WorldWideScience

Sample records for extracting extracellular dna

  1. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  2. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  3. Extracellular DNA metabolism in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Scott eChimileski

    2014-02-01

    Full Text Available Extracellular DNA is found in all environments and is a dynamic component of the micro-bial ecosystem. Microbial cells produce and interact with extracellular DNA through many endogenous mechanisms. Extracellular DNA is processed and internalized for use as genetic information and as a major source of macronutrients, and plays several key roles within prokaryotic biofilms. Hypersaline sites contain some of the highest extracellular DNA con-centrations measured in nature–a potential rich source of carbon, nitrogen and phosphorus for halophilic microorganisms. We conducted DNA growth studies for the halophilic archaeon Haloferax volcanii DS2 and show that this model Halobacteriales strain is capable of using exogenous double-stranded DNA as a nutrient. Further experiments with varying medium composition, DNA concentration and DNA types revealed that DNA is utilized primarily as a phosphorus source, that growth on DNA is concentration-dependent and that DNA isolated from different sources is metabolized selectively, with a bias against highly divergent methylated DNA sources. Additionally, fluorescence microscopy experiments showed that labeled DNA colocalized with Haloferax volcanii cells. The gene Hvo_1477 was also identified using a comparative genomic approach as a factor likely to be involved in extracellular DNA processing at the cell surface, and deletion of Hvo_1477 created an H. volcanii strain deficient in its ability to grow on extracellular DNA. Widespread distribution of Hvo_1477 homologs in archaea suggests metabolism of extracellular DNA may be of broad ecological and physiological relevance in this domain of life.

  4. Relevance of extracellular DNA in rhizosphere

    Science.gov (United States)

    Pietramellara, Giacomo; Ascher, Judith; Baraniya, Divyashri; Arfaioli, Paola; Ceccherini, Maria Teresa; Hawes, Martha

    2013-04-01

    One of the most promising areas for future development is the manipulation of the rhizosphere to produce sustainable and efficient agriculture production systems. Using Omics approaches, to define the distinctive features of eDNA systems and structures, will facilitate progress in rhizo-enforcement and biocontrol studies. The relevance of these studies results clear when we consider the plethora of ecological functions in which eDNA is involved. This fraction can be actively extruded by living cells or discharged during cellular lysis and may exert a key role in the stability and variability of the soil bacterial genome, resulting also a source of nitrogen and phosphorus for plants due to the root's capacity to directly uptake short DNA fragments. The adhesive properties of the DNA molecule confer to eDNA the capacity to inhibit or kill pathogenic bacteria by cation limitation induction, and to facilitate formation of biofilm and extracellular traps (ETs), that may protect microorganisms inhabiting biofilm and plant roots against pathogens and allelopathic substances. The ETs are actively extruded by root border cells when they are dispersed in the rhizosphere, conferring to plants the capacity to extend an endogenous pathogen defence system outside the organism. Moreover, eDNA could be involved in rhizoremediation in heavy metal polluted soil acting as a bioflotation reagent.

  5. Functional transferred DNA within extracellular vesicles

    International Nuclear Information System (INIS)

    Cai, Jin; Wu, Gengze; Jose, Pedro A.; Zeng, Chunyu

    2016-01-01

    Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmic macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.

  6. Functional transferred DNA within extracellular vesicles

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Jin [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China); Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Jiangsu Province (China); Wu, Gengze [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China); Jose, Pedro A. [Division of Nephrology, Department of Medicine and Physiology, University of Maryland, School of Medicine, Baltimore, MD 21201 (United States); Zeng, Chunyu, E-mail: Chunyuzeng01@163.com [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China)

    2016-11-15

    Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmic macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.

  7. Preservation and Significance of Extracellular DNA in Ferruginous Sediments from Lake Towuti, Indonesia

    Directory of Open Access Journals (Sweden)

    Aurèle Vuillemin

    2017-07-01

    Full Text Available Extracellular DNA is ubiquitous in soil and sediment and constitutes a dominant fraction of environmental DNA in aquatic systems. In theory, extracellular DNA is composed of genomic elements persisting at different degrees of preservation produced by processes occurring on land, in the water column and sediment. Extracellular DNA can be taken up as a nutrient source, excreted or degraded by microorganisms, or adsorbed onto mineral matrices, thus potentially preserving information from past environments. To test whether extracellular DNA records lacustrine conditions, we sequentially extracted extracellular and intracellular DNA from anoxic sediments of ferruginous Lake Towuti, Indonesia. We applied 16S rRNA gene Illumina sequencing on both fractions to discriminate exogenous from endogenous sources of extracellular DNA in the sediment. Environmental sequences exclusively found as extracellular DNA in the sediment originated from multiple sources. For instance, Actinobacteria, Verrucomicrobia, and Acidobacteria derived from soils in the catchment. Limited primary productivity in the water column resulted in few sequences of Cyanobacteria in the oxic photic zone, whereas stratification of the water body mainly led to secondary production by aerobic and anaerobic heterotrophs. Chloroflexi and Planctomycetes, the main degraders of sinking organic matter and planktonic sequences at the water-sediment interface, were preferentially preserved during the initial phase of burial. To trace endogenous sources of extracellular DNA, we used relative abundances of taxa in the intracellular DNA to define which microbial populations grow, decline or persist at low density with sediment depth. Cell lysis became an important additional source of extracellular DNA, gradually covering previous genetic assemblages as other microbial genera became more abundant with depth. The use of extracellular DNA as nutrient by active microorganisms led to selective removal of

  8. An optimized DNA extraction protocol for benthic Didymosphenia geminata.

    Science.gov (United States)

    Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

    2014-09-01

    Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. extraction of high quality dna from polysaccharides-secreting ...

    African Journals Online (AJOL)

    cistvr

    A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...

  10. Skeleton versus fine earth: what information is stored in the mobile extracellular soil DNA fraction?

    Science.gov (United States)

    Ascher, Judith; Ceccherini, Maria Teresa; Agnelli, Alberto; Corti, Guiseppe; Pietramellara, Giacomo

    2010-05-01

    The soil genome consists of an intracellular and an extracellular fraction. Recently, soil extracellular DNA (eDNA) has been shown to be quantitatively relevant, with a high survival capacity and mobility, playing a crucial role in the gene transfer by transformation, in the formation of bacterial biofilm and as a source of nutrients for soil microorganisms. The eDNA fraction can be discriminated and classified by its interaction with clay minerals, humic acids and Al/Fe oxihydroxides, resulting in differently mobile components. The eDNA extractable in water, classified as DNA free in the extracellular soil environment or adsorbed on soil colloids (eDNAfree/adsorbed), is hypothesized to be the most mobile DNA in soil. Challenging to assess the information stored in this DNA fraction, eDNAfree/adsorbed was recovered from fine earth (gel electrophoresis), and qualitative analysis in terms of the composition and distribution of fungal and bacterial communities (Denaturing Gradient Gel Electrophoresis- fingerprinting). The mobile soil eDNA, extracted from each horizon, was characterised by low molecular weight (result of the movement of eDNA along the soil profile and from fine earth to skeleton. The molecular characterization provided information about the autochthonous microflora inhabiting skeleton and fine earth as well as information about the fate of soil DNA in terms of presence, persistence and movement of eDNA and the stored genetic information.

  11. Extracellular DNA Shields against Aminoglycosides in Pseudomonas aeruginosa Biofilms

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Nilsson, Martin; Jensen, Peter Østrup

    2013-01-01

    Within recent years, it has been established that extracellular DNA is a key constituent of the matrix of microbial biofilms. In addition, it has recently been demonstrated that DNA binds positively charged antimicrobials such as aminoglycosides and antimicrobial peptides. In the present study, we...... provide evidence that extracellular DNA shields against aminoglycosides in Pseudomonas aeruginosa biofilms. We show that exogenously supplemented DNA integrates into P. aeruginosa biofilms and increases their tolerance toward aminoglycosides. We provide evidence that biofilms formed by a DNA release......-deficient P. aeruginosa quorum-sensing mutant are more susceptible to aminoglycoside treatment than wild-type biofilms but become rescued from the detrimental action of aminoglycosides upon supplementation with exogenous DNA. Furthermore, we demonstrate that exposure to lysed polymorphonuclear leukocytes...

  12. Analysis of cellular and extracellular DNA in fingerprints

    Energy Technology Data Exchange (ETDEWEB)

    Button, Julie M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2014-09-09

    It has been previously shown that DNA can be recovered from latent fingerprints left on various surfaces [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. However, the source of the DNA, extracellular versus cellular origin, is difficult to determine. If the DNA is cellular, it is believed to belong to skin cells while extracellular DNA is believed to originate from body fluids such as sweat [D. J. Daly et. al, Forensic Sci. Int. Genet. 6, 41-46 (2012); V. V. Vlassov et. al, BioEssays 29, 654-667 (2007)]. The origin of the DNA in fingerprints has implications for processing and interpretation of forensic evidence. The determination of the origin of DNA in fingerprints is further complicated by the fact that the DNA in fingerprints tends to be at a very low quantity [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. This study examined fingerprints from five volunteers left on sterilized glass slides and plastic pens. Three fingerprints were left on each glass slide (thumb, index, and middle fingers) while the pens were held as if one was writing with them. The DNA was collected from the objects using the wet swabbing technique (TE buffer). Following collection, the cellular and extracellular components of each sample were separated using centrifugation and an acoustofluidics system. Centrifugation is still the primary separation technique utilized in forensics laboratories, while acoustic focusing uses sound waves to focus large particles (cells) into low pressure nodes, separating them from the rest of the sample matrix. After separation, all samples were quantified using real-time quantitative PCR (qPCR). The overall trend is that there is more DNA in the extracellular fractions than cellular fractions for both centrifugation and acoustofluidic processing. Additionally, more DNA was generally collected from the pen samples than the samples left on glass slides.

  13. Extracellular DNA Contributes to Dental Biofilm Stability

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Meyer, Rikke Louise; Dige, Irene

    2017-01-01

    dental biofilms. This study aimed to determine whether eDNA was part of the matrix in biofilms grown in situ in the absence of sucrose and whether treatment with DNase dispersed biofilms grown for 2.5, 5, 7.5, 16.5, or 24 h. Three hundred biofilms from 10 study participants were collected and treated...... the amount of biofilm in very early stages of growth (up to 7.5 h), but the treatment effect decreased with increasing biofilm age. This study proves the involvement of eDNA in dental biofilm formation and its importance for biofilm stability in the earliest stages. Further research is required to uncover...

  14. Extracellular DNA and histones: double-edged swords in immunothrombosis.

    Science.gov (United States)

    Gould, T J; Lysov, Z; Liaw, P C

    2015-06-01

    The existence of extracellular DNA in human plasma, also known as cell-free DNA (cfDNA), was first described in the 1940s. In recent years, there has been a resurgence of interest in the functional significance of cfDNA, particularly in the context of neutrophil extracellular traps (NETs). cfDNA and histones are key components of NETs that aid in the host response to infection and inflammation. However, cfDNA and histones may also exert harmful effects by triggering coagulation, inflammation, and cell death and by impairing fibrinolysis. In this article, we will review the pathologic nature of cfDNA and histones in macrovascular and microvascular thrombosis, including venous thromboembolism, cancer, sepsis, and trauma. We will also discuss the prognostic value of cfDNA and histones in these disease states. Understanding the molecular and cellular pathways regulated by cfDNA and histones may provide novel insights to prevent pathological thrombus formation and vascular occlusion. © 2015 International Society on Thrombosis and Haemostasis.

  15. Extracellular DNA as matrix component in microbial biofilms

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Tolker-Nielsen, Tim

    2010-01-01

    Bacteria in nature primarily live in surface-associated communities commonly known as biofilms. Because bacteria in biofilms, in many cases, display tolerance to host immune systems, antibiotics, and biocides, they are often difficult or impossible to eradicate. Biofilm formation, therefore, leads...... to various persistent infections in humans and animals, and to a variety of complications in industry, where solid–water interfaces occur. Knowledge about the molecular mechanisms involved in biofilm formation is necessary for creating strategies to control biofilms. Recent studies have shown...... that extracellular DNA is an important component of the extracellular matrix of microbial biofilms. The present chapter is focussed on extracellular DNA as matrix component in biofilms formed by Pseudomonas aeruginosa as an example from the Gram-negative bacteria, and Streptococcus and Staphylococcus as examples...

  16. Filtration recovery of extracellular DNA from environmental water samples

    Science.gov (United States)

    qPCR methods are able to analyze DNA from microbes within hours of collecting water samples, providing the promptest notification and public awareness possible when unsafe pathogenic levels are reached. Health risk, however, may be overestimated by the presence of extracellular ...

  17. Indication of Horizontal DNA Gene Transfer by Extracellular Vesicles.

    Directory of Open Access Journals (Sweden)

    Stefanie Fischer

    Full Text Available The biological relevance of extracellular vesicles (EV in intercellular communication has been well established. Thus far, proteins and RNA were described as main cargo. Here, we show that EV released from human bone marrow derived mesenchymal stromal cells (BM-hMSC also carry high-molecular DNA in addition. Extensive EV characterization revealed this DNA mainly associated with the outer EV membrane and to a smaller degree also inside the EV. Our EV purification protocol secured that DNA is not derived from apoptotic or necrotic cells. To analyze the relevance of EV-associated DNA we lentivirally transduced Arabidopsis thaliana-DNA (A.t.-DNA as indicator into BM-hMSC and generated EV. Using quantitative polymerase chain reaction (qPCR techniques we detected high copy numbers of A.t.-DNA in EV. In recipient hMSC incubated with tagged EV for two weeks we identified A.t.-DNA transferred to recipient cells. Investigation of recipient cell DNA using quantitative PCR and verification of PCR-products by sequencing suggested stable integration of A.t.-DNA. In conclusion, for the first time our proof-of-principle experiments point to horizontal DNA transfer into recipient cells via EV. Based on our results we assume that eukaryotic cells are able to exchange genetic information in form of DNA extending the known cargo of EV by genomic DNA. This mechanism might be of relevance in cancer but also during cell evolution and development.

  18. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  19. DNA builds and strengthens the extracellular matrix in Myxococcus xanthus biofilms by interacting with exopolysaccharides.

    Directory of Open Access Journals (Sweden)

    Wei Hu

    Full Text Available One intriguing discovery in modern microbiology is the extensive presence of extracellular DNA (eDNA within biofilms of various bacterial species. Although several biological functions have been suggested for eDNA, including involvement in biofilm formation, the detailed mechanism of eDNA integration into biofilm architecture is still poorly understood. In the biofilms formed by Myxococcus xanthus, a Gram-negative soil bacterium with complex morphogenesis and social behaviors, DNA was found within both extracted and native extracellular matrices (ECM. Further examination revealed that these eDNA molecules formed well organized structures that were similar in appearance to the organization of exopolysaccharides (EPS in ECM. Biochemical and image analyses confirmed that eDNA bound to and colocalized with EPS within the ECM of starvation biofilms and fruiting bodies. In addition, ECM containing eDNA exhibited greater physical strength and biological stress resistance compared to DNase I treated ECM. Taken together, these findings demonstrate that DNA interacts with EPS and strengthens biofilm structures in M. xanthus.

  20. Dynamics of extracellular DNA in the marine environment

    International Nuclear Information System (INIS)

    Paul, J.H.; Jeffrey, W.H.; DeFlaun, M.F.

    1987-01-01

    The production and turnover of dissolved DNA in subtropical estuarine and oligotrophic oceanic environments were investigated. Actively growing heterotrophic bacterioplankton (i.e., those capable of [ 3 H]thymidine incorporation) were found to produce dissolved DNA, presumably through the processes of death and lysis, grazing by bacteriovores, and excretion. Production of dissolved DNA as determined by [ 3 H]thymidine incorporation was ≤4% of the ambient dissolved DNA concentration per day. In turnover studies, the addition of [ 3 H]DNA (Escherichia coli chromosomal) to seawater resulted in rapid hydrolysis and uptake of radioactivity by microbial populations. DNA was hydrolyzed by both cell-associated and extracellular nucleases, in both estuarine and offshore environments. Kinetic analysis performed for a eutrophic estuary indicated a turnover time for dissolved DNA as short as 6.5 h. Microautoradiographic studies of bacterial populations in Tampa Bay indicated that filamentous and attached bacteria took up most of the radioactivity from [ 3 H]DNA. Dissolved DNA is therefore a dynamic component of the dissolved organic matter in the marine environment, and bacterioplankton play a key role in the cycling of this material

  1. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  2. DNA extraction from herbarium specimens.

    Science.gov (United States)

    Drábková, Lenka Záveská

    2014-01-01

    With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).

  3. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  4. Composition and immuno-stimulatory properties of extracellular DNA from mouse gut flora.

    Science.gov (United States)

    Qi, Ce; Li, Ya; Yu, Ren-Qiang; Zhou, Sheng-Li; Wang, Xing-Guo; Le, Guo-Wei; Jin, Qing-Zhe; Xiao, Hang; Sun, Jin

    2017-11-28

    To demonstrate that specific bacteria might release bacterial extracellular DNA (eDNA) to exert immunomodulatory functions in the mouse small intestine. Extracellular DNA was extracted using phosphate buffered saline with 0.5 mmol/L dithiothreitol combined with two phenol extractions. TOTO-1 iodide, a cell-impermeant and high-affinity nucleic acid stain, was used to confirm the existence of eDNA in the mucus layers of the small intestine and colon in healthy Male C57BL/6 mice. Composition difference of eDNA and intracellular DNA (iDNA) of the small intestinal mucus was studied by Illumina sequencing and terminal restriction fragment length polymorphism (T-RFLP). Stimulation of cytokine production by eDNA was studied in RAW264.7 cells in vitro . TOTO-1 iodide staining confirmed existence of eDNA in loose mucus layer of the mouse colon and thin surface mucus layer of the small intestine. Illumina sequencing analysis and T-RFLP revealed that the composition of the eDNA in the small intestinal mucus was significantly different from that of the iDNA of the small intestinal mucus bacteria. Illumina Miseq sequencing showed that the eDNA sequences came mainly from Gram-negative bacteria of Bacteroidales S24-7. By contrast, predominant bacteria of the small intestinal flora comprised Gram-positive bacteria. Both eDNA and iDNA were added to native or lipopolysaccharide-stimulated Raw267.4 macrophages, respectively. The eDNA induced significantly lower tumor necrosis factor-α/interleukin-10 (IL-10) and IL-6/IL-10 ratios than iDNA, suggesting the predominance for maintaining immune homeostasis of the gut. Our results indicated that degraded bacterial genomic DNA was mainly released by Gram-negative bacteria, especially Bacteroidales-S24-7 and Stenotrophomonas genus in gut mucus of mice. They decreased pro-inflammatory activity compared to total gut flora genomic DNA.

  5. DNA Extraction Techniques for Use in Education

    Science.gov (United States)

    Hearn, R. P.; Arblaster, K. E.

    2010-01-01

    DNA extraction provides a hands-on introduction to DNA and enables students to gain real life experience and practical knowledge of DNA. Students gain a sense of ownership and are more enthusiastic when they use their own DNA. A cost effective, simple protocol for DNA extraction and visualization was devised. Buccal mucosal epithelia provide a…

  6. Extracellular DNA and lipoteichoic acids interact with exopolysaccharides in the extracellular matrix of Streptococcus mutans biofilms

    Science.gov (United States)

    Castillo Pedraza, Midian C.; Novais, Tatiana F.; Faustoferri, Roberta C.; Quivey, Robert G.; Terekhov, Anton; Hamaker, Bruce R.; Klein, Marlise I.

    2018-01-01

    Streptococcus mutans -derived exopolysaccharides are virulence determinants in the matrix of biofilms that cause caries. Extracellular DNA (eDNA) and lipoteichoic acid (LTA) are found in cariogenic biofilms, but their functions are unclear. Therefore, strains of S. mutans carrying single deletions that would modulate matrix components were used: eDNA – ΔlytS and ΔlytT; LTA – ΔdltA and ΔdltD; and insoluble exopolysaccharide – ΔgtfB. Single-species (parental strain S. mutans UA159 or individual mutant strains) and mixed-species (UA159 or mutant strain, Actinomyces naeslundii and Streptococcus gordonii) biofilms were evaluated. Distinct amounts of matrix components were detected, depending on the inactivated gene. eDNA was found to be cooperative with exopolysaccharide in early phases, while LTA played a larger role in the later phases of biofilm development. The architecture of mutant strains biofilms was distinct (vs UA159), demonstrating that eDNA and LTA influence exopolysaccharide distribution and microcolony organization. Thus, eDNA and LTA may shape exopolysaccharide structure, affecting strategies for controlling pathogenic biofilms. PMID:28946780

  7. Extracellular DNA and lipoteichoic acids interact with exopolysaccharides in the extracellular matrix of Streptococcus mutans biofilms.

    Science.gov (United States)

    Castillo Pedraza, Midian C; Novais, Tatiana F; Faustoferri, Roberta C; Quivey, Robert G; Terekhov, Anton; Hamaker, Bruce R; Klein, Marlise I

    2017-10-01

    Streptococcus mutans-derived exopolysaccharides are virulence determinants in the matrix of biofilms that cause caries. Extracellular DNA (eDNA) and lipoteichoic acid (LTA) are found in cariogenic biofilms, but their functions are unclear. Therefore, strains of S. mutans carrying single deletions that would modulate matrix components were used: eDNA - ∆lytS and ∆lytT; LTA - ∆dltA and ∆dltD; and insoluble exopolysaccharide - ΔgtfB. Single-species (parental strain S. mutans UA159 or individual mutant strains) and mixed-species (UA159 or mutant strain, Actinomyces naeslundii and Streptococcus gordonii) biofilms were evaluated. Distinct amounts of matrix components were detected, depending on the inactivated gene. eDNA was found to be cooperative with exopolysaccharide in early phases, while LTA played a larger role in the later phases of biofilm development. The architecture of mutant strains biofilms was distinct (vs UA159), demonstrating that eDNA and LTA influence exopolysaccharide distribution and microcolony organization. Thus, eDNA and LTA may shape exopolysaccharide structure, affecting strategies for controlling pathogenic biofilms.

  8. Detection of extracellular genomic DNA scaffold in human thrombus

    DEFF Research Database (Denmark)

    Oklu, Rahmi; Albadawi, Hassan; Watkins, Michael T

    2012-01-01

    into thrombus remodeling. MATERIALS AND METHODS: Ten human thrombus samples were collected during cases of thrombectomy and open surgical repair of abdominal aortic aneurysms (five samples 1 y old). Additionally, an acute murine hindlimb ischemia model was created to evaluate...... thrombus samples in mice. Human sections were immunostained for the H2A/H2B/DNA complex, myeloperoxidase, fibrinogen, and von Willebrand factor. Mouse sections were immunostained with the H2A antibody. All samples were further evaluated after hematoxylin and eosin and Masson trichrome staining. RESULTS......: An extensive network of extracellular histone/DNA complex was demonstrated in the matrix of human ex vivo thrombus. This network is present throughout the highly cellular acute thrombus. However, in chronic thrombi, detection of the histone/DNA network was predominantly in regions of low collagen content...

  9. Automated extraction of DNA from clothing

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin Benn; Nøhr Hansen, Thomas

    2011-01-01

    Presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. We have compared three automated DNA extraction methods based on magnetic beads with a manual method with the aim of reducing...

  10. Inhibitory and toxic effects of extracellular self-DNA in litter: a mechanism for negative plant-soil feedbacks?

    Science.gov (United States)

    Mazzoleni, Stefano; Bonanomi, Giuliano; Incerti, Guido; Chiusano, Maria Luisa; Termolino, Pasquale; Mingo, Antonio; Senatore, Mauro; Giannino, Francesco; Cartenì, Fabrizio; Rietkerk, Max; Lanzotti, Virginia

    2015-02-01

    Plant-soil negative feedback (NF) is recognized as an important factor affecting plant communities. The objectives of this work were to assess the effects of litter phytotoxicity and autotoxicity on root proliferation, and to test the hypothesis that DNA is a driver of litter autotoxicity and plant-soil NF. The inhibitory effect of decomposed litter was studied in different bioassays. Litter biochemical changes were evaluated with nuclear magnetic resonance (NMR) spectroscopy. DNA accumulation in litter and soil was measured and DNA toxicity was assessed in laboratory experiments. Undecomposed litter caused nonspecific inhibition of root growth, while autotoxicity was produced by aged litter. The addition of activated carbon (AC) removed phytotoxicity, but was ineffective against autotoxicity. Phytotoxicity was related to known labile allelopathic compounds. Restricted (13) C NMR signals related to nucleic acids were the only ones negatively correlated with root growth on conspecific substrates. DNA accumulation was observed in both litter decomposition and soil history experiments. Extracted total DNA showed evident species-specific toxicity. Results indicate a general occurrence of litter autotoxicity related to the exposure to fragmented self-DNA. The evidence also suggests the involvement of accumulated extracellular DNA in plant-soil NF. Further studies are needed to further investigate this unexpected function of extracellular DNA at the ecosystem level and related cellular and molecular mechanisms. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  11. Does Extracellular DNA Production Vary in Staphylococcal Biofilms Isolated From Infected Implants versus Controls?

    Science.gov (United States)

    Zatorska, Beata; Groger, Marion; Moser, Doris; Diab-Elschahawi, Magda; Lusignani, Luigi Segagni; Presterl, Elisabeth

    2017-08-01

    Prosthetic implant infections caused by Staphylococcus aureus and epidermidis are major challenges for early diagnosis and treatment owing to biofilm formation on the implant surface. Extracellular DNA (eDNA) is actively excreted from bacterial cells in biofilms, contributing to biofilm stability, and may offer promise in the detection or treatment of such infections. (1) Does DNA structure change during biofilm formation? (2) Are there time-dependent differences in eDNA production during biofilm formation? (3) Is there differential eDNA production between clinical and control Staphylococcal isolates? (4) Is eDNA production correlated to biofilm thickness? We investigated eDNA presence during biofilm formation in 60 clinical and 30 control isolates of S aureus and S epidermidis. The clinical isolates were isolated from patients with infections of orthopaedic prostheses and implants: 30 from infected hip prostheses and 30 from infected knee prostheses. The control isolates were taken from healthy volunteers who had not been exposed to antibiotics and a hospital environment during the previous 3 and 12 months, respectively. Control S epidermidis was isolated from the skin of the antecubital fossa, and control S aureus was isolated from the nares. For the biofilm experiments the following methods were used to detect eDNA: (1) fluorescent staining with 4',6-diamidino-2-phenylindole (DAPI), (2) eDNA extraction using a commercial kit, and (3) confocal laser scanning microscopy for 24-hour biofilm observation using propidium iodide and concanavalin-A staining; TOTO ® -1 and SYTO ® 60 staining were used for observation and quantification of eDNA after 6 and 24 hours of biofilm formation. Additionally antibiotic resistance was described. eDNA production as observed by confocal laser scanning microscopy was greater in clinical isolates than controls (clinical isolates mean ± SD: 1.84% ± 1.31%; control mean ± SD: 1.17% ± 1.37%; p biofilm formation. After 24 hours, the

  12. TOL plasmid carriage enhances biofilm formation and increases extracellular DNA content in Pseudomonas putida KT2440

    DEFF Research Database (Denmark)

    D'Alvise, Paul; Sjoholm, O.R.; Yankelevich, T.

    2010-01-01

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid-specific stains revealed differences in the production of extracellular polymeric substances......: TOL carriage leads to more extracellular DNA (eDNA) in pellicles and biofilms. Pellicles were dissolved by DNase I treatment. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads...

  13. Evaluation of the damage of cell wall and cell membrane for various extracellular polymeric substance extractions of activated sludge.

    Science.gov (United States)

    Guo, Xuesong; Liu, Junxin; Xiao, Benyi

    2014-10-20

    Extracellular polymeric substances (EPS) are susceptible to contamination by intracellular substances released during the extraction of EPS owing to the damage caused to microbial cell structures. The damage to cell walls and cell membranes in nine EPS extraction processes of activated sludge was evaluated in this study. The extraction of EPS (including proteins, carbohydrates and DNA) was the highest using the NaOH extraction method and the lowest using formaldehyde extraction. All nine EPS extraction methods in this study resulted in cell wall and membrane damage. The damage to cell walls, evaluated by 2-keto-3-deoxyoctonate (KDO) and N-acetylglucosamine content changes in extracted EPS, was the most significant in the NaOH extraction process. Formaldehyde extraction showed a similar extent of damage to cell walls to those detected in the control method (centrifugation), while those in the formaldehyde-NaOH and cation exchange resin extractions were slightly higher than those detected in the control. N-acetylglucosamine was more suitable than KDO for the evaluation of cell wall damage in the EPS extraction of activated sludge. The damage to cell membranes was characterized by two fluorochromes (propidium iodide and FITC Annexin V) with flow cytometry (FCM) measurement. The highest proportion of membrane-damaged cells was detected in NaOH extraction (26.54% of total cells) while membrane-damaged cells comprised 8.19% of total cells in the control. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. A comparison of five extraction methods for extracellular polymeric ...

    African Journals Online (AJOL)

    Two physical methods (centrifugation and ultrasonication) and 3 chemical methods (extraction with EDTA, extraction with formaldehyde, and extraction with formaldehyde plus NaOH) for extraction of EPS from alga-bacteria biofilm were assessed. Pretreatment with ultrasound at low intensity doubled the EPS yield without ...

  15. Extracellular DNA formation during biofilm development by freshwater bacteria

    DEFF Research Database (Denmark)

    Tang, Lone; Schramm, Andreas; Revsbech, Niels Peter

    2011-01-01

    a transient peak at 6 hours, and in Rheinheimera the concentration peaked at 12 hours and remained high. Interestingly, the Rheinheimera biofilm dispersed immediately after the eDNA concentration peaked. The antimicrobial effect of eDNA was tested in growth experiments, and Rheinheimera was strongly affected...

  16. Helicobacter pylori ATCC 43629/NCTC 11639 Outer Membrane Vesicles (OMVs) from Biofilm and Planktonic Phase Associated with Extracellular DNA (eDNA)

    Science.gov (United States)

    Grande, Rossella; Di Marcantonio, Maria C.; Robuffo, Iole; Pompilio, Arianna; Celia, Christian; Di Marzio, Luisa; Paolino, Donatella; Codagnone, Marilina; Muraro, Raffaella; Stoodley, Paul; Hall-Stoodley, Luanne; Mincione, Gabriella

    2015-01-01

    Helicobacter pylori persistence is associated with its capacity to develop biofilms as a response to changing environmental conditions and stress. Extracellular DNA (eDNA) is a component of H. pylori biofilm matrix but the lack of DNase I activity supports the hypothesis that eDNA might be protected by other extracellular polymeric substances (EPS) and/or Outer Membrane Vesicles (OMVs), which bleb from the bacteria surface during growth. The aim of the present study was to both identify the eDNA presence on OMVs segregated from H. pylori ATCC 43629/NCTC 11639 biofilm (bOMVs) and its planktonic phase (pOMVs) and to characterize the physical-chemical properties of the OMVs. The presence of eDNA in bOMVs and pOMVs was initially carried out using DNase I-gold complex labeling and Transmission Electron Microscope analysis (TEM). bOMVs and pOMVs were further isolated and physical-chemical characterization carried out using dynamic light scattering (DLS) analysis. eDNA associated with OMVs was detected and quantified using a PicoGreen spectrophotometer assay, while its extraction was performed with a DNA Kit. TEM images showed that eDNA was mainly associated with the OMV membrane surfaces; while PicoGreen staining showed a four-fold increase of dsDNA in bOMVs compared with pOMVs. The eDNA extracted from OMVs was visualized using gel electrophoresis. DLS analysis indicated that both planktonic and biofilm H. pylori phenotypes generated vesicles, with a broad distribution of sizes on the nanometer scale. The DLS aggregation assay suggested that eDNA may play a role in the aggregation of OMVs, in the biofilm phenotype. Moreover, the eDNA associated with vesicle membrane may impede DNase I activity on H. pylori biofilms. These results suggest that OMVs derived from the H. pylori biofilm phenotype may play a structural role by preventing eDNA degradation by nucleases, providing a bridging function between eDNA strands on OMV surfaces and promoting aggregation. PMID:26733944

  17. Deep-Sea, Deep-Sequencing: Metabarcoding Extracellular DNA from Sediments of Marine Canyons.

    Directory of Open Access Journals (Sweden)

    Magdalena Guardiola

    Full Text Available Marine sediments are home to one of the richest species pools on Earth, but logistics and a dearth of taxonomic work-force hinders the knowledge of their biodiversity. We characterized α- and β-diversity of deep-sea assemblages from submarine canyons in the western Mediterranean using an environmental DNA metabarcoding. We used a new primer set targeting a short eukaryotic 18S sequence (ca. 110 bp. We applied a protocol designed to obtain extractions enriched in extracellular DNA from replicated sediment corers. With this strategy we captured information from DNA (local or deposited from the water column that persists adsorbed to inorganic particles and buffered short-term spatial and temporal heterogeneity. We analysed replicated samples from 20 localities including 2 deep-sea canyons, 1 shallower canal, and two open slopes (depth range 100-2,250 m. We identified 1,629 MOTUs, among which the dominant groups were Metazoa (with representatives of 19 phyla, Alveolata, Stramenopiles, and Rhizaria. There was a marked small-scale heterogeneity as shown by differences in replicates within corers and within localities. The spatial variability between canyons was significant, as was the depth component in one of the canyons where it was tested. Likewise, the composition of the first layer (1 cm of sediment was significantly different from deeper layers. We found that qualitative (presence-absence and quantitative (relative number of reads data showed consistent trends of differentiation between samples and geographic areas. The subset of exclusively benthic MOTUs showed similar patterns of β-diversity and community structure as the whole dataset. Separate analyses of the main metazoan phyla (in number of MOTUs showed some differences in distribution attributable to different lifestyles. Our results highlight the differentiation that can be found even between geographically close assemblages, and sets the ground for future monitoring and conservation

  18. Extraction of Chromosomal DNA from Schizosaccharomyces pombe.

    Science.gov (United States)

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-05-02

    Extraction of DNA from Schizosaccharomyces pombe cells is required for various uses, including templating polymerase chain reactions (PCRs), Southern blotting, library construction, and high-throughput sequencing. To purify high-quality DNA, the cell wall is removed by digestion with Zymolyase or Lyticase and the resulting spheroplasts lysed using sodium dodecyl sulfate (SDS). Cell debris, SDS, and SDS-protein complexes are subsequently precipitated by the addition of potassium acetate and removed by centrifugation. Finally, DNA is precipitated using isopropanol. At this stage, purity is usually sufficient for PCR. However, for more sensitive procedures, such as restriction enzyme digestion, additional purification steps, including proteinase K digestion and phenol-chloroform extraction, are recommended. All of these steps are described in detail here. © 2016 Cold Spring Harbor Laboratory Press.

  19. Extracellular histones, cell-free DNA, or nucleosomes: differences in immunostimulation

    NARCIS (Netherlands)

    Marsman, Gerben; Zeerleder, Sacha; Luken, Brenda M.

    2016-01-01

    In inflammation, extensive cell death may occur, which results in the release of chromatin components into the extracellular environment. Individually, the purified chromatin components double stranded (ds)DNA and histones have been demonstrated, both in vitro and in vivo, to display various

  20. Identification of Bicarbonate as a Trigger and Genes Involved with Extracellular DNA Export in Mycobacterial Biofilms

    Directory of Open Access Journals (Sweden)

    Sasha J. Rose

    2016-12-01

    Full Text Available Extracellular DNA (eDNA is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM. Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae. The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate.

  1. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  2. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  3. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  4. Supercritical carbon dioxide extracted extracellular matrix material from adipose tissue

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jun Kit; Luo, Baiwen; Guneta, Vipra [School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); Li, Liang; Foo, Selin Ee Min [School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore); Dai, Yun; Tan, Timothy Thatt Yang [School of Chemical and Biomedical Engineering, Nanyang Technological University, 62 Nanyang Drive, Singapore 637459 (Singapore); Tan, Nguan Soon [School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore); Institute of Molecular and Cell Biology, Agency for Science, Technology and Research, 61 Biopolis Drive, Proteos, Singapore 138673 (Singapore); KK Research Centre, KK Women' s and Children' s Hospital, 100 Bukit Timah Road, Singapore 229899 (Singapore); Choong, Cleo, E-mail: cleochoong@ntu.edu.sg [School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); KK Research Centre, KK Women' s and Children' s Hospital, 100 Bukit Timah Road, Singapore 229899 (Singapore); Wong, Marcus Thien Chong [Plastic, Reconstructive & Aesthetic Surgery, Tan Tock Seng Hospital, 11 Jalan Tan Tock Seng, Singapore 308433 (Singapore)

    2017-06-01

    Adipose tissue is a rich source of extracellular matrix (ECM) material that can be isolated by delipidating and decellularizing the tissue. However, the current delipidation and decellularization methods either involve tedious and lengthy processes or require toxic chemicals, which may result in the elimination of vital proteins and growth factors found in the ECM. Hence, an alternative delipidation and decellularization method for adipose tissue was developed using supercritical carbon dioxide (SC-CO{sub 2}) that eliminates the need of any harsh chemicals and also reduces the amount of processing time required. The resultant SC-CO{sub 2}-treated ECM material showed an absence of nuclear content but the preservation of key proteins such as collagen Type I, collagen Type III, collagen Type IV, elastin, fibronectin and laminin. In addition, other biological factors such as glycosaminoglycans (GAGs) and growth factors such as basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) were also retained. Subsequently, the resulting SC-CO{sub 2}-treated ECM material was used as a bioactive coating on tissue culture plastic (TCP). Four different cell types including adipose tissue-derived mesenchymal stem cells (ASCs), human umbilical vein endothelial cells (HUVECs), immortalized human keratinocyte (HaCaT) cells and human monocytic leukemia cells (THP-1) were used in this study to show that the SC-CO{sub 2}-treated ECM coating can be potentially used for various biomedical applications. The SC-CO{sub 2}-treated ECM material showed improved cell-material interactions for all cell types tested. In addition, in vitro scratch wound assay using HaCaT cells showed that the presence of SC-CO{sub 2}-treated ECM material enhanced keratinocyte migration whilst the in vitro cellular studies using THP-1-derived macrophages showed that the SC-CO{sub 2}-treated ECM material did not evoke pro-inflammatory responses from the THP-1-derived macrophages. Overall

  5. Supercritical carbon dioxide extracted extracellular matrix material from adipose tissue.

    Science.gov (United States)

    Wang, Jun Kit; Luo, Baiwen; Guneta, Vipra; Li, Liang; Foo, Selin Ee Min; Dai, Yun; Tan, Timothy Thatt Yang; Tan, Nguan Soon; Choong, Cleo; Wong, Marcus Thien Chong

    2017-06-01

    Adipose tissue is a rich source of extracellular matrix (ECM) material that can be isolated by delipidating and decellularizing the tissue. However, the current delipidation and decellularization methods either involve tedious and lengthy processes or require toxic chemicals, which may result in the elimination of vital proteins and growth factors found in the ECM. Hence, an alternative delipidation and decellularization method for adipose tissue was developed using supercritical carbon dioxide (SC-CO 2 ) that eliminates the need of any harsh chemicals and also reduces the amount of processing time required. The resultant SC-CO 2 -treated ECM material showed an absence of nuclear content but the preservation of key proteins such as collagen Type I, collagen Type III, collagen Type IV, elastin, fibronectin and laminin. In addition, other biological factors such as glycosaminoglycans (GAGs) and growth factors such as basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) were also retained. Subsequently, the resulting SC-CO 2 -treated ECM material was used as a bioactive coating on tissue culture plastic (TCP). Four different cell types including adipose tissue-derived mesenchymal stem cells (ASCs), human umbilical vein endothelial cells (HUVECs), immortalized human keratinocyte (HaCaT) cells and human monocytic leukemia cells (THP-1) were used in this study to show that the SC-CO 2 -treated ECM coating can be potentially used for various biomedical applications. The SC-CO 2 -treated ECM material showed improved cell-material interactions for all cell types tested. In addition, in vitro scratch wound assay using HaCaT cells showed that the presence of SC-CO 2 -treated ECM material enhanced keratinocyte migration whilst the in vitro cellular studies using THP-1-derived macrophages showed that the SC-CO 2 -treated ECM material did not evoke pro-inflammatory responses from the THP-1-derived macrophages. Overall, this study shows the efficacy

  6. Supercritical carbon dioxide extracted extracellular matrix material from adipose tissue

    International Nuclear Information System (INIS)

    Wang, Jun Kit; Luo, Baiwen; Guneta, Vipra; Li, Liang; Foo, Selin Ee Min; Dai, Yun; Tan, Timothy Thatt Yang; Tan, Nguan Soon; Choong, Cleo; Wong, Marcus Thien Chong

    2017-01-01

    Adipose tissue is a rich source of extracellular matrix (ECM) material that can be isolated by delipidating and decellularizing the tissue. However, the current delipidation and decellularization methods either involve tedious and lengthy processes or require toxic chemicals, which may result in the elimination of vital proteins and growth factors found in the ECM. Hence, an alternative delipidation and decellularization method for adipose tissue was developed using supercritical carbon dioxide (SC-CO 2 ) that eliminates the need of any harsh chemicals and also reduces the amount of processing time required. The resultant SC-CO 2 -treated ECM material showed an absence of nuclear content but the preservation of key proteins such as collagen Type I, collagen Type III, collagen Type IV, elastin, fibronectin and laminin. In addition, other biological factors such as glycosaminoglycans (GAGs) and growth factors such as basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) were also retained. Subsequently, the resulting SC-CO 2 -treated ECM material was used as a bioactive coating on tissue culture plastic (TCP). Four different cell types including adipose tissue-derived mesenchymal stem cells (ASCs), human umbilical vein endothelial cells (HUVECs), immortalized human keratinocyte (HaCaT) cells and human monocytic leukemia cells (THP-1) were used in this study to show that the SC-CO 2 -treated ECM coating can be potentially used for various biomedical applications. The SC-CO 2 -treated ECM material showed improved cell-material interactions for all cell types tested. In addition, in vitro scratch wound assay using HaCaT cells showed that the presence of SC-CO 2 -treated ECM material enhanced keratinocyte migration whilst the in vitro cellular studies using THP-1-derived macrophages showed that the SC-CO 2 -treated ECM material did not evoke pro-inflammatory responses from the THP-1-derived macrophages. Overall, this study shows the efficacy

  7. Fractional, biodegradable and spectral characteristics of extracted and fractionated sludge extracellular polymeric substances.

