
Sample records for exogenous wild p53

  1. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang


    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  2. Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

    International Nuclear Information System (INIS)

    Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong


    Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

  3. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation. (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic


    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  4. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  5. No evidence for functional inactivation of wild-type p53 protein by MDM2 overexpression in gastric carcinogenesis

    NARCIS (Netherlands)

    Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.


    Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result

  6. Dose selenomethionine have radio-protective effect on cell lines with wild type p53?

    International Nuclear Information System (INIS)

    Tsuji, K.; Hagihira, T.; Ohnishi, K.; Ohnishi, T.; Matsumoto, H.


    Full text: Selenium compounds are known to have cancer preventive effects. It is reported recently that selenium in the form of selenomethionine (SeMet) can protect cells with wild type p53 from UV-induced cell killing by activating the DNA repair mechanism of p53 tumor suppressor protein via redox factor Ref1 by reducing p53 cysteine residue 275 and 277. In contrast, SeMet has no protective effect on UV-induced cell killing in p53-null cells. If SeMet also has protective effect in cells with wild type p53 on cell killing by photon irradiation, SeMet can be used as normal tissue radio-protector. We examined the effect of SeMet on cell killing by X-ray irradiation in several cell lines with different p53 status at exponentially growing phase. Cell lines used in this experiment were as follows: H1299/neo; human lung cancer cell line of p53 null type tranfected with control vector with no p53, H1299/wp53; wild type p53 transfected counterpart. A172/neo; human glioblastoma cell line with wild type p53, A172/mp53-248; mp53-248 (248-mutant, ARG >TRP) transfected counterpart. SAS/neo; human tongue cancer cell line with wild type p53, and SAS/mp53-248; mp53-248 transfected counterpart. Cells were subcultured at monolayer in D-MEM containing 10% FBS. Survivals of the cells were determined by colony forming ability. Ten-MV linac X-ray was used to irradiate the cells. Exponentially growing cells were incubated with 20μM of SeMet for 15 hours before irradiation. After 24 hours exposure of SeMet, cells were incubated up to two weeks in growth medium for colony formation. Twenty-four hours exposure of 20μM of SeMet had no cytotoxicity on these cell lines. SeMet had no modification effect on cell killing by photon irradiation in H1299/neo, H1299/wp53, SAS/neo, SAS/mp53-248, and A172/mp53-248. On the other hand, SeMet sensitized A172/neo in radiation cell killing. The effects of p53 on interaction of SeMet and photon irradiation differ according to cell lines

  7. Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

    Directory of Open Access Journals (Sweden)

    Carlos Farkas

    Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

  8. Phenylbutyrate Sensitizes Human Glioblastoma Cells Lacking Wild-Type P53 Function to Ionizing Radiation

    International Nuclear Information System (INIS)

    Lopez, Carlos A.; Feng, Felix Y.; Herman, Joseph M.; Nyati, Mukesh K.; Lawrence, Theodore S.; Ljungman, Mats


    Purpose: Histone deacetylase (HDAC) inhibitors induce growth arrest, differentiation, and apoptosis in cancer cells. Phenylbutyrate (PB) is a HDAC inhibitor used clinically for treatment of urea cycle disorders. Because of its low cytotoxicity, cerebrospinal fluid penetration, and high oral bioavailability, we investigated PB as a potential radiation sensitizer in human glioblastoma cell lines. Methods and Materials: Four glioblastoma cell lines were selected for this study. Phenylbutyrate was used at a concentration of 2 mM, which is achievable in humans. Western blots were used to assess levels of acetylated histone H3 in tumor cells after treatment with PB. Flow cytometry was used for cell cycle analysis. Clonogenic assays were performed to assess the effect of PB on radiation sensitivity. We used shRNA against p53 to study the role of p53 in radiosensitization. Results: Treatment with PB alone resulted in hyperacetylation of histones, confirmed by Western blot analysis. The PB alone resulted in cytostatic effects in three cell lines. There was no evidence of G 1 arrest, increase in sub-G 1 fraction or p21 protein induction. Clonogenic assays showed radiosensitization in two lines harboring p53 mutations, with enhancement ratios (± SE) of 1.5 (± 0.2) and 1.3 (± 0.1), respectively. There was no radiopotentiating effect in two cell lines with wild-type p53, but knockdown of wild-type p53 resulted in radiosensitization by PB. Conclusions: Phenylbutyrate can produce p21-independent cytostasis, and enhances radiation sensitivity in p53 mutant human glioblastoma cells in vitro. This suggests the potential application of combined PB and radiotherapy in glioblastoma harboring mutant p53

  9. Cyclophilin B induces chemoresistance by degrading wild type p53 via interaction with MDM2 in colorectal cancer. (United States)

    Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo


    Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Role of wild-type p53 in apoptotic and non-apoptotic cell death induced by X-irradiation and heat treatment in p53-mutated mouse M10 cells

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio


    The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)

  11. Spontaneous human squamous cell carcinomas are killed by a human cytotoxic T lymphocyte clone recognizing a wild-type p53-derived peptide

    DEFF Research Database (Denmark)

    Röpke, M; Hald, J; Guldberg, Per


    p53 genes, in a L9V/HLA-A2 specific and restricted fashion. Thus, the normal tolerance against endogenously processed p53 protein-derived self-epitopes can be broken by peptide-specific in vitro priming. p53 protein-derived wild-type peptides might thus represent tumor associated target molecules...

  12. Retention of the In Vitro Radiosensitizing Potential of Gemcitabine Under Anoxic Conditions, in p53 Wild-Type and p53-Deficient Non-Small-Cell Lung Carcinoma Cells

    International Nuclear Information System (INIS)

    Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip


    Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G 0/1 arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.

  13. The correlation between the use of personal protective equipment and level wild-type p53 of dental technicians in Surabaya

    Directory of Open Access Journals (Sweden)

    Puspa Dila Rohmaniar


    Full Text Available Background: Exposure of metals among dental technicians that come from the working environment can lead to the formation reactive oxygen species (ROS. ROS can cause mutations in the p53 gene (p53. The mutation is transversion mutation GuanineThymine. p53 mutations can lead to low expression of the wild-type p53 protein (p53. Wild-type p53 involved in many biological processes such as regulation of genes involved in cell cycle, cell growth after DNA damage, and apoptosis. However, exposure to metals among dental technicians can be prevented through the use of personal protective equipment (PPE during work. Purpose: The purpose of this study was to analyze the correlation between the use of personal protective equipment to wild-type p53 protein levels among dental technicians in Surabaya. Method: This study was observational analytic with cross sectional approach. 40 samples were taken by random sampling. Data were retrieved through interviews and observations. Wild-type p53 was analyzed from saliva with indirect ELISA method. Analysis of data used Kolmogorov Smirnov normality test and a Pearson correlation test. Value significance was p<0.05 (95% confidence level. Result: There was a significant association between the use of personal protective equipment with wild-type p53 levels with p=0.002 Conclusion: The use PPE properly is positively correlated with the wild-type p53 protein levels of dental technicians in Surabaya.

  14. On the mechanistic differences of benzene-induced leukemogenesis between wild type and p53 knockout mice

    International Nuclear Information System (INIS)

    Hirabayashi, Yoko; Yoon, Byung-Il; Kawasaki, Yasushi; Li, Guang-Xun; Kanno, Jun; Inoue, Tohru


    Leukemia induction by benzene inhalation was first reported by Le Noire in 1887, described multiple cases of leukemia among Parisian cobblers. However, experimental induction of leukemia by benzene exposure was not succeeded for a hundred years, until Snyder et al. and our group reported it nearly 20 years ago. Nevertheless, the mechanistic background of benzene-induced leukemia was still an enigma until recently a benzene-induced peculiar cell kinetics of the stem/progenitor cells has been elucidated by our study, demonstrated a marked repeated oscillatory decrease in peripheral blood and bone marrow (BM) cellularity during and after benzene exposure, which epigenetically preceded and developed the leukemia more than a year later. We utilized the BUUV (bromodeoxyuridine + UV exposure) method to study stem/progenitor cell kinetics during and/or after benzene exposure. Using these methods, we were able to measure the labeling rate, cycling fraction of clonogenic progenitor cells, and other cell cycle parameters. The cycling fraction of stem/progenitor cells was found not to turn into an active hematopoiesis but to remain low during benzene inhalation and further we found evidence that the cycling fraction depression may be mediated in part by a slowing of stem/progenitor cell cycling perse by up-regulation of p21. The benzene induced leukemogenicity between mice carrying wild-type p53 and mice lacking p53 seem to differ from one another. In the case of p53 knockout mouse, DNA damage such as weak mutagenicity and or chromosomal damages are retained, and those damages participated in the induction of a consequent activation of proto-oncogenes and the like, which led cells to further neoplastic changes. In contrast, in the case of wild type mice, a dramatic oscillational change in the cell cycle of the stem cell compartment seems to be an important factor for mice carrying the p53 gene. (author)

  15. Nitric oxide prodrug JS-K inhibits ubiquitin E1 and kills tumor cells retaining wild-type p53. (United States)

    Kitagaki, J; Yang, Y; Saavedra, J E; Colburn, N H; Keefer, L K; Perantoni, A O


    Nitric oxide (NO) is a major effector molecule in cancer prevention. A number of studies have shown that NO prodrug JS-K (O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate) induces apoptotic cell death in vitro and in vivo, indicating that it is a promising new therapeutic for cancer. However, the mechanism of its tumor-killing activity remains unclear. Ubiquitin plays an important role in the regulation of tumorigenesis and cell apoptosis. Our earlier report has shown that inactivation of the ubiquitin system through blocking E1 (ubiquitin-activating enzyme) activity preferentially induces apoptosis in p53-expressing transformed cells. As E1 has an active cysteine residue that could potentially interact with NO, we hypothesized that JS-K could inactivate E1 activity. E1 activity was evaluated by detecting ubiquitin-E1 conjugates through immunoblotting. JS-K strikingly inhibits the ubiquitin-E1 thioester formation in cells in a dose-dependent manner with an IC(50) of approximately 2 microM, whereas a JS-K analog that cannot release NO did not affect these levels in cells. Moreover, JS-K decreases total ubiquitylated proteins and increases p53 levels, which is mainly regulated by ubiquitin and proteasomal degradation. Furthermore, JS-K preferentially induces cell apoptosis in p53-expressing transformed cells. These findings indicate that JS-K inhibits E1 activity and kills transformed cells harboring wild-type p53.

  16. Identification of proteins that regulate radiation-induced apoptosis in murine tumors with wild type p53

    Energy Technology Data Exchange (ETDEWEB)

    Seong, Jinsil; Oh, Hae Jin; Kim, Jiyoung; An, Jeung Hee; Kim, Wonwoo [Dept. of Radiation Oncology, Yonsei Univ. Medical College, Seoul (Korea, Republic of)


    In this study, we investigated the molecular factors determining the induction of apoptosis by radiation. Two murine tumors syngeneic to C3H/HeJ mice were used: an ovarian carcinoma OCa-I, and a hepatocarcinoma HCa-I. Both have wild type p53, but display distinctly different radiosensitivity in terms of specific growth delay (12.7 d in OCa-I and 0.3 d in HCa-I) and tumor cure dose 50% (52.6 Gy in OCa-I and >80 Gy in HCa-I). Eight-mm tumors on the thighs of mice were irradiated with 25 Gy and tumor samples were collected at regular time intervals after irradiation. The peak levels of apoptosis were 16.1{+-}0.6% in OCa-I and 0.2{+-}0.0% in HCa-I at 4 h after radiation, and this time point was used for subsequent proteomics analysis. Protein spots were identified by peptide mass fingerprinting with a focus on those related to apoptosis. In OCa-I tumors, radiation increased the expression of cytochrome c oxidase and Bcl2/adenovirus E1B-interacting 2 (Nip 2) protein higher than 3-fold. However in HCa-I, these two proteins showed no significant change. The results suggest that radiosensitivity in tumors with wild type p53 is regulated by a complex mechanism. Furthermore, these proteins could be molecular targets for a novel therapeutic strategy involving the regulation of radiosensitivity. (author)

  17. Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells* (United States)

    Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio


    Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

  18. Identification of proteins that regulate radiation-induced apoptosis in murine tumors with wild type p53

    International Nuclear Information System (INIS)

    Seong, Jinsil; Oh, Hae Jin; Kim, Jiyoung; An, Jeung Hee; Kim, Wonwoo


    In this study, we investigated the molecular factors determining the induction of apoptosis by radiation. Two murine tumors syngeneic to C3H/HeJ mice were used: an ovarian carcinoma OCa-I, and a hepatocarcinoma HCa-I. Both have wild type p53, but display distinctly different radiosensitivity in terms of specific growth delay (12.7 d in OCa-I and 0.3 d in HCa-I) and tumor cure dose 50% (52.6 Gy in OCa-I and >80 Gy in HCa-I). Eight-mm tumors on the thighs of mice were irradiated with 25 Gy and tumor samples were collected at regular time intervals after irradiation. The peak levels of apoptosis were 16.1±0.6% in OCa-I and 0.2±0.0% in HCa-I at 4 h after radiation, and this time point was used for subsequent proteomics analysis. Protein spots were identified by peptide mass fingerprinting with a focus on those related to apoptosis. In OCa-I tumors, radiation increased the expression of cytochrome c oxidase and Bcl2/adenovirus E1B-interacting 2 (Nip 2) protein higher than 3-fold. However in HCa-I, these two proteins showed no significant change. The results suggest that radiosensitivity in tumors with wild type p53 is regulated by a complex mechanism. Furthermore, these proteins could be molecular targets for a novel therapeutic strategy involving the regulation of radiosensitivity. (author)

  19. Mutant, wild type, or overall p53 expression: freedom from clinical progression in tumours of astrocytic lineage. (United States)

    Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M


    Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.

  20. Pharmacological activation of tumor suppressor, wild-type p53 as a promising strategy to fight cancer

    Directory of Open Access Journals (Sweden)

    Alicja Sznarkowska


    Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.

  1. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53. (United States)

    York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B


    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

  2. Oral administration of an estrogen metabolite-induced potentiation of radiation antitumor effects in presence of wild-type p53 in non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Huober, Jens B.; Nakamura, Seiichi; Meyn, Ray; Roth, Jack A.; Mukhopadhyay, Tapas


    Purpose: The purpose of this study was to investigate the efficacy of 2-methoxyestradiol as an antitumor and radiosensitizing agent for the treatment of human malignancy. Methods and Materials: Two cancer cell lines with wild-type p53 status were exposed first to irradiation and then to an oral formulation of the nontoxic metabolite 2-methoxyestradiol (2ME) to stabilize p53 levels. Results: Cell growth was inhibited via G1 growth and apoptosis. Subsequent in vitro growth and Tunel assays indicated that this combination was superior to radiation alone at inducing p53 protein accumulation, stabilizing p53 protein levels, and substantially reducing long-term tumor cell growth (∼80%) and colony formation (∼95%) in vitro, and inducing apoptosis. However, harboring mutated p53, H322 cell line, was relatively insensitive to such a treatment regimen. Western blot analysis revealed that growth inhibition was associated with increased levels of p53 and p21 protein accumulation. Experiments with subcutaneous tumor in a nu/nu mouse showed the combination treatment to be superior to radiation alone at reducing tumor growth (∼50% reduction as compared to radiation alone) in vivo. Conclusion: Thus, our studies confirmed a unique strategy whereby oral administration of a nontoxic estrogen metabolite, 2ME, significantly enhanced the radiation effect on a subcutaneous tumor without any toxicity and suggesting that this strategy may be clinically useful as an adjuvant therapy

  3. Noscapine induced apoptosis via downregulation of survivin in human neuroblastoma cells having wild type or null p53.

    Directory of Open Access Journals (Sweden)

    Shiwang Li

    Full Text Available Neuroblastoma is the most common extracranial solid tumor of childhood. It accounts for 15% of pediatric cancer deaths. Chemotherapy is the mainstay of treatment in children with advanced neuroblastoma. Noscapine, a nontoxic natural compound, can trigger apoptosis in many cancer types. We now show that p53 is dispensable for Noscapine-induced cell death in neuroblastoma cell lines, proapoptotic response to this promising chemopreventive agent is mediated by suppression of survivin protein expression. The Noscapine treatment increased levels of total and Ser(15-phosphorylated p53 protein in SK-SY5Y cells, but the proapoptotic response to this agent was maintained even after knockdown of the p53 protein level. Exposure of SK-SY5Y and LA1-5S cells to Noscapine resulted in a marked decrease in protein and mRNA level of survivin as early as 12 hours after treatment. Ectopic expression of survivin conferred statistically significant protection against Noscapine-mediated cytoplasmic histone-associated apoptotic DNA fragmentation. Also, the Noscapine-induced apoptosis was modestly but statistically significantly augmented by RNA interference of survivin in both cell lines. Furthermore, Noscapine-induced apoptotic cell death was associated with activation of caspase-3 and cleavage of PARP. In conclusion, the present study provides novel insight into the molecular circuitry of Noscapine-induced apoptosis to indicate suppression of survivin expression as a critical mediator of this process.

