pathophysiology, and to draw attention to new developments about diagnosis and care. We also discuss the developments that led to the approval of enzyme replacement therapy with recombinant human alpha-glucosidase from Chinese hamster ovary cells (alglucosidase alfa) by the US Food and Drug Administration and European Medicines Agency in 2006, and review clinical practice.

  9. Refractory disease in autoimmune diseases

    NARCIS (Netherlands)

    Vasconcelos, Carlos; Kallenberg, Cees; Shoenfeld, Yehuda

    2011-01-01

    Refractory disease (RD) definition has different meanings but it is dynamic, according to knowledge and the availability of new drugs. It should be differentiated from severe disease and damage definitions and it must take into account duration of adequate therapy and compliance of the patient. It c

  10. Kummell disease.

    Science.gov (United States)

    Nickell, Larry T; Schucany, William G; Opatowsky, Michael J

    2013-07-01

    Kummell disease, or avascular necrosis of a vertebral body, presents as vertebral osteonecrosis typically affecting a thoracic vertebra with compression deformity, intravertebral vacuum cleft, and exaggerated kyphosis weeks to months after a minor traumatic injury. This rare disease is increasing in prevalence secondary to an aging population and the associated rise in osteoporosis. Treatment with vertebroplasty or surgical decompression and fusion is often required. We present a classic case of Kummell disease to illustrate the salient features of the condition, with associated imaging findings on computed tomography and magnetic resonance imaging.

  11. Crohn's disease.

    LENUS (Irish Health Repository)

    Shanahan, Fergus

    2012-02-03

    Crohn\\'s disease is a disorder mediated by T lymphocytes which arises in genetically susceptible individuals as a result of a breakdown in the regulatory constraints on mucosal immune responses to enteric bacteria. Regulation of immune reactivity to enteric antigens has improved understanding of the pathophysiological mechanisms of Crohn\\'s disease, and has expanded therapeutic options for patients with this disorder. Disease heterogeneity is probable, with various underlying defects associated with a similar pathophysiological outcome. Although most conventional drug treatments are directed at modification of host response, therapeutic manipulation of the enteric flora is becoming a realistic option.

  12. Fahr's Disease

    Directory of Open Access Journals (Sweden)

    Tezcan Caliskan

    2013-06-01

    Full Text Available Fahr's disease refers to sporadic or familial idiopathic basal ganglia, cerebral and cerebellar calcification. Patients may remain symptom-free but approximately two-thirds of the patients are symptomatic. Typical presentation starts in the 4th to 5th decades of life. Patients present with pyramidal, extrapyramidal, cerebellar, psychiatric and cognitive manifestations. Various diagnostic studies can be used to detect Fahr's disease and associated abnormalities. There is no specific treatment other than symptomatic support. In this review, clinical features and different types of presentations of Fahr's disease are discussed under the light of current literature. [J Contemp Med 2013; 3(2.000: 133-135

  13. [Fabry disease].

    Science.gov (United States)

    Boggio, Paula; Luna, Paula Carolina; Abad, María Eugenia; Larralde, Margarita

    2009-01-01

    Fabry disease is an uncommon, X-linked lysosomal storage disorder, caused by partial or complete deficiency of the enzyme a-galactosidase A. The defect leads to accumulation of uncleaved globotriaosylceramide on the vascular endothelium and visceral tissues, being the skin, heart, kidneys and central nervous system the most affected organs. We performed review of the literature related to the disease and emphasized that early recognition of angiokeratomas and hypohidrosis are key diagnostic signs of this serious disease. We also addressed the need of multidisciplinary assessment of these patients.

  14. Morgellons Disease.

    Science.gov (United States)

    Ohn, Jungyoon; Park, Seon Yong; Moon, Jungyoon; Choe, Yun Seon; Kim, Kyu Han

    2017-04-01

    Morgellons disease is a rare disease with unknown etiology. Herein, we report the first case of Morgellons disease in Korea. A 30-year-old woman presented with a 2-month history of pruritic erythematous patches and erosions on the arms, hands, and chin. She insisted that she had fiber-like materials under her skin, which she had observed through a magnifying device. We performed skin biopsy, and observed a fiber extruding from the dermal side of the specimen. Histopathological examination showed only mild lymphocytic infiltration, and failed to reveal evidence of any microorganism. The polymerase chain reaction for Borrelia burgdorferi was negative in her serum.

  15. Stargardt Disease

    Science.gov (United States)

    ... Resources Low Vision Specialists Retinal Physicians My Retina Tracker Registry Genetic Testing Clinical Trials Join the Fight ... of lipofuscin, a fatty byproduct of normal cell activity. In Stargardt disease, lipofuscin accumulates abnormally. The Foundation ...

  16. Pick disease

    Science.gov (United States)

    ... in behavior Failure to show emotional warmth, concern, empathy, sympathy Inappropriate mood Not caring about events or ... and steadily becomes worse. The person becomes totally disabled early in the course of the disease. Pick ...

  17. Vaginal Diseases

    Science.gov (United States)

    Vaginal problems are some of the most common reasons women go to the doctor. They may have ... that affect the vagina include sexually transmitted diseases, vaginal cancer, and vulvar cancer. Treatment of vaginal problems ...

  18. Legionnaires' Disease

    Science.gov (United States)

    Legionnaires' disease is a type of pneumonia caused by bacteria. You usually get it by breathing in mist from water that contains the bacteria. The mist may come from hot tubs, showers, or air-conditioning units for ...

  19. Infectious Diseases

    Science.gov (United States)

    ... people worldwide than any other single cause. Infectious diseases are caused by germs. Germs are tiny living things that are found everywhere - in air, soil and water. You can get infected by touching, eating, drinking ...

  20. Parkinson's Disease

    Science.gov (United States)

    ... sleep behavior disorder, which involves acting out your dreams. Medications may help your sleep problems. Bladder problems. ... will diagnose Parkinson's disease based on your medical history, a review of your signs and symptoms, and ...

  1. Gaucher Disease

    Science.gov (United States)

    ... Translational Research Research at NINDS Focus on Research Alzheimer's & Related Dementias Bioengineering Epilepsy Health Disparities Neural Interfaces Parkinson's Disease Spinal Cord Injury Stem Cells Traumatic Brain Injury Trans-Agency Activities Interagency Research ...

  2. Alexander Disease

    Science.gov (United States)

    ... Translational Research Research at NINDS Focus on Research Alzheimer's & Related Dementias Bioengineering Epilepsy Health Disparities Neural Interfaces Parkinson's Disease Spinal Cord Injury Stem Cells Traumatic Brain Injury Trans-Agency Activities Interagency Research ...

  3. Menkes Disease

    Science.gov (United States)

    ... Translational Research Research at NINDS Focus on Research Alzheimer's & Related Dementias Bioengineering Epilepsy Health Disparities Neural Interfaces Parkinson's Disease Spinal Cord Injury Stem Cells Traumatic Brain Injury Trans-Agency Activities Interagency Research ...

  4. Tickborne Diseases

    Science.gov (United States)

    ... of Award Clinical Terms of Award Restriction for China Clinical Terms Guidance Compliance Sample Letter Inclusion Codes ... Division of AIDS Division of Allergy, Immunology, and Transplantation Division of Microbiology and Infectious Diseases Division of ...

  5. Prion Diseases

    Science.gov (United States)

    ... of Award Clinical Terms of Award Restriction for China Clinical Terms Guidance Compliance Sample Letter Inclusion Codes ... Division of AIDS Division of Allergy, Immunology, and Transplantation Division of Microbiology and Infectious Diseases Division of ...

  6. [Prion diseases].

    Science.gov (United States)

    Zarranz, J J

    2006-10-01

    Prion diseases are one of the paradigms of modern neurological nosology founded on molecular grounds. Their incidence is low, however the public health challenges derived from their transmissibility, especially due to the appearance of a variant of Creutzfeldt-Jakob disease (vCJD) confers them a preferential place among health care authority concerns. The evolution of data from the European surveillance systems suggests a generalized underdiagnosis of prion diseases and casts doubts about their ability to detect a possible second wave of atypical vCJD, especially if their clinical-pathological characteristics change. Recent data also challenge the feasibility of a subclassification of prion diseases according to their genetic-molecular features

  7. Celiac Disease

    Science.gov (United States)

    ... gluten and to certain other proteins in the intestinal lining — a sign that the person could have celiac disease — then the doctor may order a biopsy of the small intestine to confirm the diagnosis. In the case of ...

  8. Autoinflammatory Diseases

    Science.gov (United States)

    ... disease. Colchicine – a medication also approved to treat gout (a form of arthritis) – has been used successfully as a treatment for FMF. Colchicine reduces inflammation throughout the body. ...

  9. Behcet's disease.

    Science.gov (United States)

    Nair, Jagdish R; Moots, Robert J

    2017-02-01

    Behçet's disease (BD) is a chronic relapsing and remitting vasculitis of unknown aetiology. It has the capacity to affect almost all organ systems because of its potential to involve both arteries and veins of all sizes, resulting in significant organ-threatening morbidity and mortality. Traditionally known as the 'silk road' disease, it has a worldwide occurrence. The aetiopathological mechanisms of disease development in BD remain poorly understood, but genome wide studies show human leukocyte antigen and non-human leukocyte antigen associations. Environmental influences and genetic factors may have a role in the aetiopathogenetic mechanisms that lead to development of the disease, indicating the autoimmune and auto-inflammatory nature of BD. The evidence base for treatment is limited but new knowledge is emerging and current treatment options range from symptomatic treatment, through to non-biological and biological immunosuppressive drugs, to cover the spectrum of clinical manifestations.

  10. Parkinson disease

    Science.gov (United States)

    ... control movement. Surgery to destroy brain tissue that causes Parkinson symptoms. Stem cell transplant and other procedures are ... in brain function and early death. Possible Complications Parkinson disease may cause problems such as: Difficulty performing daily activities Difficulty ...

  11. Heart Disease

    Science.gov (United States)

    ... Atherosclerosis is also the most common cause of cardiovascular disease. It can be caused by correctable problems, such as an unhealthy diet, lack of exercise, being overweight and smoking. Causes of heart arrhythmia ...

  12. Lyme Disease

    Science.gov (United States)

    ... can also spread to the nervous system, causing facial paralysis ( Bell_s_palsy ), or meningitis. The last stage of ... symptoms, joint pain or a swollen joint, or facial paralysis. Can I Prevent Lyme Disease? There's no surefire ...

  13. Endocrine Diseases

    Science.gov (United States)

    Your endocrine system includes eight major glands throughout your body. These glands make hormones. Hormones are chemical messengers. They ... levels. In the United States, the most common endocrine disease is diabetes. There are many others. They ...

  14. Hashimoto's Disease

    Science.gov (United States)

    ... use a combination of x rays and computer technology to create images. For a CT scan, a ... than men. Although the disease often occurs in adolescent or young women, it more commonly appears between ...

  15. Gum Disease

    Science.gov (United States)

    ... away from the teeth. This is known as periodontitis (pronounced: pair-ee-oh-don-TY-tus), a more advanced form of gum disease. With periodontitis, gums become weakened and form pockets around the ...

  16. Planning Diseases.

    Science.gov (United States)

    Gabel, Medard

    1984-01-01

    To solve societal problems, both local and global, a global approach is needed. Serious diseases that are crippling present-day problem solving and planning are discussed, and the characteristics of a healthy, effective planning approach are described. (RM)

  17. [Lyme disease].

    Science.gov (United States)

    Portillo, Aránzazu; Santibáñez, Sonia; Oteo, José A

    2014-02-01

    Lyme disease (LD) is a worldwide-distributed multisystemic process caused by Borrelia burgdorferi sensu lato (s.l.) and transmitted by hard ticks. In fact, it is the most common tick-borne infectious disease in the northern hemisphere. In Spain it is transmitted by Ixodes ricinus ticks and Borrelia garinii is the genoespecies of B. burgdorferi s.l. mostly involved in our area. LD is known as "the last great imitator" due to the broad clinical spectrum that may cause. Except in the case of erythema migrans (pathognomonic feature of the disease), the remaining clinical manifestations should be confirmed using microbiological tests. This review is intended to provide readers a current vision of the etiology, epidemiology, clinical manifestations, laboratory diagnosis and treatment of Lyme disease in our environment. Controversial aspects arising from the use of non-validated microbiological tests that are being used without scientific rigor are highlighted.

  18. Extrapyramidal disease

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    2008119 Therapeutic effect of neuropeptide PACAP27 on Parkinson′s disease in mice. WANG Gang(王刚), et al.Dept Neurol & Neurol Instit, Ruijin Hosp, Shanghai Jiaotong Univ, Med Sch, Shanghai 200025. Chin J Neurol 2007;40(12):837-841. Objective To investigate the effects of different doses of pituitary adenylate cyclase-activating polypeptide (PACAP) on the functional and morphological outcome in a mice model of Parkinson′s disease (PD) re

  19. Muscular disease

    Institute of Scientific and Technical Information of China (English)

    1993-01-01

    930186 The diagnostic value of MRI on neuro-muscular disease.CHEN Qingtang(陈清棠),etal.Dept Neurol,1st Hosp,Beijing Med Univ,100034.Chin J Neurol & Psychiat 1992;25(5):267-269.The article concentrated on the study ofskeletal muscles of four extremities in 12 casesof different kinds of neuromuscular diseases and4 volunteers with MRI.The results revealed:MRI could clearly display individual muscle,muscle groups or abnormal muscles morphologi-

  20. [Ledderhose's disease].

    Science.gov (United States)

    Bardelli, M; D'Arienzo, M; Veneziani, C

    1991-01-01

    The authors describe the clinical appearance of Ledderhose disease and emphasize the association with Dupuytren disease. They report on a series of patients treated at the 2nd Orthopedic Unit of University of Florence and describe the operating technique used. They believe that the procedure of removal of nodules must always be performed in association with careful exeresis of normal tissue, employing total aponeurectomy only in revision surgery.