    Science.gov (United States)

    Wei, Liang-Liang; Wang, Kun; Zhao, Qing-Liang; Jiang, Jun-Qiu; Kong, Xiang-Juan; Lee, Duu-Jong

    2012-09-15

    Correlation between fractional, biodegradable and spectral characteristics of sludge extracellular polymeric substances (EPS) by different protocols has not been well established. This work extracted sludge EPS using alkaline extractants (NH₄OH and formaldehyde + NaOH) and physical protocols (ultrasonication, heating at 80 °C or cation exchange resin (CER)) and then fractionated the extracts using XAD-8/XAD-4 resins. The alkaline extractants yielded more sludge EPS than the physical protocols. However, the physical protocols extracted principally the hydrophilic components which were readily biodegradable by microorganisms. The alkaline extractants dissolved additional humic-like substances from sludge solids which were refractory in nature. Different extraction protocols preferably extracted EPS with distinct fractional, biodegradable and spectral characteristics which could be applied in specific usages. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Extracellular DNA facilitates the formation of functional amyloids in Staphylococcus aureus biofilms.

    Science.gov (United States)

    Schwartz, Kelly; Ganesan, Mahesh; Payne, David E; Solomon, Michael J; Boles, Blaise R

    2016-01-01

    Persistent staphylococcal infections often involve surface-associated communities called biofilms. Staphylococcus aureus biofilm development is mediated by the co-ordinated production of the biofilm matrix, which can be composed of polysaccharides, extracellular DNA (eDNA) and proteins including amyloid fibers. The nature of the interactions between matrix components, and how these interactions contribute to the formation of matrix, remain unclear. Here we show that the presence of eDNA in S. aureus biofilms promotes the formation of amyloid fibers. Conditions or mutants that do not generate eDNA result in lack of amyloids during biofilm growth despite the amyloidogeneic subunits, phenol soluble modulin peptides, being produced. In vitro studies revealed that the presence of DNA promotes amyloid formation by PSM peptides. Thus, this work exposes a previously unacknowledged interaction between biofilm matrix components that furthers our understanding of functional amyloid formation and S. aureus biofilm biology. © 2015 The Authors. Molecular Microbiology published by John Wiley & Sons Ltd.

  9. Extracellular histones, cell-free DNA, or nucleosomes: differences in immunostimulation.

    Science.gov (United States)

    Marsman, Gerben; Zeerleder, Sacha; Luken, Brenda M

    2016-12-08

    In inflammation, extensive cell death may occur, which results in the release of chromatin components into the extracellular environment. Individually, the purified chromatin components double stranded (ds)DNA and histones have been demonstrated, both in vitro and in vivo, to display various immunostimulatory effects, for example, histones induce cytotoxicity and proinflammatory signaling through toll-like receptor (TLR)2 and 4, while DNA induces signaling through TLR9 and intracellular nucleic acid sensing mechanisms. However, DNA and histones are organized in nucleosomes in the nucleus, and evidence suggests that nucleosomes are released as such in inflammation. The cytotoxicity and proinflammatory signaling induced by nucleosomes have not been studied as extensively as the separate effects brought about by histones and dsDNA, and there appear to be some marked differences. Remarkably, little distinction between the different forms in which histones circulate has been made throughout literature. This is partly due to the limitations of existing techniques to differentiate between histones in their free or DNA-bound form. Here we review the current understanding of immunostimulation induced by extracellular histones, dsDNA and nucleosomes, and discuss the importance of techniques that in their detection differentiate between these different chromatin components.

  10. Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

    OpenAIRE

    Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

    1997-01-01

    The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

  11. Extracellular matrix components influence DNA synthesis of rat hepatocytes in primary culture

    International Nuclear Information System (INIS)

    Sawada, N.; Tomomura, A.; Sattler, C.A.; Sattler, G.L.; Kleinman, H.K.; Pitot, H.C.

    1986-01-01

    The effects of several extracellular matrix components (EMCs) - fibronectin (Fn), laminin (Ln), type I (C-I) and type IV (C-IV) collagen - on DNA synthesis in rat hepatocytes in primary culture were examined by both quantitative scintillation spectrometry and autoradiography of [ 3 H]thymidine incorporation. Hepatocytes cultured on Fn showed the most active DNA synthesis initiated by epidermal growth factor (EGF) with decreasing levels of [ 3 H]thymidine uptake exhibited in the cell cultured on C-IV, C-I, and Ln, respectively. The decreasing level of DNA synthesis in hepatocytes cultured on Fn, C-IV, C-I, and Ln respectively was not influenced by cell density. The number of EGF receptors of hepatocytes was also not influenced by EMCs. These data suggest that EMCs modify hepatocyte DNA synthesis by means of post-EGF-receptor mechanisms which are regulated by both growth factors and cell density

  12. Extracellular DNA Release Acts as an Antifungal Resistance Mechanism in Mature Aspergillus fumigatus Biofilms

    Science.gov (United States)

    Rajendran, Ranjith; Williams, Craig; Lappin, David F.; Millington, Owain; Martins, Margarida

    2013-01-01

    Aspergillus fumigatus has been shown to form biofilms that are associated with adaptive antifungal resistance mechanisms. These include multidrug efflux pumps, heat shock proteins, and extracellular matrix (ECM). ECM is a key structural and protective component of microbial biofilms and in bacteria has been shown to contain extracellular DNA (eDNA). We therefore hypothesized that A. fumigatus biofilms also possess eDNA as part of the ECM, conferring a functional role. Fluorescence microscopy and quantitative PCR analyses demonstrated the presence of eDNA, which was released phase dependently (8 autolysis, were significantly upregulated as the biofilm matured and that inhibition of chitinases affected biofilm growth and stability, indicating mechanistically that autolysis was possibly involved. Finally, using checkerboard assays, it was shown that combinational treatment of biofilms with DNase plus amphotericin B and caspofungin significantly improved antifungal susceptibility. Collectively, these data show that eDNA is an important structural component of A. fumigatus ECM that is released through autolysis, which is important for protection from environmental stresses, including antifungal therapy. PMID:23314962

  13. Microbial diversity in fecal samples depends on DNA extraction method

    DEFF Research Database (Denmark)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

    2014-01-01

    was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). FINDINGS: In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France......BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study...... by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA...

  14. Effect of DNA extraction and sample preservation method on rumen bacterial population.

    Science.gov (United States)

    Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

    2014-10-01

    The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  16. Food Fish Identification from DNA Extraction through Sequence Analysis

    Science.gov (United States)

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  17. Extracellular VirB5 enhances T-DNA transfer from Agrobacterium to the host plant.

    Directory of Open Access Journals (Sweden)

    Benoît Lacroix

    Full Text Available VirB5 is a type 4 secretion system protein of Agrobacterium located on the surface of the bacterial cell. This localization pattern suggests a function for VirB5 which is beyond its known role in biogenesis and/or stabilization of the T-pilus and which may involve early interactions between Agrobacterium and the host cell. Here, we identify VirB5 as the first Agrobacterium virulence protein that can enhance infectivity extracellularly. Specifically, we show that elevating the amounts of the extracellular VirB5--by exogenous addition of the purified protein, its overexpression in the bacterium, or transgenic expression in and secretion out of the host cell--enhances the efficiency the Agrobacterium-mediated T-DNA transfer, as measured by transient expression of genes contained on the transferred T-DNA molecule. Importantly, the exogenous VirB5 enhanced transient T-DNA expression in sugar beet, a major crop recalcitrant to genetic manipulation. Increasing the pool of the extracellular VirB5 did not complement an Agrobacterium virB5 mutant, suggesting a dual function for VirB5: in the bacterium and at the bacterium-host cell interface. Consistent with this idea, VirB5 expressed in the host cell, but not secreted, had no effect on the transformation efficiency. That the increase in T-DNA expression promoted by the exogenous VirB5 was not due to its effects on bacterial growth, virulence gene induction, bacterial attachment to plant tissue, or host cell defense response suggests that VirB5 participates in the early steps of the T-DNA transfer to the plant cell.

  18. Extracellular VirB5 enhances T-DNA transfer from Agrobacterium to the host plant.

    Science.gov (United States)

    Lacroix, Benoît; Citovsky, Vitaly

    2011-01-01

    VirB5 is a type 4 secretion system protein of Agrobacterium located on the surface of the bacterial cell. This localization pattern suggests a function for VirB5 which is beyond its known role in biogenesis and/or stabilization of the T-pilus and which may involve early interactions between Agrobacterium and the host cell. Here, we identify VirB5 as the first Agrobacterium virulence protein that can enhance infectivity extracellularly. Specifically, we show that elevating the amounts of the extracellular VirB5--by exogenous addition of the purified protein, its overexpression in the bacterium, or transgenic expression in and secretion out of the host cell--enhances the efficiency the Agrobacterium-mediated T-DNA transfer, as measured by transient expression of genes contained on the transferred T-DNA molecule. Importantly, the exogenous VirB5 enhanced transient T-DNA expression in sugar beet, a major crop recalcitrant to genetic manipulation. Increasing the pool of the extracellular VirB5 did not complement an Agrobacterium virB5 mutant, suggesting a dual function for VirB5: in the bacterium and at the bacterium-host cell interface. Consistent with this idea, VirB5 expressed in the host cell, but not secreted, had no effect on the transformation efficiency. That the increase in T-DNA expression promoted by the exogenous VirB5 was not due to its effects on bacterial growth, virulence gene induction, bacterial attachment to plant tissue, or host cell defense response suggests that VirB5 participates in the early steps of the T-DNA transfer to the plant cell.

  19. Overcoming DNA extraction problems from carnivorous plants

    Directory of Open Access Journals (Sweden)

    Fleischmann, Andreas

    2009-12-01

    Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.

    Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.

  20. Transmission of HBV DNA Mediated by Ceramide-Triggered Extracellular VesiclesSummary

    Directory of Open Access Journals (Sweden)

    Takahiro Sanada

    2017-03-01

    Full Text Available Background & Aims: An extracellular vesicle (EV is a nanovesicle that shuttles proteins, nucleic acids, and lipids, thereby influencing cell behavior. A recent crop of reports have shown that EVs are involved in infectious biology, influencing host immunity and playing a role in the viral life cycle. In the present work, we investigated the EV-mediated transmission of hepatitis B virus (HBV infection. Methods: We investigated the EV-mediated transmission of HBV infection by using a HBV infectious culture system that uses primary human hepatocytes derived from humanized chimeric mice (PXB-cells. Purified EVs were isolated by ultracentrifugation. To analyze the EVs and virions, we used stimulated emission depletion microscopy. Results: Purified EVs from HBV-infected PXB-cells were shown to contain HBV DNA and to be capable of transmitting HBV DNA to naive PXB-cells. These HBV-DNA–transmitting EVs were shown to be generated through a ceramide-triggered EV production pathway. Furthermore, we showed that these HBV-DNA–transmitting EVs were resistant to antibody neutralization; stimulated emission depletion microscopy showed that EVs lacked hepatitis B surface antigen, the target of neutralizing antibodies. Conclusions: These findings suggest that EVs harbor a DNA cargo capable of transmitting viral DNA into hepatocytes during HBV infection, representing an additional antibody-neutralization–resistant route of HBV infection. Keywords: HBV, Extracellular Vesicles, Transmission Pathway

  1. Mycobacterium avium Possesses Extracellular DNA that Contributes to Biofilm Formation, Structural Integrity, and Tolerance to Antibiotics.

    Directory of Open Access Journals (Sweden)

    Sasha J Rose

    Full Text Available Mycobacterium avium subsp. hominissuis is an opportunistic pathogen that is associated with biofilm-related infections of the respiratory tract and is difficult to treat. In recent years, extracellular DNA (eDNA has been found to be a major component of bacterial biofilms, including many pathogens involved in biofilm-associated infections. To date, eDNA has not been described as a component of mycobacterial biofilms. In this study, we identified and characterized eDNA in a high biofilm-producing strain of Mycobacterium avium subsp. hominissuis (MAH. In addition, we surveyed for presence of eDNA in various MAH strains and other nontuberculous mycobacteria. Biofilms of MAH A5 (high biofilm-producing strain and MAH 104 (reference strain were established at 22°C and 37°C on abiotic surfaces. Acellular biofilm matrix and supernatant from MAH A5 7 day-old biofilms both possess abundant eDNA, however very little eDNA was found in MAH 104 biofilms. A survey of MAH clinical isolates and other clinically relevant nontuberculous mycobacterial species revealed many species and strains that also produce eDNA. RAPD analysis demonstrated that eDNA resembles genomic DNA. Treatment with DNase I reduced the biomass of MAH A5 biofilms when added upon biofilm formation or to an already established biofilm both on abiotic surfaces and on top of human pharyngeal epithelial cells. Furthermore, co-treatment of an established biofilm with DNase 1 and either moxifloxacin or clarithromycin significantly increased the susceptibility of the bacteria within the biofilm to these clinically used antimicrobials. Collectively, our results describe an additional matrix component of mycobacterial biofilms and a potential new target to help treat biofilm-associated nontuberculous mycobacterial infections.

  2. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  3. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells.

    Science.gov (United States)

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  4. An efficient method for DNA extraction from Cladosporioid fungi

    OpenAIRE

    Moslem, M.A.; Bahkali, A.H.; Abd-Elsalam, K.A.; Wit, de, P.J.G.M.

    2010-01-01

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A260/A280 ratio ranging between 1.6 and 2.0. Isolated genomic DNA w...

  5. Comparative analysis of protocols for DNA extraction from soybean caterpillars.

    Science.gov (United States)

    Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

    2016-04-07

    Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

  6. Transmission of HBV DNA Mediated by Ceramide-Triggered Extracellular Vesicles.

    Science.gov (United States)

    Sanada, Takahiro; Hirata, Yuichi; Naito, Yutaka; Yamamoto, Naoki; Kikkawa, Yoshiaki; Ishida, Yuji; Yamasaki, Chihiro; Tateno, Chise; Ochiya, Takahiro; Kohara, Michinori

    2017-03-01

    An extracellular vesicle (EV) is a nanovesicle that shuttles proteins, nucleic acids, and lipids, thereby influencing cell behavior. A recent crop of reports have shown that EVs are involved in infectious biology, influencing host immunity and playing a role in the viral life cycle. In the present work, we investigated the EV-mediated transmission of hepatitis B virus (HBV) infection. We investigated the EV-mediated transmission of HBV infection by using a HBV infectious culture system that uses primary human hepatocytes derived from humanized chimeric mice (PXB-cells). Purified EVs were isolated by ultracentrifugation. To analyze the EVs and virions, we used stimulated emission depletion microscopy. Purified EVs from HBV-infected PXB-cells were shown to contain HBV DNA and to be capable of transmitting HBV DNA to naive PXB-cells. These HBV-DNA-transmitting EVs were shown to be generated through a ceramide-triggered EV production pathway. Furthermore, we showed that these HBV-DNA-transmitting EVs were resistant to antibody neutralization; stimulated emission depletion microscopy showed that EVs lacked hepatitis B surface antigen, the target of neutralizing antibodies. These findings suggest that EVs harbor a DNA cargo capable of transmitting viral DNA into hepatocytes during HBV infection, representing an additional antibody-neutralization-resistant route of HBV infection.

  7. An extracellular DNA mediated bystander effect produced from low dose irradiated endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Ermakov, Aleksei V., E-mail: avePlato@mail.ru [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation); Konkova, Marina S.; Kostyuk, Svetlana V.; Smirnova, Tatiana D.; Malinovskaya, Elena M.; Efremova, Liudmila V.; Veiko, Natalya N. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation)

    2011-07-01

    The human umbilical vein endothelial cells culture was exposed to X-ray radiation in a low dose of 10 cGy. The fragments of extracellular genomic DNA (ecDNA{sup R}) were isolated from the culture medium after the short-term incubation. A culture medium of unirradiated endothelial cells was then supplemented with ecDNA{sup R}, followed by analysing the cells along the series of parameters (bystander effect). The exposed cells and bystander endotheliocytes showed similar response to low doses: approximation of the 1q12 loci of chromosome 1 and their transposition into the cellular nucleus, change in shape of the endotheliocytic nucleus, activation of the nucleolus organizing regions (NORs), actin polymerization, and an elevated level of DNA double-stranded breaks. Following blockade of TLR9 receptors with oligonucleotide-inhibitor or chloroquine in the bystander cells these effects - except of activation of NORs - on exposure to ecDNA{sup R} disappeared, with no bystander response thus observed. The presence of the radiation-induced apoptosis in the bystander effect being studied suggests a possibility for radiation-modified ecDNA fragments (i.e., stress signaling factors) to be released into the culture medium, whereas inhibition of TLR9 suggests the binding these ligands to the recipient cells. A similar DNA-signaling pathway in the bystander effect we previously described for human lymphocytes. Integrity of data makes it possible to suppose that a similar signaling mechanism which we demonstrated for lymphocytes (humoral system) might also be mediated in a monolayer culture of cells (cellular tissue) after the development of the bystander effect in them and transfer of stress signaling factors (ecDNA{sup R}) through the culture medium.

  8. An extracellular DNA mediated bystander effect produced from low dose irradiated endothelial cells

    International Nuclear Information System (INIS)

    Ermakov, Aleksei V.; Konkova, Marina S.; Kostyuk, Svetlana V.; Smirnova, Tatiana D.; Malinovskaya, Elena M.; Efremova, Liudmila V.; Veiko, Natalya N.

    2011-01-01

    The human umbilical vein endothelial cells culture was exposed to X-ray radiation in a low dose of 10 cGy. The fragments of extracellular genomic DNA (ecDNA R ) were isolated from the culture medium after the short-term incubation. A culture medium of unirradiated endothelial cells was then supplemented with ecDNA R , followed by analysing the cells along the series of parameters (bystander effect). The exposed cells and bystander endotheliocytes showed similar response to low doses: approximation of the 1q12 loci of chromosome 1 and their transposition into the cellular nucleus, change in shape of the endotheliocytic nucleus, activation of the nucleolus organizing regions (NORs), actin polymerization, and an elevated level of DNA double-stranded breaks. Following blockade of TLR9 receptors with oligonucleotide-inhibitor or chloroquine in the bystander cells these effects - except of activation of NORs - on exposure to ecDNA R disappeared, with no bystander response thus observed. The presence of the radiation-induced apoptosis in the bystander effect being studied suggests a possibility for radiation-modified ecDNA fragments (i.e., stress signaling factors) to be released into the culture medium, whereas inhibition of TLR9 suggests the binding these ligands to the recipient cells. A similar DNA-signaling pathway in the bystander effect we previously described for human lymphocytes. Integrity of data makes it possible to suppose that a similar signaling mechanism which we demonstrated for lymphocytes (humoral system) might also be mediated in a monolayer culture of cells (cellular tissue) after the development of the bystander effect in them and transfer of stress signaling factors (ecDNA R ) through the culture medium.

  9. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  10. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  11. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  12. DNA Extraction from Chorionic Villi for Prenatal Diagnosis of Foetal ...

    African Journals Online (AJOL)

    BACKGROUND: Extraction of DNA from the chorionic villi is the first major step in the molecular determination of foetal haemoglobin genotype. There are few reports on DNA extraction from the chorionic villi. A desired method should be simple to conduct, reliable and cost effective. OBJECTIVE: The aim of the study was to ...

  13. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  14. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

  15. Neither eosinophils nor neutrophils require ATG5-dependent autophagy for extracellular DNA trap formation.

    Science.gov (United States)

    Germic, Nina; Stojkov, Darko; Oberson, Kevin; Yousefi, Shida; Simon, Hans-Uwe

    2017-11-01

    The importance of extracellular traps (ETs) in innate immunity is well established, but the molecular mechanisms responsible for their formation remain unclear and in scientific dispute. ETs have been defined as extracellular DNA scaffolds associated with the granule proteins of eosinophils or neutrophils. They are capable of killing bacteria extracellularly. Based mainly on results with phosphoinositide 3-kinase (PI3K) inhibitors such as 3-methyladenine (3-MA) and wortmannin, which are commonly used to inhibit autophagy, several groups have reported that autophagy is required for neutrophil extracellular trap (NET) formation. We decided to investigate this apparent dependence on autophagy for ET release and generated genetically modified mice that lack, specifically in eosinophils or neutrophils, autophagy-related 5 (Atg5), a gene encoding a protein essential for autophagosome formation. Interestingly, neither eosinophils nor neutrophils from Atg5-deficient mice exhibited abnormalities in ET formation upon physiological activation or exposure to low concentrations of PMA, although we could confirm that human and mouse eosinophils and neutrophils, after pre-treatment with inhibitors of class III PI3K, show a block both in reactive oxygen species (ROS) production and in ET formation. The so-called late autophagy inhibitors bafilomycin A1 and chloroquine, on the other hand, were without effect. These data indicate that ET formation occurs independently of autophagy and that the inhibition of ROS production and ET formation in the presence of 3-MA and wortmannin is probably owing to their additional ability to block the class I PI3Ks, which are involved in signalling cascades initiated by triggers of ET formation. © 2017 John Wiley & Sons Ltd.

  16. Critical assessment of extracellular polymeric substances extraction methods from mixed culture biomass

    DEFF Research Database (Denmark)

    Pellicer i Nàcher, Carles; Domingo Felez, Carlos; Mutlu, Ayten Gizem

    2013-01-01

    . This study presents a rigorous and critical assessment of existing physical and chemical EPS extraction methods applied to mixed-culture biomass samples (nitrifying, nitritation-anammox, and activated sludge biomass). A novel fluorescence-based method was developed and calibrated to quantify the lysis...... potential of different EPS extraction protocols. We concluded that commonly used methods to assess cell lysis (DNA concentrations or G6PDH activities in EPS extracts) do not correlate with cell viability. Furthermore, we discovered that the presence of certain chemicals in EPS extracts results in severe...... underestimation of protein and carbohydrate concentrations by using standard analytical methods. Keeping both maximum EPS extraction yields and minimal biomass lysis as criteria, it was identified a sonication-based extraction method as the best to determine and compare tightly-bound EPS fractions in different...

  17. Extraction and characterization of bound extracellular polymeric substances from cultured pure cyanobacterium (Microcystis wesenbergii).

    Science.gov (United States)

    Liu, Lizhen; Qin, Boqiang; Zhang, Yunlin; Zhu, Guangwei; Gao, Guang; Huang, Qi; Yao, Xin

    2014-08-01

    Preliminary characterization of bound extracellular polymeric substances (bEPS) of cyanobacteria is crucial to obtain a better understanding of the formation mechanism of cyanobacterial bloom. However, the characterization of bEPS can be affected by extraction methods. Five sets (including the control) of bEPS from Microcystis extracted by different methods were characterized using three-dimensional excitation and emission matrix (3DEEM) fluorescence spectroscopy combined chemical spectrophotometry; and the characterization results of bEPS samples were further compared. The agents used for extraction were NaOH, pure water and phosphate buffered saline (PBS) containing cationic exchange resins, and hot water. Extraction methods affected the fluorescence signals and intensities in the bEPS. Five fluorescence peaks were observed in the excitation and emission matrix fluorescence spectra of bEPS samples. Two peaks (peaks T₁ and T₂) present in all extractions were identified as protein-like fluorophores, two (peaks A and C) as humic-like fluorophores, and one (peak E) as a fulvic-like substance. Among these substances, the humic-like and fulvic-like fluorescences were only seen in the bEPS extracted with hot water. Also, NaOH solution extraction could result in strong fluorescence intensities compared to the other extraction methods. It was suggested that NaOH at pH10.0 was the most appropriate method to extract bEPS from Microcystis. In addition, dialysis could affect the yields and characteristics of extracted bEPS during the determination process. These results will help us to explore the issues of cyanobacterial blooms. Copyright © 2014. Published by Elsevier B.V.

  18. DNA, histones and neutrophil extracellular traps exert anti-fibrinolytic effects in a plasma environment.

    Science.gov (United States)

    Varjú, Imre; Longstaff, Colin; Szabó, László; Farkas, Ádám Zoltán; Varga-Szabó, Veronika Judit; Tanka-Salamon, Anna; Machovich, Raymund; Kolev, Krasimir

    2015-06-01

    In response to various inflammatory stimuli, neutrophils secrete neutrophil extracellular traps (NETs), web-like meshworks of DNA, histones and granular components forming supplementary scaffolds in venous and arterial thrombi. Isolated DNA and histones are known to promote thrombus formation and render fibrin clots more resistant to mechanical forces and tissue-type plasminogen activator (tPA)-induced enzymatic digestion. The present study extends our earlier observations to a physiologically more relevant environment including plasma clots and NET-forming neutrophils. A range of techniques was employed including imaging (scanning electron microscopy (SEM), confocal laser microscopy, and photoscanning of macroscopic lysis fronts), clot permeability measurements, turbidimetric lysis and enzyme inactivation assays. Addition of DNA and histones increased the median fibre diameter of plasma clots formed with 16 nM thrombin from 108 to 121 and 119 nm, respectively, and decreased their permeability constant from 6.4 to 3.1 and 3.7×10(-9) cm(2). Histones effectively protected thrombin from antithrombin-induced inactivation, while DNA inhibited plasminogen activation on the surface of plasma clots and their plasmin-induced resolution by 20 and 40 %, respectively. DNA and histones, as well as NETs secreted by phorbol-myristate-acetate-activated neutrophils, slowed down the tPA-driven lysis of plasma clots and the latter effect could be reversed by the addition of DNase (streptodornase). SEM images taken after complete digestion of fibrin in NET-containing plasma clots evidenced retained NET scaffold that was absent in DNase-treated clots. Our results show that DNA and histones alter the fibrin architecture in plasma clots, while NETs contribute to a decreased lytic susceptibility that can be overcome by DNase.

  19. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Svetlana Kostyuk

    2015-01-01

    Full Text Available Background. Cell free DNA (cfDNA circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci. As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR, PCNA (FACS and antiapoptotic genes (BCL2 (RT-PCR and FACS, BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR. Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs. Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR, in the level of fatty acid binding protein FABP4 (FACS analysis and in the level of fat (Oil Red O. Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  20. Extracellular calcium alters the effects of retinoic acid on DNA synthesis in cultured murine keratinocytes

    International Nuclear Information System (INIS)

    Tong, P.; Mayes, D.; Wheeler, L.

    1986-01-01

    The rate of proliferation of epidermal keratinocytes was manipulated by growing the cells in medium containing high or low concentrations of calcium. Keratinocytes cultured in high extracellular Ca ++ (1.4 mM and 2.8 mM) proliferated twice as fast as those grown in low Ca ++ medium (0.09 mM) as measured by incorporation of [ 3 H] thymidine into DNA. Exposure of high calcium keratinocytes to all-trans retinoic acid for 4 days caused a dose-related inhibition of DNA synthesis with an IC 50 of about 10 μM. In contrast, incubating low calcium keratinocytes with all-trans retinoic acid caused a dose-related stimulation of DNA synthesis with maximum increase of 278% over control at 10 μM. This increase was accompanied by increases in culture confluency with maximum increase of 109% in cell number of control at 10 μM. These results are of importance since they suggest Ca ++ may influence the effect of retinoids on keratinocytes

  1. Necessity of purification during bacterial DNA extraction with environmental soils

    Directory of Open Access Journals (Sweden)

    Hyun Jeong Lim

    2017-08-01

    Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.

  2. Neutrophil Extracellular DNA Traps Induce Autoantigen Production by Airway Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Youngwoo Choi

    2017-01-01

    Full Text Available The hypothesis of autoimmune involvement in asthma has received much recent interest. Autoantibodies, such as anti-cytokeratin (CK 18, anti-CK19, and anti-α-enolase antibodies, react with self-antigens and are found at high levels in the sera of patients with severe asthma (SA. However, the mechanisms underlying autoantibody production in SA have not been fully determined. The present study was conducted to demonstrate that neutrophil extracellular DNA traps (NETs, cytotoxic molecules released from neutrophils, are a key player in the stimulation of airway epithelial cells (AECs to produce autoantigens. This study showed that NETs significantly increased the intracellular expression of tissue transglutaminase (tTG but did not affect that of CK18 in AECs. NETs induced the extracellular release of both tTG and CK18 in a concentration-dependent manner. Moreover, NETs directly degraded intracellular α-enolase into small fragments. However, antibodies against neutrophil elastase (NE or myeloperoxidase (MPO attenuated the effects of NETs on AECs. Furthermore, each NET isolated from healthy controls (HC, nonsevere asthma (NSA, and SA had different characteristics. Taken together, these findings suggest that AECs exposed to NETs may exhibit higher autoantigen production, especially in SA. Therefore, targeting of NETs may represent a new therapy for neutrophilic asthma with a high level of autoantigens.

  3. Extraction of DNA from plant and fungus tissues in situ

    Directory of Open Access Journals (Sweden)

    Abu Almakarem Amal S

    2012-06-01

    Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt

  4. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  5. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

  6. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  7. Biofilm extracellular DNA enhances mixed species biofilms of Staphylococcus epidermidis and Candida albicans.

    Science.gov (United States)

    Pammi, Mohan; Liang, Rong; Hicks, John; Mistretta, Toni-Ann; Versalovic, James

    2013-11-14

    Polymicrobial infections are responsible for significant mortality and morbidity in adults and children. Staphylococcus epidermidis and Candida albicans are the most frequent combination of organisms isolated from polymicrobial infections. Vascular indwelling catheters are sites for mixed species biofilm formation and pose a significant risk for polymicrobial infections. We hypothesized that enhancement of biofilms in a mixed species environment increases patient mortality and morbidity. Mixed species biofilms of S. epidermidis and C. albicans were evaluated in vitro and in a subcutaneous catheter infection model in vivo. Mixed species biofilms were enhanced compared to single species biofilms of either S. epidermidis or C. albicans. A mixed species environment increased catheter infection and increased dissemination of S. epidermidis in mice. Microarrays were used to explore differential gene expression of S. epidermidis in the mixed species biofilms. In mixed species biofilms, compared to single species S. epidermidis biofilms, 2.7% of S. epidermidis genes were upregulated and 6% were down regulated. Staphylococcal autolysis repressors lrgA and lrgB were down regulated 36-fold and 27-fold respectively. The role of biofilm extracellular DNA was investigated by quantitation and by evaluating the effects of DNAse in a concentration and time dependent manner. S. epidermidis specific eDNA was increased in mixed species biofilms and further confirmed by degradation with DNAse. Mixed-species biofilms are enhanced and associated with increased S. epidermidis-specific eDNA in vitro and greater systemic dissemination of S. epidermidis in vivo. Down regulation of the lrg operon, a repressor of autolysis, associated with increased eDNA suggests a possible role for bacterial autolysis in mixed species biofilms. Enhancement and systemic dissemination of S. epidermidis may explain adverse outcomes after clinical polymicrobial infections of S. epidermidis and C. albicans.

  8. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  9. Biofilm extracellular DNA enhances mixed species biofilms of Staphylococcus epidermidis and Candida albicans

    Science.gov (United States)

    2013-01-01

    Background Polymicrobial infections are responsible for significant mortality and morbidity in adults and children. Staphylococcus epidermidis and Candida albicans are the most frequent combination of organisms isolated from polymicrobial infections. Vascular indwelling catheters are sites for mixed species biofilm formation and pose a significant risk for polymicrobial infections. We hypothesized that enhancement of biofilms in a mixed species environment increases patient mortality and morbidity. Results Mixed species biofilms of S. epidermidis and C. albicans were evaluated in vitro and in a subcutaneous catheter infection model in vivo. Mixed species biofilms were enhanced compared to single species biofilms of either S. epidermidis or C. albicans. A mixed species environment increased catheter infection and increased dissemination of S. epidermidis in mice. Microarrays were used to explore differential gene expression of S. epidermidis in the mixed species biofilms. In mixed species biofilms, compared to single species S. epidermidis biofilms, 2.7% of S. epidermidis genes were upregulated and 6% were down regulated. Staphylococcal autolysis repressors lrgA and lrgB were down regulated 36-fold and 27-fold respectively. The role of biofilm extracellular DNA was investigated by quantitation and by evaluating the effects of DNAse in a concentration and time dependent manner. S. epidermidis specific eDNA was increased in mixed species biofilms and further confirmed by degradation with DNAse. Conclusions Mixed-species biofilms are enhanced and associated with increased S. epidermidis-specific eDNA in vitro and greater systemic dissemination of S. epidermidis in vivo. Down regulation of the lrg operon, a repressor of autolysis, associated with increased eDNA suggests a possible role for bacterial autolysis in mixed species biofilms. Enhancement and systemic dissemination of S. epidermidis may explain adverse outcomes after clinical polymicrobial infections of S

  10. Iron Triggers λSo Prophage Induction and Release of Extracellular DNA in Shewanella oneidensis MR-1 Biofilms

    OpenAIRE

    Binnenkade, Lucas; Teichmann, Laura; Thormann, Kai M.

    2014-01-01

    Prophages are ubiquitous elements within bacterial chromosomes and affect host physiology and ecology in multiple ways. We have previously demonstrated that phage-induced lysis is required for extracellular DNA (eDNA) release and normal biofilm formation in Shewanella oneidensis MR-1. Here, we investigated the regulatory mechanisms of prophage λSo spatiotemporal induction in biofilms. To this end, we used a functional fluorescence fusion to monitor λSo activation in various mutant backgrounds...

  11. An improved method of DNA extraction from plants for pathogen ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

  12. Comparison of protocols for genomic DNA extraction from 'velame ...

    African Journals Online (AJOL)

    usuario

    2013-07-24

    Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

  13. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  14. Digital PCR for direct quantification of viruses without DNA extraction

    OpenAIRE

    Pav?i?, Jernej; ?el, Jana; Milavec, Mojca

    2015-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...

  15. Targeting Extracellular DNA to Deliver IGF-1 to the Injured Heart

    Science.gov (United States)

    Khan, Raffay S.; Martinez, Mario D.; Sy, Jay C.; Pendergrass, Karl D.; Che, Pao-Lin; Brown, Milton E.; Cabigas, E. Bernadette; Dasari, Madhuri; Murthy, Niren; Davis, Michael E.

    2014-03-01

    There is a great need for the development of therapeutic strategies that can target biomolecules to damaged myocardium. Necrosis of myocardium during a myocardial infarction (MI) is characterized by extracellular release of DNA, which can serve as a potential target for ischemic tissue. Hoechst, a histological stain that binds to double-stranded DNA can be conjugated to a variety of molecules. Insulin-like growth factor-1 (IGF-1), a small protein/polypeptide with a short circulating-half life is cardioprotective following MI but its clinical use is limited by poor delivery, as intra-myocardial injections have poor retention and chronic systemic presence has adverse side effects. Here, we present a novel delivery vehicle for IGF-1, via its conjugation to Hoechst for targeting infarcted tissue. Using a mouse model of ischemia-reperfusion, we demonstrate that intravenous delivery of Hoechst-IGF-1 results in activation of Akt, a downstream target of IGF-1 and protects from cardiac fibrosis and dysfunction following MI.

  16. Competitive adsorption of heavy metal by extracellular polymeric substances (EPS) extracted from sulfate reducing bacteria.

    Science.gov (United States)

    Wang, Jin; Li, Qing; Li, Ming-Ming; Chen, Tian-Hu; Zhou, Yue-Fei; Yue, Zheng-Bo

    2014-07-01

    Competitive adsorption of heavy metals by extracellular polymeric substances (EPS) extracted from Desulfovibrio desulfuricans was investigated. Chemical analysis showed that different EPS compositions had different capacities for the adsorption of heavy metals which was investigated using Cu(2+) and Zn(2+). Batch adsorption tests indicated that EPS had a higher combined ability with Zn(2+) than Cu(2+). This was confirmed and explained by Fourier transform infrared (FTIR) and excitation-emission matrix (EEM) spectroscopy analysis. FTIR analysis showed that both polysaccharides and protein combined with Zn(2+) while only protein combined with Cu(2+). EEM spectra further revealed that tryptophan-like substances were the main compositions reacted with the heavy metals. Moreover, Zn(2+) had a higher fluorescence quenching ability than Cu(2+). Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Digital PCR for direct quantification of viruses without DNA extraction.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration material and it has higher tolerance to inhibitors. DNA quantification without an extraction step (i.e. direct quantification) was performed here using dPCR and two different human cytomegalovirus whole-virus materials. Two dPCR platforms were used for this direct quantification of the viral DNA, and these were compared with quantification of the extracted viral DNA in terms of yield and variability. Direct quantification of both whole-virus materials present in simple matrices like cell lysate or Tris-HCl buffer provided repeatable measurements of virus concentrations that were probably in closer agreement with the actual viral load than when estimated through quantification of the extracted DNA. Direct dPCR quantification of other viruses, reference materials and clinically relevant matrices is now needed to show the full versatility of this very promising and cost-efficient development in virus quantification.

  18. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    Arachis hypogaea L.) is particularly problematic due to the presence of phenolic compounds and polysaccharides. Inconsistencies in extraction results can be attributed to the age and growth stages of the plant material analyzed. Mature leaves ...

  19. Eosinophil extracellular DNA traps in allergies = Trampas extracelulares de DNA de eosinófilos en alergias

    Directory of Open Access Journals (Sweden)

    Castrillón Álvarez, Marlon

    2014-04-01

    Full Text Available Allergy is a hypersensitivity reaction initiated by specific immunologic mechanisms. It can be mediated by antibodies or cells, developed in individuals previously sensitized by an allergen. In most cases, the antibody responsible for the allergic reaction is immunoglobulin E (IgE. Depending on the nature and mechanism of entry of the allergen, it will bring about the production of specific IgE affecting certain organs and tissues with specific symptoms. Eosinophil extracellular DNA traps or EETs are one of the mechanisms used by eosinophils during the response phase of allergy; they have not been well studied in terms of their induction, regulation and function. EETs have been detected in inflammatory intestinal processes, autoimmune diseases and multiple infectious diseases, but few investigations have been made about their involvement in allergic diseases. This is a review about the structure of EETs, the molecules involved in their formation, and their possible role in the pathogenesis of allergies. Furthermore, the main aspects of cellular and molecular processes involved in the immunopathogenesis of allergies, and the central aspects of the structure, composition and functioning of eosinophils are reviewed.

  20. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  1. Quantifying biostabilisation effects of biofilm-secreted and extracted extracellular polymeric substances (EPSs) on sandy substrate

    Science.gov (United States)

    van de Lageweg, Wietse I.; McLelland, Stuart J.; Parsons, Daniel R.

    2018-03-01

    Microbial assemblages (biofilms) preferentially develop at water-sediment interfaces and are known to have a considerable influence on sediment stability and erodibility. There is potential for significant impacts on sediment transport and morphodynamics, and hence on the longer-term evolution of coastal and fluvial environments. However, the biostabilisation effects remain poorly understood and quantified due to the inherent complexity of biofilms and the large spatial and temporal (i.e. seasonality) variations involved. Here, we use controlled laboratory tests to systematically quantify the effects of natural biofilm colonisation as well as extracted extracellular polymeric substances (EPSs) on sediment stability. Extracted EPSs may be useful to simulate biofilm-mediated biostabilisation and potentially provide a method of speeding up timescales of physical modelling experiments investigating biostabilisation effects. We find a mean biostabilisation effect due to natural biofilm colonisation and development of almost 4 times that of the uncolonised sand. The presented cumulative probability distribution of measured critical threshold for erosion of colonised sand reflects the large spatial and temporal variations generally seen in natural biostabilised environments. For identical sand, engineered sediment stability from the addition of extracted EPSs compares well across the measured range of the critical threshold for erosion and behaves in a linear and predictable fashion. Yet, the effectiveness of extracted EPSs to stabilise sediment is sensitive to the preparation procedure, time after application and environmental conditions such as salinity, pH and temperature. These findings are expected to improve biophysical experimental models in fluvial and coastal environments and provide much-needed quantification of biostabilisation to improve predictions of sediment dynamics in aquatic ecosystems.