  4. The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle. (United States)


    that my statement of work (SOW) for the current project omitted many of the tasks that had to be carried out in order to get the lab up and running...that we knew that we could stabilize wild-type p53 in ML-1 cells along with the possibility of being able to get an excellent elutriation profile with...nuclear protein extract was immunoprecipitated with PAb421 cross-linked to ProteinA -Sepharose beads and analysed by SDS-PAGE Western blot analysis with

  5. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  6. p53 mutations promote proteasomal activity. (United States)

    Oren, Moshe; Kotler, Eran


    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  7. Superior anti-tumor activity of the MDM2 antagonist idasanutlin and the Bcl-2 inhibitor venetoclax in p53 wild-type acute myeloid leukemia models

    Directory of Open Access Journals (Sweden)

    Christian Lehmann


    Full Text Available Abstract Background Venetoclax, a small molecule BH3 mimetic which inhibits the anti-apoptotic protein Bcl-2, and idasanutlin, a selective MDM2 antagonist, have both shown activity as single-agent treatments in pre-clinical and clinical studies in acute myeloid leukemia (AML. In this study, we deliver the rationale and molecular basis for the combination of idasanutlin and venetoclax for treatment of p53 wild-type AML. Methods The effect of idasanutlin and venetoclax combination on cell viability, apoptosis, and cell cycle progression was investigated in vitro using established AML cell lines. In vivo efficacy was demonstrated in subcutaneous and orthotopic xenograft models generated in female nude or non-obese diabetic/severe combined immunodeficiency (NOD/SCID mice. Mode-of-action analyses were performed by means of cell cycle kinetic studies, RNA sequencing as well as western blotting experiments. Results Combination treatment with venetoclax and idasanutlin results in synergistic anti-tumor activity compared with the respective single-agent treatments in vitro, in p53 wild-type AML cell lines, and leads to strongly superior efficacy in vivo, in subcutaneous and orthotopic AML models. The inhibitory effects of idasanutlin were cell-cycle dependent, with cells arresting in G1 in consecutive cycles and the induction of apoptosis only evident after cells had gone through at least two cell cycles. Combination treatment with venetoclax removed this dependency, resulting in an acceleration of cell death kinetics. As expected, gene expression studies using RNA sequencing showed significant alterations to pathways associated with p53 signaling and cell cycle arrest (CCND1 pathway in response to idasanutlin treatment. Only few gene expression changes were observed for venetoclax treatment and combination treatment, indicating that their effects are mediated mainly at the post-transcriptional level. Protein expression studies demonstrated that

  8. Dual targeting of wild-type and mutant p53 by small molecule RITA results in the inhibition of N-Myc and key survival oncogenes and kills neuroblastoma cells in vivo and in vitro. (United States)

    Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina


    Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.

  9. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation. (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki


    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Tzu-Chin [Chest Clinic, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Lin, Yi-Chin [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Chen, Hsiao-Ling [Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan (China); Huang, Pei-Ru; Liu, Shang-Yu [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Yeh, Shu-Lan, E-mail: [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Department of Nutrition, Chung Shan Medical University Hospital, Taichung, Taiwan (China)


    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  11. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    International Nuclear Information System (INIS)

    Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan


    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  12. The p53-dependent radioadaptive response (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  13. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  14. Cytotoxic T-lymphocyte clones, established by stimulation with the HLA-A2 binding p5365-73 wild type peptide loaded on dendritic cells In vitro, specifically recognize and lyse HLA-A2 tumour cells overexpressing the p53 protein

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Petersen, T R; Kirkin, A F


    of recognizing p53 derived wild type (self) peptides. Furthermore, the capacity of R9V specific T cell clones to exert HLA restricted cytotoxicity, argues that the R9V peptide is naturally presented on certain cancer cells. This supports the view that p53 derived wild type peptides might serve as candidate......Mutations in the tumour suppressor gene p53 are among the most frequent genetic alterations in human malignancies, often associated with an accumulation of the p53 protein in the cytoplasm. We have generated a number of cytotoxic T lymphocyte (CTL) clones that specifically recognize the HLA-A*0201...

  15. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression. (United States)

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa


    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  16. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah


    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  17. S100A4 interacts with p53 in the nucleus and promotes p53 degradation. (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J


    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  18. Chemical Variations on the p53 Reactivation Theme

    Directory of Open Access Journals (Sweden)

    Carlos J. A. Ribeiro


    Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

  19. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    NARCIS (Netherlands)

    Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,

  20. Mutant p53 protein localized in the cytoplasm inhibits autophagy. (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido


    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  1. Targeting the p53 Pathway in Ewing Sarcoma (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.


    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  2. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen


    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  3. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy


    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  4. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  5. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao


    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  6. Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla


    Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

  7. PRIMA-1 and PRIMA-1Met (APR-246: From Mutant/Wild Type p53 Reactivation to Unexpected Mechanisms Underlying Their Potent Anti-Tumor Effect in Combinatorial Therapies

    Directory of Open Access Journals (Sweden)

    Anne Perdrix


    Full Text Available p53 protects cells from genetic assaults by triggering cell-cycle arrest and apoptosis. Inactivation of p53 pathway is found in the vast majority of human cancers often due to somatic missense mutations in TP53 or to an excessive degradation of the protein. Accordingly, reactivation of p53 appears as a quite promising pharmacological approach and, effectively, several attempts have been made in that sense. The most widely investigated compounds for this purpose are PRIMA-1 (p53 reactivation and induction of massive apoptosis and PRIMA-1Met (APR-246, that are at an advanced stage of development, with several clinical trials in progress. Based on publications referenced in PubMed since 2002, here we review the reported effects of these compounds on cancer cells, with a specific focus on their ability of p53 reactivation, an overview of their unexpected anti-cancer effects, and a presentation of the investigated drug combinations.

  8. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)


    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  9. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.


    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  10. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.


    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  11. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa


    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  12. Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2. (United States)

    Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C


    Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

  13. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture (United States)

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan


    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  14. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents. (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J


    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  15. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)


    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  16. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.


    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  17. Friend or Foe: MicroRNAs in the p53 network. (United States)

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo


    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  18. A dual role of p53 in the control of autophagy. (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido


    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  19. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)


    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  20. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi


    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  1. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling. (United States)

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald


    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  2. Thymocyte apoptosis induced by p53-dependent and independent pathways

    International Nuclear Information System (INIS)

    Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.


    The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

  3. Regulation of autophagy by cytoplasmic p53. (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido


    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  4. The expanding universe of p53 targets. (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A


    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  5. Introduction of exogenous wild soybean DNA into cultivated soybean and RAPD molecular verification

    Institute of Scientific and Technical Information of China (English)

    谢纬武; 王斌; 雷勃钧; 李希臣; 卢翠华; 钱华; 周思君


    The exogenous total DNA of the wild high-protein soybean was transferred to cultivatedsoybean through the pollen tube channel and the genomic variation of the transformed progeny was detected bythe method of RAPD(Random Amplified Polymorphic DNA).Distinguished variations were found in one of the 7 transformed plants of the first generation(D1),ofwhich the traits of fruition,outward appearance,leaf shape and flower colour were almost identical withthose of the recipient parent;of which grain weight,seed coat colour and stem strength were situated betweenthe two parents;and there were greatly more pods per plant and 12.5% higher content of protein in seedsthan that of the recipient parent.All the properties have been invariably inherited for 3 generations.Through RAPD analysis of the genomes of the donor,the recipient and the transformed progeny(D3)as agroup,DNA polyrnorphisms were found in amplified products by 24 of 150 primers.The results prove thatthe exogenous DNA caused the distinct variance of the genome.The authors infer that the homogeneousrecombination of large exogenous DNA is the main cause for the variance.

  6. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    Directory of Open Access Journals (Sweden)

    Lin Tai-Du


    Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

  7. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected]. (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo


    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  8. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang


    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  9. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)


    textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

  10. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.


    The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

  11. R248Q mutation--Beyond p53-DNA binding. (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L


    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  12. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika


    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  13. System-based strategies for p53 recovery. (United States)

    Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I


    The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

  14. Hatching time and alevin growth prior to the onset of exogenous feeding in farmed, wild and hybrid Norwegian Atlantic salmon.

    Directory of Open Access Journals (Sweden)

    Monica Favnebøe Solberg

    Full Text Available The onset of exogenous feeding, when juveniles emerge from the gravel, is a critical event for salmonids where early emergence and large size provide a competitive advantage in the wild. Studying 131 farmed, hybrid and wild Norwegian Atlantic salmon families, originating from four wild populations and two commercial strains, we investigated whether approximately 10 generations of selection for faster growth has also resulted in increased somatic growth prior to the onset of exogenous feeding. In addition, we tested whether relaxed selection in farms has allowed for alterations in hatching time between farmed and wild salmon. Across three cohorts, wild salmon families hatched earlier than farmed salmon families, while hybrid families displayed intermediate hatching times. While the observed differences were small, i.e., 1-15 degree-days (0-3 days, as water temperatures were c. 5-6°C, these data suggest additive genetic variation for hatching time. Alevin length prior to exogenous feeding was positively related to egg size. After removal of egg size effects, no systematic differences in alevin length were observed between the wild and farmed salmon families. While these results indicate additive genetic variation for egg development timing, and wild salmon families consistently hatched earlier than farmed salmon families, these differences were so small they are unlikely to significantly influence early life history competition of farmed and wild salmon in the natural environment. This is especially the case given that the timing of spawning among females can vary by several weeks in some rivers. The general lack of difference in size between farmed and wild alevins, strongly suggest that the documented differences in somatic growth rate between wild and farmed Norwegian Atlantic salmon under hatchery conditions are first detectable after the onset of exogenous feeding.

  15. p53 functions as a cell cycle control protein in osteosarcomas.


    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B


    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  16. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo


    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  17. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei


    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  18. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)


    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  19. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy. (United States)

    Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I


    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

  20. p53 in differentiation of thyroid cancer

    International Nuclear Information System (INIS)

    Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.


    P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

  1. Hormonal control of p53 and chemoprevention

    International Nuclear Information System (INIS)

    Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C


    Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

  2. P53 Gene Mutagenesis in Breast Cancer

    National Research Council Canada - National Science Library

    Sommer, Steve S


    .... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

  3. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi


    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  4. Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization. (United States)

    Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J


    Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

  5. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA. (United States)

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina


    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  6. Therapeutic targeting of the p53 pathway in cancer stem cells (United States)

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.


    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  7. Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation

    International Nuclear Information System (INIS)

    Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki


    We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)

  8. Andrographolide induces degradation of mutant p53 via activation of Hsp70. (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu


    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  9. Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Clarke Alan R


    Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.

  10. P53 overexpression and outcome of radiation therapy in head and neck cancers

    International Nuclear Information System (INIS)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae


    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers

  11. P53 overexpression and outcome of radiation therapy in head and neck cancers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)


    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.

  12. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity. (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu


    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  13. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina


    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  14. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail:


    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  15. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity. (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom


    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  16. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric


    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  17. Tumor hypoxia, p53, and prognosis in cervical cancers

    International Nuclear Information System (INIS)

    Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen


    =0.01). Sixty of the 70 tumors showed positive immunohistologic staining for p53 protein (transformed p53=tp53), and 10/70 were negative (wild-type p53=wtp53); p53 expression had no significant impact on survival (50% for tp53 vs. 79% for wtp53, p=0.11). FIGO stage and anemia had no impact on p53 expression. Forty-nine of 70 tumors were hypoxic (HF5+), and 21 showed no hypoxia (HF5-). Hypoxic carcinomas were more frequently positive for p53 as compared to nonhypoxic tumors (27% vs. 13%, p=0.011) and showed a trend toward a lower survival (48% vs. 70%, p = 0.07). In a further multivariate analysis, the impact of a combination of p53 expression and hypoxia on survival was examined. After adjusting for FIGO stage and pretreatment anemia, patients with wtp53 tumors had the best prognosis (3-year survival 79%) followed by tp53-HF5(-) patients (57%), and the most unfavorable prognosis was observed for tp53-HF5(+) patients (47%). The DNA index was higher in tp53 carcinomas compared to wtp53 tumors, 1.97±0.4 vs. 1.67±0.1, p=0.05. The highest DNA index was found in hypoxic tumors with transformed p53 (2.2±3.1). Conclusions: Advanced stage and pretreatment hemoglobin level are independent prognostic factors in cervical carcinomas. The immunohistologic detection of (a functionally inactive) p53 and the presence of hypoxia had no prognostic impact, if analyzed as single parameters. However, the combination of both parameters was able to discriminate different prognostic subgroups. Moreover, hypoxic cancers were more often immunohistologically positive for tp53 protein and had a higher DNA index with the highest DNA index in tumors with both hypoxia and tp53 protein expression. These findings in summary support the theory that the tumor's microenvironment may influence the biologic behavior via hypoxia

  18. Peran p53 Sebagai Jalur Kritis pada Mekanisme Kontrol Siklus Sel Sebagai Pencegah Terjadinya Kanker Mulut

    Directory of Open Access Journals (Sweden)

    Herlia Nur Istindiah


    Full Text Available In cell cycle control, p53 acts as an emergency brake, where its important checkpoint function is to maintain the genome integrity by preventing the formation and proliferation of mutant cells. P53 activity is increased by DNA damage occurs caused by agents (such as radioation, UV light or drugs or oncogenes. Mdm2 protein can inhibit the p53 activation, but oncogenes can inhibit Mdm2 or activate p53. If DNA damage occurs, then p53 prevents the cells from replicating their DNA by arresting the cell cycle, so that the cells can repair the damage. Alternatively, p53 instructs the cells to undergo apoptosis by inducing bax gene expression, so that irregular cell growth, and cancer can be avoided. Cancer, including oral cancer, oftenthuolved cells with altered p53. Exogenous factors, such as tobacco and alcohol, presumably plays a role in triggering p53 mutations. Several techniques, such as immunohistochemistry and PCR can be used to investigation their etiology and development of oral cancer. The results hopefully be applied clinically in early detection, prevention and prediction of cancer. This paper discusses the role on p53 in preventing the occurrence and proliferation of mutated cells that lead to cancer, including oral cancer.