  1. Bowel disease

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    2008069 The application of Montreal classification in inflammatory bowel disease. YANG Chuanhua(杨川华), et al. Renji Hosp, Shanghai Instit, Shanghai Jiaotong Univ Med Coll, Shanghai 200001. Chin J Intern Med 2008;47(1):7-10. Objective To investigate the clinical features of Crohn′s disease (CD) and ulcerative colitis (UC) according to the Montreal classification. Methods The clinical data of 110 cases of CD or UC were reviewed. The age at

  2. Extrapyramidal disease

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    2008486 Neuropsychiatric problems in patients with Parkinson’s disease. ZHOU Mingzhu(周明珠), et al. Dept Neurol, Xinhua Hosp Shanghai Jiaotong Univ, Sch Med, Shanghai 200092.Natl Med J China 2008;88(21):1442-1445. Objective To survey the prevalence and distribution of neuropsychiatric problems in patients with Parkinson’s disease (PD), and to investigate their effects on life quality and the interactions among different neuropsychiatric problems.

  3. Huntington's disease

    OpenAIRE

    Bates, G P; Dorsey, R.; Gusella, J F; Hayden, M. R.; Kay, C; Leavitt, B. R.; Nance, M; Ross, C A; Scahill, R. I.; Wetzel, R.; Wild, E. J.; Tabrizi, S.J.

    2015-01-01

    Huntington’s disease is devastating to patients and their families — with autosomal dominant inheritance, onset typically in the prime of adult life, progressive course and combination of motor, cognitive and behavioural features. The disease is caused by an expanded CAG trinucleotide repeat (of variable length) in HTT, the gene which encodes the protein huntingtin. In mutation carriers, huntingtin is produced with abnormally long polyglutamine sequences that confers toxic gains of function a...

  4. [Kawasaki's disease].

    Science.gov (United States)

    Cortes, J; Martínez, B; Montini, C; Barraza, P; Reyes, A

    1989-08-01

    We described a case of Kawasaki's disease in a chilean girl, one year and 5 months old of age, who presented the oral characteristics, cutaneous and systemic manifestation of the condition, that is not very common for the dentist but that it is necessary to know due to the heart complications and the mortality associated with the disease, and it is necessary that the dentist recognize early this condition.

  5. HIRAYAMA DISEASE

    Directory of Open Access Journals (Sweden)

    Shaik Sulaiman

    2016-05-01

    Full Text Available Hirayama’s disease, also known as Monomelic Amyotrophy (MMA, juvenile non-progressive amyotrophy, Sobue disease. It is rare and benign condition. It is a focal, lower motor neuron type of disorder, which occurs mainly in young males. Age of onset, it is first seen most commonly in people in their second and third decades. Geographically, it is seen most commonly in Asian countries like India and Japan. Cause of this disease is unknown in most cases. MRI of cervical spine in flexion is the investigation of choice, which will reveal the cardinal features of Hirayama disease. CASE REPORT 20 years old male came with the complaints of tremors of both hands more of right hand and weakness and wasting of right hand, which is slowly progressive for past 6 months. Lower limbs had no abnormality with normal deep tendon reflexes. On examination, there was wasting and weakness of hypothenar and interosseous muscles of right hand. MRI showed thinning of cord from C5 to C7 level. Proximal epidural fat and tiny flow voids with anterior migration of the posterior dural layer at C5-7 level on flexion MRI. Based on these features a diagnosis of focal amyotrophy was made. A cervical collar was prescribed and patient is under regular follow-up. CONCLUSION Hirayama disease is a rare self-limiting disease. Early diagnosis is necessary as the use of a simple cervical collar which will prevent neck flexion, has been shown to stop the progression.

  6. Learning about Crohn's Disease

    Science.gov (United States)

    ... genetic terms used on this page. Learning About Crohn's Disease What is Crohn's disease? What are the symptoms ... disease Additional Resources for Crohn's Disease What is Crohn's disease? Crohn's disease, an idiopathic (of unknown cause), chronic ...

  7. HIV and Rheumatic Disease

    Science.gov (United States)

    ... A Patient / Caregiver Diseases & Conditions HIV & Rheumatic Diseases HIV and Rheumatic Disease Fast Facts Rheumatic diseases related ... knows he or she has HIV. What are HIV-associated rheumatic diseases? Some diseases of the joints ...

  8. HIV and Rheumatic Disease

    Science.gov (United States)

    ... A Patient / Caregiver Diseases & Conditions HIV & Rheumatic Diseases HIV and Rheumatic Disease Fast Facts Rheumatic diseases related ... knows he or she has HIV. What are HIV-associated rheumatic diseases? Some diseases of the joints ...

  9. Niemann-Pick Disease

    Science.gov (United States)

    ... Disease] National Niemann-Pick Disease Foundation, Inc. National Tay-Sachs and Allied Diseases Association See all related ... Disease] National Niemann-Pick Disease Foundation, Inc. National Tay-Sachs and Allied Diseases Association See all related ...

  10. [Dupuytren disease].

    Science.gov (United States)

    Wagner, Pablo; Román, Javier A; Vergara, Jorge

    2012-09-01

    Dupuytren disease (DD) is a connective tissue disorder that consists in fibromatosis of the palmar and digital fascia (in form of nodules or flanges) that leads to the development of flexion contractures of the palm and fingers. The little and ring finger are particularly affected. The disease can limit hand function, reducing the quality of life. The disease can have a traumatic origin and is also associated with conditions such as diabetes mellitus, alcoholism, dyslipidemia, epilepsy and AIDS, among others. However, none of these conditions can fully explain the genesis of DD. A hereditary component is described in 40% of patients and is attributed to an autosomal dominant gene of variable penetrance, probably related to collagen synthesis. However there are also spontaneous and recessive inheritance cases. The diagnosis is clinical and based on physical examination. Treatment ranges from observation or use of injectable collagenase to the surgical option in cases with significant functional limitations.

  11. Celiac disease

    DEFF Research Database (Denmark)

    Hvas, Christian Lodberg; Jensen, Michael Dam; Reimer, Maria Christina;

    2015-01-01

    , which are found in wheat, rye, and barley. The disease prevalence is 0.5-1.0%, but CD remains under-diagnosed. The diagnosis relies on the demonstration of lymphocyte infiltration, crypt hyperplasia, and villous atrophy in duodenal biopsies. Serology, malabsorption, biochemical markers......This national clinical guideline approved by the Danish Society for Gastroenterology and Hepatology describes the diagnosis and treatment of celiac disease (CD) in adults. CD is a chronic immunemediated enteropathy of the small intestine triggered by the ingestion of gluten-containing proteins...... the small intestinal mucosa and absorption. Adherence to a GFD usually requires dietary advice from a clinical dietician. The monitoring of antibody levels and malabsorption markers is crucial during follow-up and allows for early treatment of disease complications. Important complications include...

  12. Myocardial disease

    Institute of Scientific and Technical Information of China (English)

    1993-01-01

    930497 Ectopic expression and the significanceof HLA—class II antigens in the myocardium ofpatients with dilated cardiomyopathy.LI Yunyou(李运友),et al.lst Affili Hosp,Nanjing MedCoil,Nanjing,210029.Chin J Cardiol 1993;21(1):15—16.Expression of HLA—class II antigens(DQ,DP)in the myocardium of patients with differentheart diseases and normal controls was studiedwith indirect immunofluorescence(IIF).Thepositive rates in different groups were observedas follows:dilated cardiomyopathy(DCM,12/13,+++),rheumatic heart disease(2/4,++),congenital heart diseases(1/14,+),left a-trial myxoma(0/1)and normal controls(1/8,

  13. Celiac disease

    DEFF Research Database (Denmark)

    Hvas, Christian Lodberg; Jensen, Michael Dam; Reimer, Maria Christina

    2015-01-01

    This national clinical guideline approved by the Danish Society for Gastroenterology and Hepatology describes the diagnosis and treatment of celiac disease (CD) in adults. CD is a chronic immunemediated enteropathy of the small intestine triggered by the ingestion of gluten-containing proteins......, which are found in wheat, rye, and barley. The disease prevalence is 0.5-1.0%, but CD remains under-diagnosed. The diagnosis relies on the demonstration of lymphocyte infiltration, crypt hyperplasia, and villous atrophy in duodenal biopsies. Serology, malabsorption, biochemical markers...... the small intestinal mucosa and absorption. Adherence to a GFD usually requires dietary advice from a clinical dietician. The monitoring of antibody levels and malabsorption markers is crucial during follow-up and allows for early treatment of disease complications. Important complications include...

  14. Dent's disease

    Directory of Open Access Journals (Sweden)

    Thakker Rajesh V

    2010-10-01

    Full Text Available Abstract Dent's disease is a renal tubular disorder characterized by manifestations of proximal tubule dysfunction, including low-molecular-weight proteinuria, hypercalciuria, nephrolithiasis, nephrocalcinosis, and progressive renal failure. These features are generally found in males only, and may be present in early childhood, whereas female carriers may show a milder phenotype. Prevalence is unknown; the disorder has been reported in around 250 families to date. Complications such as rickets or osteomalacia may occur. The disease is caused by mutations in either the CLCN5 (Dent disease 1 or OCRL1 (Dent disease 2 genes that are located on chromosome Xp11.22 and Xq25, respectively. CLCN5 encodes the electrogenic Cl-/H+ exchanger ClC-5, which belongs to the CLC family of Cl- channels/transporters. OCRL1 encodes a phosphatidylinositol bisphosphate (PIP2 5-phosphatase and mutations are also associated with Lowe Syndrome. The phenotype of Dent's disease is explained by the predominant expression of ClC-5 in the proximal tubule segments of the kidney. No genotype-phenotype correlation has been described thus far, and there is considerable intra-familial variability in disease severity. A few patients with Dent's disease do not harbour mutations in CLCN5 and OCRL1, pointing to the involvement of other genes. Diagnosis is based on the presence of all three of the following criteria: low-molecular-weight proteinuria, hypercalciuria and at least one of the following: nephrocalcinosis, kidney stones, hematuria, hypophosphatemia or renal insufficiency. Molecular genetic testing confirms the diagnosis. The differential diagnosis includes other causes of generalized dysfunction of the proximal tubules (renal Fanconi syndrome, hereditary, acquired, or caused by exogenous substances. Antenatal diagnosis and pre-implantation genetic testing is not advised. The care of patients with Dent's disease is supportive, focusing on the treatment of hypercalciuria and

  15. Celiac disease

    DEFF Research Database (Denmark)

    Hvas, Christian Lodberg; Jensen, Michael Dam; Reimer, Maria Christina;

    2015-01-01

    the small intestinal mucosa and absorption. Adherence to a GFD usually requires dietary advice from a clinical dietician. The monitoring of antibody levels and malabsorption markers is crucial during follow-up and allows for early treatment of disease complications. Important complications include......This national clinical guideline approved by the Danish Society for Gastroenterology and Hepatology describes the diagnosis and treatment of celiac disease (CD) in adults. CD is a chronic immunemediated enteropathy of the small intestine triggered by the ingestion of gluten-containing proteins...

  16. Hansen's disease: a vanishing disease?

    Directory of Open Access Journals (Sweden)

    Sinésio Talhari

    2012-12-01

    Full Text Available The introduction, implementation, successes and failures of multidrug therapy (MDT in all Hansen's disease endemic countries are discussed in this paper. The high efficacy of leprosy treatment with MDT and the global reduction of prevalence led the World Health Organization, in 1991, to establish the goal of elimination of Hansen's disease (less than 1 patient per 10,000 inhabitants to be accomplished by the year 2000. Brazil, Nepal and East Timor are among the few countries that didn't reach the elimination goal by the year 2000 or even 2005. The implications of these aspects are highlighted in this paper. Current data from endemic and previously endemic countries that carry a regular leprosy control programme show that the important fall in prevalence was not followed by the reduction of the incidence. This means that transmission of Mycobacterium leprae is still an issue. It is reasonable to conclude that we are still far from the most important goal of Hansen's disease control: the interruption of transmission and reduction of incidence. It is necessary to emphasize to health managers the need of keeping Hansen's disease control activities to better develop control programmes in the future. The recent international proposal to interrupt the transmission of leprosy by the year 2020 seems to unrealistic and it is discussed in this paper. The possibility of epidemiological impact related to the human immunodeficiency virus/Hansen's disease coinfection is also considered.

  17. Hansen's disease: a vanishing disease?

    Science.gov (United States)

    Talhari, Sinésio; Grossi, Maria Aparecida de Faria; Oliveira, Maria Leide W D R de; Gontijo, Bernardo; Talhari, Carolina; Penna, Gerson Oliveira

    2012-12-01

    The introduction, implementation, successes and failures of multidrug therapy (MDT) in all Hansen's disease endemic countries are discussed in this paper. The high efficacy of leprosy treatment with MDT and the global reduction of prevalence led the World Health Organization, in 1991, to establish the goal of elimination of Hansen's disease (less than 1 patient per 10,000 inhabitants) to be accomplished by the year 2000. Brazil, Nepal and East Timor are among the few countries that didn't reach the elimination goal by the year 2000 or even 2005. The implications of these aspects are highlighted in this paper. Current data from endemic and previously endemic countries that carry a regular leprosy control programme show that the important fall in prevalence was not followed by the reduction of the incidence. This means that transmission of Mycobacterium leprae is still an issue. It is reasonable to conclude that we are still far from the most important goal of Hansen's disease control: the interruption of transmission and reduction of incidence. It is necessary to emphasize to health managers the need of keeping Hansen's disease control activities to better develop control programmes in the future. The recent international proposal to interrupt the transmission of leprosy by the year 2020 seems to unrealistic and it is discussed in this paper. The possibility of epidemiological impact related to the human immunodeficiency virus/Hansen's disease coinfection is also considered.

  18. Myocardial disease

    Institute of Scientific and Technical Information of China (English)

    1992-01-01

    920666 Immunocytochemical study ofCuZn superoxide dismutase in the myocardi-um of normal subjects and patients ofrheumatic heart disease.ZHENG Yi(郑毅),et al. Dept Intern Med, Navy General Hosp,PLA, Beijing. 100037. Natl Med J China 1992;72(4): 225-227. By using the methods of immunocytochemistry

  19. Parkinson's disease

    DEFF Research Database (Denmark)

    Astradsson, Arnar; Aziz, Tipu Z

    2015-01-01

    -derived therapy in people with Parkinson's disease? We searched: Medline, Embase, The Cochrane Library and other important databases up to September 2014 (Clinical Evidence reviews are updated periodically; please check our website for the most up-to-date version of this review). We included harms alerts from...

