PCR-restriction fragment length polymorphism analysis of indigenous nitrogen-fixing micro organisms lineages

International Nuclear Information System (INIS)

Liew Woan Ying Pauline; Jong Bor Chyan; Khairuddin Abdul Rahim

2006-01-01

The use of PCR-RFLP analysis as a useful microbial identification tool has been evaluated for years. This approach was verified effective worldwide, where differential DNA bands and sequence markers distinctive to specific microbes or microbial groups have been identified. In our study, PCR-RFLP technique has been adopted in the identification of our indigenous N 2 -fixing isolates obtained from several local environments. RFLP was carried out with suitable restriction enzymes and the patterns were documented. Representatives of the different patterns were selected and analysed with the 16S ribosomal DNA sequencing method. The results demonstrated correlation between the differential RFLP patterns and the 16S rDNA identities. (Author)

M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

Directory of Open Access Journals (Sweden)

Good Michael F

2005-10-01

Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

Science.gov (United States)

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

Science.gov (United States)

Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

2014-01-01

The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

Directory of Open Access Journals (Sweden)

Kush Shrivastava

2015-10-01

Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

Novel exon-exon breakpoint in CIC-DUX4 fusion sarcoma identified by anchored multiplex PCR (Archer FusionPlex Sarcoma Panel).

Science.gov (United States)

Loke, Benjamin Nathanael; Lee, Victor Kwan Min; Sudhanshi, Jain; Wong, Meng Kang; Kuick, Chik Hong; Puhaindran, Mark; Chang, Kenneth Tou En

2017-08-01

We describe the clinical and pathological features and novel genetic findings of a case of CIC-DUX4 sarcoma occurring in the thigh of a 35-year-old man. Fusion gene detection using a next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) was used to identify the novel fusion breakpoints of this CIC-DUX4 sarcoma using formalin-fixed and paraffin-embedded tumour material. This CIC-DUX4 sarcoma has a novel fusion breakpoint between exon 20 of the CIC gene and exon 1 of the DUX4 gene. This case report describes an additional case of CIC-DUX4 sarcoma with a novel fusion breakpoint, and demonstrates the value of this next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) in both diagnosis for patient care and in identification of a novel fusion breakpoint in this tumour type. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Telomere Restriction Fragment (TRF) Analysis.

Science.gov (United States)

Mender, Ilgen; Shay, Jerry W

2015-11-20

While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

R Mirnejad

2011-01-01

Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

Identification of polymorphism in exons 7 and 12 of lactoferrin gene and its association with incidence of clinical mastitis in Murrah buffalo.

Science.gov (United States)

Dinesh, Krishanender; Verma, Archana; Das Gupta, Ishwar; Thakur, Yash Pal; Verma, Nishant; Arya, Ashwani

2015-04-01

Lactoferrin gene is one of the important candidate genes for mastitis resistance. The gene is located on chromosome BTA 22 and consists of 17 exons spanning over 34.5 kb of genomic DNA. The present study was undertaken with the objectives to identify allelic variants in exons 7 and 12 of lactoferrin gene and to analyze association between its genetic variants and incidence of clinical mastitis in Murrah buffalo. The amplification of exons 7 and 12 of lactoferrin gene yielded amplicons of 232- and 461-bp sizes. PCR-restriction fragment length polymorphism (RFLP) analysis of 232-bp amplicon using BccI restriction enzyme revealed three genotypes (AA, AB, and BB) with frequencies of 0.62, 0.22, and 0.16, respectively. The frequencies of two alleles, A and B, were estimated as 0.73 and 0.27. Hpy188I-RFLP for 461-bp amplicon revealed polymorphism with three genotypes, CC, CD, and DD, with respective frequencies of 0.06, 0.39, and 0.56, whereas frequencies for C and D alleles were 0.25 and 0.75. The chi-square (χ(2)) analysis revealed a significant association between incidence of clinical mastitis and genetic variants of exon 7, and animals of AA genotype of exon 7 were found to be least susceptible to mastitis. The findings indicate potential scope for incorporation of lactoferrin gene in selection and breeding of Murrah buffaloes for improved genetic resistance to mastitis.

Comparison of Direct Sequencing, Real-Time PCR-High Resolution Melt (PCR-HRM) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis for Genotyping of Common Thiopurine Intolerant Variant Alleles NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C).

Science.gov (United States)

Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat

2017-05-12

Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.

Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

Science.gov (United States)

Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

2011-01-01

Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

OpenAIRE

Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

1995-01-01

The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

Science.gov (United States)

Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

2012-03-01

The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

Use of epitope libraries to identify exon-specific monoclonal antibodies for characterization of altered dystrophins in muscular dystrophy

Energy Technology Data Exchange (ETDEWEB)

Nguyen thi Man; Morris, G.E. (North East Wales Inst., Clwyd (United Kingdom))

1993-06-01

The majority of mutations in Xp21-linked muscular dystrophy (MD) can be identified by PCR or Southern blotting, as deletions or duplications of groups of exons in the dystrophin gene, but it is not always possible to predict how much altered dystrophin, if any, will be produced. Use of exon-specific monoclonal antibodies (mAbs) on muscle biopsies from MD patients can, in principle, provide information on both the amount of altered dystrophin produced and, when dystrophin is present, the nature of the genetic deletion or point mutation. For this purpose, mAbs which recognize regions of dystrophin encoded by known exons and whose binding is unaffected by the absence of adjacent exons are required. To map mAbs to specific exons, random [open quotes]libraries[close quotes] of expressed dystrophin fragments were created by cloning DNAseI digestion fragments of a 4.3-kb dystrophin cDNA into a pTEX expression vector. The libraries were then used to locate the epitopes recognized by 48 mAbs to fragments of 25--60 amino acids within the 1,434-amino-acid dystrophin fragment used to produce the antibodies. This is sufficiently detailed to allow further refinement by using synthetic peptides and, in many cases, to identify the exon in the DMD (Duchenne MD) gene which encodes the epitope. To illustrate their use in dystrophin analysis, a Duchenne patient with a frameshift deletion of exons 42 and 43 makes a truncated dystrophin encoded by exons 1--41, and the authors now show that this can be detected in the sarcolemma by mAbs up to and including those specific for exon 41 epitopes but not by mAbs specific for exon 43 or later epitopes. 38 refs., 2 figs., 4 tabs.

Treatment of PCR products with exonuclease I and heat-labile alkaline phosphatase improves the visibility of combined bisulfite restriction analysis

International Nuclear Information System (INIS)

Watanabe, Kousuke; Emoto, Noriko; Sunohara, Mitsuhiro; Kawakami, Masanori; Kage, Hidenori; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya

2010-01-01

Research highlights: → Incubating PCR products at a high temperature causes smears in gel electrophoresis. → Smears interfere with the interpretation of methylation analysis using COBRA. → Treatment with exonuclease I and heat-labile alkaline phosphatase eliminates smears. → The elimination of smears improves the visibility of COBRA. -- Abstract: DNA methylation plays a vital role in the regulation of gene expression. Abnormal promoter hypermethylation is an important mechanism of inactivating tumor suppressor genes in human cancers. Combined bisulfite restriction analysis (COBRA) is a widely used method for identifying the DNA methylation of specific CpG sites. Here, we report that exonuclease I and heat-labile alkaline phosphatase can be used for PCR purification for COBRA, improving the visibility of gel electrophoresis after restriction digestion. This improvement is observed when restriction digestion is performed at a high temperature, such as 60 o C or 65 o C, with BstUI and TaqI, respectively. This simple method can be applied instead of DNA purification using spin columns or phenol/chloroform extraction. It can also be applied to other situations when PCR products are digested by thermophile-derived restriction enzymes, such as PCR restriction fragment length polymorphism (RFLP) analysis.

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

International Nuclear Information System (INIS)

2010-01-01

Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

Science.gov (United States)

Altınel, Ahmet

2017-01-01

Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

Molecular markers. Amplified fragment length polymorphism

Directory of Open Access Journals (Sweden)

Pržulj Novo

2005-01-01

Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

Science.gov (United States)

Macente, Sara; Fujimura Leite, Clarice Queico; Santos, Adolfo Carlos Barreto; Siqueira, Vera Lúcia Dias; Machado, Luzia Neri Cosmo; Marcondes, Nadir Rodrigues; Hirata, Mario Hiroyuki; Hirata, Rosário Dominguez Crespo

2013-01-01

Current study evaluated the hsp65 Nested PCR Restriction Fragment Length Polymorphism Analysis (hsp65 Nested PCR-PRA) to detect and identify Mycobacterium tuberculosis complex directly in clinical samples for a rapid and specific diagnosis of tuberculosis (TB). hsp65 Nested PCR-PRA was applied directly to 218 clinical samples obtained from 127 patients suspected of TB or another mycobacterial infection from July 2009 to July 2010. The hsp65 Nested PCR-PRA showed 100% sensitivity and 95.0 and 93.1% specificity in comparison with culture and microscopy (acid fast bacillus smear), respectively. hsp65 Nested PCR-PRA was shown to be a fast and reliable assay for diagnosing TB, which may contribute towards a fast diagnosis that could help the selection of appropriate chemotherapeutic and early epidemiological management of the cases which are of paramount importance in a high TB burden country. PMID:24260739

Molecular evolution of the leptin exon 3 in some species of the family Canidae

Directory of Open Access Journals (Sweden)

Switonski Marek

2003-09-01

Full Text Available Abstract The structure of the leptin gene seems to be well conserved. The polymorphism of this gene in four species belonging to the Canidae family (the dog (Canis familiaris – 16 different breeds, the Chinese racoon dog (Nyctereutes procyonoides procyonoides, the red fox (Vulpes vulpes and the arctic fox (Alopex lagopus were studied with the use of single strand conformation polymorphism (SSCP, restriction fragment length polymorphism (RFLP and DNA sequencing techniques. For exon 2, all species presented the same SSCP pattern, while in exon 3 some differences were found. DNA sequencing of exon 3 revealed the presence of six nucleotide substitutions, differentiating the studied species. Three of them cause amino acid substitutions as well. For all dog breeds studied, SSCP patterns were identical.

Characterization of major histocompatibility complex (MHC DRB exon 2 and DRA exon 3 fragments in a primary terrestrial rabies vector (Procyon lotor.

Directory of Open Access Journals (Sweden)

Sarrah Castillo

Full Text Available The major histocompatibility complex (MHC presents a unique system to explore links between genetic diversity and pathogens, as diversity within MHC is maintained in part by pathogen driven selection. While the majority of wildlife MHC studies have investigated species that are of conservation concern, here we characterize MHC variation in a common and broadly distributed species, the North American raccoon (Procyon lotor. Raccoons host an array of broadly distributed wildlife diseases (e.g., canine distemper, parvovirus and raccoon rabies virus and present important human health risks as they persist in high densities and in close proximity to humans and livestock. To further explore how genetic variation influences the spread and maintenance of disease in raccoons we characterized a fragment of MHC class II DRA exon 3 (250 bp and DRB exon 2 (228 bp. MHC DRA was found to be functionally monomorphic in the 32 individuals screened; whereas DRB exon 2 revealed 66 unique alleles among the 246 individuals screened. Between two and four alleles were observed in each individual suggesting we were amplifying a duplicated DRB locus. Nucleotide differences between DRB alleles ranged from 1 to 36 bp (0.4-15.8% divergence and translated into 1 to 21 (1.3-27.6% divergence amino acid differences. We detected a significant excess of nonsynonymous substitutions at the peptide binding region (P = 0.005, indicating that DRB exon 2 in raccoons has been influenced by positive selection. These data will form the basis of continued analyses into the spatial and temporal relationship of the raccoon rabies virus and the immunogenetic response in its primary host.

Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

Directory of Open Access Journals (Sweden)

Caldeira Roberta L

2000-01-01

Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

Multi-exon deletions of the FBN1 gene in Marfan syndrome

Directory of Open Access Journals (Sweden)

Schrijver Iris

2001-10-01

Full Text Available Abstract Background Mutations in the fibrillin -1 gene (FBN1 cause Marfan syndrome (MFS, an autosomal dominant multi-system connective tissue disorder. The 200 different mutations reported in the 235 kb, 65 exon-containing gene include only one family with a genomic multi-exon deletion. Methods We used long-range RT-PCR for mutation detection and long-range genomic PCR and DNA sequencing for identification of deletion breakpoints, allele-specific transcript analyses to determine stability of the mutant RNA, and pulse-chase studies to quantitate fibrillin synthesis and extracellular matrix deposition in cultured fibroblasts. Southern blots of genomic DNA were probed with three overlapping fragments covering the FBN1 coding exons Results Two novel multi-exon FBN1 deletions were discovered. Identical nucleotide pentamers were found at or near the intronic breakpoints. In a Case with classic MFS, an in-frame deletion of exons 42 and 43 removed the C-terminal 24 amino acids of the 5th LTBP (8-cysteine domain and the adjacent 25th calcium-binding EGF-like (6-cysteine domain. The mutant mRNA was stable, but fibrillin synthesis and matrix deposition were significantly reduced. A Case with severe childhood-onset MFS has a de novo deletion of exons 44–46 that removed three EGF-like domains. Fibrillin protein synthesis was normal, but matrix deposition was strikingly reduced. No genomic rearrangements were detected by Southern analysis of 18 unrelated MFS samples negative for FBN1 mutation screening. Conclusions Two novel deletion cases expand knowledge of mutational mechanisms and genotype/phenotype correlations of fibrillinopathies. Deletions or mutations affecting an LTBP domain may result in unstable mutant protein cleavage products that interfere with microfibril assembly.

Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

Science.gov (United States)

Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

2017-09-01

It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

Mucopolysaccharidosis IVA: Four new exonic mutations in patients with N-acetylgalactosamine-6-sulfate sulfatase deficiency

Energy Technology Data Exchange (ETDEWEB)

Tomatsu, Shunji; Fukuda, Seiji; Yamagishi, Atsushi [Gifu Univ. (Japan)] [and others

1996-05-01

We report four new mutations in Japanese patients with mucopolysaccharidosis IVA (MPSIVA) who were heterozygous for a common double gene deletion. A nonsense mutation of CAG to TAG at codon 148 in exon 4 was identified, resulting in a change of Q to a stop codon and three missense mutations: V (GTC) to A (GCC) at codon 138 in exon 4, P (CCC) to S (TCC) at codon 151 in exon 5, and P (CCC) to L (CTC) at codon 151 in exon 5. Introduction of these mutations into the normal GALNS cDNA and transient expression in cultured fibroblasts resulted in a significant decrease in the enzyme activity. V138A and Q148X mutations result in changes of restriction site, which were analyzed by restriction-enzyme assay. P151S and P151L mutations that did not alter the restriction site were detected by direct sequencing or allele specific oligohybridization. Detection of the double gene deletion was initially done using Southern blots and was confirmed by PCR. Haplotypes were determined using seven polymorphisms to the GALNS locus in families with the double gene deletion. Haplotype analysis showed that the common double gene deletion occurred on a single haplotype, except for some variation in a VNTR-like polymorphism. This finding is consistent with a common founder for all individuals with this mutation. 48 refs., 5 figs., 1 tab.

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1994-01-01

From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

Science.gov (United States)

Andeer, Peter; Strand, Stuart E; Stahl, David A

2012-01-01

Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

Science.gov (United States)

Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

2006-05-01

The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion.

Science.gov (United States)

Shinohara, Masakazu; Ar Rochmah, Mawaddah; Nakanishi, Kenta; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Bouike, Yoshihiro; Nishio, Hisahide

2017-09-07

Spinal muscular atrophy (SMA) is a frequent autosomal recessive disorder, characterized by lower motor neuron loss in the spinal cord. More than 95% of SMA patients show homozygous survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique. However, non-specific amplification products were observed with mCOP-PCR, which might lead to erroneous interpretation of the screening results. To establish an improved version of the mCOP-PCR screening system without non-specific amplification. DNA samples were assayed using a new version of the mCOP-PCR screening system. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The new mCOP-PCR method contained a targeted pre-amplification step of the region, including an SMN1-specific nucleotide, prior to the mCOP-PCR step. mCOP-PCR products were electrophoresed on agarose gels. No non-specific amplification products were detected in electrophoresis gels with the new mCOP-PCR screening system. An additional targeted pre-amplification step eliminated non-specific amplification from mCOP-PCR screening.

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1993-01-01

From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

Genetic screening of spinal muscular atrophy using a real-time modified COP-PCR technique with dried blood-spot DNA.

Science.gov (United States)

Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Nakanishi, Kenta; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Lai, Poh San; Takeshima, Yasuhiro; Takeuchi, Atsuko; Bouike, Yoshihiro; Okamoto, Maya; Nishio, Hisahide; Shinohara, Masakazu

2017-10-01

Spinal muscular atrophy (SMA) is a common neuromuscular disorder caused by mutations in SMN1. More than 95% of SMA patients carry homozygous SMN1 deletion. SMA is the leading genetic cause of infant death, and has been considered an incurable disease. However, a recent clinical trial with an antisense oligonucleotide drug has shown encouraging clinical efficacy. Thus, early and accurate detection of SMN1 deletion may improve prognosis of many infantile SMA patients. A total of 88 DNA samples (37 SMA patients, 12 carriers and 39 controls) from dried blood spots (DBS) on filter paper were analyzed. All participants had previously been screened for SMN genes by PCR restriction fragment length polymorphism (PCR-RFLP) using DNA extracted from freshly collected blood. DNA was extracted from DBS that had been stored at room temperature (20-25°C) for 1week to 5years. To ensure sufficient quality and quantity of DNA samples, target sequences were pre-amplified by conventional PCR. Real-time modified competitive oligonucleotide priming-PCR (mCOP-PCR) with the pre-amplified PCR products was performed for the gene-specific amplification of SMN1 and SMN2 exon 7. Compared with PCR-RFLP using DNA from freshly collected blood, results from real-time mCOP-PCR using DBS-DNA for detection of SMN1 exon 7 deletion showed a sensitivity of 1.00 (CI [0.87, 1.00])] and specificity of 1.00 (CI [0.90, 1.00]), respectively. We combined DNA extraction from DBS on filter paper, pre-amplification of target DNA, and real-time mCOP-PCR to specifically detect SMN1 and SMN2 genes, thereby establishing a rapid, accurate, and high-throughput system for detecting SMN1-deletion with practical applications for newborn screening. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

Science.gov (United States)

Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

2001-01-01

A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

(PCR) for direct cloning of blunt-end DNA fragments

African Journals Online (AJOL)

Administrator

2011-09-19

Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)

Energy Technology Data Exchange (ETDEWEB)

McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))

1991-09-25

Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.

Association of Exon 10A and 10B inactivating mutation of follicle stimulating hormone receptor gene (FSHR) and Polycystic Ovarian Syndrome in Vellore cohort

Science.gov (United States)

Sekar, Nishu; Kulkarni, Rucha; Ozalkar, Sharvari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

2017-11-01

Polycystic ovarian syndrome is the most common heterogenous endocrine disorder in women. Follicle stimulating hormone receptor is associated with normal development as well as maturation of follicles and triggers estrogen production in granulosa cells of the ovary. Inactivating mutation in FSHR gene correlated with reduction of ovarian function in women is due to damage to receptor function. This study aims to investigate whether inactivating mutations, in follicle stimulating hormone receptor gene is related to polycystic ovarian morphology in women with PCOS. Genomic DNA isolated from 15 subjects from Sandhya Hospital, Vellore (10 patients with PCOS and 5 healthy controls) was taken for this study. Patient data included a clinical report, hormonal levels, and ovarian morphological details. DNA isolation was followed by DNA amplification by polymerase chain reaction using Exon 10 A and Exon 10 B primers. The PCR-RFLP analysis was performed using Dde1 restriction enzyme. Here we discuss inactivating mutation found in Exon 10 of FSHR gene in patients with PCOS.The absence of inactivating mutation was observed through PCR-RFLP study on Exon 10A and Exon 10B.

Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

Science.gov (United States)

Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

2012-01-01

Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2013-03-01

Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) for large genomic rearrangements (LGRs) detection: A new approach to assess quantitative status of BRCA1 gene in a reference laboratory.

Science.gov (United States)

Minucci, Angelo; De Paolis, Elisa; Concolino, Paola; De Bonis, Maria; Rizza, Roberta; Canu, Giulia; Scaglione, Giovanni Luca; Mignone, Flavio; Scambia, Giovanni; Zuppi, Cecilia; Capoluongo, Ettore

2017-07-01

Evaluation of copy number variation (CNV) in BRCA1/2 genes, due to large genomic rearrangements (LGRs), is a mandatory analysis in hereditary breast and ovarian cancers families, if no pathogenic variants are found by sequencing. LGRs cannot be detected by conventional methods and several alternative methods have been developed. Since these approaches are expensive and time consuming, identification of alternative screening methods for LGRs detection is needed in order to reduce and optimize the diagnostic procedure. The aim of this study was to investigate a Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) as molecular tool to detect recurrent BRCA1 LGRs. C-PCR-HRMA was performed on exons 3, 14, 18, 19, 20 and 21 of the BRCA1 gene; exons 4, 6 and 7 of the ALB gene were used as reference fragments. This study showed that it is possible to identify recurrent BRCA1 LGRs, by melting peak height ratio between target (BRCA1) and reference (ALB) fragments. Furthermore, we underline that a peculiar amplicon-melting profile is associated to a specific BRCA1 LGR. All C-PCR-HRMA results were confirmed by Multiplex ligation-dependent probe amplification. C-PCR-HRMA has proved to be an innovative, efficient and fast method for BRCA1 LGRs detection. Given the sensitivity, specificity and ease of use, c-PCR-HRMA can be considered an attractive and powerful alternative to other methods for BRCA1 CNVs screening, improving molecular strategies for BRCA testing in the context of Massive Parallel Sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates

Directory of Open Access Journals (Sweden)

Zohreh Ebrahimvandi

2014-07-01

Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A total of 30 Salmonella isolates were serotyped by specific antisera. For the PCR-RFLP method based on the fliC gene, extracted DNA was used as the template for amplifying the fliC gene (1500 bp using specific primers. PCR products were subjected to digestion using HhaI restriction endonuclease. Results: This study determined 30 serotypes as Salmonella durban (56.6%, Salmonella uno (23.3%, Salmonella enteritidis (3.3%, Salmonella tinda (3.3%, Salmonella mjimweme (3.3%, Salmonella Thompson (3.3%, Salmonella sIIO8 (3.3 % and Salmonella sIIO7 (3.3%. Observations indicated that HhaI is able to discriminate Salmonella tinda and Salmonella thompson, yet Salmonella enteritidis, Salmonella durban and Salmonella mjimweme had the same pattern with this enzyme. Also Salmonella sIIO8, Salmonella sIIO7 and Salmonella uno showed the same pattern. Thus, regarding the size and the number of resulting fragments from this enzyme, four patterns were obtained for HhaI. Conclusion: A large number of Salmonella serotypes need to be analyzed by the PCR-RFLP method and different enzymes must be used to give reliable results.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

Science.gov (United States)

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

Cutaneous and visceral leishmaniasis co-infection in dogs from Rio de Janeiro, Brazil: evaluation by specific PCR and RFLP-PCR assays

Directory of Open Access Journals (Sweden)

Marize Quinhones Pires

2014-04-01

Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.

PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products

Directory of Open Access Journals (Sweden)

Y. Erwanto

2011-04-01

Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 % was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication.

Intron Retention and TE Exonization Events in ZRANB2

Directory of Open Access Journals (Sweden)

Sang-Je Park

2012-01-01

Full Text Available The Zinc finger, RAN-binding domain-containing protein 2 (ZRANB2, contains arginine/serine-rich (RS domains that mediate its function in the regulation of alternative splicing. The ZRANB2 gene contains 2 LINE elements (L3b, Plat_L3 between the 9th and 10th exons. We identified the exonization event of a LINE element (Plat_L3. Using genomic PCR, RT-PCR amplification, and sequencing of primate DNA and RNA samples, we analyzed the evolutionary features of ZRANB2 transcripts. The results indicated that 2 of the LINE elements were integrated in human and all of the tested primate samples (hominoids: 3 species; Old World monkey: 8 species; New World monkey: 6 species; prosimian: 1 species. Human, rhesus monkey, crab-eating monkey, African-green monkey, and marmoset harbor the exon derived from LINE element (Plat_L3. RT-PCR amplification revealed the long transcripts and their differential expression patterns. Intriguingly, these long transcripts were abundantly expressed in Old World monkey lineages (rhesus, crab-eating, and African-green monkeys and were expressed via intron retention (IR. Thus, the ZRANB2 gene produces 3 transcript variants in which the Cterminus varies by transposable elements (TEs exonization and IR mechanisms. Therefore, ZRANB2 is valuable for investigating the evolutionary mechanisms of TE exonization and IR during primate evolution.

Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

DEFF Research Database (Denmark)

Kastern, W.; Dyrberg, T.; Scholler, J.

1984-01-01

DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

Science.gov (United States)

Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

1990-01-01

The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

Investigation of the 5' flanking region and exon 3 polymorphisms of IGF-1 gene showed moderate association with semen quality in Sanjabi breed rams.

Science.gov (United States)

Bakhtiar, R; Abdolmohammadi, A; Hajarian, H; Nikousefat, Z; Kalantar-Neyestanaki, D

2017-12-01

In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5' regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5' flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5' flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs. Copyright © 2017 Elsevier Inc. All rights reserved.

Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

Science.gov (United States)

Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

1998-01-01

We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

Science.gov (United States)

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

Directory of Open Access Journals (Sweden)

Akeela Fatima

2017-01-01

Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

Establishment of human sperm-specific voltage-dependent anion channel 3 recombinant vector for the production of a male contraceptive vaccine

Directory of Open Access Journals (Sweden)

Asmarinah Asmarinah

2012-05-01

Full Text Available Background: The aim of this study was to construct a recombinant vector of human sperm specific VDAC3 gene for production of VDAC3 antibody, which is potential as male contraception vaccine.Methods: Target fragment sequence of VDAC3 gene was obtained through amplification of human sperm VDAC3 cDNA with primers covering exon 5 to exon 8. Its PCR product in size of 435 bp was cloned to the pET101/D-TOPO expression vector (5753 bp. E. coli bacteria were transformed with this vector. Cloning of VDAC3 fragment gene to the vector was confirmed by the using of XbaI restriction enzyme and PCR colony method with primers covering exons 5-8 of the human VDAC3 gene.Results: Alignment analysis of amplified fragment covering exon 5 to exon 8 of VDAC3 gene showed 94% homology to human VDAC3 gene from databank. After cloning to the expression vector and transformation to E. coli competent cells, twelve colonies could grow in culture media. Gel electrophoresis of sliced VDAC3 recombinant vector showed a single band in the size of 6181 bp in 8 colonies. After application of PCR colony and amplicon sequencing, the result showed a single band in the size of 435 bp and fragment sequence with 94% identity to human VDAC3 gene.Conclusion: The construction of human sperm specific VDAC3 gene recombinant vector was established in this study. In the future, this recombinant vector will be used to produce VDAC3 antibody for the development of a male contraception vaccine. (Med J Indones. 2012;21:61-5Keywords: Contraception, recombinant vector, sperm, VDAC3

Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

Science.gov (United States)

Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

2014-12-15

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

Science.gov (United States)

Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

1998-02-01

A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

Multiple Hotspot Mutations Scanning by Single Droplet Digital PCR.

Science.gov (United States)

Decraene, Charles; Silveira, Amanda B; Bidard, François-Clément; Vallée, Audrey; Michel, Marc; Melaabi, Samia; Vincent-Salomon, Anne; Saliou, Adrien; Houy, Alexandre; Milder, Maud; Lantz, Olivier; Ychou, Marc; Denis, Marc G; Pierga, Jean-Yves; Stern, Marc-Henri; Proudhon, Charlotte

2018-02-01

Progress in the liquid biopsy field, combined with the development of droplet digital PCR (ddPCR), has enabled noninvasive monitoring of mutations with high detection accuracy. However, current assays detect a restricted number of mutations per reaction. ddPCR is a recognized method for detecting alterations previously characterized in tumor tissues, but its use as a discovery tool when the mutation is unknown a priori remains limited. We established 2 ddPCR assays detecting all genomic alterations within KRAS exon 2 and EGFR exon 19 mutation hotspots, which are of clinical importance in colorectal and lung cancer, with use of a unique pair of TaqMan ® oligoprobes. The KRAS assay scanned for the 7 most common mutations in codons 12/13 but also all other mutations found in that region. The EGFR assay screened for all in-frame deletions of exon 19, which are frequent EGFR-activating events. The KRAS and EGFR assays were highly specific and both reached a limit of detection of <0.1% in mutant allele frequency. We further validated their performance on multiple plasma and formalin-fixed and paraffin-embedded tumor samples harboring a panel of different KRAS or EGFR mutations. This method presents the advantage of detecting a higher number of mutations with single-reaction ddPCRs while consuming a minimum of patient sample. This is particularly useful in the context of liquid biopsy because the amount of circulating tumor DNA is often low. This method should be useful as a discovery tool when the tumor tissue is unavailable or to monitor disease during therapy. © 2017 American Association for Clinical Chemistry.

Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

International Nuclear Information System (INIS)

Ali, M. S.; Latif, Z.

2016-01-01

Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

Directory of Open Access Journals (Sweden)

Dinka eMandakovic

2016-05-01

Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

[JAK2 V617F and exon 12 genetic variations in Korean patients with BCR/ABL1-negative myeloproliferative neoplasms].

Science.gov (United States)

Kim, Jeong Tae; Cho, Yong Gon; Choi, Sam Im; Lee, Young Jin; Kim, Hye Ran; Jang, Sook Jin; Moon, Dae Soo; Park, Young Jin; Park, Geon

2010-12-01

JAK2 genetic variations have been described in a high proportion of patients with BCR/ABL1-negative myeloproliferative neoplasms (MPN). This study was designed to analyze the frequencies of JAK2 V617F and exon 12 variations, and their correlations with clinical characteristics of Korean patients with BCR/ABL1-negative MPN. We examined a total of 154 patients with BCR/ABL1-negative MPN that included 24, 26, 89, and 15 patients with polycythemia vera (PV), primary myelofibrosis (PMF), essential thrombocythemia (ET), and unclassified myeloproliferative neoplasms (MPNU), respectively. We performed allele-specific PCR to detect V617F in all BCR/ABL1-negative patients, and performed direct sequencing to detect exon 12 variations in 47 V617F-negative MPN patients. JAK2 c.1641+179_183del5 variation was detected by restriction fragment length polymorphism assay in 176 healthy subjects. JAK2 V617F was detected in 91 patients (59.1%): PV (91.6%), PMF (46.2%), ET (52.8%), and MPNU (66.7%). In V617F-negative MPN patients, no mutations were found in exon 12. The c.1641+179_183del5 was detected in 68.1% of V617F-negative MPN patients and 45.4% of healthy subjects (P=0.008). JAK2 V617F was closely correlated with age and leukocytosis in BCR/ABL1-negative MPN patients (P<0.05). However, c.1641+179_183del5 was not related to age, sex, or complete blood cell count parameters in V617F-negative MPN patients and healthy subjects. The c.1641+179_183del5 was associated with an increased odds ratio for MPN (odds ratio, 2.6; 95% confidences interval, 1.3-5.1; P=0.007). Frequencies of V617F are similar to reported results. JAK2 exon 12 mutations may be rare and c.1641+179_183del5 may influence the occurrence of MPN in Korean patients with V6 17F-negative MPN.

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

Science.gov (United States)

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi

Science.gov (United States)

Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.

1999-01-01

Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224

The heterothallic sugarbeet pathogen Cercospora beticola contains exon fragments of both MAT genes that are homogenized by concerted evolution.

Science.gov (United States)

Bolton, Melvin D; de Jonge, Ronnie; Inderbitzin, Patrik; Liu, Zhaohui; Birla, Keshav; Van de Peer, Yves; Subbarao, Krishna V; Thomma, Bart P H J; Secor, Gary A

2014-01-01

Dothideomycetes is one of the most ecologically diverse and economically important classes of fungi. Sexual reproduction in this group is governed by mating type (MAT) genes at the MAT1 locus. Self-sterile (heterothallic) species contain one of two genes at MAT1 (MAT1-1-1 or MAT1-2-1) and only isolates of opposite mating type are sexually compatible. In contrast, self-fertile (homothallic) species contain both MAT genes at MAT1. Knowledge of the reproductive capacities of plant pathogens are of particular interest because recombining populations tend to be more difficult to manage in agricultural settings. In this study, we sequenced MAT1 in the heterothallic Dothideomycete fungus Cercospora beticola to gain insight into the reproductive capabilities of this important plant pathogen. In addition to the expected MAT gene at MAT1, each isolate contained fragments of both MAT1-1-1 and MAT1-2-1 at ostensibly random loci across the genome. When MAT fragments from each locus were manually assembled, they reconstituted MAT1-1-1 and MAT1-2-1 exons with high identity, suggesting a retroposition event occurred in a homothallic ancestor in which both MAT genes were fused. The genome sequences of related taxa revealed that MAT gene fragment pattern of Cercospora zeae-maydis was analogous to C. beticola. In contrast, the genome of more distantly related Mycosphaerella graminicola did not contain MAT fragments. Although fragments occurred in syntenic regions of the C. beticola and C. zeae-maydis genomes, each MAT fragment was more closely related to the intact MAT gene of the same species. Taken together, these data suggest MAT genes fragmented after divergence of M. graminicola from the remaining taxa, and concerted evolution functioned to homogenize MAT fragments and MAT genes in each species. Published by Elsevier Inc.

Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

International Nuclear Information System (INIS)

Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

1990-01-01

A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

Science.gov (United States)

Barbara, D J; Morton, A; Spence, N J; Miller, A

1995-09-01

Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

Characterization of a spliced exon product of herpes simplex type-1 latency-associated transcript in productively infected cells

International Nuclear Information System (INIS)

Kang, Wen; Mukerjee, Ruma; Gartner, Jared J.; Hatzigeorgiou, Artemis G.; Sandri-Goldin, Rozanne M.; Fraser, Nigel W.

2006-01-01

The latency-associated transcripts (LATs) of herpes simplex virus type-1 (HSV-1) are the only viral RNAs accumulating during latent infections in the sensory ganglia of the peripheral nervous system. The major form of LAT that accumulates in latently infected neurons is a 2 kb intron, spliced from a much less abundant 8.3 primary transcript. The spliced exon mRNA has been hard to detect. However, in this study, we have examined the spliced exon RNA in productively infected cells using ribonuclease protection (RPA), and quantitative RT-PCR (q-PCR) assays. We were able to detect the LAT exon RNA in productively infected SY5Y cells (a human neuronal cell line). The level of the LAT exon RNA was found to be approximately 5% that of the 2 kb intron RNA and thus is likely to be relatively unstable. Quantitative RT-PCR (q-PCR) assays were used to examine the LAT exon RNA and its properties. They confirmed that the LAT exon mRNA is present at a very low level in productively infected cells, compared to the levels of other viral transcripts. Furthermore, experiments showed that the LAT exon mRNA is expressed as a true late gene, and appears to be polyadenylated. In SY5Y cells, in contrast to most late viral transcripts, the LAT exon RNA was found to be mainly nuclear localized during the late stage of a productive infection. Interestingly, more LAT exon RNA was found in the cytoplasm in differentiated compared to undifferentiated SY5Y cells, suggesting the nucleocytoplasmic distribution of the LAT exon RNA and its related function may be influenced by the differentiation state of cells

Identification of five sea cucumber species through PCR-RFLP analysis

Science.gov (United States)

Lv, Yingchun; Zheng, Rong; Zuo, Tao; Wang, Yuming; Li, Zhaojie; Xue, Yong; Xue, Changhu; Tang, Qingjuan

2014-10-01

Sea cucumbers are traditional marine food and Chinese medicine in Asia. The rapid expansion of sea cucumber market has resulted in various problems, such as commercial fraud and mislabeling. Conventionally, sea cucumber species could be distinguished by their morphological and anatomical characteristics; however, their identification becomes difficult when they are processed. The aim of this study was to develop a new convenient method of identifying and distinguishing sea cucumber species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of mitochondrial cytochrome oxidase I gene ( COI) was used to identifing five sea cucumber species ( Apostichopus japonicus, Cucumaria frondosa, Thelenota ananas, Parastichopus californicus and Actinopyga lecanora). A 692 bp fragment of COI was searched for BamHI, KpnI, PstI, XbaI and Eco31I restriction sites with DNAMAN 6.0, which were then used to PCR-RFLP analysis. These five sea cucumber species can be discriminated from mixed sea cucumbers. The developed PCR-RFLP assay will facilitate the identification of sea cucumbers, making their source tracing and quality controlling feasible.