  2. Extracellular DNA amplicon sequencing reveals high levels of benthic eukaryotic diversity in the central Red Sea

    KAUST Repository

    Pearman, John K.

    2015-11-01

    The present study aims to characterize the benthic eukaryotic biodiversity patterns at a coarse taxonomic level in three areas of the central Red Sea (a lagoon, an offshore area in Thuwal and a shallow coastal area near Jeddah) based on extracellular DNA. High-throughput amplicon sequencing targeting the V9 region of the 18S rRNA gene was undertaken for 32 sediment samples. High levels of alpha-diversity were detected with 16,089 operational taxonomic units (OTUs) being identified. The majority of the OTUs were assigned to Metazoa (29.2%), Alveolata (22.4%) and Stramenopiles (17.8%). Stramenopiles (Diatomea) and Alveolata (Ciliophora) were frequent in a lagoon and in shallower coastal stations, whereas metazoans (Arthropoda: Maxillopoda) were dominant in deeper offshore stations. Only 24.6% of total OTUs were shared among all areas. Beta-diversity was generally lower between the lagoon and Jeddah (nearshore) than between either of those and the offshore area, suggesting a nearshore–offshore biodiversity gradient. The current approach allowed for a broad-range of benthic eukaryotic biodiversity to be analysed with significantly less labour than would be required by other traditional taxonomic approaches. Our findings suggest that next generation sequencing techniques have the potential to provide a fast and standardised screening of benthic biodiversity at large spatial and temporal scales.

  3. Urinary extracellular vesicles for RNA extraction: optimization of a protocol devoid of prokaryote contamination.

    Science.gov (United States)

    Tataruch-Weinert, Dorota; Musante, Luca; Kretz, Oliver; Holthofer, Harry

    2016-01-01

    Urinary extracellular vesicles (UEVs) represent an ideal platform for biomarker discovery. They carry different types of RNA species, and reported profile discrepancies related to the presence/absence of 18s and 28s rRNA remain controversial. Moreover, sufficient urinary RNA yields and respective quality RNA profiles are still to be fully established. UEVs were enriched by hydrostatic filtration dialysis, and RNA content was extracted using 7 different commercially available techniques. RNA quantity was assessed using spectrophotometry and fluorometry, whilst RNA quality was determined by capillary electrophoresis. The presence of prokaryotic transcriptome was stressed when cellular RNA, as a control, was spiked into the UEVs samples before RNA extraction. The presence of bacteria in hydrostatic filtration dialysis above 1,000 kDa molecular weight cut-off and in crude urine was confirmed with growth media plates. The efficiency in removing urinary bacteria was evaluated by differential centrifugation, filtration (0.22 µm filters) and chemical pretreatment (water purification tablet). For volumes of urine >200 ml, the chemical treatment provides ease of handling without affecting vesicle integrity, protein and RNA profiles. This protocol was selected to enrich RNA with 7 methods, and its respective quality and quantity were assessed. The results were given as follows: (a) Fluorometry gave more repeatability and reproducibility than spectrophotometry to assess the RNA yields, (b) UEVs were enriched with small RNA, (c) Ribosomal RNA peaks were not observed for any RNA extraction method used and (d) RNA yield was higher for column-based method designed for urinary exosome, whilst the highest relative microRNA presence was obtained using TRIzol method. Our results show that the presence of bacteria can lead to misidentification in the electrophoresis peaks. Fluorometry is more reliable than spectrophotometry. RNA isolation method must be selected in conjunction with

  4. Extracellular DNA is essential for maintaining Bordetella biofilm integrity on abiotic surfaces and in the upper respiratory tract of mice.

    Directory of Open Access Journals (Sweden)

    Matt S Conover

    2011-02-01

    Full Text Available Bacteria form complex and highly elaborate surface adherent communities known as biofilms which are held together by a self-produced extracellular matrix. We have previously shown that by adopting a biofilm mode of existence in vivo, the gram negative bacterial pathogens Bordetella bronchiseptica and Bordetella pertussis are able to efficiently colonize and persist in the mammalian respiratory tract. In general, the bacterial biofilm matrix includes polysaccharides, proteins and extracellular DNA (eDNA. In this report, we investigated the function of DNA in Bordetella biofilm development. We show that DNA is a significant component of Bordetella biofilm matrix. Addition of DNase I at the initiation of biofilm growth inhibited biofilm formation. Treatment of pre-established mature biofilms formed under both static and flow conditions with DNase I led to a disruption of the biofilm biomass. We next investigated whether eDNA played a role in biofilms formed in the mouse respiratory tract. DNase I treatment of nasal biofilms caused considerable dissolution of the biofilm biomass. In conclusion, these results suggest that eDNA is a crucial structural matrix component of both in vitro and in vivo formed Bordetella biofilms. This is the first evidence for the ability of DNase I to disrupt bacterial biofilms formed on host organs.

  5. Nonhomologous DNA End Joining in Cell-Free Extracts

    Directory of Open Access Journals (Sweden)

    Sheetal Sharma

    2010-01-01

    Full Text Available Among various DNA damages, double-strand breaks (DSBs are considered as most deleterious, as they may lead to chromosomal rearrangements and cancer when unrepaired. Nonhomologous DNA end joining (NHEJ is one of the major DSB repair pathways in higher organisms. A large number of studies on NHEJ are based on in vitro systems using cell-free extracts. In this paper, we summarize the studies on NHEJ performed by various groups in different cell-free repair systems.

  6. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  7. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    OpenAIRE

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-01-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cell...

  8. Extraction of DNA from Forensic Biological Samples for Genotyping.

    Science.gov (United States)

    Stray, J E; Liu, J Y; Brevnov, M G; Shewale, J G

    2010-07-01

    Biological forensic samples constitute evidence with probative organic matter. Evidence believed to contain DNA is typically processed for extraction and purification of its nucleic acid content. Forensic DNA samples are composed of two things, a tissue and the substrate it resides on. Compositionally, a sample may contain almost anything and for each, the type, integrity, and content of both tissue and substrate will vary, as will the contaminant levels. This fact makes the success of extraction one of the most unpredictable steps in genotypic analysis. The development of robust genotyping systems and analysis platforms for short tandem repeat (STR) and mitochondrial DNA sequencing and the acceptance of results generated by these methods in the court system, resulted in a high demand for DNA testing. The increasing variety of sample submissions created a need to isolate DNA from forensic samples that may be compromised or contain low levels of biological material. In the past decade, several robust chemistries and isolation methods have been developed to safely and reliably recover DNA from a wide array of sample types in high yield and free of PCR inhibitors. In addition, high-throughput automated workflows have been developed to meet the demand for processing increasing numbers of samples. This review summarizes a number of the most widely adopted methods and the best practices for DNA isolation from forensic biological samples, including manual, semiautomated, and fully automated platforms. Copyright © 2010 Central Police University.

  9. Comparison of different methodologies for DNA extraction from Aegla longirostri

    Directory of Open Access Journals (Sweden)

    João Vitor Trindade Bitencourt

    2007-11-01

    Full Text Available The aim of this study was to compare some DNA extraction methodologies for Aegla longirostri. The protocols were based on the traditional phenol-chloroform DNA extraction methodology and using a commercial kit for DNA extraction. They differed in tissues used, the addition - or not - of beta-mercaptoethanol to the lysis buffer, times and methods for the animal's conservation (frozen, in ethanol or fresh. Individuals stored at -20°C for a long time supplied lower molecular weight DNA than those stored for a short time. The best yield for the specimens preserved in ethanol was obtained for 15 days storage in 95% ethanol. The kit resulted in a low quantity of high molecular weight DNA. The best protocol for DNA extraction from Aeglidae, and probably for other crustaceans should, therefore, utilize fresh specimens, with addition of beta-mercaptoethanol to the lysis buffer.Marcadores moleculares são ferramentas úteis para esclarecer dúvidas a respeito dos Aeglidae, único grupo de crustáceos Anomura de água doce. Essas técnicas dependem da obtenção de DNA de boa qualidade e sem contaminantes. O objetivo deste estudo foi comparar algumas metodologias de extração de DNA de Aegla longirostri. Quatorze protocolos foram analisados, baseados na metodologia tradicional de extração de DNA com fenol-clorofórmio, exceto o protocolo K no qual se utilizou um Kit. Os procedimentos diferiram quanto aos tecidos utilizados e a adição de beta-mercaptoetanol ao tampão de lise. Avaliaram-se também diferentes tempos e maneiras de conservação. Indivíduos congelados apresentaram maior degradação do material obtido conforme o tempo em que ficaram congelados. Para os indivíduos conservados em álcool, aqueles mantidos em etanol 95% forneceram material de melhor qualidade. A utilização do Mini Kit resultou em uma quantidade muito pequena de DNA de alto peso molecular. O melhor protocolo para extração de DNA de Aeglidae utilizou músculos e br

  10. Competitive adsorption of heavy metals by extracellular polymeric substances extracted from Klebsiella sp. J1.

    Science.gov (United States)

    Yang, Jixian; Wei, Wei; Pi, Shanshan; Ma, Fang; Li, Ang; Wu, Dan; Xing, Jie

    2015-11-01

    The adsorption of Cu(2+) and Zn(2+) by extracellular polymeric substances (EPS) extracted from Klebsiella sp. J1 and competitive adsorption mechanism were investigated. Equilibrium adsorption capacities of Cu(2+) (1.77mMg(-1)) on Klebsiella sp. J1 EPS were higher than those of Zn(2+) (1.36mMg(-1)) in single systems. The competitive Langmuir and Langmuir-Freundlich isotherm models were proven to be effective in describing the experimental data of binary component system. The three dimensional sorption surfaces of binary component system demonstrated that the presence of Cu(2+) more significantly decreased the sorption of Zn(2+), but the sorption of Cu(2+) was not disturbed by the presence of Zn(2+). FTIR and EEM results revealed the adsorption sites of Cu(2+) entirely overlapped with those of Zn(2+). Cu(2+) and Zn(2+) showed competitive adsorption in binary systems, and Cu(2+) was preferentially adsorbed because of the stronger complexation ability of the protein-like substances in Klebsiella sp. J1 EPS. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

  12. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... DNA is extracted from plant material it will also contain. *Corresponding author. ... an important issue in the field of plant molecular biology. Various plants ..... An excellent guide to over 500 of the more well known medicinal ...

  13. DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

    Science.gov (United States)

    Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

    2018-04-01

    Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

  14. Urinary extracellular vesicles for RNA extraction: optimization of a protocol devoid of prokaryote contamination

    Directory of Open Access Journals (Sweden)

    Dorota Tataruch-Weinert

    2016-06-01

    Full Text Available Background: Urinary extracellular vesicles (UEVs represent an ideal platform for biomarker discovery. They carry different types of RNA species, and reported profile discrepancies related to the presence/absence of 18s and 28s rRNA remain controversial. Moreover, sufficient urinary RNA yields and respective quality RNA profiles are still to be fully established. Methods: UEVs were enriched by hydrostatic filtration dialysis, and RNA content was extracted using 7 different commercially available techniques. RNA quantity was assessed using spectrophotometry and fluorometry, whilst RNA quality was determined by capillary electrophoresis. Results: The presence of prokaryotic transcriptome was stressed when cellular RNA, as a control, was spiked into the UEVs samples before RNA extraction. The presence of bacteria in hydrostatic filtration dialysis above 1,000 kDa molecular weight cut-off and in crude urine was confirmed with growth media plates. The efficiency in removing urinary bacteria was evaluated by differential centrifugation, filtration (0.22 µm filters and chemical pretreatment (water purification tablet. For volumes of urine >200 ml, the chemical treatment provides ease of handling without affecting vesicle integrity, protein and RNA profiles. This protocol was selected to enrich RNA with 7 methods, and its respective quality and quantity were assessed. The results were given as follows: (a Fluorometry gave more repeatability and reproducibility than spectrophotometry to assess the RNA yields, (b UEVs were enriched with small RNA, (c Ribosomal RNA peaks were not observed for any RNA extraction method used and (d RNA yield was higher for column-based method designed for urinary exosome, whilst the highest relative microRNA presence was obtained using TRIzol method. Conclusion: Our results show that the presence of bacteria can lead to misidentification in the electrophoresis peaks. Fluorometry is more reliable than spectrophotometry. RNA

  15. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  16. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  17. EXTRACELLULAR DNA AND THE LEVEL OF ITS METHYLATION IN DIFFERENT RHEUMATIC DISEASES

    Directory of Open Access Journals (Sweden)

    N O Shubayeva

    2012-01-01

    Conclusion. RDs are characterized by the higher concentration of apoptotic and necrotic DNA, impaired exDNA methylation, varying complexification of exDNA with monometinic proteins, which is associated with the hyperproduction of autoantibodies (including anti-exDNA antibodies and inflammatory markers.

  18. Pel is a cationic exopolysaccharide that cross-links extracellular DNA in the Pseudomonas aeruginosa biofilm matrix.

    Science.gov (United States)

    Jennings, Laura K; Storek, Kelly M; Ledvina, Hannah E; Coulon, Charlène; Marmont, Lindsey S; Sadovskaya, Irina; Secor, Patrick R; Tseng, Boo Shan; Scian, Michele; Filloux, Alain; Wozniak, Daniel J; Howell, P Lynne; Parsek, Matthew R

    2015-09-08

    Biofilm formation is a complex, ordered process. In the opportunistic pathogen Pseudomonas aeruginosa, Psl and Pel exopolysaccharides and extracellular DNA (eDNA) serve as structural components of the biofilm matrix. Despite intensive study, Pel's chemical structure and spatial localization within mature biofilms remain unknown. Using specialized carbohydrate chemical analyses, we unexpectedly found that Pel is a positively charged exopolysaccharide composed of partially acetylated 1→4 glycosidic linkages of N-acetylgalactosamine and N-acetylglucosamine. Guided by the knowledge of Pel's sugar composition, we developed a tool for the direct visualization of Pel in biofilms by combining Pel-specific Wisteria floribunda lectin staining with confocal microscopy. The results indicate that Pel cross-links eDNA in the biofilm stalk via ionic interactions. Our data demonstrate that the cationic charge of Pel is distinct from that of other known P. aeruginosa exopolysaccharides and is instrumental in its ability to interact with other key biofilm matrix components.

  19. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    Directory of Open Access Journals (Sweden)

    Shirleny Monserrat Sandoval-Arias

    2014-11-01

    Full Text Available The identification of suspects in criminal investigations has been facilitated since DNA test are executed on different samples. The application of this technology for forensic typification from human fecal samples still presents complications therefore this research evaluated two DNA extraction protocols with modifications to determine that of major efficiency. Organic extractions and extractions using the commercial kit “IQTM DNA Casework Sample Kit for Maxwell ® 16” on FTA portions of 4cm2 and 1cm2 impregnated with feces from the same individual were done to accomplish the objective. In all the assays the results were useful, however; the best forensic typification (by the electropherogram characteristics was obtained by using the commercial kit in an area of 1 cm2 of FTA paper impregnated in a 1:4 dilution.

  20. DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

    Energy Technology Data Exchange (ETDEWEB)

    Pecora, Gabrielle N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Reid, Francine C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tom, Lauren M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piceno, Yvette M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Andersen, Gary L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-05-01

    Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in the world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.

  1. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  2. Optimization of DNA extraction for ISSR studies in Tectona grandis Lf

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... genomic DNA, emphasizing screening of inexpensive, rapid and simple DNA extraction methods (Weishing et al., 1995). Yield and quality of DNA often varies among tree tissue types (Henry, 2001). Besides, purification of genomic DNA in trees is difficult due to co-extraction of high quantities of tannins, ...

  3. Bacterial community analysis of activated sludge: an evaluation of four commonly used DNA extraction methods

    NARCIS (Netherlands)

    Vanysacker, L.; Declerck, S.A.J.; Hellemans, B.; De Meester, L.; Vankelecom, I.; Declerck, P.

    2010-01-01

    The effectiveness of three commercially available direct DNA isolation kits (Mobio, Fast, Qiagen) and one published direct DNA extraction protocol (Bead) for extracting bacterial DNA from different types of activated sludge was investigated and mutually compared. The DNA quantity and purity were

  4. Extracellular DNA contributes to dental biofilm formation: An ex vivo study

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Meyer, Rikke Louise; Dige, Irene

    2016-01-01

    The extracellular matrix of dental biofilms plays an important role during caries development. It increases the mechanical stability of the biofilm, it prevents desiccation, it serves as a reservoir for nutrients and it contributes to the long-term preservation of acidic microenvironments. Research...

  5. Evaluation of four automated protocols for extraction of DNA from FTA cards.

    Science.gov (United States)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-10-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already extracted from the FTA cards.

  6. Raffinose Induces Biofilm Formation by Streptococcus mutans in Low Concentrations of Sucrose by Increasing Production of Extracellular DNA and Fructan.

    Science.gov (United States)

    Nagasawa, Ryo; Sato, Tsutomu; Senpuku, Hidenobu

    2017-08-01

    Streptococcus mutans is the primary etiological agent of dental caries and causes tooth decay by forming a firmly attached biofilm on tooth surfaces. Biofilm formation is induced by the presence of sucrose, which is a substrate for the synthesis of extracellular polysaccharides but not in the presence of oligosaccharides. Nonetheless, in this study, we found that raffinose, which is an oligosaccharide with an intestinal regulatory function and antiallergic effect, induced biofilm formation by S. mutans in a mixed culture with sucrose, which was at concentrations less than those required to induce biofilm formation directly. We analyzed the possible mechanism behind the small requirement for sucrose for biofilm formation in the presence of raffinose. Our results suggested that sucrose contributed to an increase in bacterial cell surface hydrophobicity and biofilm formation. Next, we examined how the effects of raffinose interacted with the effects of sucrose for biofilm formation. We showed that the presence of raffinose induced fructan synthesis by fructosyltransferase and aggregated extracellular DNA (eDNA, which is probably genomic DNA released from dead cells) into the biofilm. eDNA seemed to be important for biofilm formation, because the degradation of DNA by DNase I resulted in a significant reduction in biofilm formation. When assessing the role of fructan in biofilm formation, we found that fructan enhanced eDNA-dependent cell aggregation. Therefore, our results show that raffinose and sucrose have cooperative effects and that this induction of biofilm formation depends on supportive elements that mainly consist of eDNA and fructan. IMPORTANCE The sucrose-dependent mechanism of biofilm formation in Streptococcus mutans has been studied extensively. Nonetheless, the effects of carbohydrates other than sucrose are inadequately understood. Our findings concerning raffinose advance the understanding of the mechanism underlying the joint effects of sucrose and

  7. Direct human DNA protection by Coriolus versicolor (Yunzhi) extract.

    Science.gov (United States)

    Szeto, Yim Tong; Lau, Po Chun; Kalle, Wouter; Pak, Sok Cheon

    2013-07-01

    Scientific evidence has shown Coriolus versicolor (L. ex Fr.) Quel (also known as Yunzhi) has the role of immunomodulator in therapeutic effect. The aim of this in vitro study was to investigate the antioxidative effect of Yunzhi and to explore the mechanisms behind its DNA protection. Commercial Yunzhi extract was dissolved in water and diluted in five concentrations (10(1)-10(5) μg/L) with appropriate buffers. Lymphocytes harvested from three healthy subjects were incubated with Yunzhi extract for 30 min. Cells were then subjected to 5 min oxidant challenge by 45 μM hydrogen peroxide. The standard alkaline comet (SAC) assay and lysed cell comet (LCC) assay were performed in parallel. DNA damage of each treatment was scored under a fluorescence microscope and compared with the cells without Yunzhi pretreatment. U-shaped dose-response was seen in both versions of the comet assay. Yunzhi at 10(4) μg/L demonstrated a genoprotective effect against oxidative damage in the SAC assay (25% decrease in comet score). In the LCC assay, a trend of protection in lymphocytes was observed but it did not reach statistical significance. A direct antioxidant effect of Yunzhi against oxidant challenge on the DNA of lymphocytes was evidenced. The active component in Yunzhi was likely to be membrane permeable.

  8. Designing easy DNA extraction: Teaching creativity through laboratory practice.

    Science.gov (United States)

    Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

    2017-05-01

    Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  9. Effect of DNA extraction and sample preservation method on rumen bacterial population

    Czech Academy of Sciences Publication Activity Database

    Fliegerová, Kateřina; Tapio, I.; Bonin, A.; Mrázek, Jakub; Callegari, M. L.; Bani, P.; Bayat, A.; Vilkki, J.; Kopečný, Jan; Shingfield, K.; Boyer, F.; Coissac, E.; Taberlet, P.; Wallace, R. J.

    2014-01-01

    Roč. 29, č. 1 (2014), s. 80-84 ISSN 1075-9964. [International Symposium on Anaerobic Microbiology /8./. Innsbruck, 12.06.2013-15.06.2013] EU Projects: European Commission(XE) 289319 - RUMINOMICS Keywords : intracellular DNA * extracellular DNA * storage conditions Subject RIV: EE - Microbiology, Virology Impact factor: 2.479, year: 2014

  10. Enhanced transfection efficiency of human embryonic stem cells by the incorporation of DNA liposomes in extracellular matrix.

    Science.gov (United States)

    Villa-Diaz, Luis G; Garcia-Perez, Jose L; Krebsbach, Paul H

    2010-12-01

    Because human embryonic stem (hES) cells can differentiate into virtually any cell type in the human body, these cells hold promise for regenerative medicine. The genetic manipulation of hES cells will enhance our understanding of genes involved in early development and will accelerate their potential use and application for regenerative medicine. The objective of this study was to increase the transfection efficiency of plasmid DNA into hES cells by modifying a standard reverse transfection (RT) protocol of lipofection. We hypothesized that immobilization of plasmid DNA in extracellular matrix would be a more efficient method for plasmid transfer due to the affinity of hES cells for substrates such as Matrigel and to the prolonged exposure of cells to plasmid DNA. Our results demonstrate that this modification doubled the transfection efficiency of hES cells and the generation of clonal cell lines containing a piece of foreign DNA stably inserted in their genomes compared to results obtained with standard forward transfection. In addition, treatment with dimethyl sulfoxide further increased the transfection efficiency of hES cells. In conclusion, modifications to the RT protocol of lipofection result in a significant and robust increase in the transfection efficiency of hES cells.

  11. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  12. Susceptibility patterns and the role of extracellular DNA in Staphylococcus epidermidis biofilm resistance to physico-chemical stress exposure.

    Science.gov (United States)

    Olwal, Charles Ochieng'; Ang'ienda, Paul Oyieng'; Onyango, David Miruka; Ochiel, Daniel Otieno

    2018-05-02

    Over 65% of human infections are ascribed to bacterial biofilms that are often highly resistant to antibiotics and host immunity. Staphylococcus epidermidis is the predominant cause of recurrent nosocomial and biofilm-related infections. However, the susceptibility patterns of S. epidermidis biofilms to physico-chemical stress induced by commonly recommended disinfectants [(heat, sodium chloride (NaCl), sodium hypochlorite (NaOCl) and hydrogen peroxide (H 2 O 2 )] in domestic and human healthcare settings remains largely unknown. Further, the molecular mechanisms of bacterial biofilms resistance to the physico-chemical stresses remain unclear. Growing evidence demonstrates that extracellular DNA (eDNA) protects bacterial biofilms against antibiotics. However, the role of eDNA as a potential mechanism underlying S. epidermidis biofilms resistance to physico-chemical stress exposure is yet to be understood. Therefore, this study aimed to evaluate the susceptibility patterns of and eDNA release by S. epidermidis biofilm and planktonic cells to physico-chemical stress exposure. S. epidermidis biofilms exposed to physico-chemical stress conditions commonly recommended for disinfection [heat (60 °C), 1.72 M NaCl, solution containing 150 μL of waterguard (0.178 M NaOCl) in 1 L of water or 1.77 M H 2 O 2 ] for 30 and 60 min exhibited lower log reductions of CFU/mL than the corresponding planktonic cells (p chemical stress induced by the four commonly recommended disinfectants than the analogous planktonic cells. Further, S. epidermidis biofilms enhanced eDNA release in response to the sub-lethal heat and oxidative stress exposure than the corresponding planktonic cells suggesting a role of eDNA in biofilms resistance to the physico-chemical stresses.

  13. Uptake of extracellular DNA: Competence induced pili in natural transformation of Streptococcus pneumoniae

    Science.gov (United States)

    Muschiol, Sandra; Balaban, Murat; Normark, Staffan; Henriques-Normark, Birgitta

    2015-01-01

    Transport of DNA across bacterial membranes involves complex DNA uptake systems. In Gram-positive bacteria, the DNA uptake machinery shares fundamental similarities with type IV pili and type II secretion systems. Although dedicated pilus structures, such as type IV pili in Gram-negative bacteria, are necessary for efficient DNA uptake, the role of similar structures in Gram-positive bacteria is just beginning to emerge. Recently two essentially very different pilus structures composed of the same major pilin protein ComGC were proposed to be involved in transformation of the Gram-positive bacterium Streptococcus pneumoniae – one is a long, thin, type IV pilus-like fiber with DNA binding capacity and the other one is a pilus structure that was thicker, much shorter and not able to bind DNA. Here we discuss how competence induced pili, either by pilus retraction or by a transient pilus-related opening in the cell wall, may mediate DNA uptake in S. pneumoniae. PMID:25640084

  14. A simple Chelex protocol for DNA extraction from Anopheles spp.

    Science.gov (United States)

    Musapa, Mulenga; Kumwenda, Taida; Mkulama, Mtawa; Chishimba, Sandra; Norris, Douglas E; Thuma, Philip E; Mharakurwa, Sungano

    2013-01-09

    Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens. We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km(2) vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 μl of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 μl was retained while the other 10 μl was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol(9,10). The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction(9). Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality, a PCR for identification of Anopheles gambiae sibling species(10) and a nested PCR for typing of Plasmodium falciparum infection

  15. A dual role of extracellular DNA during biofilm formation of Neisseria meningitidis

    DEFF Research Database (Denmark)

    Lappann, M.; Claus, H.; van Alen, T.

    2010-01-01

    formation, whereas biofilm formation of cc with low point prevalence (ST-8 cc and ST-11 cc) was eDNA-independent. For initial biofilm formation, a ST-32 cc type strain, but not a ST-11 type strain, utilized eDNA. The release of eDNA was mediated by lytic transglycosylase and cytoplasmic N......-acetylmuramyl-l-alanine amidase genes. In late biofilms, outer membrane phospholipase A-dependent autolysis, which was observed in most cc, but not in ST-8 and ST-11 strains, was required for shear force resistance of microcolonies. Taken together, N. meningitidis evolved two different biofilm formation strategies, an e....... On the contrary, spreaders (ST-11 and ST-8 cc) are unable to use eDNA for biofilm formation and might compensate for poor colonization properties by high transmission rates....

  16. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  17. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura

    2013-01-01

    protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA...... from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore......, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already...

  18. Iron triggers λSo prophage induction and release of extracellular DNA in Shewanella oneidensis MR-1 biofilms.

    Science.gov (United States)

    Binnenkade, Lucas; Teichmann, Laura; Thormann, Kai M

    2014-09-01

    Prophages are ubiquitous elements within bacterial chromosomes and affect host physiology and ecology in multiple ways. We have previously demonstrated that phage-induced lysis is required for extracellular DNA (eDNA) release and normal biofilm formation in Shewanella oneidensis MR-1. Here, we investigated the regulatory mechanisms of prophage λSo spatiotemporal induction in biofilms. To this end, we used a functional fluorescence fusion to monitor λSo activation in various mutant backgrounds and in response to different physiological conditions. λSo induction occurred mainly in a subpopulation of filamentous cells in a strictly RecA-dependent manner, implicating oxidative stress-induced DNA damage as the major trigger. Accordingly, mutants affected in the oxidative stress response (ΔoxyR) or iron homeostasis (Δfur) displayed drastically increased levels of phage induction and abnormal biofilm formation, while planktonic cells were not or only marginally affected. To further investigate the role of oxidative stress, we performed a mutant screen and identified two independent amino acid substitutions in OxyR (T104N and L197P) that suppress induction of λSo by hydrogen peroxide (H2O2). However, λSo induction was not suppressed in biofilms formed by both mutants, suggesting a minor role of intracellular H2O2 in this process. In contrast, addition of iron to biofilms strongly enhanced λSo induction and eDNA release, while both processes were significantly suppressed at low iron levels, strongly indicating that iron is the limiting factor. We conclude that uptake of iron during biofilm formation triggers λSo-mediated lysis of a subpopulation of cells, likely by an increase in iron-mediated DNA damage sensed by RecA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Evelio Ángel

    2014-04-01

    Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

  20. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    Energy Technology Data Exchange (ETDEWEB)

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  1. Comparison of DNA quantification methodology used in the DNA extraction protocol for the UK Biobank cohort.

    Science.gov (United States)

    Welsh, Samantha; Peakman, Tim; Sheard, Simon; Almond, Rachael

    2017-01-05

    UK Biobank is a large prospective cohort study in the UK established by the Medical Research Council (MRC) and the Wellcome Trust to enable approved researchers to investigate the role of genetic factors, environmental exposures and lifestyle in the causes of major diseases of late and middle age. A wide range of phenotypic data has been collected at recruitment and has recently been enhanced by the UK Biobank Genotyping Project. All UK Biobank participants (500,000) have been genotyped on either the UK Biobank Axiom® Array or the Affymetrix UK BiLEVE Axiom® Array and the workflow for preparing samples for genotyping is described. The genetic data is hoped to provide further insight into the genetics of disease. All data, including the genetic data, is available for access to approved researchers. Data for two methods of DNA quantification (ultraviolet-visible spectroscopy [UV/Vis]) measured on the Trinean DropSense™ 96 and PicoGreen®) were compared by two laboratories (UK Biobank and Affymetrix). The sample processing workflow established at UK Biobank, for genotyping on the custom Affymetrix Axiom® array, resulted in high quality DNA (average DNA concentration 38.13 ng/μL, average 260/280 absorbance 1.91). The DNA generated high quality genotype data (average call rate 99.48% and pass rate 99.45%). The DNA concentration measured on the Trinean DropSense™ 96 at UK Biobank correlated well with DNA concentration measured by PicoGreen® at Affymetrix (r = 0.85). The UK Biobank Genotyping Project demonstrated that the high throughput DNA extraction protocol described generates high quality DNA suitable for genotyping on the Affymetrix Axiom array. The correlation between DNA concentration derived from UV/Vis and PicoGreen® quantification methods suggests, in large-scale genetic studies involving two laboratories, it may be possible to remove the DNA quantification step in one laboratory without affecting downstream analyses. This would result in

  2. Extraction of extracellular lipids from chemoautotrophic bacteria Serratia sp. ISTD04 for production of biodiesel.

    Science.gov (United States)

    Bharti, Randhir K; Srivastava, Shaili; Thakur, Indu Shekhar

    2014-08-01

    A CO2 sequestering bacterial strain, Serratia sp. ISTD04, that produces a significant amount of extracellular lipids was isolated from marble mine rocks. (14)C labeling analysis revealed that the rate of assimilation of CO2 by the strain is 0.756×10(-9)μmolCO2fixedcell(-1)h(-1). It was found to produce 466mg/l of extracellular lipid which was characterized using (1)H NMR. After transesterification of lipids, the total saturated and unsaturated FAME was found to be 51% and 49% respectively. The major FAME contained in the biodiesel were palmitic acid methyl ester (C16:0), oleic acid methyl ester (C18:1) and 10-nonadecenoic acid methyl ester (C19:1). Biodiesel produced by Serratia sp. ISTD04 is balanced in terms of FAME composition of good quality. It also contained higher proportion of oleic acid (35%) which makes it suitable for utilization in existing engines. Thus, the strain can be harnessed commercially to sequester CO2 into biodiesel. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  4. Comparative analysis of environmental DNA extraction and purification methods from different humic acid rich soils

    CSIR Research Space (South Africa)

    Lakay, FM

    2007-01-01

    Full Text Available Three different soil DNA isolation and four purification strategies were compared on different soil samples with variable rates of success. Bead beating extraction gave significantly higher DNA yields than microwave-based and liquid nitrogen...

  5. Properties of internalization factors contributing to the uptake of extracellular DNA into tumor-initiating stem cells of mouse Krebs-2 cell line.

    Science.gov (United States)

    Dolgova, Evgeniya V; Potter, Ekaterina A; Proskurina, Anastasiya S; Minkevich, Alexandra M; Chernych, Elena R; Ostanin, Alexandr A; Efremov, Yaroslav R; Bayborodin, Sergey I; Nikolin, Valeriy P; Popova, Nelly A; Kolchanov, Nikolay A; Bogachev, Sergey S

    2016-05-25

    Previously, we demonstrated that poorly differentiated cells of various origins, including tumor-initiating stem cells present in the ascites form of mouse cancer cell line Krebs-2, are capable of naturally internalizing both linear double-stranded DNA and circular plasmid DNA. The method of co-incubating Krebs-2 cells with extracellular plasmid DNA (pUC19) or TAMRA-5'-dUTP-labeled polymerase chain reaction (PCR) product was used. It was found that internalized plasmid DNA isolated from Krebs-2 can be transformed into competent Escherichia coli cells. Thus, the internalization processes taking place in the Krebs-2 cell subpopulation have been analyzed and compared, as assayed by E. coli colony formation assay (plasmid DNA) and cytofluorescence (TAMRA-DNA). We showed that extracellular DNA both in the form of plasmid DNA and a PCR product is internalized by the same subpopulation of Krebs-2 cells. We found that the saturation threshold for Krebs-2 ascites cells is 0.5 μg DNA/10(6) cells. Supercoiled plasmid DNA, human high-molecular weight DNA, and 500 bp PCR fragments are internalized into the Krebs-2 tumor-initiating stem cells via distinct, non-competing internalization pathways. Under our experimental conditions, each cell may harbor 340-2600 copies of intact plasmid material, or up to 3.097 ± 0.044×10(6) plasmid copies (intact or not), as detected by quantitative PCR. The internalization dynamics of extracellular DNA, copy number of the plasmids taken up by the cells, and competition between different types of double-stranded DNA upon internalization into tumor-initiating stem cells of mouse ascites Krebs-2 have been comprehensively analyzed. Investigation of the extracellular DNA internalization into tumor-initiating stem cells is an important part of understanding their properties and possible destruction mechanisms. For example, a TAMRA-labeled DNA probe may serve as an instrument to develop a target for the therapy of cancer, aiming at elimination of

  6. Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

    OpenAIRE

    Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

    1997-01-01

    For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

  7. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    OpenAIRE

    Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

    2016-01-01

    ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

  8. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  9. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  10. Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Andersen, Sandra Christine; Christensen, Julia

    2015-01-01

    ) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold...... of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA....

  11. [Study on a collagenase protocol to extract DNA from remnant feathers in edible bird's nest].

    Science.gov (United States)

    Wang, Ling-Li; Chen, Nian; Zhang, Wei-Wei; Wu, Guo-Hong; Lai, Xiao-Ping

    2013-08-01

    To establish a method for extracting genomic DNA from rudimental bird feather from the precious edible bird's nest (EBN) harvested from the swiftlet cave. Observed the EBN using endoscopic and studied the influence of adding collagenase on the extracting yield of DNA. PCR amplification and sequencing for the extraction was also conducted. Collagenase was used in addition to protease K which could substantively increase the DNA yield. The DNA extracted by this method could be used for PCR and other molecular biology analyses. This method can be applied to identify the species types in biological products, especially for animal tissue materials that rich in collagen.

  12. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  13. IFN-γ Induces Mimic Extracellular Trap Cell Death in Lung Epithelial Cells Through Autophagy-Regulated DNA Damage.

    Science.gov (United States)

    Lin, Chiou-Feng; Chien, Shun-Yi; Chen, Chia-Ling; Hsieh, Chia-Yuan; Tseng, Po-Chun; Wang, Yu-Chih

    2016-02-01

    Treatment of interferon-γ (IFN-γ) causes cell growth inhibition and cytotoxicity in lung epithelial malignancies. Regarding the induction of autophagy related to IFN-γ signaling, this study investigated the link between autophagy and IFN-γ cytotoxicity. In A549 human lung cancer cells, IFN-γ treatment induced concurrent apoptotic and nonapoptotic events. Unexpectedly, the nonapoptotic cells present mimic extracellular trap cell death (ETosis), which was regulated by caspase-3 and by autophagy induction through immunity-related GTPase family M protein 1 and activating transcription factor 6. Furthermore, IFN-γ signaling controlled mimic ETosis through a mechanism involving an autophagy- and Fas-associated protein with death domain-controlled caspase-8/-3 activation. Following caspase-mediated lamin degradation, IFN-γ caused DNA damage-associated ataxia telangiectasia and Rad3-related protein (ATR)/ataxia telangiectasia mutated (ATM)-regulated mimic ETosis. Upon ATR/ATM signaling, peptidyl arginine deiminase 4 (PAD4)-mediated histone 3 citrullination promoted mimic ETosis. Such IFN-γ-induced effects were defective in PC14PE6/AS2 human lung cancer cells, which were unsusceptible to IFN-γ-induced autophagy. Due to autophagy-based caspase cascade activation, IFN-γ triggers unconventional caspase-mediated DNA damage, followed by ATR/ATM-regulated PAD4-mediated histone citrullination during mimic ETosis in lung epithelial malignancy.

  14. Expression profiling of colorectal cancer cells reveals inhibition of DNA replication licensing by extracellular calcium.

    Science.gov (United States)

    Aggarwal, Abhishek; Schulz, Herbert; Manhardt, Teresa; Bilban, Martin; Thakker, Rajesh V; Kallay, Enikö

    2017-06-01

    Colorectal cancer is one of the most common cancers in industrialised societies. Epidemiological studies, animal experiments, and randomized clinical trials have shown that dietary factors can influence all stages of colorectal carcinogenesis, from initiation through promotion to progression. Calcium is one of the factors with a chemoprophylactic effect in colorectal cancer. The aim of this study was to understand the molecular mechanisms of the anti-tumorigenic effects of extracellular calcium ([Ca 2+ ] o ) in colon cancer cells. Gene expression microarray analysis of colon cancer cells treated for 1, 4, and 24h with 2mM [Ca 2+ ] o identified significant changes in expression of 1571 probe sets (ANOVA, pcalcium-sensing receptor (CaSR), a G protein-coupled receptor is a mediator involved in this process. To test whether these results were physiologically relevant, we fed mice with a standard diet containing low (0.04%), intermediate (0.1%), or high (0.9%) levels of dietary calcium. The main molecules regulating replication licensing were inhibited also in vivo, in the colon of mice fed high calcium diet. We show that among the mechanisms behind the chemopreventive effect of [Ca 2+ ] o is inhibition of replication licensing, a process often deregulated in neoplastic transformation. Our data suggest that dietary calcium is effective in preventing replicative stress, one of the main drivers of cancer and this process is mediated by the calcium-sensing receptor. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava (Psidium guajava) leaf extract

    Energy Technology Data Exchange (ETDEWEB)

    Raghunandan, Deshpande [H.K.E.S' s College of Pharmacy (India); Mahesh, Bedre D. [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India); Basavaraja, S. [Jawaharlal Nehru Centre for Advanced Scientific Research, Veeco-India Nanotechnology Laboratory (India); Balaji, S. D. [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India); Manjunath, S. Y. [Sri Krupa, Institute of Pharmaceutical Science (India); Venkataraman, A., E-mail: raman_chem@rediffmail.com [Gulbarga University, Materials Chemistry Laboratory, Department of Material Science (India)

    2011-05-15

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 {+-} 5 nm from guava (Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV-vis (UV-vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  16. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava (Psidium guajava) leaf extract

    International Nuclear Information System (INIS)

    Raghunandan, Deshpande; Mahesh, Bedre D.; Basavaraja, S.; Balaji, S. D.; Manjunath, S. Y.; Venkataraman, A.

    2011-01-01

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 ± 5 nm from guava (Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV–vis (UV–vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  17. Size exclusion chromatography for the removal of pigments from extracellular ligninolytic enzyme extracts from decayed wheat straw.

    Science.gov (United States)

    Shukla, Dharmendra; Patel, Bhavesh; Modi, Hasmukh; Vyas, Bharat Rajiv Manuel

    2011-11-01

    Solid-state fermentation of wheat straw was carried out by a native white rot basidiomycete Daedaleopsis flavida strain 5A. Extract prepared from the 12-day decayed wheat straw contained extracellular ligninolytic enzymes like manganese peroxidase (MnP), manganese-independent peroxidase (MIP), lignin peroxidase (LiP) and laccase along with straw-degraded products and pigments. Sephacryl S-200 size exclusion chromatography in 16/100 column was used for the separation of these ligninolytic enzymes and straw-degraded products and pigments. Recovery of pigment-free ligninolytic enzyme activities as protein was 40% of the total proteins loaded and specific LiP activity increased 34 fold after size exclusion chromatography. Thus accurate estimation of LiP by veratryl alcohol oxidation assay was possible only after the removal of interfering pigments. The reproducibility of size exclusion chromatography is adjudged satisfactory from the consistent results obtained after seven repetitive uses of matrices.

  18. Microwave-assisted rapid extracellular synthesis of stable bio-functionalized silver nanoparticles from guava ( Psidium guajava) leaf extract

    Science.gov (United States)

    Raghunandan, Deshpande; Mahesh, Bedre D.; Basavaraja, S.; Balaji, S. D.; Manjunath, S. Y.; Venkataraman, A.