  19. Ensemble-based computational approach discriminates functional activity of p53 cancer and rescue mutants.

    Directory of Open Access Journals (Sweden)

    Özlem Demir


    Full Text Available The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain ("cancer mutants". Activity can be restored by second-site suppressor mutations ("rescue mutants". This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD, without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC metric was strongly correlated (r(2 = 0.77 with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i p53 cancer mutants were more flexible than wild-type protein, (ii second-site rescue mutations decreased the flexibility of cancer mutants, and (iii negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants.

  20. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells. (United States)

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo


    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  1. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.


    Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or

  2. Regulation of Metabolic Activity by p53

    Directory of Open Access Journals (Sweden)

    Jessica Flöter


    Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

  3. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson


    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  4. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul


    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  5. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.


    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  6. Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

    International Nuclear Information System (INIS)

    Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko


    Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

  7. p53 functions as a cell cycle control protein in osteosarcomas. (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B


    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  8. p53 functions as a cell cycle control protein in osteosarcomas. (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B


    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  9. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia. (United States)

    Cox, Darren P


    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201. (United States)


    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  11. Regulation of p53 tetramerization and nuclear export by ARC. (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N


    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  12. Disruption of the MDM2-p53 interaction strongly potentiates p53-dependent apoptosis in cisplatin-resistant human testicular carcinoma cells via the Fas/FasL pathway

    NARCIS (Netherlands)

    Koster, R.; Timmer-Bosscha, H.; Bischoff, R.; Gietema, J. A.; de Jong, S.

    Wild-type p53 has a major role in the response and execution of apoptosis after chemotherapy in many cancers. Although high levels of wild-type p53 and hardly any TP53 mutations are found in testicular cancer (TC), chemotherapy resistance is still observed in a significant subgroup of TC patients.

  13. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  14. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents. (United States)

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang


    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  15. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis


    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  16. Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

    International Nuclear Information System (INIS)

    Frey, L. M.; Houben, R.; Brocker, E. B.


    Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

  17. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1. (United States)

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen


    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

  18. Mutant p53 interactions with supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Činčárová, Lenka; Šebest, Peter; Pivoňková, Hana; Brázda, Václav; Fojta, Miroslav; Paleček, Emil


    Roč. 24, č. 6 (2007), s. 639-640 ISSN 0739-1102. [Alban 2007: The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GP204/06/P369; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : mutant p53 * supercoiled DNA * cancer Subject RIV: BO - Biophysics

  19. P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors

    International Nuclear Information System (INIS)

    Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.


    Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy

  20. The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

    Directory of Open Access Journals (Sweden)

    Jennifer M. Smith


    Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

  1. Basal p53 expression is indispensable for mesenchymal stem cell integrity. (United States)

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G


    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  2. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein. (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H


    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  3. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein. (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H


    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  4. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P


    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  5. Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction

    Directory of Open Access Journals (Sweden)

    Louis Chesler


    Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.

  6. Detection of genotoxic and non-genotoxic carcinogens in Xpc−/−p53+/− mice

    International Nuclear Information System (INIS)

    Melis, Joost P.M.; Speksnijder, Ewoud N.; Kuiper, Raoul V.; Salvatori, Daniela C.F.; Schaap, Mirjam M.; Maas, Saskia; Robinson, Joke; Verhoef, Aart; Benthem, Jan van; Luijten, Mirjam; Steeg, Harry van


    An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.

  7. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    International Nuclear Information System (INIS)

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd; Groesch, Sabine


    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53 wt ) or being p(HCT-116 p53 -/- ), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53 -/- xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53 wt cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53 wt cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75 NTR , p53 and Bax

  8. Overexpression of p53 activated by small activating RNA suppresses the growth of human prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Ge Q


    Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate

  9. Caspase Activation and Aberrant Cell Growth in a p53+/+ Cell Line from a Li-Fraumeni Syndrome Family

    Directory of Open Access Journals (Sweden)

    Zaki A. Sherif


    Full Text Available Wild-type p53 is well known to induce cell cycle arrest and apoptosis to block aberrant cell growth. However, p53’s unique role in apoptosis and cell proliferation in Li-Fraumeni Syndrome (LFS has not been well elucidated. The aim of this study is to characterize the activity of wild-type p53 protein in LFS family dominated by a germline negative mutant p53. As expected, etoposide-treated wild-type p53-containing cell lines, LFS 2852 and control Jurkat, showed a greater rate of caspase- and annexin V-induced apoptotic cell death compared to the p53-mutant LFS 2673 cell line although mitochondrial and nuclear assays could not detect apoptosis in these organelles. The most intriguing part of the observation was the abnormal proliferation rate of the wild-type p53-containing cell line, which grew twice as fast as 2673 and Jurkat cells. This is important because apoptosis inducers acting through the mitochondrial death pathway are emerging as promising drugs against tumors where the role of p53 is not only to target gene regulation but also to block cell proliferation. This study casts a long shadow on the possible dysregulation of p53 mediators that enable cell proliferation. The deregulation of proliferation pathways represents an important anticancer therapeutic strategy for patients with the LFS phenotype.

  10. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)



    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  11. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation (United States)

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.


    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  12. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.


    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  13. Stabilization of alanine substituted p53 protein at Ser15, Thr18, and Ser20 in response to ionizing radiation

    International Nuclear Information System (INIS)

    Yamauchi, Motohiro; Suzuki, Keiji; Kodama, Seiji; Watanabe, Masami


    Phosphorylation of p53 at Ser15, Thr18, and Ser20 has been thought to be important for p53 stabilization in response to ionizing radiation. In the present study, we examined the X-ray-induced stabilization of Ala-substituted p53 protein at Ser15, Thr18, and Ser20, whose gene expression was controlled under an ecdyson-inducible promoter. We found that all single-, double-, or triple-Ala-substituted p53 at Ser15, Yhr18, and Ser20 were accumulated in the nucleus similarly to wild-type p53 after X-irradiation. These results indicate that the phosphorylation of p53 at Ser15, Thr18, and Ser20 is not necessarily needed for p53 stabilization in response to ionizing radiation

  14. A tumor-targeting p53 nanodelivery system limits chemoresistance to temozolomide prolonging survival in a mouse model of glioblastoma multiforme. (United States)

    Kim, Sang-Soo; Rait, Antonina; Kim, Eric; Pirollo, Kathleen F; Chang, Esther H


    Development of temozolomide (TMZ) resistance contributes to the poor prognosis for glioblastoma multiforme (GBM) patients. It was previously demonstrated that delivery of exogenous wild-type tumor suppressor gene p53 via a tumor-targeted nanocomplex (SGT-53) which crosses the blood-brain barrier could sensitize highly TMZ-resistant GBM tumors to TMZ. Here we assessed whether SGT-53 could inhibit development of TMZ resistance. SGT-53 significantly chemosensitized TMZ-sensitive human GBM cell lines (U87 and U251), in vitro and in vivo. Furthermore, in an intracranial GBM tumor model, two cycles of concurrent treatment with systemically administered SGT-53 and TMZ inhibited tumor growth, increased apoptosis and most importantly, significantly prolonged median survival. In contrast TMZ alone had no significant effect on median survival compared to a single cycle of TMZ. These results suggest that combining SGT-53 with TMZ appears to limit development of TMZ resistance, prolonging its anti-tumor effect and could be a more effective therapy for GBM. Using human glioblastoma multiforma cell lines, this research team demonstrated that the delivery of exogenous wild-type tumor suppressor gene p53 via a tumor-targeted nanocomplex limited the development of temozolomide resistance and prolonged its anti-tumor effect, which may enable future human application of this or similar techniques. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Mutations in p53, p53 protein overexpression and breast cancer survival

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.


    Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

  16. P53 suppresses expression of the 14-3-3gamma oncogene

    Directory of Open Access Journals (Sweden)

    Qi Wenqing


    Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.

  17. The role of p53 in the response to mitotic spindle damage

    International Nuclear Information System (INIS)

    Meek, D.W.


    The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)

  18. SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

    International Nuclear Information System (INIS)

    Milner, J.; Gamble, J.


    The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

  19. p53 is required for brain growth but is dispensable for resistance to nutrient restriction during Drosophila larval development. (United States)

    Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro


    Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.

  20. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

    International Nuclear Information System (INIS)

    Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira


    p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain

  1. Survivin inhibits anti-growth effect of p53 activated by aurora B

    International Nuclear Information System (INIS)

    Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee


    Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53

  2. p53 regulates the proliferation, differentiation and spontaneous transformation of mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Armesilla-Diaz, Alejandro, E-mail: [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain); Elvira, Gema; Silva, Augusto [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain)


    Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, a shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.

  3. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice. (United States)

    Rani, Reena; Li, Jie; Pang, Qishen


    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  4. Mutant p53 drives cancer by subverting multiple tumour suppression pathways

    Directory of Open Access Journals (Sweden)

    Sue eHaupt


    Full Text Available The tumour suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counter-productively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins (including many transcription factors, which normally partner with its wild type, tumour-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism and corrupt them to become cancer promoting.

  5. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.


    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  6. Adaptation of cancer cells from different entities to the MDM2 inhibitor nutlin-3 results in the emergence of p53-mutated multi-drug-resistant cancer cells

    NARCIS (Netherlands)

    Michaelis, M.; Rothweiler, F.; Barth, S.; Cinatl, J.; van Rikxoort, M.; Loeschmann, N.; Voges, Y.; Breitling, R.; von Deimling, A.; Roedel, F.; Weber, K.; Fehse, B.; Mack, E.; Stiewe, T.; Doerr, H. W.; Speidel, D.; Cinatl, J.; Cinatl jr., J.; Stephanou, A.


    Six p53 wild-type cancer cell lines from infrequently p53-mutated entities (neuroblastoma, rhabdomyosarcoma, and melanoma) were continuously exposed to increasing concentrations of the murine double minute 2 inhibitor nutlin-3, resulting in the emergence of nutlin-3-resistant, p53-mutated sublines

  7. p53 specific (auto)immunity in mice

    NARCIS (Netherlands)

    Lauwen, Marjolein Monique


    Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T

  8. Restriction of human herpesvirus 6B replication by p53

    DEFF Research Database (Denmark)

    Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina


    Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...

  9. Mutual interactions between P53 and growth factors in cancer

    NARCIS (Netherlands)

    Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE


    The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

  10. MDM2 inhibitor nutlin-3a induces apoptosis and senescence in cutaneous T-cell lymphoma: Role of p53

    DEFF Research Database (Denmark)

    Manfé, Valentina; Biskup, Edyta Urszula; Johansen, Peter


    cell lines, P53 mutation analysis identified a homozygous nonsense mutation (R196Stop in Hut-78) and a homozygous missense mutation (G245S in SeAx). In MyLa2000, Mac1, and Mac2a carrying wild-type P53, nutlin-3a induced apoptosis and senescence demonstrated by permanent G0/G1 cell-cycle block...... with intact p53 but also in Hut-78, SeAx, and Sézary cells. Thus, targeting p53 by nutlin-3a may constitute a therapeutic approach in CTCL because of increased apoptosis and senescence of tumor cells....

  11. Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors. (United States)

    Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles


    The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.

  12. Role of Peroxiredoxin I in Rectal Cancer and Related to p53 Status

    International Nuclear Information System (INIS)

    Chen, Miao-Fen; Lee, Kuan-Der; Yeh, Chung-Hung; Chen, Wen-Cheng; Huang, Wen-Shih; Chin, Chih-Chien; Lin, Paul- Yang; Wang, Jeng-Yi


    Background: Neoadjuvant chemoradiotherapy is widely accepted for the treatment of localized rectal cancer. Although peroxiredoxin I (PrxI) and p53 have been implicated in carcinogenesis and cancer treatment, the role of PrxI and its interaction with p53 in the prognosis and treatment response of rectal cancer remain relatively unstudied. Methods and Materials: In the present study, we examined the levels of PrxI and p53 in rectal cancer patients using membrane arrays and compared them with normal population samples. To demonstrate the biologic changes after manipulation of PrxI expression, we established stable transfectants of HCT-116 (wild-type p53) and HT-29 (mutant p53) cells with a PrxI silencing vector. The predictive capacities of PrxI and p53 were also assessed by relating the immunohistochemical staining of a retrospective series of rectal cancer cases to the clinical outcome. Results: The membrane array and immunochemical staining data showed that PrxI, but not p53, was significantly associated with the tumor burden. Our immunochemistry findings further indicated that PrxI positivity was linked to a poor response to neoadjuvant therapy and worse survival. In cellular and animal experiments, the inhibition of PrxI significantly decreased tumor growth and sensitized the tumor to irradiation, as indicated by a lower capacity to scavenge reactive oxygen species and more extensive DNA damage. The p53 status might have contributed to the difference between HCT-116 and HT-29 after knockdown of PrxI. Conclusion: According to our data, the level of PrxI combined with the p53 status is relevant to the prognosis and the treatment response. We suggested that PrxI might be a new biomarker for rectal cancer.

  13. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo. (United States)

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu


    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  14. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina


    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  15. Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning. (United States)

    Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq


    In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

  16. p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors

    NARCIS (Netherlands)

    Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't


    Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this

  17. Immunohistochemical analysis of P53 protein in odontogenic cysts (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.


    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  18. S-phase checkpoint elements of the E2F-1 family increase radiosensitivity in fibrosarcoma cells lacking p53

    International Nuclear Information System (INIS)

    Bodis, Stephan; Pruschy, Martin; Wirbelauer, Christiane; Glanzmann, Christoph; Krek, Wilhelm


    Purpose: Correct advance of cells through the S-phase of the mammalian cell cycle depends on the timely controlled activity of the E2F-1 transcription factor by cyclin A-cdk2. We are studying the reproductive integrity and radiosensitation of isogenic mouse fibrosarcoma cells, differing only in their p53 status, after expression of E2F-1 wildtype (wt) and specific E2F-1 mutants (mt) lacking the cyclin-A-binding domain. In this tumor model system only p53 wild-type expressing tumor cells are sensitive to ionizing radiation in vitro and in vivo. Material and Methods: Either wild-type p53 or genetically engineered p53 'null' mouse embryo fibroblasts were transfected with the oncogenes E1A and ras. These otherwise isogenic fibrosarcoma cells, with a malignant phenotype and tumorigenic in nude mice, were transfected with retroviruses containing either E2F-1 wild-type or specific E2F-1 mutants lacking the cyclin-A binding domain. Reproductive integrity after E2F-1 transfection with or without ionizing radiation (RT) was tested using the clonogenic assay. Tumor cell morphology of treated cells is analyzed for cell death mechanism. Results: E2F-1 wild-type expression in fibrosarcoma cells induced a clear p53 dependent cell death. While clonogenic survival of p53 'null' tumor cells was only slightly reduced with the expression of E2F-1 wild type (survival fraction of 0.5), the clonogenic survival of p53 wild-type fibrosarcoma tumor cells was reduced by at least one logarithm (survival fraction of 0.05). However, expression of the specific E2F-1 mutant lacking the cyclin-A binding domain reduced clonogenic survival in both the p53 'null' and the p53 wild-type fibrosarcoma cells by at least 2 logarithms (survival fraction 0.01 for p53 'null' and 0.002 for p53 wild-type). The mean values of the survival fractions after 2 and 5 Gy radiation alone in p53 'null' fibrosarcoma cells (SF 2 and SF 5) were SF 2 0.7, SF 5 = 0.15, respectively. The combination of ionizing RT in the p53

  19. The p53-mediated cytotoxicity of photodynamic therapy of cancer: Recent advances

    International Nuclear Information System (INIS)

    Zawacka-Pankau, Joanna; Krachulec, Justyna; Grulkowski, Ireneusz; Bielawski, Krzysztof P.; Selivanova, Galina


    Photodynamic therapy (PDT) is a promising modality for the treatment of both pre-malignant and malignant lesions. The mechanism of action converges mainly on the generation of reactive oxygen species which damage cancer cells directly as well as indirectly acting on tumor vasculature. The exact mechanism of PDT action is not fully understood, which is a formidable barrier to its successful clinical application. Elucidation of the mechanisms of cancer cell elimination by PDT might help in establishing highly specific, non-genotoxic anti-cancer treatment of tomorrow. One of the candidate PDT targets is the well-known tumor suppressor p53 protein recognized as the guardian of the genome. Together with its family members, p73 and p63 proteins, p53 is involved in apoptosis induction upon stress stimuli. The wild-type and mutant p53-targeting chemotherapeutics are currently extensively investigated as a promising strategy for highly specific anti-cancer therapy. In photodynamic therapy porphyrinogenic sensitizers are the most widely used compounds due to their potent biophysical and biochemical properties. Recent data suggest that the p53 tumor suppressor protein might play a significant role in porphyrin-PDT-mediated cell death by direct interaction with the drug which leads to its accumulation and induction of p53-dependent cell death both in the dark and upon irradiation. In this review we describe the available evidence on the role of p53 in PDT

  20. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

    Directory of Open Access Journals (Sweden)

    Simon Leuchs

    Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

  1. Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen. (United States)

    O'Neill, F J; Hu, Y; Chen, T; Carney, H


    In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.