PCR-RFLP Method to Identify Salmonid Species of Economic Importance

Directory of Open Access Journals (Sweden)

Andreea Dudu

2011-05-01

Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

DEFF Research Database (Denmark)

Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

2005-01-01

The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt....... Experimental evaluation of the method consisted of three steps: (i) RT-PCR amplification of the G-gene of VHSV isolates using purified viral RNA as template, (ii) digestion of the PCR products with a panel of restriction endonucleases and (iii) interpretation of the resulting RFLP profiles. The RFLP analysis...

A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

Science.gov (United States)

Shibuta, K; Abe, M; Suzuki, T

1994-01-01

The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

Science.gov (United States)

Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

2017-08-01

Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

The proximal first exon architecture of the murine ghrelin gene is highly similar to its human orthologue

Directory of Open Access Journals (Sweden)

Seim Inge

2009-05-01

Full Text Available Abstract Background The murine ghrelin gene (Ghrl, originally sequenced from stomach tissue, contains five exons and a single transcription start site in a short, 19 bp first exon (exon 0. We recently isolated several novel first exons of the human ghrelin gene and found evidence of a complex transcriptional repertoire. In this report, we examined the 5' exons of the murine ghrelin orthologue in a range of tissues using 5' RACE. Findings 5' RACE revealed two transcription start sites (TSSs in exon 0 and four TSSs in intron 0, which correspond to 5' extensions of exon 1. Using quantitative, real-time RT-PCR (qRT-PCR, we demonstrated that extended exon 1 containing Ghrl transcripts are largely confined to the spleen, adrenal gland, stomach, and skin. Conclusion We demonstrate that multiple transcription start sites are present in exon 0 and an extended exon 1 of the murine ghrelin gene, similar to the proximal first exon organisation of its human orthologue. The identification of several transcription start sites in intron 0 of mouse ghrelin (resulting in an extension of exon 1 raises the possibility that developmental-, cell- and tissue-specific Ghrl mRNA species are created by employing alternative promoters and further studies of the murine ghrelin gene are warranted.

Differentiation between Aspergillus flavus and Aspergillus parasiticus from Pure Culture and Aflatoxin-Contaminated Grapes Using PCR-RFLP Analysis of aflR-aflJ Intergenic Spacer

International Nuclear Information System (INIS)

El Khoury, A.; Atoui, A.; Lebrihi, A.; Rizk, T.; Lteif, R.; Kallassy, M.

2011-01-01

Aflatoxins (AFs) represent the most important single mycotoxin-related food safety problem in developed and developing countries as they have adverse effects on human and animal health. They are produced mainly by Aspergillus flavus and A. parasiticus. Both species have different aflatoxinogenic profile. In order to distinguish between A. flavus and A. parasiticus, gene-specific primers were designed to target the intergenic spacer (IGS) for the AF biosynthesis genes, aflJ and aflR. Polymerase chain reaction (PCR) products were subjected to restriction endonuclease analysis using BglII to look for restriction fragment length polymorphisms (RFLPs). Our result showed that both species displayed different PCR-based RFLP (PCR-RFLP) profile. PCR products from A. flavus cleaved into 3 fragments of 362, 210, and 102 bp. However, there is only one restriction site for this enzyme in the sequence of A. parasiticus that produced only 2 fragments of 363 and 311 bp. The method was successfully applied to contaminated grapes samples. This approach of differentiating these 2 species would be simpler, less costly, and quicker than conventional sequencing of PCR products and/or morphological identification. (author)

PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

Science.gov (United States)

Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

2009-01-01

Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

Highly sensitive detection of the PIK3CAH1047R mutation in colorectal cancer using a novel PCR-RFLP method

International Nuclear Information System (INIS)

Li, Wan-Ming; Hu, Ting-Ting; Zhou, Lin-Lin; Feng, Yi-Ming; Wang, Yun-Yi; Fang, Jin

2016-01-01

The PIK3CA H1047R mutation is considered to be a potential predictive biomarker for EGFR-targeted therapies. In this study, we developed a novel PCR-PFLP approach to detect the PIK3CA H1047R mutation in high effectiveness. A 126-bp fragment of PIK3CA exon-20 was amplified by PCR, digested with FspI restriction endonuclease and separated by 3 % agarose gel electrophoresis for the PCR-RFLP analysis. The mutant sequence of the PIK3CA H1047R was spiked into the corresponding wild-type sequence in decreasing ratios for sensitivity analysis. Eight-six cases of formalin-fixed paraffin-embedded colorectal cancer (CRC) specimens were subjected to PCR-RFLP to evaluate the applicability of the method. The PCR-RFLP method had a capability to detect as litter as 0.4 % of mutation, and revealed 16.3 % of the PIK3CA H1047R mutation in 86 CRC tissues, which was significantly higher than that discovered by DNA sequencing (9.3 %). A positive association between the PIK3CA H1047R mutation and the patients’ age was first found, except for the negative relationship with the degree of tumor differentiation. In addition, the highly sensitive detection of a combinatorial mutation of PIK3CA, KRAS and BRAF was achieved using individual PCR-RFLP methods. We developed a sensitive, simple and rapid approach to detect the low-abundance PIK3CA H1047R mutation in real CRC specimens, providing an effective tool for guiding cancer targeted therapy

Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

Directory of Open Access Journals (Sweden)

Patrícia Carvalho de Sequeira

2005-11-01

Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

Energy Technology Data Exchange (ETDEWEB)

Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

PCR-based diagnosis, molecular characterization and detection of atypical strains of avian Chlamydia psittaci in companion and wild birds.

Science.gov (United States)

Madani, S A; Peighambari, S M

2013-02-01

Chlamydiosis is one of the most important infectious diseases of birds. In this study, 253 clinical samples were taken from 27 bird species belonging to seven orders. Thirty-two (12.6%) samples were positive for Chlamydia psittaci major outer membrane gene (ompA) DNA by a nested polymerase chain reaction (PCR). Twelve nested PCR-positive specimens were typed by ompA gene-based PCR-restricted fragment length polymorphism, using CTU/CTL primers and AluI restriction enzyme. Four restriction patterns were identified, including genotype A (two specimens from an African grey parrot [Psittacus erithacus] and a lorikeet [Trichoglossus haematodus]), genotype B (two specimens from a rock dove [Columbia livia] and a canary [Serinus canaria]), a third new restriction pattern (six specimens from African grey parrots), and a fourth new restriction pattern (two specimens from a ring-necked parakeet [Psittacula krameri] and an Alexandrine parakeet [Psittacula eupatria]). The third and the fourth restriction patterns are suggested to be provisional genotypes I and J, respectively. Partial sequencing of the ompA gene of seven specimens completely correlated with the results of PCR-restricted fragment length polymorphism and confirmed the presence of genotypes A and B and the two new provisional genotypes I and J. The two new genotypes have the closest identity with C. psittaci genotype F and Chlamydia abortus, respectively. From an evolutionary perspective, both new genotypes, particularly genotype J, are intermediate between the two species, C. psittaci and C. abortus.

Nested PCR and RFLP analysis based on the 16S rRNA gene

Science.gov (United States)

Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

Inactivating Mutation screening of Exon 6 and Exon 10E of FSHR gene in women with Polycystic Ovarian Syndrome in Vellore population

Science.gov (United States)

Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

2017-11-01

Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

Science.gov (United States)

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

Science.gov (United States)

Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

2015-10-01

Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

Directory of Open Access Journals (Sweden)

Leterrier Christine

2010-07-01

Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

Progress towards construction of a total restriction fragment map of a human chromosome.

NARCIS (Netherlands)

H. Vissing; F.G. Grosveld (Frank); E. Solomon; G. Moore; N. Lench; N. Shennan; R. Williamson

1987-01-01

textabstractWe present an approach to the construction of an overlapping restriction fragment map of a single human chromosome. A genomic cosmid library genome was constructed from a mouse-human hybrid cell line containing chromosome 17 as its only human genetic component. Cosmids containing human

Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

OpenAIRE

ÖZKUL, Aykut

2002-01-01

In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

International Nuclear Information System (INIS)

Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

2007-01-01

Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

Directory of Open Access Journals (Sweden)

Zhao Jianjun

2011-02-01

Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

Directory of Open Access Journals (Sweden)

Phoebe A Chapman

Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

Science.gov (United States)

Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

2012-10-01

A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

IDENTIFICATION OF GH|ALUI AND GHR|ALUI GENES POLYMORPHISMS IN INDONESIAN BUFFALO

Directory of Open Access Journals (Sweden)

E. Andreas

2014-10-01

Full Text Available Growth hormone (GH is an anabolic hormone which sintesized and secreted by somatrotop cell inpituitary anterior lobe. GH exert its effect on growth and metabolism by interacting with a specificreceptor on the surface of the target cells. Growth hormone receptor (GHR has been suggested ascandidate gene for traits related to meat production in Bovidae. The objectives of this study were toidentify polymorphism of GH and GHR genes in buffalo. The 452 DNA samples buffalo were collectedfrom five populations in Indonesia (Siborong-Borong-Medan (65, Lebak-Banten (29, Pandeglang-Banten (180, Semarang-Central Java, and Mataram-West Nusa Tenggara (103. A gene fragment of theGH|AluI gene at 432 bp located on exon 3 and GHR|AluI gene at 298 bp on exon 10 were successfullyamplified by using the techniques of a PCR (polymerase chain reaction and genotyped by PCR-RFLP(restriction fragment length polymorphism then -SSCP (single strand conformation polymorphism. Theresults showed no polymorphisms were detected in these genes. All buffaloes tested had LL genotype forlocus GH|AluI and AA genotype for locus GHR|AluI.

Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

Science.gov (United States)

Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

2013-09-27

Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Blood grouping based on PCR methods and agarose gel electrophoresis.

Science.gov (United States)

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

Science.gov (United States)

Boyko, Alex; Kovalchuk, Igor

2010-01-01

Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

Restriction fragment length polymorphism of the major histocompatibility complex of the dog.

Science.gov (United States)

Sarmiento, U M; Storb, R F

1988-01-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.

SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

Science.gov (United States)

Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

2017-12-18

Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first

ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

Science.gov (United States)

Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

2004-10-01

Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

The possibility of discriminating within the Bacillus cereus group using gyrB sequencing and PCR-RFLP

DEFF Research Database (Denmark)

Jensen, Gert B; Fisker, Niels; Sparsø, Thomas

2005-01-01

Based on a combination of PCR and restriction endonuclease (RE) digestion (PCR-RE digestion), we have examined the possibility of differentiating members of the Bacillus cereus group. Fragments of the gyrB gene (362 bp) from pure cultures of 12 B. cereus, 25 B. thuringiensis, 25 B. mycoides and two......, it was not possible to discriminate between the B. cereus and the B. thuringiensis strains using the methods described....

NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1989-01-01

The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

THE EXON 5, 6, 7, 8 OF P53 MUTATIONS IN ORAL SQUAMOUS CELLS CARCINOMA

Directory of Open Access Journals (Sweden)

Retno P Rahayu

2012-04-01

Full Text Available Genetic instability may underlie the etiology of multistep carcinogenesis. The altered p53 gene observed in tumors may represent the expression of such instability and may allow the accumulation of other gene alterations caused by multiple mechanism. p53 gene is the guardian of the genome, that is why we pay more attention to this gene. In this study, we evaluated the significance of p53 mutation in 55 patient with oral squamous carcinoma. Thirty among them underwent well-differentiated carcinoma, while the remaining 25 patients underwent poorly differentiated carcinoma. The mutations were detected by PCR-SSCP (Single strand Conformational Polymorphism analysis in the region between exon 5 and exon 8. The results indicated that the p53 mutation in exon 5 (40%, exon 6 (28%, exon 7 (24% and exon 8 (8% were associated with poorly differentiated carcinoma, whereas mutation in exon 5 (10%, exon 6 (30%, exon 7 (40% and exon 8 (20% were associated with well-differentiated carcinoma. These observations suggest that p53 mutation in exon 5, 6, and 7 have strong correlation with poorly differentiated in oral squamous carcinoma while well-differentiated level was related with mutation in exon 6,7 and 8.

Phenylalanine hydroxylase deficiency caused by a single base substitution in an exon of the human phenylalanine hydroxylase gene

International Nuclear Information System (INIS)

Lichter-Konecki, U.; Konecki, D.S.; DiLella, A.G.; Brayton, K.; Marvit, J.; Hahn, T.M.; Trefz, E.K.; Woo, S.L.C.

1988-01-01

A novel restriction fragment length polymorphism in the phenylalanine hydroxylase (PAH) locus generated by the restriction endonuclease MspI was observed in a German phenylketonuria (PKU) patient. Molecular cloning and DNA sequence analyses revealed that the MspI polymorphism was created by a T to C transition in exon 9 of the human PAH gene, which also resulted in the conversion of a leucine codon to proline codon. The effect of the amino acid substitution was investigated by creating a corresponding mutation in a full-length human PAD cDNA by site-directed mutagenesis followed by expression analysis in cultured mammalian cells. Results demonstrate that the mutation in the gene causes the synthesis of an unstable protein in the cell corresponding to a CRM - phenotype. Together with the other mutations recently reported in the PAH gene,the data support previous biochemical and clinical observations that PKU is a heterogeneous disorder at the gene level

Phenylalanine hydroxylase deficiency caused by a single base substitution in an exon of the human phenylalanine hydroxylase gene

Energy Technology Data Exchange (ETDEWEB)

Lichter-Konecki, U.; Konecki, D.S.; DiLella, A.G.; Brayton, K.; Marvit, J.; Hahn, T.M.; Trefz, E.K.; Woo, S.L.C.

1988-04-19

A novel restriction fragment length polymorphism in the phenylalanine hydroxylase (PAH) locus generated by the restriction endonuclease MspI was observed in a German phenylketonuria (PKU) patient. Molecular cloning and DNA sequence analyses revealed that the MspI polymorphism was created by a T to C transition in exon 9 of the human PAH gene, which also resulted in the conversion of a leucine codon to proline codon. The effect of the amino acid substitution was investigated by creating a corresponding mutation in a full-length human PAD cDNA by site-directed mutagenesis followed by expression analysis in cultured mammalian cells. Results demonstrate that the mutation in the gene causes the synthesis of an unstable protein in the cell corresponding to a CRM/sup -/ phenotype. Together with the other mutations recently reported in the PAH gene,the data support previous biochemical and clinical observations that PKU is a heterogeneous disorder at the gene level.

The sensitivity and efficacy method of PIK3CA exon 9 E545A as a high diagnostic accuracy in breast cancer

Directory of Open Access Journals (Sweden)

Desriani

2018-06-01

Full Text Available The phosphatidylinositol 3-kinases (PIK3s are lipid kinases. Mutation in the exon 9 and exon 20 determined as a predictive factor in anti-HER-2 therapy. In some countries, such as Singapore, China, and Peru, PIK3CA exon 9 E545A was reported to produce the highest rate of mutation. In this research, we developed and optimized PIK3CA exon 9 E545A detection methods with intercalating dye SYBR Green I based on the Tm Shift approach by using prepared recombinant plasmid pGEMT-easy PIK3CA exon 9 and PIK3CA exon 9 E545A. Recombinant plasmid was used due to the limited number of samples. Methods: Recombinant plasmid was prepared based on manufactured procedures, and this process was then followed by Tm prediction with Poland software, Tm Shift SYBR Green I development, and its characterization (reproducibility, repeatability, sensitivity, qPCR efficiency, and qPCR amplification, respectively. Result: A method for PIK3CA E545A detection based on TM shift SYBR Green I has been successfully developed. The melting temperature for PIK3CA exon 9 was 78.1 ± 0.1 °C, while that for PIK3CA exon E545A was 80.20 °C. The Tm of mutant was the same as that predicted using Polland Software. The reproducibility of the methods was high, with the coefficient values for inter and intra assays were below 10% with a high sensitivity at 1%, while R2 0.99 and PCR efficiency was 97.75%. Conclusion: The results presented here demonstrate that the PIK3CA exon 9 E545A detection method has a good sensitivity and efficacy assay, which proves that the method has a high diagnostic accuracy in breast cancer. Keywords: SYBR Green I, PIK3CA E545A, Breast cancer, Real time PCR, Recombinant plasmid

Identification of protein features encoded by alternative exons using Exon Ontology.

Science.gov (United States)

Tranchevent, Léon-Charles; Aubé, Fabien; Dulaurier, Louis; Benoit-Pilven, Clara; Rey, Amandine; Poret, Arnaud; Chautard, Emilie; Mortada, Hussein; Desmet, François-Olivier; Chakrama, Fatima Zahra; Moreno-Garcia, Maira Alejandra; Goillot, Evelyne; Janczarski, Stéphane; Mortreux, Franck; Bourgeois, Cyril F; Auboeuf, Didier

2017-06-01

Transcriptomic genome-wide analyses demonstrate massive variation of alternative splicing in many physiological and pathological situations. One major challenge is now to establish the biological contribution of alternative splicing variation in physiological- or pathological-associated cellular phenotypes. Toward this end, we developed a computational approach, named "Exon Ontology," based on terms corresponding to well-characterized protein features organized in an ontology tree. Exon Ontology is conceptually similar to Gene Ontology-based approaches but focuses on exon-encoded protein features instead of gene level functional annotations. Exon Ontology describes the protein features encoded by a selected list of exons and looks for potential Exon Ontology term enrichment. By applying this strategy to exons that are differentially spliced between epithelial and mesenchymal cells and after extensive experimental validation, we demonstrate that Exon Ontology provides support to discover specific protein features regulated by alternative splicing. We also show that Exon Ontology helps to unravel biological processes that depend on suites of coregulated alternative exons, as we uncovered a role of epithelial cell-enriched splicing factors in the AKT signaling pathway and of mesenchymal cell-enriched splicing factors in driving splicing events impacting on autophagy. Freely available on the web, Exon Ontology is the first computational resource that allows getting a quick insight into the protein features encoded by alternative exons and investigating whether coregulated exons contain the same biological information. © 2017 Tranchevent et al.; Published by Cold Spring Harbor Laboratory Press.

Determination of exon 7 SMN1 deletion in Iranian patients and ...

Indian Academy of Sciences (India)

In consideration of these defects and in line with the latter references, we have ... master mix (Roche, Mannheim, Germany), 5 ng of genomic. DNA, and 10 pmol of .... PCR test which can evaluate comprehensively the status of. SMN1 exon 7 ...

Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

Directory of Open Access Journals (Sweden)

Jorge S.B.

2003-01-01

Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

DNA amplification of a further exon of Duchenne muscular dystrophy locus increase possibilities for deletion screening

Energy Technology Data Exchange (ETDEWEB)

Speer, A.; Rosenthal, A.; Billwitz, H.; Hanke, R.; Forrest, S.M; Love, D.; Davies, K.E.; Coutelle, C. (John Radcliffe Hospital, Oxford (England))

1989-06-26

The data of Chamberlain et al allow the detection of 76% of deletions in the region Cf56A/Cf23a identified by hybridization in their patients. The authors have generated two oligonucleotides allowing the amplification of a further exon which is included in the 3.4 kb hybridization of fragment of Cf56a. This exon is deleted in about 10% of their patients.

Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

Directory of Open Access Journals (Sweden)

Kane L Greer

2014-01-01

Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

Polymorphism of κ-Casein in Italian Goat Breeds: A New ACRS-PCR Designed DNA Test for Discrimination of A and B Alleles

Directory of Open Access Journals (Sweden)

Vlatka Cubric-Curik

2002-01-01

Full Text Available The objective of this study was to develop a DNA test for rapid characterisation of goat κ-casein (κ-CN A and B variants and to study this polymorphism in Italian goat breeds. Genetic polymorphism of κ-CN gene was, in addition to isoelectric focusing, analysed according to a new technique designated as amplification created restriction site. Two alleles that differ in one nucleotide mutation (G Ø A in exon 4 were characterised. The 167-bp PCR product surrounding the nucleotide mutation was amplified from genomic DNA and the PCR product was digested with MaeIII. After digestion the A allele gives three fragments of 77, 65 and 25 bp in comparison with the B allele which gives two fragments of 90 and 77 bp. The analysis of allele frequency distribution at κ-CN locus, based on 401 individual samples, revealed significant differences among three goat breeds from the north of Italy (Nera di Verzasca, Frontalasca and Alpine with frequency of κ-CN B allele around 0.3, versus two goat breeds from the south of Italy (Maltese and Sarda with frequency of κ-CN B allele around 0.5. While two goat breeds (Maltese and Nera di Verzasca did not show significant deviations from the Hardy-Weinberg equilibrium, a highly significant excess of heterozygote genotype (AB was observed in Alpine, Frontalasca and Sarda goats. Here the developed DNA method and observed relatively high frequency of κ-CN B allele give a prerequisite for the assessment of research related to the simultaneous estimation of the effects of composite αs1/κ-CN genotypes on milk production and cheese-making properties.

ExonMiner: Web service for analysis of GeneChip Exon array data

Directory of Open Access Journals (Sweden)

Imoto Seiya

2008-11-01

Full Text Available Abstract Background Some splicing isoform-specific transcriptional regulations are related to disease. Therefore, detection of disease specific splice variations is the first step for finding disease specific transcriptional regulations. Affymetrix Human Exon 1.0 ST Array can measure exon-level expression profiles that are suitable to find differentially expressed exons in genome-wide scale. However, exon array produces massive datasets that are more than we can handle and analyze on personal computer. Results We have developed ExonMiner that is the first all-in-one web service for analysis of exon array data to detect transcripts that have significantly different splicing patterns in two cells, e.g. normal and cancer cells. ExonMiner can perform the following analyses: (1 data normalization, (2 statistical analysis based on two-way ANOVA, (3 finding transcripts with significantly different splice patterns, (4 efficient visualization based on heatmaps and barplots, and (5 meta-analysis to detect exon level biomarkers. We implemented ExonMiner on a supercomputer system in order to perform genome-wide analysis for more than 300,000 transcripts in exon array data, which has the potential to reveal the aberrant splice variations in cancer cells as exon level biomarkers. Conclusion ExonMiner is well suited for analysis of exon array data and does not require any installation of software except for internet browsers. What all users need to do is to access the ExonMiner URL http://ae.hgc.jp/exonminer. Users can analyze full dataset of exon array data within hours by high-level statistical analysis with sound theoretical basis that finds aberrant splice variants as biomarkers.

Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique

Directory of Open Access Journals (Sweden)

Hyoung Rai Ko

2017-09-01

Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.

Comparative evaluation of the nested ITS PCR against the 18S PCR-RFLP in a survey of bovine trypanosomiasis in Kwale County, Kenya.

Science.gov (United States)

Odongo, Steven; Delespaux, Vincent; Ngotho, Maina; Bekkele, Serkalem Mindaye; Magez, Stefan

2016-09-01

We compared the nested internal transcribed spacer (ITS) PCR and the 18S PCR-RFLP (restriction-fragment length polymorphism) pan-trypanosome assays in a cross-sectional survey of bovine trypanosomiasis in 358 cattle in Kwale County, Kenya. The prevalence of trypanosomiasis as determined by the nested ITS PCR was 19.6% (70/358) and by 18S PCR-RFLP was 16.8% (60/358). Of the pathogenic trypanosomes detected, the prevalence of Trypanosoma congolense and Trypanosoma vivax was greater than that of Trypanosoma simiae The nested ITS PCR detected 83 parasite events, whereas the 18S PCR-RFLP detected 64; however, overall frequencies of infections and the parasite events detected did not differ between the assays (χ(2) = 0.8, df = 1, p > 0.05 and χ(2) = 2.5, df = 1, p > 0.05, respectively). The kappa statistic (0.8) showed good agreement between the tests. The nested ITS PCR and the 18S PCR-RFLP had comparable sensitivity, although the nested ITS PCR was better at detecting mixed infections (χ(2) = 5.4, df = 1, p < 0.05). © 2016 The Author(s).

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

International Nuclear Information System (INIS)

Jackson, Christopher B.; Gallati, Sabina; Schaller, André

2012-01-01

Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

Energy Technology Data Exchange (ETDEWEB)

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

2012-07-06

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene.

Science.gov (United States)

Kumar, Deepak; Singh, S P; Karabasanavar, Nagappa S; Singh, Rashmi; Umapathi, V

2014-11-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168-776 bp) of mitochondrial cytochrome-b (cytb) gene for targeted species was designed which yielded a 609 bp PCR amplicon. Further, restriction enzyme digestion of the amplicons with Alu1 and Taq1 restriction enzymes resulted in a distinctive digestion pattern that was able to discriminate each species. The repeatability of the PCR-RFLP assay was validated ten times with consistent results observed. The developed assay can be used in routine diagnostic laboratories to differentiate the meats of closely related domestic livestock species namely cattle from buffalo and sheep from goat.

Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

DEFF Research Database (Denmark)

Helweg-Larsen, J; Eugen-Olsen, Jesper; Lundgren, B

2000-01-01

are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

Science.gov (United States)

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping

Directory of Open Access Journals (Sweden)

Chang Hsueh-Wei

2010-04-01

Full Text Available Abstract Background PCR-restriction fragment length polymorphism (RFLP assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. Results The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels, gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. Conclusions The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.

SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping.

Science.gov (United States)

Chang, Hsueh-Wei; Cheng, Yu-Huei; Chuang, Li-Yeh; Yang, Cheng-Hong

2010-04-08

PCR-restriction fragment length polymorphism (RFLP) assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels), gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.

A G {r_arrow} A transition at position IVS-11 +1 of the HEX A {alpha}-chain gene in a non-Ashkenazic Mexican Tay-Sachs infant

Energy Technology Data Exchange (ETDEWEB)

Miranda, S.R.P.; Gwon, S.; DeGasperi, R. [New York Univ. Medical Center, NY (United States)] [and others

1994-09-01

Tay-Sachs disease (TSD) is an autosomal recessive storage disorder caused by a deficiency of the lysosomal enzyme, {beta}-N-acetylhexosaminidase A (Hex A), a heteropolymer composed of two polypeptides, {alpha} and {beta}. Mutations in the {alpha}-chain gene render the enzyme defective, resulting in the accumulation of g{sub m2} ganglioside in the nervous system. Deficiency of Hex A was detected in a non-Ashkenazic girl of Mexican origin indicating infantile onset of TSD. Molecular investigation of the {alpha}-chain gene excluded the typical Ashkenazic 4 bp insertion in the exon 11 and the intron 12 splice-junction mutations by Hae III and Dde I restriction analysis, respectively. Single strand conformation polymorphism (SSCP) analysis showed a different pattern in the sample where exon 11 and flanking regions were amplified in the patient DNA as compared to the migration of control DNA. Sequencing of PCR amplified genomic DNA containing exon 11 and flanking intronic regions showed a single base substitution (G {r_arrow} A) at position IVS-11 +1. This mutation creates a recognition site for the restriction enzyme Mbo II. Digestion of exon 11 and flanking regions with Mbo II demonstrated homozygosity of the patient for this mutation and heterozygosity in the mother. mRNA from cultured fibroblasts obtained from a normal control and from the propositus was reverse transcribed. The cDNAs coding for Hex A {alpha}-chain were amplified in four overlapping fragments. In the patient sample it was not possible to amplify the fragment containing the exon 11/intron 11 junction, indicating that this mutation alters normal RNA processing of the Hex A pre-mRNA resulting in the deficiency of Hex A activity.

Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

Energy Technology Data Exchange (ETDEWEB)

Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

1999-09-01

Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

Energy Technology Data Exchange (ETDEWEB)

Williams, S.D.

1989-01-01

Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

International Nuclear Information System (INIS)

Williams, S.D.

1989-01-01

Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

Science.gov (United States)

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

Science.gov (United States)

K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

1994-01-01

A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

Science.gov (United States)

Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

1991-01-01

Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

NARCIS (Netherlands)

ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

High resolution melting for mutation scanning of TP53 exons 5–8

International Nuclear Information System (INIS)

Krypuy, Michael; Dobrovic, Alexander; Ahmed, Ahmed Ashour; Etemadmoghadam, Dariush; Hyland, Sarah J; Australian Ovarian Cancer Study Group; Fazio, Anna de; Fox, Stephen B; Brenton, James D; Bowtell, David D

2007-01-01

p53 is commonly inactivated by mutations in the DNA-binding domain in a wide range of cancers. As mutant p53 often influences response to therapy, effective and rapid methods to scan for mutations in TP53 are likely to be of clinical value. We therefore evaluated the use of high resolution melting (HRM) as a rapid mutation scanning tool for TP53 in tumour samples. We designed PCR amplicons for HRM mutation scanning of TP53 exons 5 to 8 and tested them with DNA from cell lines hemizygous or homozygous for known mutations. We assessed the sensitivity of each PCR amplicon using dilutions of cell line DNA in normal wild-type DNA. We then performed a blinded assessment on ovarian tumour DNA samples that had been previously sequenced for mutations in TP53 to assess the sensitivity and positive predictive value of the HRM technique. We also performed HRM analysis on breast tumour DNA samples with unknown TP53 mutation status. One cell line mutation was not readily observed when exon 5 was amplified. As exon 5 contained multiple melting domains, we divided the exon into two amplicons for further screening. Sequence changes were also introduced into some of the primers to improve the melting characteristics of the amplicon. Aberrant HRM curves indicative of TP53 mutations were observed for each of the samples in the ovarian tumour DNA panel. Comparison of the HRM results with the sequencing results revealed that each mutation was detected by HRM in the correct exon. For the breast tumour panel, we detected seven aberrant melt profiles by HRM and subsequent sequencing confirmed the presence of these and no other mutations in the predicted exons. HRM is an effective technique for simple and rapid scanning of TP53 mutations that can markedly reduce the amount of sequencing required in mutational studies of TP53

Co-dominant expression of the HLA-G gene and various forms of alternatively spliced HLA-G mRNA in human first trimester trophoblast

DEFF Research Database (Denmark)

Hviid, T V; Møller, C; Sørensen, S

1998-01-01

imprinting of the HLA-G locus could have implications for the interaction in the feto-maternal relationship. Restriction Fragment Length Polymorphism (RFLP), allele-specific amplification and Single Strand Conformation Polymorphism (SSCP) analysis followed by DNA sequencing were performed on Reverse...... Transcription (RT) Polymerase Chain Reaction (PCR) products of HLA-G mRNA to examine the expression of maternal and paternal alleles. Our results demonstrate that HLA-G is co-dominantly expressed in first trimester trophoblast cells. A "new" non-synonymous base substitution in exon 4 was detected. We also...

Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

Science.gov (United States)

Kline, Margaret C; Romsos, Erica L; Duewer, David L

2016-02-16

Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

Restriction Fragment Pattern (RFP) analysis of genomes from Danish isolates of Suid herpesvirus 1 (Aujeszky's disease virus)

DEFF Research Database (Denmark)

Christensen, Laurids Siig; Sørensen, K. J.; Lei, J. C.

1987-01-01

Purified DNA from 42 isolates of Suid herpesvirus 1 (SHV-1) collected during 1985 from clinical outbreaks of Aujezsky's disease on Danish farms was compared by restriction fragment pattern (RFP) analysis. The BamHI generated RFPs were found to be distinguishable, thus confirming RFP analysis...

Growth hormone receptor exon 3 isoforms may have no importance in the clinical setting of multiethnic Brazilian acromegaly patients.

Science.gov (United States)

de Oliveira Machado, Evelyn; Lima, Carlos Henrique Azeredo; Ogino, Liana Lumi; Kasuki, Leandro; Gadelha, Mônica R

2016-08-01

Acromegaly is associated with significant morbidity and increased mortality, but has a variable severity phenotype. The presence of the exon 3-deleted isoform of the growth hormone receptor (d3-GHR) may influence the disease phenotype and treatment outcomes, including the frequency of biochemical discordance after medical treatment. The objective of this study was to analyze the influence of the d3-GHR isoform on clinical and biochemical characteristics and in the treatment outcomes of Brazilian multiethnic acromegaly patients. We retrospectively analyzed our acromegaly outpatient clinic databank and collected demographic, clinical, biochemical and treatment outcome data from those patients who agreed to participate in the study. A blood sample was collected from all patients, the DNA was extracted and the GHR isoforms were evaluated by PCR, with the full length (fl)-GHR represented by a 935-bp fragment and the d3-GHR represented by a 532-bp fragment. A total of 121 patients were included. Fifty-six patients (46.3 %) were full-length homozygous (fl/fl), 48 (39.7 %) were heterozygous (fl/d3) and 17 (14.0 %) were d3-GHR homozygous (d3/d3). There was no difference between patients homozygous for the fl isoform and those harboring at least one d3-GHR allele in the demographic, clinical and biochemical data or in the treatment outcomes, including somatostatin receptor ligands (SRL) monotherapy, combination therapy with SRL and cabergoline and pegvisomant treatment. There was also no difference between the groups for the frequency of GH and IGF-I discordance after medical treatment. GHR exon 3 genotyping appears to have no clinical significance, at least in Brazilian acromegaly patients.

MET amplification, expression, and exon 14 mutations in colorectal adenocarcinoma.

Science.gov (United States)

Zhang, Meng; Li, Guichao; Sun, Xiangjie; Ni, Shujuan; Tan, Cong; Xu, Midie; Huang, Dan; Ren, Fei; Li, Dawei; Wei, Ping; Du, Xiang

2018-04-08

MET amplification, expression, and splice mutations at exon 14 result in dysregulation of the MET signaling pathway. The aim of this study was to identify the relationship between MET amplification, protein or mRNA expression, and mutations in colorectal cancer (CRC). MET immunohistochemistry (IHC) was used for MET protein expression analysis and fluorescence in situ hybridization (FISH) was used for MET amplification detection. Both analyses were performed in tissue microarrays (TMA) containing 294 of colorectal adenocarcinoma tissue samples and 131 samples of adjacent normal epithelial tissue. MET mRNA expression was examined by real-time quantitative polymerase chain reaction (qRT-PCR) in 72 fresh colorectal adenocarcinoma tissue samples and adjacent normal colon tissue. PCR sequencing was performed to screen for MET exon 14 splice mutations in 59 fresh CRC tissue samples. Our results showed that MET protein expression was higher in colorectal tumor tissue than in adjacent normal intestinal epithelium. Positive MET protein expression was associated with significantly poorer overall survival (OS) and disease-free survival (DFS). Multivariate analysis revealed that positive MET protein expression was an independent risk factor for DFS, but not for OS. MET mRNA expression was upregulated in tumor tissues compared with the adjacent normal tissues. The incidence of MET amplification was 4.4%. None of the patients was positive for MET mutation. Collectively, MET was overexpressed in colorectal adenocarcinoma, and its positive protein expression predicted a poorer outcome in CRC patients. Furthermore, according to our results, MET amplification and 14 exon mutation are extremely rare events in colorectal adenocarcinoma. Copyright © 2018. Published by Elsevier Inc.

Molecular Characterization of Leishmania Parasites in Giemsa-Stained Slides from Cases of Human Cutaneous and Visceral Leishmaniasis, Eastern Algeria.