    2011-05-01

    Our research interest centers on microwave-assisted rapid extracellular synthesis of bio-functionalized silver nanoparticles of 26 ± 5 nm from guava ( Psidium guajava) leaf extract with control over dimension and composition. The reaction occurs very rapidly as the formation of spherical nanoparticles almost completed within 90 s. The probable pathway of the biosynthesis is suggested. Appearance, crystalline nature, size and shape of nanoparticles are understood by UV-vis (UV-vis spectroscopy), FTIR (fourier transform infrared spectroscopy), XRD (X-ray diffraction), FESEM (field emission scanning electron microscopy) and TEM (transmission electron microscopy) techniques. Microwave-assisted route is selected for the synthesis of silver nanoparticles to carry out the reaction fast, suppress the enzymatic action and to keep the process environmentally clean and green.

  19. TOL Plasmid Carriage Enhances Biofilm Formation and Increases Extracellular DNA Content in Pseudomonas Putida KT2440

    DEFF Research Database (Denmark)

    Smets, Barth F.; D'Alvise, Paul; Yankelovich, T.

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid- specific stains (cytox orange, propidium iodide) revealed differences in production...... combined with specific cytostains; release of cytoplasmic material was assayed by a β-glucosidase assay. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to increased biofilm formation...

  20. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Directory of Open Access Journals (Sweden)

    D.C.A. Leite

    2014-01-01

    Full Text Available Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit, the PowerSoil® DNA Isolation Kit (PS kit and the ZR Soil Microbe DNA Kit MiniprepTM (ZR kit, for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

  1. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Science.gov (United States)

    Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

    2014-01-01

    Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

  2. Extracellular synthesis of silver nanoparticles using the leaf extract of Coleus amboinicus Lour

    Energy Technology Data Exchange (ETDEWEB)

    Narayanan, Kannan Badri [Department of Biotechnology, School of Life Sciences, Pondicherry University, Kalapet, Puducherry 605014 (India); Sakthivel, Natarajan, E-mail: puns2005@gmail.com [Department of Biotechnology, School of Life Sciences, Pondicherry University, Kalapet, Puducherry 605014 (India)

    2011-10-15

    Highlights: {yields} Synthesis of AgNPs using the leaf extract of Coleus amboinicus L. was described. {yields} UV-vis absorption spectra showed the formation of isotrophic AgNPs at 437 nm in 6 h. {yields} XRD analysis showed intense peaks corresponding to fcc structure of AgNPs. {yields} HR-TEM analysis revealed the formation of stable anisotrophic and isotrophic AgNPs. -- Abstract: In the present investigation, Coleus amboinicus Lour. leaf extract-mediated green chemistry approach for the synthesis of silver nanoparticles was described. The nanoparticles were characterized by ultraviolet-visible (UV-Vis) spectroscopy, X-ray diffraction (XRD), energy dispersive X-ray analysis (EDAX), Fourier transform infrared spectroscopy (FTIR) and transmission electron microscopy (TEM). The influence of leaf extract on the control of size and shape of silver nanoparticles is reported. Upon an increase in the concentration of leaf extract, there was a shift in the shape of nanoparticles from anisotrophic nanostructures like triangle, decahedral and hexagonal to isotrophic spherical nanoparticles. Crystalline nature of fcc structured nanoparticles was confirmed by XRD spectrum with peaks corresponding to (1 1 1), (2 0 0), (2 2 0) and (3 1 1) planes and bright circular spots in the selected-area electron diffraction (SAED). Such environment friendly and sustainable methods are non-toxic, cheap and alternative to hazardous chemical procedures.

  3. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    International Nuclear Information System (INIS)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D.

    1991-01-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

  4. COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

    Directory of Open Access Journals (Sweden)

    Ivona Djurkin Kušec

    2015-09-01

    Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

  5. Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

    Directory of Open Access Journals (Sweden)

    Hong Chen

    Full Text Available BACKGROUND: DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. METHODOLOGY/PRINCIPAL FINDINGS: From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. CONCLUSION/SIGNIFICANCE: These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

  6. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  7. Two mini-preparation protocols to DNA extraction from plants with ...

    African Journals Online (AJOL)

    Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...

  8. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  9. Effect of Cassia hirsuta (L) extract on DNA profile of some ...

    African Journals Online (AJOL)

    The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

  10. Modifying and adapting a plant-based DNA extraction protocol for ...

    African Journals Online (AJOL)

    ... a 100 apparently healthy individuals residing in Calabar. The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell.

  11. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  12. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  13. An effective and low-cost method for DNA extraction from herbal ...

    African Journals Online (AJOL)

    Rhubarb is an important traditional Chinese herbal drug with high secondary metabolites that interfere with DNA extraction procedures and downstream applications, such as DNA restriction and amplification. An effective and low-cost protocol for isolating genomic DNA from root of Rheum tanguticum is described in this ...

  14. Extracellular dextran and DNA affect the formation of Enterococcus faecalis biofilms and their susceptibility to 2% chlorhexidine.

    Science.gov (United States)

    Li, Weilan; Liu, Hongyan; Xu, Qiong

    2012-07-01

    Enterococcus faecalis is frequently recovered from root-filled teeth with refractory apical periodontitis. The ability of E. faecalis to form a matrix-encased biofilm contributes to its pathogenicity; however, the role of extracellular dextran and DNA in biofilm formation and its effect on the susceptibility of the biofilm to chlorhexidine remains poorly understood. E. faecalis biofilms were incubated on dentin blocks. The effect of a dextran-degrading enzyme (dextranase) and DNase I on the adhesion of E. faecalis to dentin was measured using the colony-forming unit (CFU) counting method. CFU assays and confocal laser scanning microscopy were used to investigate the influence of dextranase and DNase I on the antimicrobial activity of 2% chlorhexidine. The CFU count assays indicated that the formation of biofilms by E. faecalis was reduced in cells treated with dextranase or DNase I compared with that in untreated cells (P biofilms with dextranase or DNase I effectively sensitized the biofilms to 2% chlorhexidine (P biofilms to 2% chlorhexidine. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  15. Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.

    Science.gov (United States)

    Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y

    2015-12-28

    Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.

  16. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  17. Evaluation of DNA extraction methods for the detection of Cytomegalovirus in dried blood spots

    Science.gov (United States)

    Koontz, D.; Baecher, K.; Amin, M.; Nikolova, S.; Gallagher, M.; Dollard, S.

    2015-01-01

    Background Dried blood spots (DBS) are collected universally from newborns and may be valuable for the diagnosis of congenital Cytomegalovirus (CMV) infection. The reported analytical sensitivity for DBS testing compared to urine or saliva varies greatly across CMV studies. The purpose of this study was to directly compare the performance of various DNA extraction methods for identification of CMV in DBS including those used most often in CMV studies. Study design Whatman® Grade 903 filter paper cards were spotted with blood samples from 25 organ transplant recipients who had confirmed CMV viremia. Six DNA extraction methods were compared for relative yield of viral and cellular DNA: 2 manual solution-based methods (Gentra Puregene, thermal shock), 2 manual silica column-based methods (QIAamp DNA Mini, QIAamp DNA Investigator), and 2 automated methods (M48 MagAttract Mini, QIAcube Investigator). DBS extractions were performed in triplicate followed by real-time quantitative PCR (qPCR). Results For extraction of both viral and cellular DNA, two methods (QIAamp DNA Investigator and thermal shock) consistently gave the highest yields, and two methods (M48 MagAttract Mini and QIAamp DNA Mini) consistently gave the lowest yields. There was an average 3-fold difference in DNA yield between the highest and lowest yield methods. Conclusion The choice of DNA extraction method is a major factor in the ability to detect low levels of CMV in DBS and can largely account for the wide range of DBS sensitivities reported in studies to date. PMID:25866346

  18. DNA in ancient bone - where is it located and how should we extract it?

    DEFF Research Database (Denmark)

    Campos, Paula; Craig, Oliver E.; Turner-Walker, Gordon

    2012-01-01

    Despite the widespread use of bones in ancient DNA (aDNA) studies, relatively little concrete information exists in regard to how the DNA in mineralised collagen degrades, or where it survives in the material's architecture. While, at the macrostructural level, physical exclusion of microbes...... and other external contaminants may be an important feature, and, at the ultrastructural level, the adsorption of DNA to hydroxyapatite and/or binding of DNA to Type I collagen may stabilise the DNA, the relative contribution of each, and what other factors may be relevant, are unclear....... The question arises as to whether this may be due to post-collection preservation or just an artefact of the extraction methods used in these different studies? In an attempt to resolve these questions, we examine the efficacy of DNA extraction methods, and the quality and quantity of DNA recovered from both...

  19. Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

    Science.gov (United States)

    Kar, Indrani; Chattopadhyaya, Rajagopal

    2017-11-01

    The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

  20. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

    Science.gov (United States)

    Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

    2018-01-01

    DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

  2. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  3. How Severely Is DNA Quantification Hampered by RNA Co-extraction?

    Science.gov (United States)

    Sanchez, Ignacio; Remm, Matthieu; Frasquilho, Sonia; Betsou, Fay; Mathieson, William

    2015-10-01

    The optional RNase digest that is part of many DNA extraction protocols is often omitted, either because RNase is not provided in the kit or because users do not want to risk contaminating their laboratory. Consequently, co-eluting RNA can become a "contaminant" of unknown magnitude in a DNA extraction. We extracted DNA from liver, lung, kidney, and heart tissues and established that 28-52% of the "DNA" as assessed by spectrophotometry is actually RNA (depending on tissue type). Including an RNase digest in the extraction protocol reduced 260:280 purity ratios. Co-eluting RNA drives an overestimation of DNA yield when quantification is carried out using OD 260 nm spectrophotometry, or becomes an unquantified contaminant when spectrofluorometry is used for DNA quantification. This situation is potentially incompatible with the best practice guidelines for biobanks issued by organizations such as the International Society for Biological and Environmental Repositories, which state that biospecimens should be accurately characterized in terms of their identity, purity, concentration, and integrity. Consequently, we conclude that an RNase digest must be included in DNA extractions if pure DNA is required. We also discuss the implications of unquantified RNA contamination in DNA samples in the context of laboratory accreditation schemes.

  4. Effect of Allium flavum L. and Allium melanantherum Panč. Extracts on Oxidative DNA Damage and Antioxidative Enzymes Superoxide Dismutase and Catalase.

    Science.gov (United States)

    Mitić-Ćulafić, Dragana; Nikolić, Biljana; Simin, Nataša; Jasnić, Nebojša; Četojević-Simin, Dragana; Krstić, Maja; Knežević-Vukčević, Jelena

    2016-03-01

    Allium flavum L. and Allium melanantherum Panč. are wild growing plants used in traditional diet in Balkan region. While chemical composition and some biological activities of A. flavum have been reported, A. melanantherum, as an endemic in the Balkan Peninsula, has never been comprehensively examined. After chemical characterization of A. melanantherum, we examined the protective effect of methanol extracts of both species against t-butyl hydro-peroxide (t-BOOH)-induced DNA damage and mutagenesis. The bacterial reverse mutation assay was performed on Escherichia coli WP2 oxyR strain. DNA damage was monitored in human fetal lung fibroblasts (MRC-5) with alkaline comet assay. Obtained results indicated that extracts reduced t-BOOH-induced DNA damage up to 70 and 72% for A. flavum and A. melanantherum extract, respectively, and showed no effect on t-BOOH-induced mutagenesis. Since the results indicated modulatory effect on cell-mediated antioxidative defense, the effect of extracts on total protein content, and superoxide dismutase (SOD) and catalase (CAT) amounts and activities were monitored. Both extracts increased total protein content, while the increase of enzyme amount and activity was obtained only with A. melanantherum extract and restricted to CAT. The activity of CuZnSOD family was not affected, while SOD1 and SOD2 amounts were significantly decreased, indicating potential involvement of extracellular CuZnSOD. Obtained results strongly support the traditional use of A. flavum and A. melanantherum in nutrition and recommend them for further study.

  5. Simple practical approach for sample loading prior to DNA extraction using a silica monolith in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-12-07

    A novel DNA loading methodology is presented for performing DNA extraction on a microfluidic system. DNA in a chaotropic salt solution was manually loaded onto a silica monolith orthogonal to the subsequent flow of wash and elution solutions. DNA was successfully extracted from buccal swabs using electro-osmotic pumping (EOP) coupled with in situ reagents contained within a 1.5% agarose gel matrix. The extracted DNA was of sufficient quantity and purity for polymerase chain reaction (PCR) amplification.

  6. Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

    Science.gov (United States)

    Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

    2014-11-01

    The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

  7. Noninvasive genetic sampling of endangered muriqui (Primates, Atelidae: efficiency of fecal DNA extraction

    Directory of Open Access Journals (Sweden)

    Paulo B. Chaves

    2006-01-01

    Full Text Available The muriqui (Brachyteles is one of the most endangered primates in the world, however little is known about the viability of the remaining populations. We evaluated the technique of extracting DNA from wild muriqui feces for PCR applications. In order to determine the effect of the DNA in subsequent amplifications, we analyzed five different extracts. The importance of the recommended BSA and the HotStarTaq DNA polymerase was tested. The minimal conditions to successfully amplify highly degraded fecal DNA were determined, showing that the recommended reagents are not required. We envision that this method may be useful in further conservation management studies.

  8. In situ analysis of Bacillus licheniformis biofilms: amyloid-like polymers and eDNA are involved in the adherence and aggregation of the extracellular matrix.

    Science.gov (United States)

    Randrianjatovo-Gbalou, I; Rouquette, P; Lefebvre, D; Girbal-Neuhauser, E; Marcato-Romain, C-E

    2017-05-01

    This study attempts to determine which of the exopolymeric substances are involved in the adherence and aggregation of a Bacillus licheniformis biofilm. The involvement of extracellular proteins and eDNA were particularly investigated using DNase and proteinase K treatment. The permeability of the biofilms increased fivefold after DNase I treatment. The quantification of the matrix components showed that, irrespective to the enzyme tested, eDNA and amyloid-like polymers were removed simultaneously. Size-exclusion chromatography analyses supported these observations and revealed the presence of associated nucleic acid and protein complexes in the biofilm lysates. These data suggest that some extracellular DNA and amyloid-like proteins were closely interlaced within the matrix. Finally, confocal laser scanning microscopy imaging gave supplementary clues about the 3D organization of the biofilms, confirming that eDNA and exoproteins were essentially layered under and around the bacterial cells, whereas the amyloid-like fractions were homogeneously distributed within the matrix. These results confirm that some DNA-amyloid complexes play a key role in the modulation of the mechanical resistance of B. licheniformis biofilms. The study highlights the need to consider the whole structure of biofilms and to target the interactions between matrix components. A better understanding of B. licheniformis biofilm physiology and the structural organization of the matrix will strengthen strategies of biofilm control. © 2017 The Society for Applied Microbiology.

  9. Comparison of DNA extraction methods for human gut microbial community profiling.

    Science.gov (United States)

    Lim, Mi Young; Song, Eun-Ji; Kim, Sang Ho; Lee, Jangwon; Nam, Young-Do

    2018-03-01

    The human gut harbors a vast range of microbes that have significant impact on health and disease. Therefore, gut microbiome profiling holds promise for use in early diagnosis and precision medicine development. Accurate profiling of the highly complex gut microbiome requires DNA extraction methods that provide sufficient coverage of the original community as well as adequate quality and quantity. We tested nine different DNA extraction methods using three commercial kits (TianLong Stool DNA/RNA Extraction Kit (TS), QIAamp DNA Stool Mini Kit (QS), and QIAamp PowerFecal DNA Kit (QP)) with or without additional bead-beating step using manual or automated methods and compared them in terms of DNA extraction ability from human fecal sample. All methods produced DNA in sufficient concentration and quality for use in sequencing, and the samples were clustered according to the DNA extraction method. Inclusion of bead-beating step especially resulted in higher degrees of microbial diversity and had the greatest effect on gut microbiome composition. Among the samples subjected to bead-beating method, TS kit samples were more similar to QP kit samples than QS kit samples. Our results emphasize the importance of mechanical disruption step for a more comprehensive profiling of the human gut microbiome. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  10. DNA extraction methods for detecting genetically modified foods: A comparative study.

    Science.gov (United States)

    Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter

    2011-06-15

    The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples.

    Science.gov (United States)

    Miller, D N; Bryant, J E; Madsen, E L; Ghiorse, W C

    1999-11-01

    We compared and statistically evaluated the effectiveness of nine DNA extraction procedures by using frozen and dried samples of two silt loam soils and a silt loam wetland sediment with different organic matter contents. The effects of different chemical extractants (sodium dodecyl sulfate [SDS], chloroform, phenol, Chelex 100, and guanadinium isothiocyanate), different physical disruption methods (bead mill homogenization and freeze-thaw lysis), and lysozyme digestion were evaluated based on the yield and molecular size of the recovered DNA. Pairwise comparisons of the nine extraction procedures revealed that bead mill homogenization with SDS combined with either chloroform or phenol optimized both the amount of DNA extracted and the molecular size of the DNA (maximum size, 16 to 20 kb). Neither lysozyme digestion before SDS treatment nor guanidine isothiocyanate treatment nor addition of Chelex 100 resin improved the DNA yields. Bead mill homogenization in a lysis mixture containing chloroform, SDS, NaCl, and phosphate-Tris buffer (pH 8) was found to be the best physical lysis technique when DNA yield and cell lysis efficiency were used as criteria. The bead mill homogenization conditions were also optimized for speed and duration with two different homogenizers. Recovery of high-molecular-weight DNA was greatest when we used lower speeds and shorter times (30 to 120 s). We evaluated four different DNA purification methods (silica-based DNA binding, agarose gel electrophoresis, ammonium acetate precipitation, and Sephadex G-200 gel filtration) for DNA recovery and removal of PCR inhibitors from crude extracts. Sephadex G-200 spin column purification was found to be the best method for removing PCR-inhibiting substances while minimizing DNA loss during purification. Our results indicate that for these types of samples, optimum DNA recovery requires brief, low-speed bead mill homogenization in the presence of a phosphate-buffered SDS-chloroform mixture, followed

  12. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

    Science.gov (United States)

    Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

    2017-02-01

    An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

  13. Identifikasi bite marks dengan ekstraksi DNA metode Chelex (Bite marks identification with Chelex methods in DNA extraction

    Directory of Open Access Journals (Sweden)

    Imelda Kristina Sutrisno

    2013-06-01

    Full Text Available Background: In the case of crime often encountered evidence in bite marks form that was found on the victim’s body. Generally, bitemarks identification use standard techniques that compare the interpretation picture with the tooth model of suspected person. However, sometimes the techniques do not obtain accurate results. Therefore another technique is needed to support the identification process,such as DNA analysis that use the remaining epithelium attached in saliva to identify the DNA of the suspected person. In this processes a limited DNA material could be met, not only less in quantity but also less in quality. Chelex known as one of an effective DNA extraction method in DNA forensic case is needed to overcome this problem. Purpose: The study was aimed to examine the use of Chelex as DNA extraction method on a bitemarks sample models. Methods: The blood and bitemarks of 5 persons with were taken. The DNA of each subject was exctracted with Chelex and quantified the quantity with UV Spechtrophotometer. The DNA results was amplified by PCR at locus vWA and TH01 then vizualised by electrophoresis. Results: The electrophoresis’s results showed band at locus vWA and TH01 for blood sample and bite marks with no significant differences. Conclusion: The study showed that Chelex method could be use to extract DNA from bitemarks.Latar belakang: Dalam kasus kejahatan sering dijumpai bukti dalam bentuk bekas gigitan (bitemarks yang ditemukan pada tubuh korban. Umumnya, untuk mengidentifikasi bite marks menggunakan teknik standar yaitu membandingkan foto interpretasi dengan model gigi dari orang yang dicurigai. Namun demikian teknik ini terkadang tidak mendapatkan hasil yang akurat, sehingga diperlukan teknik lain untuk menunjang keberhasilan proses identifikasi pelaku, yakni melalui analisis DNA bitemarks, yang diperoleh dari saliva yang mengandung sisa epitel tersangka pelaku. Sampel DNA yang berasal dari bitemarks umumnya terbatas, tidak hanya

  14. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  15. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  16. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  17. [DNA Extraction from Old Bones by AutoMate Express™ System].

    Science.gov (United States)

    Li, B; Lü, Z

    2017-08-01

    To establish a method for extracting DNA from old bones by AutoMate Express™ system. Bones were grinded into powder by freeze-mill. After extraction by AutoMate Express™, DNA were amplified and genotyped by Identifiler®Plus and MinFiler™ kits. DNA were extracted from 10 old bone samples, which kept in different environments with the postmortem interval from 10 to 20 years, in 3 hours by AutoMate Express™ system. Complete STR typing results were obtained from 8 samples. AutoMate Express™ system can quickly and efficiently extract DNA from old bones, which can be applied in forensic practice. Copyright© by the Editorial Department of Journal of Forensic Medicine

  18. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    Directory of Open Access Journals (Sweden)

    André Moura

    2016-07-01

    Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

  19. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  20. Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

    Science.gov (United States)

    Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

    2011-11-01

    An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  1. Effect of DNA extraction in the Rosa canina L. identification under different processing temperature

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2017-01-01

    Full Text Available Rosa canina, L. is widely used for medicinal purposes as well as in food industry where it is a valuable source, bioactive compounds and natural colorants. Actually, no specific method is recommended as suitable one for DNA extraction from rose hips. The aim of the study was to compare three commercial and three non-commercial methods to extract total genomic DNA from rose hips hyphanthium. Four methods are based on the precipitation in principle and two methods are based on resin-binding. Extracted DNA was proved for the effectivity in following PCR. In total, six different DNA isolations was performed for differently heat processes rose hips - fresh hyphanthium, 2-weeks frozen hyphanthium, dried hyphanthium (50 °C and boiled hyphanthium (100 °C. The amplification parameters of 500 bp chloroplast gene amplicon were evaluated. Obtained amounts of extracted DNA was very variable not only for every individual method used but for individual treatment of samples, too. In general, non-commercial method provided higher amount of extracted DNA, but the A260/280 ratio was lower. When regarding the processing treatment of the samples, high differences were found among the samples untreated by heat and those that were dried or boiled for three of the used extraction methods. All the samples were positive for amplification, but different amounts of amplified product were obtained. The comparison of data for concentrations of extracted DNA and concentrations of amplified product showed large differences when regarding the achieved purity of DNA in extraction.

  2. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  3. Comparison of seven DNA extraction and ampliffication protocols in historical herbarium specimens of Juncaceae

    Czech Academy of Sciences Publication Activity Database

    Drábková, Lenka; Kirschner, Jan; Vlček, Čestmír

    2002-01-01

    Roč. 20, - (2002), s. 161-175 ISSN 0735-9640 R&D Projects: GA MŠk LN00A079; GA ČR GA206/02/0355 Institutional research plan: CEZ:AV0Z6005908 Keywords : cpDNA * DNA extraction * herbarium specimens Subject RIV: EF - Botanics Impact factor: 0.803, year: 2002

  4. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  5. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    Science.gov (United States)

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    Science.gov (United States)

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

    2012-01-01

    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  7. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  8. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  9. Optimization of DNA extraction for RAPD and ISSR analysis of Arbutus unedo L. Leaves.

    Science.gov (United States)

    Sá, Olga; Pereira, José Alberto; Baptista, Paula

    2011-01-01

    Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds-namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A(260)/A(280), was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  10. Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

    Directory of Open Access Journals (Sweden)

    Paula Baptista

    2011-06-01

    Full Text Available Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP, 1,4-dithiothreitol (DTT and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v and sodium chloride (2M concentration; and an extraction with organic solvents (phenol and chloroform with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 µg/µL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  11. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  12. The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

    Science.gov (United States)

    Kasu, Mohaimin; Shires, Karen

    2015-07-01

    The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Comparison of Three Different DNA Extraction Methods for Linguatula serrata as a Food Born Pathogen

    Directory of Open Access Journals (Sweden)

    Gilda ESLAMI

    2017-06-01

    Full Text Available Background: One of the most important items in molecular characterization of food-borne pathogens is high quality genomic DNA. In this study, we investigated three protocols and compared their simplicity, duration and costs for extracting genomic DNA from Linguatula serrata.Methods: The larvae were collected from the sheep’s visceral organs from the Yazd Slaughterhouse during May 2013. DNA extraction was done in three different methods, including commercial DNA extraction kit, Phenol Chloroform Isoamylalcohol (PCI, and salting out. Extracted DNA in each method was assessed for quantity and quality using spectrophotometery and agarose gel electrophoresis, respectively.Results: The less duration was regarding to commercial DNA extraction kit and then salting out protocol. The cost benefit one was salting out and then PCI method. The best quantity was regarding to PCI with 72.20±29.20 ng/μl, and purity of OD260/OD280 in 1.76±0.947. Agarose gel electrophoresis for assessing the quality found all the same.Conclusion: Salting out is introduced as the best method for DNA extraction from L. seratta as a food-borne pathogen with the least costand appropriate purity. Although, the best purity was regarding to PCI but PCI is not safe as salting out. In addition, the duration of salting out was less than PCI. The least duration was seen in commercial DNA extraction kit, but it is expensive and therefore is not recommended for developing countries where consumption of offal is common.

  14. A Suitable Method for DNA Extraction from Bones for Forensic Applications: A Case Study

    Directory of Open Access Journals (Sweden)

    Aqeela S. Abuidrees

    2016-06-01

    Full Text Available Human identification techniques are constantly developing. Before the discovery of DNA, anthropology accompanied with odontology was the most applicable technique for human identification. With the new era of molecular biology and the revolution of DNA and PCR techniques, DNA profiling has become the core of the human forensic identification process. Different types of samples can be exploited in forensic DNA analysis. In some extreme cases, bone samples are the only accessible samples of DNA due to the bad conditions of putrefaction or degradation of other biological materials and tissues. Therefore, an appropriate method should be determined to yield a full and clean profile. A case study is presented here in order to identify human remains and conclude the most appropriate method of DNA extraction from human remains. In addition, this study looks at the best part of the skeletal remains to be considered in the extraction of DNA for the purposes of identification. A suspect admitted that he buried his aborted son six months ago. The remains were recovered and DNA analysis was performed in order to determine any genetic link of the remains to the suspect and the female who delivered the baby. Two extraction methods were compared, the standard organic (phenol:chloroform:isoamyl alcohol and automated extraction using magnetic beads coated with silica (Qiagen EZ1 Advanced XL. Two bone parts, femur and clavicle, were also compared in terms of DNA yield. The efficiency of the two methods of DNA extraction from bones is illustrated quantitatively and qualitatively. Paternity testing was performed and the suspect was excluded from being the alleged father.

  15. DNA extraction from wings as a suitable approach for queen bees genotyping

    Directory of Open Access Journals (Sweden)

    Elena Facchini

    2018-06-01

    Full Text Available In livestock, genomics has been used since a decade in combination with phenotypic information for the estimation of breeding values. In honey bees (Apis mellifera, the advantage for including genomics in selective breeding programmes is represented by the possibility to reduce the generation interval and increase the accuracies of estimated breeding values resulting in higher genetic gain (Brascamp et al., 2018. The limit for this application is DNA extraction. Extraction methods for small animals such as insects often rely upon destructive approaches. The challenge is to develop tissue sampling methods that permit the survival of the animal while providing adequate quality DNA for genotyping. Along with previous reports of DNA extraction from several matrices, this study aims to contribute in developing suitable methodologies for genotyping honey bees queens using DNA extracted from wing cuttings (Chaline et al., 2004; Gregory and Rinderer, 2004; Gould et al., 2011. The clipping of the queen wings in beekeeping is a common practice and it ensures the survival and normal activities of the animal (Forster, 1971. A total of 57 queens with known pedigree were enrolled for this study. Wings from each queen were cut and stored at -20°C until processed (Fig. 1. Extractions were carried out using a modified protocol provided by Qiagen (DNeasy® Blood & Tissue. The modification consists in an initial incubation of the samples with proteinase K for 20 minutes, further steps are carried out following the manufacturer’s instructions. To test the suitability of the extracted DNA for genotyping, PCR was performed on Esterase FE4 like gene. Although quantification with NanoDrop™ resulted in <20 ng/μL of DNA in solution, the extracted material was sufficient for PCR amplification of candidate genes for sequencing and genotyping. Our results show that it is possible to extract DNA from wings’ cuttings permitting to implement genomic approaches in honey

  16. Permanganate-assisted removal of PCR inhibitors during the DNA Chelex extraction from stained denim samples.

    Science.gov (United States)

    Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru

    2017-03-01

    In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.

  17. Efficient method for extracting DNA of parasites causing bovine babesiosis from tick vectors

    Science.gov (United States)

    The southern cattle tick, Rhipicephalus (Boophilus) microplus, is an economically important pest costing animal agriculture billions of dollars worldwide. This research focuses on a comparison of three different tick DNA extraction methods: phenol-chloroform extraction (method 1), a modified version...

  18. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa 1

    OpenAIRE

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)?based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer?s protocol. In parallel, CTAB-based extractions were done using the a...

  19. Evaluation of methods for the extraction and purification of DNA from the human microbiome.

    Directory of Open Access Journals (Sweden)

    Sanqing Yuan

    Full Text Available DNA extraction is an essential step in all cultivation-independent approaches to characterize microbial diversity, including that associated with the human body. A fundamental challenge in using these approaches has been to isolate DNA that is representative of the microbial community sampled.In this study, we statistically evaluated six commonly used DNA extraction procedures using eleven human-associated bacterial species and a mock community that contained equal numbers of those eleven species. These methods were compared on the basis of DNA yield, DNA shearing, reproducibility, and most importantly representation of microbial diversity. The analysis of 16S rRNA gene sequences from a mock community showed that the observed species abundances were significantly different from the expected species abundances for all six DNA extraction methods used.Protocols that included bead beating and/or mutanolysin produced significantly better bacterial community structure representation than methods without both of them. The reproducibility of all six methods was similar, and results from different experimenters and different times were in good agreement. Based on the evaluations done it appears that DNA extraction procedures for bacterial community analysis of human associated samples should include bead beating and/or mutanolysin to effectively lyse cells.

  20. Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

    Energy Technology Data Exchange (ETDEWEB)

    Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

    2012-11-15

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

  1. Microbes on building materials — Evaluation of DNA extraction protocols as common basis for molecular analysis

    International Nuclear Information System (INIS)

    Ettenauer, Jörg D.; Piñar, Guadalupe; Lopandic, Ksenija; Spangl, Bernhard; Ellersdorfer, Günther; Voitl, Christian; Sterflinger, Katja

    2012-01-01

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials — common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: ► Up to thirteen extraction methods were evaluated with three building materials.

  2. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  3. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  4. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  5. Comparison of two silica-based extraction methods for DNA isolation from bones.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2016-09-01

    One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. Dichlorvos exposure impedes extraction and amplification of DNA from insects in museum collections

    Directory of Open Access Journals (Sweden)

    Åkerlund Monika

    2010-01-01

    Full Text Available Abstract Background The insecticides dichlorvos, paradichlorobenzene and naphthalene have been commonly used to eradicate pest insects from natural history collections. However, it is not known how these chemicals affect the DNA of the specimens in the collections. We thus tested the effect of dichlorvos, paradichlorobenzene and naphthalene on DNA of insects (Musca domestica by extracting and amplifying DNA from specimens exposed to insecticides in two different concentrations over increasing time intervals. Results The results clearly show that dichlorvos impedes both extraction and amplification of mitochondrial and nuclear DNA after relatively short time, whereas paradichlorobenzene and naphthalene do not. Conclusion Collections treated with paradichlorobenzene and naphthalene, are better preserved concerning DNA, than those treated with dichlorvos. Non toxic pest control methods should, however, be preferred due to physical damage of specimens and putative health risks by chemicals.

  7. Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

    Science.gov (United States)

    Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

    2006-09-18

    A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

  8. Comparison of two commercial DNA extraction kits for the analysis of nasopharyngeal bacterial communities

    Directory of Open Access Journals (Sweden)

    Keith A. Crandall

    2016-04-01

    Full Text Available Characterization of microbial communities via next-generation sequencing (NGS requires an extraction ofmicrobial DNA. Methodological differences in DNA extraction protocols may bias results and complicate inter-study comparisons. Here we compare the effect of two commonly used commercial kits (Norgen and Qiagenfor the extraction of total DNA on estimatingnasopharyngeal microbiome diversity. The nasopharynxis a reservoir for pathogens associated with respiratory illnesses and a key player in understandingairway microbial dynamics. Total DNA from nasal washes corresponding to 30 asthmatic children was extracted using theQiagenQIAamp DNA and NorgenRNA/DNA Purification kits and analyzed via IlluminaMiSeq16S rRNA V4 ampliconsequencing. The Norgen samples included more sequence reads and OTUs per sample than the Qiagen samples, but OTU counts per sample varied proportionallybetween groups (r = 0.732.Microbial profiles varied slightly between sample pairs, but alpha- and beta-diversity indices (PCoAand clustering showed highsimilarity between Norgen and Qiagenmicrobiomes. Moreover, no significant differences in community structure (PERMANOVA and adonis tests and taxa proportions (Kruskal-Wallis test were observed betweenkits. Finally, aProcrustes analysis also showed low dissimilarity (M2 = 0.173; P< 0.001 between the PCoAs of the two DNA extraction kits. Contrary to what has been observed in previous studies comparing DNA extraction methods, our 16S NGS analysis of nasopharyngeal washes did not reveal significant differences in community composition or structure between kits. Our findingssuggest congruence between column-based chromatography kits and supportthe comparison of microbiomeprofilesacross nasopharyngeal metataxonomic studies.

  9. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  10. Streptococcus mutans Extracellular DNA Is Upregulated during Growth in Biofilms, Actively Released via Membrane Vesicles, and Influenced by Components of the Protein Secretion Machinery

    Science.gov (United States)

    Liao, Sumei; Klein, Marlise I.; Heim, Kyle P.; Fan, Yuwei; Bitoun, Jacob P.; Ahn, San-Joon; Burne, Robert A.; Koo, Hyun; Brady, L. Jeannine

    2014-01-01

    Streptococcus mutans, a major etiological agent of human dental caries, lives primarily on the tooth surface in biofilms. Limited information is available concerning the extracellular DNA (eDNA) as a scaffolding matrix in S. mutans biofilms. This study demonstrates that S. mutans produces eDNA by multiple avenues, including lysis-independent membrane vesicles. Unlike eDNAs from cell lysis that were abundant and mainly concentrated around broken cells or cell debris with floating open ends, eDNAs produced via the lysis-independent pathway appeared scattered but in a structured network under scanning electron microscopy. Compared to eDNA production of planktonic cultures, eDNA production in 5- and 24-h biofilms was increased by >3- and >1.6-fold, respectively. The addition of DNase I to growth medium significantly reduced biofilm formation. In an in vitro adherence assay, added chromosomal DNA alone had a limited effect on S. mutans adherence to saliva-coated hydroxylapatite beads, but in conjunction with glucans synthesized using purified glucosyltransferase B, the adherence was significantly enhanced. Deletion of sortase A, the transpeptidase that covalently couples multiple surface-associated proteins to the cell wall peptidoglycan, significantly reduced eDNA in both planktonic and biofilm cultures. Sortase A deficiency did not have a significant effect on membrane vesicle production; however, the protein profile of the mutant membrane vesicles was significantly altered, including reduction of adhesin P1 and glucan-binding proteins B and C. Relative to the wild type, deficiency of protein secretion and membrane protein insertion machinery components, including Ffh, YidC1, and YidC2, also caused significant reductions in eDNA. PMID:24748612

  11. AtlA Mediates Extracellular DNA Release, Which Contributes to Streptococcus mutans Biofilm Formation in an Experimental Rat Model of Infective Endocarditis.

    Science.gov (United States)

    Jung, Chiau-Jing; Hsu, Ron-Bin; Shun, Chia-Tung; Hsu, Chih-Chieh; Chia, Jean-San

    2017-09-01

    Host factors, such as platelets, have been shown to enhance biofilm formation by oral commensal streptococci, inducing infective endocarditis (IE), but how bacterial components contribute to biofilm formation in vivo is still not clear. We demonstrated previously that an isogenic mutant strain of Streptococcus mutans deficient in autolysin AtlA (Δ atlA ) showed a reduced ability to cause vegetation in a rat model of bacterial endocarditis. However, the role of AtlA in bacterial biofilm formation is unclear. In this study, confocal laser scanning microscopy analysis showed that extracellular DNA (eDNA) was embedded in S. mutans GS5 floes during biofilm formation on damaged heart valves, but an Δ atlA strain could not form bacterial aggregates. Semiquantification of eDNA by PCR with bacterial 16S rRNA primers demonstrated that the Δ atlA mutant strain produced dramatically less eDNA than the wild type. Similar results were observed with in vitro biofilm models. The addition of polyanethol sulfonate, a chemical lysis inhibitor, revealed that eDNA release mediated by bacterial cell lysis is required for biofilm initiation and maturation in the wild-type strain. Supplementation of cultures with calcium ions reduced wild-type growth but increased eDNA release and biofilm mass. The effect of calcium ions on biofilm formation was abolished in Δ atlA cultures and by the addition of polyanethol sulfonate. The VicK sensor, but not CiaH, was found to be required for the induction of eDNA release or the stimulation of biofilm formation by calcium ions. These data suggest that calcium ion-regulated AtlA maturation mediates the release of eDNA by S. mutans , which contributes to biofilm formation in infective endocarditis. Copyright © 2017 American Society for Microbiology.

  12. A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

    Science.gov (United States)

    Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

    2010-07-01

    A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

  13. Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

    Directory of Open Access Journals (Sweden)

    Moulay Abdelaziz El Alaoui

    Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

  14. Separation/extraction, detection, and interpretation of DNA mixtures in forensic science (review).

    Science.gov (United States)

    Tao, Ruiyang; Wang, Shouyu; Zhang, Jiashuo; Zhang, Jingyi; Yang, Zihao; Sheng, Xiang; Hou, Yiping; Zhang, Suhua; Li, Chengtao

    2018-05-25

    Interpreting mixed DNA samples containing material from multiple contributors has long been considered a major challenge in forensic casework, especially when encountering low-template DNA (LT-DNA) or high-order mixtures that may involve missing alleles (dropout) and unrelated alleles (drop-in), among others. In the last decades, extraordinary progress has been made in the analysis of mixed DNA samples, which has led to increasing attention to this research field. The advent of new methods for the separation and extraction of DNA from mixtures, novel or jointly applied genetic markers for detection and reliable interpretation approaches for estimating the weight of evidence, as well as the powerful massively parallel sequencing (MPS) technology, has greatly extended the range of mixed samples that can be correctly analyzed. Here, we summarized the investigative approaches and progress in the field of forensic DNA mixture analysis, hoping to provide some assistance to forensic practitioners and to promote further development involving this issue.

  15. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  16. DNA extraction from hair shafts of wild Brazilian felids and canids.

    Science.gov (United States)

    Alberts, C C; Ribeiro-Paes, J T; Aranda-Selverio, G; Cursino-Santos, J R; Moreno-Cotulio, V R; Oliveira, A L D; Porchia, B F M M; Santos, W F; Souza, E B

    2010-12-21

    Wild felids and canids are usually the main predators in the food chains where they dwell and are almost invisible to behavior and ecology researchers. Due to their grooming behavior, they tend to swallow shed hair, which shows up in the feces. DNA found in hair shafts can be used in molecular studies that can unravel, for instance, genetic variability, reproductive mode and family structure, and in some species, it is even possible to estimate migration and dispersion rates in given populations. First, however, DNA must be extracted from hair. We extracted successfully and dependably hair shaft DNA from eight wild Brazilian felids, ocelot, margay, oncilla, Geoffroy's cat, pampas cat, jaguarundi, puma, and jaguar, as well as the domestic cat and from three wild Brazilian canids, maned wolf, crab-eating fox, and hoary fox, as well as the domestic dog. Hair samples came mostly from feces collected at the São Paulo Zoo and were also gathered from non-sedated pet or from recently dead wild animals and were also collected from museum specimens. Fractions of hair samples were stained before DNA extraction, while most samples were not. Our extraction protocol is based on a feather DNA extraction technique, based in the phenol:chloroform:isoamyl alcohol general method, with proteinase K as digestive enzyme.

  17. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  18. Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

    Science.gov (United States)

    Lech, T

    2016-05-06

    Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

  19. Enterococcus faecium biofilm formation: identification of major autolysin AtlAEfm, associated Acm surface localization, and AtlAEfm-independent extracellular DNA Release.