  20. Wilson Disease

    Science.gov (United States)

    ... prevent organ damage. Changes in Eating, Diet, and Nutrition People with Wilson disease should reduce their dietary copper intake by avoiding foods that are high in copper, such as shellfish liver mushrooms nuts chocolate People should not eat these foods during the ...

  1. Mitochondrial Diseases

    Science.gov (United States)

    ... fats) that come from your food. When the mitochondria are defective, the cells do not have enough energy. The unused oxygen ... disease can vary. It depends on how many mitochondria are defective, and where ... organ, tissue, or cell type is affected. But often the problem affects ...

  2. Behcet's Disease

    Science.gov (United States)

    ... to stop taking the medicine suddenly, because the medicine alters the body’s production of the natural corticosteroid hormones. Long-term use of these medications can have side effects such as osteoporosis (a disease that leads to bone fragility), weight gain, delayed ...

  3. Huntington's disease

    DEFF Research Database (Denmark)

    Hjermind, Lena Elisabeth; Law, Ian; Jønch, Aia

    2011-01-01

    In this open-label pilot study, the authors evaluated the effect of memantine on the distribution of brain glucose metabolism in four Huntington's disease (HD) patients as determined by serial 18-fluoro-deoxyglucose [F(18)]FDG-PET scans over a period of 3-4 months (90-129 days, with one patient...

  4. Parkinson disease

    Science.gov (United States)

    In Parkinson disease, dopamine production becomes irregular and inadequate and nerve cells cannot properly transmit messages. This results in the loss of muscle function. By providing an even, adequate supply of medication that the body converts into dopamine, neurons are able to transmit ...

  5. Meningococcal disease

    Directory of Open Access Journals (Sweden)

    Alex Koyfman

    2011-12-01

    Full Text Available The first cases of meningococcal meningitis were described in Geneva in 1805 and in New England in 1806, the causative agent finally being identified by Anton Weichselbaum in 1887. The first meningococcal epidemics occurred in sub-Saharan Africa in the early 1900s and periodic outbreaks continue to occur worldwide today. Neisseria meningitidis colonizes the naso-oropharyngeal mucosa in approximately 10–20% of healthy individuals. When it invades the bloodstream, meningococcus has the potential to cause devastating disease. It can affect people of any age, but primarily infects children and adolescents. Meningococcemia classically follows an upper respiratory illness consisting of myalgias, fever, headache, and nausea. It can present as an indolent infection with rapid recovery or progress within a few hours into a fulminant illness affecting multiple organ systems. As such, meningococcemia is one of the important causes of sepsis. Prior to antibiotic therapy, the disease carried a 70% mortality rate. Despite advances in early diagnosis and treatment, 10–15% of affected patients die from the disease and another 10–20% are left with severe morbidities (neurologic disability, hearing loss, loss of a limb. Meningococcal disease remains a significant global health threat.

  6. Lung Diseases

    Science.gov (United States)

    When you breathe, your lungs take in oxygen from the air and deliver it to the bloodstream. The cells in your body need oxygen to ... you breathe nearly 25,000 times. People with lung disease have difficulty breathing. Millions of people in ...

  7. INFECTIOUS DISEASE

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    2.1 Viral disease2003263 Isolation, identification and sequence analyses of dengue virus type 2 strain GD19/2001. REN Rui-wen(任瑞文), et al. Milit Med Instit Guangzhou Milit District, Guangzhou 510507. Chin J Epidemiol 2003; 24 (4):288-290. Objective:To identify the virus isolated from patients

  8. INFECTIOUS DISEASE

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    3.1 Viral disease2004310 One-step simultaneous detection of G-genotype of human group a rotaviruses by multiplex RT-PCR. TANG Shaowen (唐少文) , et al. Dept Epidemiol, Tongji Med Coll Huozhong Univ Sci & Technol, Wuhan 430030. Chin J Lab Med 2004; 27 (4):234-236

  9. INFECTIOUS DISEASE

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    4. 1 Viral disease2004174 Study on the seropositive prevalence of humanimmunodeficiency virus in a village residents living in rural region of central China. CHENG Hua (程华), et al. Public Health Sch, Fudan Univ, Shanghai 200032. Chin J Epidemiol 2004;25(4):317 -321.

  10. Huntington's Disease

    Science.gov (United States)

    ... seizures. More than 30,000 Americans have HD. Huntington’s disease is caused by a mutation in the gene for a protein called huntingtin. The defect causes the cytosine, adenine, and guanine (CAG) building blocks of DNA to repeat many more ...

  11. Huntington disease

    Science.gov (United States)

    ... President of the Florida Society of Neurology (FSN). Review provided by VeriMed Healthcare Network. Also reviewed by David Zieve, MD, MHA, Isla Ogilvie, PhD, and the A.D.A.M. Editorial team. Huntington's Disease Read more Latest Health News Read more Health ...

  12. Prionic diseases

    Directory of Open Access Journals (Sweden)

    Abelardo Q-C Araujo

    2013-09-01

    Full Text Available Prion diseases are neurodegenerative illnesses due to the accumulation of small infectious pathogens containing protein but apparently lacking nucleic acid, which have long incubation periods and progress inexorably once clinical symptoms appear. Prions are uniquely resistant to a number of normal decontaminating procedures. The prionopathies [Kuru, Creutzfeldt-Jakob disease (CJD and its variants, Gerstmann-Sträussler-Scheinker (GSS syndrome and fatal familial insomnia (FFI] result from accumulation of abnormal isoforms of the prion protein in the brains of normal animals on both neuronal and non-neuronal cells. The accumulation of this protein or fragments of it in neurons leads to apoptosis and cell death. There is a strong link between mutations in the gene encoding the normal prion protein in humans (PRNP - located on the short arm of chromosome 20 – and forms of prion disease with a familial predisposition (familial CJD, GSS, FFI. Clinically a prionopathy should be suspected in any case of a fast progressing dementia with ataxia, myoclonus, or in individuals with pathological insomnia associated with dysautonomia. Magnetic resonance imaging, identification of the 14-3-3 protein in the cerebrospinal fluid, tonsil biopsy and genetic studies have been used for in vivo diagnosis circumventing the need of brain biopsy. Histopathology, however, remains the only conclusive method to reach a confident diagnosis. Unfortunately, despite numerous treatment efforts, prionopathies remain short-lasting and fatal diseases.

  13. INFECTIOUS DISEASE

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    3.1 Viral disease2003162 The clinical and epidemiological analysis on 46 patients with epidemic hemorrhagic fever in Huainan areas. WANG Kexia(王克霞). Sch Med, An-hui Univ Sci & Tehnol, Huainan 232001. Chin J En-demiol 2003;22(1):48-50.

  14. Extraphyramidal disease

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    2009250 Effects of bilateral deep brain stimulation of the subthalamic nucleus on depression in patients with parkinson’s disease. WANG Xuelian(王学廉),et al.Dept Neurosurg,Tangdu Hosp,4th Milit Med Univ,Xi’an,710038.Chin J Nerv Ment Dis,2009;35(2):88-92.

  15. Chagas Disease

    Science.gov (United States)

    ... contact with an infected triatomine bug also called “kissing bug,”“benchuca,” “vinchuca,”“chinche,”or “barbeiro” Who can ... get Chagas disease? ■ Usually from contact with a kissing bug ■ After the kissing bug bites, it poops. ...

  16. Neurodegenerative disorders: Parkinson's disease and Huntington's disease

    Science.gov (United States)

    Hague, S; Klaffke, S; Bandmann, O

    2005-01-01

    Parkinson's disease and Huntington's disease are both model diseases. Parkinson's disease is the most common of several akinetic-rigid syndromes and Huntington's disease is only one of an ever growing number of trinucleotide repeat disorders. Molecular genetic studies and subsequent molecular biological studies have provided fascinating new insights into the pathogenesis of both disorders and there is now real hope for disease modifying treatment in the not too distant future for patients with Parkinson's disease or Huntington's disease. PMID:16024878

  17. Neurodegenerative disorders: Parkinson's disease and Huntington's disease.

    Science.gov (United States)

    Hague, S M; Klaffke, S; Bandmann, O

    2005-08-01

    Parkinson's disease and Huntington's disease are both model diseases. Parkinson's disease is the most common of several akinetic-rigid syndromes and Huntington's disease is only one of an ever growing number of trinucleotide repeat disorders. Molecular genetic studies and subsequent molecular biological studies have provided fascinating new insights into the pathogenesis of both disorders and there is now real hope for disease modifying treatment in the not too distant future for patients with Parkinson's disease or Huntington's disease.

  18. Infectious Disease

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    3.1 Viral disease2007149 Study on platelet β3 integrin expression levels and their relationships with disease severity in patients with hemorrhagic fever with renal syndrome.GAO Maicang(高麦仓), et al. Dept Infect Dis, 1st Affili Hosp, Sch Med, Xi′an Jiaotong Univ , Xi′an 710061. Chin J Infect Dis 2007;25(3):152-153. Objective To investigate the relationship between the expression level of platelet membrane glycoprotein 133(GP Ⅲa, CD61) and the severity of disease in patients with hemorrhagic fever with renal syndrome(HFRS). Methods One hundred and four patients with HFRS and 30 healthy individuals were recruited. The percentage of CD61 positive platelets and the mean fluorescence intensities (MFI) of platelet membrane glycoprotein β3 were determined by flow cytometry (FCM). The 104 patients studied were divided into three groups based on their expression levels of platelet membrane glycoprotein β3 at oliguric phase. Clinical data and laboratory parameters in different groups were compared and analyzed. Results The expression levels of CD61 in patients with HFRS were significantly higher than those in control group, although no significant difference in the percentage of CD61 positive platelets between patients with HFRS and controls was detected. The MFI of CD61 expression in patients with HFRS at fever phase, oliguric phase and polyuric phase was 19. 75±2.57, 17.46±1.48 and 15. 55±0.60, respectively, which was significantly higher than that in control group (3. 20±0.12). The expression level of CD61 in patients with HFRS at oliguric phase was negatively correlated with platelet count and serum albumin(r=-0.637 and -0. 695. respectively) and positively correlated with white blood cell count, blood urea nitrogen, serum creatinine and alanine aminotransferase(r= 0.945, 0. 904, 0.956 and 0. 891, respectively). When the patients were compared according to the expression levels of CD61, it was indicated that the higher the expression level of CD61, the

  19. Celiac disease

    Institute of Scientific and Technical Information of China (English)

    Luis Rodrigo

    2006-01-01

    Celiac disease (CD) is a common autoimmune disorder,induced by the intake of gluten proteins present in wheat, barley and rye. Contrary to common belief,this disorder is a protean systemic disease, rather than merely a pure digestive alteration. CD is closely associated with genes that code HLA-Ⅱ antigens, mainly of DQ2 and DQ8 classes. Previously, it was considered to be a rare childhood disorder, but is actually considered a frequent condition, present at any age, which may have multiple complications. Tissue transglutaminase-2(tTG), appears to be an important component of this disease, both, in its pathogenesis and diagnosis. Active CD is characterized by intestinal and/or extra-intestinal symptoms, villous atrophy and crypt hyperplasia, and strongly positive tTG auto-antibodies. The duodenal biopsy is considered to be the "gold standard" for diagnosis, but its practice has significant limitations in its interpretation, especially in adults. Occasionally, it results in a false-negative because of patchy mucosal changes and the presence of mucosal villous atrophy is often more severe in the proximal jejunum, usually not reached by endoscopic biopsies. CD is associated with increased rates of several diseases, such as iron deficiency anemia, osteoporosis, dermatitis herpetiformis,several neurologic and endocrine diseases, persistent chronic hypertransami-nasemia of unknown origin,various types of cancer and other autoimmune disorders.Treatment of CD dictates a strict, life-long gluten-free diet, which results in remission for most individuals,although its effect on some associated extraintestinal manifestations remains to be established.

  20. Bacterial disease

    Institute of Scientific and Technical Information of China (English)

    1993-01-01

    930445 A report on investigation of an outbreakof legionnaires’disease in a hotel in Beijing.DENG Changying(邓长英),et al.Beijing ArmedForce General Hosp,Beijing,100027.Chin J Epi-demiol 1993;14(2):78—79.During the period from February to March,1992,an outbreak of upper respiratory infection(influenza—like syndrome)took place in a hotelin Beijing.An epidemiological investigation andbacteriological examination were carried out inthis hotel.The results showed that it was anoutbreak of Legionnaires’disease caused by Le-gionella pneumophila serogroup 10(Lpl0).Theincidence was 13.51%(5/37).This is the firstreport on Lp10 infection in China.

  1. Parkinson's disease

    DEFF Research Database (Denmark)

    Astradsson, Arnar; Aziz, Tipu Z

    2015-01-01

    INTRODUCTION: The mean age of onset of Parkinson's disease is about 65 years, with a median time of 9 years between diagnosis and death. METHODS AND OUTCOMES: We conducted a systematic review and aimed to answer the following clinical question: What are the effects of fetal cell or stem cell......-derived therapy in people with Parkinson's disease? We searched: Medline, Embase, The Cochrane Library and other important databases up to September 2014 (Clinical Evidence reviews are updated periodically; please check our website for the most up-to-date version of this review). We included harms alerts from...... relevant organisations such as the US Food and Drug Administration (FDA) and the UK Medicines and Healthcare products Regulatory Agency (MHRA). RESULTS: We found two studies that met our inclusion criteria. We performed a GRADE evaluation of the quality of evidence for interventions. CONCLUSIONS...

  2. Menkes disease.

    Science.gov (United States)

    Tümer, Zeynep; Møller, Lisbeth B

    2010-05-01

    Menkes disease (MD) is a lethal multisystemic disorder of copper metabolism. Progressive neurodegeneration and connective tissue disturbances, together with the peculiar 'kinky' hair are the main manifestations. MD is inherited as an X-linked recessive trait, and as expected the vast majority of patients are males. MD occurs due to mutations in the ATP7A gene and the vast majority of ATP7A mutations are intragenic mutations or partial gene deletions. ATP7A is an energy dependent transmembrane protein, which is involved in the delivery of copper to the secreted copper enzymes and in the export of surplus copper from cells. Severely affected MD patients die usually before the third year of life. A cure for the disease does not exist, but very early copper-histidine treatment may correct some of the neurological symptoms.