Science.gov (United States)

Beldi, Nadia; Mansouri, Roukaya; Bettaieb, Jihene; Yaacoub, Alia; Souguir Omrani, Hejer; Saadi Ben Aoun, Yusr; Saadni, Farida; Guizani, Ikram; Guerbouj, Souheila

2017-06-01

In Algeria, visceral leishmaniasis (VL) is due to Leishmania (L.) infantum, while three cutaneous forms (CL) are caused by Leishmania major, Leishmania tropica and Leishmania infantum. In this study, the use of Giemsa-stained slides was evaluated with two PCR techniques, in Eastern Algeria. A total of 136 samples corresponding to 100 CL smears (skin scrapings) and 36 VL slides (bone marrow aspirates) collected from 2008 to 2014 were tested. Upon DNA extraction, two PCRs were used to amplify the ribosomal Internal Transcribed Spacer 1 (ITS1) and mini-exon genes. Amplified products were digested (PCR-RFLP) and profiles analyzed for Leishmania species identification. A statistical analysis was also performed. ITS1-PCR was found significantly more sensitive than mini-exon-PCR (77.95% positives vs. 67.65%; p = 0.001). Comparison of PCR positivity showed statistically significant differences between old and recently prepared slides suggesting a better use of recent slides in PCR analyses. For species identification, PCR-restriction fragment length polymorphism (RFLP) results of ITS1 and mini-exon were concordant. L. infantum was identified from VL cases and L. infantum, L. major, and L. tropica from CL ones. According to geographical origin, L. infantum was found in North-Eastern provinces, while L. major was distributed from the North to the Center-East of Algeria. Interestingly, two L. tropica samples were identified in Annaba, located far North-East Algeria. Distribution of leishmaniasis in Eastern parts of Algeria, besides finding of L. tropica in the far North, is in this study described for the first time using molecular tools, thus confirming the usefulness of slides for PCR identification of Leishmania parasites in retrospective epidemiological investigations.

Delineation of the Marfan phenotype associated with mutations in exons 23-32 of the FBN1 gene

Energy Technology Data Exchange (ETDEWEB)

Putnam, E.A.; Cho, M.; Milewicz, D.M. [Univ. of Texas-Houston Medical School, Houston, TX (United States)] [and others

1996-03-29

Marfan syndrome is a dominantly inherited connective tissue disorder with a wide range of phenotypic severity. The condition is the result of mutations in FBN1, a large gene composed of 65 exons encoding the fibrillin-1 protein. While mutations causing classic manifestations of Marfan syndrome have been identified throughout the FBN1 gene, the six previously characterized mutations resulting in the severe, perinatal lethal form of Marfan syndrome have clustered in exons 24-32 of the gene. We screened 8 patients with either neonatal Marfan syndrome or severe cardiovascular complications of Marfan syndrome for mutations in this region of the gene. Using intron-based exon-specific primers, we amplified exons 23-32 from genomic DNAs, screened these fragments by single-stranded conformational polymorphism analysis, and sequenced indicated exons. This analysis documented mutations in exons 25-27 of the FBN1 mutations in 6 of these patients. These results, taken together with previously published FBN1 mutations in this region, further define the phenotype associated with mutations in exons 24-32 of the FBN1 gene, information important for the development of possible diagnostic tests and genetic counseling. 49 refs., 4 figs., 2 tabs.

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

Directory of Open Access Journals (Sweden)

Milbury Coren A

2010-09-01

Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS

Directory of Open Access Journals (Sweden)

Tülin GÜVEN GÖKMEN

Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.

Analysis of Prolactin Gene Exon 4 Diversity in Peking, White Mojosari, and Peking White Mojosari Crossbreed

Directory of Open Access Journals (Sweden)

M. Indriati

2016-04-01

Full Text Available Genetic marker linked to loci reproductive traits could be used to increase an effectiveness of improvement in animal breeding. Association between DNA polymorphism and a trait could be considered as candidate genetic marker for marker assisted selection (MAS programs. Prolactin (PRL is one of polypeptide hormones secreted by anterior pituitary gland in vertebrates. PRL plays an important role in onset of poultry incubation and brooding behavior. The aim of this study was to investigate the diversity of prolactin gene and to characterize the type of mutation in partial intron 3, intron 4 and exon 4 of duck prolactin gene. Blood extraction was collected from 168 ducks consisted of 19 Peking, 36 Mojosari, and 113 Peking White Mojosari (Peking Mojosari putih ducks. Polymerase chain reaction of fragment prolactin gene exon 4 and partial intron 3 and 4 have been successfully amplified with length of base pair were 496 bp. A total of 30 µL PCR product from each sample were sequenced for forward sequence using BIOTRACE 3730 by First Base Company, Malaysia. Alignment analysis found six SNP consisted of g.3941T>G, g.3975C>A, g.4110T>C, INDEL 3724A, INDEL 34031, and INDEL 3939A. Analysis of SNP frequency result indicated mutation of INDEL 3724A, g.3941T>G, g.3975C>A, INDEL 4031A and g.4110T>A in duck sample were polymorphic and INDEL 3939A were monomorphic.

KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

Directory of Open Access Journals (Sweden)

Gusti Ngurah Permana

2016-11-01

The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

Differentiation of Toxocara canis and Toxocara cati based on PCR-RFLP analyses of rDNA-ITS and mitochondrial cox1 and nad1 regions.

Science.gov (United States)

Mikaeili, Fattaneh; Mathis, Alexander; Deplazes, Peter; Mirhendi, Hossein; Barazesh, Afshin; Ebrahimi, Sepideh; Kia, Eshrat Beigom

2017-09-26

The definitive genetic identification of Toxocara species is currently based on PCR/sequencing. The objectives of the present study were to design and conduct an in silico polymerase chain reaction-restriction fragment length polymorphism method for identification of Toxocara species. In silico analyses using the DNASIS and NEBcutter softwares were performed with rDNA internal transcribed spacers, and mitochondrial cox1 and nad1 sequences obtained in our previous studies along with relevant sequences deposited in GenBank. Consequently, RFLP profiles were designed and all isolates of T. canis and T. cati collected from dogs and cats in different geographical areas of Iran were investigated with the RFLP method using some of the identified suitable enzymes. The findings of in silico analyses predicted that on the cox1 gene only the MboII enzyme is appropriate for PCR-RFLP to reliably distinguish the two species. No suitable enzyme for PCR-RFLP on the nad1 gene was identified that yields the same pattern for all isolates of a species. DNASIS software showed that there are 241 suitable restriction enzymes for the differentiation of T. canis from T. cati based on ITS sequences. RsaI, MvaI and SalI enzymes were selected to evaluate the reliability of the in silico PCR-RFLP. The sizes of restriction fragments obtained by PCR-RFLP of all samples consistently matched the expected RFLP patterns. The ITS sequences are usually conserved and the PCR-RFLP approach targeting the ITS sequence is recommended for the molecular differentiation of Toxocara species and can provide a reliable tool for identification purposes particularly at the larval and egg stages.

Development and validation of PCR-based assays for diagnosis of American cutaneous leishmaniasis and identificatio nof the parasite species

Directory of Open Access Journals (Sweden)

Grazielle Cardoso da Graça

2012-08-01

Full Text Available In this study, PCR assays targeting different Leishmania heat-shock protein 70 gene (hsp70 regions, producing fragments ranging in size from 230-390 bp were developed and evaluated to determine their potential as a tool for the specific molecular diagnosis of cutaneous leishmaniasis (CL. A total of 70 Leishmania strains were analysed, including seven reference strains (RS and 63 previously typed strains. Analysis of the RS indicated a specific region of 234 bp in the hsp70 gene as a valid target that was highly sensitive for detection of Leishmania species DNA with capacity of distinguishing all analyzed species, after polymerase chain reaction-restriction fragment length polymorfism (PCR-RFLP. This PCR assay was compared with other PCR targets used for the molecular diagnosis of leishmaniasis: hsp70 (1400-bp region, internal transcribed spacer (ITS1 and glucose-6-phosphate dehydrogenase (G6pd. A good agreement among the methods was observed concerning the Leishmania species identification. Moreover, to evaluate the potential for molecular diagnosis, we compared the PCR targets hsp70-234 bp, ITS1, G6pd and mkDNA using a panel of 99 DNA samples from tissue fragments collected from patients with confirmed CL. Both PCR-hsp70-234 bp and PCR-ITS1 detected Leishmania DNA in more than 70% of the samples. However, using hsp70-234 bp PCR-RFLP, identification of all of the Leishmania species associated with CL in Brazil can be achieved employing a simpler and cheaper electrophoresis protocol.

Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons

Science.gov (United States)

Gelfman, Sahar; Burstein, David; Penn, Osnat; Savchenko, Anna; Amit, Maayan; Schwartz, Schraga; Pupko, Tal; Ast, Gil

2012-01-01

Exon–intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon–intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstructed the ancestral motifs of both 3′ and 5′ splice sites, as also the ancestral length of exons and introns. Our analyses suggest that vertebrate introns increased in length from the shortest ancestral introns to the longest primate introns. An evolutionary analysis of splice sites revealed that weak splice sites act as a restrictive force keeping introns short. In contrast, strong splice sites allow recognition of exons flanked by long introns. Reconstruction of the ancestral state suggests these phenomena were not prevalent in the vertebrate ancestor, but appeared during vertebrate evolution. By calculating evolutionary rate shifts in exons, we identified cis-acting regulatory sequences that became fixed during the transition from early vertebrates to mammals. Experimental validations performed on a selection of these hexamers confirmed their regulatory function. We additionally revealed many features of exons that can discriminate alternative from constitutive exons. These features were integrated into a machine-learning approach to predict whether an exon is alternative. Our algorithm obtains very high predictive power (AUC of 0.91), and using these predictions we have identified and successfully validated novel alternatively spliced exons. Overall, we provide novel insights regarding the evolutionary constraints acting upon exons and their recognition by the splicing machinery. PMID:21974994

Computer analysis of protein functional sites projection on exon structure of genes in Metazoa.

Science.gov (United States)

Medvedeva, Irina V; Demenkov, Pavel S; Ivanisenko, Vladimir A

2015-01-01

Study of the relationship between the structural and functional organization of proteins and their coding genes is necessary for an understanding of the evolution of molecular systems and can provide new knowledge for many applications for designing proteins with improved medical and biological properties. It is well known that the functional properties of proteins are determined by their functional sites. Functional sites are usually represented by a small number of amino acid residues that are distantly located from each other in the amino acid sequence. They are highly conserved within their functional group and vary significantly in structure between such groups. According to this facts analysis of the general properties of the structural organization of the functional sites at the protein level and, at the level of exon-intron structure of the coding gene is still an actual problem. One approach to this analysis is the projection of amino acid residue positions of the functional sites along with the exon boundaries to the gene structure. In this paper, we examined the discontinuity of the functional sites in the exon-intron structure of genes and the distribution of lengths and phases of the functional site encoding exons in vertebrate genes. We have shown that the DNA fragments coding the functional sites were in the same exons, or in close exons. The observed tendency to cluster the exons that code functional sites which could be considered as the unit of protein evolution. We studied the characteristics of the structure of the exon boundaries that code, and do not code, functional sites in 11 Metazoa species. This is accompanied by a reduced frequency of intercodon gaps (phase 0) in exons encoding the amino acid residue functional site, which may be evidence of the existence of evolutionary limitations to the exon shuffling. These results characterize the features of the coding exon-intron structure that affect the functionality of the encoded protein and

Molecular discrimination of Echinococcus granulosus and Echinococcus multilocularis by sequencing and a new PCR-RFLP method with the potential use for other Echinococcus species

OpenAIRE

ŞAKALAR, Çağrı; KUK, Salih; ERENSOY, Ahmet; DAĞLI, Adile Ferda; ÖZERCAN, İbrahim Hanifi

2015-01-01

To develop a novel polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol using a new genomic marker sequence and a novel set of restriction enzymes in order to detect and discriminate 2 Echinococcus species, E. granulosus and E. multilocularis, found in formalin-fixed paraffin-embedded (FFPE) human tissues. Materials and methods: DNA was isolated from 11 FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis. A mitochondrial...

Molecular discrimination of Echinococcus granulosus and Echinococcus multilocularis by sequencing and a new PCR-RFLP method with the potential use for other Echinococcus species.

Science.gov (United States)

Şakalar, Çağrı; Kuk, Salih; Erensoy, Ahmet; Dağli, Adile Ferda; Özercan, İbrahim Hanifi; Çetınkaya, Ülfet; Yazar, Süleyman

2014-01-01

To develop a novel polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol using a new genomic marker sequence and a novel set of restriction enzymes in order to detect and discriminate 2 Echinococcus species, E. granulosus and E. multilocularis, found in formalin-fixed paraffin-embedded (FFPE) human tissues. DNA was isolated from 11 FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis. A mitochondrial genomic marker region was amplified and sequenced using a novel primer pair and a new PCR-RFLP protocol was developed for the detection and discrimination of E. granulosus and E. multilocularis using a set of restriction enzymes including AccI, MboI, MboII, and TsoI. The selected marker region was amplified using DNA isolated from FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis and the discrimination of E. granulosus and E. multilocularis was accomplished by use of the novel PCR-RFLP method. In this PCR-RFLP protocol, use of any single restriction enzyme is enough for the discrimination of E. granulosus and E. multilocularis. The PCR-RFLP protocol can be potentially used for the discrimination of 5 other Echinococcus species: E. oligarthus, E. shiquicus, E. ortleppi, E. canadensis, and E. vogeli.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

Science.gov (United States)

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Next-generation sequencing of multiple individuals per barcoded library by deconvolution of sequenced amplicons using endonuclease fragment analysis

DEFF Research Database (Denmark)

Andersen, Jeppe D; Pereira, Vania; Pietroni, Carlotta

2014-01-01

The simultaneous sequencing of samples from multiple individuals increases the efficiency of next-generation sequencing (NGS) while also reducing costs. Here we describe a novel and simple approach for sequencing DNA from multiple individuals per barcode. Our strategy relies on the endonuclease...... digestion of PCR amplicons prior to library preparation, creating a specific fragment pattern for each individual that can be resolved after sequencing. By using both barcodes and restriction fragment patterns, we demonstrate the ability to sequence the human melanocortin 1 receptor (MC1R) genes from 72...... individuals using only 24 barcoded libraries....

Exon-primed intron-crossing (EPIC markers for non-model teleost fishes

Directory of Open Access Journals (Sweden)

Riethoven Jean-Jack M

2010-03-01

Full Text Available Abstract Background Exon-primed intron-crossing (EPIC markers have three advantages over anonymous genomic sequences in studying evolution of natural populations. First, the universal primers designed in exon regions can be applied across a broad taxonomic range. Second, the homology of EPIC-amplified sequences can be easily determined by comparing either their exon or intron portion depending on the genetic distance between the taxa. Third, having both the exon and intron fragments could help in examining genetic variation at the intraspecific and interspecific level simultaneously, particularly helpful when studying species complex. However, the paucity of EPIC markers has hindered multilocus studies using nuclear gene sequences, particularly in teleost fishes. Results We introduce a bioinformatics pipeline for developing EPIC markers by comparing the whole genome sequences between two or more species. By applying this approach on five teleost fishes whose genomes were available in the Ensembl database http://www.ensembl.org, we identified 210 EPIC markers that have single-copy and conserved exon regions with identity greater than 85% among the five teleost fishes. We tested 12 randomly chosen EPIC markers in nine teleost species having a wide phylogenetic range. The success rate of amplifying and sequencing those markers varied from 44% to 100% in different species. We analyzed the exon sequences of the 12 EPIC markers from 13 teleosts. The resulting phylogeny contains many traditionally well-supported clades, indicating the usefulness of the exon portion of EPIC markers in reconstructing species phylogeny, in addition to the value of the intron portion of EPIC markers in interrogating the population history. Conclusions This study illustrated an effective approach to develop EPIC markers in a taxonomic group, where two or more genome sequences are available. The markers identified could be amplified across a broad taxonomic range of teleost

Folding Landscape of Mutant Huntingtin Exon1: Diffusible Multimers, Oligomers and Fibrils, and No Detectable Monomer.

Directory of Open Access Journals (Sweden)

Bankanidhi Sahoo

Full Text Available Expansion of the polyglutamine (polyQ track of the Huntingtin (HTT protein above 36 is associated with a sharply enhanced risk of Huntington's disease (HD. Although there is general agreement that HTT toxicity resides primarily in N-terminal fragments such as the HTT exon1 protein, there is no consensus on the nature of the physical states of HTT exon1 that are induced by polyQ expansion, nor on which of these states might be responsible for toxicity. One hypothesis is that polyQ expansion induces an alternative, toxic conformation in the HTT exon1 monomer. Alternative hypotheses posit that the toxic species is one of several possible aggregated states. Defining the nature of the toxic species is particularly challenging because of facile interconversion between physical states as well as challenges to identifying these states, especially in vivo. Here we describe the use of fluorescence correlation spectroscopy (FCS to characterize the detailed time and repeat length dependent self-association of HTT exon1-like fragments both with chemically synthesized peptides in vitro and with cell-produced proteins in extracts and in living cells. We find that, in vitro, mutant HTT exon1 peptides engage in polyQ repeat length dependent dimer and tetramer formation, followed by time dependent formation of diffusible spherical and fibrillar oligomers and finally by larger, sedimentable amyloid fibrils. For expanded polyQ HTT exon1 expressed in PC12 cells, monomers are absent, with tetramers being the smallest molecular form detected, followed in the incubation time course by small, diffusible aggregates at 6-9 hours and larger, sedimentable aggregates that begin to build up at 12 hrs. In these cell cultures, significant nuclear DNA damage appears by 6 hours, followed at later times by caspase 3 induction, mitochondrial dysfunction, and cell death. Our data thus defines limits on the sizes and concentrations of different physical states of HTT exon1 along the

Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

Directory of Open Access Journals (Sweden)

Shomron Noam

2007-11-01

Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

Suitability of PCR fingerprinting, infrequent-restriction-site PCR, and pulsed-field gel electrophoresis, combined with computerized gel analysis, in library typing of Salmonella enterica serovar enteritidis

DEFF Research Database (Denmark)

Garaizar, J.; Lopez-Molina, N.; Laconcha, I.

2000-01-01

Strains of Salmonella enterica (n = 212) of different serovars and phage types were used to establish a library typing computerized system for serovar Enteritidis on the basis of PCR fingerprinting, infrequent-restriction-site PCR (IRS-PCR), or pulsed-field gel electrophoresis (PFGE). The rate...... showed an intercenter reproducibility value of 93.3%. The high reproducibility of PFGE combined with the previously determined high discrimination directed its use for library typing. The use of PFGE with enzymes XbaI, BlnI, and SpeI for library typing of serovar Enteritidis was assessed with GelCompar 4.......0 software, Three computer libraries of PFGE DNA profiles were constructed, and their ability to recognize new DNA profiles was analyzed. The results obtained pointed out that the combination of PFGE with computerized analysis could be suitable in long-term epidemiological comparison and surveillance...

Development of Quantitative Competitive PCR and Absolute Based Real-Time PCR Assays for Quantification of The Butyrate Producing Bacterium: Butyrivibrio fibrisolvens

Directory of Open Access Journals (Sweden)

Mojtaba Tahmoorespur

2016-04-01

Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio

JAK2 V617F, MPL W515L and JAK2 Exon 12 Mutations in Chinese Patients with Primary Myelofibrosis.

Science.gov (United States)

Xia, Jun; Lu, Mi-Ze; Jiang, Yuan-Qiang; Yang, Guo-Hua; Zhuang, Yun; Sun, Hong-Li; Shen, Yun-Feng

2012-03-01

JAK2 V617F, MPL W515L and JAK2 exon 12 mutations are novel acquired mutations that induce constitutive cytokine-independent activation of the JAK-STAT pathway in myeloproliferative disorders (MPD). The discovery of these mutations provides novel mechanism for activation of signal transduction in hematopoietic malignancies. This research was to investigate their prevalence in Chinese patients with primary myelofibrosis (PMF). We introduced allele-specific PCR (AS-PCR) combined with sequence analysis to simultaneously screen JAK2 V617F, MPL W515L and JAK2 exon 12 mutations in 30 patients with PMF. Fifteen PMF patients (50.0%) carried JAK2 V617F mutation, and only two JAK2 V617F-negative patients (6.7%) harbored MPL W515L mutation. None had JAK2 exon 12 mutations. Furthermore, these three mutations were not detected in 50 healthy controls. MPL W515L and JAK2 V617F mutations existed in PMF patients but JAK2 exon 12 mutations not. JAK2 V617F and MPL W515L and mutations might contribute to the primary molecular pathogenesis in patients with PMF.

Molecular detection and PCR-RFLP analysis using Pst1 and Alu1 of multidrug resistant Klebsiella pneumoniae causing urinary tract infection in women in the eastern part of Bangladesh

Directory of Open Access Journals (Sweden)

Golam Mahmudunnabi

2018-06-01

Full Text Available Klebsiella pneumoniae is the second leading causative agent of UTI. In this study, a rapid combined polymerase chain reaction and restriction fragment length polymorphism analysis was developed to identify K. pneumoniae in women, infected with urinary tract infection in the Sylhet city of Bangladesh. Analysis of 11 isolates from women at the age range of 20–55 from three different hospitals were done firstly by amplification with K. pneumoniae specific ITS primers. All of the 11 collected isolates were amplified in PCR and showed the expected 136 bp products. Then, restriction fragment length polymorphism analysis of 11 isolates were conducted after PCR amplification by 16s rRNA universal primers, followed by subsequent digestion and incubation with two restriction enzymes, Pst1 and Alu1. Seven out of 11 isolates were digested by Pst1 restriction enzymes, six isolates digested by Alu1, and while others were negative for both enzymes. Data results reveal that, women at age between 25 and 50 were digested by both enzymes. A woman aged over than 50 was negative while bellow 20 was digested by only Pst1. The results could pave the tactic for further research in the detection of K. pneumoniae from UTI infected women. Keywords: Klebsiella pneumoniae, ITS-primer, MDR isolates, PCR-RFLP analysis

Transient neonatal diabetes mellitus with macroglossia diagnosed by methylation specific PCR (MS-PCR

Directory of Open Access Journals (Sweden)

Hye Young Jin

2010-03-01

Full Text Available Transient neonatal diabetes mellitus (TNDM has been associated with paternal uniparental isodisomy of chromosome 6, paternally inherited duplication of 6q24, or a methylation defect at a CpG island of the ZAC or HYMAI gene. We experienced a case of TNDM in which the patient presented with hyperglycemia, macroglossia, and intrauterine growth retardation, caused by a paternally derived HYMAI. An 18-day-old female infant was admitted to the hospital because of macroglossia and recurrent hyperglycemia. In addition to the macroglossia, she also presented with large fontanelles, micrognathia, and prominent eyes. Serum glucose levels were 200&#8211;300 mg/dL and they improved spontaneously 2 days after admission. To identify the presence of a maternal methylated allele, bisulfite-treated genomic DNA from peripheral blood was prepared and digested with BssHII after polymerase chain reaction (PCR amplification with methylation-specific HYMAI primers. PCR and restriction fragment length polymorphism analysis showed that the patient had only the paternal origin of the HYMA1 gene. TNDM is associated with a methylation defect in chromosome 6, suggesting that an imprinted gene on chromosome 6 is responsible for this phenotype.

A DEL phenotype attributed to RHD Exon 9 sequence deletion: slipped-strand mispairing and blood group polymorphisms.

Science.gov (United States)

Lopez, Genghis H; Turner, Robyn M; McGowan, Eunike C; Schoeman, Elizna M; Scott, Stacy A; O'Brien, Helen; Millard, Glenda M; Roulis, Eileen V; Allen, Amanda J; Liew, Yew-Wah; Flower, Robert L; Hyland, Catherine A

2018-03-01

The RhD blood group antigen is extremely polymorphic and the DEL phenotype represents one such class of polymorphisms. The DEL phenotype prevalent in East Asian populations arises from a synonymous substitution defined as RHD*1227A. However, initially, based on genomic and cDNA studies, the genetic basis for a DEL phenotype in Taiwan was attributed to a deletion of RHD Exon 9 that was never verified at the genomic level by any other independent group. Here we investigate the genetic basis for a Caucasian donor with a DEL partial D phenotype and compare the genomic findings to those initial molecular studies. The 3'-region of the RHD gene was amplified by long-range polymerase chain reaction (PCR) for massively parallel sequencing. Primers were designed to encompass a deletion, flanking Exon 9, by standard PCR for Sanger sequencing. Targeted sequencing of exons and flanking introns was also performed. Genomic DNA exhibited a 1012-bp deletion spanning from Intron 8, across Exon 9 into Intron 9. The deletion breakpoints occurred between two 25-bp repeat motifs flanking Exon 9 such that one repeat sequence remained. Deletion mutations bordered by repeat sequences are a hallmark of slipped-strand mispairing (SSM) event. We propose this genetic mechanism generated the germline deletion in the Caucasian donor. Extensive studies show that the RHD*1227A is the most prevalent DEL allele in East Asian populations and may have confounded the initial molecular studies. Review of the literature revealed that the SSM model explains some of the extreme polymorphisms observed in the clinically significant RhD blood group antigen. © 2017 AABB.

Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

1994-08-01

The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

Clinical utility of routine MPL exon 10 analysis in the diagnosis of essential thrombocythaemia and primary myelofibrosis.

Science.gov (United States)

Boyd, Elaine M; Bench, Anthony J; Goday-Fernández, Andrea; Anand, Shubha; Vaghela, Krishna J; Beer, Phillip; Scott, Mike A; Bareford, David; Green, Anthony R; Huntly, Brian; Erber, Wendy N

2010-04-01

Approximately 50% of essential thrombocythaemia and primary myelo-fibrosis patients do not have a JAK2 V617F mutation. Up to 5% of these are reported to have a MPL exon 10 mutation but testing for MPL is not routine as there are multiple mutation types. The ability to routinely assess both JAK2 and MPL mutations would be beneficial in the differential diagnosis of unexplained thrombocytosis or myelofibrosis. We developed and applied a high resolution melt (HRM) assay, capable of detecting all known MPL mutations in a single analysis, for the detection of MPL exon 10 mutations. We assessed 175 ET and PMF patients, including 67 that were JAK2 V617F-negative by real time polymerase chain reaction (PCR). Overall, 19/175 (11%) patients had a MPL exon 10 mutation, of whom 16 were JAK2 V617F-negative (16/67; 24%). MPL mutation types were W515L (11), W515K (4), W515R (2) and W515A (1). One patient had both W515L and S505N MPL mutations and these were present in the same haemopoietic colonies. Real time PCR for JAK2 V617F analysis and HRM for MPL exon 10 status identified one or more clonal marker in 71% of patients. This combined genetic approach increases the sensitivity of meeting the World Health Organization diagnostic criteria for these myeloproliferative neoplasms.

Restriction Fragment Length Polymorphism Analysis Reveals High Levels of Genetic Divergence Among the Light Organ Symbionts of Flashlight Fish.

Science.gov (United States)

Wolfe, C J; Haygood, M G

1991-08-01

Restriction fragment length polymorphisms within the lux and 16S ribosomal RNA gene regions were used to compare unculturable bacterial light organ symbionts of several anomalopid fish species. The method of Nei and Li (1979) was used to calculate phylogenetic distance from the patterns of restriction fragment lengths of the luxA and 16S rRNA regions. Phylogenetic trees constructed from each distance matrix (luxA and 16S rDNA data) have similar branching orders. The levels of divergence among the symbionts, relative to other culturable luminous bacteria, suggests that the symbionts differ at the level of species among host fish genera. Symbiont relatedness and host geographic location do not seem to be correlated, and the symbionts do not appear to be strains of common, free-living, luminous bacteria. In addition, the small number of hybridizing fragments within the 16S rRNA region of the symbionts, compared with that of the free-living species, suggests a decrease in copy number of rRNA operons relative to free-living species. At this level of investigation, the symbiont phylogeny is consistent with the proposed phylogeny of the host fish family and suggests that each symbiont strain coevolved with its host fish species.

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Revised genomic structure of the human ghrelin gene and identification of novel exons, alternative splice variants and natural antisense transcripts

Directory of Open Access Journals (Sweden)

Herington Adrian C

2007-08-01

Full Text Available Abstract Background Ghrelin is a multifunctional peptide hormone expressed in a range of normal tissues and pathologies. It has been reported that the human ghrelin gene consists of five exons which span 5 kb of genomic DNA on chromosome 3 and includes a 20 bp non-coding first exon (20 bp exon 0. The availability of bioinformatic tools enabling comparative analysis and the finalisation of the human genome prompted us to re-examine the genomic structure of the ghrelin locus. Results We have demonstrated the presence of an additional novel exon (exon -1 and 5' extensions to exon 0 and 1 using comparative in silico analysis and have demonstrated their existence experimentally using RT-PCR and 5' RACE. A revised exon-intron structure demonstrates that the human ghrelin gene spans 7.2 kb and consists of six rather than five exons. Several ghrelin gene-derived splice forms were detected in a range of human tissues and cell lines. We have demonstrated ghrelin gene-derived mRNA transcripts that do not code for ghrelin, but instead may encode the C-terminal region of full-length preproghrelin (C-ghrelin, which contains the coding region for obestatin and a transcript encoding obestatin-only. Splice variants that differed in their 5' untranslated regions were also found, suggesting a role of these regions in the post-transcriptional regulation of preproghrelin translation. Finally, several natural antisense transcripts, termed ghrelinOS (ghrelin opposite strand transcripts, were demonstrated via orientation-specific RT-PCR, 5' RACE and in silico analysis of ESTs and cloned amplicons. Conclusion The sense and antisense alternative transcripts demonstrated in this study may function as non-coding regulatory RNA, or code for novel protein isoforms. This is the first demonstration of putative obestatin and C-ghrelin specific transcripts and these findings suggest that these ghrelin gene-derived peptides may also be produced independently of preproghrelin

Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Caldeira Roberta Lima

1998-01-01

Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Science.gov (United States)

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

Directory of Open Access Journals (Sweden)

Glen John McIntyre

Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

RT-PCR analysis of dystrophin mRNA in DND/BMD patients

Energy Technology Data Exchange (ETDEWEB)

Ciafaloni, E.; Silva, H.A.R. de; Roses, A.D. [Duke Univ. Medical Center, Durham, NC (United States)

1994-09-01

Duchenne and Becker muscular dystrophies (DMD, BMD) are X-linked recessive disorders caused by mutations in the dystrophin (dys) gene. The majority of these mutations are intragenic deletions of duplications routinely detected by Southern biots and multiplex PCR. The remainder are very likely, smaller mutations, mostly point-mutations. Detection of these mutations is very difficult due to the size and complexity of the dys gene. We applied RT-PCR to analyse the entire dys mRNA of three DMD patients with no detectable genomic defect. In two unrelated patients, a duplication of the 62 bp exon 2 was identified. This causes a frameshift sufficient to explain the DMD phenotype. In the third patient, who had congenital DMD and severe mental retardation, a complex pattern of aberrant splicing at the 3-prime exons 67-79 was observed. Sural nerve biopsy in this patient showed the complete absence of Dp116. PCR-SSCP studies are presently in progress to identify the mutations responsible for the aberrant splicing patterns.

Molecular identification of dermatophytosis by polymerase chain reaction (PCR and detection of source of infection by restricted fragment length polymorphism (RFLP

Directory of Open Access Journals (Sweden)

BK Jha

2013-09-01

Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

Directory of Open Access Journals (Sweden)

Davis Thomas M

2010-03-01

Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

Restriction Cascade Exponential Amplification (RCEA) assay with an attomolar detection limit: a novel, highly specific, isothermal alternative to qPCR.

Science.gov (United States)

Ghindilis, Andrey L; Smith, Maria W; Simon, Holly M; Seoudi, Ihab A; Yazvenko, Nina S; Murray, Iain A; Fu, Xiaoqing; Smith, Kenneth; Jen-Jacobson, Linda; Xu, Shuang-Yong

2015-01-13

An alternative to qPCR was developed for nucleic acid assays, involving signal rather than target amplification. The new technology, Restriction Cascade Exponential Amplification (RCEA), relies on specific cleavage of probe-target hybrids by restriction endonucleases (REase). Two mutant REases for amplification (Ramp), S17C BamHI and K249C EcoRI, were conjugated to oligonucleotides, and immobilized on a solid surface. The signal generation was based on: (i) hybridization of a target DNA to a Ramp-oligonucleotide probe conjugate, followed by (ii) specific cleavage of the probe-target hybrid using a non-immobilized recognition REase. The amount of Ramp released into solution upon cleavage was proportionate to the DNA target amount. Signal amplification was achieved through catalysis, by the free Ramp, of a restriction cascade containing additional oligonucleotide-conjugated Ramp and horseradish peroxidase (HRP). Colorimetric quantification of free HRP indicated that the RCEA achieved a detection limit of 10 aM (10(-17) M) target concentration, or approximately 200 molecules, comparable to the sensitivity of qPCR-based assays. The RCEA assay had high specificity, it was insensitive to non-specific binding, and detected target sequences in the presence of foreign DNA. RCEA is an inexpensive isothermal assay that allows coupling of the restriction cascade signal amplification with any DNA target of interest.

Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

International Nuclear Information System (INIS)

Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

1987-01-01

The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

Origins and Impacts of New Mammalian Exons

Directory of Open Access Journals (Sweden)

Jason J. Merkin

2015-03-01

Full Text Available Mammalian genes are composed of exons, but the evolutionary origins and functions of new internal exons are poorly understood. Here, we analyzed patterns of exon gain using deep cDNA sequencing data from five mammals and one bird, identifying thousands of species- and lineage-specific exons. Most new exons derived from unique rather than repetitive intronic sequence. Unlike exons conserved across mammals, species-specific internal exons were mostly located in 5′ UTRs and alternatively spliced. They were associated with upstream intronic deletions, increased nucleosome occupancy, and RNA polymerase II pausing. Genes containing new internal exons had increased gene expression, but only in tissues in which the exon was included. Increased expression correlated with the level of exon inclusion, promoter proximity, and signatures of cotranscriptional splicing. Altogether, these findings suggest that increased splicing at the 5′ ends of genes enhances expression and that changes in 5′ end splicing alter gene expression between tissues and between species.

[Association of muscle segment homeobox gene 1 polymorphisms with nonsyndromic cleft lip with or without cleft palate].

Science.gov (United States)

Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng

2008-06-01

Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.

Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

Science.gov (United States)

Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

2012-01-01

The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

Diversity analysis of bacterial community compositions in sediments of urban lakes by terminal restriction fragment length polymorphism (T-RFLP).

Science.gov (United States)

Zhao, Dayong; Huang, Rui; Zeng, Jin; Yan, Wenming; Wang, Jianqun; Ma, Ting; Wang, Meng; Wu, Qinglong L

2012-11-01

Bacteria are crucial components in lake sediments and play important role in various environmental processes. Urban lakes in the densely populated cities are often small, shallow, highly artificial and hypereutrophic compared to rural and natural lakes and have been overlooked for a long time. In the present study, bacterial community compositions in surface sediments of three urban lakes (Lake Mochou, Lake Qianhu and Lake Zixia) in Nanjing City, China, were investigated using the terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene and clone libraries. Remarkable differences in the T-RFLP patterns were observed in different lakes or different sampling stations of the same lake. Canonical correspondence analysis indicated that total nitrogen (TN) had significant effects on bacterial community structure in the lake sediments. Chloroflexi were the most dominant bacterial group in the clone library from Lake Mochou (21.7 % of the total clones) which was partly associated with its higher TN and organic matters concentrations. However, Bacteroidetes appeared to be dominated colonizers in the sediments of Lake Zixia (20.4 % of the total clones). Our study gives a comprehensive insight into the structure of bacterial community of urban lake sediments, indicating that the environmental factors played a key role in influencing the bacterial community composition in the freshwater ecosystems.

Polymerase chain reaction-based method for the identification of Leishmania (Viannia) braziliensis and Leishmania (Viannia) guyanensis in mucosal tissues conserved in paraffin.

Science.gov (United States)

Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique

2015-01-01

In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.