    Science.gov (United States)

    Paganelli, Fernanda L; Willems, Rob J L; Jansen, Pamela; Hendrickx, Antoni; Zhang, Xinglin; Bonten, Marc J M; Leavis, Helen L

    2013-04-16

    Enterococcus faecium is an important multidrug-resistant nosocomial pathogen causing biofilm-mediated infections in patients with medical devices. Insight into E. faecium biofilm pathogenesis is pivotal for the development of new strategies to prevent and treat these infections. In several bacteria, a major autolysin is essential for extracellular DNA (eDNA) release in the biofilm matrix, contributing to biofilm attachment and stability. In this study, we identified and functionally characterized the major autolysin of E. faecium E1162 by a bioinformatic genome screen followed by insertional gene disruption of six putative autolysin genes. Insertional inactivation of locus tag EfmE1162_2692 resulted in resistance to lysis, reduced eDNA release, deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and significant chaining compared to that of the wild type. Therefore, locus tag EfmE1162_2692 was considered the major autolysin in E. faecium and renamed atlAEfm. In addition, AtlAEfm was implicated in cell surface exposure of Acm, a virulence factor in E. faecium, and thereby facilitates binding to collagen types I and IV. This is a novel feature of enterococcal autolysins not described previously. Furthermore, we identified (and localized) autolysin-independent DNA release in E. faecium that contributes to cell-cell interactions in the atlAEfm mutant and is important for cell separation. In conclusion, AtlAEfm is the major autolysin in E. faecium and contributes to biofilm stability and Acm localization, making AtlAEfm a promising target for treatment of E. faecium biofilm-mediated infections. IMPORTANCE Nosocomial infections caused by Enterococcus faecium have rapidly increased, and treatment options have become more limited. This is due not only to increasing resistance to antibiotics but also to biofilm-associated infections. DNA is released in biofilm matrix via cell lysis, caused by autolysin, and acts as a matrix stabilizer. In this study

  20. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    Administrator

    2007-02-19

    Feb 19, 2007 ... RNA transcription, nucleic acid labeling (random primer labeling) etc. Hence ... form extraction are “tried and true” and nearly always work. Many modified versions of ... Effect (mean ± SE) of starting blood sample (µl) on variables studied. Blood sample ..... PhD Thesis submitted to University of. Agricultural ...

  1. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    Science.gov (United States)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (pextract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (pextract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  2. Impact of two different commercial DNA extraction methods on BK virus viral load

    Directory of Open Access Journals (Sweden)

    Massimiliano Bergallo

    2016-03-01

    Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.

  3. Comparative analysis of different DNA extraction protocols in fresh and herbarium specimens of the genus Dalbergia.

    Science.gov (United States)

    Ribeiro, R A; Lovato, M B

    2007-03-29

    Five published DNA extraction protocols were compared for their ability to produce good quality DNA from fresh and herbarium leaves of several species of the genus Dalbergia. The leaves of these species contain high amounts of secondary metabolites, which make it difficult to perform a clean DNA extraction and thereby interfering with subsequent PCR amplification. The protocol that produced the best DNA quality in most of the Dalbergia species analyzed, utilizes polyvinylpyrrolidone to bind the phenolic compounds, a high molar concentration of NaCl to inhibit co-precipitation of polysaccharides and DNA, and LiCl for removing RNA by selective precipitation. The DNA quality of herbarium specimens was worse than that for fresh leaves, due to collecting conditions and preservation of samples. We analyzed 54 herbarium specimens, but the recovered DNA allowed successful PCR amplification in only eight. For the genus Dalbergia, the herbarium is an important source of material for phylogenetic and evolutionary studies; due to the occurrence of the different species in various geographical regions in Brazil, it is difficult to obtain fresh material in nature. Our results demonstrated that for Dalbergia species the methods used for the collection and preservation of herbarium specimens have a mayor influence on DNA quality and in the success of phylogenetic studies of the species.

  4. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  5. A high throughput DNA extraction method with high yield and quality

    Directory of Open Access Journals (Sweden)

    Xin Zhanguo

    2012-07-01

    Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  6. Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

    DEFF Research Database (Denmark)

    Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

    2010-01-01

    Archived otoliths constitute an important source of historical DNA for use in temporal genetic studies, but such otoliths are also valuable for other research applications, e.g. growth or microchemistry studies, where information about the past is of relevance. Consequently, there are potentially...... conflicting interests regarding how the limited and irreplaceable otolith collections should be used. To resolve this, it is important to find out whether DNA extraction damages otoliths such that they can no longer be used for other research purposes or whether individual otoliths can be used in multiple...... applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...

  7. Application of FTA technology to extraction of sperm DNA from mixed body fluids containing semen.

    Science.gov (United States)

    Fujita, Yoshihiko; Kubo, Shin-ichi

    2006-01-01

    FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. In this study, we report a rapid and simple method of extracting DNA from sperm when body fluids mixed with semen were collected using FTA cards. After proteinase K digestion of the sperm and body fluid mixture, the washed pellet suspension as the sperm fraction and the concentrated supernatant as the epithelial cell fraction were respectively applied to FTA cards containing DTT. The FTA cards were dried, then directly added to a polymerase chain reaction (PCR) mix and processed by PCR. The time required from separation of the mixed fluid into sperm and epithelial origin DNA extractions was only about 2.5-3h. Furthermore, the procedure was extremely simple. It is considered that our designed DNA extraction procedure using an FTA card is available for application to routine work.

  8. Automated extraction of DNA and PCR setup using a Tecan Freedom EVO® liquid handler

    DEFF Research Database (Denmark)

    Frøslev, Tobias Guldberg; Hansen, Anders Johannes; Stangegaard, Michael

    2009-01-01

    We have implemented and validated automated protocols for DNA extraction and PCR setup using a Tecan Freedom EVO® liquid handler mounted with the TeMagS magnetic separation device. The methods were validated for accredited, forensic genetic work according to ISO 17025 using the Qiagen Mag...... genetic DNA typing can be implemented on a simple robot leading to the reduction of manual work as well as increased quality and throughput....

  9. DNA Damage Protecting Activity and Antioxidant Potential of Launaea taraxacifolia Leaves Extract.

    Science.gov (United States)

    Adinortey, Michael Buenor; Ansah, Charles; Weremfo, Alexander; Adinortey, Cynthia Ayefoumi; Adukpo, Genevieve Etornam; Ameyaw, Elvis Ofori; Nyarko, Alexander Kwadwo

    2018-01-01

    The leaf extract of Launaea taraxacifolia commonly known as African Lettuce is used locally to treat dyslipidemia and liver diseases, which are associated with oxidative stress. Methanol extract from L. taraxacifolia leaves was tested for its antioxidant activity and its ability to protect DNA from oxidative damage. In vitro antioxidant potential of the leaf extract was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH), nitric oxide (NO), and hydroxyl (OH) radical scavenging assays. Ferric reducing power, total antioxidant capacity (TAC), metal chelating, and anti-lipid peroxidation ability of the extract were also examined using gallic acid, ascorbic acid, citric acid, and ethylenediaminetetraacetic acid as standards. L. taraxacifolia leaves extract showed antioxidant activity with IC 50 values of 16.18 μg/ml (DPPH), 123.3 μg/ml (NO), 128.2 μg/ml (OH radical), 97.94 μg/ml (metal chelating), 80.28 μg/ml (TAC), and 23 μg/ml (anti-lipid peroxidation activity). L. taraxacifolia leaves extract exhibited a strong capability for DNA damage protection at 20 mg/ml concentration. These findings suggest that the methanolic leaf extract of L. taraxacifolia could be used as a natural antioxidant and also as a preventive therapy against diseases such as arteriosclerosis associated with DNA damage.

  10. INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

    Directory of Open Access Journals (Sweden)

    L. S. Dyshlyuk

    2014-01-01

    Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

  11. Study of microtip-based extraction and purification of DNA from human samples for portable devices

    Science.gov (United States)

    Fotouhi, Gareth

    DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

  12. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  14. Minimally destructive DNA extraction from archaeological artefacts made from whale baleen

    DEFF Research Database (Denmark)

    Sinding, Mikkel Holger Strander; Gilbert, Tom; Grønnow, Bjarne

    2012-01-01

    Here we demonstrate the successful extraction and amplification of target species DNA from artefacts made of whale baleen collected from excavations of past palaeo-Eskimo and Inuit cultures in Greenland. DNA was successfully extracted and amplified from a single baleen bristle of 1.5 cm length...... genetic studies. We conclude that genetic investigation of historical baleen collections can contribute to our knowledge of the prehistoric population genetics of baleen whales, for example by quantifying the impact of modern whaling on the genetic diversity of bowhead whales....

  15. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  16. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  17. Two simple techniques for the safe Sarcoptes collection and individual mite DNA extraction.

    Science.gov (United States)

    Soglia, Dominga; Rambozzi, Luisa; Maione, Sandra; Spalenza, Veronica; Sartore, Stefano; Alasaad, Samer; Sacchi, Paola; Rossi, Luca

    2009-10-01

    Availability of mites is a recognized limiting factor of biological and genetic investigations of the genus Sarcoptes. Current methods of deoxyribonucleic acid (DNA) extraction from individual mites also need substantial improvement in efficiency and operator friendliness. We have first developed a technique for efficient and safe extraction of living mites from scabietic skin samples (crusts or deep skin scrapings). Its core device is a large plastic syringe connected with a 1.5-ml Eppendorf tube. The source material is introduced in the syringe and the device in a shoe box with the tip half of the tube emerging. Mites migrate towards a heat source during a minimum of 36 h. Then, the tube is detached and the mites utilized without risks for the operators. A second technique allows operator-friendly manipulation of individual mites for DNA extraction. Fixed mites are isolated by adhesion to a small strip of polyvinyl chloride (PVC) adhesive tape operated with tweezers. Then, mite and strip are plunged in the lyses buffer and the sample twice submitted to thermal shock for disruption of the chitinous exoskeleton. Data show that the tape does not interfere with successive DNA extraction with a commercial kit. The corresponding protocol, that we briefly name "PVC adhesive tape + thermal shock + kit DNA extraction," compares favorably with the available ones.

  18. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  19. Ancient DNA extracted from Danish aurochs (Bos primigenius)

    DEFF Research Database (Denmark)

    Nielsen, Peter Gravlund; Aaris-Sørensen, Kim; Hofreiter, Michael

    2012-01-01

    study of genetic variation of Danish aurochs. In addition, for all specimens we address correlations between the ability to obtain DNA sequences and various parameters such as the age of the sample, the collagen content, the museum storage period, Danish geography and whether the specimens were found...... in an archeological or geological context. We find that aurochs from southern Scandinavia display a star-shaped population genetic structure, that is indicative of a local and relatively recent diversification from a few ancestral haplotypes that may have originated in the ancestral Western European population before...... migration northwards during the retreat of the glaciers. Scenarios suggesting several invasions of genetically distinct aurochs are not supported by these analyses. Rather, our results suggest that a single continuous migration northward occurred. Our findings also suggest, although with only limited...

  20. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  1. An Improved Method for High Quality Metagenomics DNA Extraction from Human and Environmental Samples

    DEFF Research Database (Denmark)

    Bag, Satyabrata; Saha, Bipasa; Mehta, Ojasvi

    2016-01-01

    and human origin samples. We introduced a combination of physical, chemical and mechanical lysis methods for proper lysis of microbial inhabitants. The community microbial DNA was precipitated by using salt and organic solvent. Both the quality and quantity of isolated DNA was compared with the existing...... methodologies and the supremacy of our method was confirmed. Maximum recovery of genomic DNA in the absence of substantial amount of impurities made the method convenient for nucleic acid extraction. The nucleic acids obtained using this method are suitable for different downstream applications. This improved...

  2. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-01-01

    Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

  3. Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-06-16

    As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  4. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Directory of Open Access Journals (Sweden)

    Schnabel Robert D

    2009-06-01

    Full Text Available Abstract Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb, and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72 in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  5. Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

    Directory of Open Access Journals (Sweden)

    Khandaker Shadia

    2012-01-01

    Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

  6. Improving Griffith's protocol for co-extraction of microbial DNA and RNA in adsorptive soils

    DEFF Research Database (Denmark)

    Paulin, Mélanie Marie; Nicolaisen, Mette Haubjerg; Jacobsen, Carsten Suhr

    2013-01-01

    Quantification of microbial gene expression is increasingly being used to study key functions in soil microbial communities, yet major limitations still exist for efficient extraction of nucleic acids, especially RNA for transcript analysis, from this complex matrix. We present an improved......-time PCR on both the RNA (after conversion to cDNA) and the DNA fraction of the extracts. Non-adsorptive soils were characterized by low clay content and/or high phosphate content, whereas adsorptive soils had clay contents above 20% and/or a strong presence of divalent Ca in combination with high p......H. Modifications to the co-extraction protocol improved nucleic acid extraction efficiency from all adsorptive soils and were successfully validated by DGGE analysis of the indigenous community based on 16S rRNA gene and transcripts in soils representing low biomass and/or high clay content. This new approach...

  7. DNA extraction in Echinococcus granulosus and Taenia spp. eggs in dogs stool samples applying thermal shock.

    Science.gov (United States)

    Hidalgo, Alejandro; Melo, Angélica; Romero, Fernando; Hidalgo, Víctor; Villanueva, José; Fonseca-Salamanca, Flery

    2018-03-01

    The extraction of DNA in taeniid eggs shows complications attached to the composition of stool samples and the high resistance of eggs to degradation. The objective of this study was to test a method of DNA extraction in taeniid eggs by applying a thermal shock to facilitate the chemical-enzymatic degradation of these elements. A group of six tubes containing 1 ml of dog stool sample was spiked with eggs of Echinococcus granulosus and another group of six with Taenia pisiformis. Samples were floated with supersaturated sugar solution and centrifuged. The upper portion of each tube (500 μl) was aspirated and deposited in 1.5 ml tubes. Three tubes from each group were incubated at -20 °C and then at 90 °C, the remaining three from each group, incubated at room temperature. Proteinase K and lysis buffer were added to each tube and incubated for 12 h at 58 °C. The lysis effect was evaluated by microscopy at 3, 6 and 12 h and integrity by electrophoresis in 1% agarose gels. With the same experimental scheme, the thermal shock effect was evaluated in extractions of 1, 2, 3 and 4 eggs of each species and the DNA was quantified. Additionally, the protocol was applied in samples of 4 dogs diagnosed with natural infection by Taeniidae worms. Finally, all the extractions were tested by PCR amplification. Both E. granulosus and T. pisiformis eggs showed a similar response in the tests. In samples without treatment, the lysis effect was poor and showed no differences over time, but in those subjected to thermal shock, eggs degradation increased with time. In both treatments, there was no DNA loss integrity. The protocol applied to limited amounts of eggs yielded PCR products in 100% of the samples exposed to thermal shock, allowing PCR amplifications up to 1 egg. In non-exposed samples, the results were not replicable. However, DNA quantification showed low values in both treatments. In turn, DNA extractions with thermal shock in infected dog samples

  8. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Science.gov (United States)

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

    2015-07-01

    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  9. Low cost extraction and isothermal amplification of DNA for infectious diarrhea diagnosis.

    Directory of Open Access Journals (Sweden)

    Shichu Huang

    Full Text Available In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10(-2 pg of C. difficile DNA while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health.

  10. Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

    Science.gov (United States)

    Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

    2013-01-01

    In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

  11. Simple DNA extraction of urine samples: Effects of storage temperature and storage time.

    Science.gov (United States)

    Ng, Huey Hian; Ang, Hwee Chen; Hoe, See Ying; Lim, Mae-Lynn; Tai, Hua Eng; Soh, Richard Choon Hock; Syn, Christopher Kiu-Choong

    2018-06-01

    Urine samples are commonly analysed in cases with suspected illicit drug consumption. In events of alleged sample mishandling, urine sample source identification may be necessary. A simple DNA extraction procedure suitable for STR typing of urine samples was established on the Promega Maxwell ® 16 paramagnetic silica bead platform. A small sample volume of 1.7mL was used. Samples were stored at room temperature, 4°C and -20°C for 100days to investigate the influence of storage temperature and time on extracted DNA quantity and success rate of STR typing. Samples stored at room temperature exhibited a faster decline in DNA yield with time and lower typing success rates as compared to those at 4°C and -20°C. This trend can likely be attributed to DNA degradation. In conclusion, this study presents a quick and effective DNA extraction protocol from a small urine volume stored for up to 100days at 4°C and -20°C. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  13. Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities.

    Science.gov (United States)

    Oldham, Athenia L; Drilling, Heather S; Stamps, Blake W; Stevenson, Bradley S; Duncan, Kathleen E

    2012-11-20

    The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources.

  14. A new method to extract dental pulp DNA: application to universal detection of bacteria.

    Directory of Open Access Journals (Sweden)

    Lam Tran-Hung

    Full Text Available BACKGROUND: Dental pulp is used for PCR-based detection of DNA derived from host and bacteremic microorganims. Current protocols require odontology expertise for proper recovery of the dental pulp. Dental pulp specimen exposed to laboratory environment yields contaminants detected using universal 16S rDNA-based detection of bacteria. METHODOLOGY/PRINCIPAL FINDINGS: We developed a new protocol by encasing decontaminated tooth into sterile resin, extracting DNA into the dental pulp chamber itself and decontaminating PCR reagents by filtration and double restriction enzyme digestion. Application to 16S rDNA-based detection of bacteria in 144 teeth collected in 86 healthy people yielded a unique sequence in only 14 teeth (9.7% from 12 individuals (14%. Each individual yielded a unique 16S rDNA sequence in 1-2 teeth per individual. Negative controls remained negative. Bacterial identifications were all confirmed by amplification and sequencing of specific rpoB sequence. CONCLUSIONS/SIGNIFICANCE: The new protocol prevented laboratory contamination of the dental pulp. It allowed the detection of bacteria responsible for dental pulp colonization from blood and periodontal tissue. Only 10% such samples contained 16S rDNA. It provides a new tool for the retrospective diagnostic of bacteremia by allowing the universal detection of bacterial DNA in animal and human, contemporary or ancient tooth. It could be further applied to identification of host DNA in forensic medicine and anthropology.

  15. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... The effects of three different grinding methods in DNA extraction of cowpea .... 100 mg of the leaf tissues were weighed in an electronic balance. CTAB method .... The primers were synthesized by Life Technologies (AB & Invitrogen). .... This work was supported by 'Shuang-Zhi Plan' of Sichuan. Agricultural ...

  16. Efficient recovery of environmental DNA for expression cloning by indirect extraction methods

    NARCIS (Netherlands)

    Gabor, Esther; de Vries, Erik; Janssen, DB

    2003-01-01

    Using direct and cell extraction-based (indirect) isolation methods, DNA was obtained from environmental samples with largely differing characteristics (loam soil, sand soil, sediment, activated sludge, and compost) and evaluated with respect to the comprised bacterial diversity and its suitability

  17. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... This makes coffee seed as one of the important material for molecular marker ... homogenised in 10 ml of freshly prepared extraction buffer (200. mM Tris-HCl pH 8.0, .... DNA material for particular molecular analysis. This method will be ... Pharmawati M, Yan G, Sedgley R, Finnegan PM (2004). Chloroplast.

  18. Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs

    Directory of Open Access Journals (Sweden)

    Ana Cristina dos Reis Ferreira

    2015-06-01

    Full Text Available ABSTRACT. Ferreira A.C.dosR. & dos Santos B.M. [Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs.] Avaliação de três métodos de extração de DNA de Salmonella sp. em ovos de galinhas contaminados artificialmente. Revista Brasileira de Medicina Veterinária, 37(2:115-119, 2015. Departamento de Veterinária, Universidade Federal de Viçosa, Campus Universitário, Av. Peter Henry Rolfs, s/n, Viçosa, MG 36571-000, Brasil. E-mail: bmsantos@ufv.br The present study evaluated the efficiency of different protocols for the genomic DNA extraction of Salmonella bacteria in chicken eggs free of specific pathogens – SPF. Seventy-five eggs were used and divided into five groups with fifteen eggs each. Three of the five groups of eggs were inoculated with enteric Salmonella cultures. One of the five groups was inoculated with Escherichia coli bacterium culture. And another group of eggs was the negative control that received saline solution 0.85% infertile. The eggs were incubated on a temperature that varied from 20 to 25°C during 24, 48 and 72 hours. Five yolks of each group were collected every 24 hours. These yolks were homogenized and centrifuged during 10 minutes. The supernatant was rejected. After the discard, PBS ph 7.2 was added and centrifuged again. The sediment obtained of each group was used for the extraction of bacterial genomic DNA. Silica particles and a commercial kit were utilized as the extraction methods. The extracted DNA was kept on a temperature of 20°C until the evaluation through PCR. The primers utilized were related with the invA gene and they were the following: 5’ GTA AAA TTA TCG CCA CGT TCG GGC AA 3’ and 5’ TCA TCG CAC CGT CAA AGG AAC C 3’. The amplification products were visualized in transilluminator with ultraviolet light. The obtained results through the bacterial DNA extractions demonstrated that the extraction method utilizing silica particles was

  19. An Improved DNA Extraction Method for Efficient and Quantitative Recovery of Phytoplankton Diversity in Natural Assemblages.

    Directory of Open Access Journals (Sweden)

    Jian Yuan

    Full Text Available Marine phytoplankton are highly diverse with different species possessing different cell coverings, posing challenges for thoroughly breaking the cells in DNA extraction yet preserving DNA integrity. While quantitative molecular techniques have been increasingly used in phytoplankton research, an effective and simple method broadly applicable to different lineages and natural assemblages is still lacking. In this study, we developed a bead-beating protocol based on our previous experience and tested it against 9 species of phytoplankton representing different lineages and different cell covering rigidities. We found the bead-beating method enhanced the final yield of DNA (highest as 2 folds in comparison with the non-bead-beating method, while also preserving the DNA integrity. When our method was applied to a field sample collected at a subtropical bay located in Xiamen, China, the resultant ITS clone library revealed a highly diverse assemblage of phytoplankton and other micro-eukaryotes, including Archaea, Amoebozoa, Chlorophyta, Ciliphora, Bacillariophyta, Dinophyta, Fungi, Metazoa, etc. The appearance of thecate dinoflagellates, thin-walled phytoplankton and "naked" unicellular organisms indicates that our method could obtain the intact DNA of organisms with different cell coverings. All the results demonstrate that our method is useful for DNA extraction of phytoplankton and environmental surveys of their diversity and abundance.

  20. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  1. Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Wang, Z.; Wu, X.; Friedberg, E.C.

    1993-01-01

    A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

  2. Grape (Vitis vinifera) extracts protect against radiation-induced oxidative stress and DNA damage

    International Nuclear Information System (INIS)

    Singha, Indrani; Das, Subir Kumar; Saxena, S.; Gautam, S.

    2016-01-01

    Ionizing radiation (IR) causes oxidative stress through the overwhelming generation of reactive oxygen species (ROS) in the living cells leading further to the oxidative damage to biomolecules. Grapes (Vitis vinifera) contain several bioactive phytochemicals and are the richest source of antioxidant. In this study, we investigated and compared in vitro antioxidant activity and DNA damage protective property of the grape extracts of four different cultivars, including the Thompson seedless, Flame seedless, Kishmish chorni and Red globe. The activities of ascorbic acid oxidase and catalase significantly (p<0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly among extracts of any cultivar. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay and ABTS. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. DNA damage was evaluated in acellular system using pBR322 plasmid relaxation. Grape extract was able to effectively scavenge free radicals in vitro. It could significantly prevent radiation-induced DNA damage. Furthermore, the protective action of grape depends on the source of extract and type of the cultivars. (author)

  3. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  4. Comparison of eight methods for the extraction of Bacillus atrophaeus spore DNA from eleven common interferents and a common swab.

    Directory of Open Access Journals (Sweden)

    Helen L Rose

    Full Text Available Eight DNA extraction products or methods (Applied Biosystems PrepFiler Forensic DNA Extraction Kit; Bio-Rad Instagene Only, Bio-Rad Instagene & Spin Column Purification; EpiCentre MasterPure DNA & RNA Kit; FujiFilm QuickGene Mini80; Idaho Technologies 1-2-3 Q-Flow Kit; MoBio UltraClean Microbial DNA Isolation Kit; Sigma Extract-N-Amp Plant and Seed Kit were adapted to facilitate extraction of DNA under BSL3 containment conditions. DNA was extracted from 12 common interferents or sample types, spiked with spores of Bacillus atropheaus. Resulting extracts were tested by real-time PCR. No one method was the best, in terms of DNA extraction, across all sample types. Statistical analysis indicated that the PrepFiler method was the best method from six dry powders (baking, biological washing, milk, plain flour, filler and talcum and one solid (Underarm deodorant, the UltraClean method was the best from four liquids (aftershave, cola, nutrient broth, vinegar, and the MasterPure method was the best from the swab sample type. The best overall method, in terms of DNA extraction, across all sample types evaluated was the UltraClean method.

  5. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    2012-01-01

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  6. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  7. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

    NARCIS (Netherlands)

    Schwartz, A.; Baidjoe, A.Y.; Rosenthal, P.J.; Dorsey, G.; Bousema, T.; Greenhouse, B.

    2015-01-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We

  8. Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Zallet, J; Lillebaek, T

    2015-01-01

    Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

  9. Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities.

    Directory of Open Access Journals (Sweden)

    Gemma Henderson

    Full Text Available Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However

  10. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Science.gov (United States)

    Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji

    2011-01-01

    Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  11. An improved protocol and a new grinding device for extraction of genomic DNA from microorganisms by a two-step extraction procedure.

    Science.gov (United States)

    Zhang, S S; Chen, D; Lu, Q

    2012-05-21

    Current protocols to extract genomic DNA from microorganisms are still laborious, tedious and costly, especially for the species with thick cell walls. In order to improve the effectiveness of extracting DNA from microbial samples, a novel protocol, defined as two-step extraction method, along with an improved tissue-grinding device, was developed. The protocol included two steps, disruption of microbial cells or spores by grinding the sample together with silica sand in a new device and extraction of DNA with an effective buffer containing cell lysis chemicals. The device was prepared by using a commercial electric mini-grinder, adapted with a grinding stone, and a sample cup processed by lathing from a polytetrafluoroethylene rod. We tested the method with vegetative cells of four microbial species and two microbial spores that have thick cell walls and are therefore hard to process; these included Escherichia coli JM109, Bacillus subtilis WB600, Sacchromyces cerevisiae INVSc1, Trichoderma viride AS3.3711, and the spores of S. cerevisiae and T. viride, respectively, representing Gram-positive bacteria, Gram-negative bacteria, yeast, filamentous fungi. We found that this new method and device extracted usable quantities of genomic DNA from the samples. The DNA fragments that were extracted exceeded 23 kb. The target sequences up to about 5 kb were successfully and exclusively amplified by PCR using extracted DNA as the template. In addition, the DNA extraction was finalized within 1.5 h. Thus, we conclude that this two-step extraction method is an effective and improved protocol for extraction of genomic DNA from microbial samples.

  12. Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

    Science.gov (United States)

    Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

    2012-05-01

    In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  14. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  15. Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

    Science.gov (United States)

    Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

    2012-09-01

    Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. Antioxidant Activity of Lawsonia inermis Extracts Inhibits Chromium(VI-Induced Cellular and DNA Toxicity

    Directory of Open Access Journals (Sweden)

    Gunjan Guha

    2011-01-01

    Full Text Available Hexavalent chromium Cr(VI is a very strong oxidant which consequently causes high cytotoxicity through oxidative stress. Prevention of Cr(VI-induced cellular damage has been sought in this study in aqueous and methanolic extracts of Lawsonia inermis Linn. (Lythraceae, commonly known as Henna. The extracts showed significant (P < .05 potential in scavenging free radicals (DPPH• and ABTS•+ and Fe3+, and in inhibiting lipid peroxidation. DNA damage caused by exposure of pBR322 to Cr(VI-UV is markedly inhibited by both extracts in varying degrees. A distinct decline in Cr(VI-induced cytotoxicity was noticed in MDA-MB-435S (human breast carcinoma cells with an increase in dosage of both extracts individually. Furthermore, both extracts proved to contain a high content of phenolic compounds which were found to have a strong and significant (P < .05 positive correlation to the radical scavenging potential, lipid peroxidation inhibition capacity and cyto-protective efficiency against Cr(VI-induced oxidative cellular damage. HPLC analysis identified some of the major phenolic compounds in both extracts, which might be responsible for the antioxidant potential and the properties of DNA and cyto-protection. This study contributes to the search for natural resources that might yield potent therapeutic drugs against Cr(VI-induced oxidative cell damage.

  17. High-capacity conductive nanocellulose paper sheets for electrochemically controlled extraction of DNA oligomers.

    Directory of Open Access Journals (Sweden)

    Aamir Razaq

    Full Text Available Highly porous polypyrrole (PPy-nanocellulose paper sheets have been evaluated as inexpensive and disposable electrochemically controlled three-dimensional solid phase extraction materials. The composites, which had a total anion exchange capacity of about 1.1 mol kg(-1, were used for extraction and subsequent release of negatively charged fluorophore tagged DNA oligomers via galvanostatic oxidation and reduction of a 30-50 nm conformal PPy layer on the cellulose substrate. The ion exchange capacity, which was, at least, two orders of magnitude higher than those previously reached in electrochemically controlled extraction, originated from the high surface area (i.e. 80 m(2 g(-1 of the porous composites and the thin PPy layer which ensured excellent access to the ion exchange material. This enabled the extractions to be carried out faster and with better control of the PPy charge than with previously employed approaches. Experiments in equimolar mixtures of (dT(6, (dT(20, and (dT(40 DNA oligomers showed that all oligomers could be extracted, and that the smallest oligomer was preferentially released with an efficiency of up to 40% during the reduction of the PPy layer. These results indicate that the present material is very promising for the development of inexpensive and efficient electrochemically controlled ion-exchange membranes for batch-wise extraction of biomolecules.

  18. To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis

    Directory of Open Access Journals (Sweden)

    Alyssa D. Ammazzalorso

    2015-08-01

    Full Text Available Background. Blacklegged ticks (Ixodes scapularis are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield.Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis—nymph and adult—that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material.Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females.Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

  19. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  20. UV light induced DNA damages and the radiation protection effects of Lingzi mushroom extract

    International Nuclear Information System (INIS)

    Vo Thi Thuong Lan; Dinh Ba Tuan; Ta Bich Thuan; Tran Bang Diep; Tran Minh Quynh

    2016-01-01

    UV light has strongly influenced on the growth of E. coli as well as caused DNA damages. Configurations of both genomic DNA and pUC 19 plasmids extracted from E. coli were significantly changed by the exposure to UV light of 254 nm and DLT, an extract of Ganoderma lucidum Lingzi mushroom. The results also revealed the radio-protective effects of DLT to UV radiation. By adding 2% DLT to its culturing suspension, the growth of E. coli was significantly decreased, whereas a low DLT amount of about 0.5% slightly improved its growth, indicated that the DLT extract can be used as a promising protective substance against UV radiation. At the molecular level, the radio-protective effects of DLT were observed for both UV treated DNA and protein. Thus, DLT can protect DNA in vivo, but not in vitro. This effect was also observed for Taq polymerase, suggested that the radioprotection effect of DLT may due to it accelerated the degradation of radicals or species that produced in the suspensions during UV exposure. (author)

  1. Inhibitory and toxic effects of extracellular self-DNA in litter : A mechanism for negative plant-soil feedbacks?

    NARCIS (Netherlands)

    Mazzoleni, Stefano; Bonanomi, Giuliano; Incerti, Guido; Chiusano, Maria Luisa; Termolino, Pasquale; Mingo, Antonio; Senatore, Mauro; Giannino, Francesco; Cartenì, Fabrizio; Rietkerk, Max; Lanzotti, Virginia

    2015-01-01

    Plant-soil negative feedback (NF) is recognized as an important factor affecting plant communities. The objectives of this work were to assess the effects of litter phytotoxicity and autotoxicity on root proliferation, and to test the hypothesis that DNA is a driver of litter autotoxicity and

  2. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  3. Pomegranate extract protects against cerebral ischemia/reperfusion injury and preserves brain DNA integrity in rats.

    Science.gov (United States)

    Ahmed, Maha A E; El Morsy, Engy M; Ahmed, Amany A E

    2014-08-21

    Interruption to blood flow causes ischemia and infarction of brain tissues with consequent neuronal damage and brain dysfunction. Pomegranate extract is well tolerated, and safely consumed all over the world. Interestingly, pomegranate extract has shown remarkable antioxidant and anti-inflammatory effects in experimental models. Many investigators consider natural extracts as novel therapies for neurodegenerative disorders. Therefore, this study was carried out to investigate the protective effects of standardized pomegranate extract against cerebral ischemia/reperfusion-induced brain injury in rats. Adult male albino rats were randomly divided into sham-operated control group, ischemia/reperfusion (I/R) group, and two other groups that received standardized pomegranate extract at two dose levels (250, 500 mg/kg) for 15 days prior to ischemia/reperfusion (PMG250+I/R, and PMG500+I/R groups). After I/R or sham operation, all rats were sacrificed and brains were harvested for subsequent biochemical analysis. Results showed reduction in brain contents of MDA (malondialdehyde), and NO (nitric oxide), in addition to enhancement of SOD (superoxide dismutase), GPX (glutathione peroxidase), and GRD (glutathione reductase) activities in rats treated with pomegranate extract prior to cerebral I/R. Moreover, pomegranate extract decreased brain levels of NF-κB p65 (nuclear factor kappa B p65), TNF-α (tumor necrosis factor-alpha), caspase-3 and increased brain levels of IL-10 (interleukin-10), and cerebral ATP (adenosine triphosphate) production. Comet assay showed less brain DNA (deoxyribonucleic acid) damage in rats protected with pomegranate extract. The present study showed, for the first time, that pre-administration of pomegranate extract to rats, can offer a significant dose-dependent neuroprotective activity against cerebral I/R brain injury and DNA damage via antioxidant, anti-inflammatory, anti-apoptotic and ATP-replenishing effects. Copyright © 2014 Elsevier Inc

  4. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  5. Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

    Science.gov (United States)

    Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

    2016-04-01

    Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. CGH and SNP array using DNA extracted from fixed cytogenetic preparations and long-term refrigerated bone marrow specimens

    Directory of Open Access Journals (Sweden)

    MacKinnon Ruth N

    2012-02-01

    Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.

  7. Usefulness of FTA® cards as a Pneumocystis-DNA extraction method in bronchoalveolar lavage samples.

    Science.gov (United States)

    Rodiño, Jenniffer M; Aguilar, Yudy A; Rueda, Zulma Vanessa; Vélez, Lázaro A

    2016-01-01

    FTA® cards (Fast Technology for Analysis of Nucleic Acids) are an alternative DNA extraction method in bronchoalveolar lavage (BAL) samples for Pneumocystis jirovecii molecular analyses. The goal was to evaluate the usefulness of FTA® cards to detect P. jirovecii-DNA by PCR in BAL samples compared to silica adsorption chromatography (SAC). This study used 134 BAL samples from immunocompromised patients previously studied to establish microbiological aetiology of pneumonia, among them 15 cases of Pneumocystis pneumonia (PCP) documented by staining and 119 with other alternative diagnoses. The FTA® system and SAC were used for DNA extraction and then amplified by nested PCR to detect P. jirovecii. Performance and concordance of the two DNA extraction methods compared to P. jirovecii microscopy were calculated. The influence of the macroscopic characteristics, transportation of samples and the duration of the FTA® card storage (1, 7, 10 or 12 months) were also evaluated. Among 134 BAL samples, 56% were positive for P. jirovecii-DNA by SAC and 27% by FTA®. All 15 diagnosed by microscopy were detected by FTA® and SAC. Specificity of the FTA® system and SAC were 82.4% and 49.6%, respectively. Compared to SAC, positivity by FTA® decreased with the presence of blood in BAL (62% vs 13.5%). The agreement between samples at 7, 10 and 12 months was 92.5% for FTA®. Positive cases by FTA® remained the same after shipment by mail. Results suggest that FTA® is a practical, safe and economical method to preserve P. jirovecii-DNA in BAL samples for molecular studies.

  8. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    OpenAIRE

    Sandoval-Arias, Shirleny Monserrat

    2014-01-01

    La identificación de sospechosos en casos criminales se ha facilitado desde la aplicación de pruebas de ADN a diferentes muestras. El uso de esta técnica para la tipificación forense a partir de muestras fecales humanas aún presenta complicaciones, por lo que en esta investigación se evaluaron dos protocolos de extracción de ADN con ciertas modificaciones para determinar el de mayor efectividad. Se realizaron extracciones orgánicas y mediante el kit comercial “DNA IQTM Casework Sample Kit par...

  9. The fruit extract of Berberis crataegina DC: exerts potent antioxidant activity and protects DNA integrity.

    Science.gov (United States)

    Charehsaz, Mohammad; Sipahi, Hande; Celep, Engin; Üstündağ, Aylin; Cemiloğlu Ülker, Özge; Duydu, Yalçın; Aydın, Ahmet; Yesilada, Erdem

    2015-04-17

    Dried fruits of Berberis crataegina (Berberidaceae) have been frequently consumed as food garniture in Turkish cuisine, while its fruit paste has been used to increase stamina and in particular to prevent from cardiovascular dysfunctions in Northeastern Black Sea region of Turkey. This study investigated this folkloric information in order to explain the claimed healing effects as well as to evaluate possible risks. Total phenolic, flavonoid and proanthocyanidin contents and antioxidant capacity of the methanolic fruit extract were evaluated through several in vitro assays. The cytotoxic and genotoxic effects of B. crataegina fruit extract were also assessed in both cervical cancer cell line (HeLa) and human peripheral blood lymphocytes. The extract showed protective effects against ferric-induced oxidative stress and had a relatively good antioxidant activity. It also ameliorated the H2O2 mediated DNA damage in lymphocytes, suggesting the protective effect against oxidative DNA damage. The methanolic extract of B. crataegina fruits may be a potential antioxidant nutrient and also may exert a protective role against lipid peroxidation as well as oxidative DNA damage.

  10. Use of real-time PCR to evaluate two DNA extraction methods from food

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

  11. Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

    Science.gov (United States)

    Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

    2010-01-01

    Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

  12. AFSC/RACE/SAP/Shavey: DNA extraction from archived Giemsa-stained blood smears using polymerase chain reaction to detect host and parasitic DNA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These are the data from a laboratory experiment in which DNA content was removed from blood smears and extracted. The blood smears were either stained with...

  13. DNA extraction from dry museum beetles without conferring external morphological damage

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Moore, Wendy; Melchior, Linea

    2007-01-01

    undesirable when dealing with rare species or otherwise important specimens, such as type specimens. METHODOLOGY: We describe a method for the extraction of PCR-amplifiable mitochondrial and nuclear DNA from dry insects without causing external morphological damage. Using PCR to amplify approximately 220 bp...... of the mitochondrial gene cytochrome c oxidase I, and 250-345 bp fragments of the multi-copy, nuclear 28s ribosomal DNA gene, we demonstrate the efficacy of this method on beetles collected up to 50 years ago. CONCLUSIONS: This method offers a means of obtaining useful genetic information from rare insects without...... conferring external morphological damage. Udgivelsesdato: 2007-null...

  14. An Improved Methodology to Overcome Key Issues in Human Fecal Metagenomic DNA Extraction

    Directory of Open Access Journals (Sweden)

    Jitendra Kumar

    2016-12-01

    Full Text Available Microbes are ubiquitously distributed in nature, and recent culture-independent studies have highlighted the significance of gut microbiota in human health and disease. Fecal DNA is the primary source for the majority of human gut microbiome studies. However, further improvement is needed to obtain fecal metagenomic DNA with sufficient amount and good quality but low host genomic DNA contamination. In the current study, we demonstrate a quick, robust, unbiased, and cost-effective method for the isolation of high molecular weight (>23 kb metagenomic DNA (260/280 ratio >1.8 with a good yield (55.8 ± 3.8 ng/mg of feces. We also confirm that there is very low human genomic DNA contamination (eubacterial: human genomic DNA marker genes = 227.9:1 in the human feces. The newly-developed method robustly performs for fresh as well as stored fecal samples as demonstrated by 16S rRNA gene sequencing using 454 FLX+. Moreover, 16S rRNA gene analysis indicated that compared to other DNA extraction methods tested, the fecal metagenomic DNA isolated with current methodology retains species richness and does not show microbial diversity biases, which is further confirmed by qPCR with a known quantity of spike-in genomes. Overall, our data highlight a protocol with a balance between quality, amount, user-friendliness, and cost effectiveness for its suitability toward usage for culture-independent analysis of the human gut microbiome, which provides a robust solution to overcome key issues associated with fecal metagenomic DNA isolation in human gut microbiome studies.

  15. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  16. DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

    Science.gov (United States)

    Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

    2015-01-01

    Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

  17. Extracting the basal extracellular dopamine concentrations from the evoked responses: re-analysis of the dopamine kinetics.

    Science.gov (United States)

    Chen, Kevin C; Budygin, Evgeny A

    2007-08-15

    Fast-scan cyclic voltammetry in conjunction with carbon fiber microelectrode has been used to study dopamine (DA) release and uptake mechanisms in rat brains because of the smaller size of the electrode and the subsecond resolution. Current voltammetry data were analyzed by a DA kinetic model assuming a zero baseline, which is in conflict with existing microdialysis findings and a recent claim of the striatal extracellular DA concentration at micromolar levels. This work applied a new analysis approach based on a modified DA kinetic model to analyze the kinetics of electrically evoked DA overflow in the caudate-putamen of anesthetized rats. The DA uptake parameters were fitted from the electrical stimulation phase, and subsequently used to calculate theoretical DA uptake rates. Comparison of the theoretical uptake rates with experimental clearance rates allows for the study of the tonic DA release process following electrical stimulations. Analyses of DA voltammetry data suggest that the locally averaged basal level of extracellular DA in the rat striatum might be confined between 95 and 220 nM. The disparate time scales in the clearance kinetics of endogenous and exogenous DA were investigated. Long-distance diffusion could only partially explain the slow clearance time course of exogenous DA. Model simulations and parameter analyses on evoked DA responses indicate that suppression of the nonevoked DA release process immediately following electrical stimulation cannot completely account for the rapid clearance of the electrically evoked DA. Inconsistency in the measured uptake strengths in the literature studying endogenous and exogenous DA remains to be investigated in the future.