  3. Morgellons disease?

    Science.gov (United States)

    Accordino, Robert E; Engler, Danielle; Ginsburg, Iona H; Koo, John

    2008-01-01

    Morgellons disease, a pattern of dermatologic symptoms very similar, if not identical, to those of delusions of parasitosis, was first described many centuries ago, but has recently been given much attention on the internet and in the mass media. The present authors present a history of Morgellons disease, in addition to which they discuss the potential benefit of using this diagnostic term as a means of building trust and rapport with patients to maximize treatment benefit. The present authors also suggest "meeting the patient halfway" and creating a therapeutic alliance when providing dermatologic treatment by taking their cutaneous symptoms seriously enough to provide both topical ointments as well as antipsychotic medications, which can be therapeutic in these patients.

  4. Lyme Disease.

    Science.gov (United States)

    Hu, Linden T

    2016-05-03

    This issue provides a clinical overview of Lyme disease, focusing on prevention, diagnosis, treatment, and practice improvement. The content of In the Clinic is drawn from the clinical information and education resources of the American College of Physicians (ACP), including MKSAP (Medical Knowledge and Self-Assessment Program). Annals of Internal Medicine editors develop In the Clinic in collaboration with the ACP's Medical Education and Publishing divisions and with the assistance of additional science writers and physician writers.

  5. Ledderhose Disease

    Science.gov (United States)

    Fausto de Souza, Dominique; Micaelo, Lilian; Cuzzi, Tullia

    2010-01-01

    Plantar fibromatosis, or Ledderhose disease, is a rare hyperproliferative disorder of the plantar aponeurosis. It may occur at any age with the greatest prevalence at middle age and beyond. This disorder is more common in men than woman and it is sometimes associated with other forms of fibromatosis. A 28-year-old Brazilian woman with a six-year history of painless bilateral plantar nodules is described in this article. PMID:20877526

  6. INFECTIOUS DISEASE

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    4.1 Viral disease2003021 Analysis on the epidemiologic features of Dengue fever in Guangdong province, 1990 - 2000. LUO Huiming(罗会明), et al. Dis Contr & Prev Center Guangdong Prov, Guangzhou 510300. Chin J Epi-demiol 2002;23(6):427-430.Objective: To determine the epidemiological characteristics and risk factors of Dengue fever in Guangdong province in 1990 - 2000, and to develop the strategy for

  7. Fungal disease

    Institute of Scientific and Technical Information of China (English)

    1993-01-01

    930031 Experimental studies on lung lesionsof rabbits caused by streptomyces thermohy-groscopicus.LIU Fang(刘仿),et al.Dept Mi-crobiol,Hubei Med Coll,Xianning Branch,437100.Chin J Tuberc & Respir Dis 1992;15(4):207—208.Imitating the natural way of infection ofFarmer’s lung disease,we succeeded in inducingChina Medical Abstracts(Internal Medicine)

  8. Wilson's disease.

    Science.gov (United States)

    Loudianos, G; Gitlin, J D

    2000-01-01

    Wilson's disease is an autosomal recessive disorder of copper metabolism resulting from the absence or dysfunction of a copper transporting P-type ATPase encoded on chromosome 13. This ATPase is expressed in hepatocytes where it is localized to the trans-Golgi network and transports copper into the secretory pathway for incorporation into ceruloplasmin and excretion into the bile. Under physiologic circumstances, biliary excretion represents the sole mechanism for copper excretion, and thus affected individuals have progressive copper accumulation in the liver. When the capacity for hepatic storage is exceeded, cell death ensues with copper release into the plasma, hemolysis, and tissue deposition. Presentation in childhood may include chronic hepatitis, asymptomatic cirrhosis, or acute liver failure. In young adults, neuropsychiatric symptoms predominate and include dystonia, tremor, personality changes, and cognitive impairments secondary to copper accumulation in the central nervous system. The laboratory diagnosis of Wilson's disease is confirmed by decreased serum ceruloplasmin, increased urinary copper content, and elevated hepatic copper concentration. Molecular genetic analysis is complex as more than 100 unique mutations have been identified and most individuals are compound heterozygotes. Copper chelation with penicillamine is an effective therapy in most patients and hepatic transplantation is curative in individuals presenting with irreversible liver failure. Elucidation of the molecular genetic basis of Wilson's disease has permitted new insights into the mechanisms of cellular copper homeostasis.

  9. Polycystic Kidney Disease

    Science.gov (United States)

    ... Kidney Disease Polycystic Kidney Disease (PKD) Related Topics Section Navigation Kidney Disease Acquired Cystic Kidney Disease Amyloidosis & ... for a Child with Kidney Disease Ectopic Kidney Medullary Sponge Kidney Kidney Dysplasia Kidney Failure Choosing a ...

  10. Coronary heart disease

    Science.gov (United States)

    Heart disease, Coronary heart disease, Coronary artery disease; Arteriosclerotic heart disease; CHD; CAD ... slow down or stop. A risk factor for heart disease is something that increases your chance of getting ...

  11. Parkinson's Disease Dementia

    Science.gov (United States)

    ... Find your local chapter Join our online community Parkinson's Disease Dementia Parkinson's disease dementia is an impairment in ... disease. About Symptoms Diagnosis Causes & risks Treatments About Parkinson's disease dementia The brain changes caused by Parkinson's disease ...

  12. [Goodpasture disease].

    Science.gov (United States)

    Fomegné, G; Dratwa, M; Wens, R; Mesquita, M; Van der Straaten, M; Vanden Haute, K; Fosso, C

    2006-01-01

    We report one case of acute renal failure with oliguria, microscopic haematuria and normocytic anemia in a 86-year old Swedish woman. A full investigation led to the diagnosis of Goodpasture disease, an isolated form of Goodpasture syndrome. Goodpasture disease is and autoimmune disorder characterized by the development of autoantibodies to the NC1 domain of the alpha3 chain of type IV collagen, found mainly in glomerular basement membranes (GBM). When the disease affects both the lung and the kidney, it is called Goodpasture syndrome but the pulmonary or renal involvement can be isolated or separated in years. Its pathogenesis is not well known. It occurs essentially in Caucasian subjects, preferentially from Nordic and Anglo-Saxon countries (higher prevalence of HLA DR B1-15 and B1-4 group). Are also mentioned, the exposure to hydrocarbons, rustproof, insecticides and greasy solvents. The annual incidence of Goodpasture syndrome is rare and has been estimated in Europe to be about 0.5 to 1 case per million inhabitants. The isolated renal form represents about 1/3 of the cases. The clinical presentation is characterized by rapidly progressive renal failure with oliguria or anuria and in case of lung involvement, pulmonary hemorrhage responsible of hemoptysis, sometimes massive. Renal biopsy and immunofluorescence analysis play a key role in the diagnosis. The presence of both linear deposits of IgG along the glomerular basement membrane (GBM) and circulating anti-GBM antibodies is of paramount importance. The treatment, which depends on the degree of renal involvement, is based on the association of corticosteroids, cyclophosphamide and plasma exchanges.

  13. Celiac disease

    DEFF Research Database (Denmark)

    Hvas, Christian Lodberg; Jensen, Michael Dam; Reimer, Maria Christina

    2015-01-01

    This national clinical guideline approved by the Danish Society for Gastroenterology and Hepatology describes the diagnosis and treatment of celiac disease (CD) in adults. CD is a chronic immunemediated enteropathy of the small intestine triggered by the ingestion of gluten-containing proteins......, and identification of specific HLA haplotypes may contribute to CD diagnosis. Classical CD presents with diarrhoea and weight loss, but non-classical CD with vague or extraintestinal symptoms is common. The treatment for CD is a lifelong gluten-free diet (GFD), which, in the majority of patients, normalises...

  14. Menkes disease

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Møller, Lisbeth B

    2010-01-01

    of patients are males. MD occurs due to mutations in the ATP7A gene and the vast majority of ATP7A mutations are intragenic mutations or partial gene deletions. ATP7A is an energy dependent transmembrane protein, which is involved in the delivery of copper to the secreted copper enzymes and in the export......Menkes disease (MD) is a lethal multisystemic disorder of copper metabolism. Progressive neurodegeneration and connective tissue disturbances, together with the peculiar 'kinky' hair are the main manifestations. MD is inherited as an X-linked recessive trait, and as expected the vast majority...

  15. Menkes disease

    OpenAIRE

    Tümer, Zeynep; Møller, Lisbeth B

    2009-01-01

    Menkes disease (MD) is a lethal multisystemic disorder of copper metabolism. Progressive neurodegeneration and connective tissue disturbances, together with the peculiar ‘kinky' hair are the main manifestations. MD is inherited as an X-linked recessive trait, and as expected the vast majority of patients are males. MD occurs due to mutations in the ATP7A gene and the vast majority of ATP7A mutations are intragenic mutations or partial gene deletions. ATP7A is an energy dependent transmembrane...

  16. Celiac disease.

    Science.gov (United States)

    Polanco, Isabel

    2008-08-01

    Celiac disease is an immunologically mediated enteropathy of the small intestine, characterized by lifelong intolerance to the gliadin and related prolamines from wheat and other cereals, that occurs in genetically predisposed individuals. Symptoms result from structural damage to the mucosa of the small intestine, which may cause malabsorption with positive autoantibodies in the sera. Normal mucosal architecture is restored after the use of a gluten-free diet and the normalization of the autoantibodies. Villous atrophy and high levels of autoantibodies reappear when gluten is reintroduced into the diet (gluten challenge).

  17. Infectious Disease

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    2.1 Viral disease 2006009 Correlation analysis of type A influenza virus genetic variation characteristic with survival selective pressure ZHOU xiao -ming(周晓明 ) ,et al. Sch Pub Health,Fudan Univ. Shanghai 200032. China J Infect Dis 2005;23(4) :221 -224 Objective:To study the relationship betweer. type A influenza virus genetic variation with survival selective pressure to find possible vaccine conserved antigen target. Methods:Seven strains of same HA (Hemagglutinin) serotype, regional and isolation time closely related type A influenza virus were selected with full HA gene coding sequence , Blast2 program was used to calculate the param-

  18. Women's Heart Disease: Heart Disease Risk Factors

    Science.gov (United States)

    ... this page please turn JavaScript on. Feature: Women's Heart Disease Heart Disease Risk Factors Past Issues / Winter 2014 Table of ... or habits may raise your risk for coronary heart disease (CHD). These conditions are known as risk factors. ...

  19. Crohn disease - children - discharge

    Science.gov (United States)

    Inflammatory bowel disease in children - Crohn disease; IBD in children - Crohn disease; Regional enteritis - children; Ileitis - children; Granulomatous ileocolitis - children; Colitis in children; CD - children

  20. Infectious diseases and arthropods

    National Research Council Canada - National Science Library

    Goddard, Jerome

    2000-01-01

    .... His book covers mosquito-, tick-, and flea-borne diseases, and a variety of other miscellaneous vector-borne diseases, including Chagas' disease, African sleeping sickness, onchocerciasis, scrub...

  1. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... of Parkinson's Disease OHSU - Parkinson's Disease: Managing Depression, Anxiety & Psychosis OHSU - Parkinson's Disease: Pharmacological Management of Depression, Anxiety & Psychosis OHSU - Therapeutic ...

  2. Hirayama disease

    Directory of Open Access Journals (Sweden)

    Atul T Tayade

    2010-01-01

    Full Text Available A 17-year-old male, who gave up his favorite sport cricket and started playing football, presented with one-year history of slowly progressive atrophic weakness of forearms and hands. Neurological examination showed weak and wasted arms, forearms and hand but no evidence of pyramidal tract, spinothalmic tract and posterior column lesions. Plain cervical spine radiographs showed no abnormal findings. Cervical magnetic resonance imaging (MRI showed asymmetric cord atrophy; images obtained with neck flexed showed the anterior shifting of the posterior wall of the lower cervical dural sac resulting in cord compression. These findings suggest Hirayama disease, a kind of cervical myelopathy related to the flexion movements of the neck.

  3. [Bone disease in Gaucher's disease].

    Science.gov (United States)

    Roca Espiau, Mercedes

    2011-09-01

    The exposition aims, is to review the pathophysiological mechanisms of bone marrow involvement and the patterns of marrow infiltration by Gaucher cells. We have reviewed the different methods of assessment of bone marrow infiltration and its temporal development. Qualitative methods include simple radiography, magnetic resonance imaging (MRI), computed tomography (CT) and radioisotope. The simple radiography is the basic element, but its sensitivity is limited and only allows for assessing changes and trabecular bone remodeling MRI allows us to appreciate the bone marrow infiltration, detection of complications and response to therapy. Radioisotopes can contribute to the differential diagnosis of osteomyelitis and bone crises. Among the quantitative methods are the QCSI (quantitative chemical shift imaging) and the dual-energy X-ray absorptiometry (DEXA), as well as new quantitative techniques of CT, MRI and ultrasound densitometry. The QCSI performed an assessment of fat content of bone marrow in the spine. DEXA quantifies bone density by measuring the attenuation coefficient. The semiquantitative methods have various "scores" to establish criteria for generalized bone disease endpoints of disease progression and response to therapy.

  4. Undifferentiated Connective Tissue Disease

    Science.gov (United States)

    ... Home Conditions Undifferentiated Connective Tissue Disease (UCTD) Undifferentiated Connective Tissue Disease (UCTD) Make an Appointment Find a Doctor ... L. Goldstein, MD, MMSc (February 01, 2016) Undifferentiated connective tissue disease (UCTD) is a systemic autoimmune disease. This ...

  5. Associated Autoimmune Diseases

    Science.gov (United States)

    ... gland in the neck, thick and coarse hair. Addison’s Disease Arare disease involving the adrenal gland. The prevalence of celiac disease in people with addison’s disease is significant. Symptoms of Addison’s may include weight ...

  6. Genetics and Rheumatic Disease

    Science.gov (United States)

    ... Well with Rheumatic Disease Genetics and Rheumatic Disease Genetics and Rheumatic Disease Fast Facts Studying twins has ... 70%, and for non-identical pairs, even lower. Genetics and ankylosing spondylitis Each rheumatic disease has its ...