Two novel mutations in exon 3 and 4 of low density lipoprotein (LDL) receptor gene in patients with heterozygous familial hypercholesterolemia

International Nuclear Information System (INIS)

Khan, S.P.

2011-01-01

Objective: To determine the common mutation of low density lipoprotein receptor in hypercholesterolemia patients requiring screening for heterozygous familial hypercholesterolemia (HeFH) in Karachi. Study Design: Case-series. Place and Duration of Study: Dr. Ziauddin Hospital Laboratory and Dr. Rubina Ghani's Pathological and Molecular Laboratories, Karachi, for the PCR bench work from June 2008 to October 2009. Methodology: All the patients selected for this study were from Dr. Ziauddin Hospital and National Institute of Cardiovascular Diseases. All the patients having high total cholesterol and LDL-cholesterol were included in this study with premature coronary artery diseases or a family history of hypercholesterolemia. Exclusion criteria included Diabetes mellitus, hypertension, renal disease, hypothyroidism and steroid therapy. After lipid profile with overnight fasting, DNA was extracted from whole blood collected in EDTA (ethylenediamine tetra acetic acid) tube and multiplex PCR (polymerase chain reaction) using forward and reverse primers of exons 3, 4, 9 and 14 of base pairs 162, 431, 550 and 496 respectively. Results: Out of total of 120 hypercholesterolemia cases, 42 patients were classical cases of HeFH (heterozygous familial hypercholesterolemia) with xanthomas, xanthelasmas and LDL-C > 160 mg/dl. The total cholesterol (260 +- 57 mg/dL) and LDL-C (192 +- 39 mg/dL ) of cases was significantly high as compared to, controls having total cholesterol (184 9 +- 27 mg/dL) and LDL-C (105 +- 22 mg/dL), p > 0.001. Two novel point mutations were noted in exon 3 and exon 4. The other 78 cases were probable with raised LDL-C (low density lipoprotein cholesterol) and family history of premature coronary heart diseases. Conclusion: The frequency of HeFH was 35% classical and 65% probable cases out of total 120 hypercholesterolemia patients from two tertiary care hospitals in Karachi. The point mutation on exon 3 and exon 4 of LDLR gene was the most common. PCR is

Optimized Exon-Exon Junction Library and its Application on Rodents' Brain Transcriptome Analysis

Directory of Open Access Journals (Sweden)

Tong-Hai Dou

2017-05-01

Full Text Available ABSTRACT Background: Alternative splicing (AS, which plays an important role in gene expression and functional regulation, has been analyzed on genome-scale by various bioinformatic approaches based on RNA-seq data. Compared with the huge number of studies on mouse, the AS researches approaching the rat, whose genome is intermedia between mouse and human, were still limited. To enrich the knowledge on AS events in rodents' brain, we perfomed a comprehensive analysis on four transcriptome libraries (mouse cerebrum, mouse cerebellum, rat cerebrum, and rat cerebellum, recruiting high-throughput sequencing technology. An optimized exon-exon junction library approach was introduced to adapt the longer RNA-seq reads and to improve mapping efficiency. Results: In total, 7,106 mouse genes and 2,734 rat genes were differentially expressed between cerebrum and cerebellum, while 7,125 mouse genes and 1,795 rat genes exhibited varieties on transcript variant level. Only half of the differentially expressed exon-exon junctions could be reflected at gene expression level. Functional cluster analysis showed that 32 pathways in mouse and 9 pathways in rat were significantly enriched, and 6 of them were in both. Interestingly, some differentially expressed transcript variants did not show difference on gene expression level, such as PLCβ1 and Kcnma1. Conclusion: Our work provided a case study of a novel exon-exon junction strategy to analyze the expression of genes and isoforms, helping us understand which transcript contributes to the overall expression and further functional change.

Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

Energy Technology Data Exchange (ETDEWEB)

Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

1999-09-01

In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

Science.gov (United States)

Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

2016-10-01

Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

Molecular effects of autoimmune-risk promoter polymorphisms on expression, exon choice, and translational efficiency of interferon regulatory factor 5.

Science.gov (United States)

Clark, Daniel N; Lambert, Jared P; Till, Rodney E; Argueta, Lissenya B; Greenhalgh, Kathryn E; Henrie, Brandon; Bills, Trieste; Hawkley, Tyson F; Roznik, Marinya G; Sloan, Jason M; Mayhew, Vera; Woodland, Loc; Nelson, Eric P; Tsai, Meng-Hsuan; Poole, Brian D

2014-05-01

The rs2004640 single nucleotide polymorphism and the CGGGG copy-number variant (rs77571059) are promoter polymorphisms within interferon regulatory factor 5 (IRF5). They have been implicated as susceptibility factors for several autoimmune diseases. IRF5 uses alternative promoter splicing, where any of 4 first exons begin the mRNA. The CGGGG indel is in exon 1A's promoter; the rs2004640 allele creates a splicing recognition site, enabling usage of exon 1B. This study aimed at characterizing alterations in IRF5 mRNA due to these polymorphisms. Cells with risk polymorphisms exhibited ~2-fold higher levels of IRF5 mRNA and protein, but demonstrated no change in mRNA stability. Quantitative PCR demonstrated decreased usage of exons 1C and 1D in cell lines with the risk polymorphisms. RNA folding analysis revealed a hairpin in exon 1B; mutational analysis showed that the hairpin shape decreased translation 5-fold. Although translation of mRNA that uses exon 1B is low due to a hairpin, increased IRF5 mRNA levels in individuals with the rs2004640 risk allele lead to higher overall protein expression. In addition, several new splice variants of IRF5 were sequenced. IRF5's promoter polymorphisms alter first exon usage and increase transcription levels. High levels of IRF5 may bias the immune system toward autoimmunity.

Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

Science.gov (United States)

Lott, M J; Hose, G C; Power, M L

2014-09-01

Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

Typing of Human Mycobacterium avium Isolates in Italy by IS1245-Based Restriction Fragment Length Polymorphism Analysis

Science.gov (United States)

Lari, Nicoletta; Cavallini, Michela; Rindi, Laura; Iona, Elisabetta; Fattorini, Lanfranco; Garzelli, Carlo

1998-01-01

All but 2 of 63 Mycobacterium avium isolates from distinct geographic areas of Italy exhibited markedly polymorphic, multibanded IS1245 restriction fragment length polymorphism (RFLP) patterns; 2 isolates showed the low-number banding pattern typical of bird isolates. By computer analysis, 41 distinct IS1245 patterns and 10 clusters of essentially identical strains were detected; 40% of the 63 isolates showed genetic relatedness, suggesting the existence of a predominant AIDS-associated IS1245 RFLP pattern. PMID:9817900

Deletion analysis of SMN1 and NAIP genes in southern Chinese children with spinal muscular atrophy

Institute of Scientific and Technical Information of China (English)

Yu-hua LIANG; Xiao-ling CHEN; Zhong-sheng YU; Chun-yue CHEN; Sheng BI; Lian-gen MAO; Bo-lin ZHOU; Xian-ning ZHANG

2009-01-01

Spinal muscular atrophy (SMA) is a disorder characterized by degeneration of lower motor neurons and occasionally bulbar motor neurons leading to progressive limb and trunk paralysis as well as muscular atrophy. Three types of SMA are rec-ognized depending on the age of onset, the maximum muscular activity achieved, and survivorship: SMA1, SMA2, and SMA3. The survival of motor neuron (SMN) gene has been identified as an SMA determining gene, whereas the neuronal apoptosis inhibitory protein (NAIP) gene is considered to be a modifying factor of the severity of SMA. The main objective of this study was to analyze the deletion of SMN1 and NAIP genes in southern Chinese children with SMA. Here, polymerase chain reaction (PCR) combined with restriction fragment length polymorphism (RFLP) was performed to detect the deletion of both exon 7 and exon 8 of SMNI and exon 5 of NAIP in 62 southern Chinese children with strongly suspected clinical symptoms of SMA. All the 32 SMAI patients and 76% (13/17) of SMA2 patients showed homozygous deletions for exon 7 and exon 8, and all the 13 SMA3 patients showed single deletion of SMN1 exon 7 along with 24% (4/17) of SMA2 patients. Eleven out of 32 (34%) SMA1 patients showed NAIP deletion, and none of SMA2 and SMA3 patients was found to have NAIP deletion. The findings of homozygous deletions of exon 7 and/or exon 8 of SMN1 gene confirmed the diagnosis of SMA, and suggested that the deletion of SMN1 exon 7 is a major cause of SMA in southern Chinese children, and that the NA1P gene may be a modifying factor for disease severity of SMA 1. The molecular diagnosis system based on PCR-RFLP analysis can conveniently be applied in the clinical testing, genetic counseling, prenatal diagnosis and preimplantation genetic diagnosis of SMA.

Sensitive identification of mycobacterial species using PCR-RFLP on bronchial washings.

Science.gov (United States)

Hidaka, E; Honda, T; Ueno, I; Yamasaki, Y; Kubo, K; Katsuyama, T

2000-03-01

In 98 patients (24 with active pulmonary tuberculosis [TB] lesions, 28 with cured TB lesions, and 46 with nontuberculous opacities [control group] in chest CT scans), we examined whether washing the bronchus after brushing the lesion, then applying polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to the bronchial washings might be useful for diagnosing TB and nontuberculous mycobacteriosis (NTMosis). After biopsy and brushing with a bronchoscope, the bronchus connecting to the lesion was washed with 20 ml saline. The saline used for washing the brushes (5 ml; brushing sample), and 3 to 10 ml saline aspirated through the forceps channel (washing sample) were examined by PCR-RFLP, which proved able to identify Mycobacterium tuberculosis and seven species of nontuberculous mycobacteria (NTM). The values obtained for the sensitivity of the PCR-RFLP with respect to the brushing sample, the washing sample, and both samples mixed together were 70, 76, and 91%, respectively, when only patients who were culture-positive or radiologically improved after antituberculous therapy were considered as showing true infection. A mixture of brushing and washing samples provides useful material for PCR and culture, and the PCR-RFLP used here is a good method for the simultaneous identification of several species of mycobacterium (including M. tuberculosis).

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene

OpenAIRE

Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.

2012-01-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...

MORPHOLOGY AND GENETIC DIVERSITY OF MITOCHONDRIAL DNA D-LOOP REGION USING PCR-RFLP ANALYSIS IN MAGELANG DUCK AND OTHER NATIVE DUCK

Directory of Open Access Journals (Sweden)

D. Purwantini

2014-10-01

Full Text Available The aim of this study was to investigate the different of plumage colors on morphological diversityof Magelang duck and genetic diversity using PCR-RFLP mtDNA D-loop region analysis of Magelangduck and four others native duck population (Tegal, Mojosari, Bali and Alabio duck in Indonesia. Bloodsample was taken from 50 Magelang ducks and 20 of each native ducks. Morphological characteristicsof body measurement, production ability and egg quality of Magelang duck were analyzed usingCompletely Randomized Design with 11 plumage colors as treatments. PCR technique was administeredto amplify fragments in mtDNA D-loop region and PCR products were digested with endonucleaserestriction enzyme AluI and HaeIII. The result showed that morphology diversity of Magelang duck wasstatistically affected by different plumage colors. PCR-RFLP analysis using AluI and HaeIII restrictionenzyme resulted in six combinations of restriction fragment pattern shown in six haplotypes (A, B, C, D,E and F. Haplotype difference showed genetic diversity in the population of Magelang duck and theother native ducks. In conclusion, the different plumage colors affected morphology diversity ofMagelang duck. Genetic diversity of Indonesian native duck population could be identified by usingPCR-RFLP analysis on mtDNA D-loop region.

PCR-RFLP diagnostic method for identifying Globodera species in Slovenia

Directory of Open Access Journals (Sweden)

Sasa ŠIRCA

2011-01-01

Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.

Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1991-01-01

The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC......), systemic lupus erythematosus (SLE), pauciarticular juvenile rheumatoid arthritis (P-JRA), rheumatoid arthritis (RA), and primary Sjögren's syndrome (pSS), and in healthy Danes. The BAT2/RsaI 2.7-kb band fragment was more frequent in PBC, pSS, and SLE than in controls, but the p values did not reach...... significance when corrected for multiple comparisons. For pSS and SLE, the associations may be secondary to primary associations with HLA-B8 because the BAT2/RsaI 2.3-kb band, which is allelic to the BAT2/RsaI 2.7-kb band, is strongly negatively associated with HLA-B8 and HLA-DR3. The only significance...

A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

Energy Technology Data Exchange (ETDEWEB)

Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

1996-07-01

Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

Application of FTA sample collection and DNA purification system on the determination of CTG trinucleotide repeat size by PCR-based Southern blotting.

Science.gov (United States)

Hsiao, K M; Lin, H M; Pan, H; Li, T C; Chen, S S; Jou, S B; Chiu, Y L; Wu, M F; Lin, C C; Li, S Y

1999-01-01

Myotonic dystrophy (DM) is caused by a CTG trinucleotide expansion mutation at exon 15 of the myotonic dystrophy protein kinase gene. The clinical severity of this disease correlates with the length of the CTG trinucleotide repeats. Determination of the CTG repeat length has been primarily relied on by Southern blot analysis of restriction enzyme-digested genomic DNA. The development of PCR-based Southern blotting methodology provides a much more sensitive and simpler protocol for DM diagnosis. However, the quality of the template and the high (G+C) ratio of the amplified region hamper the use of PCR on the diagnosis of DM. A modified PCR protocol to amplify different lengths of CTG repeat region using various concentrations of 7deaza-dGTP has been reported (1). Here we describe a procedure including sample collection, DNA purification, and PCR analysis of CTG repeat length without using 7-deaza-dGTP. This protocol is very sensitive and convenient because only a small number of nucleate cells are needed for detection of CTG expansion. Therefore, it could be very useful in clinical and prenatal diagnosis as well as in prevalence study of DM.

Application of GP IIIa gene Taq I polymorphism to determination of carrier status in Glanzmann's thrombasthenia families of Chinese origin

International Nuclear Information System (INIS)

Ruan Changgeng; Gu Jianmin; Wang Xiaodong; Chu Xiaohong; Pan Junliang; Wu Qingyu

1992-08-01

Glanzmann's thrombasthenia is a bleeding disorder caused by qualitative and/or quantitative defects of platelet membrane glycoprotein (GP) Ii b /III a complex. The disease is inherited in an autosomal recessive manner. The use of cDNA probes to study restriction fragment length polymorphisms (RFLPs) in GPIII a gene is reported. A Taq I polymorphism was identified and this RFLP consisted of variant bands of 6.5 kb/4.0 and 2.5 kb with a frequency of 0.46/0.54 in Chinese population. The Taq I polymorphism was further localized by polymerase chain reaction (PCR) method to exon VIII of the GPIII a gene. In two Glanzmann's thrombasthenia families, the Taq I RFLP studied with both Southern blotting and PCR methods identified defective GPIII a gene inherited by patients, and determined the genotype of asymptomatic subjects. Analysis of this Taq I polymorphism by PCR method should be potentially useful in future for the carrier detection and prenatal diagnosis in Glanzmann's thrombasthenia families

Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1990-01-01

The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...

Fast detection of deletion breakpoints using quantitative PCR

Directory of Open Access Journals (Sweden)

Gulshara Abildinova

2016-01-01

Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.

Splicing of phenylalanine hydroxylase (PAH) exon 11 is vulnerable - Molecular pathology of mutations in PAH exon 11

DEFF Research Database (Denmark)

Heintz, Caroline; Dobrowolski, Steven F.; Andersen, Henriette Skovgaard

2012-01-01

as a vulnerable exon and used patient derived lymphoblast cell lines and PAH minigenes to study the molecular defect that impacted pre-mRNA processing. We showed that the c.1144T>C and c.1066-3C>T mutations cause exon 11 skipping, while the c.1139C>T mutation is neutral or slightly beneficial. The c.1144T......In about 20-30% of phenylketonuria (PKU) patients, phenylalanine (Phe) levels can be controlled by cofactor 6R-tetrahydrobiopterin (BH(4)) administration. The phenylalanine hydroxylase (PAH) genotype has a predictive value concerning BH(4)-response and therefore a correct assessment of the mutation...... molecular pathology is important. Mutations that disturb the splicing of exons (e.g. interplay between splice site strength and regulatory sequences like exon splicing enhancers (ESEs)/exon splicing silencers (ESSs)) may cause different severity of PKU. In this study, we identified PAH exon 11...

[Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

Science.gov (United States)

Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

2017-08-10

To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

Detection of MPL exon10 mutations in 103 Chinese patients with JAK2V617F-negative myeloproliferative neoplasms.

Science.gov (United States)

Chen, Xiuhua; Qi, Xiling; Tan, Yanhong; Xu, Zhifang; Xu, Aining; Zhang, Linlin; Wang, Hongwei

2011-06-15

JAK2V617F mutation has been reported in 90% of patients with polycythemia vera (PV) and about 50% of patients with essential thromobocythemia (ET) and primary myelofibrosis (PMF). Recently, acquired mutations in the transmembrane-juxtamembrane region of MPL (MPLW515 mutations) have been reported in approximately 5% of JAK2V617F-negative PMF and about 1% of all cases of ET. MPL is the receptor for thrombopoietin that regulates the production of platelets by bone marrow. It is likely that some mutations more closely related to ET in MPL exon10 may have been missed by current assays. We inferred that there might be other mutations in MPL exon10 for MPN patients in addition to MPLW515 mutations. To investigate its mutation types and prevalence in Chinese patients with myeloproliferative neoplasms (MPN), we performed mutation detection on MPL exon10 in 103 JAK2V617F-negative MPN patients by single strand conformation polymorphism (SSCP) and allele-specific PCR (AS-PCR) combined with sequencing. As a result, one previously unrecognized MPL mutation (12-bp in-frame insertion) was identified in one patient with ET in addition to an MPLW515K mutation identified in one PMF patient. This confirms our hypothesis that BCR/ABL negative and JAK2V617F-negative MPN patients have other mutations besides W515 mutation in MPL exon10 and mutations other than single nucleotide exchange also exist. In addition, MPL mutation was associated with Chinese MPN patients. Copyright © 2011 Elsevier Inc. All rights reserved.

Application of RFLP-PCR-Based Identification for Sand Fly Surveillance in an Area Endemic for Kala-Azar in Mymensingh, Bangladesh

Directory of Open Access Journals (Sweden)

Mohammad Shafiul Alam

2012-01-01

Full Text Available Mymensingh is the most endemic district for kala-azar in Bangladesh. Phlebotomus argentipes remains the only known vector although a number of sand fly species are prevalent in this area. Genotyping of sand flies distributed in a VL endemic area was developed by a PCR and restriction-fragment-length polymorphism (RFLP of 18S rRNA gene of sand fly species. Using the RFLP-PCR analysis with AfaI and HinfI restriction enzymes, P. argentipes, P. papatasi, and Sergentomyia species could be identified. Among 1,055 female sand flies successfully analyzed for the species identification individually, 64.4% flies was classified as Sergentomyia species, whereas 35.6% was identified as P. argentipes and no P. papatasi was found. Although infection of Leishmania within the sand flies was individually examined targeting leishmanial minicircle DNA, none of the 1,055 sand flies examined were positive for Leishmania infection. The RFLP-PCR could be useful tools for taxonomic identification and Leishmania infection monitoring in endemic areas of Bangladesh.

Detection and identification of Leishmania spp.: application of two hsp70-based PCR-RFLP protocols to clinical samples from the New World.

Science.gov (United States)

Montalvo, Ana M; Fraga, Jorge; Tirado, Dídier; Blandón, Gustavo; Alba, Annia; Van der Auwera, Gert; Vélez, Iván Darío; Muskus, Carlos

2017-07-01

Leishmaniasis is highly prevalent in New World countries, where several methods are available for detection and identification of Leishmania spp. Two hsp70-based PCR protocols (PCR-N and PCR-F) and their corresponding restriction fragment length polymorphisms (RFLP) were applied for detection and identification of Leishmania spp. in clinical samples recruited in Colombia, Guatemala, and Honduras. A total of 93 cases were studied. The samples were classified into positive or suspected of leishmaniasis according to parasitological criteria. Molecular amplification of two different hsp70 gene fragments and further RFLP analysis for identification of Leishmania species was done. The detection in parasitologically positive samples was higher using PCR-N than PCR-F. In the total of samples studied, the main species identified were Leishmania panamensis, Leishmania braziliensis, and Leishmania infantum (chagasi). Although RFLP-N was more efficient for the identification, RFLP-F is necessary for discrimination between L. panamensis and Leishmania guyanesis, of great importance in Colombia. Unexpectedly, one sample from this country revealed an RFLP pattern corresponding to Leishmania naiffi. Both molecular variants are applicable for the study of clinical samples originated in Colombia, Honduras, and Guatemala. Choosing the better tool for each setting depends on the species circulating. More studies are needed to confirm the presence of L. naiffi in Colombian territory.

Deletion of Dystrophin In-Frame Exon 5 Leads to a Severe Phenotype: Guidance for Exon Skipping Strategies.

Directory of Open Access Journals (Sweden)

Zhi Yon Charles Toh

Full Text Available Duchenne and Becker muscular dystrophy severity depends upon the nature and location of the DMD gene lesion and generally correlates with the dystrophin open reading frame. However, there are striking exceptions where an in-frame genomic deletion leads to severe pathology or protein-truncating mutations (nonsense or frame-shifting indels manifest as mild disease. Exceptions to the dystrophin reading frame rule are usually resolved after molecular diagnosis on muscle RNA. We report a moderate/severe Becker muscular dystrophy patient with an in-frame genomic deletion of DMD exon 5. This mutation has been reported by others as resulting in Duchenne or Intermediate muscular dystrophy, and the loss of this in-frame exon in one patient led to multiple splicing events, including omission of exon 6, that disrupts the open reading frame and is consistent with a severe phenotype. The patient described has a deletion of dystrophin exon 5 that does not compromise recognition of exon 6, and although the deletion does not disrupt the reading frame, his clinical presentation is more severe than would be expected for classical Becker muscular dystrophy. We suggest that the dystrophin isoform lacking the actin-binding sequence encoded by exon 5 is compromised, reflected by the phenotype resulting from induction of this dystrophin isoform in mouse muscle in vivo. Hence, exon skipping to address DMD-causing mutations within DMD exon 5 may not yield an isoform that confers marked clinical benefit. Additional studies will be required to determine whether multi-exon skipping strategies could yield more functional dystrophin isoforms, since some BMD patients with larger in-frame deletions in this region have been reported with mild phenotypes.

General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

International Nuclear Information System (INIS)

Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

2006-01-01

Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

Discrimination of the Thai rejuvenating herbs Pueraria candollei (White Kwao Khruea), Butea superba (Red Kwao Khruea), and Mucuna collettii (Black Kwao Khruea) using PCR-RFLP.

Science.gov (United States)

Wiriyakarun, Suchaya; Yodpetch, Woraluk; Komatsu, Katsuko; Zhu, Shu; Ruangrungsi, Nijsiri; Sukrong, Suchada

2013-07-01

The tuberous roots of Pueraria candollei (White Kwao Khruea), Butea superba (Red Kwao Khruea) and Mucuna collettii (Black Kwao Khruea), which belong to the family Leguminosae, are used as rejuvenating herbs in traditional Thai medicine. Although all of these species have an indication for rejuvenation, each differs in its medicinal properties. Two varieties of P. candollei, var. mirifica and var. candollei, affect females, whereas B. superba and M. collettii exhibit effects on males. However, the identification of these roots according to the name "Kwao Khruea" is confusing due to the similarity in their features. Polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) was utilised to identify plant origin. The partial matK gene was amplified and subjected to restriction enzyme digestion with DdeI and TaqI. The restriction fragments generated differed in number and size. To test the reliability of the method, an admixture of the different Kwao Khruea species containing equal amounts of DNA was tested. The results showed combined restriction patterns, and each species could be detected in the background of the others. The method was also used to authenticate eight different crude drugs sold as various types of Kwao Khruea in Thai markets. The results showed that the misidentification of commercial drugs remains a problem in crude drug markets. The PCR-RFLP analysis developed here provides a simple and accurate discrimination of these rejuvenating "Kwao Khruea" species.

Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance.

Science.gov (United States)

Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; Ep Mundhofir, Farmaditya; Mh Faradz, Sultana; Hisatome, Ichiro

2017-03-01

High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100-400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1 .

DNA Polymorphism of Insulin-like Growth Factor-binding Protein-3 Gene and Its Association with Cashmere Traits in Cashmere Goats

Directory of Open Access Journals (Sweden)

Haiying Liu

2012-11-01

Full Text Available Insulin-like growth factor binding protein-3 (IGFBP-3 gene is important for regulation of growth and development in mammals. The present investigation was carried out to study DNA polymorphism by PCR-RFLP of IGFBP-3 gene and its effect on fibre traits of Chinese Inner Mongolian cashmere goats. The fibre traits data investigated were cashmere fibre diameter, combed cashmere weight, cashmere fibre length and guard hair length. Four hundred and forty-four animals were used to detect polymorphisms in the hircine IGFBP-3 gene. A 316-bp fragment of the IGFBP-3 gene in exon 2 was amplified and digested with HaeIII restriction enzyme. Three patterns of restriction fragments were observed in the populations. The frequency of AA, AB and BB genotypes was 0.58, 0.33 and 0.09 respectively. The allelic frequency of the A and B allele was 0.75 and 0.25 respectively. Nucleotide sequencing revealed a C>G transition in the exon 2 region of the IGFBP-3 gene resulting in R158G change which caused the polymorphism. Least squares analysis revealed a significant effect of genotypes on cashmere weight (p0.05. The animals of AB and BB genotypes showed higher cashmere weight, cashmere fibre length and hair length than the animals possessing AA genotype. These results suggested that polymorphisms in the hircine IGFBP-3 gene might be a potential molecular marker for cashmere weight in cashmere goats.

Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿

OpenAIRE

Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.

2009-01-01

Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from...

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Sixty-five radiation hybrids for the short arm of human chromosome 6: their value as a mapping panel and as a source for rapid isolation of new probes using repeat element-mediated PCR

International Nuclear Information System (INIS)

Zoghbi, H.Y.; McCall, A.E.; LeBorgne-Demarquoy, F.

1991-01-01

We have used an irradiation and fusion procedure to generate somatic cell hybrids that retain fragments of the short arm of human chromosome 6 (6p). To identify hybrids retaining human material, we performed repeat element-mediated PCR on crude lysates of cells from individual clones. Sixty-five hybrids were shown to contain human material and fifty of those contained one or more 6p-specific probes. Detailed characterization of these hybrids identified a subset that divides 6p into ten mapping intervals. Using repeat element-mediated PCR, we were able to isolate and map 61 new DNA fragments from specific regions of 6p. Fifteen of these fragments were used to screen for restriction fragment length polymorphisms (RFLPs), and nine identified RFLPs with one or more enzymes. The radiation hybrids described in this study provide a valuable resource for high-resolution mapping of 6p and for the rapid isolation of region-specific markers

A specific PCR-assay for resistance to Biotypes 1 and 2 of the rosy leaf curling aphid in apple based on an RFLP marker closely linked to the Sd1 gene

NARCIS (Netherlands)

Roche, P.; Arkel, van G.; Heusden, van A.W.

1997-01-01

This report describes the conversion of a restriction fragment length polymorphism (RFLP) marker (the 2B12a locus), linked to the Sd1 aphid resistance gene, to a polymerase chain reaction (PCR) based marker. A section of the 2B12 probe was sequenced and two primers were designed to amplify this

High prevalence of exon 8 G533C mutation in apparently sporadic medullary thyroid carcinoma in Greece.

Science.gov (United States)

Sarika, H L; Papathoma, A; Garofalaki, M; Vasileiou, V; Vlassopoulou, B; Anastasiou, E; Alevizaki, M

2012-12-01

Genetic screening for ret mutation has become routine practice in the evaluation of medullary thyroid carcinoma (MTC). Approximately 25% of these tumours are familial, and they occur as components of the multiple endocrine neoplasia type 2 syndromes (MEN 2A and 2B) or familial MTC. In familial cases, the majority of mutations are found in exons 10, 11, 13, 14 or 15 of the ret gene. A rare mutation involving exon 8 (G533C) has recently been reported in familial cases of MTC in Brazil and Greece; some of these cases were originally thought to be sporadic. The aim of this study was to re-evaluate a series of sporadic cases of MTC, with negative family history, and screen them for germline mutations in exon 8. Genomic DNA was extracted from peripheral lymphocytes in 129 unrelated individuals who had previously been characterized as 'sporadic' based on the negative family history and negative screening for ret gene mutations. Samples were analysed in Applied Biosystems 7500 real-time PCR and confirmed by sequencing. The G533C exon 8 mutation was identified in 10 of 129 patients with sporadic MTC. Asymptomatic gene carriers were subsequently identified in other family members. In our study, we found that 7·75% patients with apparently sporadic MTC do carry G533C mutation involving exon 8 of ret. We feel that there is now a need to include exon 8 mutation screening in all patients diagnosed as sporadic MTC, in Greece. © 2012 Blackwell Publishing Ltd.

Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

Science.gov (United States)

Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

2013-12-01

Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

Science.gov (United States)

Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

2000-01-01

Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

Improved sensitivity of circulating tumor DNA measurement using short PCR amplicons

DEFF Research Database (Denmark)

Andersen, Rikke Fredslund; Spindler, Karen-Lise Garm; Brandslund, Ivan

2015-01-01

, however, presents a number of challenges that require attention. The amount of DNA is low and highly fragmented and analyses need to be optimized accordingly. KRAS ARMS-qPCR assays with amplicon lengths of 120 and 85 base pairs, respectively, were compared using positive control material (PCR fragments...

Investigation of Exon 1 in FXN Gene in Patients with Clinical Symptomatic of Friedreich Ataxia

Directory of Open Access Journals (Sweden)

Naseroleslami M

2013-01-01

Full Text Available Background and Objectives: Friedreich’s ataxia (FRDA is an autosomal recessive disorder that is typically associated with dysarthria, muscle weakness, spasticity in the lower limbs, scoliosis, bladder dysfunction, absent lower limb reflexes, and loss of position and vibration sense. Approximately two-thirds of these patients suffer from cardiomyopathy and more than 30% have diabetes mellitus. Individuals with FRDA have identifiable mutations in the FXN gene. The most common type of mutation which is observed on both alleles in more than 98% of patients is an expansion of a GAA triplet-repeat in intron of FXN gene. Approximately 2% of individuals with FRDA are compound heterozygotes, who have a GAA expansion in the disease-causing range in one FXN allele and an inactivating FXN mutation in another allele. Aim of the present study was to investigate exon 1 in FRDA gene in patients with clinical symptoms of Friedreich’s Ataxia that have not GAA triplet-repeat expansion in intron 1 of FXN gene.Methods: In this study, exon 1 in 5 patients suspected of FRDA analyzed using PCR and sequencing. Results: An A to G transition at nucleotide number 815284, in exon 1 was observed in all patients. Conclusion: The results of this study showed that disease-causing homozygous mutations could be because of consanguinity marriage in Iran. Therefore, sequencing of all exons of the gene is necessary.

PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

Science.gov (United States)

Ristaino, Jean B.; Madritch, Michael; Trout, Carol L.; Parra, Gregory

1998-01-01

We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA products were conducted with the restriction enzymes RsaI, MspI, and HaeIII. Restriction fragment patterns were similar after digestions with RsaI for the following species: P. capsici and P. citricola; P. infestans, P. cactorum, and P. mirabilis; P. fragariae, P. cinnamomi, and P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated P. capsici from P. citricola and separated P. cactorum from P. infestans and P. mirabilis. Restriction digests with HaeIII separated P. citrophthora from P. cryptogea, P. cinnamomi from P. fragariae and P. megasperma on peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were identical with all restriction enzymes tested. A unique DNA sequence from the ITS region I in P. capsici was used to develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici, P. citricola, and P. citrophthora and not 13 other species in the genus. Restriction digests with MspI separated P. capsici from the other two species. PCR was superior to traditional isolation methods for detection of P. capsici in infected bell pepper tissue in field samples. The techniques described will provide a powerful tool for identification of the major species in the genus Phytophthora. PMID:9501434

Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

Science.gov (United States)

Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

2017-10-03

A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.

Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene

Science.gov (United States)

Gonçalves, Ana; Coelho, Teresa; Melo-Pires, Manuel; Sousa, Mário

2017-01-01

A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD. PMID:28972564

Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

NARCIS (Netherlands)

Coolen, MJL; Post, E; Davis, CC; Forney, LJ

2005-01-01

To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

Germline mutation of RET proto-oncogene’s exons 17 and 18 in Iranian medullary thyroid carcinoma patients

Directory of Open Access Journals (Sweden)

Marjan Zarif Yeganeh

2017-03-01

Full Text Available Background: Thyroid carcinoma is the most common endocrine malignancy. Medullary thyroid carcinoma (MTC approximately accounts for 5-10% of all thyroid carcinoma. Nowadays, it is obviously, the mutations in REarranged during transfection (RET proto-oncogene, especially, mutations in exons 10, 11 and 16 are associated with MTC pathogenesis and occurrence. Thus, early diagnosis of MTC by mutation detection in RET proto-oncogene allows to identify patients who do not have any developed symptoms. The aim of this study was to screening of germline mutations in RET proto-oncogene exons 17 and 18 in MTC patients and their first degree relatives in Iranian population. Methods: In this cross-sectional study, three hundred eleven participates (190 patients, 121 their relatives were referred to endocrine research center, Shahid Beheshti University of Medical Science during September 2013 until September 2015. The inclusion criteria were pathological and clinical diagnosis. After whole blood sampling, genomic DNA was extracted from peripheral blood leucocytes using the standard Salting Out/Proteinase K method. Nucleotide change detection in exons 17 and 18 was performed using PCR and direct DNA sequencing methods. Results: In this study, twenty missense mutations [CGC>TGC, c.2944C>T, p.Arg982Cys (rs17158558] which included 16 heterozygote and 4 homozygote mutations were found in codon 982 (exon 18. In the present study, 154 G>A (rs2742236 and 4 C>T (rs370072408 nucleotide changes were detected in exons 18 and intron 17 respectively. There was no mutation in exon 17. Conclusion: It seems that because of arginine to cysteine substitutions in RET tyrosine kinase protein structure and its polyphen score (0.955 and SIFT score (0.01 the mutation in codon 982 (exon 18 could be have pathogenic effects. On the other hands, the mentioned mutation frequency was 6.4% among MTC patients, so this mutation of exon 18 could be checked in genetic screening tests of RET

Genetic polymorphisms and protein structures in growth hormone, growth hormone receptor, ghrelin, insulin-like growth factor 1 and leptin in Mehraban sheep.

Science.gov (United States)

Bahrami, A; Behzadi, Sh; Miraei-Ashtiani, S R; Roh, S-G; Katoh, K

2013-09-15

The somatotropic axis, the control system for growth hormone (GH) secretion and its endogenous factors involved in the regulation of metabolism and energy partitioning, has promising potentials for producing economically valuable traits in farm animals. Here we investigated single nucleotide polymorphisms (SNPs) of the genes of factors involved in the somatotropic axis for growth hormone (GH1), growth hormone receptor (GHR), ghrelin (GHRL), insulin-like growth factor 1 (IGF-I) and leptin (LEP), using polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing methods in 452 individual Mehraban sheep. A nonradioactive method to allow SSCP detection was used for genomic DNA and PCR amplification of six fragments: exons 4 and 5 of GH1; exon 10 of GH receptor (GHR); exon 1 of ghrelin (GHRL); exon 1 of insulin-like growth factor-I (IGF-I), and exon 3 of leptin (LEP). Polymorphisms were detected in five of the six PCR products. Two electrophoretic patterns were detected for GH1 exon 4. Five conformational patterns were detected for GH1 exon 5 and LEP exon 3, and three for IGF-I exon 1. Only GHR and GHRL were monomorphic. Changes in protein structures due to variable SNPs were also analyzed. The results suggest that Mehraban sheep, a major breed that is important for the animal industry in Middle East countries, has high genetic variability, opening interesting prospects for future selection programs and preservation strategies. Copyright © 2013 Elsevier B.V. All rights reserved.

SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

Science.gov (United States)

Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

2016-01-01

Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

Identification of a DNA restriction-modification system in Pectobacterium carotovorum strains isolated from Poland.

Science.gov (United States)

Waleron, K; Waleron, M; Osipiuk, J; Podhajska, A J; Lojkowska, E

2006-02-01

Polish isolates of pectinolytic bacteria from the species Pectobacterium carotovorum were screened for the presence of a DNA restriction-modification (R-M) system. Eighty-nine strains of P. carotovorum were isolated from infected potato plants. Sixty-six strains belonged to P. carotovorum ssp. atrosepticum and 23 to P. carotovorum ssp. carotovorum. The presence of restriction enzyme Pca17AI, which is an isoschizomer of EcoRII endonuclease, was observed in all isolates of P. c. atrosepticum but not in P. c. carotovorum. The biochemical properties, PCR amplification, and sequences of the Pca17AI restriction endonuclease and methyltransferase genes were compared with the prototype EcoRII R-M system genes. Only when DNA isolated from cells of P. c. atrosepticum was used as a template, amplification of a 680 bp homologous to the gene coding EcoRII endonuclease. Endonuclease Pca17AI, having a relatively low temperature optimum, was identified. PCR amplification revealed that the nucleotide sequence of genes for EcoRII and Pca17AI R-M are different. Dcm methylation was observed in all strains of Pectobacterium and other Erwinia species tested. The sequence of a DNA fragment coding Dcm methylase in P. carotovorum was different from that of Escherichia coli. Pca17AI is the first psychrophilic isoschizomer of EcoRII endonuclease. The presence of specific Dcm methylation in chromosomal DNA isolated from P. carotovorum is described for the first time. A 680 bp PCR product, unique for P. c. atrosepticum strains, could serve as a molecular marker for detection of these bacteria in environmental samples.

Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

Science.gov (United States)

Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

2010-07-01

To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

Quark fragmentation in e+e- collisions

International Nuclear Information System (INIS)

Oddone, P.

1984-12-01

This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

International Nuclear Information System (INIS)

Conn, V.

1987-01-01

The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy

Directory of Open Access Journals (Sweden)

van Ommen Gert-Jan B

2007-07-01

Full Text Available Abstract Background Antisense-mediated exon skipping is currently one of the most promising therapeutic approaches for Duchenne muscular dystrophy (DMD. Using antisense oligonucleotides (AONs targeting specific exons the DMD reading frame is restored and partially functional dystrophins are produced. Following proof of concept in cultured muscle cells from patients with various deletions and point mutations, we now focus on single and multiple exon duplications. These mutations are in principle ideal targets for this approach since the specific skipping of duplicated exons would generate original, full-length transcripts. Methods Cultured muscle cells from DMD patients carrying duplications were transfected with AONs targeting the duplicated exons, and the dystrophin RNA and protein were analyzed. Results For two brothers with an exon 44 duplication, skipping was, even at suboptimal transfection conditions, so efficient that both exons 44 were skipped, thus generating, once more, an out-of-frame transcript. In such cases, one may resort to multi-exon skipping to restore the reading frame, as is shown here by inducing skipping of exon 43 and both exons 44. By contrast, in cells from a patient with an exon 45 duplication we were able to induce single exon 45 skipping, which allowed restoration of wild type dystrophin. The correction of a larger duplication (involving exons 52 to 62, by combinations of AONs targeting the outer exons, appeared problematic due to inefficient skipping and mistargeting of original instead of duplicated exons. Conclusion The correction of DMD duplications by exon skipping depends on the specific exons targeted. Its options vary from the ideal one, restoring for the first time the true, wild type dystrophin, to requiring more 'classical' skipping strategies, while the correction of multi-exon deletions may need the design of tailored approaches.

Real-Time PCR Quantification of Heteroplasmy in a Mouse Model with Mitochondrial DNA of C57BL/6 and NZB/BINJ Strains

Science.gov (United States)

Sangalli, Juliano Rodrigues; Rodrigues, Thiago Bittencourt; Smith, Lawrence Charles; Meirelles, Flávio Vieira; Chiaratti, Marcos Roberto

2015-01-01

Mouse models are widely employed to study mitochondrial inheritance, which have implications to several human diseases caused by mutations in the mitochondrial genome (mtDNA). These mouse models take advantage of polymorphisms between the mtDNA of the NZB/BINJ and the mtDNA of common inbred laboratory (i.e., C57BL/6) strains to generate mice with two mtDNA haplotypes (heteroplasmy). Based on PCR followed by restriction fragment length polymorphism (PCR-RFLP), these studies determine the level of heteroplasmy across generations and in different cell types aiming to understand the mechanisms underlying mitochondrial inheritance. However, PCR-RFLP is a time-consuming method of low sensitivity and accuracy that dependents on the use of restriction enzyme digestions. A more robust method to measure heteroplasmy has been provided by the use of real-time quantitative PCR (qPCR) based on allelic refractory mutation detection system (ARMS-qPCR). Herein, we report an ARMS-qPCR assay for quantification of heteroplasmy using heteroplasmic mice with mtDNA of NZB/BINJ and C57BL/6 origin. Heteroplasmy and mtDNA copy number were estimated in germline and somatic tissues, providing evidence of the reliability of the approach. Furthermore, it enabled single-step quantification of heteroplasmy, with sensitivity to detect as low as 0.1% of either NZB/BINJ or C57BL/6 mtDNA. These findings are relevant as the ARMS-qPCR assay reported here is fully compatible with similar heteroplasmic mouse models used to study mitochondrial inheritance in mammals. PMID:26274500

Association between CTLA-4 gene promoter (49 A/G) in exon 1 polymorphisms and inflammatory bowel disease in the Tunisian population

International Nuclear Information System (INIS)

Alaya, Walid Ben; Sfar, Imen; Aouadi, Houda; Jendoubi, Saloua; Najjar, Tawfik; Filali, Azza; Gorgi, Yousr; Abdallah, Taieb Ben; Mouelhi, Leila; Matri, Samira; Ayed, Khaled

2009-01-01

To investigate the possible association between the polymorphism of the CTLA-4 exon 1 +49 A/G and susceptibility to Crohn's disease (CD) and ulcerative colitis (UC) in the Tunisian population. The +49 A/G dimorphism was analyzed in 119 patients with CD, 65 patients with UC, and 100 controls by the polymerase chain reaction-restriction fragment length polymorphism method. Significantly higher frequencies of the CTLA-4 +49A allele and A/A homozygous individuals were observed in patients with CD when compared with controls (pc = 0.0023 and pc = 0.0003, respectively). Analysis of CTLA-4 A/G polymorphism with respect to sex in CD showed a significant difference in A/A genotypes between female patients and controls (pc = 0.0001 and pc = 0.038, respectively). There were no differences in the subgroups of patients with CD. Forty-nine A alleles and AA genotype are associated with CD susceptibility in Tunisians. Other genes involved in the T-cell regulation remain strong candidates for IBD susceptibility and require further investigation. (author)

Keragaman Genetik Gen Hormon Pertumbuhan (GH|MboII pada Itik Sikumbang Janti Menggunakan Penciri PCR-RFLP

Directory of Open Access Journals (Sweden)

T.D. Nova

2016-02-01

Full Text Available Penelitian ini bertujuan untuk mengetahui keragaman gen hormon pertumbuhan (GH dengan enzim MboII pada itik Sikumbang Janti dengan menggunakan penciri PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism. Penelitian ini menggunakan sebanyak 50 sampel darah itik Sikumbang Janti. Sampel darah itik Sikumbang Janti diambil melalui vena achilaris sebanyak ± 1 ml. DNA sampel darah diisolasi menggunakan protocol Genomik DNA Purification Kit (Promega. DNA total diamplifikasi menggunakan sepasang primer F : 5’-CTG GAG CAG GCA GGA AAA TT-3’ dan R: 5’-TCC AGG GAC AGT GAC TCA AC-3’ yang menghasilkan fragmen exon 1 gen GH dengan panjang 801 bp. Produk amplifikasi direstriksi dengan menggunakan MboII yang mengenali situs pemotongan GAAGA (N/8↓ . Dari 46 sampel hasil restriksi diperoleh dua posisi. Pada posisi 618 bp dengan genotip yaitu genotip heterozigot (+/- yang terdiri dari 3 pita (266 bp, 535 bp dan 801 bp, genotip homozigot (+/+ yang terdiri dari 3 pita (109 bp, 266 bp, 426 bp dan genotip homozigot (-/- yang terdiri dari 1 pita ( 801 dan terdapat dua tipe alel, yaitu alel (+ dan all (-, all (+ sebesar 0,79 dan alel (- sebesar 0,21. Sedangkan pada posisi 727 bp memiliki genotip yaitu genotip heterozigot (+/- yang terdiri dari 3 pita (109 bp, 266 bp, 426 bp, dan genotip homozigot (-/- yang terdiri dari 3 pita dan terdapat dua tipe alel, yaitu frekuensi alel (+ sebesar 0,61 dan frekuensi alel (- sebesar 0,39. Dari hasil penelitian ini dapat disimpulkan bahwa gen GH-MboII memiliki keragamanan yang tinggi serta menunjukkan adanya keseimbangan atau tidak menyimpang dari keseimbangan Hardy Weinberg pada posisi keragaman 618 bp dan pada posisi 727 dalam ketidakseimbangan Hardy Weinberg.

Molecular genetic analysis of cereal β-amylase genes using exon-primed intron-crossing (EPIC PCR

Directory of Open Access Journals (Sweden)

Stratula Olga

2014-01-01

Full Text Available The proteins encoded by cereal β-amylase genes Bamy1 and Bamy2 genes play an important role in seedling germination and in the brewing process. Here, we use exon-primed intron-crossing (EPIC to analyse Bamy1 and Bamy2 genetic diversity among 38 accessions belonging to six Poaceae tribes. DNA sequence alignment of multiple Poaceae species β-amylase sequences allowed design of EPIC primers that simultaneously amplify Bamy1 and Bamy2 in all the cereal species investigated. The genetic variation observed in the samples investigated is analysed and discussed, and illustrates the effectiveness of this approach for intra- and interspecific analysis in plant species.

Characterization of TTN Novex Splicing Variants across Species and the Role of RBM20 in Novex-Specific Exon Splicing

Directory of Open Access Journals (Sweden)

Zhilong Chen

2018-02-01

Full Text Available Titin (TTN is a major disease-causing gene in cardiac muscle. Titin (TTN contains 363 exons in human encoding various sizes of TTN protein due to alternative splicing regulated mainly by RNA binding motif 20 (RBM20. Three isoforms of TTN protein are produced by mutually exclusive exons 45 (Novex 1, 46 (Novex 2, and 48 (Novex 3. Alternatively splicing in Novex isoforms across species and whether Novex isoforms are associated with heart disease remains completely unknown. Cross-species exon comparison with the mVISTA online tool revealed that exon 45 is more highly conserved across all species than exons 46 and 48. Importantly, a conserved region between exons 47 and 48 across species was revealed for the first time. Reverse transcript polymerase chain reaction (RT-PCR and DNA sequencing confirmed a new exon named as 48′ in Novex 3. In addition, with primer pairs for Novex 1, a new truncated form preserving introns 44 and 45 was discovered. We discovered that Novex 2 is not expressed in the pig, mouse, and rat with Novex 2 primer pairs. Unexpectedly, three truncated forms were identified. One TTN variant with intron 46 retention is mainly expressed in the human and frog heart, another variant with co-expression of exons 45 and 46 exists predominantly in chicken and frog heart, and a third with retention of introns 45 and 46 is mainly expressed in pig, mouse, rat, and chicken. Using Rbm20 knockout rat heart, we revealed that RBM20 is not a splicing regulator of Novex variants. Furthermore, the expression levels of Novex variants in human hearts with cardiomyopathies suggested that Novexes 2 and 3 could be associated with dilated cardiomyopathy (DCM and/or arrhythmogenic right ventricular cardiomyopathy (ARVC. Taken together, our study reveals that splicing diversity of Novex exons across species and Novex variants might play a role in cardiomyopathy.

Comprehensive detection of diverse exon 19 deletion mutations of EGFR in lung Cancer by a single probe set.

Science.gov (United States)

Bae, Jin Ho; Jo, Seong-Min; Kim, Hak-Sung

2015-12-15

Detection of exon 19 deletion mutation of EGFR, one of the most frequently occurring mutations in lung cancer, provides the crucial information for diagnosis and treatment guideline in non-small-cell lung cancer (NSCLC). Here, we demonstrate a simple and efficient method to detect various exon 19 deletion mutations of EGFR using a single probe set comprising of an oligo-quencher (oligo-Q) and a molecular beacon (MB). While the MB hybridizes to both the wild and mutant target DNA, the oligo-Q only binds to the wild target DNA, leading to a fluorescent signal in case of deletion mutation. This enables the comprehensive detection of the diverse exon 19 deletion mutations using a single probe set. We demonstrated the utility and efficiency of the approach by detecting the frequent exon 19 deletion mutations of EGFR through a real-time PCR and in situ fluorescence imaging. Our approach enabled the detection of genomic DNA as low as 0.02 ng, showing a detection limit of 2% in a heterogeneous DNA mixture, and could be used for detecting mutations in a single cell level. The present MB and oligo-Q dual probe system can be used for diagnosis and treatment guideline in NSCLC. Copyright © 2015 Elsevier B.V. All rights reserved.

Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India

Science.gov (United States)

Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

2011-01-01

Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

Science.gov (United States)

Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

2011-04-01

Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

Comparison by restriction fragment pattern analyses and molecular characterization of some European isolates of Suid herpesvirus 1: A contribution to strain differentiation of European isolates

DEFF Research Database (Denmark)

Christensen, Laurids Siig

1988-01-01

Eleven European isolates of Suid herpesvirus type 1 (SHV-1) were compared by restriction fragment pattern analyses and Southern blot hybridization using different genomic probes. The presence of strain discriminative 4 major genome types and several subtypes as well as the molecular distinctions...

A multiplex PCR for detection of six viruses in ducks.

Science.gov (United States)

Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

2017-10-01

In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

Cluster of differentiation 14 gene polymorphism and its association with incidence of clinical mastitis in Karan fries cattle

Directory of Open Access Journals (Sweden)

A. Sakthivel Selvan

2014-12-01

Full Text Available Aim: The present study was undertaken with the objectives to characterize, identify DNA polymorphism in cluster of differentiation 14 (CD14 gene in Karan Fries (KF cattle and to analyze association between genetic variants with incidence of clinical mastitis in National Dairy Research Institute (NDRI herd, Karnal. Materials and Methods: Genomic DNA was extracted using blood of randomly selected hundred KF lactating cattle by phenol-chloroform method. After checking its quality and quantity, polymerase chain reaction (PCR was carried out using reported primers to amplify 832 base pair region covering nucleotide base position number 1012 to 1843 (part of promoter, 5’UTR, exon 1, intron 1 and part of exon 2 of bovine CD14 gene. The PCR amplified target product was purified, sequenced and further ClustalW analysis was done to align edited sequence with reported Bos taurus sequence (EU148610.1. The restriction fragment length polymorphism (RFLP analysis was performed for each KF cow using HinfI restriction enzyme (RE. Cows were assigned genotypes obtained by PCR-RFLP analysis and association study was done using Chi-square (χ2 test. Results: After PCR amplification, DNA sequencing of amplicon confirmed the 832 bases covering 1012 to 1843 nucleotide base position of bovine CD14 gene. ClustalW multiple sequence alignment program for DNA revealed six nucleotide changes in KF cows at positions T1117D, T1239G, T1291C, G1359C, G1361A, and G1811A. Cows were also screened using PCR-RFLP with HinfI RE, which revealed three genotypes CC, CD and DD that differed significantly regarding mastitis incidence. Within CC genotype, 72.73% of cows were in a mastitis non-affected group whereas, those in CD and DD genotypes 69.44% and 60.38% respectively were mastitis affected. Conclusion: KF cows with allele C of CD14 gene were less susceptibility to mastitis compared with D allele.

Restrictive Dermopathy: Molecular diagnosis of restrictive dermopathy in a stillborn fetus from a consanguineous Iranian family

International Nuclear Information System (INIS)

Karaminejad, A.; Goodarzi, P.; Huong, Le Thi Thanh; Wehnert, Manfred S.

2009-01-01

Restrictive dermopathy (RD) is an autosomal recessive lethal human genetic disorder. It is characterized by intrauterine growth retardation, tight and rigid skin with erosions, multiple joint contractures, lung hypoplasia, prominent superficial vasculature and epidermal hyperkeratosis. In the present report, we describe the first case of restrictive dermopathy in a stillborn fetus of Iranian origin, confirmed by molecular genetic diagnosis. In the index case (G-30159), a homozygous one base insertion in ZMPSTE24exon 9 (c.1085-1086insT) was identified. We believe that by increasing awareness of this disease in clinicians, gynecologists and pathologists, we may be able to help families who have had suspected cases of restrictive dermopathy be diagnosed and offer molecular testing in carriers and prenatal diagnosis to prevent the occurrence of further affected cases. (author)

CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.

Science.gov (United States)

Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel

2018-03-29

Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.

The ICR96 exon CNV validation series: a resource for orthogonal assessment of exon CNV calling in NGS data [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Shazia Mahamdallie

2017-05-01

Full Text Available Detection of deletions and duplications of whole exons (exon CNVs is a key requirement of genetic testing. Accurate detection of this variant type has proved very challenging in targeted next-generation sequencing (NGS data, particularly if only a single exon is involved. Many different NGS exon CNV calling methods have been developed over the last five years. Such methods are usually evaluated using simulated and/or in-house data due to a lack of publicly-available datasets with orthogonally generated results. This hinders tool comparisons, transparency and reproducibility. To provide a community resource for assessment of exon CNV calling methods in targeted NGS data, we here present the ICR96 exon CNV validation series. The dataset includes high-quality sequencing data from a targeted NGS assay (the TruSight Cancer Panel together with Multiplex Ligation-dependent Probe Amplification (MLPA results for 96 independent samples. 66 samples contain at least one validated exon CNV and 30 samples have validated negative results for exon CNVs in 26 genes. The dataset includes 46 exon CNVs in BRCA1, BRCA2, TP53, MLH1, MSH2, MSH6, PMS2, EPCAM or PTEN, giving excellent representation of the cancer predisposition genes most frequently tested in clinical practice. Moreover, the validated exon CNVs include 25 single exon CNVs, the most difficult type of exon CNV to detect. The FASTQ files for the ICR96 exon CNV validation series can be accessed through the European-Genome phenome Archive (EGA under the accession number EGAS00001002428.

Inverse fusion PCR cloning.

Directory of Open Access Journals (Sweden)

Markus Spiliotis

Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients

Directory of Open Access Journals (Sweden)

Aziza Sbiti

2002-01-01

Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.

Use of RAPD and PCR double amplification in the study of ancient DNA

Directory of Open Access Journals (Sweden)

F. Balzano

2011-01-01

Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T).

Science.gov (United States)

Gumus, Evren

2018-05-07

Familial Mediterranean Fever (FMF) is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV) gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January⁻December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T) mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP), do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS) analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

The Development of Three Long Universal Nuclear Protein-Coding Locus Markers and Their Application to Osteichthyan Phylogenetics with Nested PCR

Science.gov (United States)

Zhang, Peng

2012-01-01

Background Universal nuclear protein-coding locus (NPCL) markers that are applicable across diverse taxa and show good phylogenetic discrimination have broad applications in molecular phylogenetic studies. For example, RAG1, a representative NPCL marker, has been successfully used to make phylogenetic inferences within all major osteichthyan groups. However, such markers with broad working range and high phylogenetic performance are still scarce. It is necessary to develop more universal NPCL markers comparable to RAG1 for osteichthyan phylogenetics. Methodology/Principal Findings We developed three long universal NPCL markers (>1.6 kb each) based on single-copy nuclear genes (KIAA1239, SACS and TTN) that possess large exons and exhibit the appropriate evolutionary rates. We then compared their phylogenetic utilities with that of the reference marker RAG1 in 47 jawed vertebrate species. In comparison with RAG1, each of the three long universal markers yielded similar topologies and branch supports, all in congruence with the currently accepted osteichthyan phylogeny. To compare their phylogenetic performance visually, we also estimated the phylogenetic informativeness (PI) profile for each of the four long universal NPCL markers. The PI curves indicated that SACS performed best over the whole timescale, while RAG1, KIAA1239 and TTN exhibited similar phylogenetic performances. In addition, we compared the success of nested PCR and standard PCR when amplifying NPCL marker fragments. The amplification success rate and efficiency of the nested PCR were overwhelmingly higher than those of standard PCR. Conclusions/Significance Our work clearly demonstrates the superiority of nested PCR over the conventional PCR in phylogenetic studies and develops three long universal NPCL markers (KIAA1239, SACS and TTN) with the nested PCR strategy. The three markers exhibit high phylogenetic utilities in osteichthyan phylogenetics and can be widely used as pilot genes for

Molecular characterization of the rDNA-ITS sequence and a PCR diagnostic technique for Pileolaria terebinthi, the cause of pistachio rust

Directory of Open Access Journals (Sweden)

Hossein ALAEI

2013-01-01

Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.

ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

DEFF Research Database (Denmark)

Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

2008-01-01

A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

Science.gov (United States)

Wood, S; Starr, T V; Shukin, R J

1986-01-01

We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

Clinical Characteristics and Outcomes of Lung Cancer Patients 
with EGFR Mutations in Exons 19 and 21

Directory of Open Access Journals (Sweden)

Renwang LIU

2014-11-01

Full Text Available Background and objective Studies on the epidermal growth factor receptor (EGFR signaling pathways and the therapeutic effects of EGFR-tyrosine kinase inhibitors (EGFR-TKIs have recently proven that targeted therapy has a major role in the treatment of lung cancer. However, the therapeutic effects of EGFR-TKIs on lung cancers with different EGFR mutation subtypes remain unclear. And if there is a significant difference in the effects of EGFR-TKIs, the mechanisms for the difference remain unclear. The aim of this study was to investigate the clinical importance of EGFR mutations in exons 19 and 21 of lung cancer patients and to compare the outcomes of these patients. Methods The study recruited 113 patients who had non-small cell lung cancer (NSCLC with EGFR mutations. EGFR mutations were detected for 47 patients using Real-time PCR or DNA sequencinag. The mutations of the remaining patients were determined using xTag-EGFR liquid chip technology. All stages I-III patients underwent radical resection followed by 4 cycles of postoperative chemotherapy. Patients with pleural metastases underwent pleural biopsy, pleurodesis, and chemotherapy only. Patients with distant metastases underwent biopsy and chemotherapy only. Collected clinical data were analyzed using SPSS 19.0 software. Results EGFR exon mutations 19 and 21 were found in 56 and 57 patients, respectively. The mean age of patients with exon 19 mutations was lower than the age of the patients with exon 21 mutations (57.02±11.31 years vs 62.25±7.76 years, respectively; P0.05 between the patients with exon 19 and 21 mutations; and survival analysis of 91 (80.5% patients with complete clinical data found no differences in overall survival. Stratification analysis found out that patients with exon 19 mutations had longer overall survival associated with age>61 years, male gender, ever smoking, and stage IV disease; although the differences were not significant. Conclusion Compared to the lung

Identification of three novel OA1 gene mutations identified in three families misdiagnosed with congenital nystagmus and carrier status determination by real-time quantitative PCR assay

Directory of Open Access Journals (Sweden)

Hamel Christian

2003-01-01

Full Text Available Abstract Background X-linked ocular albinism type 1 (OA1 is caused by mutations in OA1 gene, which encodes a membrane glycoprotein localised to melanosomes. OA1 mainly affects pigment production in the eye, resulting in optic changes associated with albinism including hypopigmentation of the retina, nystagmus, strabismus, foveal hypoplasia, abnormal crossing of the optic fibers and reduced visual acuity. Affected Caucasian males usually appear to have normal skin and hair pigment. Results We identified three previously undescribed mutations consisting of two intragenic deletions (one encompassing exon 6, the other encompassing exons 7–8, and a point mutation (310delG in exon 2. We report the development of a new method for diagnosis of heterozygous deletions in OA1 gene based on measurement of gene copy number using real-time quantitative PCR from genomic DNA. Conclusion The identification of OA1 mutations in families earlier reported as families with hereditary nystagmus indicate that ocular albinism type 1 is probably underdiagnosed. Our method of real-time quantitative PCR of OA1 exons with DMD exon as external standard performed on the LightCycler™ allows quick and accurate carrier-status assessment for at-risk females.

Polymorphic Variation in Double Strand Break Repair Gene in Indian Population: A Comparative Approach with Worldwide Ethnic Group Variations.

Science.gov (United States)

Mandal, Raju Kumar; Mittal, Rama Devi

2018-04-01

DNA repair capacity is essential in maintaining cellular functions and homeostasis. Identification of genetic polymorphisms responsible for reduced DNA repair capacity may allow better cancer prevention. Double strand break repair pathway plays critical roles in maintaining genome stability. Present study was conducted to determine distribution of XRCC3 Exon 7 (C18067T, rs861539) and XRCC7 Intron 8 (G6721T, rs7003908) gene polymorphisms in North Indian population and compare with different populations globally. The genotype assays were performed in 224 normal healthy individuals of similar ethnicity using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Allelic frequencies of wild type were 79% (C) in XRCC3 Exon 7 C > T and 57% (G) in XRCC7 Intron 8 (G > T) 57% (G) observed. On the other hand, the variant allele frequency were 21% (T) in XRCC3 Exon 7 C > T and 43% (T) in XRCC7 Intron 8 G > T respectively. Major differences from other ethnic populations were observed. Our results suggest that frequency in these DNA repair genes exhibit distinctive pattern in India that could be attributed to ethnicity variation. This could assist in high-risk screening of humans exposed to environmental carcinogens and cancer predisposition in different ethnic groups.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

Science.gov (United States)

Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

2015-01-01

We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods

Directory of Open Access Journals (Sweden)

Nelly eDatukishvili

2015-07-01

Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

Interpreting ecological diversity indices applied to terminal restriction fragment length polymorphism data: insights from simulated microbial communities.

Science.gov (United States)

Blackwood, Christopher B; Hudleston, Deborah; Zak, Donald R; Buyer, Jeffrey S

2007-08-01

Ecological diversity indices are frequently applied to molecular profiling methods, such as terminal restriction fragment length polymorphism (T-RFLP), in order to compare diversity among microbial communities. We performed simulations to determine whether diversity indices calculated from T-RFLP profiles could reflect the true diversity of the underlying communities despite potential analytical artifacts. These include multiple taxa generating the same terminal restriction fragment (TRF) and rare TRFs being excluded by a relative abundance (fluorescence) threshold. True community diversity was simulated using the lognormal species abundance distribution. Simulated T-RFLP profiles were generated by assigning each species a TRF size based on an empirical or modeled TRF size distribution. With a typical threshold (1%), the only consistently useful relationship was between Smith and Wilson evenness applied to T-RFLP data (TRF-E(var)) and true Shannon diversity (H'), with correlations between 0.71 and 0.81. TRF-H' and true H' were well correlated in the simulations using the lowest number of species, but this correlation declined substantially in simulations using greater numbers of species, to the point where TRF-H' cannot be considered a useful statistic. The relationships between TRF diversity indices and true indices were sensitive to the relative abundance threshold, with greatly improved correlations observed using a 0.1% threshold, which was investigated for comparative purposes but is not possible to consistently achieve with current technology. In general, the use of diversity indices on T-RFLP data provides inaccurate estimates of true diversity in microbial communities (with the possible exception of TRF-E(var)). We suggest that, where significant differences in T-RFLP diversity indices were found in previous work, these should be reinterpreted as a reflection of differences in community composition rather than a true difference in community diversity.

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

Science.gov (United States)

Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

2017-10-27

Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

Science.gov (United States)

Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

2001-01-01

Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

To Screen Inactivation Mutation of Exon 1 of FSHR Gene in Polycystic Ovarian Syndrome: A South Indian Cohort Study

Science.gov (United States)

Sekar, Nishu; Yeole, Samiksha; Pradeep, Rashmi; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

2017-11-01

Polycystic ovary syndrome is an endocrine disorder. Irregular menstrual cycle, acne, facial hair and elevated androgen levels are the most common signs for PCOS. PCOS has an estimated prevalence of 4-12% among reproductive age women, thus making it a forerunner in female infertility. FSHR plays an important role in FSH signaling pathway making it an important gene for PCOS. In this study, we aim to focus on any association between the FSHR gene and PCOS. Our study was to evaluate any polymorphism of exon 1 of FSHR gene associated with PCOS.PCR-RFLP technique was performed on the PCOS samples. Hormonal changes were found in the patients. Exon 1 inactivation mutation of FSHR gene was not observed in the patient sample. A study of this association needs to be done using large sample size.

Hypermethylation of the 5′ CpG island of the p14ARF flanking exon 1β in human colorectal cancer displaying a restricted pattern of p53 overexpression concomitant with increased MDM2 expression

Directory of Open Access Journals (Sweden)

Nyiraneza Christine

2012-06-01

Full Text Available Abstract Background It has been suggested that inactivation of p14ARF, a tumor suppressor central to regulating p53 protein stability through interaction with the MDM2 oncoprotein, abrogates p53 activity in human tumors retaining the wild-type TP53 gene. Differences in expression of tumor suppressor genes are frequently associated with cancer. We previously reported on a pattern of restricted p53 immunohistochemical overexpression significantly associated with microsatellite instability (MSI, low TP53 mutation frequency, and MDM2 overexpression in colorectal cancers (CRCs. In this study, we investigated whether p14ARF alterations could be a mechanism for disabling the p53 pathway in this subgroup of CRCs. Results Detailed maps of the alterations in the p14ARF gene were determined in a cohort of 98 CRCs to detect both nucleotide and copy-number changes. Methylation-specific PCR combined with bisulfite sequencing was used to evaluate the prevalence and distribution of p14ARF methylation. p14ARF alterations were then correlated with MSI status, TP53 mutations, and immunohistochemical expression of p53 and MDM2. The frequency of p14ARF mutations was extremely low (1/98; 1%, whereas coexistence of methylated and unmethylated alleles in both tumors and normal colon mucosa was common (91/98; 93%. Only seven of ninety-eight tumors (7% had a distinct pattern of methylation compared with normal colon mucosa. Evaluation of the prevalence and distribution of p14ARF promoter methylation in a region containing 27 CpG sites in 35 patients showed a range of methylated CpG sites in tumors (0 to 25 (95% CI 1 to 13 versus 0 to 17 (95% CI 0 to 2 in adjacent colon mucosa (P = 0.004. Hypermethylation of the p14ARF promoter was significantly correlated with the restricted p53 overexpression pattern (P = 0.03, and MDM2 overexpression (P = 0.02, independently of MSI phenotype. Although no significant correlation between p14ARF methylation and TP53 mutational

Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis

Energy Technology Data Exchange (ETDEWEB)

Satoh, Chiyoko; Takahashi, Norio; Asakawa, Junichi; Hiyama, Keiko; Kodaira, Meiko (Radiation Effects Research Foundation, Hiroshima (Japan))

1993-01-01

In the course of feasibility studies to examine the efficiencies and practicalities of various techniques for screening for genetic variations, the human coagulation factor IX (F9) genes of 63 Japanese families were examined by PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Four target sequences with lengths of 983-2,891 bp from the F9 genes of 126 unrelated individuals from Hiroshima and their 100 children were amplified by PCR, digested with restriction enzymes to approximately 500-bp fragments, and examined by DGGE - a total of 6,724 bp being examined per individual. GC-rich sequences (GC-clamps) of 40 bp were attached to both ends of the target sequences, as far as was feasible. Eleven types of new nucleotide substitutions were detected in the population, none of which produced RFLPs or caused hemophilia B. By examining two target sequences in a single lane, approximately 8,000 bp in a diploid individual could be examined. This approach is very effective for the detection of variations in DNA and is applicable to large-scale population studies. 46 refs., 3 figs., 1 tab.

GGC and StuI polymorphism on the androgen receptor gene in endometrial cancer patients

International Nuclear Information System (INIS)

Sasaki, Masahiro; Karube, Akihiro; Karube, Yuko; Watari, Michiko; Sakuragi, Noriaki; Fujimoto, Seiichiro; Dahiya, Rajvir

2005-01-01

Androgens have an anti-proliferative effect on endometrial cells. Human androgen receptor (AR) gene contains two polymorphic short tandem repeats of GGC and CAG, and a single-nucleotide polymorphism on exon 1 that is recognized by the restriction enzyme, StuI. Prior studies have shown that the lengths of the CAG repeat are inversely and linearly related to AR activity and associated with endometrial cancer. However, little is known about the GGC repeat and the StuI polymorphism of the AR gene. Thus, we investigated whether these AR polymorphisms are risk factors for endometrial cancer. To test this hypothesis, the genetic distributions of these polymorphisms were investigated in blood samples from endometrial cancer patients and healthy controls. The allelic and genotyping profiles were analyzed by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and direct DNA sequencing, and analyzed statistically. The GGC repeat was significantly longer in endometrial cancer patients as compared to normal healthy controls. In general, an increased risk of endometrial cancer was found with increasing GGC repeat. The relative risk for the 17 GGC repeat was greater than 4, as compared to controls. However, the StuI polymorphism was not significantly different between patients and controls. The findings suggest that increased numbers of GGC repeat on the AR gene may be a risk factor for endometrial cancer

The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T

Directory of Open Access Journals (Sweden)

Evren Gumus

2018-05-01

Full Text Available Background: Familial Mediterranean Fever (FMF is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. Methods: In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January–December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Results: Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. Conclusions: One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP, do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

Science.gov (United States)

Tomasello, Salvatore; Heubl, Günther

2017-07-01

The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

International Nuclear Information System (INIS)

Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

1987-01-01

The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

RFLP for the human pepsinogen C gene (PGC)

Energy Technology Data Exchange (ETDEWEB)

Azuma, T; Pals, G; Taggart, R T

1988-10-11

PGC 301 is a 1224 bp cDNA clone containing exons 2-9 of the human pepsinogen C (progastericsin) coding sequence. 100 bp deletion/insertion polymorphism is observed with five restriction endonucleases; BamHI, EcoRI, MstII, PstI, and SacI. The same RFLP is observed with these enzymes. The polymorphic region is located between exons 7 and 8. The frequency was estimated from 40 unrelated Caucasians, with the large fragment allele 82.5% and the small fragment allele 17.5%. PGC gene has been assigned to 6p21.1-pter by somatic cell hybrids. Mendelian inheritance was demonstrated in two families.

In-frame mutations in exon 1 of SKI cause dominant Shprintzen-Goldberg syndrome.