  18. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    Science.gov (United States)

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  19. Effects of extracellular magnesium extract on the proliferation and differentiation of human osteoblasts and osteoclasts in coculture.

    Science.gov (United States)

    Wu, Lili; Feyerabend, Frank; Schilling, Arndt F; Willumeit-Römer, Regine; Luthringer, Bérengère J C

    2015-11-01

    Coculture of osteoblasts and osteoclasts is a subject of interest in the understanding of how magnesium (Mg)-based implants influence the bone metabolism and remodeling upon degradation. Human telomerase reverse transcriptase (hTERT) transduced mesenchymal stem cells (SCP-1) were first differentiated into osteoblasts with osteogenic supplements and then further cocultured with peripheral blood mononucleated cells (PBMC) without the addition of osteoclastogenesis promoting factors. Concomitantly, the cultures were exposed to variable Mg extract dilutions (0, 30×, 10×, 5×, 3×, 2× and 1×). Phenotype characterization documented that while 2× dilution of Mg extract was extremely toxic to osteoclast monoculture, monocytes in coculture with osteoblasts exhibited a greater tolerance to higher Mg extract concentration. The dense growth of osteoblasts in cultures with 1× dilution of Mg extract suggested that high concentration of Mg extract promoted osteoblast proliferation/differentiation behavior. The results of intracellular alkaline phosphatase (ALP) and tartrate-resistant acid phosphatase (TRAP) activities as well as protein and gene expressions of receptor activator of nuclear factor kappa-B ligand (RANKL), macrophage colony-stimulating factor (M-CSF), and osteoclast-associated receptor (OSCAR) revealed significantly enhanced formation of osteoblasts whereas decreased osteoclastogenesis in the cultures with high concentrations of Mg extract (2× and 1× dilutions). In conclusion, while an increased osteoinductivity has been demonstrated, the impact of potentially decreased osteoclastogenesis around the Mg-based implants should be also taken into account. Cocultures containing both bone-forming osteoblasts and bone-resorbing osteoclasts should be preferentially performed for in vitro cytocompatibility assessment of Mg-based implants as they more closely mimic the in vivo environment. An attractive human osteoblasts and osteoclasts cocultivation regime was

  20. A novel technique using potassium permanganate and reflectance confocal microscopy to image biofilm extracellular polymeric matrix reveals non-eDNA networks in Pseudomonas aeruginosa biofilms.

    Science.gov (United States)

    Swearingen, Matthew C; Mehta, Ajeet; Mehta, Amar; Nistico, Laura; Hill, Preston J; Falzarano, Anthony R; Wozniak, Daniel J; Hall-Stoodley, Luanne; Stoodley, Paul

    2016-02-01

    Biofilms are etiologically important in the development of chronic medical and dental infections. The biofilm extracellular polymeric substance (EPS) determines biofilm structure and allows bacteria in biofilms to adapt to changes in mechanical loads such as fluid shear. However, EPS components are difficult to visualize microscopically because of their low density and molecular complexity. Here, we tested potassium permanganate, KMnO4, for use as a non-specific EPS contrast-enhancing stain using confocal laser scanning microscopy in reflectance mode. We demonstrate that KMnO4 reacted with EPS components of various strains of Pseudomonas, Staphylococcus and Streptococcus, yielding brown MnO2 precipitate deposition on the EPS, which was quantifiable using data from the laser reflection detector. Furthermore, the MnO2 signal could be quantified in combination with fluorescent nucleic acid staining. COMSTAT image analysis indicated that KMnO4 staining increased the estimated biovolume over that determined by nucleic acid staining alone for all strains tested, and revealed non-eDNA EPS networks in Pseudomonas aeruginosa biofilm. In vitro and in vivo testing indicated that KMnO4 reacted with poly-N-acetylglucosamine and Pseudomonas Pel polysaccharide, but did not react strongly with DNA or alginate. KMnO4 staining may have application as a research tool and for diagnostic potential for biofilms in clinical samples. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. DNA purification using dynamic solid-phase extraction on a rotationally-driven polyethylene-terephthalate microdevice

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, K.R. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Borba, J.C. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Meija, M. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Mills, D.L. [TeGrex Technologies, Sperryville, VA 22740 (United States); Haverstick, D.M. [Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States); Olson, K.E.; Aranda, R. [Office of the Chief Scientist, Defense Forensic Science Center, N 31st Street, Atlanta, GA 30297 (United States); Garner, G.T. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Carrilho, E. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Landers, J.P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-09-21

    We report the development of a disposable polyester toner centrifugal device for semi-automated, dynamic solid phase DNA extraction (dSPE) from whole blood samples. The integration of a novel adhesive and hydrophobic valving with a simple and low cost microfabrication method allowed for sequential addition of reagents without the need for external equipment for fluid flow control. The spin-dSPE method yielded an average extraction efficiency of ∼45% from 0.6 μL of whole blood. The device performed single sample extractions or accommodate up to four samples for simultaneous DNA extraction, with PCR-readiness DNA confirmed by effective amplification of a β-globin gene. The purity of the DNA was challenged by a multiplex amplification with 16 targeted amplification sites. Successful multiplexed amplification could routinely be obtained using the purified DNA collected post an on-chip extraction, with the results comparable to those obtained with commercial DNA extraction methods. This proof-of-principle work represents a significant step towards a fully-automated low cost DNA extraction device. - Highlights: • dSPE design on centrifugal PeT device with a unique mixing strategy was proposed. • Increased fluidic control with novel adhesive tape valves on a PeT device. • Multiplexed spin-dSPE device to run up to 4 samples simultaneously. • Demonstrated strong singleplexed and multiplexed amplification following chip dSPE.

  2. Aqueous extract of Allium sativum L bulbs offer nephroprotection by attenuating vascular endothelial growth factor and extracellular signal-regulated kinase-1 expression in diabetic rats.

    Science.gov (United States)

    Shiju, T M; Rajkumar, R; Rajesh, N G; Viswanathan, Pragasam

    2013-02-01

    To investigate the nephroprotective effect of garlic and elucidate the mechanism by which it prevents the progression of diabetic nephropathy in diabetic rats, diabetes was induced by a single ip injection of streptozotocin (45 mg/kg body weight). Garlic extract (500 mg/kg body weight) and aminoguanidine (1 g/L) were supplemented in the treatment groups. Histopathological examination using H&E, PAS staining and the immunohistochemical analysis of vascular endothelial growth factor (VEGF) and extracellular signal-regulated kinase-1 (ERK-1) expression were performed on kidney sections at the end of 12 weeks. Significant change in both, the urine and serum biochemistry confirmed kidney damage in diabetic animals which was further confirmed by the histological changes such as mesangial expansion, glomerular basement membrane thickening, glycosuria and proteinuria. However, the diabetic animals treated with garlic extract showed a significant change in urine and serum biochemical parameters such as albumin, urea nitrogen and creatinine compared to that of diabetic rats. Further, the garlic supplemented diabetic rats showed a significant decrease in the expression of VEGF and ERK-1 compared to diabetic rats, attenuating mesangial expansion and glomerulosclerosis. Thus, garlic extract rendered nephroprotection in diabetic rats.

  3. A Simple Thermoplastic Substrate Containing Hierarchical Silica Lamellae for High-Molecular-Weight DNA Extraction.

    Science.gov (United States)

    Zhang, Ye; Zhang, Yi; Burke, Jeffrey M; Gleitsman, Kristin; Friedrich, Sarah M; Liu, Kelvin J; Wang, Tza-Huei

    2016-12-01

    An inexpensive, magnetic thermoplastic nanomaterial is developed utilizing a hierarchical layering of micro- and nanoscale silica lamellae to create a high-surface-area and low-shear substrate capable of capturing vast amounts of ultrahigh-molecular-weight DNA. Extraction is performed via a simple 45 min process and is capable of achieving binding capacities up to 1 000 000 times greater than silica microparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  5. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  6. Evaluation of simplified dna extraction methods for EMM typing of group a streptococci

    Directory of Open Access Journals (Sweden)

    Jose JJM

    2006-01-01

    Full Text Available Simplified methods of DNA extraction for amplification and sequencing for emm typing of group A streptococci (GAS can save valuable time and cost in resource crunch situations. To evaluate this, we compared two methods of DNA extraction directly from colonies with the standard CDC cell lysate method for emm typing of 50 GAS strains isolated from children with pharyngitis and impetigo. For this, GAS colonies were transferred into two sets of PCR tubes. One set was preheated at 94oC for two minutes in the thermal cycler and cooled while the other set was frozen overnight at -20oC and then thawed before adding the PCR mix. For the cell lysate method, cells were treated with mutanolysin and hyaluronidase before heating at 100oC for 10 minutes and cooling immediately as recommended in the CDC method. All 50 strains could be typed by sequencing the hyper variable region of the emm gene after amplification. The quality of sequences and the emm types identified were also identical. Our study shows that the two simplified DNA extraction methods directly from colonies can conveniently be used for typing a large number of GAS strains easily in relatively short time.

  7. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  8. PROTOCOL FOR EXTRACTION OF BACTERIAL METAGENOME DNA TO PRAWN Macrobrachium carcinus L

    Directory of Open Access Journals (Sweden)

    J U González de la Cruz

    2011-07-01

    Full Text Available In this work we adapted a protocol for the extraction of metagenomic DNA (ADNmg bacteria in the digestive system (intestines, stomach and hepatopancreas of Macrobrachium carcinus L., with reference to the method of extracting bacterial DNA from soils and sediments (Rojas-Herrera et al., 2008. This methodology consisted of enzymatic, physics, mechanics and chemistry after a series of tests was abolished enzymatic lysis. However, the success ADNmg extraction was influenced mainly by the preparation of the samples, in particular the hepatopancreas, where it was necessary to remove the fat by thermal shock temperature and phase separation by centrifugation with the sample frozen.The effectiveness of isolated DNA fragmentation was verified by gel electrophoresis in denaturing gradient (DGGE after amplification with universal primers. In general, it had a low diversity (19 phylotypes between the different organs analyzed of 13.5 ± 1 (intestines to 11.7 ± 0.96 (stomach. The Shannon-Weaver index (2.45, Simpsons (10.88 and equity (0972 obtained from the digitization of the image of the gel, suggested that the phylotypes that form the gut microflora M. carcinus, is distributed unevenly between the different organs analyzed.

  9. A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types

    DEFF Research Database (Denmark)

    Lever, Mark; Torti, Andrea; Eickenbusch, Philip

    2015-01-01

    tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world...... DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample...

  10. Analysis of intracellular and extracellular microcystin variants in sediments and pore waters by accelerated solvent extraction and high performance liquid chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Zastepa, Arthur; Pick, Frances R.; Blais, Jules M.; Saleem, Ammar

    2015-01-01

    Highlights: • First analytical method for intracellular microcystins (MCs) in sediment. • Includes a suite of variants (LR, 7dm LR, RR, YR, WR, LA, LF, LY, LW) and nodularin. • Reports the first measurements of MCs in sediment pore waters. • MCs detected in >100 year old lake sediments suggesting long-term preservation. • Sediment-pore water distribution (K d ) differed between variants suggesting differences in environmental fate. - Abstract: The fate and persistence of microcystin cyanotoxins in aquatic ecosystems remains poorly understood in part due to the lack of analytical methods for microcystins in sediments. Existing methods have been limited to the extraction of a few extracellular microcystins of similar chemistry. We developed a single analytical method, consisting of accelerated solvent extraction, hydrophilic–lipophilic balance solid phase extraction, and reversed phase high performance liquid chromatography-tandem mass spectrometry, suitable for the extraction and quantitation of both intracellular and extracellular cyanotoxins in sediments as well as pore waters. Recoveries of nine microcystins, representing the chemical diversity of microcystins, and nodularin (a marine analogue) ranged between 75 and 98% with one, microcystin-RR (MC-RR), at 50%. Chromatographic separation of these analytes was achieved within 7.5 min and the method detection limits were between 1.1 and 2.5 ng g −1 dry weight (dw). The robustness of the method was demonstrated on sediment cores collected from seven Canadian lakes of diverse geography and trophic states. Individual microcystin variants reached a maximum concentration of 829 ng g −1 dw on sediment particles and 132 ng mL −1 in pore waters and could be detected in sediments as deep as 41 cm (>100 years in age). MC-LR, -RR, and -LA were more often detected while MC-YR, -LY, -LF, and -LW were less common. The analytical method enabled us to estimate sediment-pore water distribution coefficients (K d

  11. Analysis of intracellular and extracellular microcystin variants in sediments and pore waters by accelerated solvent extraction and high performance liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zastepa, Arthur, E-mail: arthur.zastepa@gmail.com; Pick, Frances R.; Blais, Jules M.; Saleem, Ammar

    2015-05-04

    Highlights: • First analytical method for intracellular microcystins (MCs) in sediment. • Includes a suite of variants (LR, {sup 7dm}LR, RR, YR, WR, LA, LF, LY, LW) and nodularin. • Reports the first measurements of MCs in sediment pore waters. • MCs detected in >100 year old lake sediments suggesting long-term preservation. • Sediment-pore water distribution (K{sub d}) differed between variants suggesting differences in environmental fate. - Abstract: The fate and persistence of microcystin cyanotoxins in aquatic ecosystems remains poorly understood in part due to the lack of analytical methods for microcystins in sediments. Existing methods have been limited to the extraction of a few extracellular microcystins of similar chemistry. We developed a single analytical method, consisting of accelerated solvent extraction, hydrophilic–lipophilic balance solid phase extraction, and reversed phase high performance liquid chromatography-tandem mass spectrometry, suitable for the extraction and quantitation of both intracellular and extracellular cyanotoxins in sediments as well as pore waters. Recoveries of nine microcystins, representing the chemical diversity of microcystins, and nodularin (a marine analogue) ranged between 75 and 98% with one, microcystin-RR (MC-RR), at 50%. Chromatographic separation of these analytes was achieved within 7.5 min and the method detection limits were between 1.1 and 2.5 ng g{sup −1} dry weight (dw). The robustness of the method was demonstrated on sediment cores collected from seven Canadian lakes of diverse geography and trophic states. Individual microcystin variants reached a maximum concentration of 829 ng g{sup −1} dw on sediment particles and 132 ng mL{sup −1} in pore waters and could be detected in sediments as deep as 41 cm (>100 years in age). MC-LR, -RR, and -LA were more often detected while MC-YR, -LY, -LF, and -LW were less common. The analytical method enabled us to estimate sediment-pore water

  12. Analysis of intracellular and extracellular microcystin variants in sediments and pore waters by accelerated solvent extraction and high performance liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Zastepa, Arthur; Pick, Frances R; Blais, Jules M; Saleem, Ammar

    2015-05-04

    The fate and persistence of microcystin cyanotoxins in aquatic ecosystems remains poorly understood in part due to the lack of analytical methods for microcystins in sediments. Existing methods have been limited to the extraction of a few extracellular microcystins of similar chemistry. We developed a single analytical method, consisting of accelerated solvent extraction, hydrophilic-lipophilic balance solid phase extraction, and reversed phase high performance liquid chromatography-tandem mass spectrometry, suitable for the extraction and quantitation of both intracellular and extracellular cyanotoxins in sediments as well as pore waters. Recoveries of nine microcystins, representing the chemical diversity of microcystins, and nodularin (a marine analogue) ranged between 75 and 98% with one, microcystin-RR (MC-RR), at 50%. Chromatographic separation of these analytes was achieved within 7.5 min and the method detection limits were between 1.1 and 2.5 ng g(-1) dry weight (dw). The robustness of the method was demonstrated on sediment cores collected from seven Canadian lakes of diverse geography and trophic states. Individual microcystin variants reached a maximum concentration of 829 ng g(-1) dw on sediment particles and 132 ng mL(-1) in pore waters and could be detected in sediments as deep as 41 cm (>100 years in age). MC-LR, -RR, and -LA were more often detected while MC-YR, -LY, -LF, and -LW were less common. The analytical method enabled us to estimate sediment-pore water distribution coefficients (K(d)), MC-RR had the highest affinity for sediment particles (log K(d)=1.3) while MC-LA had the lowest affinity (log K(d)=-0.4), partitioning mainly into pore waters. Our findings confirm that sediments serve as a reservoir for microcystins but suggest that some variants may diffuse into overlying water thereby constituting a new route of exposure following the dissipation of toxic blooms. The method is well suited to determine the fate and persistence of different

  13. Evaluation of Sample Stability and Automated DNA Extraction for Fetal Sex Determination Using Cell-Free Fetal DNA in Maternal Plasma

    Directory of Open Access Journals (Sweden)

    Elena Ordoñez

    2013-01-01

    Full Text Available Objective. The detection of paternally inherited sequences in maternal plasma, such as the SRY gene for fetal sexing or RHD for fetal blood group genotyping, is becoming part of daily routine in diagnostic laboratories. Due to the low percentage of fetal DNA, it is crucial to ensure sample stability and the efficiency of DNA extraction. We evaluated blood stability at 4°C for at least 24 hours and automated DNA extraction, for fetal sex determination in maternal plasma. Methods. A total of 158 blood samples were collected, using EDTA-K tubes, from women in their 1st trimester of pregnancy. Samples were kept at 4°C for at least 24 hours before processing. An automated DNA extraction was evaluated, and its efficiency was compared with a standard manual procedure. The SRY marker was used to quantify cfDNA by real-time PCR. Results. Although lower cfDNA amounts were obtained by automated DNA extraction (mean 107,35 GE/mL versus 259,43 GE/mL, the SRY sequence was successfully detected in all 108 samples from pregnancies with male fetuses. Conclusion. We successfully evaluated the suitability of standard blood tubes for the collection of maternal blood and assessed samples to be suitable for analysis at least 24 hours later. This would allow shipping to a central reference laboratory almost from anywhere in Europe.

  14. Toxic reagents and expensive equipment: are they really necessary for the extraction of good quality fungal DNA?

    Science.gov (United States)

    Rodrigues, P; Venâncio, A; Lima, N

    2018-01-01

    The aim of this work was to evaluate a fungal DNA extraction procedure with the lowest inputs in terms of time as well as of expensive and toxic chemicals, but able to consistently produce genomic DNA of good quality for PCR purposes. Two types of fungal biological material were tested - mycelium and conidia - combined with two protocols for DNA extraction using Sodium Dodecyl Sulphate (SDS) and Cetyl Trimethyl Ammonium Bromide as extraction buffers and glass beads for mechanical disruption of cell walls. Our results showed that conidia and SDS buffer was the combination that lead to the best DNA quality and yield, with the lowest variation between samples. This study clearly demonstrates that it is possible to obtain high yield and pure DNA from pigmented conidia without the use of strong cell disrupting procedures and of toxic reagents. There are numerous methods for DNA extraction from fungi. Some rely on expensive commercial kits and/or equipments, unavailable for many laboratories, or make use of toxic chemicals such as chloroform, phenol and mercaptoethanol. This study clearly demonstrates that it is possible to obtain high yields of pure DNA from pigmented conidia without the use of strong and expensive cell disrupting procedures and of toxic reagents. The method herein described is simultaneously inexpensive and adequate to DNA extraction from several different types of fungi. © 2017 The Society for Applied Microbiology.

  15. Evaluation of two methods DNA extraction from formalin-fixed, paraffin-embedded tissues on non-optimal conditions

    International Nuclear Information System (INIS)

    Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo

    2011-01-01

    Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.

  16. Endonuclease activities in extracts of Micrococcus luteus that act on. gamma. -irradiated DNA

    Energy Technology Data Exchange (ETDEWEB)

    Schoen-Bopp, A; Schaefer, G; Hagen, U [Kernforschungszentrum Karlsruhe (Germany, F.R.). Inst. fuer Strahlenbiologie

    1977-03-01

    Several protein fractions containing endonuclease activity against ..gamma..-irradiated DNA (..gamma..-endonuclease) were isolated from M.luteus. The crude extract was eluted on a phosphocellulose column and chromatographed on TEAE cellulose and subsequently on hydroxypatite. Five peaks of ..gamma..-endonuclease were obtained from each preparation. Repeated experiments showed comparable chromatographic behaviour of the fractions. There was no detectable activity of uv-endonuclease in the fractions with ..gamma..-endonuclease but a small contamination of endonuclease against unirradiated DNA and against DNA with apurinic sites. The ..gamma..-endonuclease was stimulated by, but was not dependent on, magnesium. Several tests for endonuclease activity have been used: the analysis of strand breaks in calf-thymus DNA or in PM2 DNA, and the determination of end-groups formed by endonuclease, either 3'OH end-groups or phosphomonoester end groups. From the results obtained it can be assumed that the strand breaks induced by the ..gamma..-endonuclease carry 3'OH and 5' phosphate end groups.

  17. Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

    International Nuclear Information System (INIS)

    Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

    1995-01-01

    The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

  18. Camptosorus sibiricus rupr aqueous extract prevents lung tumorigenesis via dual effects against ROS and DNA damage.

    Science.gov (United States)

    He, Shugui; Ou, Rilan; Wang, Wensheng; Ji, Liyan; Gao, Hui; Zhu, Yuanfeng; Liu, Xiaomin; Zheng, Hongming; Liu, Zhongqiu; Wu, Peng; Lu, Linlin

    2018-06-28

    Camptosorus sibiricus Rupr (CSR) is a widely used herbal medicine with antivasculitis, antitrauma, and antitumor effects. However, the effect of CSR aqueous extract on B[a]P-initiated tumorigenesis and the underlying mechanism remain unclear. Moreover, the compounds in CSR aqueous extract need to be identified and structurally characterized. We aim to investigate the chemopreventive effect of CSR and the underlying molecular mechanism. A B[a]P-stimulated normal cell model (BEAS.2B) and lung adenocarcinoma animal model were established on A/J mice. In B[a]P-treated BEAS.2B cells, the protective effects of CSR aqueous extract on B[a]P-induced DNA damage and ROS production were evaluated through flow cytometry, Western blot, real-time quantitative PCR, single-cell gel electrophoresis, and immunofluorescence. Moreover, a model of B[a]P-initiated lung adenocarcinoma was established on A/J mice to determine the chemopreventive effect of CSR in vivo. The underlying mechanism was analyzed via immunohistochemistry and microscopy. Furthermore, the new compounds in CSR aqueous extract were isolated and structurally characterized using IR, HR-ESI-MS, and 1D and 2D NMR spectroscopy. CSR effectively suppressed ROS production by re-activating Nrf2-mediated reductases HO-1 and NQO-1. Simultaneously, CSR attenuated the DNA damage of BEAS.2B cells in the presence of B[a]P. Moreover, CSR at 1.5 and 3 g/kg significantly suppressed tumorigenesis with tumor inhibition ratios of 36.65% and 65.80%, respectively. The tumor volume, tumor size, and multiplicity of B[a]P-induced lung adenocarcinoma were effectively decreased by CSR in vivo. After extracting and identifying the compounds in CSR aqueous extract, three new triterpene saponins were isolated and characterized structurally. CSR aqueous extract prevents lung tumorigenesis by exerting dual effects against ROS and DNA damage, suggesting that CSR is a novel and effective agent for B[a]P-induced carcinogenesis. Moreover, by isolating

  19. Sources of pre-analytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC.

    Directory of Open Access Journals (Sweden)

    Elodie Caboux

    Full Text Available The European Prospective Investigation into Cancer and nutrition (EPIC is a long-term, multi-centric prospective study in Europe investigating the relationships between cancer and nutrition. This study has served as a basis for a number of Genome-Wide Association Studies (GWAS and other types of genetic analyses. Over a period of 5 years, 52,256 EPIC DNA samples have been extracted using an automated DNA extraction platform. Here we have evaluated the pre-analytical factors affecting DNA yield, including anthropometric, epidemiological and technical factors such as center of subject recruitment, age, gender, body-mass index, disease case or control status, tobacco consumption, number of aliquots of buffy coat used for DNA extraction, extraction machine or procedure, DNA quantification method, degree of haemolysis and variations in the timing of sample processing. We show that the largest significant variations in DNA yield were observed with degree of haemolysis and with center of subject recruitment. Age, gender, body-mass index, cancer case or control status and tobacco consumption also significantly impacted DNA yield. Feedback from laboratories which have analyzed DNA with different SNP genotyping technologies demonstrate that the vast majority of samples (approximately 88% performed adequately in different types of assays. To our knowledge this study is the largest to date to evaluate the sources of pre-analytical variations in DNA extracted from peripheral leucocytes. The results provide a strong evidence-based rationale for standardized recommendations on blood collection and processing protocols for large-scale genetic studies.

  20. Quantitative proteomic analysis of extracellular matrix extracted from mono- and dual-species biofilms of Fusobacterium nucleatum and Porphyromonas gingivalis.

    Science.gov (United States)

    Mohammed, Marwan Mansoor Ali; Pettersen, Veronika Kuchařová; Nerland, Audun H; Wiker, Harald G; Bakken, Vidar

    2017-04-01

    The Gram-negative bacteria Fusobacterium nucleatum and Porphyromonas gingivalis are members of a complex dental biofilm associated with periodontal disease. In this study, we cultured F. nucleatum and P. gingivalis as mono- and dual-species biofilms, and analyzed the protein composition of the biofilms extracellular polymeric matrix (EPM) by high-resolution liquid chromatography-tandem mass spectrometry. Label-free quantitative proteomic analysis was used for identification of proteins and sequence-based functional characterization for their classification and prediction of possible roles in EPM. We identified 542, 93 and 280 proteins in the matrix of F. nucleatum, P. gingivalis, and the dual-species biofilm, respectively. Nearly 70% of all EPM proteins in the dual-species biofilm originated from F. nucleatum, and a majority of these were cytoplasmic proteins, suggesting an enhanced lysis of F. nucleatum cells. The proteomic analysis also indicated an interaction between the two species: 22 F. nucleatum proteins showed differential levels between the mono and dual-species EPMs, and 11 proteins (8 and 3 from F. nucleatum and P. gingivalis, respectively) were exclusively detected in the dual-species EPM. Oxidoreductases and chaperones were among the most abundant proteins identified in all three EPMs. The biofilm matrices in addition contained several known and hypothetical virulence proteins, which can mediate adhesion to the host cells and disintegration of the periodontal tissues. This study demonstrated that the biofilm matrix of two important periodontal pathogens consists of a multitude of proteins whose amounts and functionalities vary largely. Relatively high levels of several of the detected proteins might facilitate their potential use as targets for the inhibition of biofilm development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

    Science.gov (United States)

    Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

    2011-12-01

    DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

  2. A simple and efficient total genomic DNA extraction method for individual zooplankton.

    Science.gov (United States)

    Fazhan, Hanafiah; Waiho, Khor; Shahreza, Md Sheriff

    2016-01-01

    Molecular approaches are widely applied in species identification and taxonomic studies of minute zooplankton. One of the most focused zooplankton nowadays is from Subclass Copepoda. Accurate species identification of all life stages of the generally small sized copepods through molecular analysis is important, especially in taxonomic and systematic assessment of harpacticoid copepod populations and to understand their dynamics within the marine community. However, total genomic DNA (TGDNA) extraction from individual harpacticoid copepods can be problematic due to their small size and epibenthic behavior. In this research, six TGDNA extraction methods done on individual harpacticoid copepods were compared. The first new simple, feasible, efficient and consistent TGDNA extraction method was designed and compared with the commercial kit and modified available TGDNA extraction methods. The newly described TGDNA extraction method, "Incubation in PCR buffer" method, yielded good and consistent results based on the high success rate of PCR amplification (82%) compared to other methods. Coupled with its relatively consistent and economical method the "Incubation in PCR buffer" method is highly recommended in the TGDNA extraction of other minute zooplankton species.

  3. Selection of the most suitable method for the extraction of DNA from foods and feeds for species identification

    Directory of Open Access Journals (Sweden)

    Michaela Nesvadbová

    2010-01-01

    Full Text Available High quality and purity of DNA isolated from food and feed is essential for species identification and has unpredictable influences an effect of analysis. In this study, the efficiency of eight different methods for DNA isolation was investigated. For DNA extraction, the raw chicken meet, ham, sausages, tinned lunch meat, pate, tinned feeds for dogs, complete granulated feeds for dogs and chicken flour were used. Kits of several different producers, i.e.: NucleoSpin Food (Marchery-Nagel, Wizard Genomic DNA Purification Kit (Promega, Invisorb Spin Food Kit I (Invitek, Wizard SV Genomic DNA Purification System (Promega, JetQuick Tissue DNA Spin Kit (Genomed, RNA Blue (Top-Bio, JetQuick Blood & Cell Culture Kit (Genomed, QIAamp DNA Mini Kit and QIAamp DNA Blood Mini Kit (Qiagen were employed in the study. Gel agarose electrophoresis for primary verification of DNA quality was performed. The isolates were subsequently assessed for quantity and quality using by spectrophotometer Nanodrop 2000 (Thermo Scientific. To verify of template usability and quality of isolated DNA, the polymerase chain reaction (PCR was used.Differences between isolated DNA from tinned products and meat, ham, sausage, granulated dog feed and chicken flour were found. In tinned food and feed, the DNA was more degraded, DNA content and DNA purity was lower and also PCR amplification was the most difficult. Overall DNA yield and quality have important influence on PCR products amplification. The best results were obtained with NucleoSpin Food and JetQuick Tissue DNA Spin Kit. DNA extracted by these methods proved highest yields, purity and template quality in all foods and feeds and the results of PCR analysis are excellent reproducible. Analyses showed that results depended on different food or feed using and dif­fe­rent isolation system.The results of this work will be utilized to choose the suitable isolating kit for educational course, which is designed for students and

  4. Comparison of DNA extraction protocols to detect Mycobacterium bovis in bovine tissue by PCR

    Directory of Open Access Journals (Sweden)

    Cássia Yumi Ikuta

    2016-11-01

    Full Text Available The current scenario of international beef trading has increased the pressure for better and faster diagnosis of bovine tuberculosis. Although traditional culture remains the gold standard method to confirm Mycobacterium bovis infection, it is exceedingly time consuming, and demands viable mycobacteria. Molecular methods overcome the flaws of the bacteriological methods with faster detection and identification. However, mycobacterial features like a complex cell wall and pathogen–host interaction make the molecular detection a challenge. Three protocols for DNA extraction (A, B and C from bovine tissues were tested to verify the most suitable technique for routine diagnostic assessment of their specificity and sensitivity. Thirty culture-positive and thirty culture-negative granulomatous lesions were included in the trial. From each sample, three tissue suspensions at different dilutions (10-1, 10-2 and 10-3 were prepared and submitted to DNA extraction. PCR procedures targeting IS6110 were performed, employing two volumes of DNA: 5 µL of all three dilutions, and 2.5 µL of the 10-1 dilution. Protocol A was able to detect members of the M. tuberculosis complex in most samples. The sensitivity of the test decreased with increase in tissue-suspension dilution. Although Protocol A presented the highest sensitivity followed by C and B, it showed the lowest specificity, which can be due to a failure in primary isolation caused by the lack of viable organisms or incubation time. Regardless classical bacteriological methods are still recommended by OIE, after evaluating the sensitivity of DNA extraction protocols and PCR procedures, we conclude that the best strategy for M. bovis detection is to follow Protocol A on concentrated tissue suspensions.

  5. Effects of an extract from the sea squirt Ecteinascidia turbinata on DNA synthesis and excision repair in human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dunn, W.C.; Carrier, W.L.; Regan, J.D.

    1982-01-01

    An aqueous ethanol extract from the marine tunicate species Ecteinascidia turbinata was studied to determine its effect on semiconservative DNA synthesis in human skin fibroblast cultures as measured by (/sup 3/H) thymidine uptake in acid-insoluble cell fractions. In addition, the effect of this extract on DNA excision repair in ultraviolet light (254 nm) irradiated fibroblasts was measured by the bromodeoxyuridine photolysis assay, thymine dimer chromatography, and DNA single-strand break analysis on alkaline sucrose gradients. Repair inhibition was accompanied by an accumulation of single-strand DNA breaks which was enhanced by the addtion of 2 mM hydroxyurea. These results are discussed with respect to a mechanism of action of the marine tunicate extract at the level of DNA polymerases and are contrasted with previously studied inhibitory mechanisms of arabinofuranosyl nucleosides.

  6. Determination of polyphenolic content, HPLC analyses and DNA cleavage activity of Malaysian Averrhoa carambola L. fruit extracts

    Directory of Open Access Journals (Sweden)

    Zakia Khanam

    2015-10-01

    Full Text Available In developing countries, the increasing gap between population growth and food supply has created renewed interest in finding reliable and cheap natural resources of nutraceutical value and health promoting properties. Therefore, the present study deals with the phytochemical analyses and DNA cleavage activity of Averrhoa carambola L. fruit (starfruit extracts. The phytochemical studies involve colour tests and quantification of phenolics and flavonoids of the prepared ethanolic and aqueous extracts. Identification of phenolic acids and flavonoids present in the extracts were conducted by high performance liquid chromatography (HPLC equipped with diode array detector (DAD. DNA cleavage activity of the extracts was evaluated through gel electrophoresis against plasmid Escherichia coli DNA at different concentrations (0.125–0.60 μg/μl. The results of the study exhibited that the starfruit is a rich source of polyphenols and all the extracts exhibited a dose dependent DNA cleavage activity, whereas ethanolic extract induced more cleavage as compared to the aqueous extract. In conclusion, the present study provides preliminary evidence with regard to nutraceutical value of the fruit. So, further extensive study is a prerequisite to exploit DNA cleaving properties of the fruit extracts for therapeutic application.

  7. High-Quality and -Quantity DNA Extraction from Frozen Archival Blood Clots for Genotyping of Single-Nucleotide Polymorphisms

    DEFF Research Database (Denmark)

    Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke

    2013-01-01

    the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...

  8. Improved Methods of Carnivore Faecal Sample Preservation, DNA Extraction and Quantification for Accurate Genotyping of Wild Tigers

    Science.gov (United States)

    Harika, Katakam; Mahla, Ranjeet Singh; Shivaji, Sisinthy

    2012-01-01

    Background Non-invasively collected samples allow a variety of genetic studies on endangered and elusive species. However due to low amplification success and high genotyping error rates fewer samples can be identified up to the individual level. Number of PCRs needed to obtain reliable genotypes also noticeably increase. Methods We developed a quantitative PCR assay to measure and grade amplifiable nuclear DNA in feline faecal extracts. We determined DNA degradation in experimentally aged faecal samples and tested a suite of pre-PCR protocols to considerably improve DNA retrieval. Results Average DNA concentrations of Grade I, II and III extracts were 982pg/µl, 9.5pg/µl and 0.4pg/µl respectively. Nearly 10% of extracts had no amplifiable DNA. Microsatellite PCR success and allelic dropout rates were 92% and 1.5% in Grade I, 79% and 5% in Grade II, and 54% and 16% in Grade III respectively. Our results on experimentally aged faecal samples showed that ageing has a significant effect on quantity and quality of amplifiable DNA (pDNA degradation occurs within 3 days of exposure to direct sunlight. DNA concentrations of Day 1 samples stored by ethanol and silica methods for a month varied significantly from fresh Day 1 extracts (p0.05). DNA concentrations of fresh tiger and leopard faecal extracts without addition of carrier RNA were 816.5pg/µl (±115.5) and 690.1pg/µl (±207.1), while concentrations with addition of carrier RNA were 49414.5pg/µl (±9370.6) and 20982.7pg/µl (±6835.8) respectively. Conclusions Our results indicate that carnivore faecal samples should be collected as freshly as possible, are better preserved by two-step method and should be extracted with addition of carrier RNA. We recommend quantification of template DNA as this facilitates several downstream protocols. PMID:23071624

  9. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

    Science.gov (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

    2017-11-21

    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

  10. Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method

    Directory of Open Access Journals (Sweden)

    Wajhul Qamar

    2017-11-01

    Full Text Available In case of studies associated with human genetics, genomics, and pharmacogenetics the genomic DNA is extracted from the buccal cells, whole blood etc. Several methods are exploited by the researchers to extract DNA from the whole blood. One of these methods, which utilizes cell lysis and proteolytic properties of sodium dodecyl sulfate (SDS and proteinase K respectively, might also be called SDS-PK method. It does not include any hazardous chemicals such as phenol or chloroform and is inexpensive. However, several researchers report the same method with different formulas and conditions. During our experiments with whole blood DNA extraction we experienced problems such as protein contamination, DNA purity and yield when followed some SDS-PK protocols reported elsewhere. A260/A280 and A260/A230 ratios along with PCR amplification give a clear idea about the procedure that was followed to extract the DNA. In an effort to increase the DNA purity from human whole blood, we pointed out some steps of the protocol that play a crucial role in determining the extraction of high quality DNA.

  11. The Extraction and Partial Purification of Bacterial DNA as a Practical Exercise for GCE Advanced Level Students.

    Science.gov (United States)

    Falconer, A. C.; Hayes, L. J.

    1986-01-01

    Describes a relatively simple method of extraction and purification of bacterial DNA. This technique permits advanced secondary-level science students to obtain adequate amounts of DNA from very small pellets of bacteria and to observe some of its polymer properties. (ML)

  12. The effect of DNA extraction methods on observed microbial communities from fibrous and liquid rumen fractions of dairy cows

    NARCIS (Netherlands)

    Vaidya, Jueeli D.; Bogert, van den Bartholomeus; Boekhorst, Jos; Saccenti, Edoardo; Plugge, Caroline M.; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of

  13. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Science.gov (United States)

    Adamowicz, Michael S; Stasulli, Dominique M; Sobestanovich, Emily M; Bille, Todd W

    2014-01-01

    Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C) as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  14. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Directory of Open Access Journals (Sweden)

    Michael S Adamowicz

    Full Text Available Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  15. Direct-acting DNA alkylating agents present in aqueous extracts of areca nut and its products.

    Science.gov (United States)

    Hu, Chiung-Wen; Chao, Mu-Rong

    2012-11-19

    Areca nut is a carcinogen to humans and has been strongly associated with oral premalignant and malignant diseases. Previous studies speculated the presence of unknown direct-acting mutagens present in aqueous extracts of areca nut. We hypothesized whether any direct-acting alkylating agents are present in areca nut and its commercial products. In this study, calf thymus DNA was treated with four different aqueous extracts obtained from unripe and ripe areca nuts or their commercial products, namely, pan masala (without tobacco) and gutkha (with tobacco). Three N-alkylated purines including N7-methylguanine (N7-MeG), N3-methyladenine (N3-MeA), and N7-ethylguanine (N7-EtG) were detected using sensitive and specific isotope-dilution liquid chromatography-tandem-mass spectrometry (LC-MS/MS) methods. The results showed that four types of aqueous extracts significantly induced the formation of N7-MeG and N3-MeA in a linear dose-response manner. Extracts from unripe areca nut exhibited higher methylating potency than those of ripe areca nut, while gutkha had higher methylating potency than pan masala. Meanwhile, gutkha made with areca nut and tobacco, was the only extract found to induce the formation of N7-EtG. Overall, this study first demonstrated that the presence of direct-acting alkylating agents in areca nut and its commercial products exist at a level that is able to cause significant DNA damage. Our findings may provide another mechanistic rationale for areca nut-mediated oral carcinogenesis and also highlight the importance and necessity of the identification of these direct-acting alkylating agents.

  16. Extraction and structural properties of Acanthophora muscoides (Rhodophyceae extracellular matrix sulfated polysaccharides and their effects on coagulation

    Directory of Open Access Journals (Sweden)

    José Ariévilo Gurgel Rodrigues

    2016-06-01

    Full Text Available Acanthophora muscoides (Rhodophyta contains structurally heterogeneous sulfated polysaccharides (Am-SPs with pharmacological importance; however, its matrix SPs composition has not been still extensively investigated. This study sequentially extracted and compared the structural features and the in vitro anticoagulant effects of the Am-SPs. Papain-extraction sequence yielded Am.E-1, Am.E-2 and Am.E-3 containing differences among the relative proportions of sulfate (26.18-33% and hexoses (42.02-60.67% based on chemical analyses. One- (1H and two-dimensions (1H/13C nuclear magnetic resonance experiments showed very complex Am-SPs composed of alternating 4-linked-α-galactopyranosyl units and 3-linked-β-galactopyranosyl units presenting variable sulfation, CH3 substitutions and3,6-anhydro-α-L-galactose units and pyruvated-D-galactose residues, respectively, typical of agarocolloids. Different chromatographic profiles (DEAE-cellulose were observed, with fractions (Am I, Am II and Am III eluted with 0.5, 0.75 and/or 1 M of NaCl, respectively revealing charge density patterns and distinct mobility to heparin by agarose-electrophoresis and, when analyzed by polyacrylamide-electrophoresis, a dispersive migration and similar mobility as chondroitin-6-sulfate for Am I fractions were noted. Regarding the activated partial thromboplastin time test, fractions had no virtually anticoagulation (1.47→3.07 IU mg-1 in comparison with 193 IU mg-1 heparin. Therefore, Am-SPs show significantly lower anticoagulation than heparin.