  7. Chronic Beryllium Disease

    Science.gov (United States)

    ... Science Education & Training Home Conditions Chronic Beryllium Disease Chronic Beryllium Disease Make an Appointment Find a Doctor ... MD, MSPH, FCCP (February 01, 2016) What is chronic beryllium disease (CBD)? Chronic beryllium disease (CBD) is ...

  8. Heart disease - risk factors

    Science.gov (United States)

    Heart disease - prevention; CVD - risk factors; Cardiovascular disease - risk factors; Coronary artery disease - risk factors; CAD - risk ... a certain health condition. Some risk factors for heart disease you cannot change, but some you can. ...

  9. Inflammation and Heart Disease

    Science.gov (United States)

    ... Disease Venous Thromboembolism Aortic Aneurysm More Inflammation and Heart Disease Updated:Oct 12,2016 Understand the risks of ... inflammation causes cardiovascular disease, inflammation is common for heart disease and stroke patients and is thought to be ...

  10. Lipid Storage Diseases

    Science.gov (United States)

    ... age 2, usually from lung disease. Children with Tay-Sachs and Sandhoff diseases often die at an ... age 2, usually from lung disease. Children with Tay-Sachs and Sandhoff diseases often die at an ...

  11. Heart disease and women

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/007188.htm Heart disease and women To use the sharing features on ... please enable JavaScript. People often DO NOT consider heart disease a woman's disease. Yet cardiovascular disease is the ...

  12. Men and Heart Disease

    Science.gov (United States)

    ... Pressure Salt Cholesterol Million Hearts® WISEWOMAN Men and Heart Disease Fact Sheet Recommend on Facebook Tweet Share Compartir Source: Interactive Atlas of Heart Disease and Stroke Heart Disease Facts in Men Heart disease is the leading ...

  13. American Lyme Disease Foundation

    Science.gov (United States)

    ... Infectious Diseases, 35: 451-464, 2002) What is Lyme Disease? Lyme disease (LD) is an infection caused by ... mission with your own tax-deductible contribution. American Lyme Disease Foundation, Inc. PO Box 466 Lyme, CT 06371 ...

  14. Thyroid Disease (for Parents)

    Science.gov (United States)

    ... Teaching Kids to Be Smart About Social Media Thyroid Disease KidsHealth > For Parents > Thyroid Disease Print A ... many other parts of the body. What Is Thyroid Disease? Thyroid disease is when the thyroid gland ...

  15. Thyroid Disease and Teens

    Science.gov (United States)

    ... Surgery? Choosing the Right Sport for You Shyness Thyroid Disease KidsHealth > For Teens > Thyroid Disease Print A ... other parts of your body. continue What Is Thyroid Disease? Thyroid disease occurs when the thyroid gland ...

  16. Genetics and Rheumatic Disease

    Science.gov (United States)

    ... Well with Rheumatic Disease Genetics and Rheumatic Disease Genetics and Rheumatic Disease Fast Facts Studying twins has ... 70%, and for non-identical pairs, even lower. Genetics and ankylosing spondylitis Each rheumatic disease has its ...

  17. Pelvic Inflammatory Disease (PID)

    Science.gov (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Pelvic Inflammatory Disease (PID) Home For Patients Search FAQs Pelvic Inflammatory ... Inflammatory Disease (PID) FAQ077, September 2015 PDF Format Pelvic Inflammatory Disease (PID) Gynecologic Problems What is pelvic inflammatory disease ( ...

  18. Thyroid Disease (for Parents)

    Science.gov (United States)

    ... Old Feeding Your 1- to 2-Year-Old Thyroid Disease KidsHealth > For Parents > Thyroid Disease A A ... many other parts of the body. What Is Thyroid Disease? Thyroid disease is when the thyroid gland ...

  19. Thyroid Disease and Teens

    Science.gov (United States)

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Thyroid Disease KidsHealth > For Teens > Thyroid Disease A A ... other parts of your body. continue What Is Thyroid Disease? Thyroid disease occurs when the thyroid gland ...

  20. Sickle Cell Disease

    Science.gov (United States)

    ... sickle cell disease?Sickle cell disease, also called sickle cell anemia, is a hereditary condition (which means it runs ... disease, hemoglobin SS disease, hemoglobin synthesis, hemoglobinopathies, ... cell anemia, sickle cell crisis, vaso-occlusive crisis Family Health, ...

  1. Gaucher Disease in Pregnancy

    Science.gov (United States)

    ... from your health care provider. What is Gaucher disease? Gaucher disease is a genetic disorder. People with Gaucher ... severe and depend on the type of Gaucher disease. Gaucher disease occurs in approximately 1 in 60,000 ...

  2. Aortic Valve Disease

    Science.gov (United States)

    ... Tricuspid Valve Disease Cardiac Rhythm Disturbances Thoracic Aortic Aneurysm Pediatric and Congenital Heart Disease Heart abnormalities that are ... Transplantation End-stage Lung Disease Adult Lung Transplantation Pediatric Lung ... Aortic Aneurysm Aortic Valve Disease Overview The human heart has ...

  3. What Is Vascular Disease?

    Science.gov (United States)

    ... Donors Corporate Sponsors Donor Privacy Policy What Is Vascular Disease? What Is Vascular Disease? Vascular disease is any abnormal condition of ... steps to prevent vascular disease here. Understanding the Vascular System Your vascular system – the highways of the ...

  4. Parkinson's disease.

    Science.gov (United States)

    Benninger, David H

    2013-01-01

    In advanced Parkinson's disease (PD), the emergence of symptoms refractory to conventional therapy poses therapeutic challenges. The success of deep brain stimulation (DBS) and advances in the understanding of the pathophysiology of PD have raised interest in noninvasive brain stimulation as an alternative therapeutic tool. The rationale for its use draws from the concept that reversing abnormalities in brain activity and physiology thought to cause the clinical deficits may restore normal functioning. Currently the best evidence in support of this concept comes from DBS, which improves motor deficits, and modulates brain activity and motor cortex physiology, although whether a causal interaction exists remains largely undetermined. Most trials of noninvasive brain stimulation in PD have applied repetitive transcranial magnetic stimulation (rTMS), targeting the motor cortex. Current studies suggest a possible therapeutic potential for rTMS and transcranial direct current stimulation (tDCS), but clinical effects so far have been small and negligible with regard to functional independence and quality of life. Approaches to potentiate the efficacy of rTMS include increasing stimulation intensity and novel stimulation parameters that derive their rationale from studies on brain physiology. These novel parameters are intended to simulate normal firing patterns or to act on the hypothesized role of oscillatory activity in the motor cortex and basal ganglia with regard to motor control and its contribution to the pathogenesis of motor disorders. Noninvasive brain stimulation studies will enhance our understanding of PD pathophysiology and might provide further evidence for potential therapeutic applications.

  5. [Castleman disease].

    Science.gov (United States)

    Belletti, Gerardo A; Savio, Verónica; Minoldo, Daniel; Caminos, Susana; Yorio, Marcelo A

    2004-01-01

    A 66 years female, who was since last year under astenia, arthralgias, pimply lesions in spread plates and tests showing eritrosedimentation over 100 mm, anemi, leucocitosis with neutrofilia, policlonal hypergammaglobulinemia, slight proteinuria and IgE on 900. This patient was sporadically treated with corticoids. When made the medical consult had lost 34lb., was under anorexy, as well as dyspepsia. Hemoglobyn 6.9 gr/dl, leucocytes 20000/mm3, neutrofils at 90%, proteinogram the same as former, with hypoalbuminemia. She was taking prednisona, 16 mg/day. When examined showed depress of conscience, astenia, and dermic lesions already quoted. 4 cm nonpainful right axillary adenopaty adhered to deep planes. Medulogram with increased iron, hyperegenerative. Ganglionar biopsia: linfoid hyperplasic process linked to inmune response. Toracoabdominal tomography with adenomegalia in torax and retroperitoneo. Skin biopsia: neutrofilic vasculitis. The patient suspends the 16 mg of prednisona and fever as well as generalized adenopatias come up. After laying aside other ethiologies, and understanding as Castleman Multicentric disease, it is started to supply prednisona 1 mg/kg of weight with a clinical and biochemical fast and outstanding response. After 7 months it was progressively suspended the esteroids and 60 days later, the process fall back; for that, corticoids are restarted, with a good evolution. The illness of Castleman although it is not very frequent, it should be considered as differential diagnosis in those clinical cases that are accompanied with important general commitment, linphadenopaties and respons to steroid therapy.

  6. Blood and Lymph Diseases

    Science.gov (United States)

    ... and Disease [Internet]. Bethesda (MD): National Center for Biotechnology Information (US); 1998-. Blood and Lymph Diseases. PDF version of this page ( ... On Blood and Lymph Diseases - Genes and Disease Blood and Lymph Diseases - Genes and Disease Your browsing ... Biotechnology Information , U.S. National Library of Medicine 8600 Rockville ...

  7. Bone scintigraphy and metabolic disorders

    Energy Technology Data Exchange (ETDEWEB)

    Mari' , C.; Catafau, A.; Carrio' , I. [Hospital de Sant Pau, Barcelone (Spain). Serv. of Nuclear Medicine

    1999-09-01

    The paper discusses the main clinical value of bone scan in metabolic bone disease: its detection of focal conditions or focal complications of such generalized disease, its most common use of being the detection of fractures in osteoporosis, pseudo fractures in osteomalacia and the evaluation of Paget's disease.

  8. Muscle disease.

    Science.gov (United States)

    Tsao, Chang-Yong

    2014-02-01

    On the basis of strong research evidence, Duchenne muscular dystrophy (DMD), the most common severe childhood form of muscular dystrophy, is an X-linked recessive disorder caused by out-of-frame mutations of the dystrophin gene. Thus, it is classified asa dystrophinopathy. The disease onset is before age 5 years. Patients with DMD present with progressive symmetrical limb-girdle muscle weakness and become wheelchair dependent after age 12 years. (2)(3). On the basis of some research evidence,cardiomyopathy and congestive heart failure are usually seen in the late teens in patients with DMD. Progressive scoliosis and respiratory in sufficiency often develop once wheelchair dependency occurs. Respiratory failure and cardiomyopathy are common causes of death, and few survive beyond the third decade of life. (2)(3)(4)(5)(6)(7). On the basis of some research evidence, prednisone at 0.75 mg/kg daily (maximum dose, 40 mg/d) or deflazacort at 0.9 mg/kg daily (maximum dose, 39 mg/d), a derivative of prednisolone (not available in the United States), as a single morning dose is recommended for DMD patients older than 5 years, which may prolong independent walking from a few months to 2 years. (2)(3)(16)(17). Based on some research evidence, treatment with angiotensin-converting enzyme inhibitors, b-blockers, and diuretics has been reported to be beneficial in DMD patients with cardiac abnormalities. (2)(3)(5)(18). Based on expert opinion, children with muscle weakness and increased serum creatine kinase levels may be associated with either genetic or acquired muscle disorders (Tables 1 and 3). (14)(15)

  9. An integrated approach to consumer representation and involvement in a multicentre randomized controlled trial.

    Science.gov (United States)

    Langston, Anne L; McCallum, Marilyn; Campbell, Marion K; Robertson, Clare; Ralston, Stuart H

    2005-01-01

    Although, consumer involvement in individual studies is often limited, their involvement in guiding health research is generally considered to be beneficial. This paper outlines our experiences of an integrated relationship between the organisers of a clinical trial and a consumer organisation. The PRISM trial is a UK multicentre, randomized controlled trial comparing treatment strategies for Paget's disease of the bone. The National Association for the Relief of Paget's Disease (NARPD) is the only UK support group for sufferers of Paget's disease and has worked closely with the PRISM team from the outset. NARPD involvement is integral to the conduct of the trial and specific roles have included: peer-review; trial steering committee membership; provision of advice to participants, and promotion of the trial amongst Paget's disease patients. The integrated relationship has yielded benefits to both the trial and the consumer organisation. The benefits for the trial have included: recruitment of participants via NARPD contacts; well-informed participants; unsolicited patient advocacy of the trial; and interested and pro-active collaborators. For the NARPD and Paget's disease sufferers, benefits have included: increased awareness of Paget's disease; increased access to relevant health research; increased awareness of the NARPD services; and wider transfer of diagnosis and management knowledge to/from health care professionals. Our experience has shown that an integrated approach between a trial team and a consumer organisation is worthwhile. Adoption of such an approach in other trials may yield significant improvements in recruitment and quality of participant information flow. There are, however, resource implications for both parties.

  10. Alzheimer disease: An interactome of many diseases

    Directory of Open Access Journals (Sweden)

    Balaji S Rao

    2014-01-01

    Full Text Available Alzheimer Disease (AD is an outcome as well as source of many diseases. Alzheimer is linked with many other diseases like Diabetes type 2, cholesterolemia, hypertension and many more. But how each of these diseases affecting other is still unknown to scientific community. Signaling Pathways of one disease is interlinked with other disease. But to what extent healthy brain is affected when any signaling in human body is disturbed is the question that matters. There is a need of Pathway analysis, Protein-Protein interaction (PPI and the conserved interactome study in AD and linked diseases. It will be helpful in finding the potent drug or vaccine target in conscious manner. In the present research the Protein-Protein interaction of all the proteins involved in Alzheimer Disease is analyzed using ViSANT and osprey tools and pathway analysis further reveals the significant genes/proteins linking AD with other diseases.

  11. Association between periodontal diseases and systemic diseases.

    Science.gov (United States)

    Weidlich, Patrícia; Cimões, Renata; Pannuti, Claudio Mendes; Oppermann, Rui Vicente

    2008-01-01

    Current evidence suggests that periodontal disease may be associated with systemic diseases. This paper reviewed the published data about the relationship between periodontal disease and cardiovascular diseases, adverse pregnancy outcomes, diabetes and respiratory diseases, focusing on studies conducted in the Brazilian population. Only a few studies were found in the literature focusing on Brazilians (3 concerning cardiovascular disease, 7 about pregnancy outcomes, 9 about diabetes and one regarding pneumonia). Although the majority of them observed an association between periodontitis and systemic conditions, a causal relationship still needs to be demonstrated. Further studies, particularly interventional well-designed investigations, with larger sample sizes, need to be conducted in Brazilian populations.