Science.gov (United States)

Carmignac, Virginie; Thevenon, Julien; Adès, Lesley; Callewaert, Bert; Julia, Sophie; Thauvin-Robinet, Christel; Gueneau, Lucie; Courcet, Jean-Benoit; Lopez, Estelle; Holman, Katherine; Renard, Marjolijn; Plauchu, Henri; Plessis, Ghislaine; De Backer, Julie; Child, Anne; Arno, Gavin; Duplomb, Laurence; Callier, Patrick; Aral, Bernard; Vabres, Pierre; Gigot, Nadège; Arbustini, Eloisa; Grasso, Maurizia; Robinson, Peter N; Goizet, Cyril; Baumann, Clarisse; Di Rocco, Maja; Sanchez Del Pozo, Jaime; Huet, Frédéric; Jondeau, Guillaume; Collod-Beroud, Gwenaëlle; Beroud, Christophe; Amiel, Jeanne; Cormier-Daire, Valérie; Rivière, Jean-Baptiste; Boileau, Catherine; De Paepe, Anne; Faivre, Laurence

2012-11-02

Shprintzen-Goldberg syndrome (SGS) is characterized by severe marfanoid habitus, intellectual disability, camptodactyly, typical facial dysmorphism, and craniosynostosis. Using family-based exome sequencing, we identified a dominantly inherited heterozygous in-frame deletion in exon 1 of SKI. Direct sequencing of SKI further identified one overlapping heterozygous in-frame deletion and ten heterozygous missense mutations affecting recurrent residues in 18 of the 19 individuals screened for SGS; these individuals included one family affected by somatic mosaicism. All mutations were located in a restricted area of exon 1, within the R-SMAD binding domain of SKI. No mutation was found in a cohort of 11 individuals with other marfanoid-craniosynostosis phenotypes. The interaction between SKI and Smad2/3 and Smad 4 regulates TGF-β signaling, and the pattern of anomalies in Ski-deficient mice corresponds to the clinical manifestations of SGS. These findings define SGS as a member of the family of diseases associated with the TGF-β-signaling pathway. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Hemi-nested PCR and RFLP methodologies for identifying blood meals of the Chagas disease vector, Triatoma infestans.

Science.gov (United States)

Roellig, Dawn M; Gomez-Puerta, Luis A; Mead, Daniel G; Pinto, Jesus; Ancca-Juarez, Jenny; Calderon, Maritza; Bern, Caryn; Gilman, Robert H; Cama, Vitaliano A

2013-01-01

Trypanosoma cruzi, the etiologic agent of Chagas disease, is transmitted by hematophagous reduviid bugs within the subfamily Triatominae. These vectors take blood meals from a wide range of hosts, and their feeding behaviors have been used to investigate the ecology and epidemiology of T. cruzi. In this study we describe two PCR-based methodologies that amplify a fragment of the 16S mitochondrial rDNA, aimed to improve the identification of blood meal sources for Triatoma infestans: a.--Sequence analyses of two heminested PCRs that allow the identification of mammalian and avian species, and b.--restriction fragment length polymorphism (RFLP) analysis from the mammalian PCR to identify and differentiate multi-host blood meals. Findings from both methodologies indicate that host DNA could be detected and the host species identified in samples from laboratory reared and field collected triatomines. The implications of this study are two-fold. First, these methods can be used in areas where the fauna diversity and feeding behavior of the triatomines are unknown. Secondly, the RFLP method led to the identification of multi-host DNA from T. infestans gut contents, enhancing the information provided by this assay. These tools are important contributions for ecological and epidemiological studies of vector-borne diseases.

Widespread evolutionary conservation of alternatively spliced exons in caenorhabditis

DEFF Research Database (Denmark)

Irimia, Manuel; Rukov, Jakob L; Penny, David

2007-01-01

Alternative splicing (AS) contributes to increased transcriptome and proteome diversity in various eukaryotic lineages. Previous studies showed low levels of conservation of alternatively spliced (cassette) exons within mammals and within dipterans. We report a strikingly different pattern...... in Caenorhabditis nematodes-more than 92% of cassette exons from Caenorhabditis elegans are conserved in Caenorhabditis briggsae and/or Caenorhabditis remanei. High levels of conservation extend to minor-form exons (present in a minority of transcripts) and are particularly pronounced for exons showing complex...... patterns of splicing. The functionality of the vast majority of cassette exons is underscored by various other features. We suggest that differences in conservation between lineages reflect differences in levels of functionality and further suggest that these differences are due to differences in intron...

Increased frequency of co-existing JAK2 exon-12 or MPL exon-10 mutations in patients with low JAK2(V617F) allelic burden.

Science.gov (United States)

Nussenzveig, Roberto H; Pham, Ha T; Perkins, Sherrie L; Prchal, Josef T; Agarwal, Archana M; Salama, Mohamed E

2016-01-01

The frequency of co-existing JAK2(V617F)/MPL and JAK2(V617F)/JAK2 exon-12 mutations has not been previously investigated in MPNs. Poor survival was reported in primary myelofibrosis with low JAK2(V617F) allelic burden. However, mutational status of JAK2 exon-12 or MPL were not reported in these patients. This study developed a cost-effective multiplex high resolution melt assay that screens for mutations in JAK2 gene exons-12 and -14 ((V617F)) and MPL gene exon-10. Co-existing mutations with JAK2(V617F) were detected in 2.9% (6/208; two JAK2 exon-12 and four MPL exon-10) patient specimens with known JAK2(V617F) (allelic-burden range: 0.1-96.8%). Co-existing mutations were detected in specimens with MPL exon-10 mutation should be pursued.

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Novel rapid genotyping assays for neuronal ceroid lipofuscinosis in Border Collie dogs and high frequency of the mutant allele in Japan.

Science.gov (United States)

Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Kawahara, Natsuko; Hayashi, Daisuke; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

2011-11-01

Neuronal ceroid lipofuscinosis (NCL) constitutes a group of recessively inherited lysosomal storage diseases that primarily affect neuronal cells. Such diseases share certain clinical and pathologic features in human beings and animals. Neuronal ceroid lipofuscinosis in Border Collie dogs was first detected in Australia in the 1980s, and the pathogenic mutation was shown to be a nonsense mutation (c.619C>T) in exon 4 in canine CLN5 gene. In the present study, novel rapid genotyping assays including polymerase chain reaction (PCR)-restriction fragment length polymorphism, PCR primer-induced restriction analysis, mutagenically separated PCR, and real-time PCR with TaqMan minor groove binder probes, were developed. The utility of microchip electrophoresis was also evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies in Japan using these assays to determine the current allele frequency in Japan, providing information to control and prevent this disease in the next stage. All assays developed in the current study are available to discriminate these genotypes, and microchip electrophoresis showed a timesaving advantage over agarose gel electrophoresis. Of all assays, real-time PCR was the most suitable for large-scale examination because of its high throughput. The genotyping survey demonstrated that the carrier frequency was 8.1%. This finding suggested that the mutant allele frequency of NCL in Border Collies is high enough in Japan that measures to control and prevent the disease would be warranted. The genotyping assays developed in the present study could contribute to the prevention of NCL in Border Collies.

Differentiation of Meat Samples from Domestic Horses ( Equus caballus and Asiatic Wild Asses ( Equus hemionus Using a Species-Speci fi c Restriction Site in the Mitochondrial Cytochrome b Region

Directory of Open Access Journals (Sweden)

Ralph Kuehn

2006-12-01

Full Text Available Recent studies suggest that Asiatic wild asses ( Equus hemionus are being increasingly poached in a commercial fashion. Part of the meat is believed to reach the meat markets in the capital Ulaanbaatar. To test this hypothesis, we collected 500 meat samples between February and May 2006. To differentiate between domestic horse ( Equus caballus and wild ass meat, we developed a restriction fragment length polymorphism (RFLP assay based on the polymerase chain reaction (PCR. We ampli fi ed and sequenced a cytochrome b fragment (335 bp and carried out a multialignment of the generated sequences for the domestic horse, the Asiatic wild ass, the domestic donkey ( Equus asinus and the Przewalski’s horse ( Equus ferus przewalskii . We detected a species-speci fi c restriction site (AatII for the Asiatic wild ass, resulting in a speci fi c restriction fragment length polymorphism (RFLP band pattern. This RFLP assay represents a rapid and cost-effective method to detect wild ass meat. All of the 500 meat samples we collected and analysed within this pilot project proved to be domestic horsemeat as declared by the sales people. Thus, either the assumption that wild ass meat is sold as “cheap horse meat” is wrong, or we picked the wrong markets, products or season.

Evaluating approaches to find exon chains based on long reads.

Science.gov (United States)

Kuosmanen, Anna; Norri, Tuukka; Mäkinen, Veli

2018-05-01

Transcript prediction can be modeled as a graph problem where exons are modeled as nodes and reads spanning two or more exons are modeled as exon chains. Pacific Biosciences third-generation sequencing technology produces significantly longer reads than earlier second-generation sequencing technologies, which gives valuable information about longer exon chains in a graph. However, with the high error rates of third-generation sequencing, aligning long reads correctly around the splice sites is a challenging task. Incorrect alignments lead to spurious nodes and arcs in the graph, which in turn lead to incorrect transcript predictions. We survey several approaches to find the exon chains corresponding to long reads in a splicing graph, and experimentally study the performance of these methods using simulated data to allow for sensitivity/precision analysis. Our experiments show that short reads from second-generation sequencing can be used to significantly improve exon chain correctness either by error-correcting the long reads before splicing graph creation, or by using them to create a splicing graph on which the long-read alignments are then projected. We also study the memory and time consumption of various modules, and show that accurate exon chains lead to significantly increased transcript prediction accuracy. The simulated data and in-house scripts used for this article are available at http://www.cs.helsinki.fi/group/gsa/exon-chains/exon-chains-bib.tar.bz2.

Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

Science.gov (United States)

Qu, Xinshun; Christ, Barbara J

2006-10-01

ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

Science.gov (United States)

Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

1996-01-01

Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

Distribution and differential diagnosis of Entamoeba Histolytica from Entamoeba Dispar by the PCR-RFLP method in central Iran

International Nuclear Information System (INIS)

Hooshyar, Hossein; Rezian, Mostafa; Kazemi, Bahram

2003-01-01

Entamoeba histolytica and Entamoeba dispar are two morphologically indistinguishable human protozoan parasites that are genetically distinct species. The potential invasive pathogenic Entamoeba histolytica and non-invasive parasites Entamoeba dispar can be differentiated by molecular and other methods. We used Polymer Chain Reaction (PCR) to determine the ratio of two species in a population in central Iran.Human stool samples(n=12 148) were randomly collected in Tehran and Karaj and examined for E.histolytica/E.dispar cysts with direct and formalin-ether methods.Eighty -seven (0.7%) cases were positive, of which 49 (62.8%) isolates were successfully cultured in Robison's medium. A pair of oligonucleotide primers designed from sequence data for genomic DNA coding the 30-KD surface antigen of E.histolytica/E.dipar was used to amplify a 374 base-pair (bp) fragment. The restriction fragment length polymorphism (RFLP) pattern obtained from a standard E.histolytica isolate had had two fragments (219 bp and 155bp), but the standard isolate of E. disparshowed three fragments (155, 152 and 67bp ). Differential diagonosis of 49 isolates of E. histolytica/ E. dispar from Tehran and Karaj using PCR-RFLP revealed that 46(93.9%) were E. were E. dispar while only 2(4.1%) were E. histolytica .One person (2%) had a mixed infection and showed both patterns The differential diagonosis of the potentially pathogenic parasite E.histolytica from the non-pathogenic E. dispar is of clinical and epidemiological importance. This study demonstrated E. dispar is much more prevalent than E.histolytica among the c yst passersin Tehran and Kraj in Central Iran. (author)

Exon - ASTRA | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...ontents Exons in variants Data file File name: astra_exon.zip File URL: ftp://ftp.biosciencedbc.jp/archive/a... About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Exon - ASTRA | LSDB Archive ...

Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

NARCIS (Netherlands)

Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

2013-01-01

BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

Efficient use of a translation start codon in BDNF exon I.

Science.gov (United States)

Koppel, Indrek; Tuvikene, Jürgen; Lekk, Ingrid; Timmusk, Tõnis

2015-09-01

The brain-derived neurotrophic factor (BDNF) gene contains a number of 5' exons alternatively spliced with a common 3' exon. BDNF protein is synthesized from alternative transcripts as a prepro-precursor encoded by the common 3' exon IX, which has a translation start site 21 bp downstream of the splicing site. BDNF mRNAs containing exon I are an exception to this arrangement as the last three nucleotides of this exon constitute an in-frame AUG. Here, we show that this AUG is efficiently used for translation initiation in PC12 cells and cultured cortical neurons. Use of exon I-specific AUG produces higher levels of BDNF protein than use of the common translation start site, resulting from a higher translation rate. No differences in protein degradation, constitutive or regulated secretion were detected between BDNF isoforms with alternative 5' termini. As the BDNF promoter preceding exon I is known to be highly regulated by neuronal activity, our results suggest that the function of this translation start site may be efficient stimulus-dependent synthesis of BDNF protein. The brain-derived neurotrophic factor (BDNF) gene contains multiple untranslated 5' exons alternatively spliced to one common protein-coding 3' exon. However, exon I contains an in-frame ATG in a favorable translation context. Here, we show that use of this ATG is associated with more efficient protein synthesis than the commonly used ATG in exon IX. © 2015 International Society for Neurochemistry.

Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

Directory of Open Access Journals (Sweden)

Chang Chieh-Ting

2008-06-01

Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.

Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

NARCIS (Netherlands)

Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

2013-01-01

In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

Two novel exonic point mutations in HEXA identified in a juvenile Tay-Sachs patient: role of alternative splicing and nonsense-mediated mRNA decay.

Science.gov (United States)

Levit, A; Nutman, D; Osher, E; Kamhi, E; Navon, R

2010-06-01

We have identified three mutations in the beta-hexoseaminidase A (HEXA) gene in a juvenile Tay-Sachs disease (TSD) patient, which exhibited a reduced level of HEXA mRNA. Two mutations are novel, c.814G>A (p.Gly272Arg) and c.1305C>T (p.=), located in exon 8 and in exon 11, respectively. The third mutation, c.1195A>G (p.Asn399Asp) in exon 11, has been previously characterized as a common polymorphism in African-Americans. Hex A activity measured in TSD Glial cells, transfected with HEXA cDNA constructs bearing these mutations, was unaltered from the activity level measured in normal HEXA cDNA. Analysis of RT-PCR products revealed three aberrant transcripts in the patient, one where exon 8 was absent, one where exon 11 was absent and a third lacking both exons 10 and 11. All three novel transcripts contain frameshifts resulting in premature termination codons (PTCs). Transfection of mini-gene constructs carrying the c.814G>A and c.1305C>T mutations proved that the two mutations result in exon skipping. mRNAs that harbor a PTC are detected and degraded by the nonsense-mediated mRNA decay (NMD) pathway to prevent synthesis of abnormal proteins. However, although NMD is functional in the patient's fibroblasts, aberrant transcripts are still present. We suggest that the level of correctly spliced transcripts as well as the efficiency in which NMD degrade the PTC-containing transcripts, apparently plays an important role in the phenotype severity of the unique patient and thus should be considered as a potential target for drug therapy.

MDE heteroduplex analysis of PCR products spanning each exon of the fibrillin (FBN1) gene greatly increases the efficiency of mutation detection in the Marfan syndrome

Energy Technology Data Exchange (ETDEWEB)

Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)

1994-09-01

Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.

Putative in vitro expressed gene fragments unique to Mycobacterium avium subspecies para tuberculosis

DEFF Research Database (Denmark)

Nielsen, Kirstine Klitgaard; Ahrens, Peter

2002-01-01

By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria. The uniquen......By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria....... The uniqueness and diagnostic potential of seven of these fragments in relation to M. paratuberculosis closest relative Mycobacterium avium subsp. avium (M. avium) was confirmed by species-specific PCR and Southern blot. Furthermore, RT-PCR indicated that eight of the nine fragments originate from areas...

Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

DEFF Research Database (Denmark)

Priemé, Anders; Wolsing, Martin

2004-01-01

Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

Global analysis of aberrant pre-mRNA splicing in glioblastoma using exon expression arrays

Directory of Open Access Journals (Sweden)

Nixon Tamara J

2008-05-01

Full Text Available Abstract Background Tumor-predominant splice isoforms were identified during comparative in silico sequence analysis of EST clones, suggesting that global aberrant alternative pre-mRNA splicing may be an epigenetic phenomenon in cancer. We used an exon expression array to perform an objective, genome-wide survey of glioma-specific splicing in 24 GBM and 12 nontumor brain samples. Validation studies were performed using RT-PCR on glioma cell lines, patient tumor and nontumor brain samples. Results In total, we confirmed 14 genes with glioma-specific splicing; seven were novel events identified by the exon expression array (A2BP1, BCAS1, CACNA1G, CLTA, KCNC2, SNCB, and TPD52L2. Our data indicate that large changes (> 5-fold in alternative splicing are infrequent in gliomagenesis ( Conclusion While we observed some tumor-specific alternative splicing, the number of genes showing exclusive tumor-specific isoforms was on the order of tens, rather than the hundreds suggested previously by in silico mining. Given the important role of alternative splicing in neural differentiation, there may be selective pressure to maintain a majority of splicing events in order to retain glial-like characteristics of the tumor cells.

Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

NARCIS (Netherlands)

de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

2013-01-01

In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

NARCIS (Netherlands)

Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

2013-01-01

In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

SOD1 Gene +35A/C (exon3/intron3 Polymorphism in Type 2 Diabetes Mellitus among South Indian Population

Directory of Open Access Journals (Sweden)

K. Nithya

2016-01-01

Full Text Available Superoxide dismutase is an antioxidant enzyme that is involved in defence mechanisms against oxidative stress. Cu/Zn SOD is a variant that is located in exon3/intron3 boundary. The aim of the present study was to investigate whether the Cu/Zn SOD (+35A/C gene polymorphism is associated with the susceptibility to type 2 diabetes mellitus among south Indian population. The study included patients with type 2 diabetes mellitus (n=100 and healthy controls (n=75. DNA was isolated from the blood and genotyping of Cu/Zn SOD gene polymorphism was done by polymerase chain reaction based restriction fragment length polymorphism method. Occurrence of different genotypes and normal (A and mutant (C allele frequencies were determined. The frequency of the three genotypes of the total subjects was as follows: homozygous wild-type A/A (95%, heterozygous genotype A/C (3%, and homozygous mutant C/C (2%. The mutant (C allele and the mutant genotypes (AC/CC were found to be completely absent among the patients with type 2 diabetes mellitus. Absence of mutant genotype (CC shows that the Cu/Zn SOD gene polymorphism may not be associated with the susceptibility to type 2 diabetes mellitus among south Indian population.

Structure of the exon junction core complex with a trapped DEAD-box ATPase bound to RNA

DEFF Research Database (Denmark)

Andersen, Christian Brix Folsted; Ballut, Lionel; Johansen, Jesper Sanderhoff

2006-01-01

exon junction core complex containing the DEAD-box adenosine triphosphatase (ATPase) eukaryotic initiation factor 4AIII (eIF4AIII) bound to an ATP analog, MAGOH, Y14, a fragment of MLN51, and a polyuracil mRNA mimic. eIF4AIII interacts with the phosphate-ribose backbone of six consecutive nucleotides...... and prevents part of the bound RNA from being double stranded. The MAGOH and Y14 subunits lock eIF4AIII in a prehydrolysis state, and activation of the ATPase probably requires only modest conformational changes in eIF4AIII motif I....

MHC class II B diversity in blue tits: a preliminary study.

Science.gov (United States)

Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

2013-07-01

In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4-7 fragments, indicating a minimum number of 2-4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date.

Genotyping of β-Lactoglobulin gene by PCR-RFLP in Sahiwal and Tharparkar cattle breeds

Directory of Open Access Journals (Sweden)

Gupta Neelam

2006-05-01

Full Text Available Abstract Background Improvement of efficiency and economic returns is an important goal in dairy farming, as in any agricultural enterprise. The primary goal of dairy industry has been to identify an efficient and economical way of increasing milk production and its constituents without increasing the size of the dairy herd. Selection of animals with desirable genotypes and mating them to produce the next generation has been the basis of livestock improvement and this would continue to remain the same in the coming years. The use of polymorphic genes as detectable molecular markers is a promising alternative to the current methods of trait selection once these genes are proven to be associated with traits of interest in animals. The point mutations in exon IV of bovine β-Lactoglobulin gene determine two allelic variants A and B. These variants were distinguished by Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP analysis in two indigenous Bos indicus breeds viz. Sahiwal and Tharparkar cattle. DNA samples (228 in Sahiwal and 86 in Tharparkar were analyzed for allelic variants of β-Lactoglobulin gene. Polymorphism was detected by digestion of PCR amplified products with Hae III enzyme, and separation on 12% non-denaturing gels and resolved by silver staining. Results The allele B of β-Lactoglobulin occurred at a higher frequency than the allele A in both Sahiwal and Tharparkar breeds. The genotypic frequencies of AA, AB, and BB in Sahiwal and Tharparkar breeds were 0.031, 0.276, 0.693 and 0.023, 0.733, 0.244 respectively. Frequencies of A and B alleles were 0.17 and 0.83, and 0.39 and 0.61 in Sahiwal and Tharparkar breeds respectively. The Chi-square test results (at one degree of freedom at one per cent level revealed that the Tharparkar population was not in Hardy-Weinberg equilibrium as there was a continuous migration of animals in the herd studied, where as, the results are not significant for the Sahiwal

Evaluation of two real-time multiplex PCR screening assays detecting fetal RHD in plasma from RhD negative women to ascertain the requirement for antenatal RhD prophylaxis

DEFF Research Database (Denmark)

Clausen, Frederik Banch; Krog, Grethe Risum; Rieneck, Klaus

2011-01-01

and 5. We used the same fluorescent dye for the exon 7 and 10 probes to increase sensitivity; exon 5 was VIC labeled. We evaluated possible inhibition of DNA amplification with dilution experiments. We then tested the two multiplex assays with DNA extracted from 97 plasma samples from 38 RhD negative......OBJECTIVE: To evaluate two different multiplex real-time PCR assays detecting fetal RHD for screening of RhD negative women in relation to antenatal RhD prophylaxis. METHODS: We designed a duplex assay for the detection of RHD exon 7 and 10 and a triplex assay for the detection of RHD exon 7, 10...... assay (exon 7/10), accuracy was 94.2%. Detection of exon 5 was less reliable. CONCLUSION: The duplex assay using exon 7/10 was the most reliable for prenatal prediction of fetal RhD type as a candidate assay for screening of RhD negative women in relation to antenatal RhD prophylaxis. The triplex assay...

Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

DEFF Research Database (Denmark)

Munch, M.; Nielsen, L.P.; Handberg, Kurt

2001-01-01

A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

Directory of Open Access Journals (Sweden)

Sedlackova Tatiana

2013-02-01

Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

Transcription and splicing regulation in human umbilical vein endothelial cells under hypoxic stress conditions by exon array

Directory of Open Access Journals (Sweden)

Wu Yonghong

2009-03-01

Full Text Available Abstract Background The balance between endothelial cell survival and apoptosis during stress is an important cellular process for vessel integrity and vascular homeostasis, and it is also pivotal in angiogenesis during the development of many vascular diseases. However, the underlying molecular mechanisms remain largely unknown. Although both transcription and alternative splicing are important in regulating gene expression in endothelial cells under stress, the regulatory mechanisms underlying this state and their interactions have not yet been studied on a genome-wide basis. Results Human umbilical vein endothelial cells (HUVECs were treated with cobalt chloride (CoCl2 both to mimic hypoxia and to induce cell apoptosis and alternative splicing responses. Cell apoptosis rate analysis indicated that HUVECs exposed to 300 μM CoCl2 for 24 hrs were initially counterbalancing apoptosis with cell survival. We therefore used the Affymetrix exon array system to determine genome-wide transcript- and exon-level differential expression. Other than 1583 differentially expressed transcripts, 342 alternatively spliced exons were detected and classified by different splicing types. Sixteen alternatively spliced exons were validated by RT-PCR. Furthermore, direct evidence for the ongoing balance between HUVEC survival and apoptosis was provided by Gene Ontology (GO and protein function, as well as protein domain and pathway enrichment analyses of the differentially expressed transcripts. Importantly, a novel molecular module, in which the heat shock protein (HSP families play a significant role, was found to be activated under mimicked hypoxia conditions. In addition, 46% of the transcripts containing stress-modulated exons were differentially expressed, indicating the possibility of combinatorial regulation of transcription and splicing. Conclusion The exon array system effectively profiles gene expression and splicing on the genome-wide scale. Based on

PCR-SSCP analysis and its application to human genome study

International Nuclear Information System (INIS)

Hayashi, Kenshi

1994-01-01

A large amount of DNA sequence data are now available owing to the development of the human genome project. These data are deposited in public databases, e.g. DDBJ, GebBank and EMBL, and freely accessible to scientific community. One of the major advantages of having these databases is that we can now detect sequence differences between individuals in a large scale. Using the sequence informations, we can design primer sequences, amplify various target regions of the sample DNA's by PCR and detect abnormal sequence changes from reference, or normal sequences. Detecting sequence changes, or mutations, are essential part of searching genes responsible for hereditary diseases and also DNA diagnosis of hereditary diseases or cancer. We can also measure mutation frequency of the human genome by knowing its variability. Our group has developed and been improving a method, PCR-SSCP analysis, as an extremely rapid and easy technique for detection of sequence differences between sample DNA's. Knowing the sensitivity (percentage detection of mutations) of this technique is important in evaluating usefulness of it for the purposes stated above. Considerable number of experiences on PCR-SSCP analysis of fragments shorter than 300 b.p. are accumulating. We summarize here the sensitivity of PCR-SSCP analysis for various sequence context of this size range examined in various electrophoretic conditions conducted in many laboratories. Data on mutation detection by this technique for longer fragments are limited. We also present oue effort for defining electrophoretic conditions of PCR-SSCP analysis when examining longer (350 to 600 b.p.) fragments. (author)

Lex-SVM: exploring the potential of exon expression profiling for disease classification.

Science.gov (United States)

Yuan, Xiongying; Zhao, Yi; Liu, Changning; Bu, Dongbo

2011-04-01

Exon expression profiling technologies, including exon arrays and RNA-Seq, measure the abundance of every exon in a gene. Compared with gene expression profiling technologies like 3' array, exon expression profiling technologies could detect alterations in both transcription and alternative splicing, therefore they are expected to be more sensitive in diagnosis. However, exon expression profiling also brings higher dimension, more redundancy, and significant correlation among features. Ignoring the correlation structure among exons of a gene, a popular classification method like L1-SVM selects exons individually from each gene and thus is vulnerable to noise. To overcome this limitation, we present in this paper a new variant of SVM named Lex-SVM to incorporate correlation structure among exons and known splicing patterns to promote classification performance. Specifically, we construct a new norm, ex-norm, including our prior knowledge on exon correlation structure to regularize the coefficients of a linear SVM. Lex-SVM can be solved efficiently using standard linear programming techniques. The advantage of Lex-SVM is that it can select features group-wisely, force features in a subgroup to take equal weihts and exclude the features that contradict the majority in the subgroup. Experimental results suggest that on exon expression profile, Lex-SVM is more accurate than existing methods. Lex-SVM also generates a more compact model and selects genes more consistently in cross-validation. Unlike L1-SVM selecting only one exon in a gene, Lex-SVM assigns equal weights to as many exons in a gene as possible, lending itself easier for further interpretation.

Identification of Pit-1 Gen Using PCR-RFLP of Padjadjaran Sheep and Evaluate of Growth Rate

Science.gov (United States)

Prajoga, S. B. K.; Andriani, L.; Subhandiana, H.

2018-02-01

The objectives of this research were to evaluate variation of Pit-1 gen of Padjadjaran Sheep and evaluate of their growth rate. The data comprised of 15 lambs female and 15 lambs male records of 0 - 12 mouths old lambs. Variation of Padjadjaran Sheep PIT-1 gen was analyzed using PCR-RFLP and used primer by 5’-GAGGGATAATTACAAATGGTCC-3’ and 5’-TGTTAACAGCTGTGGGACACAC-3’, length fragment analyse using HinfI restriction enzyme. Presence or absence of deference bands in a PCR fragment of the result can be distinguished by differences in the electrophoretic migration of the fragment. The result showed that the variation Pit1 gene showed that there was in the position 345 bp, 137 bp and 115 bp. In this experiment the difference migration did occur in all samples (monomorphic), that was amplificated with reverse and forward primer. The average male birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.29 ±0.42kg 8.96 ±1,89 kg and 30.12 ±5,65 kg. The average female birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.33 ±0.49 kg; 8.23 ±1.99 kg and 26.11 ±5.50 kg. Correlation value between age and body weight was 0,99 for female and 0,97 for male. The highest body weight gain per month was 2.85 kg for female at the age of six months and 3.4 kg for male at the age of one year. The best equition of growth rate was Ŷ = 1,862 + 0,127X1 0,076X2

Cloning and expression of cell wall acid invertase gene fragment ...

African Journals Online (AJOL)

A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

Restricted fragmentation of poliovirus type 1, 2, and 3 RNAs by ribonuclease III

Energy Technology Data Exchange (ETDEWEB)

Nomoto, A. (State Univ. of New York, Stony Brook); Lee, Y.F.; Babich, A.; Jacobson, A.; Dunn, J.J.; Wimmer, E.

1979-01-01

Cleavage of the genome RNAs of poliovirus type 1, 2, and 3 with the ribonuclease III of Escherichia coli has been investigated with the following results: (1) at or above physiological salt concentration, the RNAs are completely resistant to the action of the enzyme, an observation suggesting that the RNAs lack primary cleavage sites; (2) lowering the salt concentration to 0.1 M or below allows RNase III to cleave the RNAs at secondary sites. Both large and small fragments can be obtained in a reproducible manner depending on salt conditions chosen for cleavage. Fingerprints of three large fragments of poliovirus type 2 RNA show that they originate from unique segments and represent most if not all sequences of the genome. Based upon binding to poly(U) filters of poly(A)-linked fragments, a physical map of the large fragments of poliovirus type 2 RNA was constructed. The data suggest that RNase III cleavage of single-stranded RNA provides a useful method to fragment the RNA for further studies.

PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

Science.gov (United States)

Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

2009-03-01

The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

International Nuclear Information System (INIS)

Robinson, M.A.

1989-01-01

Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

Energy Technology Data Exchange (ETDEWEB)

Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

1997-03-01

An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

Polymorphism in exons of the myostatin gene and its relationship with body weight traits in the Bian chicken.

Science.gov (United States)

Zhang, Genxi; Ding, Fuxiang; Wang, Jinyu; Dai, Guojun; Xie, Kaizhou; Zhang, Lijun; Wang, Wei; Zhou, Shenghua

2011-02-01

In our research, single nucleotide polymorphisms (SNPs) of exon regions of the myostatin gene were detected by PCR-SSCP in the Bian chicken and three reference chicken populations (Jinghai, Youxi, and Arbor Acre). Four novel SNPs (G2283A, C7552T, C7638T, and T7661A) were detected. The findings from the least square means showed that Bian chickens with EE and DE genotypes had significantly higher body weight, at 6-18 weeks of age, than those of the DD genotype (P chicken.

Exon silencing by UAGG motifs in response to neuronal excitation.

Directory of Open Access Journals (Sweden)

Ping An

2007-02-01

Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Richard Atherton

2013-06-01

Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

Karakterisasi Molekuler Ikan Gurami Soang (Osphronemus goramy Lac. berbeda uuran menggunakan Pcr-Rflp Gen Sitokrom C Oksidase 1

Directory of Open Access Journals (Sweden)

Siti Nur Azizah

2017-01-01

Full Text Available Gourami (Osprhronemus goramy Lac. is a  freshwater fish that is  widely cultivated in Indonesia, particularly by fish farmer in Java. Soang strain has a faster growth rate than other strains. However, the fry that derived from a single cohort (generated from a single spawning shows various sizes even in the same age because they have different growth rate. Differences in growth rate may occur due to differences in metabolic capabilities especially cellular respiration. Different rate of respiration can be assumed to be due to differences in the genetic component, especially on their cytochrome c oxidase 1 gene (CO1. Therefore this study aimed to determine whether there are differences in PCR-RFLP marker CO1 gene among different sizes of gourami soang strain from the same cohort so that can be used to analyze genetic diversity. This study used survey method by applying purposive random sampling. Four restriction enzymes were used  during the  research. Molecular characters were defined descriptively based on the appearance of restriction fragment on agarose gel. The result showed that soang strain which used in this study had monomorphics allele on their CO1-HindIII. PstI, BamHI, and EcoRI, could not cut the PCR products and results no RFLP markers. So that genetic variation in the used CO1 gene fragment could not be detected using HindIII, Pst1, BamH1 and EcoR1 enzymes. The three different sizes of soang strain had similar alleles or homozygous, meaning that heterozigocity value was 0 (zero. Therefore, the CO1 gene in this study could not be used as molecular character to differentiate different sizes of gourami soang strain from the same cohort.

Partial association of restriction polymorphism of the ligand binding domain of human androgen receptor in prostate cancer

Directory of Open Access Journals (Sweden)

Mohamed Hessien

2016-04-01

Conclusion: Our results indicate that the loss of the restriction integrity in the C-terminal part (exons: 7 and 8 of the LBD is associated with the progression of benign prostatic hyperplasia to prostate cancer.

Alternative splicing and differential gene expression in colon cancer detected by a whole genome exon array

Directory of Open Access Journals (Sweden)

Sugnet Charles

2006-12-01

Full Text Available Abstract Background Alternative splicing is a mechanism for increasing protein diversity by excluding or including exons during post-transcriptional processing. Alternatively spliced proteins are particularly relevant in oncology since they may contribute to the etiology of cancer, provide selective drug targets, or serve as a marker set for cancer diagnosis. While conventional identification of splice variants generally targets individual genes, we present here a new exon-centric array (GeneChip Human Exon 1.0 ST that allows genome-wide identification of differential splice variation, and concurrently provides a flexible and inclusive analysis of gene expression. Results We analyzed 20 paired tumor-normal colon cancer samples using a microarray designed to detect over one million putative exons that can be virtually assembled into potential gene-level transcripts according to various levels of prior supporting evidence. Analysis of high confidence (empirically supported transcripts identified 160 differentially expressed genes, with 42 genes occupying a network impacting cell proliferation and another twenty nine genes with unknown functions. A more speculative analysis, including transcripts based solely on computational prediction, produced another 160 differentially expressed genes, three-fourths of which have no previous annotation. We also present a comparison of gene signal estimations from the Exon 1.0 ST and the U133 Plus 2.0 arrays. Novel splicing events were predicted by experimental algorithms that compare the relative contribution of each exon to the cognate transcript intensity in each tissue. The resulting candidate splice variants were validated with RT-PCR. We found nine genes that were differentially spliced between colon tumors and normal colon tissues, several of which have not been previously implicated in cancer. Top scoring candidates from our analysis were also found to substantially overlap with EST-based bioinformatic

[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

Science.gov (United States)

Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

2015-04-01

To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

DETECÇÃO DO COMPLEXO Mycobacterium tuberculosis NO LEITE PELA REAÇÃO EM CADEIA DA POLIMERASE SEGUIDA DE ANÁLISE DE RESTRIÇÃO DO FRAGMENTO AMPLIFICADO (PRA DETECTION OF Mycobacterium tuberculosis COMPLEX BY PCR-RESTRICTION FRAGMENT LENGTH POLYMORFISM ANALYSIS OF THE HSP65 GENE

Directory of Open Access Journals (Sweden)

Joab Trajano Silva

2008-12-01

, up to species level, is time consuming and difficult. In this work, the objective was to standardize a polymerase chain reaction followed by an enzyme restriction analysis in order to identify the M. tuberculosis complex in milk, without a microbiological isolation step. Reference strains and raw milk seeded with M. Bovis, were used as the starting material.  A 441pb fragment of the hsp65 gene was amplified and digested by two restriction enzymes BstEII and HaeIII. The obtained profile was used to identify the M. tuberculosis complex in milk. The minimum limit of detection of M. bovis in milk was 10CFU/mL. PRA methodology proved to be a specific and sensible method. It can be used to assist the microbiological and biochemical methods commonly used to identifying the bacilli in clinical samples, as milk 

Key word: Detection limit (PRA, Mycobacterium tuberculosis complex, milk Mycobacterium bovis, Restriction Enzyme Analysis (PCR,

Differentiation of Leishmania (Viannia) panamensis and Leishmania (V.) guyanensis using BccI for hsp70 PCR-RFLP.