  2. [Punish or cherish: p53, metabolism and tumor suppression]. (United States)

    Albagli, Olivier


    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  3. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α. (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra


    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Biological and genetic properties of the p53 null preneoplastic mammary epithelium (United States)

    Medina, Daniel; Kittrell, Frances S.; Shepard, Anne; Stephens, L. Clifton; Jiang, Cheng; Lu, Junxuan; Allred, D. Craig; McCarthy, Maureen; Ullrich, Robert L.


    The absence of the tumor suppressor gene p53 confers an increased tumorigenic risk for mammary epithelial cells. In this report, we describe the biological and genetic properties of the p53 null preneoplastic mouse mammary epithelium in a p53 wild-type environment. Mammary epithelium from p53 null mice was transplanted serially into the cleared mammary fat pads of p53 wild-type BALB/c female to develop stable outgrowth lines. The outgrowth lines were transplanted for 10 generations. The outgrowths were ductal in morphology and progressed through ductal hyperplasia and ductal carcinoma in situ before invasive cancer. The preneoplastic outgrowth lines were immortal and exhibited activated telomerase activity. They are estrogen and progesterone receptor-positive, and aneuploid, and had various levels of tumorigenic potential. The biological and genetic properties of these lines are distinct from those found in most hyperplastic alveolar outgrowth lines, the form of mammary preneoplasia occurring in most traditional models of murine mammary tumorigenesis. These results indicate that the preneoplastic cell populations found in this genetically engineered model are similar in biological properties to a subset of precurser lesions found in human breast cancer and provide a unique model to identify secondary events critical for tumorigenicity and invasiveness.

  5. Comparison of effects of p53 null and gain-of-function mutations on salivary tumors in MMTV-Hras transgenic mice.

    Directory of Open Access Journals (Sweden)

    Dadi Jiang

    Full Text Available p53 is an important tumor suppressor gene which is mutated in ~50% of all human cancers. Some of these mutants appear to have acquired novel functions beyond merely losing wild-type functions. To investigate these gain-of-function effects in vivo, we generated mice of three different genotypes: MMTV-Hras/p53(+/+, MMTV-Hras/p53(-/-, and MMTV-Hras/p53R172H/R172H. Salivary tumors from these mice were characterized with regard to age of tumor onset, tumor growth rates, cell cycle distribution, apoptotic levels, tumor histopathology, as well as response to doxorubicin treatment. Microarray analysis was also performed to profile gene expression. The MMTV-Hras/p53(-/- and MMTV-Hras/p53R172H/R172H mice displayed similar properties with regard to age of tumor onset, tumor growth rates, tumor histopathology, and response to doxorubicin, while both groups were clearly distinct from the MMTV-Hras/p53(+/+ mice by these measurements. In addition, the gene expression profiles of the MMTV-Hras/p53(-/- and MMTV-Hras/p53(R172H/R172H tumors were tightly clustered, and clearly distinct from the profiles of the MMTV-Hras/p53(+/+ tumors. Only a small group of genes showing differential expression between the MMTV-Hras/p53(-/- and MMTV-Hras/p53(R172H/R172H tumors, that did not appear to be regulated by wild-type p53, were identified. Taken together, these results indicate that in this MMTV-Hras-driven salivary tumor model, the major effect of the p53 R172H mutant is due to the loss of wild-type p53 function, with little or no gain-of-function effect on tumorigenesis, which may be explained by the tissue- and tumor type-specific properties of this gain-of-function mutant of p53.

  6. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya


    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  7. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdul-Hamid M.; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib


    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  8. Pharmacological targeting of p53 through RITA is an effective antitumoral strategy for malignant pleural mesothelioma. (United States)

    Di Marzo, Domenico; Forte, Iris Maria; Indovina, Paola; Di Gennaro, Elena; Rizzo, Valeria; Giorgi, Francesca; Mattioli, Eliseo; Iannuzzi, Carmelina Antonella; Budillon, Alfredo; Giordano, Antonio; Pentimalli, Francesca


    Malignant mesothelioma, a very aggressive tumor associated to asbestos exposure, is expected to increase in incidence, and unfortunately, no curative modality exists. Reactivation of p53 is a new attractive antitumoral strategy. p53 is rarely mutated in mesothelioma, but it is inactivated in most tumors by the lack of p14(ARF). Here, we evaluated the feasibility of this approach in pleural mesothelioma by testing RITA and nutlin-3, two molecules able to restore p53 function through a different mechanism, on a panel of mesothelioma cell lines representing the epithelioid (NCI-H28, NCI-H2452, IST-MES 2), biphasic (MSTO-211H), and sarcomatoid (NCI-H2052) histotypes compared with the normal mesothelial HMC-hTERT. RITA triggered robust caspase-dependent apoptosis specifically in epithelioid and biphasic mesothelioma cell lines, both through wild-type and mutant p53, concomitant to p21 downregulation. Conversely, nutlin-3 induced a p21-dependent growth arrest, rather than apoptosis, and was slightly toxic on HMC-hTERT.   Interestingly, we identified a previously undetected point mutation of p53 (p.Arg249Ser) in IST-MES 2, and showed that RITA is also able to reactivate this p53 mutant protein and its apoptotic function. RITA reduced tumor growth in a MSTO-211H-derived xenograft model of mesothelioma and synergized with cisplatin, which is the mainstay of treatment for this tumor. Our data indicate that reactivation of p53 and concomitant p21 downregulation effectively induce cell death in mesothelioma, a tumor characterized by a high intrinsic resistance to apoptosis. Altogether, our findings provide the preclinical framework supporting the use of p53-reactivating agents alone, or in combination regimens, to improve the outcome of patients with mesothelioma.

  9. Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC. (United States)

    Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick


    Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

  10. Stress and parental care in a wild Teleost fish: insights from exogenous supraphysiological cortisol implants. (United States)

    O'Connor, Constance M; Gilmour, Kathleen M; Arlinghaus, Robert; Van Der Kraak, Glen; Cooke, Steven J


    Male largemouth bass (Micropterus salmoides) provide sole parental care over a 4-6-wk period to a single brood, fanning the eggs to keep them oxygenated and free of silt and defending the brood until the offspring develop antipredator tactics. During this period, fish are highly active and have few opportunities for feeding, so this activity is energetically costly. To understand some of the consequences of stress during this challenging period, we injected fish with cortisol suspended in coconut oil to experimentally raise circulating cortisol in parental males for the first week of the parental care period. We compared parental care behavior between cortisol-treated, sham-treated (injected only with coconut oil), and control parental males. We further compared physiological parameters associated with metabolism and reproductive function between cortisol-treated and control males. The cortisol injections resulted in supraphysiological levels of circulating plasma cortisol, giving us insight into potential maximal effects of stress during parental care. At these supraphysiological levels, the cortisol-treated fish displayed higher concentrations of circulating glucose and cholesterol and lower concentrations of circulating triglycerides when compared with control fish, with no change in plasma concentrations of total protein. Plasma concentrations of androgen were similarly unaffected by cortisol treatment. In the short term (initial 1-2 wk), parental care of eggs and egg-sac fry was maintained by all groups, with no differences observed in behavior (e.g., tending, vigilance, defense) among the groups. However, the cortisol-treated fish abandoned their offspring at a higher rate than in the control or sham groups. The fish treated with cortisol also tended to develop external Saprolegnian infections, indicative of compromised immune function. These data demonstrate that exogenous cortisol elevation during parental care results in changes in energy use and a

  11. The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei


    Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53

  12. The anti-hypercholesterolemic effect of low p53 expression protects vascular endothelial function in mice.

    Directory of Open Access Journals (Sweden)

    Francois Leblond

    Full Text Available To demonstrate that p53 modulates endothelial function and the stress response to a high-fat western diet (WD.Three-month old p53+/+ wild type (WT and p53+/- male mice were fed a regular or WD for 3 months. Plasma levels of total cholesterol (TC and LDL-cholesterol were significantly elevated (p<0.05 in WD-fed WT (from 2.1±0.2 mmol/L to 3.1±0.2, and from 0.64±0.09 mmol/L to 1.25±0.11, respectively but not in p53+/- mice. The lack of cholesterol accumulation in WD-fed p53+/- mice was associated with high bile acid plasma concentrations (p53+/- =  4.7±0.9 vs. WT =  3.3±0.2 μmol/L, p<0.05 concomitant with an increased hepatic 7-alpha-hydroxylase mRNA expression. While the WD did not affect aortic endothelial relaxant function in p53+/- mice (WD =  83±5 and RD =  82±4% relaxation, it increased the maximal response to acetylcholine in WT mice (WD =  87±2 vs. RD =  62±5% relaxation, p<0.05 to levels of p53+/-. In WT mice, the rise in TC associated with higher (p<0.05 plasma levels of pro-inflammatory keratinocyte-derived chemokine, and an over-activation (p<0.05 of the relaxant non-nitric oxide/non-prostacyclin endothelial pathway. It is likely that in WT mice, activations of these pathways are adaptive and contributed to maintain endothelial function, while the WD neither promoted inflammation nor affected endothelial function in p53+/- mice.Our data demonstrate that low endogenous p53 expression prevents the rise in circulating levels of cholesterol when fed a WD. Consequently, the endothelial stress of hypercholesterolemia is absent in young p53+/- mice as evidenced by the absence of endothelial adaptive pathway over-activation to minimize stress-related damage.

  13. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)


    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  14. Analysis of p53- immunoreactivity in astrocytic brain tumors

    Directory of Open Access Journals (Sweden)

    Shinkarenko T.V.


    Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

  15. Targeting p53 by small molecules in hematological malignancies


    Saha, Manujendra N; Qiu, Lugui; Chang, Hong


    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...

  16. The nucleolus directly regulates p53 export and degradation. (United States)

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P


    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  17. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa


    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  18. p53 inhibits autophagy by interacting with the human ortholog of yeast Atg17, RB1CC1/FIP200. (United States)

    Morselli, Eugenia; Shen, Shensi; Ruckenstuhl, Christoph; Bauer, Maria Anna; Mariño, Guillermo; Galluzzi, Lorenzo; Criollo, Alfredo; Michaud, Mickael; Maiuri, Maria Chiara; Chano, Tokuhiro; Madeo, Frank; Kroemer, Guido


    The tumor suppressor protein p53 tonically suppresses autophagy when it is present in the cytoplasm. This effect is phylogenetically conserved from mammals to nematodes, and human p53 can inhibit autophagy in yeast, as we show here. Bioinformatic investigations of the p53 interactome in relationship to the autophagy-relevant protein network underscored the possible relevance of a direct molecular interaction between p53 and the mammalian ortholog of the essential yeast autophagy protein Atg17, namely RB1-inducible coiled-coil protein 1 (RB1CC1), also called FAK family kinase-interacting protein of 200 KDa (FIP200). Mutational analyses revealed that a single point mutation in p53 (K382R) abolished its capacity to inhibit autophagy upon transfection into p53-deficient human colon cancer or yeast cells. In conditions in which wild-type p53 co-immunoprecipitated with RB1CC1/FIP200, p53 (K382R) failed to do so, underscoring the importance of the physical interaction between these proteins for the control of autophagy. In conclusion, p53 regulates autophagy through a direct molecular interaction with RB1CC1/FIP200, a protein that is essential for the very apical step of autophagy initiation.

  19. Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells. (United States)

    Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun


    The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    Directory of Open Access Journals (Sweden)

    Liang Y


    Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood

  1. Mutant p53 protein in serum could be used as a molecular marker in human breast cancer. (United States)

    Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J


    p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

  2. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming


    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  3. P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation

    International Nuclear Information System (INIS)

    Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.


    Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells

  4. Exploring a minimal two-component p53 model

    International Nuclear Information System (INIS)

    Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei


    The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

  5. p53 downregulates the Fanconi anaemia DNA repair pathway. (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck


    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  6. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)


    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  7. Chronology of p53 protein accumulation in gastric carcinogenesis

    NARCIS (Netherlands)

    Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.


    p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early

  8. Role of p53 status in radiation sensitivity and cell cycle progression

    International Nuclear Information System (INIS)

    Zellars, Richard C.; Loney, Tania; Schott, Ann F.; Davis, Mary A.; Maybaum, Jonathan; Clarke, Michael F.; Lawrence, Theodore S.


    Purpose: Although p53 function plays a major role in G1 arrest after radiation, the influence of p53 status on progress through other phases of the cell cycle and on radiation sensitivity of human tumors is less clear. We investigated these issues using cells with a conditional expression system for wild type p53. Methods: A temperature sensitive murine wild type p53 plasmid was used (Ginsberg D, et al: Mol. Cell.Biol . 11:582, 1991). At the permissive temperature (32 deg. C), this plasmid produces a protein which assumes a conformation that exhibits wild type p53 function. However, when cells are cultured at 38 deg. C, this protein assumes an inactive conformation. HT29 human colon cancer cells (which are p53 mutant) were transduced with this plasmid (designated PEP A and PEP G cells) or a control vector (designated CCH1 cells) using electroporation and Geneticin selection. The presence of murine p53 transcript in the PEP cells was confirmed by Northern analysis. Results: Cells were cultured under 3 conditions: 1) 38 deg. C at all times; 2) 32 deg. C for 24 hours prior to irradiation and 3) 32 deg. C for 24 hours after irradiation. We found that culturing under permissive temperatures produced a small decrease in surviving fraction in the PEP clones (0.61 ± 0.10 and 0.64 ± 0.07, for PEP A and G, respectively) but not the CCH1 controls (1.14 ± 0.15). PEP cells tended to be more radiosensitive than CCH1 cells (even under non-permissive conditions) and demonstrated a trend towards increased radiosensitivity under both Conditions 2 and 3. In addition, flow cytometry revealed that a 24 hour exposure to permissive conditions increased the fraction of cells in G1 slightly and in G2/M substantially. S phase was almost absent. Conclusion: Restoration of p53 function in HT29 human colon cancer cells using this temperature sensitive system produced increased cytotoxicity and radiation sensitivity as well as cell cycle redistribution. It will be important to assess the

  9. p53 as the focus of gene therapy: past, present and future. (United States)

    Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani


    Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at

  10. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.