  12. Inflammatory bowel disease and airway diseases

    Science.gov (United States)

    Vutcovici, Maria; Brassard, Paul; Bitton, Alain

    2016-01-01

    Airway diseases are the most commonly described lung manifestations of inflammatory bowel disease (IBD). However, the similarities in disease pathogenesis and the sharing of important environmental risk factors and genetic susceptibility suggest that there is a complex interplay between IBD and airway diseases. Recent evidence of IBD occurrence among patients with airway diseases and the higher than estimated prevalence of subclinical airway injuries among IBD patients support the hypothesis of a two-way association. Future research efforts should be directed toward further exploration of this association, as airway diseases are highly prevalent conditions with a substantial public health impact. PMID:27678355

  13. Association between periodontal diseases and systemic diseases

    Directory of Open Access Journals (Sweden)

    Patrícia Weidlich

    2008-08-01

    Full Text Available Current evidence suggests that periodontal disease may be associated with systemic diseases. This paper reviewed the published data about the relationship between periodontal disease and cardiovascular diseases, adverse pregnancy outcomes, diabetes and respiratory diseases, focusing on studies conducted in the Brazilian population. Only a few studies were found in the literature focusing on Brazilians (3 concerning cardiovascular disease, 7 about pregnancy outcomes, 9 about diabetes and one regarding pneumonia. Although the majority of them observed an association between periodontitis and systemic conditions, a causal relationship still needs to be demonstrated. Further studies, particularly interventional well-designed investigations, with larger sample sizes, need to be conducted in Brazilian populations.

  14. Childhood Facial Osteo Sarcoma: a Case Report

    OpenAIRE

    Farhangi, Hamid; Farzadnia, Mahdi; Alamdaran, Ali

    2015-01-01

    Osteosarcoma (OS) is the eighth common cancer of childhood and its incidence is 4 cases in one million in children younger than 14. Facial OS incidence is estimated between 8 and 10% of OS cases. The main etiology of OS is unknown, but various predisposing factors are proposed such as radiation, radiotherapy, some benign bone diseases like Paget?s disease or fibrous dysplasia. There is a 5-year survival rate of 68% and it decreases with the increase of age. Positive history of radiotherapy is...

  15. Adenomatosis erosiva del pezón Erosive adenomatosis of the nipple

    Directory of Open Access Journals (Sweden)

    R E Achenbach

    2008-12-01

    Full Text Available Comunicamos un caso de adenomatosis erosiva del pezón con correlación clínico-patológica, patología infrecuente y que debemos conocer para evitar cirugías agresivas innecesarias, dado que se presta al diagnóstico diferencial con la enfermedad de Paget y el carcinoma de mama intraductal.A case of erosive adenomatosis of the nipple is reported with a clinicopathologic correlation, an unusual disease that we, as dermatologists, should know since the differential diagnosis with the Paget's disease and the intraductal breast carcinoma can lead to unnecessary surgery.

  16. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  17. Role of ATF7-TAF12 interactions in the VDR hyper-sensitivity of osteoclast precursors in Paget’s disease

    Science.gov (United States)

    Teramachi, Jumpei; Hiruma, Yuko; Ishizuka, Seiichi; Ishizuka, Hisako; Brown, Jacques P.; Michou, Laëtitia; Cao, Huiling; Galson, Deborah L; Subler, Mark A; Zhou, Hua; Dempster, David W; Windle, Jolene J; Roodman, G. David; Kurihara, Noriyoshi

    2013-01-01

    Osteoclast (OCL) precursors from many Paget's disease (PD) patients express measles virus nucleocapsid protein (MVNP) and are hypersensitive to 1,25-(OH)2D3. The increased 1,25-(OH)2D3 sensitivity is mediated by TAF12, a co-activator of VDR, which is present at much higher levels in MVNP-expressing OCL precursors than normals. These results suggest that TAF12 plays an important role in the abnormal OCL activity in PD. However, the molecular mechanisms underlying both 1,25-(OH)2D3’s effects on OCL formation and the contribution of TAF12 to these effects in both normals and PD patients are unclear. Inhibition of TAF12 with a specific TAF12 antisense construct decreased OCL formation and OCL precursors sensitivity to 1,25-(OH)2D3 in PD patient bone marrow samples. Further, OCL-precursors from transgenic mice in which TAF12 expression was targeted to the OCL lineage (TRAP-TAF12 mice), formed OCL at very low levels of 1,25-(OH)2D3, although the OCL failed to exhibit other hallmarks of PD OCL, including RANKL hyper-sensitivity and hyper-multinucleation. ChIP analysis of OCL precursors using an anti-TAF12 antibody demonstrated that TAF12 binds the 24-hydroxylase (CYP24A1) promoter, which contains two functional vitamin D response elements (VDRE), in the presence of 1,25-(OH)2D3. Since TAF12 directly interacts with the ATF7 transcription factor and potentiates ATF7-induced transcriptional activation of ATF7-driven genes in other cell types, we determined if TAF12 is a functional partner of ATF7 in OCL precursors. Immunoprecipitation of lysates from either WT or MVNP-expressing OCL with an anti-TAF12 antibody followed by blotting with an anti-ATF7 antibody, or vice versa, showed that TAF12 and ATF7 physically interact in OCL. Knockdown of ATF7 in MVNP-expressing cells decreased CYP24A1 induction by 1,25-(OH)2D3 as well as TAF12 binding to the CYP24A1 promoter. These results show that ATF7 interacts with TAF12 and contributes to the hyper-sensitivity of OCL precursors to 1

  18. Acquired Cystic Kidney Disease

    Science.gov (United States)

    ... Kidney Disease (CKD) What Is Chronic Kidney Disease? Causes of CKD Tests & Diagnosis Managing CKD Eating Right Preventing CKD ... as polycystic kidney disease (PKD), another disease that causes the kidneys to ... chronic kidney disease (CKD)—a condition that develops over many years ...

  19. Lyme Disease (For Parents)

    Science.gov (United States)

    ... Teaching Kids to Be Smart About Social Media Lyme Disease KidsHealth > For Parents > Lyme Disease Print A A ... en español La enfermedad de Lyme What Is Lyme Disease? Lyme disease is the leading tick-borne disease ...

  20. Virus diseases of fish

    Science.gov (United States)

    Watson, Stanley W.

    1954-01-01

    Viruses are probably the cause of a wide spectrum of fish diseases. Although relatively few virus diseases of fish are known today, some of the diseases of unknown etiology, as well as some diseases presently accepted as due to bacteria, protozoa, fungi or nutritional deficiencies, possibly will be recognized eventually as virus diseases.

  1. KEGG DISEASE / Acute encephalitis [KEGG DISEASE

    Lifescience Database Archive (English)

    Full Text Available DISEASE: H01417 Entry H01417Disease Name Acute encephalitis Description Acute encep...ns Infections caused by dsDNA viruses H01417Acute encephalitis Human diseases in ICD-10 classification [BR:b...of the central nervous system G04Encephalitis, myelitis and encephalomyelitis H01417Acute encephalitis Patho...elines for management. Journal Eur J Neurol 12:331-43 (2005) KEGG DISEASE / Acute encephalitis ...

  2. Coronary Artery Disease - Coronary Heart Disease

    Science.gov (United States)

    ... result of coronary artery disease, or CAD, said Edward A. Fisher, M.D., Ph.D., M.P. ... Problems and Disease • High Blood Pressure (HBP) • Metabolic Syndrome • Pericarditis • Peripheral Artery Disease (PAD) • Stroke • Vascular Health • ...

  3. KEGG DISEASE / Acute alcohol sensitivity [KEGG DISEASE

    Lifescience Database Archive (English)

    Full Text Available DISEASE: H01071 Entry H01071Disease Name Acute alcohol sensitivity Description Alde...bolism Congenital disorders of carbohydrate metabolism H01071Acute alcohol sensit...eases. Journal Cardiovasc Res 88:51-7 (2010) KEGG DISEASE / Acute alcohol sensitivity ...

  4. Lysosomal storage disease 2 - Pompe's disease

    NARCIS (Netherlands)

    van der Ploeg, Ans T.; Reuser, Arnold J. J.

    2008-01-01

    Pompe's disease, glycogen-storage disease type II, and acid maltase deficiency are alternative names for the same metabolic disorder. It is a pan-ethnic autosomal recessive trait characterised by acid alpha-glucosidase deficiency leading to lysosomal glycogen storage. Pompe's disease is also

  5. Anemia of chronic disease

    Science.gov (United States)

    ... disease Long-term infections, such as bacterial endocarditis, osteomyelitis (bone infection), HIV/AIDS , hepatitis B or hepatitis ... disease Crohn disease Erythropoietin test Juvenile idiopathic arthritis Osteomyelitis Rheumatic fever Ulcerative colitis Review Date 2/1/ ...

  6. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... Parkinson's Disease Cognition: A Mind Guide to Parkinson’s Disease Nutrition Matters Speech and Swallowing Psychosis: A Mind Guide to Parkinson's Disease Guide to Deep Brain Stimulation You Can Make ...

  7. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... and Social Network? How Does Parkinson's Disease Affect Memory? How Does Parkinson's Disease Affect the Urinary System? ... Parkinson's Disease Patients with a Depression Diagnosis? What Type of Exercise or Exercise Programs Are Recommended? What ...

  8. Newcastle Disease Virus (PDQ)

    Science.gov (United States)

    ... Professionals Questions to Ask about Your Treatment Research Newcastle Disease Virus (PDQ®)–Patient Version Overview Go to ... cancer (see Question 8 ). Questions and Answers About Newcastle Disease Virus What is Newcastle disease virus? Newcastle ...

  9. Learn About Neuromuscular Disease

    Science.gov (United States)

    ... Inherited and Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Muscular Dystrophy (MMD) Spinal-Bulbar Muscular ... Deficient Congenital Muscular Dystrophy Metabolic Diseases of Muscle Mitochondrial Myopathy Miyoshi Distal Myopathy Motor Neurone Disease Muscle-Eye- ...

  10. Autoimmune liver disease panel

    Science.gov (United States)

    Liver disease test panel - autoimmune ... Autoimmune disorders are a possible cause of liver disease. The most common of these diseases are autoimmune hepatitis and primary biliary cholangitis (formerly called primary biliary cirrhosis). This group of tests ...

  11. Liver Disease and IBD

    Science.gov (United States)

    ... Home > Resources > Liver Disease and IBD Go Back Liver Disease and IBD Email Print + Share Several complications ... be necessary to make the definitive diagnosis. FATTY LIVER DISEASE (HEPATCI STEATOSIS) This is the most common ...

  12. Leprosy (Hansen's Disease)

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Leprosy (Hansen's Disease) Leprosy (Hansen's Disease) is a chronic ... as Mycobacterium leprae . Why Is the Study of Leprosy (Hansen's Disease) a Priority for NIAID? At the ...

  13. Reflux and Lung Disease

    Science.gov (United States)

    ... Healthy Eating Reflux and Lung Disease Reflux and Lung Disease Make an Appointment Ask a Question Find a Doctor Many people with chronic lung disease also suffer from gastroesophageal reflux (GERD). In this ...

  14. Tay-Sachs Disease

    Science.gov (United States)

    Tay-Sachs disease is a rare, inherited disease. It is a type of lipid metabolism disorder. It ... cells, causing mental and physical problems. . Infants with Tay-Sachs disease appear to develop normally for the ...

  15. Diabetic Heart Disease

    Science.gov (United States)

    ... be coronary heart disease (CHD), heart failure, and diabetic cardiomyopathy. Diabetes by itself puts you at risk for heart disease. Other risk factors include Family history of heart disease Carrying extra ...

  16. Heart Disease (For Kids)

    Science.gov (United States)

    ... CPR: A Real Lifesaver Kids Talk About: Coaches Heart Disease KidsHealth > For Kids > Heart Disease Print A A ... chest pain, heart attacks, and strokes . What Is Heart Disease? The heart is the center of the cardiovascular ...

  17. Heart Diseases and Disorders

    Science.gov (United States)

    ... Resources Heart Diseases & Disorders Back to Patient Resources Heart Diseases & Disorders Millions of people experience irregular heartbeats, called ... harmless and happen in healthy people free of heart disease. However, some abnormal heart rhythms can be serious ...

  18. Parkinson disease - discharge

    Science.gov (United States)

    Your doctor has told you that you have Parkinson disease . This disease affects the brain and leads to ... have you take different medicines to treat your Parkinson disease and many of the problems that may come ...

  19. What Is Parkinson's Disease?

    Science.gov (United States)

    ... resources & more. Order Free Materials Today What is Parkinson’s Disease? Parkinson's disease (PD) is a chronic and progressive movement disorder, ... million people in the US are living with Parkinson's disease. The cause is unknown, and although there is ...

  20. Cardiovascular Disease and Diabetes

    Science.gov (United States)

    ... Disease Venous Thromboembolism Aortic Aneurysm More Cardiovascular Disease & Diabetes Updated:Apr 14,2017 The following statistics speak ... disease. This content was last reviewed August 2015. Diabetes • Home • About Diabetes • Why Diabetes Matters Introduction Cardiovascular ...

  1. Heart Disease Risk Factors

    Science.gov (United States)

    ... Hearts® WISEWOMAN Program Other Chronic Disease Topics Diabetes Nutrition Obesity Physical Activity Stroke Heart Disease Risk Factors Recommend ... Hearts® WISEWOMAN Program Other Chronic Disease Topics Diabetes Nutrition Obesity Physical Activity Stroke File Formats Help: How do ...

  2. Lyme disease (image)

    Science.gov (United States)

    Lyme disease is an acute inflammatory disease characterized by skin changes, joint inflammation and symptoms similar to the ... that is caused by the bacterium Borrelia burgdorferi . Lyme disease is transmitted by the bite of a deer ...

  3. Kidney Disease (Nephropathy)

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Kidney Disease (Nephropathy) Kidneys are remarkable organs. Inside them ... resulting in kidney disease. How Does Diabetes Cause Kidney Disease? When our bodies digest the protein we ...

  4. Learning about Dercum Disease

    Science.gov (United States)

    ... About Dercum Disease Specific Genetic Disorders Specific Genetic Disorders Learning About Prostate Cancer See Also: Talking Glossary of ... Definitions for genetic terms used on this page. Learning About Dercum Disease What is Dercum disease? What are the symptoms ...