Science.gov (United States)

Montalvo Alvarez, Ana Margarita; Nodarse, Jorge Fraga; Goodridge, Ivón Montano; Fidalgo, Lianet Monzote; Marin, Marcel; Van Der Auwera, Gert; Dujardin, Jean-Claude; Bernal, Iván Darío Velez; Muskus, Carlos

2010-05-01

Leishmania panamensis and Leishmania guyanensis are two species of the subgenus Viannia that are genetically very similar. Both parasites are usually associated with cutaneous leishmaniasis, but also have the potential to cause the mucocutaneous form of the disease. In addition, the study of foci and consequently the identification of vectors and probable reservoirs involved in transmission require a correct differentiation between both species, which is important at epidemiological level. We explored the possibility of identifying these species by using restriction fragment length polymorphisms (RFLP) in the gene coding for heat-shock protein 70 (hsp70). Previously, an hsp70 PCR-RFLP assay proved to be very effective in differentiating other Leishmania species when HaeIII is used as restriction enzyme. Based on hsp70 sequences analysis, BccI was found to generate species-specific fragments that can easily be recognized by agarose gel electrophoresis. Using the analysis of biopsies, scrapings, and parasite isolates previously grouped in a cluster comprising both L. panamensis and L. guyanensis, we showed that our approach allowed differentiation of both entities. This offers the possibility not only for identification of parasites in biological samples, but also to apply molecular epidemiology in certain countries of the New World, where several Leishmania species could coexist. Copyright 2009 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

Differential GC Content between Exons and Introns Establishes Distinct Strategies of Splice-Site Recognition

Directory of Open Access Journals (Sweden)

Maayan Amit

2012-05-01

Full Text Available During evolution segments of homeothermic genomes underwent a GC content increase. Our analyses reveal that two exon-intron architectures have evolved from an ancestral state of low GC content exons flanked by short introns with a lower GC content. One group underwent a GC content elevation that abolished the differential exon-intron GC content, with introns remaining short. The other group retained the overall low GC content as well as the differential exon-intron GC content, and is associated with longer introns. We show that differential exon-intron GC content regulates exon inclusion level in this group, in which disease-associated mutations often lead to exon skipping. This group's exons also display higher nucleosome occupancy compared to flanking introns and exons of the other group, thus “marking” them for spliceosomal recognition. Collectively, our results reveal that differential exon-intron GC content is a previously unidentified determinant of exon selection and argue that the two GC content architectures reflect the two mechanisms by which splicing signals are recognized: exon definition and intron definition.

Software for optimization of SNP and PCR-RFLP genotyping to discriminate many genomes with the fewest assays

Directory of Open Access Journals (Sweden)

Wagner Mark C

2005-05-01

Full Text Available Abstract Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As

Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis.

Science.gov (United States)

D'Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; Lee, Ji-Yun; He, Hong; Li, Shibo; Smaoui, Nizar; Hejtmancik, James F; Sieving, Paul A; Wang, Xinjing

2013-01-01

X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4-5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5' region of the RS1 gene (including the promoter) through intron 1 (c.(-35)-1723_c.51+2664del4472). The exon 4-5 deletion spans introns 3 to intron 5 (c.185-1020_c.522+1844del5764). Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes.

Molecular Determination of Fasciola Spp. Isolates from Domestic Ruminants Fecal Samples in the Northwest of Iran

Science.gov (United States)

IMANI BARAN, Abbas; CHERAGHI SARAY, Habib; KATIRAEE, Farzad

2017-01-01

Background: Fasciola species are the main causes for fascioliasis with great financial losses and are among the most important food/water-borne parasites worldwide. The basic proceedings such as epidemiology and effective control of fascioliasis rely mainly on precise identification of Fasciola species. The present study was conducted to determine the Fasciola species in ruminant fecal samples from East Azerbaijan Province in Iran. Methods: Overall, 2012 fecal samples were collected and processed initially for microscopic examination of Fasciola eggs in 2014–15. Then, recovered eggs were subjected to molecular identification. A fragment of 618 bp of the 28S rRNA gene pertaining to Fasciola genus was amplified under PCR. The amplified fragment was restricted by fast digest Ava II enzyme in order to a Restriction Fragment Length Polymorphism. Results: Based on microscopic examination, 72 samples were infected, from which, 10 and 62 cases pertained to cattle and sheep samples respectively. Based on RFLP, the PCR products restricted by the Ava II restriction enzyme produced 529 bp fragments only. According to the positive controls, all restriction patterns were related to Fasciola hepatica, while no restriction patterns were linked to F. gigantica. Conclusion: Based on PCR-RFLP, F. hepatica was dominant species in animals of the studied areas and no evidence of F. gigantica was observed. Therefore, further field studies to verify these results are suggested. PMID:28761485

The role of exon shuffling in shaping protein-protein interaction networks

Directory of Open Access Journals (Sweden)

França Gustavo S

2010-12-01

Full Text Available Abstract Background Physical protein-protein interaction (PPI is a critical phenomenon for the function of most proteins in living organisms and a significant fraction of PPIs are the result of domain-domain interactions. Exon shuffling, intron-mediated recombination of exons from existing genes, is known to have been a major mechanism of domain shuffling in metazoans. Thus, we hypothesized that exon shuffling could have a significant influence in shaping the topology of PPI networks. Results We tested our hypothesis by compiling exon shuffling and PPI data from six eukaryotic species: Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Cryptococcus neoformans and Arabidopsis thaliana. For all four metazoan species, genes enriched in exon shuffling events presented on average higher vertex degree (number of interacting partners in PPI networks. Furthermore, we verified that a set of protein domains that are simultaneously promiscuous (known to interact to multiple types of other domains, self-interacting (able to interact with another copy of themselves and abundant in the genomes presents a stronger signal for exon shuffling. Conclusions Exon shuffling appears to have been a recurrent mechanism for the emergence of new PPIs along metazoan evolution. In metazoan genomes, exon shuffling also promoted the expansion of some protein domains. We speculate that their promiscuous and self-interacting properties may have been decisive for that expansion.

Molecular basis of aromatase deficiency in an adult female with sexual infantilism and polycystic ovaries

Energy Technology Data Exchange (ETDEWEB)

Ito, Y.; Fisher, C.R.; Simpson, E.R. (Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)); Conte, F.A.; Grumbach, M.M. (Univ. of California, San Francisco, CA (United States))

1993-11-15

The authors identified two mutations in the CYP19 gene responsible for aromatase deficiency in an 18-year-old 46,XX female with ambiguous external genitalia at birth, primary amenorrhea and sexual infantilism, and polycystic ovaries. The coding exons, namely exons II-X, of the CYP19 gene were amplified by PCR from genomic DNA and sequenced directly. Direct sequencing of the amplified DNA from the patient revealed two single-base changes, at bp 1303 (C[yields]T) and bp 1310 (G[yields]A) in exon X, which were newly found missense mutations and resulted in codon changes of R435C and C437Y, respectively. Subcloning followed by sequencing confirmed that the patient is a compound heterozygote. The results of restriction fragment length polymorphism analysis and direct sequencing of the amplified exon X DNA from the patient's mother indicate maternal inheritance of the R435C mutation. Transient expression experiments showed that the R435C mutant protein had [approx]1.1% of the activity of the wild type, whereas C437Y was totally inactive. Cysteine-437 is the conserved cysteine in the heme-binding region believed to serve as the fifth coordinating ligand of the heme iron. To the authors' knowledge, this patient is the first adult to have described the cardinal features of a syndrome of aromatase deficiency. Recognition that such defects exist will lead to a better understanding of the role of this enzyme in human development and disease.

Novel P2 promoter-derived HNF4α isoforms with different N-terminus generated by alternate exon insertion

International Nuclear Information System (INIS)

Huang, Jianmin; Levitsky, Lynne L.; Rhoads, David B.

2009-01-01

Hepatocyte nuclear factor 4α (HNF4α) is a critical transcription factor for pancreas and liver development and functions in islet β cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4α variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4α variants designated HNF4α10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4α10-α12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding α7-α9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4α10-α12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4α than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4α mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

Novel P2 promoter-derived HNF4{alpha} isoforms with different N-terminus generated by alternate exon insertion

Energy Technology Data Exchange (ETDEWEB)

Huang, Jianmin, E-mail: jmhuang@partners.org [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Levitsky, Lynne L. [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Rhoads, David B., E-mail: rhoads@helix.mgh.harvard.edu [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States)

2009-04-15

Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

CELF family RNA-binding protein UNC-75 regulates two sets of mutually exclusive exons of the unc-32 gene in neuron-specific manners in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Hidehito Kuroyanagi

Full Text Available An enormous number of alternative pre-mRNA splicing patterns in multicellular organisms are coordinately defined by a limited number of regulatory proteins and cis elements. Mutually exclusive alternative splicing should be strictly regulated and is a challenging model for elucidating regulation mechanisms. Here we provide models of the regulation of two sets of mutually exclusive exons, 4a-4c and 7a-7b, of the Caenorhabditis elegans uncoordinated (unc-32 gene, encoding the a subunit of V0 complex of vacuolar-type H(+-ATPases. We visualize selection patterns of exon 4 and exon 7 in vivo by utilizing a trio and a pair of symmetric fluorescence splicing reporter minigenes, respectively, to demonstrate that they are regulated in tissue-specific manners. Genetic analyses reveal that RBFOX family RNA-binding proteins ASD-1 and FOX-1 and a UGCAUG stretch in intron 7b are involved in the neuron-specific selection of exon 7a. Through further forward genetic screening, we identify UNC-75, a neuron-specific CELF family RNA-binding protein of unknown function, as an essential regulator for the exon 7a selection. Electrophoretic mobility shift assays specify a short fragment in intron 7a as the recognition site for UNC-75 and demonstrate that UNC-75 specifically binds via its three RNA recognition motifs to the element including a UUGUUGUGUUGU stretch. The UUGUUGUGUUGU stretch in the reporter minigenes is actually required for the selection of exon 7a in the nervous system. We compare the amounts of partially spliced RNAs in the wild-type and unc-75 mutant backgrounds and raise a model for the mutually exclusive selection of unc-32 exon 7 by the RBFOX family and UNC-75. The neuron-specific selection of unc-32 exon 4b is also regulated by UNC-75 and the unc-75 mutation suppresses the Unc phenotype of the exon-4b-specific allele of unc-32 mutants. Taken together, UNC-75 is the neuron-specific splicing factor and regulates both sets of the mutually exclusive

CYP3A4*18: it is not rare allele in Japanese population.

Science.gov (United States)

Yamamoto, Takehito; Nagafuchi, Nobue; Ozeki, Takeshi; Kubota, Takahiro; Ishikawa, Hiroshi; Ogawa, Seishi; Yamada, Yasuhiko; Hirai, Hisamaru; Iga, Tatsuji

2003-01-01

We sequenced all 13 exons of the CYP3A4 gene derived from 48 Japanese subjects. One subject possess the 20070 T>C mutation in the exon 10 (result in leu293Pro substitution, namely CYP3A4(*)18), as heterozygote. Thus, we investigated the frequency of CYP3A4(*)18 in 118 Japanese population using polymerase chain reaction-restriction fragment length polymorphism with Msp I and determined that the frequency of the CYP3A4(*)18 allele was 1.3%.

PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

International Nuclear Information System (INIS)

Enan, M. R.; Bashandy, S.A.

2006-01-01

Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

SC*994C>T causes the Sc(null) phenotype in Pacific Islanders and successful transfusion of Sc3+ blood to a patient with anti-Sc3.

Science.gov (United States)

Reid, Marion E; Hue-Roye, Kim; Velliquette, Randall W; Larimore, Kathleen; Moscarelli, Sue; Ohswaldt, Nicolas; Lomas-Francis, Christine

2013-01-01

Antigens in the SC blood group system are expressed by the human erythrocyte membrane-associated protein (ERMAP).Two molecular bases have been reported for the Sc,un phenotype:SC*307del2 and SC*994C>T. We report our investigation of the molecular background of five Sc,n1 individuals from the Pacific Islands and describe the successful transfusion of Sc3+ blood to a patient with anti-Sc3 in her plasma. SC (ERMAP) exons 2,3, and 12 and their flanking intronic regions were analyzed. TheSC*994C>T change introduces a restriction enzyme cleavage site for Tsp45I, and polymerase chain reaction (PCR) products from exon 12 were subjected to this PCR-restriction fragment length polymorphism (RFLP) assay. The five samples had the variant SC*994T/T. One sample, from a first cousin of one Marshallese proband, was heterozygous for SC*1514C/T (in the 3' untranslated region); the other four samples were SC*1514C/C(consensus sequence). Samples from white donors (n = 100) and African American donors (n = 99) were tested using the Tsp45IPCR-RFLP assay; all gave a banding pattern that was consistent with the SC*994C/C consensus sequence. In all five samples,our analyses showed homozygosity for the nonsense nucleotide change SC*994C>Tin an allele carrying the nucleotide associated with SLd. Further investigation determined that one of the probands reported previously with the SC*994C>T change was from the Marshall Islands (which form part of the Micronesian Pacific Islands) and the other was from an unspecified location within the large collection of Pacific Islands. Taken together, the five known probands with the SC*994C>T silencing nucleotide change were from the Pacific Islands.

The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

Directory of Open Access Journals (Sweden)

Tatsuya Ishikawa

2017-06-01

Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

Characterization of a splicing mutation in group A xeroderma pigmentosum

International Nuclear Information System (INIS)

Satokata, Ichiro; Tanaka, Kiyoji; Miura, Naoyuki; Miyamoto, Iwai; Okada, Yoshio; Satoh, Yoshiaki; Kondo, Seiji

1990-01-01

The molecular basis of group A xeroderma pigmentosum (WP) was investigated by comparison of the nucleotide sequences of multiple clones of the XP group A complementing gene (XPAC) from a patient with group A XP with that of a normal gene. The clones showed a G → C substitution at the 3' splice acceptor site of intron 3, which altered the obligatory AG acceptor dinucleotide to AC. Nucleotide sequencing of cDNAs amplified by the polymerase chain reaction revealed that this single base substitution abolishes the canonical 3' splice site, thus creating two abnormally spliced mRNA forms. The larger form is identical with normal mRNA except for a dinucleotide deletion at the 5' end of exon 4. This deletion results in a frameshift with premature translation termination in exon 4. The smaller form has a deletion of the entire exon 3 and the dinucleotide at the 5' end of exon 4. The result of a transfection study provided additional evidence that this single base substitution is the disease-causing mutation. This single base substitution creates a new cleavage site for the restriction nuclease AlwNI. Analysis of AlwNI restriction fragment length polymorphism showed a high frequency of this mutation in Japanese patients with group A XP: 16 of 21 unrelated Japanese patients were homozygous and 4 were heterozygous for this mutation. However, 11 Caucasians and 2 Blacks with group A XP did not have this mutant allele. The polymorphic AlwNI restriction fragments are concluded to be useful for diagnosis of group A XP in Japanese subjects, including prenatal cases and carriers

Subtractive hybridization and random arbitrarily primed PCR analyses of a benzoate-assimilating bacterium, Desulfotignum balticum.

Science.gov (United States)

Habe, Hiroshi; Kobuna, Akinori; Hosoda, Akifumi; Kouzuma, Atsushi; Yamane, Hisakazu; Nojiri, Hideaki; Omori, Toshio; Watanabe, Kazuya

2008-05-01

Subtractive hybridization (SH) and random arbitrarily primed PCR (RAP-PCR) were used to detect genes involved in anaerobic benzoate degradation by Desulfotignum balticum. Through SH, we obtained 121 DNA sequences specific for D. balticum but not for D. phosphitoxidans (a non-benzoate-assimilating species). Furthermore, RAP-PCR analysis showed that a 651-bp DNA fragment, having 55% homology with the solute-binding protein of the ABC transporter system in Methanosarcina barkeri, was expressed when D. balticum was grown on benzoate, but not on pyruvate. By shotgun sequencing of the fosmid clone (38,071 bp) containing the DNA fragment, 33 open reading frames (ORFs) and two incomplete ORFs were annotated, and several genes within this region corresponded to the DNA fragments obtained by SH. An 11.3-kb gene cluster (ORF10-17) revealed through reverse transcription-PCR showed homology with the ABC transporter system and TonB-dependent receptors, both of which are presumably involved in the uptake of siderophore/heme/vitamin B(12), and was expressed in response to growth on benzoate.

Low frequency variants in the exons only encoding isoform A of HNF1A do not contribute to susceptibility to type 2 diabetes.

Directory of Open Access Journals (Sweden)

Bahram Jafar-Mohammadi

2009-08-01

Full Text Available There is considerable interest in the hypothesis that low frequency, intermediate penetrance variants contribute to the proportion of Type 2 Diabetes (T2D susceptibility not attributable to the common variants uncovered through genome-wide association approaches. Genes previously implicated in monogenic and multifactorial forms of diabetes are obvious candidates in this respect. In this study, we focussed on exons 8-10 of the HNF1A gene since rare, penetrant mutations in these exons (which are only transcribed in selected HNF1A isoforms are associated with a later age of diagnosis of Maturity onset diabetes of the young (MODY than mutations in exons 1-7. The age of diagnosis in the subgroup of HNF1A-MODY individuals with exon 8-10 mutations overlaps with that of early multifactorial T2D, and we set out to test the hypothesis that these exons might also harbour low-frequency coding variants of intermediate penetrance that contribute to risk of multifactorial T2D.We performed targeted capillary resequencing of HNF1A exons 8-10 in 591 European T2D subjects enriched for genetic aetiology on the basis of an early age of diagnosis ( or =1 affected sibling. PCR products were sequenced and compared to the published HNF1A sequence. We identified several variants (rs735396 [IVS9-24T>C], rs1169304 [IVS8+29T>C], c.1768+44C>T [IVS9+44C>T] and rs61953349 [c.1545G>A, p.T515T] but no novel non-synonymous coding variants were detected.We conclude that low frequency, nonsynonymous coding variants in the terminal exons of HNF1A are unlikely to contribute to T2D-susceptibility in European samples. Nevertheless, the rationale for seeking low-frequency causal variants in genes known to contain rare, penetrant mutations remains strong and should motivate efforts to screen other genes in a similar fashion.

[Sequence analysis of LEAFY homologous gene from Dendrobium moniliforme and application for identification of medicinal Dendrobium].

Science.gov (United States)

Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu

2013-04-01

The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.

Clinical and molecular consequences of exon 78 deletion in DMD gene.

Science.gov (United States)

Traverso, Monica; Assereto, Stefania; Baratto, Serena; Iacomino, Michele; Pedemonte, Marina; Diana, Maria Cristina; Ferretti, Marta; Broda, Paolo; Minetti, Carlo; Gazzerro, Elisabetta; Madia, Francesca; Bruno, Claudio; Zara, Federico; Fiorillo, Chiara

2018-03-19

We present a 13-year-old patient with persistent increase of serum Creatine Kinase (CK) and myalgia after exertion. Skeletal muscle biopsy showed marked reduction of dystrophin expression leading to genetic analysis of DMD gene by MLPA, which detected a single deletion of exon 78. To the best of our knowledge, DMD exon 78 deletion has never been described in literature and, according to prediction, it should lead to loss of reading frame in the dystrophin gene. To further assess the actual effect of exon 78 deletion, we analysed cDNA from muscle mRNA. This analysis confirmed the absence of 32 bp of exon 78. Exclusion of exon 78 changes the open reading frame of exon 79 and generate a downstream stop codon, producing a dystrophin protein of 3703 amino acids instead of 3685 amino acids. Albeit loss of reading frame usually leads to protein degradation and severe phenotype, in this case, we demonstrated that deletion of DMD exon 78 can be associated with a functional protein able to bind DGC complex and a very mild phenotype. This study adds a novel deletion in DMD gene in human and helps to define the compliance between maintaining/disrupting the reading frame and clinical form of the disease.

Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

Science.gov (United States)

Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

2004-01-01

Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

A comparison of EGFR mutation testing methods in lung carcinoma: direct sequencing, real-time PCR and immunohistochemistry.

Directory of Open Access Journals (Sweden)

Bárbara Angulo

Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.

Malonyl CoA decarboxylase deficiency: C to T transition in intron 2 of the MCD gene.

Science.gov (United States)

Surendran, S; Sacksteder, K A; Gould, S J; Coldwell, J G; Rady, P L; Tyring, S K; Matalon, R

2001-09-15

Malonyl CoA decarboxylase (MCD) is an enzyme involved in the metabolism of fatty acids synthesis. Based on reports of MCD deficiency, this enzyme is particular important in muscle and brain metabolism. Mutations in the MCD gene result in a deficiency of MCD activity, that lead to psychomotor retardation, cardiomyopathy and neonatal death. To date however, only a few patients have been reported with defects in MCD. We report here studies of a patient with MCD deficiency, who presented with hypotonia, cardiomyopathy and psychomotor retardation. DNA sequencing of MCD revealed a homozygous intronic mutation, specifically a -5 C to T transition near the acceptor site for exon 3. RT-PCR amplification of exons 2 and 3 revealed that although mRNA from a normal control sample yielded one major DNA band, the mutant mRNA sample resulted in two distinct DNA fragments. Sequencing of the patient's two RT-PCR products revealed that the larger molecular weight fragments contained exons 2 and 3 as well as the intervening intronic sequence. The smaller size band from the patient contained the properly spliced exons, similar to the normal control. Western blotting analysis of the expressed protein showed only a faint band in the patient sample in contrast to a robust band in the control. In addition, the enzyme activity of the mutant protein was lower than that of the control protein. The data indicate that homozygous mutation in intron 2 disrupt normal splicing of the gene, leading to lower expression of the MCD protein and MCD deficiency. Copyright 2001 Wiley-Liss, Inc.

Genotyping of Pasteurella multocida ovine and bovine isolates from Iran based on PCR-RFLP of ompH gene

Directory of Open Access Journals (Sweden)

A. Ghanizadeh

2015-10-01

Full Text Available Pasteurella multocida (P. multocida, A Gram-negative facultative anaerobic bacterium, is a causative animal pathogen in porcine atrophic rhinitis and avian fowl cholera. The outer membrane of Gram-negative bacteria contains of many different protein in very high copy numbers. One of the major outer membrane, the H proteins have functional as high immunogenicity and antigenicity. In this study to increase information about epidemiology of ovine and bovine P. multocida, the 24 isolates from sheep and nine isolates from cattle were investigated by PCR-RFLP analysis of the ompH gene. In all 33 isolates, digestion of the amplified fragment of ompH gene by using EcoRI, cfoI and HindIII produced 3, 5 and 3 different restriction patterns respectively. Sixteen RFLP patterns were found among 33 investigated P.multocida isolates. This study showed that, the PCR RFLP based on ompH gene is potentially a useful method for typing of P. multocida isolates from sheep and cattle. The RFLP patterns of this gene exhibited extensive restriction site heterogeneity, which may be particularly suitable for fingerprinting of P. multocida isolates.Considering ompH protein as a protective immunogenic moiety of P.ultocida, the results of this study showed a heterogenic bacteria and this means the possibility to produce a multivalent vaccine to be protective against diseases caused by this organism in sheep and cattle in Iran.

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

Functional understanding of the diverse exon-intron structures of human GPCR genes.

Science.gov (United States)

Hammond, Dorothy A; Olman, Victor; Xu, Ying

2014-02-01

The GPCR genes have a variety of exon-intron structures even though their proteins are all structurally homologous. We have examined all human GPCR genes with at least two functional protein isoforms, totaling 199, aiming to gain an understanding of what may have contributed to the large diversity of the exon-intron structures of the GPCR genes. The 199 genes have a total of 808 known protein splicing isoforms with experimentally verified functions. Our analysis reveals that 1301 (80.6%) adjacent exon-exon pairs out of the total of 1,613 in the 199 genes have either exactly one exon skipped or the intron in-between retained in at least one of the 808 protein splicing isoforms. This observation has a statistical significance p-value of 2.051762 * e(-09), assuming that the observed splicing isoforms are independent of the exon-intron structures. Our interpretation of this observation is that the exon boundaries of the GPCR genes are not randomly determined; instead they may be selected to facilitate specific alternative splicing for functional purposes.

First Exon Length Controls Active Chromatin Signatures and Transcription

Directory of Open Access Journals (Sweden)

Nicole I. Bieberstein

2012-07-01

Full Text Available Here, we explore the role of splicing in transcription, employing both genome-wide analysis of human ChIP-seq data and experimental manipulation of exon-intron organization in transgenic cell lines. We show that the activating histone modifications H3K4me3 and H3K9ac map specifically to first exon-intron boundaries. This is surprising, because these marks help recruit general transcription factors (GTFs to promoters. In genes with long first exons, promoter-proximal levels of H3K4me3 and H3K9ac are greatly reduced; consequently, GTFs and RNA polymerase II are low at transcription start sites (TSSs and exhibit a second, promoter-distal peak from which transcription also initiates. In contrast, short first exons lead to increased H3K4me3 and H3K9ac at promoters, higher expression levels, accuracy in TSS usage, and a lower frequency of antisense transcription. Therefore, first exon length is predictive for gene activity. Finally, splicing inhibition and intron deletion reduce H3K4me3 levels and transcriptional output. Thus, gene architecture and splicing determines transcription quantity and quality as well as chromatin signatures.

Identification of five novel mutations in the long isoform of the USH2A gene in Chinese families with Usher syndrome type II.

Science.gov (United States)

Dai, Hanjun; Zhang, Xiaohui; Zhao, Xin; Deng, Ting; Dong, Bing; Wang, Jingzhao; Li, Yang

2008-01-01

Usher syndrome type II (USH2) is the most common form of Usher syndrome, an autosomal recessive disorder characterized by moderate to severe hearing loss, postpuberal onset of retinitis pigmentosa (RP), and normal vestibular function. Mutations in the USH2A gene have been shown to be responsible for most cases of USH2. To further elucidate the role of USH2A in USH2, mutation screening was undertaken in three Chinese families with USH2. Three unrelated Chinese families, consisting of six patients and 10 unaffected relatives, were examined clinically, and 100 normal Chinese individuals served as controls. Genomic DNA was extracted from the venous blood of all participants. The coding region (exons 2-72), including the intron-exon boundary of USH2A, was amplified by polymerase chain reaction (PCR). The PCR products amplified from the three probands were analyzed using direct sequencing to screen sequence variants. Whenever substitutions were identified in a patient, restriction fragment length polymorphism analysis, or single strand conformation polymorphism analysis was performed on all available family members and the control group. Fundus examination revealed typical fundus features of RP, including narrowing of the vessels, bone-speckle pigmentation, and waxy optic discs. The ERG wave amplitudes of three probands were undetectable. Audiometric tests indicated moderate to severe sensorineural hearing impairment. Vestibular function was normal. Five novel mutations (one small insertion, one small deletion, one nonsense, one missense, and one splice site) were detected in three families after sequence analysis of USH2A. Of the five mutations, four were located in exons 22-72, specific to the long isoform of USH2A. The mutations found in our study broaden the spectrum of USH2A mutations. Our results further indicate that the long isoform of USH2A may harbor even more mutations of the USH2A gene.

FB elements can promote exon shuffling: a promoter-less white allele can be reactivated by FB mediated transposition in Drosophila melanogaster.

Science.gov (United States)

Moschetti, R; Marsano, R M; Barsanti, P; Caggese, C; Caizzi, R

2004-05-01

Foldback ( FB) elements are transposable elements found in many eukaryotic genomes; they are thought to contribute significantly to genome plasticity. In Drosophila melanogaster, FBs have been shown to be involved in the transposition of large chromosomal regions and in the genetic instability of some alleles of the white gene. In this report we show that FB mediated transposition of w(67C23), a mutation that deletes the promoter of the white gene and its first exon, containing the start codon, can restore expression of the white gene. We have characterized three independent events in which a 14-kb fragment from the w(67C23) locus was transposed into an intron region in three different genes. In each case a local promoter drives the expression of white, producing a chimeric mRNA. These findings suggest that, on an evolutionary timescale, FB elements may contribute to the creation of new genes via exon shuffling.

Cloud-based adaptive exon prediction for DNA analysis.

Science.gov (United States)

Putluri, Srinivasareddy; Zia Ur Rahman, Md; Fathima, Shaik Yasmeen

2018-02-01

Cloud computing offers significant research and economic benefits to healthcare organisations. Cloud services provide a safe place for storing and managing large amounts of such sensitive data. Under conventional flow of gene information, gene sequence laboratories send out raw and inferred information via Internet to several sequence libraries. DNA sequencing storage costs will be minimised by use of cloud service. In this study, the authors put forward a novel genomic informatics system using Amazon Cloud Services, where genomic sequence information is stored and accessed for processing. True identification of exon regions in a DNA sequence is a key task in bioinformatics, which helps in disease identification and design drugs. Three base periodicity property of exons forms the basis of all exon identification techniques. Adaptive signal processing techniques found to be promising in comparison with several other methods. Several adaptive exon predictors (AEPs) are developed using variable normalised least mean square and its maximum normalised variants to reduce computational complexity. Finally, performance evaluation of various AEPs is done based on measures such as sensitivity, specificity and precision using various standard genomic datasets taken from National Center for Biotechnology Information genomic sequence database.

Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

Science.gov (United States)

Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

2017-08-15

Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

Science.gov (United States)

Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

2007-08-01

The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

Science.gov (United States)

Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

1991-01-01

Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

International Nuclear Information System (INIS)

Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

1990-01-01

The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

Science.gov (United States)

Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

2014-12-01

Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

[Detection of Cryptospordium spp. in environmental water samples by FTA-PCR].

Science.gov (United States)

Zhang, Xiao-Ping; Zhu, Qian; He, Yan-Yan; Jiang, Li; Jiang, Shou-Fu

2011-02-01

To establish a FTA-polymeras chain reaction (FTA-PCR) method in detection of Cryptospordium spp. in different sources of water. The semi automated immunomagnetic separation (IMS) of Cryptospordium oocysts in environmental water samples was performed firstly, and then genomic DNA of Cryptospordium oocysts was extracted by FTA filters disk. Oligonucleotide primers were designed based on the DNA fragment of the 18 S rRNA gene from C. parvum. Plate DNA was amplified with primers in PCR. The control DNA samples from Toxoplasma gondii,Sarcocystis suihominis, Echinococcus granulosus, and Clonorchis sinensis were amplified simultaneously. All PCR products were detected by agar electrophoresis dyed with ethidium bromide. The 446 bp fragment of DNA was detected in all samples of C. parvum, C. andersoni, and C. baileyi, while it was not detected in control groups in laboratory. No positive samples were found from 10 samples collected from tape water in 5 districts of Shanghai City by FTA-PCR. Nine positive samples were detected totally from 70 different environmental water samples, there were 0 out of 15 samples from the source of tape water, 2 out of 25 from the Huangpu River, 5 out of 15 from rivers around the animal farmers, 1 out of 9 from output water of contaminating water treatment factory, 1 out of 6 from the out gate of living contaminating water. The 446 bp fragment was detected from all the amplified positive water samples. FTA-PCR is an efficient method for gene detection of Cryptospordium oocysts, which could be used in detection of environmental water samples. The contamination degree of Cryptospordium oocysts in the river water around animal farms is high.

Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

Science.gov (United States)

Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

2018-01-01

ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

Context Dependent Effects of Chimeric Peptide Morpholino Conjugates Contribute to Dystrophin Exon-skipping Efficiency.

Science.gov (United States)

Yin, Haifang; Boisguerin, Prisca; Moulton, Hong M; Betts, Corinne; Seow, Yiqi; Boutilier, Jordan; Wang, Qingsong; Walsh, Anthony; Lebleu, Bernard; Wood, Matthew Ja

2013-09-24

We have recently reported that cell-penetrating peptides (CPPs) and novel chimeric peptides containing CPP (referred as B peptide) and muscle-targeting peptide (referred as MSP) motifs significantly improve the systemic exon-skipping activity of morpholino phosphorodiamidate oligomers (PMOs) in dystrophin-deficient mdx mice. In the present study, the general mechanistic significance of the chimeric peptide configuration on the activity and tissue uptake of peptide conjugated PMOs in vivo was investigated. Four additional chimeric peptide-PMO conjugates including newly identified peptide 9 (B-9-PMO and 9-B-PMO) and control peptide 3 (B-3-PMO and 3-B-PMO) were tested in mdx mice. Immunohistochemical staining, RT-PCR and western blot results indicated that B-9-PMO induced significantly higher level of exon skipping and dystrophin restoration than its counterpart (9-B-PMO), further corroborating the notion that the activity of chimeric peptide-PMO conjugates is dependent on relative position of the tissue-targeting peptide motif within the chimeric peptide with respect to PMOs. Subsequent mechanistic studies showed that enhanced cellular uptake of B-MSP-PMO into muscle cells leads to increased exon-skipping activity in comparison with MSP-B-PMO. Surprisingly, further evidence showed that the uptake of chimeric peptide-PMO conjugates of both orientations (B-MSP-PMO and MSP-B-PMO) was ATP- and temperature-dependent and also partially mediated by heparan sulfate proteoglycans (HSPG), indicating that endocytosis is likely the main uptake pathway for both chimeric peptide-PMO conjugates. Collectively, our data demonstrate that peptide orientation in chimeric peptides is an important parameter that determines cellular uptake and activity when conjugated directly to oligonucleotides. These observations provide insight into the design of improved cell targeting compounds for future therapeutics studies.Molecular Therapy-Nucleic Acids (2013) 2, e124; doi:10.1038/mtna.2013

Context Dependent Effects of Chimeric Peptide Morpholino Conjugates Contribute to Dystrophin Exon-skipping Efficiency

Directory of Open Access Journals (Sweden)

HaiFang Yin

2013-01-01

Full Text Available We have recently reported that cell-penetrating peptides (CPPs and novel chimeric peptides containing CPP (referred as B peptide and muscle-targeting peptide (referred as MSP motifs significantly improve the systemic exon-skipping activity of morpholino phosphorodiamidate oligomers (PMOs in dystrophin-deficient mdx mice. In the present study, the general mechanistic significance of the chimeric peptide configuration on the activity and tissue uptake of peptide conjugated PMOs in vivo was investigated. Four additional chimeric peptide-PMO conjugates including newly identified peptide 9 (B-9-PMO and 9-B-PMO and control peptide 3 (B-3-PMO and 3-B-PMO were tested in mdx mice. Immunohistochemical staining, RT-PCR and western blot results indicated that B-9-PMO induced significantly higher level of exon skipping and dystrophin restoration than its counterpart (9-B-PMO, further corroborating the notion that the activity of chimeric peptide-PMO conjugates is dependent on relative position of the tissue-targeting peptide motif within the chimeric peptide with respect to PMOs. Subsequent mechanistic studies showed that enhanced cellular uptake of B-MSP-PMO into muscle cells leads to increased exon-skipping activity in comparison with MSP-B-PMO. Surprisingly, further evidence showed that the uptake of chimeric peptide-PMO conjugates of both orientations (B-MSP-PMO and MSP-B-PMO was ATP- and temperature-dependent and also partially mediated by heparan sulfate proteoglycans (HSPG, indicating that endocytosis is likely the main uptake pathway for both chimeric peptide-PMO conjugates. Collectively, our data demonstrate that peptide orientation in chimeric peptides is an important parameter that determines cellular uptake and activity when conjugated directly to oligonucleotides. These observations provide insight into the design of improved cell targeting compounds for future therapeutics studies.

Association of transforming growth factor-ß3 gene polymorphism ...

African Journals Online (AJOL)

Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

Science.gov (United States)

Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

1999-01-01

We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

Genotyping of the Holstein-Friesian crossbred cattle for CD18 gene using PCR-RFLP

Directory of Open Access Journals (Sweden)

A. S. Khade

2014-05-01

Full Text Available Aim: The present study was undertaken in Holstein-Friesian (HF crossbred cattle with the objective to find out genotype of HF crossbred cattle for Bovine Leucocyte Adhesion Deficiency (BLAD by using PCR-RFLP. Materials and Methods: 50 blood samples were collected from HF crossbred cattle and subjected to PCR. The amplified PCR products were digested using Taq I restriction enzyme at 65 oC overnight. After restriction digestion, the final PCR products were electrophoresed on 2.5 % agarose gel. Results: All the 50 animals under present investigation were found to be normal as the amplified PCR product upon digestion with Taq I restriction enzyme, revealed two bands of 313 bp and 54 bp for normal animals. Conclusions: In the present investigation D128G carrier frequency was found to be 0 %. However, recent reports suggest that the mutant gene has already been observed in the HF crossbred cattle population of India, which makes it necessary to screen the animals to avoid the risk of spreading BLAD in the breeding cattle population.