    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  11. G2-block after irradiation of cells with different p53 status

    International Nuclear Information System (INIS)

    Zoelzer, Friedo; Jagetia, Ganesh; Streffer, Christian


    Although it is clear that functional p53 is not required for radiation-induced G 2 block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G 2 compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G 2 phase itself. We observed the movement of BrdU-labeled cells through G 2 and M into G 1 . From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G 2 and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G 2 and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G 2 compartment alone is misleading when differences in the G 2 block are investigated and that the G 2 block itself is indeed independent of functional p53. (orig.) [de

  12. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. (United States)

    Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A


    Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.

  13. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    International Nuclear Information System (INIS)

    Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A


    A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology

  14. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    Directory of Open Access Journals (Sweden)

    Kousparou Christina A


    Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.

  15. Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines. (United States)

    Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid


    The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at

  16. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    International Nuclear Information System (INIS)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook


    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently cancer cells. Lack of functional accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference

  17. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)


    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently cancer cells. Lack of functional accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.

  18. Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53. (United States)

    Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei


    Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.

  19. Mutant p53 - heat shock response oncogenic cooperation: a new mechanism of cancer cell survival

    Directory of Open Access Journals (Sweden)

    Evguenia eAlexandrova


    Full Text Available The main tumor suppressor function of p53 as a ‘guardian of the genome’ is to respond to cellular stress by transcriptional activation of apoptosis, growth arrest or senescence in damaged cells. Not surprisingly, mutations in the p53 gene are the most frequent genetic alteration in human cancers. Importantly, mutant p53 (mutp53 proteins not only lose their wild-type tumor suppressor activity, but also can actively promote tumor development. Two main mechanisms accounting for mutp53 proto-oncogenic activity are inhibition of the wild-type p53 in a dominant-negative fashion and gain of additional oncogenic activities known as gain-of-function (GOF. Here we discuss a novel mechanism of mutp53 GOF, which relies on its oncogenic cooperation with the heat shock machinery. This coordinated adaptive mechanism renders cancer cells more resistant to proteotoxic stress and provides both, a strong survival advantage to cancer cells and a promising means for therapeutic intervention.

  20. p53 and the pathogenesis of skin cancer

    International Nuclear Information System (INIS)

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.


    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

  1. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia


    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  2. HEXIM1, a New Player in the p53 Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)


    Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

  3. Zoledronic acid produces combinatory anti-tumor effects with cisplatin on mesothelioma by increasing p53 expression levels.

    Directory of Open Access Journals (Sweden)

    Shinya Okamoto

    Full Text Available We examined anti-tumor effects of zoledronic acid (ZOL, one of the bisphosphonates agents clinically used for preventing loss of bone mass, on human mesothelioma cells bearing the wild-type p53 gene. ZOL-treated cells showed activation of caspase-3/7, -8 and -9, and increased sub-G1 phase fractions. A combinatory use of ZOL and cisplatin (CDDP, one of the first-line anti-cancer agents for mesothelioma, synergistically or additively produced the cytotoxicity on mesothelioma cells. Moreover, the combination achieved greater anti-tumor effects on mesothelioma developed in the pleural cavity than administration of either ZOL or CDDP alone. ZOL-treated cells as well as CDDP-treated cells induced p53 phosphorylation at Ser 15, a marker of p53 activation, and up-regulated p53 protein expression levels. Down-regulation of p53 levels with siRNA however did not influence the ZOL-mediated cytotoxicity but negated the combinatory effects by ZOL and CDDP. In addition, ZOL treatments augmented cytotoxicity of adenoviruses expressing the p53 gene on mesothelioma. These data demonstrated that ZOL-mediated augmentation of p53, which was not linked with ZOL-induced cytotoxicity, played a role in the combinatory effects with a p53 up-regulating agent, and suggests a possible clinical use of ZOL to mesothelioma with anti-cancer agents.

  4. The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

    International Nuclear Information System (INIS)

    Ohnishi, Takeo


    I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

  5. Tumor-promoting phorbol ester transiently down-modulates the p53 level and blocks the cell cycle

    DEFF Research Database (Denmark)

    Skouv, J.; Jensen, P O; Forchhammer, J


    Activation of the protein kinase C signaling pathway by tumor-promoting phorbol esters, such as 4 beta-phorbol 12-myristate 13-acetate (PMA), induced a decrease in the level of p53 mRNA in several serum-starved human cell lines. Also, the tumor-promoting phosphatase inhibitor okadaic acid induced...... a decrease in the p53 mRNA level in the cell lines. Normal diploid as well as various tumor cell lines were tested. Two tumor cell lines, HeLa and A549, both containing the wild-type p53 gene, but very different levels of p53 protein, were studied in detail. In both cell lines, the level of p53 m......RNA was minimal after 9 h of exposure to PMA. After approximately 120 h, the p53 mRNA level was similar to the pretreatment level. PMA induced a similar transient decrease in the level of p53 protein in the A549 cell line. The decrease in the p53 mRNA level could not be explained by changes in the transcriptional...


    Energy Technology Data Exchange (ETDEWEB)



    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  7. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.


    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  8. Robustness of the p53 network and biological hackers. (United States)

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G


    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.




    The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern

  10. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma. (United States)

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong


    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  11. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Manujendra N Saha

    Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

  12. Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA. (United States)

    Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z


    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

  13. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail:; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail:; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail:; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail:


    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  14. A dynamic P53-MDM2 model with time delay

    International Nuclear Information System (INIS)

    Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.


    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

  15. Role of P53 in Mammary Epithelial Cell Senescence

    National Research Council Canada - National Science Library

    Dimri, Goberdhan P


    .... We also chose several other targets of p53 that are induced by DNA damage. The RT PCR analysis aws carried out using mRNA prepared from young growing early passage and senescent late passage HMECs...

  16. Polymorphism at codon 36 of the p53 gene. (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A


    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  17. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53. (United States)

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T


    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.

  18. Post-translational regulation enables robust p53 regulation. (United States)

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling


    The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

  19. 40 Years of Research Put p53 in Translation (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques


    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  20. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53. (United States)

    Loging, W T; Reisman, D


    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  1. A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions. (United States)

    Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A


    A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

  2. Characterisation of the p53-mediated cellular responses evoked in primary mouse cells following exposure to ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Gillian D McFeat

    Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.

  3. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    Directory of Open Access Journals (Sweden)

    Liu Jun


    Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.

  4. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    International Nuclear Information System (INIS)

    Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei


    BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies

  5. Effects of serum starvation on radiosensitivity, proliferation and apoptosis in four human tumor cell lines with different p53 status

    International Nuclear Information System (INIS)

    Oya, N.; Zoelzer, F.; Werner, F.; Streffer, C.


    Purpose: The effects of serum starvation on radiation sensitivity, cell proliferation and apoptosis were investigated with particular consideration of the p53 status. Material and Methods: Four human tumor cell lines, Be11 (melanoma, p53 wild-type), MeWo (melanoma, p53 mutant), 4197 (squamous cell carcinoma, p53 wild-type) and 4451 (squamous cell carcinoma, p53 mutant), were used. After the cells had been incubated in starvation medium (0.5% FCS) for 1-6 days, changes in cell cycle distribution, induction of apoptosis and necrosis, and changes in radiation sensitivity were assessed by two-parameter flow cytometric measurements of DNA content/BrdU labeling, two-parameter flow cytometric measurements of DNA-dye-exclusion/Annexin V binding, and a conventional colony assay, respectively. Results: p53 wild-type cell lines showed a decrease in the BrdU labeling index and an increase in the apoptotic cell frequency in starvation medium. p53 mutant cell lines showed a decrease in the BrdU labeling index but no evidence of apoptosis. These cells went into necrosis instead. The radiation sensitivity was increased in 4451 and slightly decreased in Be11 and 4197 in starvation medium. Conclusion: These data suggest a functional involvement of p53 in starvation-induced G1-block and apoptosis in tumor cells. Altered radiosensitivity after culture in starvation medium seemed to be explained at least in part by the starvation-induced G1-block. The frequency of starvation-induced apoptosis or necrosis was not correlated with radiation sensitivity. (orig.)

  6. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage (United States)

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.


    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  7. A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine

    International Nuclear Information System (INIS)

    Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R


    p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development

  8. A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

    International Nuclear Information System (INIS)

    Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.


    eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

  9. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity. (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S


    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  10. p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells. (United States)

    Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete


    CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.

  11. Naphthoquinone Derivative PPE8 Induces Endoplasmic Reticulum Stress in p53 Null H1299 Cells

    Directory of Open Access Journals (Sweden)

    Jin-Cherng Lien


    Full Text Available Endoplasmic reticulum (ER plays a key role in synthesizing secretory proteins and sensing signal function in eukaryotic cells. Responding to calcium disturbance, oxidation state change, or pharmacological agents, ER transmembrane protein, inositol-regulating enzyme 1 (IRE1, senses the stress and triggers downstream signals. Glucose-regulated protein 78 (GRP78 dissociates from IRE1 to assist protein folding and guard against cell death. In prolonged ER stress, IRE1 recruits and activates apoptosis signal-regulating kinase 1 (ASK1 as well as downstream JNK for cell death. Naphthoquinones are widespread natural phenolic compounds. Vitamin K3, a derivative of naphthoquinone, inhibits variant tumor cell growth via oxygen uptake and oxygen stress. We synthesized a novel naphthoquinone derivative PPE8 and evaluated capacity to induce ER stress in p53 null H1299 and p53 wild-type A549 cells. In H1299 cells, PPE8 induced ER enlargement, GRP78 expression, and transient IER1 activation. Activated IRE1 recruited ASK1 for downstream JNK phosphorylation. IRE1 knockdown by siRNA attenuated PPE8-induced JNK phosphorylation and cytotoxicity. Prolonged JNK phosphorylation may be involved in PPE8-induced cytotoxicity. Such results did not arise in A549 cells, but p53 knockdown by siRNA restored PPE8-induced GRP78 expression and JNK phosphorylation. We offer a novel compound to induce ER stress and cytotoxicity in p53-deficient cancer cells, presenting an opportunity for treatment.

  12. p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells

    International Nuclear Information System (INIS)

    Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.


    The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC

  13. Harnessing the p53-PUMA Axis to Overcome DNA Damage Resistance in Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Xiaoguang Zhou


    Full Text Available Resistance to DNA damage–induced apoptosis is a hallmark of cancer and a major cause of treatment failure and lethal disease outcome. A tumor entity that is largely resistant to DNA-damaging therapies including chemo- or radiotherapy is renal cell carcinoma (RCC. This study was designed to explore the underlying molecular mechanisms of DNA damage resistance in RCC to develop strategies to resensitize tumor cells to DNA damage–induced apoptosis. Here, we show that apoptosis-resistant RCC cells have a disconnect between activation of p53 and upregulation of the downstream proapoptotic protein p53 upregulated modulator of apoptosis (PUMA. We demonstrate that this disconnect is not caused by gene-specific repression through CCCTC-binding factor (CTCF but instead by aberrant chromatin compaction. Treatment with an HDAC inhibitor was found to effectively reactivate PUMA expression on the mRNA and protein level and to revert resistance to DNA damage–induced cell death. Ectopic expression of PUMA was found to resensitize a panel of RCC cell lines to four different DNA-damaging agents tested. Remarkably, all RCC cell lines analyzed were wild-type for p53, and a knockdown was likewise able to sensitize RCC cells to acute genotoxic stress. Taken together, our results indicate that DNA damage resistance in RCC is reversible, involves the p53-PUMA axis, and is potentially targetable to improve the oncological outcomes of RCC patients.

  14. The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

    Directory of Open Access Journals (Sweden)

    Krzysztof Puszynski


    Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

  15. The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer. (United States)

    Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M


    We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. The expanding regulatory universe of p53 in gastrointestinal cancer. (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang


    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  17. p53 regulates cytoskeleton remodeling to suppress tumor progression. (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko


    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  18. Simplified approaches for the development of an ELISA to detect circulating autoantibodies to p53 in cancer patients

    Directory of Open Access Journals (Sweden)

    Tayapiwatana Chatchai


    Full Text Available Abstract Background The recognition that human tumors stimulate the production of autoantibodies has initiated the use of this immune response as serological markers for the early diagnosis and management of cancer. The enzyme-linked immunosorbent assay (ELISA is the most common method used in detecting autoantibodies, which involves coating the microtiter plate with the tumor associated antigen (TAA of interest and allowing serum antibodies to bind. The patient's sample is directly in contact with the coating antigen so the protein used for coating must be pure to avoid non-specific binding. In this study, a simplified method to selectively and specifically immobilize TAAs onto microtiter plates in order to detect circulating autoantibodies in cancer patients without prior purification process was described. Wild type full-length p53 protein was produced in fusion with biotin carboxyl carrier peptide (BCCP or hexahistidine [(His6] using pAK400 and pET15b(+ vectors, respectively. The recombinant p53 fusion protein produced was then subjected to react with either a commercial p53 monoclonal antibody (mAb or sera from lung cancer patients and healthy volunteers in an enzyme-linked immunosorbent assay (ELISA format. Results Both of the immobilized p53 fusion proteins as well as the purified (His6-p53 fusion protein had a similar dose response of detection to a commercial p53 mAb (DO7. When the biotinylated p53-BCCP fusion protein was used as an antigen to detect p53 autoantibodies in clinical samples, the result showed that human serum reacted strongly to avidin-coated microwell even in the absence of the biotinylated p53-BCCP fusion protein, thus compromised its ability to differentiate weakly positive sera from those that were negative. In contrast, the (His6-p53 protein immobilized directly onto Ni+ coated microplate was able to identify the p53 autoantibody positive serum. In addition, its reactivity to clinical serum samples highly correlated

  19. Activities of wildtype and mutant p53 in suppression of homologous recombination as measured by a retroviral vector system

    International Nuclear Information System (INIS)

    Lu Xiongbin; Lozano, Guillermina; Donehower, Lawrence A.


    DNA repair of double strand breaks, interstrand DNA cross-links, and other types of DNA damage utilizes the processes of homologous recombination and non-homologous end joining to repair the damage. Aberrant homologous recombination is likely to be responsible for a significant fraction of chromosomal deletions, duplications, and translocations that are observed in cancer cells. To facilitate measurement of homologous recombination frequencies in normal cells, mutant cells, and cancer cells, we have developed a high titer retroviral vector containing tandem repeats of mutant versions of a GFP-Zeocin resistance fusion gene and an intact neomycin resistance marker. Recombination between the tandem repeats regenerates a functional GFP-Zeo R marker that can be easily scored. This retroviral vector was used to assess homologous recombination frequencies in human cancer cells and rodent fibroblasts with differing dosages of wild type or mutant p53. Absence of wild type p53 stimulated spontaneous and ionizing radiation-induced homologous recombination, confirming previous studies. Moreover, p53 +/- mouse fibroblasts show elevated levels of homologous recombination compared to their p53 +/+ counterparts following retroviral vector infection, indicating that p53 is haploinsufficient for suppression of homologous recombination. Transfection of vector-containing p53 null Saos-2 cells with various human cancer-associated p53 mutants revealed that these altered p53 proteins retain some recombination suppression function despite being totally inactive for transcriptional transactivation. The retroviral vector utilized in these studies may be useful in performing recombination assays on a wide array of cell types, including those not readily transfected by normal vectors

  20. p53-Mediated Molecular Control of Autophagy in Tumor Cells

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic


    Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.