  5. Learning about Parkinson's Disease

    Science.gov (United States)

    ... About Parkinson's Disease Specific Genetic Disorders Specific Genetic Disorders Learning About Prostate Cancer See Also: Talking Glossary of ... diseases Journal of Biological Chemistry , June 9, 2011 Learning About Parkinson's Disease What do we know about heredity and Parkinson's ...

  6. Pediatric Celiac Disease

    Science.gov (United States)

    ... of Pediatric Gastroenterology and Nutrition Nurses Print Share Celiac Disease Many kids have sensitivities to certain foods, and ... protein found in wheat, rye, and barley. Pediatric Celiac Disease If your child has celiac disease, consuming gluten ...

  7. Eye Disease Simulations

    Science.gov (United States)

    ... USAJobs Home > Eye Health Information > Eye Disease Simulations Eye Disease Simulations Age-Related Macular Degeneration Cataract Diabetic ... information page Back to top Diabetic Retinopathy Diabetic Eye Disease information page Back to top Glaucoma Glaucoma ...

  8. Diabetic Eye Disease

    Science.gov (United States)

    ... Other Dental Problems Diabetes & Sexual & Urologic Problems Diabetic Eye Disease What is diabetic eye disease? Diabetic eye disease is a group of ... loss can occur. How does diabetes affect my eyes? Diabetes affects your eyes when your blood glucose, ...

  9. Understanding cardiovascular disease

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000759.htm Understanding cardiovascular disease To use the sharing features on this page, ... lead to heart attack or stroke. Types of Cardiovascular Disease Coronary heart disease (CHD) is the most common ...

  10. Menopause and Heart Disease

    Science.gov (United States)

    ... Peripheral Artery Disease Venous Thromboembolism Aortic Aneurysm More Menopause and Heart Disease Updated:Jun 23,2017 Heart ... can become more evident after the onset of menopause. Menopause does not cause cardiovascular diseases . However, certain ...

  11. Cholestatic liver disease masquerading as Wilson disease.

    Science.gov (United States)

    Sood, Vikrant; Rawat, Dinesh; Khanna, Rajeev; Alam, Seema

    2015-03-01

    Wilson disease and cholestatic liver diseases may present as a diagnostic dilemma if standard guidelines incorporating markers of copper overload are followed. We hereby present a series of four cases of sclerosing cholangitis masquerading as Wilson disease. True Wilson disease cases had significantly lower ceruloplasmin (6 vs. 16 mg/dL) and higher 24-hour urinary copper (322.3 vs. 74.5 μg/day) as compared to mimickers. Initial low serum ceruloplasmin levels normalized in mimickers on follow up, and this may used as a diagnostic indicator. Standard Wilson disease diagnostic criteria thus need further modification especially in developing countries to help avoid mismanagement.

  12. Disease cycle approach to plant disease prediction.

    Science.gov (United States)

    De Wolf, Erick D; Isard, Scott A

    2007-01-01

    Plant disease cycles represent pathogen biology as a series of interconnected stages of development including dormancy, reproduction, dispersal, and pathogenesis. The progression through these stages is determined by a continuous sequence of interactions among host, pathogen, and environment. The stages of the disease cycle form the basis of many plant disease prediction models. The relationship of temperature and moisture to disease development and pathogen reproduction serve as the basis for most contemporary plant disease prediction systems. Pathogen dormancy and inoculum dispersal are considered less frequently. We found extensive research efforts evaluating the performance of prediction models as part of operation disease management systems. These efforts appear to be greater than just a few decades ago, and include novel applications of Bayesian decision theory. Advances in information technology have stimulated innovations in model application. This trend must accelerate to provide the disease management strategies needed to maintain global food supplies.

  13. Rheumatoid lung disease

    Science.gov (United States)

    Lung disease - rheumatoid arthritis; Rheumatoid nodules; Rheumatoid lung ... They often cause no symptoms. The cause of lung disease associated with rheumatoid arthritis is unknown. Sometimes, the ...

  14. Liver in systemic disease

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Potential causes of abnormal liver function tests include viral hepatitis, alcohol intake, nonalcoholic fatty liver disease, autoimmune liver diseases, hereditary diseases, hepatobiliary malignancies or infection, gallstones and drug-induced liver injury. Moreover, the liver may be involved in systemic diseases that mainly affect other organs. Therefore, in patients without etiology of liver injury by screening serology and diagnostic imaging, but who have systemic diseases, the abnormal liver function test results might be caused by the systemic disease. In most of these patients, the systemic disease should be treated primarily. However, some patients with systemic disease and severe liver injury or fulminant hepatic failure require intensive treatments of the liver.

  15. Fibrous Dysplasia

    Science.gov (United States)

    ... Size | S S M M L L Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics News Glossary ... focus(); */ } //--> Print-Friendly Page Home Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics About Us ...

  16. Osteopetrosis Overview

    Science.gov (United States)

    ... Size | S S M M L L Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics News Glossary ... focus(); */ } //--> Print-Friendly Page Home Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics About Us ...

  17. Biomarker for Glycogen Storage Diseases

    Science.gov (United States)

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  18. [Wilson's disease: clinical spectrum of liver disease].

    Science.gov (United States)

    Ochoa Palominos, Alejandra; Ibáñez Samaniego, Luis; Catalina Rodríguez, María-Vega; Pajares Díaz, José; Clemente Ricote, Gerardo

    2013-02-01

    Wilson's disease is a hereditary autosomal recessive disorder of copper metabolism,characterized by copper accumulation in the liver and brain. This rare entity, which has a broad clinical spectrum, is often difficult to diagnose and should therefore always be suspected in patients with liver disease of unclear cause. We describe two types of manifestation of liver disease in two patients; the first developed fulminant hepatic failure requiring urgent liver transplantation and the second showed advanced chronic liver disease and received standard medical treatment. The objective of this clinical observation is to analyze the diagnosis of Wilson's disease in two patients with distinct onset, illustrating the broad clinical spectrum of the disease, and its treatment.

  19. Interstitial Lung Diseases

    Science.gov (United States)

    Interstitial lung disease is the name for a large group of diseases that inflame or scar the lungs. The inflammation and scarring make it hard to ... air is responsible for some types of interstitial lung diseases. Specific types include Black lung disease among ...

  20. What Causes Heart Disease?

    Science.gov (United States)

    ... page from the NHLBI on Twitter. What Causes Heart Disease? Research suggests that coronary heart disease (CHD) begins with damage to the lining and ... causing coronary microvascular disease (MVD). Coronary MVD is heart disease that affects the heart's tiny arteries. The cause ...

  1. PERIANAL CROHNS-DISEASE

    NARCIS (Netherlands)

    HOEDEMAKER, HOT

    1994-01-01

    Perianal disease in Crohn's disease is a difficult matter to deal with. The indication for therapy is not always clear in this disease with a relatively mild natural course. More confusion is caused by the fact that not all disease in the perianal region in a patient with Crohn's has to be Crohn-rel

  2. Occupational skin diseases

    DEFF Research Database (Denmark)

    Mahler, Vera; Aalto-Korte, Kristiina; Alfonso, Jose Hernan

    2017-01-01

    BACKGROUND: Work-related skin diseases (WSD) are caused or worsened by a professional activity. Occupational skin diseases (OSD) need to fulfil additional legal criteria which differ from country to country. OSD range amongst the five most frequently notified occupational diseases (musculoskeletal...... diseases, neurologic diseases, lung diseases, diseases of the sensory organs, skin diseases) in Europe. OBJECTIVE: To retrieve information and compare the current state of national frameworks and pathways to manage patients with occupational skin disease with regard to prevention, diagnosis, treatment...... in Science and Technology (COST) Action TD 1206 (StanDerm) (www.standerm.eu). RESULTS: Besides a national health service or a statutory health insurance, most European member states implemented a second insurance scheme specifically geared at occupational diseases [insurance against occupational risks...

  3. [Periodontal disease in pediatric rheumatic diseases].

    Science.gov (United States)

    Fabri, Gisele M C; Savioli, Cynthia; Siqueira, José T; Campos, Lucia M; Bonfá, Eloisa; Silva, Clovis A

    2014-01-01

    Gingivitis and periodontitis are immunoinflammatory periodontal diseases characterized by chronic localized infections usually associated with insidious inflammation This narrative review discusses periodontal diseases and mechanisms influencing the immune response and autoimmunity in pediatric rheumatic diseases (PRD), particularly juvenile idiopathic arthritis (JIA), childhood-onset systemic lupus erythematosus (C-SLE) and juvenile dermatomyositis (JDM). Gingivitis was more frequently observed in these diseases compared to health controls, whereas periodontitis was a rare finding. In JIA patients, gingivitis and periodontitis were related to mechanical factors, chronic arthritis with functional disability, dysregulation of the immunoinflammatory response, diet and drugs, mainly corticosteroids and cyclosporine. In C-SLE, gingivitis was associated with longer disease period, high doses of corticosteroids, B-cell hyperactivation and immunoglobulin G elevation. There are scarce data on periodontal diseases in JDM population, and a unique gingival pattern, characterized by gingival erythema, capillary dilation and bush-loop formation, was observed in active patients. In conclusion, gingivitis was the most common periodontal disease in PRD. The observed association with disease activity reinforces the need for future studies to determine if resolution of this complication will influence disease course or severity.

  4. Huntington’s Disease

    Science.gov (United States)

    2012-05-01

    New advances in disease testing and diagnosis, such as genetic testing , now provide increased means for disease diagnosis but also possible therapeutic...treatments. Indeed, according to some experts, genetic testing and therapy may be key to future disease detection, therapy, and even prevention. In...associated with its long-term management. 15. SUBJECT TERMS Neurological disease , genetic testing , aeromedical concerns, Huntington’s disease 16

  5. Genetic diseases in adults.

    Science.gov (United States)

    Kolettis, Peter N

    2003-02-01

    Genetic diseases that do not primarily affect the genitourinary tract may have urologic manifestations. These urologic manifestations range from benign and malignant renal disease to infertility. Thus, the practicing urologist may be involved in the care of these patients and should have knowledge of these diseases. Continued improvements in the diagnosis and treatment of these genetic diseases will likely result in improved survival and will increase the number of patients who may develop urologic manifestations of these diseases.

  6. Pregnancy and periodontal disease

    OpenAIRE

    SAĞLAM, Ebru; SARUHAN, Nesrin; Çanakçı, Cenk Fatih

    2015-01-01

    Some maternal immunological changes due to pregnancy increases susceptibility to infections. Periodontal disease, the main cause is plaque, is a common disease which is seen multifactorial and varying severity. There are many clinical criteria for diagnosis of periodontal disease. Correlation between pregnancy and periodontal inflammation is known for many years. Periodontal disease affects pregnant’s systemic condition and also has negative effects on fetus. Periodontal disease increases the...

  7. The Relationship Between Fatty Liver Disease and Periodontal Disease

    Science.gov (United States)

    2017-03-22

    Periodontitis is a highly prevalent and destructive chronic disease. Numerous studies support an association between periodontal disease and other...systemic diseases ( diabetes , cardiovascular disease, chronic kidney disease, adverse pregnancy outcome, etc.). Non-alcoholic fatty liver disease is a...destruction seen in periodontal disease. The association between the two diseases has never been investigated. A reasonable mechanism in which periodontal

  8. Tay-Sachs Disease

    Science.gov (United States)

    ... Craniosynostosis Information Page Creutzfeldt-Jakob Disease Information Page Cushing's Syndrome Information Page Dandy-Walker Syndrome Information Page Deep Brain Stimulation for Parkinson's Disease Information Page Dementia Information ...

  9. Infantile Refsum Disease

    Science.gov (United States)

    ... Craniosynostosis Information Page Creutzfeldt-Jakob Disease Information Page Cushing's Syndrome Information Page Dandy-Walker Syndrome Information Page Deep Brain Stimulation for Parkinson's Disease Information Page Dementia Information ...

  10. What Is Kawasaki Disease?

    Science.gov (United States)

    ANSWERS by heart Cardiovascular Conditions What is Kawasaki Disease? Kawasaki disease is a children’s illness. It’s also known as Kawasaki syndrome or mucocutaneous lymph node syndrome. About 75 percent of people ...

  11. Mitral Valve Disease

    Science.gov (United States)

    ... for more information on procedures, news, and pre- & post-operative care. Section Navigation Select Topic Aortic Valve Disease ... is most commonly caused by inflammation from rheumatic fever, a disease that is related to strep infections; ...

  12. Treatments for Alzheimer's Disease

    Science.gov (United States)

    ... 3900 Find your chapter: search by state Home > Alzheimer's Disease > Treatments Overview What Is Dementia? What Is Alzheimer's? ... and move closer to a cure. Treatments for Alzheimer's disease Currently, there is no cure for Alzheimer's. But ...

  13. Heart Diseases--Prevention

    Science.gov (United States)

    ... you have a close family member who had heart disease at an early age. Fortunately, there are many things you can do reduce your chances of getting heart disease. You should Know your blood pressure and keep ...

  14. Lyme disease antibody

    Science.gov (United States)

    ... JavaScript. The Lyme disease blood test looks for antibodies in the blood to the bacteria that causes ... needed. A laboratory specialist looks for Lyme disease antibodies in the blood sample using the ELISA test . ...

  15. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... Care: Real Stories Betsaida Cruz, PT, Long Beach Memorial Medicinal: “Terapia fisica para el Parkinson” Building a ... and Social Network? How Does Parkinson's Disease Affect Memory? How Does Parkinson's Disease Affect the Urinary System? ...

  16. Addison's Disease: Treatment

    Science.gov (United States)

    Addison's disease Diagnosis Your doctor will talk to you first about your medical history and your signs and ... If your doctor thinks that you may have Addison's disease, you may undergo some of the following tests: ...

  17. Alcoholic liver disease

    Science.gov (United States)

    Liver disease due to alcohol; Cirrhosis or hepatitis - alcoholic; Laennec's cirrhosis ... Alcoholic liver disease occurs after years of heavy drinking. Over time, scarring and cirrhosis can occur. Cirrhosis is the ...