No evidence for mutations in exons 1, 8 and 18 of the patched gene in sporadic skin lesions of Brazilian patients

Directory of Open Access Journals (Sweden)

Granja F.

2003-01-01

Full Text Available There is strong evidence that the patched (PTCH gene is a gene for susceptibility to the nevoid basal cell carcinoma syndrome. PTCH has also been shown to mutate in both familial and sporadic basal cell carcinomas. However, mutations of the gene seem to be rare in squamous cell carcinomas. In order to characterize the role of the gene in the broader spectrum of sporadic skin malignant and pre-malignant lesions, we performed a polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP analysis of genomic DNA extracted from 105 adult patients (46 females and 59 males. There were 66 patients with basal cell carcinomas, 30 with squamous cell carcinomas, 2 with malignant melanomas and 7 patients with precancerous lesions. Two tissue samples were collected from each patient, one from the central portion of the tumor and another from normal skin. Using primers that encompass the entire exon 1, exon 8 and exon 18, where most of the mutations have been detected, we were unable to demonstrate any band shift. Three samples suspected to present aberrant migrating bands were excised from the gel and sequenced directly. In addition, we sequenced 12 other cases, including tumors and corresponding normal samples. A wild-type sequence was found in all 15 cases. Although our results do not exclude the presence of clonal alterations of the PTCH gene in skin cancers or mutations in other exons that were not screened, the present data do not support the presence of frequent mutations reported for non-melanoma skin cancer of other populations.

Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques

Directory of Open Access Journals (Sweden)

PAULO Z. PASSAMANI

2017-12-01

Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

A method to discriminate between closely related bovine major histocompatibility complex class I alleles by combining established PCR-SSP assays with RFLPs.

Science.gov (United States)

Svitek, N; Nzau, B; Steinaa, L; Nene, V

2015-04-01

We have developed a polymerase chain reaction-sequence-specific primers-restriction fragment length polymorphism (PCR-SSP-RFLP) method to rapidly differentiate between the A18 and A18 variant (v) BoLA haplotypes and between A14 and A15/A15v BoLA haplotypes in Holstein/Friesian cattle. We used published SSP to PCR amplify BoLA alleles expressed in animals of known haplotype and exposed the amplicons to the restriction enzyme PvuII that was predicted to cut at a unique site in the middle of BoLA-6*01302 (A18v) and BoLA-1*00901 (A15) but not in BoLA-6*01301 (A18) or BoLA-1*02301 (A14) alleles. Whereas the method does not discriminate between the A15 and A15v haplotypes, as the BoLA-1*00902 allele associated with A15v also contains a PvuII site, we are interested in cattle of A18 and A14 haplotype for vaccine related studies. Our results also indicated that the BoLA-6*01302 (A18v) allele is much more abundant than BoLA-6*01301 (A18) in the cattle that we sampled. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Arginine kinase in Toxocara canis: Exon-intron organization, functional analysis of site-directed mutants and evaluation of putative enzyme inhibitors.

Science.gov (United States)

Wickramasinghe, Susiji; Yatawara, Lalani; Nagataki, Mitsuru; Agatsuma, Takeshi

2016-10-01

To determine exon/intron organization of the Toxocara canis (T. canis) AK (TCAK) and to test green and black tea and several other chemicals against the activity of recombinant TCAK in the guanidino-specific region by site-directed mutants. Amplification of genomic DNA fragments containing introns was carried out by PCRs. The open-reading frame (1200 bp) of TCAK (wild type) was cloned into the BamH1/SalI site of pMAL-c2X. The maltose-binding protein-TCAK fusion protein was expressed in Escherichia coli TB1 cells. The purity of the expressed enzyme was verified by SDS-PAGE. Mutations were introduced into the guanidino-specific region and other areas of pMAL/TCAK by PCR. Enzyme activity was measured with an NADH-linked assay at 25 °C for the forward reaction (phosphagen synthesis). Arginine kinase in T. canis has a seven-exon/six-intron gene structure. The lengths of the introns ranged from 542 bp to 2 500 bp. All introns begin with gt and end with ag. Furthermore, we measured the enzyme activity of site-directed mutants of the recombinant TCAK. The K m value of the mutant (Alanine to Serine) decreased indicating a higher affinity for substrate arginine than the wild-type. The K m value of the mutant (Serine to Glycine) increased to 0.19 mM. The K m value (0.19 mM) of the double mutant (Alanine-Serine to Serine-Glycine) was slightly greater than in the wild-type (0.12 mM). In addition, several other chemicals were tested; including plant extract Azadiracta indica (A. indica), an aminoglycoside antibiotic (aminosidine), a citrus flavonoid glycoside (rutin) and a commercially available catechin mixture against TCAK. Green and black tea (1:10 dilution) produced 15% and 25% inhibition of TCAK, respectively. The extract of A. indica produced 5% inhibition of TCAK. Moreover, green and black tea produced a non-competitive type of inhibition and A. indica produced a mixed-type of inhibition on TCAK. Arginine kinase in T. canis has a seven-exon/six-intron gene

Screening for mutations in two exons of FANCG gene in Pakistani population.

Science.gov (United States)

Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

2017-06-01

Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

Real-time PCR for Leishmania species identification: Evaluation and comparison with classical techniques.

Science.gov (United States)

de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena

2016-06-01

Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing

Tracking the evolution of alternatively spliced exons within the Dscam family

Directory of Open Access Journals (Sweden)

Vision Todd J

2006-02-01

Full Text Available Abstract Background The Dscam gene in the fruit fly, Drosophila melanogaster, contains twenty-four exons, four of which are composed of tandem arrays that each undergo mutually exclusive alternative splicing (4, 6, 9 and 17, potentially generating 38,016 protein isoforms. This degree of transcript diversity has not been found in mammalian homologs of Dscam. We examined the molecular evolution of exons within this gene family to locate the point of divergence for this alternative splicing pattern. Results Using the fruit fly Dscam exons 4, 6, 9 and 17 as seed sequences, we iteratively searched sixteen genomes for homologs, and then performed phylogenetic analyses of the resulting sequences to examine their evolutionary history. We found homologs in the nematode, arthropod and vertebrate genomes, including homologs in several vertebrates where Dscam had not been previously annotated. Among these, only the arthropods contain homologs arranged in tandem arrays indicative of mutually exclusive splicing. We found no homologs to these exons within the Arabidopsis, yeast, tunicate or sea urchin genomes but homologs to several constitutive exons from fly Dscam were present within tunicate and sea urchin. Comparing the rate of turnover within the tandem arrays of the insect taxa (fruit fly, mosquito and honeybee, we found the variants within exons 4 and 17 are well conserved in number and spatial arrangement despite 248–283 million years of divergence. In contrast, the variants within exons 6 and 9 have undergone considerable turnover since these taxa diverged, as indicated by deeply branching taxon-specific lineages. Conclusion Our results suggest that at least one Dscam exon array may be an ancient duplication that predates the divergence of deuterostomes from protostomes but that there is no evidence for the presence of arrays in the common ancestor of vertebrates. The different patterns of conservation and turnover among the Dscam exon arrays

Identification of Mx gene nucleotide dimorphism (G/A as genetic marker for antiviral activity in Egyptian chickens

Directory of Open Access Journals (Sweden)

Mohamed S. Hassanane

2018-06-01

Full Text Available Egyptian chickens, representing 2 breeds and 7 strains, were genotyped using the PCR-RFLP and sequencing techniques for detection of a non-synonymous dimorphism (G/A in exon 14 of chicken Myxovirus resistance (Mx gene. This dimorphic position is responsible for altering Mx protein’s antiviral activity. Polymerase Chain reactions were performed using Egyptian chickens DNA and specific primer set to amplify Mx DNA fragments of 299 or 301 bp, containing the dimorphic position. Amplicons were cut with restriction enzyme Hpy81. Genotype and allele frequencies for the resistant allele A and sensitive allele G were calculated in all the tested chickens. Results of PCR-RFLP were confirmed by sequencing. The three genotypes AA, AG, GG at the target nucleotide position in Mx gene were represented in all the studied Egyptian chicken breeds and strains except Baladi strain which showed only one genotype AA. The average allele frequency of the resistant A allele in the tested birds (0.67 was higher than the sensitive G allele average frequency in the same birds (0.33. Appling PCR-RFLP technique in the breeding program can be used to select chickens carrying the A allele with high frequencies. This will help in improving poultry breeding in Egypt by producing infectious disease-resistant chickens. Keywords: Egyptian chickens, Antiviral activity, Mx gene, Genotyping, PCR-RFLP

Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

Science.gov (United States)

Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

2016-03-12

Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

Species identification of Cannabis sativa using real-time quantitative PCR (qPCR).

Science.gov (United States)

Johnson, Christopher E; Premasuthan, Amritha; Satkoski Trask, Jessica; Kanthaswamy, Sree

2013-03-01

Most narcotics-related cases in the United States involve Cannabis sativa. Material is typically identified based on the cystolithic hairs on the leaves and with chemical tests to identify of the presence of cannabinoids. Suspect seeds are germinated into a viable plant so that morphological and chemical tests can be conducted. Seed germination, however, causes undue analytical delays. DNA analyses that involve the chloroplast and nuclear genomes have been developed for identification of C. sativa materials, but they require several nanograms of template DNA. Using the trnL 3' exon-trnF intragenic spacer regions within the C. sativa chloroplast, we have developed a real-time quantitative PCR assay that is capable of identifying picogram amounts of chloroplast DNA for species determination of suspected C. sativa material. This assay provides forensic science laboratories with a quick and reliable method to identify an unknown sample as C. sativa. © 2013 American Academy of Forensic Sciences.

Detection of the mosquitocidal toxin genes encoding Cry11 proteins from Bacillus thuringiensis using a novel PCR-RFLP method Detección de genes que codifican proteínas mosquitocidas Cry11 de Bacillus thuringiensis mediante un método de PCR-RFLP novedoso

Directory of Open Access Journals (Sweden)

D. H. Sauka

2010-02-01

Full Text Available A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method for detection of cry11 genes from Bacillus thuringiensis was established. Based on the analysis of conserved regions of the cry11 genes, 2 oligonucleotide primers were designed to amplify a 1459-bp fragment of the cry11Aa gene, and a 1471-bp of the cry11Ba and cry11Bb genes. The amplification products were digested with restriction endonuclease HinfI. Exotic B. thuringiensis strains and native isolates collected from soils, leaves and stored product dust of Argentina were analyzed to study the distribution of cry11 genes. The PCR-RFLP patterns revealed the detection of cry11 genes in 3 of 64 exotic strains and in 10 of 107 native B. thuringiensis isolates tested. Just the cry11Aa gene subclass was detected among these bacteria. Since the methodology was also developed to detect cry11Ba and cry11Bb genes, an experimental future confirmation will be required. Based on the results obtained, the PCR-RFLP method presented may be a valuable tool for specific detection of the mosquitocidal toxin genes encoding Cry11 proteins from B. thuringiensis.En el presente estudio se estableció una estrategia basada en la amplificación génica (PCR y el posterior análisis de restricción (RFLP para detectar todos los genes cry11 de Bacillus thuringiensis informados hasta ahora. De acuerdo con el análisis de las regiones conservadas en los genes cry11, se diseñaron dos cebadores para amplificar un fragmento de 1459 pb de los genes cry11Aa y un fragmento de 1471 pb de los genes cry11Ba y cry11Bb. Los productos de la amplificación fueron digeridos con la enzima de restricción HinfI. Se analizaron cepas exóticas de B. thuringiensis y aislamientos nativos de Argentina obtenidos a partir de muestras de suelos, hojas y polvillo de silos, para estudiar la distribución de los genes cry11. Los patrones de PCR-RFLP revelaron la presencia de genes cry11 en 3 de las 64 cepas ex

Optimal decision procedures for satisfiability in fragments of alternating-time temporal logics

DEFF Research Database (Denmark)

Goranko, Valentin; Vester, Steen

2014-01-01

We consider several natural fragments of the alternating-time temporal logics ATL*and ATL with restrictions on the nesting between temporal operators and strate-gicquantifiers. We develop optimal decision procedures for satisfiability in these fragments, showing that they have much lower complexi...

Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

Science.gov (United States)

Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

2012-03-23

Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

Restriction map of the single-stranded DNA genome of Kilham rat virus strain 171, a nondefective parvovirus

International Nuclear Information System (INIS)

Banerjee, P.T.; Rathrock, R.; Mitra, S.

1981-01-01

A physical map of Kilham rat virus strain 171 DNA was constructed by analyzing the sizes and locations of restriction endonuclease-generated fragments of the replicative-form viral DNA synthesized in vitro. BglI, KpnI, BamHI, SmaI, XhoI, and XorII did not appear to have any cleavage sites, whereas 11 other enzymes cleaved the genome at one to eight sites, and AluI generated more than 12 distinct fragments. The 30 restriction sites that were mapped were distributed randomly in the viral genome. A comparison of the restriction fragments of in vivo- and in vitro-replicated replicative-form DNAs showed that these DNAs were identical except in the size or configuration of the terminal fragments

Real-time PCR in virology.

Science.gov (United States)

Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

2002-03-15

The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

NARCIS (Netherlands)

Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

1998-01-01

Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

Specific detection of Echinococcus spp. from the Tibetan fox (Vulpes ferrilata) and the red fox (V. vulpes) using copro-DNA PCR analysis.

Science.gov (United States)

Jiang, Weibin; Liu, Nan; Zhang, Gaotian; Renqing, Pengcuo; Xie, Fei; Li, Tiaoying; Wang, Zhenghuan; Wang, Xiaoming

2012-10-01

There are three Echinococcus species, Echinococcus granulosus, E. multilocularis, and E. shiquicus, which are distributed on the vast area of pastureland on the eastern Tibetan plateau in China. Tibetan foxes (Vulpes ferrilata) have been determined to be the main wild definitive host of E. multilocularis and E. shiquicus, but little information is available on the prevalence of these two parasites in Tibetan foxes. Consequently, the copro-prevalence of these parasites in foxes from the eastern Tibetan plateau was evaluated in this study. For each copro-DNA sample extracted from fox feces, a 133-bp segment of EgG1 Hae III was used to screen for infection with E. granulosus. Multiplex nested polymerase chain reaction (PCR) analysis was used to target an 874-bp segment of the mitochondrial COI gene to distinguish E. multilocularis and E. shiquicus. Among 184 fecal samples, 120 were from Tibetan foxes and six from red foxes (Vulpes vulpes). Of the fecal samples from Tibetan foxes, 74 (giving a copro-prevalence of 62%) showed the presence of Echinococcus spp.: 23 (19%) were found to contain E. multilocularis, 32 (27%) E. shiquicus, and 19 (16%) showed mixed infection with both E. multilocularis and E. shiquicus. Two fecal samples from red foxes were found to be infected with E. multilocularis. No fox feces were found to be infected with E. granulosus. Tests on zinc finger protein genes and a 105-bp fragment of the Sry gene found no significant difference in the prevalence of the two parasites between sexes. The efficiency of our multiplex nested PCR methods were compared with previous polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) methods and some problems associated with the copro-PCR were discussed.

Alternative-splicing in the exon-10 region of GABA(A receptor beta(2 subunit gene: relationships between novel isoforms and psychotic disorders.

Directory of Open Access Journals (Sweden)

Cunyou Zhao

Full Text Available BACKGROUND: Non-coding single nucleotide polymorphisms (SNPs in GABRB2, the gene for beta(2-subunit of gamma-aminobutyric acid type A (GABA(A receptor, have been associated with schizophrenia (SCZ and quantitatively correlated to mRNA expression and alternative splicing. METHODS AND FINDINGS: Expression of the Exon 10 region of GABRB2 from minigene constructs revealed this region to be an "alternative splicing hotspot" that readily gave rise to differently spliced isoforms depending on intron sequences. This led to a search in human brain cDNA libraries, and the discovery of two novel isoforms, beta(2S1 and beta(2S2, bearing variations in the neighborhood of Exon-10. Quantitative real-time PCR analysis of postmortem brain samples showed increased beta(2S1 expression and decreased beta(2S2 expression in both SCZ and bipolar disorder (BPD compared to controls. Disease-control differences were significantly correlated with SNP rs187269 in BPD males for both beta(2S1 and beta(2S2 expressions, and significantly correlated with SNPs rs2546620 and rs187269 in SCZ males for beta(2S2 expression. Moreover, site-directed mutagenesis indicated that Thr(365, a potential phosphorylation site in Exon-10, played a key role in determining the time profile of the ATP-dependent electrophysiological current run-down. CONCLUSION: This study therefore provided experimental evidence for the importance of non-coding sequences in the Exon-10 region in GABRB2 with respect to beta(2-subunit splicing diversity and the etiologies of SCZ and BPD.

Authentication of Meat Species in Sucuk by Multiplex PCR

Directory of Open Access Journals (Sweden)

Osman İrfan İLHAK

2015-01-01

Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

PCR-based detection of a rare linear DNA in cell culture

Directory of Open Access Journals (Sweden)

Saveliev Sergei V.

2002-01-01

Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

PCR-based detection of a rare linear DNA in cell culture.

Science.gov (United States)

Saveliev, Sergei V.

2002-11-11

The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

Fragmentation of Ceramics in Rapid Expansion Mode

Science.gov (United States)

Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

''Normal'' tissues from humans exposed to radium contain an alteration in the c-mos locus

International Nuclear Information System (INIS)

Huberman, E.; Schlenker, R.A.; Hardwick, J.P.

1989-01-01

The structures of a number of human proto-oncogenes from persons with internal systemic exposure to radium were analyzed by restriction enzyme digestion and southern blotting of their DNA. Two extra c-mos Eco R1 restriction-fragment-length bands of 5.0 kb and 5.5 kb were found in tissue DNA from six of seven individuals. The extra c-mos bands were detected in DNA from many, but not all, of the tissues of the individuals exposed to radium. Our results suggest that the c-mos restriction-fragment-length alterations (RFLA) found in individuals exposed to radium were induced rather than inherited, are epigenetic in origin, and most likely result from changes in the methylation of bases surrounding the single exon of the c-mos proto-oncogene. 7 refs., 3 figs., 2 tabs

Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

International Nuclear Information System (INIS)

Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

1988-01-01

The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

A double mutation in exon 6 of the [beta]-hexosaminidase [alpha] subunit in a patient with the B1 variant of Tay-Sachs disease

Energy Technology Data Exchange (ETDEWEB)

Ainsworth, P.J. (Univ. of Western Ontario, Ontario (Canada) Child Health Research Institute, London, Ontario (Canada)); Coulter-Mackie, M.B. (Univ. of Western Ontario, Ontario (Canada) Child Health Research Institute, London, Ontario (Canada) Children' s Psychiatric Research Institute, London, Ontario (Canada))

1992-10-01

The B1 variant form of Tay-Sachs disease is enzymologically unique in that the causative mutation(s) appear to affect the active site in the [alpha] subunit of [beta]-hexosaminidase A without altering its ability to associate with the [beta] subunit. Most previously reported B1 variant mutations were found in exon 5 within codon 178. The coding sequence of the [alpha] subunit gene of a patient with the B1 variant form was examined with a combination of reverse transcription of mRNA to cDNA, PCR, and dideoxy sequencing. A double mutation in exon 6 has been identified: a G[sub 574][yields]C transversion causing a val[sub 192][yields]leu change and a G[sub 598][yields] A transition resulting in a val[sub 200][yields]met alteration. The amplified cDNAs were otherwise normal throughout their sequence. The 574 and 598 alterations have been confirmed by amplification directly from genomic DNA from the patient and her mother. Transient-expression studies of the two exon 6 mutations (singly or together) in COS-1 cells show that the G[sub 574][yields]C change is sufficient to cause the loss of enzyme activity. The biochemical phenotype of the 574 alteration in transfection studies is consistent with that expected for a B1 variant mutation. As such, this mutation differs from previously reported B1 variant mutations, all of which occur in exon 5. 31 refs., 2 figs., 2 tabs.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Effects of rs769217 and rs1001179 polymorphisms of catalase gene on blood catalase, carbohydrate and lipid biomarkers in diabetes mellitus.

Science.gov (United States)

Góth, László; Nagy, Teréz; Kósa, Zsuzsanna; Fejes, Zsolt; Bhattoa, Harjit Pal; Paragh, György; Káplár, Miklós

2012-10-01

Oxidative stress and deficiency of the enzyme catalase, which is the primary scavenger of the oxidant H(2)O(2), may contribute to diabetes. The current study examined two polymorphisms in the catalase gene, -262C>nT in the promoter and 111C>T in exon 9, and their effects on blood catalase activity as well as on concentrations of blood glucose, haemoglobin A1c, triglyceride, cholesterol, HDL, LDL, ApoA-I and ApoB. Subjects were type-1 and type-2 diabetics. We evaluated PCR-single strand conformational polymorphism for 111C>T and PCR-restriction fragment length polymorphism for - 262C>T. TT genotype frequency of 111C>T polymorphism was increased in type-1 diabetes. Type-2 diabetics with the CC or CT genotypes had decreased catalase and increased glucose, hemoglobinA1c and ApoB. Type-2 diabetics who have TT genotype in -262C>T may have elevated risk for diabetes complications; these patients had the lowest mean catalase and HDL, as well as the highest glucose, haemoglobin A1c, cholesterol and ApoB.

Consistent absence of BRAF mutations in salivary gland carcinomas

Directory of Open Access Journals (Sweden)

Nooshin Mohtasham

2017-06-01

Full Text Available Introduction: Malignant salivary gland tumors are rare entities. Despite advances in surgery, radiation therapy and chemotherapy, the rate of the mortality and five-year survival has not been improved markedly over the last few decades. The activation of EGFR- RAS-RAF signaling pathway contributes to the initiation and progression of many human cancers, promising a key pathway for therapeutic molecules. Thus, the objective of this study was to evaluate BRAF mutations in salivary gland carcinomas. Methods: We designed PCR- RFLP (Polymerase Chain Reaction -Restriction Fragment Length Polymorphism and screened 50 salivary gland carcinomas (SGCs including mucoepidermoid carcinoma (MEC, adenoid cystic carcinoma (AdCC and polymorphous low grade adenocarcinoma (PLGA for the BRAF V600E mutation. Results: PCR-RFLP analyses demonstrated no mutation in BRAF exon 15 for SGC samples at position V600, which is the most commonly mutated site for BRAF in human cancer. Conclusions: According to our results SGCs didn’t acquire BRAF mutations that result in a constitutive activation of the signaling cascade downstream of EGFR, hence SGCs can be a good candidate for anti EGFR therapies.

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

Science.gov (United States)

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

SEQUENCING AND SEQUENCE ANALYSIS OF MYOSTATIN GENE IN THE EXON 1 OF THE CAMEL (CAMELUS DROMEDARIUS

Directory of Open Access Journals (Sweden)

M. G. SHAH, A. S. QURESHI1, M. REISSMANN2 AND H. J. SCHWARTZ3

2006-10-01

Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.

Lab-on-a-Chip-Based PCR-RFLP Assay for the Detection of Malayan Box Turtle (Cuora amboinensis) in the Food Chain and Traditional Chinese Medicines

Science.gov (United States)

Asing; Ali, Md. Eaqub; Abd Hamid, Sharifah Bee; Hossain, M. A. Motalib; Mustafa, Shuhaimi; Kader, Md. Abdul; Zaidul, I. S. M.

2016-01-01

The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition. PMID:27716792

Lab-on-a-Chip-Based PCR-RFLP Assay for the Detection of Malayan Box Turtle (Cuora amboinensis) in the Food Chain and Traditional Chinese Medicines.

Science.gov (United States)

Asing; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Hossain, M A Motalib; Mustafa, Shuhaimi; Kader, Md Abdul; Zaidul, I S M

2016-01-01

The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition.

How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

Science.gov (United States)

Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

2012-01-01

Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

Atypical Presentation of Gelsolin Amyloidosis in a Man of African Descent with a Novel Mutation in the Gelsolin Gene.

Science.gov (United States)

Oregel, Karlos Z; Shouse, Geoffrey P; Oster, Cyrus; Martinez, Freddy; Wang, Jun; Rosenzweig, Michael; Deisch, Jeremy K; Chen, Chien-Shing; Nagaraj, Gayathri

2018-03-30

BACKGROUND Gelsolin amyloidosis is a very rare systemic disease presenting with a pathognomonic triad of corneal lattice dystrophy, cutis laxa, and polyneuropathy. The disease is mostly restricted to a Finnish population with known mutations (G654A, G654T) in exon 4 of the gelsolin gene. The mutations lead to errors in protein processing and folding, and ultimately leads to deposition of an amyloidogenic fragment in the extracellular space, causing the symptoms of disease. CASE REPORT We present a case of gelsolin amyloidosis in a male of African descent with an atypical clinical presentation including fevers, skin rash, polyneuropathy, and anemia. Gelsolin amyloidosis was diagnosed based on mass spectrometry of tissue samples. Importantly, a novel mutation in the gelsolin gene (C1375G) in exon 10 was found in this patient. His atypical presentation can possibly be attributed to the presence of a novel mutation in the gelsolin gene as the likely underlying cause of the syndrome. PCR primers were used to amplify the gelsolin gene from genomic DNA. Purified PCR products were then shipped to Eton Biosciences (San Diego, CA) for sequencing. CONCLUSIONS This study carries several important lessons relevant to the practice of medicine. First, the differential diagnosis for multisystem disease presentations should always include amyloidosis. Second, despite what has been uncovered about the molecular biology of disease, there is always more that can be discovered. Finally, further work to verify the link between this mutation and the clinical syndrome is still needed, as are effective treatments for this disease.

An 8bp indel in exon 1 of Ghrelin gene associated with chicken growth.

Science.gov (United States)

Fang, Meixia; Nie, Qinghua; Luo, Chenglong; Zhang, Dexiang; Zhang, Xiquan

2007-04-01

Ghrelin, acts as the endogenous ligand for growth hormone secretagogues receptor (GHS-R), is a novel growth hormone (GH) releasing peptide with reported effects on food intake in chickens. In this study, an 8 bp indel polymorphism in exon 1 of the chicken Ghrelin (cGHRL) gene was genotyped in a F(2) designed full-sib population to analyze its associations with chicken growth and carcass traits. Later, mRNA level in the proventriculus was determined by real-time PCR to reveal the expression feature of cGHRL gene. Result showed that this 8 bp indel was significantly associated with body weight at the age of 28 days (BW28) and 56 days (BW56), eviscerated weight (EW) and leg muscle weight (LMW) (PGhrelin on chicken growth were indicated by this study.

Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Azzedine Bounamous

2014-07-01

Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

Science.gov (United States)

Wumba, Roger; Jean, Menotti; Benjamin, Longo-Mbenza; Madone, Mandina; Fabien, Kintoki; Josué, Zanga; Jean, Sala; Eric, Kendjo; AC, Guillo-Olczyk; Marc, Thellier

2012-01-01

Objective. To determine the prevalence and the genotypes of Enterocytozoon bieneusi in stool specimens from HIV patients. Methods. This cross-sectional study was carried out in Kinshasa hospitals between 2009 and 2012. Detection of microsporidia including E. bieneusi and E. intestinalis was performed in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI) in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM) was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n = 19) among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3%) and 5 type IV strains of E. bieneusi (26.3%) were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo), and the concurrence of type I and type IV strains. PMID:22811884

Discrimination of gastrointestinal nematode eggs from crude fecal egg preparations by inhibitor-resistant conventional and real-time PCR.

Science.gov (United States)

Demeler, Janina; Ramünke, Sabrina; Wolken, Sonja; Ianiello, Davide; Rinaldi, Laura; Gahutu, Jean Bosco; Cringoli, Giuseppe; von Samson-Himmelstjerna, Georg; Krücken, Jürgen

2013-01-01

Diagnosis of gastrointestinal nematodes relies predominantly on coproscopic methods such as flotation, Kato-Katz, McMaster or FLOTAC. Although FLOTAC allows accurate quantification, many nematode eggs can only be differentiated to genus or family level. Several molecular diagnostic tools discriminating closely related species suffer from high costs for DNA isolation from feces and limited sensitivity since most kits use only small amounts of feces (PCR from crude egg preparations was designed for full compatibility with FLOTAC to accurately quantify eggs per gram feces (epg) and determine species composition. Eggs were recovered from the flotation solution and concentrated by sieving. Lysis was achieved by repeated boiling and freezing cycles - only Trichuris eggs required additional mechanic disruption. Egg lysates were directly used as template for PCR with Phusion DNA polymerase which is particularly resistant to PCR inhibitors. Qualitative results were obtained with feces of goats, cattle, horses, swine, cats, dogs and mice. The finally established protocol was also compatible with quantitative real-time PCR in the presence of EvaGreen and no PCR inhibition was detectable when extracts were diluted at least fourfold. Sensitivity was comparable to DNA isolation protocols and spiked samples with five epg were reliably detected. For Toxocara cati a detection limit below one epg was demonstrated. It was possible to distinguish T. cati and Toxocara canis using high resolution melt (HRM) analysis, a rapid tool for species identification. In human samples, restriction fragment length polymorphism (RFLP) and HRM analysis were used to discriminate Necator americanus and Ancylostoma duodenale. The method is able to significantly improve molecular diagnosis of gastrointestinal nematodes by increasing speed and sensitivity while decreasing overall costs. For identification of species or resistance alleles, analysis of PCR products with many different post PCR methods can

Discrimination of gastrointestinal nematode eggs from crude fecal egg preparations by inhibitor-resistant conventional and real-time PCR.

Directory of Open Access Journals (Sweden)

Janina Demeler

Full Text Available Diagnosis of gastrointestinal nematodes relies predominantly on coproscopic methods such as flotation, Kato-Katz, McMaster or FLOTAC. Although FLOTAC allows accurate quantification, many nematode eggs can only be differentiated to genus or family level. Several molecular diagnostic tools discriminating closely related species suffer from high costs for DNA isolation from feces and limited sensitivity since most kits use only small amounts of feces (<1 g. A direct PCR from crude egg preparations was designed for full compatibility with FLOTAC to accurately quantify eggs per gram feces (epg and determine species composition. Eggs were recovered from the flotation solution and concentrated by sieving. Lysis was achieved by repeated boiling and freezing cycles - only Trichuris eggs required additional mechanic disruption. Egg lysates were directly used as template for PCR with Phusion DNA polymerase which is particularly resistant to PCR inhibitors. Qualitative results were obtained with feces of goats, cattle, horses, swine, cats, dogs and mice. The finally established protocol was also compatible with quantitative real-time PCR in the presence of EvaGreen and no PCR inhibition was detectable when extracts were diluted at least fourfold. Sensitivity was comparable to DNA isolation protocols and spiked samples with five epg were reliably detected. For Toxocara cati a detection limit below one epg was demonstrated. It was possible to distinguish T. cati and Toxocara canis using high resolution melt (HRM analysis, a rapid tool for species identification. In human samples, restriction fragment length polymorphism (RFLP and HRM analysis were used to discriminate Necator americanus and Ancylostoma duodenale. The method is able to significantly improve molecular diagnosis of gastrointestinal nematodes by increasing speed and sensitivity while decreasing overall costs. For identification of species or resistance alleles, analysis of PCR products with many

The molecular analysis of mutations in exons 4, 11 and 21 of the cystic fibrosis transmembrane conductance regulator (CFTR gene in cystic fibrosis patients in Kermanshah, Iran

Directory of Open Access Journals (Sweden)

Nasibe Karimi

2017-03-01

Full Text Available Introduction: Cystic fibrosis (CF is a common genetic disorder in white populations with an autosomal recessive pattern, caused by mutations in the CFTR gene. The frequency of more than 1950 various mutations reported in the CFTR gene significantly varies in different populations. ∆F508 is a common mutation in exon 10, which is first addressed in the molecular analysis of the disease. Other exons are required to be investigated owing to failing to identify mutations in the patients. The present study was conducted to investigate mutations in exons 4, 11 and 21 of the CFTR gene using the sequencing method in CF patients in Kermanshah province, Iran. Methods: The present descriptive study was conducted on all patients with CF presenting to the medical genetics center in Kermanshah in 2010-2011. After taking blood samples and extracting DNA using saturated NaCl solution, sequences of exons were amplified using PCR and sequenced for identifying mutations. Results: The frequency of mutations was found to be respectively 0, 0 and 5.5% in exon 11, 21 and 4. The D110H mutation was found to be homozygous in one subject and heterozygous in another. Moreover, the 4029A>G polymorphism (12.9% was found to be homozygous in two subjects and heterozygous in three others. Conclusion: The D110H mutation is recommended to be included in the screening programs of the study population. The results obtained support the effects of ethnic and geographical factors on the distribution of CF mutations.

The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.

Science.gov (United States)

Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J

2013-01-01

Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.

Identification of Echinococcus Granulosus Strains in Isolated Hydatid Cyst Specimens from Animals by PCR-RFLP Method in West Azerbaijan – Iran

Directory of Open Access Journals (Sweden)

Haleh Hanifian

2013-09-01

Full Text Available Background: The aim of this study was DNA extraction from protosco­lecses of Echinococcus granulosus and identification of these strains in West-Azerbai­jan Province, north western Iran.Methods: Thirty one livestock isolates from sheep and cattle were collected from abattoirs of the province. To investigate the genetic variation of the isolates, after DNA extraction by Glass beads-phenol chloroform method; PCR-RLFP analysis of rDNA-ITS1 was performed using three different restric­tion enzymes of Taq 1, Rsa 1 and Alu 1.Result: Amplified PCR products for all isolates were 1000bp band which is expected band in sheep strains (G1-G3 complex. The results of RFLP analy­sis also were the same for all isolates. PCR-RFLP patterns restriction en­zymes were identical as follows, Rsa1 bands under UV showed two bands approximately 655bp and 345bp. Alu1 bands were as follows: two approx­imately 800bp and 200bp and Taq1 did not cut any region and bands were approximately 1000 bp in all samples.Conclusions: Based on PCR-RFLP patterns of ITS1 fragment produced with endonucleases enzyme digestion in animal isolates, it can be concluded that a single strain of E. granulosus (sheep strain or G1-G3 complex is domi­nant genotype in this province

Terminal Restriction Fragment Length Polymorphism Analysis of Soil Bacterial Communities under Different Vegetation Types in Subtropical Area.

Directory of Open Access Journals (Sweden)

Zeyan Wu

Full Text Available Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF, coniferous forest (CF, subalpine dwarf forest (SDF and alpine meadow (AM were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA revealed that the soil bacterial communities' structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC, total nitrogen (TN, total phosphorus (TP and total potassium (TK were positively correlated with the diversity of bacterial communities.

Diversity of indigeneous bradyrhizobia associated with three ...

African Journals Online (AJOL)

The diversity of Bradyrhizobium strains nodulating three cowpea (Vigna ... PCR- Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of 16S-23S ... 85 crushed nodules distinguished four genetic profiles, IGS types I, II, III and IV.

Naturally occuring nucleosome positioning signals in human exons and introns

DEFF Research Database (Denmark)

Baldi, Pierre; Brunak, Søren; Chauvin, Yves

1996-01-01

We describe the structural implications of a periodic pattern found in human exons and introns by hidden Markov models. We show that exons (besides the reading frame) have a specific sequential structure in the form of a pattern with triplet consensus non-T(A/T)G, and a minimal periodicity of rou...

Quantitative threefold allele-specific PCR (QuanTAS-PCR) for highly sensitive JAK2 V617F mutant allele detection

International Nuclear Information System (INIS)

Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander

2013-01-01

The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a