  17. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  18. DNA agarose gel electrophoresis for antioxidant analysis: Development of a quantitative approach for phenolic extracts.

    Science.gov (United States)

    Silva, Sara; Costa, Eduardo M; Vicente, Sandra; Veiga, Mariana; Calhau, Conceição; Morais, Rui M; Pintado, Manuela E

    2017-10-15

    Most of the fast in vitro assays proposed to determine the antioxidant capacity of a compound/extract lack either biological context or employ complex protocols. Therefore, the present work proposes the improvement of an agarose gel DNA electrophoresis in order to allow for a quantitative estimation of the antioxidant capacity of pure phenolic compounds as well as of a phenolic rich extract, while also considering their possible pro-oxidant effects. The result obtained demonstrated that the proposed method allowed for the evaluation of the protection of DNA oxidation [in the presence of hydrogen peroxide (H 2 O 2 ) and an H 2 O 2 /iron (III) chloride (FeCl 3 ) systems] as well as for the observation of pro-oxidant activities, with the measurements registering interclass correlation coefficients above 0.9. Moreover, this method allowed for the characterization of the antioxidant capacity of a blueberry extract while demonstrating that it had no perceived pro-oxidant effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  20. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Directory of Open Access Journals (Sweden)

    Krithivasan Sankaranarayanan

    Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  1. Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

    Science.gov (United States)

    Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

    2014-02-27

    Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

  2. A novel reliable method of DNA extraction from olive oil suitable for molecular traceability.

    Science.gov (United States)

    Raieta, Katia; Muccillo, Livio; Colantuoni, Vittorio

    2015-04-01

    Extra virgin olive oil production has a worldwide economic impact. The use of this brand, however, is of great concern to Institutions and private industries because of the increasing number of fraud and adulteration attempts to the market products. Here, we present a novel, reliable and not expensive method for extracting the DNA from commercial virgin and extra virgin olive oils. The DNA is stable overtime and amenable for molecular analyses; in fact, by carrying out simple sequence repeats (SSRs) markers analysis, we characterise the genetic profile of monovarietal olive oils. By comparing the oil-derived pattern with that of the corresponding tree, we can unambiguously identify four cultivars from Samnium, a region of Southern Italy, and distinguish them from reference and more widely used varieties. Through a parentage statistical analysis, we also identify the putative pollinators, establishing an unprecedented and powerful tool for olive oil traceability. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  4. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  5. Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Nicole L Podnecky

    Full Text Available Burkholderia pseudomallei, the etiologic agent of melioidosis, is endemic in northern Australia and Southeast Asia and can cause severe septicemia that may lead to death in 20% to 50% of cases. Rapid detection of B. pseudomallei infection is crucial for timely treatment of septic patients. This study evaluated seven commercially available DNA extraction kits to determine the relative recovery of B. pseudomallei DNA from spiked EDTA-containing human whole blood. The evaluation included three manual kits: the QIAamp DNA Mini kit, the QIAamp DNA Blood Mini kit, and the High Pure PCR Template Preparation kit; and four automated systems: the MagNAPure LC using the DNA Isolation Kit I, the MagNAPure Compact using the Nucleic Acid Isolation Kit I, and the QIAcube using the QIAamp DNA Mini kit and the QIAamp DNA Blood Mini kit. Detection of B. pseudomallei DNA extracted by each kit was performed using the B. pseudomallei specific type III secretion real-time PCR (TTS1 assay. Crossing threshold (C T values were used to compare the limit of detection and reproducibility of each kit. This study also compared the DNA concentrations and DNA purity yielded for each kit. The following kits consistently yielded DNA that produced a detectable signal from blood spiked with 5.5×10(4 colony forming units per mL: the High Pure PCR Template Preparation, QIAamp DNA Mini, MagNA Pure Compact, and the QIAcube running the QIAamp DNA Mini and QIAamp DNA Blood Mini kits. The High Pure PCR Template Preparation kit yielded the lowest limit of detection with spiked blood, but when this kit was used with blood from patients with confirmed cases of melioidosis, the bacteria was not reliably detected indicating blood may not be an optimal specimen.

  6. Evaluation of raw nepodin extraction from Rumex japonicus and R. obtusifolius and their DNA polymorphisms.

    Science.gov (United States)

    Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae

    2018-01-01

    Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.

  7. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  8. Reconstitution of the cellular response to DNA damage in vitro using damage-activated extracts from mammalian cells

    International Nuclear Information System (INIS)

    Roper, Katherine; Coverley, Dawn

    2012-01-01

    In proliferating mammalian cells, DNA damage is detected by sensors that elicit a cellular response which arrests the cell cycle and repairs the damage. As part of the DNA damage response, DNA replication is inhibited and, within seconds, histone H2AX is phosphorylated. Here we describe a cell-free system that reconstitutes the cellular response to DNA double strand breaks using damage-activated cell extracts and naïve nuclei. Using this system the effect of damage signalling on nuclei that do not contain DNA lesions can be studied, thereby uncoupling signalling and repair. Soluble extracts from G1/S phase cells that were treated with etoposide before isolation, or pre-incubated with nuclei from etoposide-treated cells during an in vitro activation reaction, restrain both initiation and elongation of DNA replication in naïve nuclei. At the same time, H2AX is phosphorylated in naïve nuclei in a manner that is dependent upon the phosphatidylinositol 3-kinase-like protein kinases. Notably, phosphorylated H2AX is not focal in naïve nuclei, but is evident throughout the nucleus suggesting that in the absence of DNA lesions the signal is not amplified such that discrete foci can be detected. This system offers a novel screening approach for inhibitors of DNA damage response kinases, which we demonstrate using the inhibitors wortmannin and LY294002. -- Highlights: ► A cell free system that reconstitutes the response to DNA damage in the absence of DNA lesions. ► Damage-activated extracts impose the cellular response to DNA damage on naïve nuclei. ► PIKK-dependent response impacts positively and negatively on two separate fluorescent outputs. ► Can be used to screen for inhibitors that impact on the response to damage but not on DNA repair. ► LY294002 and wortmannin demonstrate the system's potential as a pathway focused screening approach.

  9. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  10. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows.

    Science.gov (United States)

    Vaidya, Jueeli D; van den Bogert, Bartholomeus; Edwards, Joan E; Boekhorst, Jos; van Gastelen, Sanne; Saccenti, Edoardo; Plugge, Caroline M; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini) differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100), 67% GS and 33% maize silage (GS67MS33), 33% GS and 67% MS (GS33MS67), or 100% MS (MS100). An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method ( p anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA) of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction ( p = 0.012), and that PBB ( p = 0.012) and FDSS ( p = 0.024) also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In summary, the comprehensive assessment of observed communities of bacteria, archaea and anaerobic fungi described here provides insight into a rational basis for selecting an optimal methodology to obtain a representative picture of the rumen microbiota.

  11. Comparison of QIAsymphony Automated and QIAamp Manual DNA Extraction Systems for Measuring Epstein-Barr Virus DNA Load in Whole Blood Using Real-Time PCR

    OpenAIRE

    Laus, Stella; Kingsley, Lawrence A.; Green, Michael; Wadowsky, Robert M.

    2011-01-01

    Automated and manual extraction systems have been used with real-time PCR for quantification of Epstein-Barr virus [human herpesvirus 4 (HHV-4)] DNA in whole blood, but few studies have evaluated relative performances. In the present study, the automated QIAsymphony and manual QIAamp extraction systems (Qiagen, Valencia, CA) were assessed using paired aliquots derived from clinical whole-blood specimens and an in-house, real-time PCR assay. The detection limits using the QIAsymphony and QIAam...

  12. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N

    2013-01-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors...

  13. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Directory of Open Access Journals (Sweden)

    Christina Gill

    Full Text Available Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating prior to chemical and enzyme-based DNA extraction with a commercial kit.After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering.An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of

  14. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Science.gov (United States)

    Gill, Christina; van de Wijgert, Janneke H H M; Blow, Frances; Darby, Alistair C

    2016-01-01

    Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating) prior to chemical and enzyme-based DNA extraction with a commercial kit. After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity) between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering. An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of epidemiological studies

  15. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Science.gov (United States)

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

    2015-05-01

    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  16. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows

    Directory of Open Access Journals (Sweden)

    Jueeli D. Vaidya

    2018-01-01

    Full Text Available DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF and fibrous content (FC fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100, 67% GS and 33% maize silage (GS67MS33, 33% GS and 67% MS (GS33MS67, or 100% MS (MS100. An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method (p < 0.001 and fraction (p < 0.001. The 260/280 ratio was not affected by extraction (p = 0.08 but was affected by fraction (p = 0.03. On the other hand, the 260/230 ratio was affected by extraction method (p < 0.001 but not affected by fraction (p = 0.8. However, all four extraction procedures yielded DNA suitable for further analysis of bacterial, archaeal and anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction (p = 0.012, and that PBB (p = 0.012 and FDSS (p = 0.024 also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In

  17. Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

    Energy Technology Data Exchange (ETDEWEB)

    Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

    2009-09-01

    Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

  18. Development of a real-world direct interface for integrated DNA extraction and amplification in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenway, Gillian M; Greenman, John; Haswell, Stephen J

    2011-02-07

    Integrated DNA extraction and amplification have been carried out in a microfluidic device using electro-osmotic pumping (EOP) for fluidic control. All the necessary reagents for performing both DNA extraction and polymerase chain reaction (PCR) amplification were pre-loaded into the microfluidic device following encapsulation in agarose gel. Buccal cells were collected using OmniSwabs [Whatman™, UK] and manually added to a chaotropic binding/lysis solution pre-loaded into the microfluidic device. The released DNA was then adsorbed onto a silica monolith contained within the DNA extraction chamber and the microfluidic device sealed using polymer electrodes. The washing and elution steps for DNA extraction were carried out using EOP, resulting in transfer of the eluted DNA into the PCR chamber. Thermal cycling, achieved using a Peltier element, resulted in amplification of the Amelogenin locus as confirmed using conventional capillary gel electrophoresis. It was demonstrated that the PCR reagents could be stored in the microfluidic device for at least 8 weeks at 4 °C with no significant loss of activity. Such methodology lends itself to the production of 'ready-to-use' microfluidic devices containing all the necessary reagents for sample processing, with many obvious applications in forensics and clinical medicine.

  19. Evaluation of the ISO standard 11063 DNA extraction procedure for assessing soil microbial abundance and community structure.

    Directory of Open Access Journals (Sweden)

    Pierre Plassart

    Full Text Available Soil DNA extraction has become a critical step in describing microbial biodiversity. Historically, ascertaining overarching microbial ecological theories has been hindered as independent studies have used numerous custom and commercial DNA extraction procedures. For that reason, a standardized soil DNA extraction method (ISO-11063 was previously published. However, although this ISO method is suited for molecular tools such as quantitative PCR and community fingerprinting techniques, it has only been optimized for examining soil bacteria. Therefore, the aim of this study was to assess an appropriate soil DNA extraction procedure for examining bacterial, archaeal and fungal diversity in soils of contrasting land-use and physico-chemical properties. Three different procedures were tested: the ISO-11063 standard; a custom procedure (GnS-GII; and a modified ISO procedure (ISOm which includes a different mechanical lysis step (a FastPrep ®-24 lysis step instead of the recommended bead-beating. The efficacy of each method was first assessed by estimating microbial biomass through total DNA quantification. Then, the abundances and community structure of bacteria, archaea and fungi were determined using real-time PCR and terminal restriction fragment length polymorphism approaches. Results showed that DNA yield was improved with the GnS-GII and ISOm procedures, and fungal community patterns were found to be strongly dependent on the extraction method. The main methodological factor responsible for differences between extraction procedure efficiencies was found to be the soil homogenization step. For integrative studies which aim to examine bacteria, archaea and fungi simultaneously, the ISOm procedure results in higher DNA recovery and better represents microbial communities.

  20. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Science.gov (United States)

    Yamagishi, Junya; Sato, Yukuto; Shinozaki, Natsuko; Ye, Bin; Tsuboi, Akito; Nagasaki, Masao; Yamashita, Riu

    2016-01-01

    The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field), QIAsymphony (a robotics method), and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  1. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Directory of Open Access Journals (Sweden)

    Junya Yamagishi

    Full Text Available The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field, QIAsymphony (a robotics method, and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  2. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

    Science.gov (United States)

    Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

    2015-01-01

    The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  3. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences

    Directory of Open Access Journals (Sweden)

    Brett eWagner Mackenzie

    2015-02-01

    Full Text Available The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation, with a smaller proportion of variation associated with DNA extraction method (technical variation and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  4. Comparison of DNA Extraction Methods in Terms of Yield, Purity, Long-Term Storage, and Downstream Manipulation with Brewer's Yeast Chromosomal DNA

    Czech Academy of Sciences Publication Activity Database

    Kopecká, J.; Matoulková, D.; Němec, M.; Jelínková, Markéta; Felsberg, Jürgen

    2014-01-01

    Roč. 72, č. 1 (2014), s. 1-5 ISSN 0361-0470 Institutional support: RVO:61388971 Keywords : Brewer's yeast * Isolation of DNA * Phenol/chloroform extraction Subject RIV: EE - Microbiology, Virology Impact factor: 0.886, year: 2014

  5. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  6. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  7. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

    Science.gov (United States)

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

  8. Direct extraction of genomic DNA from maize with aqueous ionic liquid buffer systems for applications in genetically modified organisms analysis.

    Science.gov (United States)

    Gonzalez García, Eric; Ressmann, Anna K; Gaertner, Peter; Zirbs, Ronald; Mach, Robert L; Krska, Rudolf; Bica, Katharina; Brunner, Kurt

    2014-12-01

    To date, the extraction of genomic DNA is considered a bottleneck in the process of genetically modified organisms (GMOs) detection. Conventional DNA isolation methods are associated with long extraction times and multiple pipetting and centrifugation steps, which makes the entire procedure not only tedious and complicated but also prone to sample cross-contamination. In recent times, ionic liquids have emerged as innovative solvents for biomass processing, due to their outstanding properties for dissolution of biomass and biopolymers. In this study, a novel, easily applicable, and time-efficient method for the direct extraction of genomic DNA from biomass based on aqueous-ionic liquid solutions was developed. The straightforward protocol relies on extraction of maize in a 10 % solution of ionic liquids in aqueous phosphate buffer for 5 min at room temperature, followed by a denaturation step at 95 °C for 10 min and a simple filtration to remove residual biopolymers. A set of 22 ionic liquids was tested in a buffer system and 1-ethyl-3-methylimidazolium dimethylphosphate, as well as the environmentally benign choline formate, were identified as ideal candidates. With this strategy, the quality of the genomic DNA extracted was significantly improved and the extraction protocol was notably simplified compared with a well-established method.

  9. Mutant analysis of Cdt1's function in suppressing nascent strand elongation during DNA replication in Xenopus egg extracts.

    Science.gov (United States)

    Nakazaki, Yuta; Tsuyama, Takashi; Azuma, Yutaro; Takahashi, Mikiko; Tada, Shusuke

    2017-09-02

    The initiation of DNA replication is strictly regulated by multiple mechanisms to ensure precise duplication of chromosomes. In higher eukaryotes, activity of the Cdt1 protein is temporally regulated during the cell cycle, and deregulation of Cdt1 induces DNA re-replication. In previous studies, we showed that excess Cdt1 inhibits DNA replication by suppressing progression of replication forks in Xenopus egg extracts. Here, we investigated the functional regions of Cdt1 that are required for the inhibition of DNA replication. We constructed a series of N-terminally or C-terminally deleted mutants of Cdt1 and examined their inhibitory effects on DNA replication in Xenopus egg extracts. Our results showed that the region spanning amino acids (a. a.) 255-620 is required for efficient inhibition of DNA replication, and that, within this region, a. a. 255-289 have a critical role in inhibition. Moreover, one of the Cdt1 mutants, Cdt1 R285A, was compromised with respect to the licensing activity but still inhibited DNA replication. This result suggests that Cdt1 has an unforeseen function in the negative regulation of DNA replication, and that this function is located within a molecular region that is distinct from those required for the licensing activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Evaluation of five DNA extraction methods for purification of DNA from atherosclerotic tissue and estimation of prevalence of Chlamydia pneumoniae in tissue from a Danish population undergoing vascular repair

    Directory of Open Access Journals (Sweden)

    Lindholt Jes S

    2003-09-01

    Full Text Available Abstract Background To date PCR detection of Chlamydia pneumoniae DNA in atherosclerotic lesions from Danish patients has been unsuccessful. To establish whether non-detection was caused by a suboptimal DNA extraction method, we tested five different DNA extraction methods for purification of DNA from atherosclerotic tissue. Results The five different DNA extraction methods were tested on homogenate of atherosclerotic tissue spiked with C. pneumoniae DNA or EB, on pure C. pneumoniae DNA samples and on whole C. pneumoniae EB. Recovery of DNA was measured with a C. pneumoniae-specific quantitative real-time PCR. A DNA extraction method based on DNA-binding to spin columns with a silica-gel membrane (DNeasy Tissue kit showed the highest recovery rate for the tissue samples and pure DNA samples. However, an automated extraction method based on magnetic glass particles (MagNA Pure performed best on intact EB and atherosclerotic tissue spiked with EB. The DNeasy Tissue kit and MagNA Pure methods and the highly sensitive real-time PCR were subsequently used on 78 atherosclerotic tissue samples from Danish patients undergoing vascular repair. None of the samples were positive for C. pneumoniae DNA. The atherosclerotic samples were tested for inhibition by spiking with two different, known amounts of C. pneumoniae DNA and no samples showed inhibition. Conclusion As a highly sensitive PCR method and an optimised DNA extraction method were used, non-detection in atherosclerotic tissue from the Danish population was probably not caused by use of inappropriate methods. However, more samples may need to be analysed per patient to be completely certain on this. Possible methodological and epidemiological reasons for non-detection of C. pneumoniae DNA in atherosclerotic tissue from the Danish population are discussed. Further testing of DNA extraction methods is needed as this study has shown considerable intra- and inter-method variation in DNA recovery.

  11. A simple method for extracting DNA from rhododendron plants infected with Phytophthora spp. for use in PCR

    Directory of Open Access Journals (Sweden)

    Trzewik Aleksandra

    2016-01-01

    Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.

  12. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    Directory of Open Access Journals (Sweden)

    Luis E. Rojas

    2014-07-01

    Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.

  13. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Directory of Open Access Journals (Sweden)

    Žel Jana

    2006-08-01

    Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was

  14. Critical points of DNA quantification by real-time PCR--effects of DNA extraction method and sample matrix on quantification of genetically modified organisms.

    Science.gov (United States)

    Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina

    2006-08-14

    Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to

  15. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Science.gov (United States)

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary

  16. EXTRACTION AND PURIFICATION OF EXTRACELLULAR LACCASE FROM WILD, MUTANTS AND HYBRID STRAINS OF TWO WHITE-ROT FUNGUS AND ITS APPLICATIONS IN DECOLOURIZATION AND LIGNINOLYSIS

    Directory of Open Access Journals (Sweden)

    Olusola Majolagbe

    2012-12-01

    Full Text Available Extracellular laccases were extracted from a 5-day old submerge cultures of the wild, mutants and hybrid of Lentinus subnudus. Mutants were generated by exposure of the wild strain of L. subnudus to ultraviolet radiation (ג = 280 nm at specific time intervals while the hybrid was produced by cross-breeding L. subnudus with L. edodes. The crude enzyme was fractionated with 80% ammonium sulphate and further purified on DEAE column. The laccase has a molecular weight of about 45 KDa. Purification yield on DEAE column gave the highest purification yield of 23.25% in SWT and least in SHT (5.29%. Its potentials in decolourization of 2, 6-dichlorophenol-indophenol dye at different pH conditions were investigated. Five out of the six fungal strains tested gave significant (P<0.05 percentage decolourization (≥43.94% at pH 8. The fungus was further studied for their ability in degrading wheat and paddy straws. The solid substrate fermentation was inoculated with two pieces (0.6cm diameter mycelial agar blocks of each of the fungal strains, supplemented with 30mg/100g sucrose, 24mg/100g KNO3 and 60mg/100g CaCO3. The periodic reduction in weight of the solid substrate medium and enzymatic activity of laccase for each of the fungal strains was assessed. Therefore, the ability of the wild, mutants and hybrid of L subnudus strains to produce laccase enzyme shows their significant potential in textile industry, especially in decolourization of dye and bioconversion of lignocellulosic wastes.

  17. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    Science.gov (United States)

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  18. Replication of UV-irradiated DNA in human cell extracts: Evidence for mutagenic bypass of pyrimidine dimers

    International Nuclear Information System (INIS)

    Thomas, D.C.; Kunkel, T.A.

    1993-01-01

    The authors have examined the efficiency and fidelity of simian virus 40-origin-dependent replication of UV-irradiated double-stranded DNA in extracts of human cells. Using as a mutational target the α-complementation domain of the Escherichia coli lacZ gene in bacteriophage M13mp2DNA, replication of undamaged DNA in HeLa cell extracts was highly accurate, whereas replication of DNA irradiated with UV light (280-320 nm) was both less efficient and less accurate. Replication was inhibited by irradiation in a dose-dependent manner. Nonetheless, covalently closed, monomer-length circular products were generated that were resistant to digestion by Dpn I, showing that they resulted from semiconservative replication. These products were incised by T4 endonuclease V, whereas the undamaged replication products were not, suggesting that pyrimidine dimers were bypassed during replication. When replicated, UV-irradiated DNA was used to transfect an E. coli α-complementation host strain to score mutant M13mp2 plaques, the mutant plaque frequency was substantially higher than that obtained with either unirradiated, replicated DNA, or unreplicated, UV-irradiated DNA. Both the increased mutagenicity and the inhibition of replication associated with UV irradiation were reversed by treatment of the irradiated DNA with photolyase before replication. Sequence analysis of mutants resulting from replication of UV-irradiated DNA demonstrated that most mutants contained C → T transition errors at dipyrimidine sites. A few mutants contained 1-nt frameshift errors or tandem double CC → TT substitutions. The data are consistent with the interpretation that pyrimidine dimers are bypassed during replication by the multiprotein replication apparatus in human cell extracts and that this bypass is mutagenic primarily via misincorporation of dAMP opposite a cytosine (or uracil) in the dimer. 56 refs., 2 figs., 3 tabs

  19. Hot water extract of Chlorella vulgaris induced DNA damage and apoptosis

    Science.gov (United States)

    Yusof, Yasmin Anum Mohd; Md. Saad, Suhana; Makpol, Suzana; Shamaan, Nor Aripin; Ngah, Wan Zurinah Wan

    2010-01-01

    OBJECTIVES: The aim of this study was to determine the antiproliferative and apoptotic effects of hot water extracts of Chlorella vulgaris on hepatoma cell line HepG2. INTRODUCTION: The search for food and spices that can induce apoptosis in cancer cells has been a major study interest in the last decade. Chlorella vulgaris, a unicellular green algae, has been reported to have antioxidant and anti‐cancer properties. However, its chemopreventive effects in inhibiting the growth of cancer cells have not been studied in great detail. METHODS: HepG2 liver cancer cells and WRL68 normal liver cells were treated with various concentrations (0‐4 mg/ml) of hot water extract of C. vulgaris after 24 hours incubation. Apoptosis rate was evaluated by TUNEL assay while DNA damage was assessed by Comet assay. Apoptosis proteins were evaluated by Western blot analysis. RESULTS: Chlorella vulgaris decreased the number of viable HepG2 cells in a dose dependent manner (p Chlorella vulgaris tested. Evaluation of apoptosis by TUNEL assay showed that Chlorella vulgaris induced a higher apoptotic rate (70%) in HepG2 cells compared to normal liver cells, WRL68 (15%). Western blot analysis showed increased expression of pro‐ apoptotic proteins P53, Bax and caspase‐3 in the HepG2 cells compared to normal liver cells WRL68, and decreased expression of the anti‐apoptotic protein Bcl‐2. CONCLUSIONS: Chlorella vulgaris may have anti‐cancer effects by inducing apoptosis signaling cascades via an increased expression of P53, Bax and caspase‐3 proteins and through a reduction of Bcl‐2 protein, which subsequently lead to increased DNA damage and apoptosis. PMID:21340229

  20. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  1. Aqueous extract of Crataegus azarolus protects against DNA damage in human lymphoblast Cell K562 and enhances antioxidant activity.

    Science.gov (United States)

    Mustapha, Nadia; Bouhlel, Inès; Chaabane, Fadwa; Bzéouich, Imèn Mokdad; Ghedira, Kamel; Hennebelle, Thierry; Chekir-Ghedira, Leila

    2014-02-01

    The present study was carried out to characterize the cellular antioxidant effect of the aqueous extract of Crataegus azarolus and its antigenotoxic potential using human myelogenous cells, K562. The antioxidant capacity of this extract was evaluated by determining its cellular antioxidant activity (CAA) in K562 cells. Also, preceding antigenotoxicity assessment, its eventual genotoxicity property was investigated by evaluating its capacity to induce the DNA degradation of treated cell nuclei. As no genotoxicity was detected at different exposure times, its ability to protect cell DNA against H2O2 oxidative effect was investigated, using the "comet assay." It appears that 800 μg/mL of extract inhibited the genotoxicity induced by H2O2 with a rate of 41.30 %, after 4 h of incubation. In addition, this extract revealed a significant cellular antioxidant capacity against the reactive oxygen species in K562 cells.

  2. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by {sup 32}P-postlabeling

    Energy Technology Data Exchange (ETDEWEB)

    Randerath, E. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Zhou, G.D. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Donnelly, K.C. [Department of Veterinary Anatomy and Public Health, Texas A and M University, College Station, TX (United States); Safe, S.H. [Department of Veterinary Physiology/Pharmacology, Texas A and M University, College Station, TX (United States); Randerath, K. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States)

    1996-09-01

    In the present study, a mouse bioassay was used in combination with {sup 32}P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10{sup 6} DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10{sup 7} or 1.2 x 10{sup 7} DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the {sup 32}P-labeled derivative of the reaction product of 7{beta}, 8{alpha}-dihydroxy-9{alpha}, 10{alpha}-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N{sup 2} of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs.

  3. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by 32P-postlabeling

    International Nuclear Information System (INIS)

    Randerath, E.; Zhou, G.D.; Donnelly, K.C.; Safe, S.H.; Randerath, K.

    1996-01-01

    In the present study, a mouse bioassay was used in combination with 32 P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10 6 DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10 7 or 1.2 x 10 7 DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the 32 P-labeled derivative of the reaction product of 7β, 8α-dihydroxy-9α, 10α-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N 2 of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs

  4. Radioprotective effect of methanolic root extract of Loeseneriella arnottiana on radiation induced DNA damage in human lymphocytes in vitro

    International Nuclear Information System (INIS)

    Prajna, P.S.

    2012-01-01

    Intense exposure to ionization radiation by accidental, occupational or therapeutical purpose causes cellular damage mainly by formation of excessive reactive oxygen species (ROS) or by free radicals. Humans are intentionally exposed to ionising radiation for diagnostic or therapeutic purposes. The use of ionising radiation in cancer therapy may lead to transient and/or permanent injury to normal tissues within the treatment field. To increase the therapeutic index of radiation therapy, various modes of radioprotection have been developed that selectively reduce cytotoxic effects to normal tissues. Because radiation-induced cellular damage is attributed primarily to the harmful effects of free radicals, molecules with radical scavenging properties are particularly promising as radioprotectors. Loeseneriella arnottiana, a member of family Hippocrateaceae, is a climbing shrub used by traditional medicine practitioners. To study the antioxidant activity and radioprotective effect of methanolic root extract of Loeseneriella arnottiana against electron beam radiation induced DNA damage in human lymphocytes. Loeseneriella arnottiana roots were dried and extracted using methanol by solvent extraction method. Antioxidant activity was measured by DPPH method. DNA damage was assessed by comet assay parameters. The lymphocytes were incubated for one hour with two different concentrations 10 μg and 50 μg of root extract before exposure to 2 Gy electron beam radiation. 30 μg of methanolic root extract of Loeseneriella arnottiana exhibited 96% radical scavenging activity comparable to 15 μg of ascorbic acid. In reducing power assay it showed dose dependent increase in absorbance indicating that extract is capable of donating hydrogen atoms. Pretreatment of lymphocytes with 10 μg and 50 μg of root extract before irradiation resulted in reduction in the Comet length, Olive tail moment, percentage of DNA in tail when compared to the radiation control group. Results of this

  5. Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

    Science.gov (United States)

    Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

    2017-01-01

    Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

  6. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    Science.gov (United States)

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  7. Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2016-10-01

    Full Text Available The spore-forming microbiota is mainly responsible for the deterioration of pasteurized milk with long shelf life in the United States. The identification of these microorganisms, using molecular tools, is of particular importance for the maintenance of the quality of milk. However, these molecular techniques are not only costly but also labor-intensive and time-consuming. The aim of this study was to compare the efficiency of boiling in conjunction with four other methods for the genomic DNA extraction of sporulated bacteria with proteolytic and lipolytic potential isolated from raw milk in the states of Paraná and Maranhão, Brazil. Protocols based on cellular lysis by enzymatic digestion, phenolic extraction, microwave-heating, as well as the use of guanidine isothiocyanate were used. This study proposes a method involving simple boiling for the extraction of genomic DNA from these microorganisms. Variations in the quality and yield of the extracted DNA among these methods were observed. However, both the cell lysis protocol by enzymatic digestion (commercial kit and the simple boiling method proposed in this study yielded sufficient DNA for successfully carrying out the Polymerase Chain Reaction (PCR of the rpoB and 16S rRNA genes for all 11 strains of microorganisms tested. Other protocols failed to yield sufficient quantity and quality of DNA from all microorganisms tested, since only a few strains have showed positive results by PCR, thereby hindering the search for new microorganisms. Thus, the simple boiling method for DNA extraction from sporulated bacteria in spoiled milk showed the same efficacy as that of the commercial kit. Moreover, the method is inexpensive, easy to perform, and much less time-consuming.

  8. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    Science.gov (United States)

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  9. Comparison of four DNA extraction methods for the detection of Mycobacterium leprae from Ziehl-Neelsen-stained microscopic slides.

    Science.gov (United States)

    Ruiz-Fuentes, Jenny Laura; Díaz, Alexis; Entenza, Anayma Elena; Frión, Yahima; Suárez, Odelaisy; Torres, Pedro; de Armas, Yaxsier; Acosta, Lucrecia

    2015-12-01

    The diagnosis of leprosy has been a challenge due to the low sensibility of the conventional methods and the impossibility of culturing the causative organism. In this study, four methods for Mycobacterium leprae nucleic-acid extraction from Ziehl-Neelsen-stained slides (ZNS slides) were compared: Phenol/chloroform, Chelex 100 resin, and two commercial kits (Wizard Genomic DNA Purification Kit and QIAamp DNA Mini Kit). DNA was extracted from four groups of slides: a high-codification-slide group (bacteriological index [BI]⩾4), a low-codification-slide group (BI=1), a negative-slide group (BI=0), and a negative-control-slide group (BI=0). Quality DNA was evidenced by the amplification of specific repetitive element present in M. leprae genomic DNA (RLEP) using a nested polymerase chain reaction. This is the first report comparing four different extraction methods for obtaining M. leprae DNA from ZNS slides in Cuban patients, and applied in molecular diagnosis. Good-quality DNA and positive amplification were detected in the high-codification-slide group with the four methods, while from the low-codification-slide group only the QIAGEN and phenol-chloroform methods obtained amplification of M. leprae. In the negative-slide group, only the QIAGEN method was able to obtain DNA with sufficient quality for positive amplification of the RLEP region. No amplification was observed in the negative-control-slide group by any method. Patients with ZNS negative slides can still transmit the infection, and molecular methods can help identify and treat them, interrupting the chain of transmission and preventing the onset of disabilities. The ZNS slides can be sent easily to reference laboratories for later molecular analysis that can be useful not only to improve the diagnosis, but also for the application of other molecular techniques. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  10. A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

    Science.gov (United States)

    Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

    2015-08-01

    Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.

  11. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

    2014-01-01

    Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

  12. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods.

    Science.gov (United States)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N; Hoflund, Anders; Mogensen, Helle S; Hansen, Anders J; Morling, Niels

    2013-05-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors that may be co-extracted with the DNA. Using 120 forensic trace evidence samples consisting of various types of fabric, we compared three automated DNA extraction methods based on magnetic beads (PrepFiler Express Forensic DNA Extraction Kit on an AutoMate Express, QIAsyphony DNA Investigator kit either with the sample pre-treatment recommended by Qiagen or an in-house optimized sample pre-treatment on a QIAsymphony SP) and one manual method (Chelex) with the aim of reducing the amount of PCR inhibitors in the DNA extracts and increasing the proportion of reportable STR-profiles. A total of 480 samples were processed. The highest DNA recovery was obtained with the PrepFiler Express kit on an AutoMate Express while the lowest DNA recovery was obtained using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen. Extraction using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen resulted in the lowest percentage of PCR inhibition (0%) while extraction using manual Chelex resulted in the highest percentage of PCR inhibition (51%). The largest number of reportable STR-profiles was obtained with DNA from samples extracted with the PrepFiler Express kit (75%) while the lowest number was obtained with DNA from samples extracted using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen (41%). Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  14. Assessment of age and greenness of herbarium specimens as predictors for successful extraction and amplification of DNA

    NARCIS (Netherlands)

    Erkens, R.H.J.; Cross, H.; Maas, J.W.; Hoenselaar, K.; Chatrou, L.W.

    2008-01-01

    Age and the greenness of leaves have been frequently used as indicators for selecting herbarium specimens for molecular studies. Although plant DNA extraction and amplification have been common lab procedures for the past 20 years, no studies specifically investigated the success of these

  15. Evaluation of Antioxidant and DNA Damage Protection Activity of the Hydroalcoholic Extract of Desmostachya bipinnata L. Stapf

    Directory of Open Access Journals (Sweden)

    Upendarrao Golla

    2014-01-01

    Full Text Available Desmostachya bipinnata Stapf (Poaceae/Gramineae is an official drug of ayurvedic pharmacopoeia. Various parts of this plant were used extensively in traditional and folklore medicine to cure various human ailments. The present study was aimed to evaluate the antioxidant and DNA damage protection activity of hydroalcoholic extract of Desmostachya bipinnata both in vitro and in vivo, to provide scientific basis for traditional usage of this plant. The extract showed significant antioxidant activity in a dose-dependent manner with an IC50 value of 264.18±3.47 μg/mL in H2O2 scavenging assay and prevented the oxidative damage to DNA in presence of DNA damaging agent (Fenton’s reagent at a concentration of 50 μg/mL. Also, the presence of extract protected yeast cells in a dose-dependent manner against DNA damaging agent (Hydroxyurea in spot assay. Moreover, the presence of extract exhibited significant antioxidant activity in vivo by protecting yeast cells against oxidative stressing agent (H2O2. Altogether, the results of current study revealed that Desmostachya bipinnata is a potential source of antioxidants and lends pharmacological credence to the ethnomedical use of this plant in traditional system of medicine, justifying its therapeutic application for free-radical-induced diseases.

  16. DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products.

    Science.gov (United States)

    Turkec, Aydin; Kazan, Hande; Karacanli, Burçin; Lucas, Stuart J

    2015-08-01

    In this paper, DNA extraction methods have been evaluated to detect the presence of genetically modified organisms (GMOs) in maize food and feed products commercialised in Turkey. All the extraction methods tested performed well for the majority of maize foods and feed products analysed. However, the highest DNA content was achieved by the Wizard, Genespin or the CTAB method, all of which produced optimal DNA yield and purity for different maize food and feed products. The samples were then screened for the presence of GM elements, along with certified reference materials. Of the food and feed samples, 8 % tested positive for the presence of one GM element (NOS terminator), of which half (4 % of the total) also contained a second element (the Cauliflower Mosaic Virus 35S promoter). The results obtained herein clearly demonstrate the presence of GM maize in the Turkish market, and that the Foodproof GMO Screening Kit provides reliable screening of maize food and feed products.

  17. Co-isolation of in vivo 32P-labeled specific transcripts and DNA without phenol extraction of nuclease digestion

    International Nuclear Information System (INIS)

    Hayes, S.; Hayes, C.; Brand, L.

    1981-01-01

    A method is described for isolation and quantitation of specific intact transcripts, for which a hybridization probe is available, from 32 P-labeled bacterial cells. The RNA is extracted in the absence of R Nase activity by incorporating an inert, physically removable R Nase inhibitor throughout the spheroplasting, cell lysis, and pronase digestion steps. [/sup 32/P]RNA is separated from [ 32 P]DNA, without recourse to phenol extraction of DNase treatment, on a Cs 2 SO/sub 4-/HCONH 2 step gradient in which the precipitated RNA forms a sharp band. Specific transcripts are purified from [ 32 P]RNA by physical separation of the transcript and hybridization probe using gel-exclusion chromatography. The gentleness of this technique enables the co-isolation of DNA and can facilitate the analysis of covalently joined RNA-DNA replication intermediates

  18. A device for extraction, manipulation and stretching of DNA from single human chromosomes

    DEFF Research Database (Denmark)

    Rasmussen, Kristian Hagsted; Marie, Rodolphe; Moresco, Jacob Lange

    2011-01-01

    by time-lapse imaging; pressure-driven flow was then used to shunt the chromosomal DNA package into a nanoslit. A long linear DNA strand (>1.3 Mbp) was seen to stretch out from the DNA package and along the length of the nanoslit. Delivery of DNA in its native metaphase chromosome package as well...

  19. A new protocol for extraction of C 0 t-1 DNA from rice | Yan | African ...

    African Journals Online (AJOL)

    C0t-1 DNA, enriched for repetitive DNA sequences, has been proved to be valuable in the studies of plant species differentiation and genome evolution. A new protocol to steadily obtain the aimed range of DNA fragments has been developed by shearing the genomic DNA with the digest system containing DNase ...

  20. Use of Moringa oleifera Flower Pod Extract as Natural Preservative and Development of SCAR Marker for Its DNA Based Identification.

    Science.gov (United States)

    Gull, Iram; Javed, Attia; Aslam, Muhammad Shahbaz; Mushtaq, Roohi; Athar, Muhammad Amin

    2016-01-01

    The use of Moringa oleifera as natural food preservative has been evaluated in the present study. In addition, for quality assurance, the study has also been focused on the shelf life of product to authenticate the identification of plant by development of DNA based marker. Among the different extracts prepared from flower pods of Moringa oleifera, methanol and aqueous extract exhibited high antibacterial and antioxidant activity, respectively. The high phenolic contents (53.5 ± 0.169 mg GAE/g) and flavonoid contents (10.9 ± 0.094 mg QE/g) were also recorded in methanol and aqueous extract, respectively. Due to instability of bioactive compounds in aqueous extract, methanol extract is considered as potent natural preservative. The shelf life of methanol extract was observed for two months at 4°C under dark conditions. The developed SCAR primers (MOF217/317/MOR317) specifically amplified a fragment of 317 bp from DNA of Moringa oleifera samples collected from different regions of Punjab province of Pakistan. The methanol extract of Moringa oleifera flower pods has great potential to be used as natural preservative and nutraceutical in food industry.

  1. Genotoxic Evaluation of Mikania laevigata Extract on DNA Damage Caused by Acute Coal Dust Exposure

    Energy Technology Data Exchange (ETDEWEB)

    Freitas, T.P.; Heuser, V.D.; Tavares, P.; Leffa, D.D.; da Silva, G.A.; Citadini-Zanette, V.; Romao, P.R.T.; Pinho, R.A.; Streck, E.L.; Andrade,V.M. [University of Extremo Catarinense, Criciuma, SC (Brazil)

    2009-06-15

    We report data on the possible antigenotoxic activity of Mikania laevigata extract (MLE) after acute intratracheal instillation of coal dust using the comet assay in peripheral blood, bone marrow, and liver cells and the micronucleus test in peripheral blood of Wistar rats. The animals were pretreated for 2 weeks with saline solution (groups 1 and 2) or MLE (100 mg/kg) (groups 3 and 4). On day 15, the animals were anesthetized with ketamine (80 mg/kg) and xylazine (20 mg/kg), and gross mineral coal dust (3 mg/0.3 mL saline) (groups 2 and 4) or saline solution (0.3 mL) (groups 1 and 3) was administered directly in the lung by intratracheal administration. Fifteen days after coal dust or saline instillation, the animals were sacrificed, and the femur, liver, and peripheral blood were removed. The results showed a general increase in the DNA damage values at 8 hours for all treatment groups, probably related to surgical procedures that had stressed the animals. Also, liver cells from rats treated with coal dust, pretreated or not with MLE, showed statistically higher comet assay values compared to the control group at 14 days after exposure. These results could be expected because the liver metabolizes a variety of organic compounds to more polar by-products. On the other hand, the micronucleus assay results did not show significant differences among groups. Therefore, our data do not support the antimutagenic activity of M. laevigata as a modulator of DNA damage after acute coal dust instillation.