  18. Chronic granulomatous disease

    Science.gov (United States)

    CGD; Fatal granulomatosis of childhood; Chronic granulomatous disease of childhood; Progressive septic granulomatosis ... In chronic granulomatous disease (CGD), immune system cells called phagocytes are unable to kill some types of bacteria and ...

  19. Valvular heart disease

    OpenAIRE

    Gelson, E; Gatzoulis, M; Johnson, M.

    2007-01-01

    Valvular disease may be unmasked in pregnancy when physiological changes increase demands on the heart. Women with valvular heart disease require close follow-up during pregnancy, delivery, and postpartum

  20. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... Use for Freezing? Are There Any Ways to Control the Rate of Progression of the Disease? Ask ... Memory? How Does Parkinson's Disease Affect the Urinary System? How Does Speech Therapy Help Parkinson's Patients? How ...

  1. Celiac disease - nutritional considerations

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/002443.htm Celiac disease - nutritional considerations To use the sharing features on this page, please enable JavaScript. Celiac disease is an immune disorder passed down through families. ...

  2. Hypothyroidism and Heart Disease

    Science.gov (United States)

    ... in Balance › Hypothyroidism and Heart Disease Fact Sheet Hypothyroidism and Heart Disease January 2014 Download PDFs English ... nervous system, body temperature, and weight. What is hypothyroidism and what are its symptoms? Hypothyroidism, also called ...

  3. Genetic Disease Foundation

    Science.gov (United States)

    ... mission to help prevent, manage and treat inherited genetic diseases. View our latest News Brief here . You can ... contributions to the diagnosis, prevention and treatment of genetic diseases. Learn how advances at Mount Sinai have impacted ...

  4. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... Sexual Functioning? How Does Depression Affect the Patient's Family and Social Network? How Does Parkinson's Disease Affect Memory? How Does Parkinson's Disease Affect the Urinary System? How Does Speech Therapy Help Parkinson's Patients? How ...

  5. Pediatric inflammatory bowel disease

    Institute of Scientific and Technical Information of China (English)

    Karen A Diefenbach; Christopher K Breuer

    2006-01-01

    Inflammatory bowel disease is an important cause of gastrointestinal pathology in children and adolescents.The incidence of pediatric inflammatory bowel disease is increasing; therefore, it is important for the clinician to be aware of the presentation of this disease in the pediatric population. Laboratory tests, radiology studies,and endoscopic procedures are helpful in diagnosing inflammatory bowel disease and differentiating between Crohn's disease and ulcerative colitis. Once diagnosed,the goal of medical management is to induce remission of disease while minimizing the side effects of the medication. Specific attention needs to be paid to achieving normal growth in this susceptible population.Surgical management is usually indicated for failure of medical management, complication, or malignancy.Algorithms for diagnostic evaluation and treatment of pediatric inflammatory bowel disease are presented.The specific psychosocial issues facing these patients are also discussed in this review as are the future goals of research in the complex problem of pediatric inflammatory bowel disease.

  6. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... Disease Nutrition Matters Speech and Swallowing Psychosis: A Mind Guide to Parkinson's Disease Guide to Deep Brain Stimulation You Can Make A Difference Your donation to the National Parkinson Foundation goes ...

  7. American Behcet's Disease Association

    Science.gov (United States)

    ... Behcet's Awareness Day Behcet's Disease Awareness Share your story and educate others about Behcet's: www.rareconnect.org/en/community/behcet-s-syndrome Upcoming Events American Behcet's Disease Association PO BOX 80576 Rochester, MI ...

  8. What Is Parkinson's Disease?

    Science.gov (United States)

    ... million people in the US are living with Parkinson's disease. The cause is unknown, and although there is presently no ... a Diagnosis What is Parkinson’s Disease? ... Trials Statistics on Parkinson's What's New In Parkinson's Research? What's in the ...

  9. Sickle Cell Disease

    Science.gov (United States)

    ... About Us Overview of CDC’s work. Advancements in Sickle Cell Disease New supplement from the American Journal of Preventive Medicine describes the state of sickle cell disease related care in the United States. Read Supplement ...

  10. Learning about Huntington's Disease

    Science.gov (United States)

    ... Mouse Models Of Huntington's Disease 1998 News Release Learning About Huntington's Disease What do we know about ... and treatment information. Hosted by the Dolan DNA Learning Center at Cold Spring Harbor Laboratory. Huntington's Outreach ...

  11. Congenital heart disease

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001114.htm Congenital heart disease To use the sharing features on this page, please enable JavaScript. Congenital heart disease (CHD) is a problem with the heart's structure ...

  12. Aspirin and heart disease

    Science.gov (United States)

    ... medlineplus.gov/ency/patientinstructions/000092.htm Aspirin and heart disease To use the sharing features on this page, ... healthy people who are at low risk for heart disease. You provider will consider your overall medical condition ...

  13. Cyanotic heart disease

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001104.htm Cyanotic heart disease To use the sharing features on this page, please enable JavaScript. Cyanotic heart disease refers to a group of many different heart ...

  14. Managing Your Parkinson's Disease

    Science.gov (United States)

    ... Patient Advocates Sign Up for Funding News npj Parkinson's Disease Scientific Advisory Board Understanding Parkinson's Coping with a Diagnosis What is Parkinson’s Disease? National HelpLine Educational Publications Online Seminars Parkinson's News ...

  15. Pain in Parkinson's Disease

    Science.gov (United States)

    ... Patient Advocates Sign Up for Funding News npj Parkinson's Disease Scientific Advisory Board Understanding Parkinson's Coping with a Diagnosis What is Parkinson’s Disease? National HelpLine Educational Publications Online Seminars Parkinson's News ...

  16. Parkinson's Disease Foundation Newsletter

    Science.gov (United States)

    ... Patient Advocates Sign Up for Funding News npj Parkinson's Disease Scientific Advisory Board Understanding Parkinson's Coping with a Diagnosis What is Parkinson’s Disease? National HelpLine Educational Publications Online Seminars Parkinson's News ...

  17. Parkinson's Disease Foundation

    Science.gov (United States)

    ... Patient Advocates Sign Up for Funding News npj Parkinson's Disease Scientific Advisory Board Understanding Parkinson's Coping with a Diagnosis What is Parkinson’s Disease? National HelpLine Educational Publications Online Seminars Parkinson's News ...

  18. Diabetes and Kidney Disease

    Science.gov (United States)

    ... disease of diabetes, or diabetic nephropathy. How does diabetes cause kidney disease? High blood glucose , also called ... I keep my kidneys healthy if I have diabetes? The best way to slow or prevent diabetes- ...

  19. Pediatric Celiac Disease

    Science.gov (United States)

    ... Free Diet Guide Eosinophilic Esophagitis Inflammatory Bowel Disease Nutrition & Obesity Reflux & GERD Search Keyword Connect with Facebook Additional ... Nutrition (NASPGHAN) Celiac Disease Eosinophilic Esophagitis Pediatric IBD Nutrition & Obesity Reflux & GERD Research & Grants Our Supporters Site Map © ...

  20. Chronic Kidney Diseases

    Science.gov (United States)

    ... Room? What Happens in the Operating Room? Chronic Kidney Diseases KidsHealth > For Kids > Chronic Kidney Diseases Print ... re talking about your kidneys. What Are the Kidneys? Your kidneys are tucked under your lower ribs ...

  1. Polycystic kidney disease

    Science.gov (United States)

    Cysts - kidneys; Kidney - polycystic; Autosomal dominant polycystic kidney disease; ADPKD ... Polycystic kidney disease (PKD) is passed down through families (inherited). The 2 inherited forms of PKD are autosomal dominant ...

  2. Kidney Disease Basics

    Science.gov (United States)

    ... Links Take the first step Alternate Language URL Kidney Disease Basics Page Content Your kidneys filter extra ... blood pressure are the most common causes of kidney disease. ​These conditions can slowly damage the kidneys ...

  3. Diet - chronic kidney disease

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/002442.htm Diet - chronic kidney disease To use the sharing features on this page, ... make changes to your diet when you have chronic kidney disease. These changes may include limiting fluids, eating a ...

  4. Feline corneal disease.

    Science.gov (United States)

    Moore, Phillip Anthony

    2005-05-01

    The cornea is naturally transparent. Anything that interferes with the cornea's stromal architecture, contributes to blood vessel migration, increases corneal pigmentation, or predisposes to corneal edema, disrupts the corneas transparency and indicates corneal disease. The color, location, and shape and pattern of a corneal lesion can help in determining the underlying cause for the disease. Corneal disease is typically divided into congenital or acquired disorders. Congenital disorders, such as corneal dermoids are rare in cats, whereas acquired corneal disease associated with nonulcerative or ulcerative keratitis is common. Primary ocular disease, such as tear film instability, adenexal disease (medial canthal entropion, lagophthalmus, eyelid agenesis), and herpes keratitis are associated with the majority of acquired corneal disease in cats. Proliferative/eosinophilic keratitis, acute bullous keratopathy, and Florida keratopathy are common feline nonulcerative disorders. Nonprogressive ulcerative disease in cats, such as chronic corneal epithelial defects and corneal sequestration are more common than progressive corneal ulcerations.

  5. Carotid Artery Disease

    Science.gov (United States)

    ... Kawasaki Disease Long Q-T Syndrome Marfan Syndrome Metabolic Syndrome Mitral Valve Prolapse Myocardial Bridge Myocarditis Obstructive Sleep Apnea Pericarditis Peripheral Vascular Disease Rheumatic Fever Sick Sinus Syndrome Silent Ischemia Stroke Sudden ...

  6. Creutzfeldt-Jakob disease

    Science.gov (United States)

    ... part of a funeral ritual) Scrapie (found in sheep) Other very rare inherited human diseases, such as ... markers that sometimes occur with the disease CT scan of the brain Electroencephalogram (EEG) MRI of the ...

  7. Autoimmune Inner Ear Disease

    Science.gov (United States)

    ... Find an ENT Doctor Near You Autoimmune Inner Ear Disease Autoimmune Inner Ear Disease Patient Health Information ... with a hearing loss. How Does the Healthy Ear Work? The ear has three main parts: the ...

  8. [Depression and neurological diseases].

    Science.gov (United States)

    Piber, D; Hinkelmann, K; Gold, S M; Heesen, C; Spitzer, C; Endres, M; Otte, C

    2012-11-01

    In many neurological diseases a depressive syndrome is a characteristic sign of the primary disease or is an important comorbidity. Post-stroke depression, for example, is a common and relevant complication following ischemic brain infarction. Approximately 4 out of every 10 stroke patients develop depressive disorders in the course of the disease which have a disadvantageous effect on the course and the prognosis. On the other hand depression is also a risk factor for certain neurological diseases as was recently demonstrated in a meta-analysis of prospective cohort studies which revealed a much higher stroke risk for depressive patients. Furthermore, depression plays an important role in other neurological diseases with respect to the course and quality of life, such as Parkinson's disease, multiple sclerosis and epilepsy. This article gives a review of the most important epidemiological, pathophysiological and therapeutic aspects of depressive disorders as a comorbidity of neurological diseases and as a risk factor for neurological diseases.

  9. Sickle Cell Disease Quiz

    Science.gov (United States)

    ... Websites About Us Information For... Media Policy Makers Sickle Cell Disease Quiz Language: English Español (Spanish) Recommend on ... 1. True or False: Only African Americans get sickle cell disease. A True B False 2. True or ...

  10. Degenerative Nerve Diseases

    Science.gov (United States)

    Degenerative nerve diseases affect many of your body's activities, such as balance, movement, talking, breathing, and heart function. Many of these diseases are genetic. Sometimes the cause is a medical ...

  11. Sexually Transmitted Diseases

    Science.gov (United States)

    Sexually transmitted diseases (STDs) are infections that are passed from one person to another through sexual contact. The causes of STDs ... often help with the symptoms and keep the disease under control. Correct usage of latex condoms greatly ...

  12. Celiac disease - sprue

    Science.gov (United States)

    ... Gluten intolerance; Gluten-sensitive enteropathy; Gluten-free diet celiac disease ... The exact cause of celiac disease is unknown. The lining of the intestines have small areas called villi which project outward into the opening of the ...

  13. Celiac Disease Tests

    Science.gov (United States)

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Celiac Disease Antibody Tests Share this page: Was this page ... else I should know? How is it used? Celiac disease antibody tests are primarily used to help diagnose ...

  14. Coronary Artery Disease

    Science.gov (United States)

    Coronary artery disease (CAD) is the most common type of heart disease. It is the leading cause of death ... happens when the arteries that supply blood to heart muscle become hardened and narrowed. This is due ...

  15. Women and Parasitic Diseases

    Science.gov (United States)

    ... Resources How to Find A Physician Diagnosis of Parasitic Diseases Statistics More Information Get Email Updates To receive ... often need special consideration when being treated for parasitic diseases in order to avoid harm to the fetus, ...

  16. Diagnosis of Parasitic Diseases

    Science.gov (United States)

    ... Laboratory Diagnostic Assistance [DPDx] Parasites Home Diagnosis of Parasitic Diseases Recommend on Facebook Tweet Share Compartir On this ... the United States cannot diagnose parasites? How are parasitic diseases diagnosed? Many kinds of lab tests are available ...

  17. Collagen vascular disease

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001223.htm Collagen vascular disease To use the sharing features on this ... previously said to have "connective tissue" or "collagen vascular" disease. We now have names for many specific ...

  18. Pelizaeus-Merzbacher Disease

    Science.gov (United States)

    ... diseases associated with PLP1, which also includes Spastic Paraplegia Type 2 (SPG2). The PLP1-related disorders span ... diseases associated with PLP1, which also includes Spastic Paraplegia Type 2 (SPG2). The PLP1-related disorders span ...

  19. Lewy Body Disease

    Science.gov (United States)

    Lewy body disease is one of the most common causes of dementia in the elderly. Dementia is the loss ... enough to affect normal activities and relationships. Lewy body disease happens when abnormal structures, called Lewy bodies, ...

  20. Parkinson's Disease Videos

    Medline Plus

    Full Text Available ... Parkinson's Disease Affect the Urinary System? How Does Speech Therapy Help Parkinson's Patients? How Does the DBS ... A Mind Guide to Parkinson’s Disease Nutrition Matters Speech and Swallowing Psychosis: A Mind Guide to Parkinson's ...