  1. Super p53 for Treatment of Ovarian Cancer (United States)


    System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14

  2. High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhihong CHEN


    Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

  3. G2-block after irradiation of cells with different p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Zoelzer, Friedo [University of South Bohemia in Ceske Budejovice, Department of Radiology, Toxicology and Civil Protection, Faculty of Health and Social Studies, Ceske Budejovice (Czech Republic); University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Jagetia, Ganesh [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Mizoram University, Department of Zoology, School of Life Sciences, Aizawl (India); Streffer, Christian [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany)


    Although it is clear that functional p53 is not required for radiation-induced G{sub 2} block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G{sub 2} compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G{sub 2} phase itself. We observed the movement of BrdU-labeled cells through G{sub 2} and M into G{sub 1}. From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G{sub 2} and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G{sub 2} and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G{sub 2} compartment alone is misleading when differences in the G{sub 2} block are investigated and that the G{sub 2} block itself is indeed independent of functional p53. (orig.) [German] Obwohl klar ist, dass ein funktionelles p53-Protein fuer die Ausbildung des strahleninduzierten G{sub 2}-Blocks nicht zwingend erforderlich ist, gibt es experimentelle Befunde, die nahe legen, dass p53 in diesem Zusammenhang doch eine gewisse Rolle spielt. Zum Beispiel bestaetigen wir hier fruehere Berichte, dass die Akkumulation von Zellen im G{sub 2}-Kompartiment bei p53-Mutanten deutlich spaeter nach Bestrahlung ihr Maximum erreicht als bei p53-Wildtypen. Es bleibt jedoch zu klaeren, ob dieser Unterschied seinen Grund in einem laengeren Block der G{sub 2}-Phase selbst hat. Beobachtet wurde die Bewegung von BrdU-markierten Zellen durch G{sub 2} und M nach G{sub 1}. Aus der zeitlichen Veraenderung des Anteils markierter Zellen im G{sub 1}-Kompartiment des naechsten Zellzyklus konnte die

  4. Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer

    Directory of Open Access Journals (Sweden)

    Wen-Cheng Chung


    Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.

  5. Influence of p53 (rs1625895 polymorphism in kidney transplant recipients

    Directory of Open Access Journals (Sweden)

    Negar Azarpira


    Full Text Available Reperfusion injury predisposes the kidney allograft to acute rejection. Apoptosis is a mechanism that results in graft injury, and TP53 is an important involved gene. To determine the association between single nucleotide polymorphism (SNP in the pro-apoptotic protein p53 (rs1625895 and acute rejection in renal transplants, we studied 100 recipients of kidney allografts and 100 healthy individuals served as controls. The polymorphism was determined by the polymerase chain reaction restriction-fragment length polymorphism (PCR-RFLP test. Overall, 31 recipients developed rejection. There was no difference in the genotype frequencies between the recipients and the controls. However, we found a difference of genotype and allele frequencies between recipients with and those without rejection. The WW genotype was more frequent in recipients with rejection. Although rejection is a complex immunologic event and functional importance of SNPs has not been confirmed yet, we suggest that wild type p53 may promote apoptosis during inflammation.

  6. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  7. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Renee


    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...

  8. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Rene


    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...

  9. The Hunger Games: p53 regulates metabolism upon serine starvation. (United States)

    Tavana, Omid; Gu, Wei


    Cancer cells reprogram their metabolism to support a high proliferative rate. A new study shows that, upon serine starvation, the tumor suppressor p53 activates p21 to shift metabolic flux from purine biosynthesis to glutathione production, which enhances cellular proliferation and viability by combating ROS (Maddocks et al., 2013). Copyright © 2013 Elsevier Inc. All rights reserved.

  10. The p53-MDM2 network: from oscillations to apoptosis

    Indian Academy of Sciences (India)


    Apoptosis; cancer; cell cycle; MDM2 overexpression; tumour suppressor .... model of the p53-MDM2 negative feedback loop included an .... MDM2 overexpression, when subjected to nutlin-3 treatment. Some aspects of the model are similar to those ... A family of proteases termed caspases .... Implications for therapy; Proc.

  11. Overexpression of p53 in Nigerian breast cancers and its ...

    African Journals Online (AJOL)

    This study sought to determine the expression of p53 protein as well as the relationship with oestrogen receptor (ER) and progesterone receptor (PR) proteins. Methodology: Formalin-fixed, paraffin-embedded tissue samples of diagnosed invasive breast cancer were obtained from the Department of Anatomic and ...

  12. p53 expression in colorectal carcinoma in relation to ...

    African Journals Online (AJOL)

    Haematoxylin and eosin stain was used for evaluation of histological types and degree of differentiation of the tumors. Topography of the tumors and demographic data were obtained from accompanying histological request forms. Results: Out of 109 patient\\'s tissue blocks that were studied, 61 cases (56%) expressed p53 ...

  13. Cellular inactivation of nitric oxide induces p53-dependent ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.

  14. Irradiation-injured brain tissues can self-renew in the absence of the pivotal tumor suppressor p53 in the medaka (Oryzias latipes) embryo

    International Nuclear Information System (INIS)

    Yasuda, Takako; Nagata, Kento; Igarashi, Kento; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi; Kimori, Yoshitaka


    The tumor suppressor protein, p53, plays pivotal roles in regulating apoptosis and proliferation in the embryonic and adult central nervous system (CNS) following neuronal injuries such as those induced by ionizing radiation. There is increasing evidence that p53 negatively regulates the self-renewal of neural stem cells in the adult murine brain; however, it is still unknown whether p53 is essential for self-renewal in the injured developing CNS. Previously, we demonstrated that the numbers of apoptotic cells in medaka (Oryzias latipes) embryos decreased in the absence of p53 at 12-24 h after irradiation with 10-Gy gamma rays. Here, we used histology to examine the later morphological development of the irradiated medaka brain. In p53-deficient larvae, the embryonic brain possessed similar vacuoles in the brain and retina, although the vacuoles were much smaller and fewer than those found in wild-type embryos. At the time of hatching (6 days after irradiation), no brain abnormality was observed. In contrast, severe disorganized neuronal arrangements were still present in the brain of irradiated wild-type embryos. Our present results demonstrated that self-renewal of the brain tissue completed faster in the absence of p53 than wild type at the time of hatching because p53 reduces the acute severe neural apoptosis induced by irradiation, suggesting that p53 is not essential for tissue self-renewal in developing brain. (author)

  15. Morphological Heterogeneity of p53 Positive and p53 Negative Nuclei in Breast Cancers Stratified by Clinicopathological Variables

    Directory of Open Access Journals (Sweden)

    Katrin Friedrich


    Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.

  16. Apoptosis in spermatogonia irradiated P53 null mice

    International Nuclear Information System (INIS)

    Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.


    Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after

  17. Use of a temperature-sensitive p53 mutant to evaluate mechanisms of 5-fluorodeoxyuridine-mediated radiosensitization

    International Nuclear Information System (INIS)

    Naida, J.D.; Davis, M.A.; Lawrence, T.S.


    Purpose/Objective: Evidence exists that fluorodeoxyuridine (FdUrd)-mediated radiosensitization occurs in HT29 human colon carcinoma cells (which are p53 mutant) when these cells progress past the G 1 /S boundary in the presence of the drug. It has been demonstrated that wild type p53 levels increase following fluoropyrimidine treatment and that G 1 arrest is associated with increased p53 levels. We hypothesized that the restoration of wild type p53 function might restore G 1 /S arrest after FdUrd treatment, and that this would prevent FdUrd-mediated radiosensitization. Similarly, we hypothesized that cells containing wild type p53 would not be radiosensitized by FdUrd. Materials and Methods: Two clones of HT29 human colon cancer cells (ts29-A and ts29-G) containing murine temperature-sensitive p53 were constructed using electroporation and Geneticin selection. Incubation of these cells at the permissive temperature of 32 deg. C produces wild type p53 function and at the non permissive temperature of 38 deg. C causes mutant p53 function. A G418 resistant control cell line was also constructed (HT29neo). Cells were incubated at either 32 deg. C or 38 deg. C for 24 hours prior to irradiation and with FdUrd (100 nM) or medium only during the last 14 hours of the temperature shift. To assess progression into S phase, single-parameter (propidium iodide (PI)) and two-parameter (PI and bromodeoxyuridine) flow cytometry were performed at the end of drug exposure. A standard clonogenic assay was used. Results: We found that when ts29-A and ts29-G cells were incubated at the non-permissive (inactive p53 conformation) temperature, they progressed into S phase following exposure to FdUrd and were radiosensitized (enhancement ratio 1.5) to a degree similar to that seen in parental HT29 cells. Cells incubated at the permissive (wild-type p53 conformation) temperature demonstrated G 1 arrest, S phase depletion, and G2 arrest. In addition, FdUrd-mediated radiosensitization was

  18. Vaccination with p53-peptide-pulsed dendritic cells, of patients with advanced breast cancer: report from a phase I study

    DEFF Research Database (Denmark)

    Svane, Inge Marie; Pedersen, Anders E; Johnsen, Hans E


    the treatment. In conclusion, the strategy for p53-DC vaccination seems safe and without toxicity. Furthermore, indications of both immunologic and clinical effect were found in heavily pretreated patients with advanced breast cancer. An independent clinical effect of repeated administration of DCs and IL-2 can......Peptides derived from over-expressed p53 protein are presented by class I MHC molecules and may act as tumour-associated epitopes. Due to the diversity of p53 mutations, immunogenic peptides representing wild-type sequences are preferable as a basis for a broad-spectrum p53-targeting cancer vaccine......) loaded with a cocktail of three wild-type and three modified p53 peptides are being analysed in six HLA-A2+ patients with progressive advanced breast cancer. Vaccinations were well tolerated and no toxicity was observed. Disease stabilisation was seen in two of six patients, one patient had a transient...

  19. Role for p53 in the Recovery of Transcription and Protection Against Apoptosis Induced by Ultraviolet Light

    Directory of Open Access Journals (Sweden)

    Bruce C. McKay


    Full Text Available We have previously suggested that the inhibition of RNA polymerase II-mediated transcription after exposure to UV light promotes the accumulation of p53 and the induction of apoptosis (Oncogene 13, 823–831. However, it was not clear whether p53 induction was contributing to apoptosis. Here we report that apoptosis is triggered at lower UV doses in p53-deficient Li-Fraumeni syndrome (LFS and human papillomavirus (HPV E6 expressing fibroblasts than in normal cells, suggesting that p53 can be protective against UVinduced apoptosis. There is no significant difference in the effect of UV-irradiation on the cell cycle distribution of normal and primary LFS fibroblasts. Importantly, the recovery of nascent mRNA synthesis in all p53-deficient fibroblasts is significantly impaired compared with control cells after exposure to relevant doses of UV light. Taken together, our results suggest that wild-type p53 can protect cells against UV-induced apoptosis by facilitating the recovery of transcription. Furthermore, we suggest that the capacity of cells to recover transcription after genotoxic damage is an important determinant of sensitivity to apoptosis.

  20. Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.

    Directory of Open Access Journals (Sweden)

    Mariell Pettersson

    Full Text Available The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2 via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.

  1. The structure formed by inverted repeats in p53 response elements determines the transactivation activity of p53 protein

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Čechová, Jana; Battistin, M.; Coufal, Jan; Jagelská, Eva; Raimondi, I.; Inga, A.


    Roč. 483, č. 1 (2017), s. 516-521 ISSN 0006-291X R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : tumor-suppressor p53 * cruciform structures * dna-conformation Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.466, year: 2016

  2. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation. (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji


    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura


    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  4. Delayed expression of apoptosis in X-irradiated human leukemic MOLT-4 cells transfected with mutant p53

    International Nuclear Information System (INIS)

    Nakano, Hisako; Yonekawa, Hiromichi; Shinohara, Kunio


    The effects of X-rays on cell survival, apoptosis, and long-term response in the development of cell death as measured by the dye exclusion test were studied in human leukemic MOLT-4 cells (p53 wild-type) stably transfected with a mutant p53 cDNA expression vector. Cell survival, as determined from colony-forming ability, was increased in an expression level dependent manner, but the increase was partial even with the highest-expressing clone (B3). This contrasts with the prior observation that cell death and apoptosis in B3 are completely inhibited at 24 h after irradiation with 1.8 Gy of X-rays. The examination of B3 cells incubated for longer than 24 h after X-irradiation showed a delay in the induction of cell death and apoptosis. Western blot analysis revealed that the time required to reach the highest level of wild-type p53 protein in B3 was longer than the time in MOLT-4 and that the p53 may be stabilized by the phosphorylation at Ser-15. These results suggest that the introduction of mutant p53 into MOLT-4 merely delays the development of apoptosis, during which the cells could repair the damage induced by X-rays, and results in the partial increase in cell survival. (author)

  5. Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

    International Nuclear Information System (INIS)

    Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang


    The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

  6. Significant difference in p53 and p21 protein immunoreactivity in HPV 16 positive and HPV negative breast carcinomas

    International Nuclear Information System (INIS)

    Hennig, E.M.; Norwegian Radium Hospital, Oslo; Kvinnsland, S.; Holm, R.; Nesland, J.M.


    Human papillomavirus (HPV) 16 has previously been found in 19/41 breast carcinomas (46%) in women with a history of HPV 16 positive CIN III lesions. There was no significant difference in distribution of histological subtypes, mean or median tumour diameter or number of regional lymph node metastases in the HPV positive and HPV negative breast carcinoma groups. P53, p21 and c-erbB-2 proteins were analyzed by immunohistochemistry in the HPV 16 positive and HPV negative breast carcinomas. There was a significant difference in p53 and p21 protein immunoreactivity between HPV 16 positive and HPV negative breast carcinomas (p=0.0091 and p=0.0040), with a significant less detectable p53 and p21 protein immunoreactivity in the HPV 16 positive cases. There was also a significant difference in the coexpression of p53/p21 between the HPV 16 positive and HPV 16 negative breast carcinomas (p=0.002). No significant difference in immunostaining for c-erbB-2 protein in the two groups was found (p=0.15), or for the coexpression of p53/c-erbB-2 (p=0.19). The significantly lower expression of p53 and p21 proteins in HPV 16 positive than in HPV 16 negative breast carcinomas supports the hypothesis of inactivation and degradation of wild-type p53 proteins by HPV 16 E6 and that p53 mutation is not necessary for transformation in the HPV 16 positive cases. (orig.)

  7. Differential effects of p53 on bystander phenotypes induced by gamma ray and high LET heavy ion radiation (United States)

    He, Mingyuan; Dong, Chen; Konishi, Teruaki; Tu, Wenzhi; Liu, Weili; Shiomi, Naoko; Kobayashi, Alisa; Uchihori, Yukio; Furusawa, Yoshiya; Hei, Tom K.; Dang, Bingrong; Shao, Chunlin


    High LET particle irradiation has several potential advantages over γ-rays such as p53-independent response. The purpose of this work is to disclose the effect of p53 on the bystander effect induced by different LET irradiations and underlying mechanism. Lymphocyte cells of TK6 (wild type p53) and HMy2.CIR (mutated p53) were exposed to either low or high LET irradiation, then their mitochondrial dysfunction and ROS generation were detected. The micronuclei (MN) induction in HL-7702 hepatocytes co-cultured with irradiated lymphocytes was also measured. It was found that the mitochondrial dysfunction, p66Shc activation, and intracellular ROS were enhanced in TK6 but not in HMy2.CIR cells after γ-ray irradiation, but all of them were increased in both cell lines after carbon and iron irradiation. Consistently, the bystander effect of MN formation in HL-7702 cells was only triggered by γ-irradiated TK6 cells but not by γ-irradiated HMy2.CIR cells. But this bystander effect was induced by both lymphocyte cell lines after heavy ion irradiation. PFT-μ, an inhibitor of p53, only partly inhibited ROS generation and bystander effect induced by 30 keV/μm carbon-irradiated TK6 cells but failed to suppress the bystander effect induced by the TK6 cells irradiated with either 70 keV/μm carbon or 180 keV/μm iron. The mitochondrial inhibitors of rotenone and oligomycin eliminated heavy ion induced ROS generation in TK6 and HMy2.CIR cells and hence diminished the bystander effect on HL-7702 cells. These results clearly demonstrate that the bystander effect is p53-dependent for low LET irradiation, but it is p53-independent for high LET irradiation which may be because of p53-independent ROS generation due to mitochondrial dysfunction.