  2. Application of thiopropyl sepharose 6B for removal of PCR inhibitors from DNA extracts of a thigh bone recovered from the sea

    DEFF Research Database (Denmark)

    Sørensen, Erik; Hansen, Steen Holger; Eriksen, Birthe

    2003-01-01

    for the removal of PCR inhibitors in DNA extracts originating from stains on clothing. Here we show that TS is efficient also for the removal of inhibitors from PCR extracts from a highly decomposed human thigh bone. TS treatment, however, leads to a substantial loss of DNA making the technique best suited when...

  3. Comparison of Methods of Extracting Salmonella enterica Serovar Enteritidis DNA from Environmental Substrates and Quantification of Organisms by Using a General Internal Procedural Control

    NARCIS (Netherlands)

    Klerks, M.M.; Bruggen, van A.H.C.; Zijlstra, C.; Donnikov, M.; Vos, de R.

    2006-01-01

    This paper compares five commercially available DNA extraction methods with respect to DNA extraction efficiency of Salmonella enterica serovar Enteritidis from soil, manure, and compost and uses an Escherichia coli strain harboring a plasmid expressing green fluorescent protein as a general

  4. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  5. The currently used commercial DNA-extraction methods give different results of clostridial and actinobacterial populations derived from human fecal samples.

    Science.gov (United States)

    Maukonen, Johanna; Simões, Catarina; Saarela, Maria

    2012-03-01

    Recently several human health-related microbiota studies have had partly contradictory results. As some differences may be explained by methodologies applied, we evaluated how different storage conditions and commonly used DNA-extraction kits affect bacterial composition, diversity, and numbers of human fecal microbiota. According to our results, the DNA-extraction did not affect the diversity, composition, or quantity of Bacteroides spp., whereas after a week's storage at -20 °C, the numbers of Bacteroides spp. were 1.6-2.5 log units lower (P Eubacterium rectale (Erec)-group, Clostridium leptum group, bifidobacteria, and Atopobium group were 0.5-4 log units higher (P < 0.05) after mechanical DNA-extraction as detected with qPCR, regardless of storage. Furthermore, the bacterial composition of Erec-group differed significantly after different DNA-extractions; after enzymatic DNA-extraction, the most prevalent genera detected were Roseburia (39% of clones) and Coprococcus (10%), whereas after mechanical DNA-extraction, the most prevalent genera were Blautia (30%), Coprococcus (13%), and Dorea (10%). According to our results, rigorous mechanical lysis enables detection of higher bacterial numbers and diversity from human fecal samples. As it was shown that the results of clostridial and actinobacterial populations are highly dependent on the DNA-extraction methods applied, the use of different DNA-extraction protocols may explain the contradictory results previously obtained. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. Oryza sativa (Rice) Hull Extract Inhibits Lipopolysaccharide-Induced Inflammatory Response in RAW264.7 Macrophages by Suppressing Extracellular Signal-regulated Kinase, c-Jun N-terminal Kinase, and Nuclear Factor-κB Activation.

    Science.gov (United States)

    Ha, Sang Keun; Sung, Jeehye; Choi, Inwook; Kim, Yoonsook

    2016-01-01

    Rice ( Oryza sativa ) is a major cereal crop in many Asian countries and an important staple food source. Rice hulls have been reported to possess antioxidant activities. In this study, we evaluated the antiinflammatory effects of rice hull extract and associated signal transduction mechanisms in lipopolysaccharide (LPS)-stimulated RAW 264.7 macrophages. We found that rice hull extract inhibited nitric oxide (NO) and prostaglandin E 2 by suppressing the expression of inducible NO synthase and cyclooxygenase-2, respectively. The release of interleukin-1β and tumor necrosis factor-α was also reduced in a dose-dependent manner. Furthermore, rice hull extract attenuated the activation of nuclear factor-kappa B (NF-κB), as well as the phosphorylation of mitogen-activated protein kinases, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK), in LPS-stimulated RAW264.7 cells. This suggests that rice hull extract decreases the production of inflammatory mediators by downregulating ERK and JNK and the NF-κB signal pathway in RAW 264.7 cells. Rice hull extract inhibits the lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages.Rice hull extract inhibited nitric oxide and prostaglandin E 2 by suppressing the expression of inducible NO synthase and cyclooxygenase-2, respectively.Rice hull extract exerted anti-inflammatory effect through inhibition of nuclear factor-kappa B, extracellular signal-regulated kinase and c-Jun N-terminal kinase signaling pathways.Rice hull extract may provide a potential therapeutic approach for inflammatory diseases. Abbreviations used: COX-2: cyclooxygenase-2, ERK: extracellular signal-regulated kinase, IκB: inhibitory kappa B, IL-1β: interleukin-1β, iNOS: inducible NO synthase, JNK: c-Jun N-terminal kinase, LPS: lipopolysaccharide, MAPKs: mitogen-activated protein kinases, NF-κB: nuclear factor-κB, NO: nitric oxide, PGE2: prostaglandin E2, RHE: rice hull extract, ROS: reactive oxygen species

  7. Extraction and Characterization of Extracellular Proteins and Their Post-Translational Modifications from Arabidopsis thaliana Suspension Cell Cultures and Seedlings: A Critical Review

    Directory of Open Access Journals (Sweden)

    Mina Ghahremani

    2016-09-01

    Full Text Available Proteins secreted by plant cells into the extracellular space, consisting of the cell wall, apoplastic fluid, and rhizosphere, play crucial roles during development, nutrient acquisition, and stress acclimation. However, isolating the full range of secreted proteins has proven difficult, and new strategies are constantly evolving to increase the number of proteins that can be detected and identified. In addition, the dynamic nature of the extracellular proteome presents the further challenge of identifying and characterizing the post-translational modifications (PTMs of secreted proteins, particularly glycosylation and phosphorylation. Such PTMs are common and important regulatory modifications of proteins, playing a key role in many biological processes. This review explores the most recent methods in isolating and characterizing the plant extracellular proteome with a focus on the model plant Arabidopsis thaliana, highlighting the current challenges yet to be overcome. Moreover, the crucial role of protein PTMs in cell wall signalling, development, and plant responses to biotic and abiotic stress is discussed.

  8. Low-Dose Ionizing Radiation Affects Mesenchymal Stem Cells via Extracellular Oxidized Cell-Free DNA: A Possible Mediator of Bystander Effect and Adaptive Response

    Directory of Open Access Journals (Sweden)

    V. A. Sergeeva

    2017-01-01

    Full Text Available We have hypothesized that the adaptive response to low doses of ionizing radiation (IR is mediated by oxidized cell-free DNA (cfDNA fragments. Here, we summarize our experimental evidence for this model. Studies involving measurements of ROS, expression of the NOX (superoxide radical production, induction of apoptosis and DNA double-strand breaks, antiapoptotic gene expression and cell cycle inhibition confirm this hypothesis. We have demonstrated that treatment of mesenchymal stem cells (MSCs with low doses of IR (10 cGy leads to cell death of part of cell population and release of oxidized cfDNA. cfDNA has the ability to penetrate into the cytoplasm of other cells. Oxidized cfDNA, like low doses of IR, induces oxidative stress, ROS production, ROS-induced oxidative modifications of nuclear DNA, DNA breaks, arrest of the cell cycle, activation of DNA reparation and antioxidant response, and inhibition of apoptosis. The MSCs pretreated with low dose of irradiation or oxidized cfDNA were equally effective in induction of adaptive response to challenge further dose of radiation. Our studies suggest that oxidized cfDNA is a signaling molecule in the stress signaling that mediates radiation-induced bystander effects and that it is an important component of the development of radioadaptive responses to low doses of IR.

  9. New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

    Science.gov (United States)

    Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

    2011-09-01

    Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

  10. A simple and cost-effective method of DNA extraction from small formalin-fixed paraffin-embedded tissue for molecular oncologic testing.

    Science.gov (United States)

    Snow, Anthony N; Stence, Aaron A; Pruessner, Jonathan A; Bossler, Aaron D; Ma, Deqin

    2014-01-01

    Extraction of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue is a critical step in molecular oncologic testing. As molecular oncology testing becomes more important for prognostic and therapeutic decision making and tissue specimens become smaller due to earlier detection of suspicious lesions and the use of fine needle aspiration methods for tissue collection, it becomes more challenging for the typical molecular pathology laboratory to obtain reliable test results. We developed a DNA extraction method to obtain sufficient quantity and high quality genomic DNA from limited FFPE tissue for molecular oncology testing using a combination of H&E stained slides, a matrix capture method and the Qiagen DNA column. THREE DNA EXTRACTION METHODS WERE COMPARED: our standard procedure of manually scraping tissue from unstained slides followed by DNA extraction using the QIAamp FFPE column (Qiagen, Valencia, CA), a glue capture method (Pinpoint Solution, Zymo Research Corp, Inc) on H&E stained slides followed by DNA extraction using either the QIAamp column or the column included with the Pinpoint kit (Zymo Research). The DNA extraction protocol was optimized. Statistical analysis was performed using the paired two-sample student's t-test. The combination of the matrix capture method with the QIAamp column gave an equivalent amount of DNA as our standard extraction method using the unstained slides and a 4.6-fold higher DNA yield than using the Zymo column included in the Pinpoint Slide Solution kit. Several molecular tests were performed and DNA purified using the new method gave the same results as for the previous methods. Using H&E stained slides allows visual confirmation of tumor cells during microdissection. The Pinpoint solution made removal of specific tissue from the slides easier and reduced the risk of contamination and tissue loss. This DNA extraction method is simple, cost-effective, and blends with our current workflow requiring no additional equipment.

  11. Transcriptional effect of an Aframomum angustifolium seed extract on human cutaneous cells using low-density DNA chips.

    Science.gov (United States)

    Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin

    2007-06-01

    Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.

  12. Protective effects of aqueous and ethanolic extracts of Portulaca oleracea L. aerial parts on H2O2-induced DNA damage in lymphocytes by comet assay.

    Science.gov (United States)

    Behravan, Javad; Mosafa, Fatemeh; Soudmand, Negar; Taghiabadi, Elahe; Razavi, Bibi Marjan; Karimi, Gholamreza

    2011-09-01

    The comet assay is a standard method for measuring DNA damage. In this study, the protective effects of ethanolic and aqueous extracts of Portulaca oleracea L. (P. oleracea) on human lymphocyte DNA lesions were evaluated with the comet assay. Lymphocytes were isolated from blood samples taken from healthy volunteers. Human lymphocytes were incubated in H(2)O(2) (50,100, and 200 μM), aqueous extract (0.05, 0.1, 0.5, 1, and 2.5mg/ml), and ethanolic extracts (0.05, 0.1, 0.5, 1, and 2.5mg/ml) of P. oleraceae aerial parts alone with a combination of H(2)O(2) (100 μM) with either 1 or 2.5mg/ml of both extracts at 4°C for 30 minutes. The extent of DNA migration was measured using the alkaline single cell gel electrophoresis approach assay, and DNA damage was expressed as percentage tail DNA. We found that the aqueous extract of P. oleracea significantly inhibited DNA damage, while there was no effect of the ethanolic extract. These data suggest that the aqueous extract of P. oleracea can prevent oxidative DNA damage to human lymphocytes, which is likely due to antioxidant constituents in the extract. Copyright © 2011. Published by Elsevier B.V.

  13. Radioprotection against DNA damage by an extract of Indian green mussel, Perna viridis (L.)

    Digital Repository Service at National Institute of Oceanography (India)

    Kumaran, S.P.; Kutty, B.C.; Chatterji, A.; Parameswaran, P.S.; Mishra, K.P.

    -irradiation Prevention of DNA damage both in plasmid and lymphocytes and cell death in lymphocytes appears correlated with reduction of oxidatively generated free radicals It is concluded that protection against radiation-induced cell death and DNA damage by MH...

  14. Myricitrin and bioactive extract of Albizia amara leaves: DNA protection and modulation of fertility and antioxidant-related genes expression.

    Science.gov (United States)

    Kassem, Mona El Said; Ibrahim, Lamya Fawzy; Hussein, Sameh Reda; El-Sharawy, Reham; El-Ansari, Mohamed Amin; Hassanane, Mahrousa Mohamed; Booles, Hoda Fahime

    2016-11-01

    Albizia species are reported to exhibit many biological activities including antiovulatory properties in female rats and antispermatogenic and antiandrogenic activities in male rats. The present study investigates the flavonoids of Albizia amara (Roxb.) B. Boivin (Fabaceae) leaves and evaluates their activity on gene expression of fertility and antioxidant glutathione-S-transferase-related genes of treated female mice in addition to their effect on DNA damage. Plant materials were extracted by using 70% methanol for 48 h, the extract was chromatographed on a polyamide 6S column, each isolated compound was purified by using Sephadex LH-20 column; its structure was elucidated by chemical and spectral methods. Both the leaves extract and myricitrin (200, 30 mg/kg bw/d, respectively) were assayed for their effect on DNA damage in female mice after four weeks treatment using Comet assay. Their modulatory activity on gene expression of fertility (aromatase CYP19 and luteinizing hormone LH) and antioxidant glutathione-S-transferase (GST)-related genes of treated female mice were investigated by real-time PCR (qPCR). Quercetin-3-O-gentiobioside, myricitrin, quercetin-3-O-α-rhamnopyranoside, myricetin, quercetin and kaempferol were isolated and identified from the studied taxa. Myricitrin and the extract induced low rate of DNA damage (4.8% and 5%, respectively), compared with the untreated control (4.2%) and significantly down-regulated the expression of CYP19 and LH genes and up-regulated GST gene. Our results highlight the potential effect of the leaves extract of Albizia amara and myricitrin as fertility-regulating phytoconstituents with ability to protect DNA from damage and cells from oxidative stress.

  15. Validating DNA barcodes: A non-destructive extraction protocol enables simultaneous vouchering of DNA and morphological vouchers

    Science.gov (United States)

    Morphology-based keys support accurate identification of many taxa. However, identification can be difficult for taxa that are not well studied, very small, members of cryptic species complexes, or represented by immature stages. For such cases, DNA barcodes may provide diagnostic characters. Ecolog...

  16. Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

    Science.gov (United States)

    Konakandla, Bhanu; Park, Yoonseong; Margolies, David

    2006-01-01

    We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

  17. Design of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates

    Directory of Open Access Journals (Sweden)

    Michele E Murphy

    2016-01-01

    Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.

  18. A sensitive method to extract DNA from biological traces present on ammunition for the purpose of genetic profiling.

    Science.gov (United States)

    Dieltjes, Patrick; Mieremet, René; Zuniga, Sofia; Kraaijenbrink, Thirsa; Pijpe, Jeroen; de Knijff, Peter

    2011-07-01

    Exploring technological limits is a common practice in forensic DNA research. Reliable genetic profiling based on only a few cells isolated from trace material retrieved from a crime scene is nowadays more and more the rule rather than the exception. On many crime scenes, cartridges, bullets, and casings (jointly abbreviated as CBCs) are regularly found, and even after firing, these potentially carry trace amounts of biological material. Since 2003, the Forensic Laboratory for DNA Research is routinely involved in the forensic investigation of CBCs in the Netherlands. Reliable DNA profiles were frequently obtained from CBCs and used to match suspects, victims, or other crime scene-related DNA traces. In this paper, we describe the sensitive method developed by us to extract DNA from CBCs. Using PCR-based genotyping of autosomal short tandem repeats, we were able to obtain reliable and reproducible DNA profiles in 163 out of 616 criminal cases (26.5%) and in 283 out of 4,085 individual CBC items (6.9%) during the period January 2003-December 2009. We discuss practical aspects of the method and the sometimes unexpected effects of using cell lysis buffer on the subsequent investigation of striation patterns on CBCs.

  19. Antioxidant, cytotoxic and DNA protective properties of Achillea eriophora DC. and Achillea biebersteinii Afan. extracts: A comparative study

    Directory of Open Access Journals (Sweden)

    Maryam Varasteh-kojourian

    2017-02-01

    Full Text Available Objective: Achillea is a traditional medicinal herb which contains different phenol and flavonoid compounds that are responsible for Achillea pharmacological effects. We aimed to determine phenol and flavonoid contents, besides antioxidant activities of different extracts from Achillea eriophoraa (A. eriophora DC. and Achillea biebersteinii (A. biebersteinii Afan. (endemic species in Iran and to investigate their effects on human cells.Materials and Methods: Achillea extracts, were prepared by maceration and shaking methods, from different parts (aerial parts, stem, leaves and inflorescence of two species using methanol and ethanol as solvents. Total phenol and flavonoid contents were measured by spectrophotometry, and antioxidant activities of the extracts were determined by DPPH radical scavenging, BCB and TBARS assays. Cytotoxicity and antioxidant activities of the extracts were investigated in Human Foreskin Fibroblast (HFF3 cells using MTT, comet and H2O2 assays.Results: Methanol extracts of A. biebersteinii prepared from leaves and inflorescence by maceration method exhibited maximum phenol (1657.58 ± 36.45 mg GAE/100 g DW and flavonoid (264.00 ± 62.16 mg QUE/100 g DW contents. Leaf methanol extract showed significantly higher antioxidant activity (0.0276 ± 0.003, 0.16 ± 0.016 and 13.96 ± 0.26 mg/ml for DPPH, BCB and TBARS IC50s, respectively than those of the other extracts. Leaf extract of A. biebersteinii was not cytotoxic even at the highest examined dose (512 µg/ml and inhibited cell toxicity induced by H2O2 (98% viability for the cells pretreated with plant extract in the presence of H2O2. Comet assay also confirmed high DNA protective activity of leaf extracts.Conclusion: Achillea extracts possess remarkable antioxidant activity, and could be good natural alternatives to synthetic antioxidants in pharmaceutical and food industries.

  20. sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis‐dependent release of eDNA

    DEFF Research Database (Denmark)

    Christner, Martin; Heinze, Constanze; Busch, Michael

    2012-01-01

    to biofilm formation in mutant 1585ΔsarA. Increased eDNA amounts indirectly resulted from upregulation of metalloprotease SepA, leading to boosted processing of autolysin AtlE, in turn inducing augmented autolysis and release of eDNA. Hence, this study identifies sarA as a negative regulator of Embp‐ and e...

  1. DNA adducts and oxidative DNA damage induced by organic extracts from PM2.5 in an acellular assay

    Czech Academy of Sciences Publication Activity Database

    Topinka, Jan; Rössner ml., Pavel; Milcová, Alena; Schmuczerová, Jana; Švecová, Vlasta; Šrám, Radim

    2011-01-01

    Roč. 202, č. 3 (2011), s. 186-192 ISSN 0378-4274 R&D Projects: GA MŠk 2B08005; GA MŽP(CZ) SP/1B3/8/08 Institutional research plan: CEZ:AV0Z50390512 Keywords : air pollution * genotoxicity * DNA adducts Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.230, year: 2011

  2. Antioxidant and DNA damage protective properties of anthocyanin-rich extracts from Hibiscus and Ocimum: a comparative study.

    Science.gov (United States)

    Sarkar, Biswatrish; Kumar, Dhananjay; Sasmal, Dinakar; Mukhopadhyay, Kunal

    2014-01-01

    Anthocyanin extracts (AEs) from Ocimum tenuiflorum (leaf), Hibiscus rosa-sinensis (petal) and Hibiscus sabdariffa (calyx) were investigated and compared for in vitro antioxidant activity and DNA damage protective property. Total phenolic content (TPC) and total anthocyanin content (TAC) of the AEs were determined and the major anthocyanins were characterised. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay, 2,2-diphenyl-1-picryl hydrazyl (DPPH) radical-scavenging activity, 2-deoxy-D-ribose degradation assay and lipid peroxidation assay. The protective property of the AEs was also examined against oxidative DNA damage by H2O2 and UV using pUC19 plasmid. All the AEs particularly those from O. tenuiflorum demonstrated efficient antioxidant activity and protected DNA from damage. Strong correlation between antioxidant capacity and TPC and TAC was observed. Significant correlation between antioxidant capacity and TPC and TAC ascertained that phenolics and anthocyanins were the major contributors of antioxidant activity.

  3. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

    Science.gov (United States)

    Yang, Qi; Franco, Christopher M M; Zhang, Wei

    2015-10-01

    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

  4. DNA Protecting Activities of Nymphaea nouchali (Burm. f Flower Extract Attenuate t-BHP-Induced Oxidative Stress Cell Death through Nrf2-Mediated Induction of Heme Oxygenase-1 Expression by Activating MAP-Kinases

    Directory of Open Access Journals (Sweden)

    Md Badrul Alam

    2017-09-01

    Full Text Available This study was performed to investigate the antioxidant activities of Nymphaea nouchali flower (NNF extract and the underlying mechanism using RAW 264.7 cells. The presence of gallic acid, catechin, epicatechin, epigallocatechin, epicatechin gallate, caffeic acid, quercetin, and apigenin in the NNF was confirmed by high-performance liquid chromatography (HPLC. The extract had a very potent capacity to scavenge numerous free radicals. NNF extract was also able to prevent DNA damage and quench cellular reactive oxygen species (ROS generation induced by tert-Butyl hydroperoxide (t-BHP with no signs of toxicity. The NNF extract was able to augment the expression of both primary and phase II detoxifying enzyme, resulting in combat the oxidative stress. This is accomplished by phosphorylation of mitogen-activated protein kinase (MAP kinase (p38 kinase and extracellular signal-regulated kinase (ERK followed by enhancing the nuclear translocation of the nuclear factor erythroid 2-related factor 2 (Nrf2. This attenuates cellular ROS generation and confers protection from cell death. Altogether, the results of current study revealed that Nymphaea nouchali flower could be a source of natural phytochemicals that could lead to the development of new therapeutic agents for preventing oxidative stress associated diseases and attenuating disease progression.

  5. Transfection with extracellularly UV-damaged DNA induces human and rat cells to express a mutator phenotype towards parvovirus H-1

    International Nuclear Information System (INIS)

    Dinsart, C.; Cornelis, J.J.; Klein, B.; van der Eb, A.J.; Rommelaere, J.

    1984-01-01

    Human and rat cells transfected with UV-irradiated linear double-stranded DNA from calf thymus displayed a mutator activity. This phenotype was identified by growing a lytic thermosensitive single-stranded DNA virus (parvovirus H-1) in those cells and determining viral reversion frequencies. Likewise, exogenous UV-irradiated closed circular DNAs, either double-stranded (simian virus 40) or single-stranded (phi X174), enhanced the ability of recipient cells to mutate parvovirus H-1. The magnitude of mutator activity expression increased along with the number of UV lesions present in the inoculated DNA up to a saturation level. Unirradiated DNA displayed little inducing capacity, irrespective of whether it was single or double stranded. Deprivation of a functional replication origin did not impede UV-irradiated simian virus 40 DNA from providing rat and human cells with a mutator function. Our data suggest that in mammalian cells a trans-acting mutagenic signal might be generated from UV-irradiated DNA without the necessity for damaged DNA to replicate

  6. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food.

    Science.gov (United States)

    Pacheco Coello, Ricardo; Pestana Justo, Jorge; Factos Mendoza, Andrés; Santos Ordoñez, Efrén

    2017-12-20

    In Ecuador, food products need to be labeled if exceeded 0.9% of transgenic content in whole products. For the detection of genetically modified organisms (GMOs), three DNA extraction methods were tested in 35 food products commercialized in Ecuador. Samples with positive amplification of endogenous genes were screened for the presence of the Cauliflower mosaic virus 35S-promoter (P35S) and the nopaline synthase-terminator (Tnos). TaqMan™ probes were used for determination of transgenic content of the GTS 40-3-2 and MON810 events through quantitative PCR (qPCR). Twenty-six processed food samples were positive for the P35S alone and eight samples for the Tnos and P35S. Absolute qPCR results indicated that eleven samples were positive for GTS 40-3-2 specific event and two for MON810 specific event. A total of nine samples for events GTS 40-3-2 and MON810 exceeded the umbral allowed of transgenic content in the whole food product with the specific events. Different food products may require different DNA extraction protocols for GMO detection through PCR. Among the three methods tested, the DNeasy mericon food kit DNA extraction method obtained higher proportion of amplified endogenous genes through PCR. Finally, event-specific GMOs were detected in food products in Ecuador.

  7. Automated Extraction of Genomic DNA from Medically Important Yeast Species and Filamentous Fungi by Using the MagNA Pure LC System

    OpenAIRE

    Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

    2002-01-01

    A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (105 to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sen...

  8. Action of an ionizing radiation and hydrodynamic effect on matrix properties of DNA during extracellular synthesis of RNA, and thiophosphate protection of matrix properties of T2-DNA against. gamma. -radiation. [gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Shekhtman, Ya L; Domashenko, A D; Kamzolova, S G; Medvedkov, A A [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki

    1976-05-01

    Action of an ionizing radiation and the hydrodynamic effect of the matrix activity of thymus DNA and T2 phase DNA have been studied in vitro in the RNA: polymerase system of E.coli B. Also studied have been the thiophosphate protection of matrix properties of T2-DNA against ..gamma..-radiation.

  9. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  11. Automated extraction of DNA from reference samples from various types of biological materials on the Qiagen BioRobot EZ1 Workstation

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Jørgensen, Mads; Hansen, Anders Johannes

    2009-01-01

    , and muscle biopsies. The DNA extraction was validated according to EN/ISO 17025 for the STR kits AmpFlSTR« Identifiler« and AmpFlSTR« Yfiler« (Applied Biosystems). Of 298 samples extracted, 11 (4%) did not yield acceptable results. In conclusion, we have demonstrated that extraction of DNA from various types......We have validated and implemented a protocol for DNA extraction from various types of biological materials using a Qiagen BioRobot EZ1 Workstation. The sample materials included whole blood, blood from deceased, buccal cells on Omni swabs and FTA Cards, blood on FTA Cards and cotton swabs...... of biological material can be performed quickly and without the use of hazardous chemicals, and that the DNA may be successfully STR typed according to the requirements of forensic genetic investigations accredited according to EN/ISO 17025...

  12. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    OpenAIRE

    Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

    2016-01-01

    Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

  13. Extracting DNA from 'jaws': High yield and quality from archived tiger shark (Galeocerdo cuvier) skeletal material

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Morgan, J. A T; Maher, S. L.

    2017-01-01

    of tiger sharks (Galeocerdo cuvier). Protocols were compared for DNA yield and quality using a qPCR approach. For jaw swarf, all methods provided relatively high DNA yield and quality, while large differences in yield between protocols were observed for vertebrae. Similar results were obtained from samples...... observed, likely reflecting different preparation and storage methods for the trophies. Trial sequencing of DNA capture genomic libraries using 20 000 baits revealed that a significant proportion of captured sequences were derived from tiger sharks. This study demonstrates that archived shark jaws...

  14. Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

    Science.gov (United States)

    Moon, Myungjin; Nakai, Kenta

    2018-04-01

    Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

  15. Observing dynamics of chromatin fibers in Xenopus egg extracts by single DNA manipulation using a transverse magnetic tweezer setup

    Science.gov (United States)

    Yan, Jie; Skoko, Dunja; Marko, John; Maresca, Tom; Heald, Rebecca

    2005-03-01

    We have studied assembly of chromatin on single DNAs using Xenopus egg extracts and a specially designed magnetic tweezer setup which generates controlled force in the focal plane of the objective, allowing us to visualize and measure DNA extension under a wide range of constant tensions. We found, in the absence of ATP, interphase extracts assembled nucleosomes against DNA tensions of up to 3.5 piconewtons (pN). We observed force-induced disassembly and opening-closing fluctuations indicating our experiments were in mechano-chemical equilibrium. We found that the ATP-depleted reaction can do mechanical work of 27 kcal/mol per nucleosome, providing a measurement of the free energy difference between core histone octamers on and off DNA. Addition of ATP leads to highly dynamic behavior: time courses show processive runs of assembly and disassembly of not observed in the -ATP case, with forces of 2 pN leading to nearly complete fiber disassembly. Our study shows that ATP hydrolysis plays a major role in nucleosome rearrangement and removal, and suggests that chromatin in vivo may be subject to continual assembly and disassembly.

  16. Comparison of QIAsymphony automated and QIAamp manual DNA extraction systems for measuring Epstein-Barr virus DNA load in whole blood using real-time PCR.

    Science.gov (United States)

    Laus, Stella; Kingsley, Lawrence A; Green, Michael; Wadowsky, Robert M

    2011-11-01

    Automated and manual extraction systems have been used with real-time PCR for quantification of Epstein-Barr virus [human herpesvirus 4 (HHV-4)] DNA in whole blood, but few studies have evaluated relative performances. In the present study, the automated QIAsymphony and manual QIAamp extraction systems (Qiagen, Valencia, CA) were assessed using paired aliquots derived from clinical whole-blood specimens and an in-house, real-time PCR assay. The detection limits using the QIAsymphony and QIAamp systems were similar (270 and 560 copies/mL, respectively). For samples estimated as having ≥10,000 copies/mL, the intrarun and interrun variations were significantly lower using QIAsymphony (10.0% and 6.8%, respectively), compared with QIAamp (18.6% and 15.2%, respectively); for samples having ≤1000 copies/mL, the two variations ranged from 27.9% to 43.9% and were not significantly different between the two systems. Among 68 paired clinical samples, 48 pairs yielded viral loads ≥1000 copies/mL under both extraction systems. Although the logarithmic linear correlation from these positive samples was high (r(2) = 0.957), the values obtained using QIAsymphony were on average 0.2 log copies/mL higher than those obtained using QIAamp. Thus, the QIAsymphony and QIAamp systems provide similar EBV DNA load values in whole blood. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. Strategy for Extracting DNA from Clay Soil and Detecting a Specific Target Sequence via Selective Enrichment and Real-Time (Quantitative) PCR Amplification ▿

    Science.gov (United States)

    Yankson, Kweku K.; Steck, Todd R.

    2009-01-01

    We present a simple strategy for isolating and accurately enumerating target DNA from high-clay-content soils: desorption with buffers, an optional magnetic capture hybridization step, and quantitation via real-time PCR. With the developed technique, μg quantities of DNA were extracted from mg samples of pure kaolinite and a field clay soil. PMID:19633108

  18. Extraction of inhibitor-free metagenomic DNA from polluted sediments, compatible with molecular diversity analysis using adsorption and ion-exchange treatments.

    Science.gov (United States)

    Desai, Chirayu; Madamwar, Datta

    2007-03-01

    PCR inhibitor-free metagenomic DNA of high quality and high yield was extracted from highly polluted sediments using a simple remediation strategy of adsorption and ion-exchange chromatography. Extraction procedure was optimized with series of steps, which involved gentle mechanical lysis, treatment with powdered activated charcoal (PAC) and ion-exchange chromatography with amberlite resin. Quality of the extracted DNA for molecular diversity analysis was tested by amplifying bacterial 16S rDNA (16S rRNA gene) with eubacterial specific universal primers (8f and 1492r), cloning of the amplified 16S rDNA and ARDRA (amplified rDNA restriction analysis) of the 16S rDNA clones. The presence of discrete differences in ARDRA banding profiles provided evidence for expediency of the DNA extraction protocol in molecular diversity studies. A comparison of the optimized protocol with commercial Ultraclean Soil DNA isolation kit suggested that method described in this report would be more efficient in removing metallic and organic inhibitors, from polluted sediment samples.

  19. Extraction of Trypanosoma cruzi DNA from food: a contribution to the elucidation of acute Chagas disease outbreaks.

    Science.gov (United States)

    Ferreira, Renata Trotta Barroso; Melandre, Aline Martins; Cabral, Maria Luiza; Branquinho, Maria Regina; Cardarelli-Leite, Paola

    2016-04-01

    Before 2004, the occurrence of acute Chagas disease (ACD) by oral transmission associated with food was scarcely known or investigated. Originally sporadic and circumstantial, ACD occurrences have now become frequent in the Amazon region, with recently related outbreaks spreading to several Brazilian states. These cases are associated with the consumption of açai juice by waste reservoir animals or insect vectors infected with Trypanosoma cruzi in endemic areas. Although guidelines for processing the fruit to minimize contamination through microorganisms and parasites exist, açai-based products must be assessed for quality, for which the demand for appropriate methodologies must be met. Dilutions ranging from 5 to 1,000 T. cruzi CL Brener cells were mixed with 2mL of acai juice. Four Extraction of T. cruzi DNA methods were used on the fruit, and the cetyltrimethyl ammonium bromide (CTAB) method was selected according to JRC, 2005. DNA extraction by the CTAB method yielded satisfactory results with regard to purity and concentration for use in PCR. Overall, the methods employed proved that not only extraction efficiency but also high sensitivity in amplification was important. The method for T. cruzi detection in food is a powerful tool in the epidemiological investigation of outbreaks as it turns epidemiological evidence into supporting data that serve to confirm T. cruzi infection in the foods. It also facilitates food quality control and assessment of good manufacturing practices involving acai-based products.

  20. Extraction of Trypanosoma cruzi DNA from food: a contribution to the elucidation of acute Chagas disease outbreaks

    Directory of Open Access Journals (Sweden)

    Renata Trotta Barroso Ferreira

    2016-04-01

    Full Text Available Abstract: INTRODUCTION: Before 2004, the occurrence of acute Chagas disease (ACD by oral transmission associated with food was scarcely known or investigated. Originally sporadic and circumstantial, ACD occurrences have now become frequent in the Amazon region, with recently related outbreaks spreading to several Brazilian states. These cases are associated with the consumption of açai juice by waste reservoir animals or insect vectors infected with Trypanosoma cruzi in endemic areas. Although guidelines for processing the fruit to minimize contamination through microorganisms and parasites exist, açai-based products must be assessed for quality, for which the demand for appropriate methodologies must be met. METHODS: Dilutions ranging from 5 to 1,000 T. cruzi CL Brener cells were mixed with 2mL of acai juice. Four Extraction of T. cruzi DNA methods were used on the fruit, and the cetyltrimethyl ammonium bromide (CTAB method was selected according to JRC, 2005. RESULTS: DNA extraction by the CTAB method yielded satisfactory results with regard to purity and concentration for use in PCR. Overall, the methods employed proved that not only extraction efficiency but also high sensitivity in amplification was important. CONCLUSIONS: The method for T. cruzi detection in food is a powerful tool in the epidemiological investigation of outbreaks as it turns epidemiological evidence into supporting data that serve to confirm T. cruzi infection in the foods. It also facilitates food quality control and assessment of good manufacturing practices involving acai-based products.

  1. Isolation of high-quality DNA in 16 aromatic and medicinal Colombian species using silica-based extraction columns

    Directory of Open Access Journals (Sweden)

    Vega Vela Nelson Enrique

    2011-12-01

    Full Text Available

    Aromatic and medicinal plant species are a valuable resource for research and development of pharmaceutical, cosmetic, crop protection and nutritional agents, due to the high amount of bioactive phytochemicals that they contain. However, these compounds are a major obstacle in the isolation of high-quality DNA suitable for genetic analyses. In this paper, we report a protocol that optimizes the use of the cationic detergent CTAB and the reductant β-mercaptoethanol in cell lysis. The elimination of plant secondary metabolites such as polysaccharides and polyphenols, that typically co-isolate with DNA, was achieved using the chemical denaturing properties of the guanidinium cation, which together with the adsorbent chemical specificity of the silica, resulted in the purification of high-quality DNA suitable for digestion with restriction enzymes and optimal for PCR amplification of AFLP-type molecular markers. This protocol was evaluated on 16 Colombian aromatic and medicinal plant species promising for their essential oils. The results allow suggesting that this procedure might be appropriate for other species, tissues and sample types recalcitrant to DNA extraction.

  2. Characterization of DNA antigens from immune complexes deposited in the skin of patients with systemic lupus erythematosus

    Institute of Scientific and Technical Information of China (English)

    曾凡钦; 尹若菲; 谭国珍; 郭庆; 许德清

    2004-01-01

    Background Skin lesions are common manifestations in systemic lupus erythematosus (SLE). It is still unknown what the definite pathogenesis of skin involvement was and whether DNA participated in it. Our study was designed to explore the pathogenetic role and nature of nuclear antigen (DNA) deposited in the skin lesions of patients with SLE.Methods Thirty skin samples from patients with SLE and 2 normal skin samples were studied. Extracellular DNA was evaluated by indirect immunofluorescence methods. The deposited immune complexes were extracted by cryoprecipitation, and DNA was then isolated with phenol and chloroform. DNA fragment sizes were detected by agarose gel electrophoresis. Finally, 8 different probes were used to analyze the origin of these DNA molecules using Dot hybridization.Results Extracellular DNA staining was found only in skin lesions, mainly those located in the basement membrane zone, vascular wall, and hair follicle wall. Normal skin and non-lesion SLE skin showed no fluorescence at locations outside the nuclei. There were no differences in the rate and intensity of extracellular DNA staining when comparing active phase to remission phase patients. No relationship was found between extracellular DNA and circulating anti-dsDNA antibodies. Deposited DNA fragments clustered into four bands of somewhat discrete sizes: 20 000 bp, 1300 bp, 800-900 bp, 100-200 bp. Small sized fragments (100-200 bp) were positively correlated with disease activity (P<0.05, r=0.407). Dot hybridization showed significant homology of the various extracellular DNA fragments examined with human genomic DNA, but not with DNA from the microorganisms and viruses we examined. There were also homologies between DNA samples from different individuals.Conclusions DNA and its immune complexes may contribute to the pathogenesis of skin lesions in SLE. These DNA molecules range in size from 100 bp to 20 kb and may be endogenous in origin.

  3. Inhibition of iNOS and DNA Oxidation by Methanol Extract of ...

    African Journals Online (AJOL)

    Purpose: To investigate the antioxidant properties of the methanol extract of S. tenuifolia as well as its effect on inducible nitric oxide synthase (iNOS) and cycleooxygenase-2 (COX-2) expression in lipopolysaccharides (LPS)-induced cell damage in macrophage cells. Methods: The antioxidant activities of the plant extract ...

  4. Chamomile flower extract-directed CuO nanoparticle formation for its antioxidant and DNA cleavage properties

    Energy Technology Data Exchange (ETDEWEB)

    Duman, Fatih, E-mail: fduman@erciyes.edu.tr [Erciyes University, Science Faculty, Biology Department, Kayseri 38039, Kayseri (Turkey); Ocsoy, Ismail [Department of Analytical Chemistry, Faculty of Pharmacy, Erciyes University, 38039, Kayseri (Turkey); Erciyes University, Nanotechnology Research Center, 38039, Kayseri (Turkey); Kup, Fatma Ozturk [Erciyes University, Science Faculty, Biology Department, Kayseri 38039, Kayseri (Turkey)

    2016-03-01

    In this study, we report the synthesis of copper oxide nanoparticles (CuO NPs) using a medicinal plant (Matricaria chamomilla) flower extract as both reducing and capping agent and investigate their antioxidant activity and interaction with plasmid DNA (pBR322).The CuO NPs were characterized using Uv–Vis spectroscopy, FT-IR (Fourier transform infrared spectroscopy), DLS (dynamic light scattering), XRD (X-ray diffraction), EDX (energy-dispersive X-ray) spectroscopy and SEM (scanning electron microscopy). The CuO NPs exhibited nearly mono-distributed and spherical shapes with diameters of 140 nm size. UV–Vis absorption spectrum of CuO NPs gave a broad peak around 285 and 320 nm. The existence of functional groups on the surface of CuO NPs was characterized with FT-IR analysis. XRD pattern showed that the NPs are in the form of a face-centered cubic crystal. Zeta potential value was measured as − 20 mV due to the presence of negatively charged functional groups in plant extract. Additionally, we demonstrated concentration-dependent antioxidant activity of CuO NPs and their interaction with plasmid DNA. We assumed that the CuO NPs both cleave and break DNA double helix structure. - Highlights: • The synthesis of microwave assisted green synthesis of CuO nanoparticles • The synthesized nanoparticles were analyzed by FT-IR, DLS, XRD, EDX and SEM. • Concentration-dependent antioxidant activity of CuO NPs was determined. • CuO NPs cause both cleavage in the DNA double helix structure and breaks as well.

  5. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    OpenAIRE

    Luis E. Rojas; Maritza Reyes; Naivy Pérez-Alonso; María I. Olóriz; Laisyn Posada-Pérez; Bárbara Ocaña; Orelvis Portal; Borys Chong-Pérez; Jorge L. Pérez Pérez

    2014-01-01

    The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol). In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR). From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend ...

  6. Epithermal neutron activation analysis of Spirulina platensis biomass, of the C-phycocianin and of DNA extracted from it

    International Nuclear Information System (INIS)

    Mosulishvili, L.M.; Belokobyl'skij, A.I.; Kirkesali, E.I.; Khizanishvili, A.I.; Frontas'eva, M.V.; Pomyakushina, E.V.

    2002-01-01

    The epithermal neutron activation analysis (ENAA) was used for study of the biomass of Spirulina platensis. The background levels of concentration of 27 macro-, micro- and trace elements ranging from 10 -3 up to 10 4 ppm were determined. It was found that the biomass of Spirulina does not contain toxic elements above the tolerance levels and can be utilized as a matrix of pharmaceuticals based on it. The concentrations of basic elements in C-phycocianin and DNA extracted from Spirulina platensis were determined by ENAA. A comparison of the element content of a whole Spirulina biomass with that of a refined C-phycocianin preparation was made

  7. Epithermal Neutron Activation Analysis of Spirulina plate