  8. p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

    International Nuclear Information System (INIS)

    Willers, H.; Powell, S.N.; Dahm-Daphi, J.


    Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

  9. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer

    Directory of Open Access Journals (Sweden)

    Youfeng Shen


    Full Text Available Abstract Background Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Methods Transcription activator-like effector nucleases (TALENs were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. Results The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19 were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean

  10. Pu-erh Tea Inhibits Tumor Cell Growth by Down-Regulating Mutant p53 (United States)

    Zhao, Lanjun; Jia, Shuting; Tang, Wenru; Sheng, Jun; Luo, Ying


    Pu-erh tea is a kind of fermented tea with the incorporation of microorganisms’ metabolites. Unlike green tea, the chemical characteristics and bioactivities of Pu-erh tea are still not well understood. Using water extracts of Pu-erh tea, we analyzed the tumor cell growth inhibition activities on several genetically engineered mouse tumor cell lines. We found that at the concentration that did not affect wild type mouse embryo fibroblasts (MEFs) growth, Pu-erh tea extracts could inhibit tumor cell growth by down-regulated S phase and cause G1 or G2 arrest. Further study showed that Pu-erh tea extracts down-regulated the expression of mutant p53 in tumor cells at the protein level as well as mRNA level. The same concentration of Pu-erh tea solution did not cause p53 stabilization or activation of its downstream pathways in wild type cells. We also found that Pu-erh tea treatment could slightly down-regulate both HSP70 and HSP90 protein levels in tumor cells. These data revealed the action of Pu-erh tea on tumor cells and provided the possible mechanism for Pu-erh tea action, which explained its selectivity in inhibiting tumor cells without affecting wild type cells. Our data sheds light on the application of Pu-erh tea as an anti-tumor agent with low side effects. PMID:22174618

  11. p53 protects against genome instability following centriole duplication failure (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield


    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  12. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Ganapathy, Suthakar, E-mail: [Center for Drug Development, Northeastern University, Boston (United States); Li, Ping [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Fagman, Johan [The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Yu, Tianqi; Lafontant, Jean [Center for Drug Development, Northeastern University, Boston (United States); Zhang, Guojun [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); Chen, Changyan [Center for Drug Development, Northeastern University, Boston (United States); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden)


    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  13. Distinct pattern of p53 mutations in bladder cancer

    DEFF Research Database (Denmark)

    Spruck, C H; Rideout, W M; Olumi, A F


    A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...

  14. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    International Nuclear Information System (INIS)

    Ganapathy, Suthakar; Li, Ping; Fagman, Johan; Yu, Tianqi; Lafontant, Jean; Zhang, Guojun; Chen, Changyan


    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  15. COX-2 and p53 in human sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Cyr, Diane; Luce, Danièle


    The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...

  16. Super p53 for Treatment of Ovarian Cancer (United States)


    position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public...a lead construct. Technical skills gained in the proposal include cell culture , transfections, microscopy, apoptosis assays, transcriptional assays...experiments complete 100% (DOD) Specific Aim 2: Deliver super p53 DNA with advanced polymeric systems alone and in combination with CPTX first in vitro

  17. p53 and ARF: Unexpected players in autophagy


    Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.


    p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino...

  18. The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy

    International Nuclear Information System (INIS)

    Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.


    Background and purpose: Experimental studies have implicated the normal or 'wild type' p53 protein (i.e. WTp53) in the cellular response to ionizing radiation and other DNA damaging agents. Whether altered WTp53 protein function can lead to changes in cellular radiosensitivity and/or clinical radiocurability remains an area of ongoing study. In this review, we describe the potential implications of altered WTp53 protein function in normal and tumour cells as it relates to clinical radiotherapy, and describe novel treatment strategies designed to re-institute WTp53 protein function as a means of sensitizing cells to ionizing radiation. Methods and Materials: A number of experimental and clinical studies are critically reviewed with respect to the role of the p53 protein as a determinant of cellular oncogenesis, genomic stability, apoptosis, DNA repair and radioresponse in normal and transformed mammalian cells. Results: In normal fibroblasts, exposure to ionizing radiation leads to a G1 cell cycle delay (i.e. a 'G1 checkpoint') as a result of WTp53-mediated inhibition of G1-cyclin-kinase and retinoblastoma (pRb) protein function. The G1 checkpoint response is absent in tumour cells which express a mutant form of the p53 protein (i.e. MTp53), leading to acquired radioresistance in vitro. Depending on the cell type studied, this increase in cellular radiation survival can be mediated through decreased radiation-induced apoptosis, or altered kinetics of the radiation-induced G1 checkpoint. Recent biochemical studies support an indirect role for the p53 protein in both nucleotide excision and recombinational DNA repair pathways. However, based on clinicopathologic data, it remains unclear as to whether WTp53 protein function can predict for human tumour radiocurability and normal tissue radioresponse. Conclusions: Alterations in cell cycle control secondary to aberrant WTp53 protein function may be clinically significant if they lead to the acquisition of mutant

  19. Non-Canonical Cell Death Induced by p53

    Directory of Open Access Journals (Sweden)

    Atul Ranjan


    Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.

  20. Electrophoretic detection of protein p53 in human leukocytes

    International Nuclear Information System (INIS)

    Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.


    The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients

  1. Tumour suppression in skin and other tissues via cross-talk between vitamin D- and p53-signalling

    Directory of Open Access Journals (Sweden)

    Joerg eReichrath


    Full Text Available P53 and its family members have been implicated in the direct regulation of the vitamin D receptor (VDR. Vitamin D- and p53-signaling pathways have a significant impact on spontaneous or carcinogen-induced malignant transformation of cells, with VDR and p53 representing important tumour suppressors. VDR and the p53/p63/p73 proteins all function typically as receptors or sensors that turn into transcriptional regulators upon stimulus, with the main difference being that the nuclear VDR is activated as a transcription factor after binding its naturally occurring ligand 1,25-dihydroxyvitamin D with high affinity while the p53 family of transcription factors, mostly in the nucleoplasm, responds to a large number of alterations in cell homeostasis commonly referred to as stress. An increasing body of evidence now convincingly demonstrates a cross-talk between vitamin D- and p53-signaling that occurs at different levels, has genome-wide implications and that should be of high importance for many malignancies, including non-melanoma skin cancer. One interaction involves the ability of p53 to increase skin pigmentation via POMC derivatives including alpha-MSH and ACTH. Pigmentation protects the skin against UV-induced DNA damage and skin carcinogenesis, yet on the other hand reduces cutaneous synthesis of vitamin D. A second level of interaction may be through the ability of 1,25-dihydroxyvitamin D to increase the survival of skin cells after UV irradiation. UV irradiation-surviving cells show significant reductions in thymine dimers in the presence of 1,25-dihydroxyvitamin D that are associated with increased nuclear p53 protein expression, and significantly reduced NO products. A third level of interaction is documented by the ability of vitamin D compounds to regulate the expression of the murine double minute 2 (MDM2 gene in dependence of the presence of wild-type p53. MDM2 has a well established role as a key negative regulator of p53 activity

  2. The effects of combining ionizing radiation and adenovirus-mediated p53 gene transfer in human nasopharyngeal carcinoma cell lines

    International Nuclear Information System (INIS)

    Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry


    Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the

  3. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Monti, Paola; Fronza, Gilberto [Mutagenesis Unit, Istituto di Ricerca e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, 16132 Genoa (Italy); Pereira, Clara [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Saraiva, Lucília, E-mail: [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal)


    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.

  4. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    International Nuclear Information System (INIS)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana; Monti, Paola; Fronza, Gilberto; Pereira, Clara; Saraiva, Lucília


    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73

  5. Effect of the p53 gene status on the sensitivity of oral squamous cell carcinoma cells to boron neutron capture therapy

    International Nuclear Information System (INIS)

    Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.


    The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)

  6. The Role of Tumor Protein 53 Mutations in Common Human Cancers and Targeting the Murine Double Minute 2–P53 Interaction for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Tayebeh Hamzehloie


    Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.

  7. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong


    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  8. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    Directory of Open Access Journals (Sweden)

    Zanatta Daniela B


    p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53.

  9. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    International Nuclear Information System (INIS)

    Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E


    Arf and nutlin-3. To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53

  10. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX (United States)

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G


    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

  11. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX. (United States)

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G


    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

  12. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK

    International Nuclear Information System (INIS)

    Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi


    PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK

  13. Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

    Directory of Open Access Journals (Sweden)

    Ravshan Burikhanov


    Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

  14. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G


    Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches

  15. A systematic review of p53 regulation of oxidative stress in skeletal muscle. (United States)

    Beyfuss, Kaitlyn; Hood, David A


    p53 is a tumor suppressor protein involved in regulating a wide array of signaling pathways. The role of p53 in the cell is determined by the type of imposed oxidative stress, its intensity and duration. The last decade of research has unravelled a dual nature in the function of p53 in mediating the oxidative stress burden. However, this is dependent on the specific properties of the applied stress and thus requires further analysis. A systematic review was performed following an electronic search of Pubmed, Google Scholar, and ScienceDirect databases. Articles published in the English language between January 1, 1990 and March 1, 2017 were identified and isolated based on the analysis of p53 in skeletal muscle in both animal and cell culture models. Literature was categorized according to the modality of imposed oxidative stress including exercise, diet modification, exogenous oxidizing agents, tissue manipulation, irradiation, and hypoxia. With low to moderate levels of oxidative stress, p53 is involved in activating pathways that increase time for cell repair, such as cell cycle arrest and autophagy, to enhance cell survival. However, with greater levels of stress intensity and duration, such as with irradiation, hypoxia, and oxidizing agents, the role of p53 switches to facilitate increased cellular stress levels by initiating DNA fragmentation to induce apoptosis, thereby preventing aberrant cell proliferation. Current evidence confirms that p53 acts as a threshold regulator of cellular homeostasis. Therefore, within each modality, the intensity and duration are parameters of the oxidative stressor that must be analyzed to determine the role p53 plays in regulating signaling pathways to maintain cellular health and function in skeletal muscle. Acadl: acyl-CoA dehydrogenase, long chain; Acadm: acyl-CoA dehydrogenase, C-4 to C-12 straight chain; AIF: apoptosis-inducing factor; Akt: protein kinase B (PKB); AMPK: AMP-activated protein kinase; ATF-4: activating

  16. Effect of UV C irradiation on P53 in FADD+/+ and FADD-/- cells

    International Nuclear Information System (INIS)

    Matic, Igor; Radnic, Maja; Marijanovic, Inga; Furcic, Ivana; Nagy, Biserka


    not mutant-specific. Allele-specific PCR detection of P53 in genomic DNA from UV-irradiated knockout and wild type cells were analyzed by gel electrophoresis.The results indicated that the mutant-specific primers (154-155, 175-176 and 275) didn't amplified 119-, 55- and 134-base pair (bp) products, unexpectedly, from irradiated FADD +/+ and FADD -/- cell DNAs as well as expected from non-radiated FADD +/+ and FADD -/- cell DNAs. In contrast, the mutant-specific primer for codon 270 amplified 134-base pair product from irradiated from FADD +/+ and FADD -/- cell DNAs. Because FADD is required for elimination of UV-irradiated cells, its loss could inhibit apoptosis and lead to expansion of apoptosis defective cells that contain P53 mutations. The data presented here suggest that loss of FADD expression and loss of wild type P53 function due to mutations can inhibit apoptosis and lead to the expansion of UV carcinogenesis. (author)

  17. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka


    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  18. Characterization and Molecular Mechanism of Peptide-Conjugated Gold Nanoparticle Inhibiting p53-HDM2 Interaction in Retinoblastoma

    Directory of Open Access Journals (Sweden)

    Sushma Kalmodia


    Full Text Available Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB. Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs.

  19. The Inherited p53 Mutation in the Brazilian Population. (United States)

    Achatz, Maria Isabel; Zambetti, Gerard P


    A common criticism of studying rare diseases is the often-limited relevance of the findings to human health. Here, we review ∼15 years of research into an unusual germline TP53 mutation (p.R337H) that began with its detection in children with adrenocortical carcinoma (ACC), a remarkably rare childhood cancer that is associated with poor prognosis. We have come to learn that the p.R337H mutation exists at a very high frequency in Southern and Southeastern Brazil, occurring in one of 375 individuals within a total population of ∼100 million. Moreover, it has been determined that carriers of this founder mutation display variable tumor susceptibility, ranging from isolated cases of pediatric ACC to Li-Fraumeni or Li-Fraumeni-like (LFL) syndromes, thus representing a significant medical issue for this country. Studying the biochemical and molecular consequences of this mutation on p53 tumor-suppressor activity, as well as the putative additional genetic alterations that cooperate with this mutation, is advancing our understanding of how p53 functions in tumor suppression in general. These studies, which originated with a rare childhood tumor, are providing important information for guiding genetic counselors and physicians in treating their patients and are already providing clinical benefit. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  20. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos


    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  1. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner


    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  2. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik


    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  3. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    NARCIS (Netherlands)

    Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.


    Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,

  4. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome. (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E


    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. p53-dependent non-coding RNA networks in chronic lymphocytic leukemia

    NARCIS (Netherlands)

    Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.


    Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We

  6. p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer

    DEFF Research Database (Denmark)

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F


    The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....

  7. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.


    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  8. Cytogenetic damage, oncogenic transformation and p53 induction in human epithelial cells in response to irradiation (United States)

    Armitage, Mark

    Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or

  9. Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway (United States)

    Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.


    Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280

  10. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line. (United States)

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen


    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  11. Cytotoxic effects of replication-competent adenoviruses on human esophageal carcinoma are enhanced by forced p53 expression

    International Nuclear Information System (INIS)

    Yang, Shan; Kawamura, Kiyoko; Okamoto, Shinya; Yamauchi, Suguru; Shingyoji, Masato; Sekine, Ikuo; Kobayashi, Hiroshi; Tada, Yuji; Tatsumi, Koichiro; Hiroshima, Kenzo; Shimada, Hideaki; Tagawa, Masatoshi


    Improvement of transduction and augmentation of cytotoxicity are crucial for adenoviruses (Ad)-mediated gene therapy for cancer. Down-regulated expression of type 5 Ad (Ad5) receptors on human tumors hampered Ad-mediated transduction. Furthermore, a role of the p53 pathways in cytotoxicity mediated by replication-competent Ad remained uncharacterized. We constructed replication-competent Ad5 of which the E1 region genes were activated by a transcriptional regulatory region of the midkine or the survivin gene, which is expressed preferentially in human tumors. We also prepared replication-competent Ad5 which were regulated by the same region but had a fiber-knob region derived from serotype 35 (AdF35). We examined the cytotoxicity of these Ad and a possible combinatory use of the replication-competent AdF35 and Ad5 expressing the wild-type p53 gene (Ad5/p53) in esophageal carcinoma cells. Expression levels of molecules involved in cell death, anti-tumor effects in vivo and production of viral progenies were also investigated. Replication-competent AdF35 in general achieved greater cytotoxic effects to esophageal carcinoma cells than the corresponding replication-competent Ad5. Infection with the AdF35 induced cleavages of caspases and increased sub-G1 fractions, but did not activate the autophagy pathway. Transduction with Ad5/p53 in combination with the replication-competent AdF35 further enhanced the cytotoxicity in a synergistic manner. We also demonstrated the combinatory effects in an animal model. Transduction with Ad5/p53 however suppressed production of replication-competent AdF35 progenies, but the combination augmented Ad5/p53-mediated p53 expression levels and the downstream pathways. Combination of replication-competent AdF35 and Ad5/p53 achieved synergistic cytotoxicity due to enhanced p53-mediated apoptotic pathways. The online version of this article (doi:10.1186/s12885-015-1482-8) contains supplementary material, which is available to authorized

  12. The cooperative effect of p53 and Rb in local nanotherapy in a rabbit VX2 model of hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Dong S


    Full Text Available Shengli Dong,1 Qibin Tang,2 Miaoyun Long,3 Jian Guan,4 Lu Ye,5 Gaopeng Li6 1Department of General Surgery, The Second Hospital of Shanxi Medical University, Shanxi Medical University, Taiyuan, Shanxi Province, 2Department of Hepatobiliopancreatic Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, 3Department of Thyroid and Vascular Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, 4Department of Radiology, First Affiliated Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, 5Infection Department, Guangzhou No 8 Hospital, Guangzhou, Guangdong Province, 6Department of Ultrasound, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, People's Republic of China Background/aim: A local nanotherapy (LNT combining the therapeutic efficacy of trans-arterial embolization, nanoparticles, and p53 gene therapy has been previously presented. The study presented here aimed to further improve the incomplete tumor eradication and limited survival enhancement and to elucidate the molecular mechanism of the LNT. Methods: In a tumor-targeting manner, recombinant expressing plasmids harboring wild-type p53 and Rb were either co-transferred or transferred separately to rabbit hepatic VX2 tumors in a poly-L-lysine-modified hydroxyapatite nanoparticle nanoplex and Lipiodol® (Guerbet, Villepinte, France emulsion via the hepatic artery. Subsequent co-expression of p53 and Rb proteins within the treated tumors was investigated by Western blotting and in situ analysis by laser-scanning confocal microscopy. The therapeutic effect was evaluated by the tumor growth velocity, apoptosis and necrosis rates, their sensitivity to Adriamycin® (ADM, mitomycin C, and fluorouracil, the microvessel density of tumor tissue, and the survival time of animals. Eventually, real-time polymerase chain reaction and enhanced chemiluminescence Western blotting

  13. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation. (United States)

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D


    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  14. Identification of differentially expressed proteins in spontaneous thymic lymphomas from knockout mice with deletion of p53

    DEFF Research Database (Denmark)

    Honoré, Bent; Buus, Søren; Claësson, Mogens H


    ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two-dimensiona......ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two...... alpha type 3, transforming acidic coiled-coil containing protein 3, mitochondrial ornithine aminotransferase and epidermal fatty acid binding protein and down-regulation of adenylosuccinate synthetase, tubulin beta-3 chain, a 25 kDa actin fragment, proteasome subunit beta type 9, cofilin-1 and glia...

  15. Understanding the role of p53 in adaptive response to radiation-induced germline mutations

    International Nuclear Information System (INIS)

    Langlois, N.L.; Quinn, J.S.; Somers, C.M.; Boreham, D.R.; Mitchel, R.E.J.


    Full text: Radiation-induced adaptive response is now a widely studied area of radiation biology. Studies have demonstrated reduced levels of radiation-induced biological damage when an 'adaptive dose' is given before a higher 'challenge dose' compared to when the challenge dose is given alone. It has been shown in some systems to be a result of inducible cellular repair systems. The adaptive response has been clearly demonstrated in many model systems, however its impact on heritable effects in the mammalian germline has never been studied. Expanded Simple Tandem Repeat (ESTR) loci have been used as markers demonstrating that induced heritable mutations in mice follow a dose-response relationship. Recent data in our laboratory show preliminary evidence of radiation-induced adaptive response suppressing germline mutations at ESTR loci in wild type mice. The frequency of heritable mutations was significantly reduced when a priming dose of 0.1 Gy was given 24 hours prior to a 1 Gy acute challenging dose. We are now conducting a follow-up study to attempt to understand the mechanism of this adaptive response. P53 is known to play a significant role in governing apoptosis, DNA repair and cancer induction. In order to determine what function p53 has in the adaptive response for heritable mutations, we have mated radiation treated Trp53+/- male mice (C57Bl) to untreated, normal females (C57Bl). Using DNA fingerprinting, we are investigating the rate of inherited radiation-induced mutations on pre- and post-meiotic radiation-treated gametocytes by examining mutation frequencies in offspring DNA. If p53 is integral in the mechanism of adaptive response, we should not see an adaptive response in radiation-induced heritable mutations in these mice. This research is significant in that it will provide insight to understanding the mechanism behind radiation-induced adaptive response in the mammalian germline

  16. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.


    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  17. Activation of p53 by nutlin-3a induces apoptosis and cellular senescence in human glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Ruth Villalonga-Planells


    Full Text Available Glioblastoma multiforme (GBM is the most common and aggressive primary brain tumor in adults. Despite concerted efforts to improve current therapies and develop novel clinical approaches, patient survival remains poor. As such, increasing attention has focused on developing new therapeutic strategies that specifically target the apoptotic pathway in order to improve treatment responses. Recently, nutlins, small-molecule antagonists of MDM2, have been developed to inhibit p53-MDM2 interaction and activate p53 signaling in cancer cells. Glioma cell lines and primary cultured glioblastoma cells were treated with nutlin-3a. Nutlin-3a induced p53-dependent G1- and G2-M cell cycle arrest and apoptosis in glioma cell lines with normal TP53 status. In addition, nutlin-arrested glioma cells show morphological features of senescence and persistent induction of p21 protein. Furthermore, senescence induced by nutlin-3a might be depending on mTOR pathway activity. In wild-type TP53 primary cultured cells, exposure to nutlin-3a resulted in variable degrees of apoptosis as well as cellular features of senescence. Nutlin-3a-induced apoptosis and senescence were firmly dependent on the presence of functional p53, as revealed by the fact that glioblastoma cells with knockdown p53 with specific siRNA, or cells with mutated or functionally impaired p53 pathway, were completely insensitive to the drug. Finally, we also found that nutlin-3a increased response of glioma cells to radiation therapy. The results provide a basis for the rational use of MDM2 antagonists as a novel treatment option for glioblastoma patients.

  18. Expression of p53-regulated proteins in human cultured lymphoblastoid TSCE5 and WTK1 cell lines during spaceflight

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko


    The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)

  19. Reactivating p53 and Inducing Tumor Apoptosis (RITA Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin

    Directory of Open Access Journals (Sweden)

    Armin Wiegering


    Full Text Available Colorectal carcinoma (CRC is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n = 9 including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n = 5 with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC50< 3.0 μmol/l were identified within established (4/9 and primary patient-derived (2/5 CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number

  20. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells. (United States)

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E


    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  1. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)


    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  2. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer


    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  3. MiR-192-Mediated Positive Feedback Loop Controls the Robustness of Stress-Induced p53 Oscillations in Breast Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Richard Moore


    Full Text Available The p53 tumor suppressor protein plays a critical role in cellular stress and cancer prevention. A number of post-transcriptional regulators, termed microRNAs, are closely connected with the p53-mediated cellular networks. While the molecular interactions among p53 and microRNAs have emerged, a systems-level understanding of the regulatory mechanism and the role of microRNAs-forming feedback loops with the p53 core remains elusive. Here we have identified from literature that there exist three classes of microRNA-mediated feedback loops revolving around p53, all with the nature of positive feedback coincidentally. To explore the relationship between the cellular performance of p53 with the microRNA feedback pathways, we developed a mathematical model of the core p53-MDM2 module coupled with three microRNA-mediated positive feedback loops involving miR-192, miR-34a, and miR-29a. Simulations and bifurcation analysis in relationship to extrinsic noise reproduce the oscillatory behavior of p53 under DNA damage in single cells, and notably show that specific microRNA abrogation can disrupt the wild-type cellular phenotype when the ubiquitous cell-to-cell variability is taken into account. To assess these in silico results we conducted microRNA-perturbation experiments in MCF7 breast cancer cells. Time-lapse microscopy of cell-population behavior in response to DNA double-strand breaks, together with image classification of single-cell phenotypes across a population, confirmed that the cellular p53 oscillations are compromised after miR-192 perturbations, matching well with the model predictions. Our study via modeling in combination with quantitative experiments provides new evidence on the role of microRNA-mediated positive feedback loops in conferring robustness to the system performance of stress-induced response of p53.

  4. Conformational detection of p53's oligomeric state by FlAsH Fluorescence


    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.


    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...

  5. Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer. (United States)

    Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L


    The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.


    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H


    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  7. Exogenous PTHrP Repairs the Damaged Fracture Healing of PTHrP+/− Mice and Accelerates Fracture Healing of Wild Mice (United States)

    Wang, Yinhe; Fang, Xin; Wang, Chun; Ding, Congzhu; Lin, Hua; Liu, Anlong; Wang, Lei; Cao, Yang


    Bone fracture healing is a complicated physiological regenerative process initiated in response to injury and is similar to bone development. To demonstrate whether an exogenous supply of parathyroid hormone–related protein (PTHrP) helps in bone fracture healing, closed mid-diaphyseal femur fractures were created and stabilized with intramedullary pins in eight-week-old wild-type (WT) PTHrP+/+ and PTHrP+/− mice. After administering PTHrP for two weeks, callus tissue properties were analyzed at one, two, and four weeks post-fracture (PF) by various methods. Bone formation–related genes and protein expression levels were evaluated by real-time reverse transcriptase–polymerase chain reaction and Western blots. At two weeks PF, mineral density of callus, bony callus areas, mRNA levels of alkaline phosphatase (ALP), type I collagen, Runt-related transcription factor 2 (Runx-2), and protein levels of Runx-2 and insulin-like growth factor-1 decreased in PTHrP+/− mice compared with WT mice. At four weeks PF, total collagen-positive bony callus areas, osteoblast number, ALP-positive areas, and type I collagen-positive areas all decreased in PTHrP+/− mice. At both two and four weeks PF, tartrate-resistant acid phosphatase–positive osteoclast number and surface decreased a little in PTHrP+/− mice. The study indicates that exogenous PTHrP provided by subcutaneous injection could redress impaired bone fracture healing, leading to mutation of activated PTHrP by influencing callus areas, endochondral bone formation, osteoblastic bone formation, and bone turnover. PMID:28178186

  8. Exogenous PTHrP Repairs the Damaged Fracture Healing of PTHrP+/− Mice and Accelerates Fracture Healing of Wild Mice

    Directory of Open Access Journals (Sweden)

    Yinhe Wang


    Full Text Available Bone fracture healing is a complicated physiological regenerative process initiated in response to injury and is similar to bone development. To demonstrate whether an exogenous supply of parathyroid hormone–related protein (PTHrP helps in bone fracture healing, closed mid-diaphyseal femur fractures were created and stabilized with intramedullary pins in eight-week-old wild-type (WT PTHrP+/+ and PTHrP+/− mice. After administering PTHrP for two weeks, callus tissue properties were analyzed at one, two, and four weeks post-fracture (PF by various methods. Bone formation–related genes and protein expression levels were evaluated by real-time reverse transcriptase–polymerase chain reaction and Western blots. At two weeks PF, mineral density of callus, bony callus areas, mRNA levels of alkaline phosphatase (ALP, type I collagen, Runt-related transcription factor 2 (Runx-2, and protein levels of Runx-2 and insulin-like growth factor-1 decreased in PTHrP+/− mice compared with WT mice. At four weeks PF, total collagen-positive bony callus areas, osteoblast number, ALP-positive areas, and type I collagen-positive areas all decreased in PTHrP+/− mice. At both two and four weeks PF, tartrate-resistant acid phosphatase–positive osteoclast number and surface decreased a little in PTHrP+/− mice. The study indicates that exogenous PTHrP provided by subcutaneous injection could redress impaired bone fracture healing, leading to mutation of activated PTHrP by influencing callus areas, endochondral bone formation, osteoblastic bone formation, and bone turnover.

  9. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang


    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  10. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    International Nuclear Information System (INIS)

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.; Fu, Jian; Pinson, Barbara M.; Levin, Jeffrey; Shetty, Sreerama


    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acute and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of

  11. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.


    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  12. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)


    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  13. An adaptive molecular timer in p53-meidated cell fate decision (United States)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  14. The critical role of catalase in prooxidant and antioxidant function of p53 (United States)

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J


    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  15. Radioadaptive response and radiation-induced teratogenesis in the late period of organogenesis in mice. Involvement of p53-dependent apoptosis

    International Nuclear Information System (INIS)

    Wang, Bing; Ohyama, Harumi; Nose, Masako; Yukawa, Osami; Yamada, Takeshi; Hayata, Isamu


    In the past 5 years, a series of study was done at our institute to investigate radiation effects on the embryogenesis in mice with an emphasis on mechanisms involved in the radiation-induced adaptive response and the role of radiation-induced apoptosis played in teratogenesis in the late period of organogenesis. Using the limb bud system, we first found that radiation-induced apoptosis is involved in malformations, namely, radiation-induced apoptosis in the predigital regions of embryonic limb buds is responsible for digital defects in ICR mice. Examination of embryonic C57BL/6J mice with different p53 status led to further finding that susceptibility to the radiation-induced apoptosis and digital defects depends on both the p53 status and the radiation dose. p53 wild-type mice appeared to be the most sensitive, while p53 knockout mice were the most resistant. These results indicate that p53-dependent apoptosis mediates radiation-induced digital defects. The existence of a radioadaptive response in fetuses, i.e., the priming dose significantly decreases the apoptosis induction, prenatal death, and digital defects in the living fetuses induced by the challenging dose, was found first in ICR strain mice and later confirmed again in C57BL/6J mice. p53 heterozygous embryos did not show the radioadaptive response, indicating the involvement of p53 in the radioadaptive response. (author)

  16. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)


    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  17. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc


    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  18. Identification and characterization of small molecule inhibitors of the calcium-dependent S100B-p53 tumor suppressor interaction. (United States)

    Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J


    The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).

  19. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit


    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  20. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function (United States)

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.


    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  1. Neem oil limonoids induces p53-independent apoptosis and autophagy. (United States)

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan


    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.

  2. Neem oil limonoids induces p53-independent apoptosis and autophagy (United States)

    Chandra, Dhyan


    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  3. Structural Basis of Competitive Recognition of p53 and MDM2 by HAUSP/USP7: Implications for the Regulation of the p53-MDM2 Pathway.

    Directory of Open Access Journals (Sweden)


    Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.

  4. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  5. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  6. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats


    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  7. Isolation and characterization of DUSP11, a novel p53 target gene

    DEFF Research Database (Denmark)

    Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina


    target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

  8. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen


    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  9. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    NARCIS (Netherlands)

    Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.


    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent

  10. FGFR3 and P53 characterize alternative genetic pathways in the pathogenesis of urothelial cell carcinoma

    NARCIS (Netherlands)

    B.W. van Rhijn (Bas); Th.H. van der Kwast (Theo); A.N. Vis (André); W.J. Kirkels (Wim); E.R. Boeve; A.C. Jobsis; E.C. Zwarthoff (Ellen)


    textabstractFibroblast growth factor receptor 3 (FGFR3) and P53 mutations are frequently observed in bladder cancer. We here describe the distribution of FGFR3 mutations and P53 overexpression in 260 primary urothelial cell carcinomas. FGFR3 mutations were observed in 59% and P53

  11. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38. (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H


    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  12. Skp2B overexpression alters a prohibitin-p53 axis and the transcription of PAPP-A, the protease of insulin-like growth factor binding protein 4.

    Directory of Open Access Journals (Sweden)

    Harish Chander

    Full Text Available We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established.We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured.These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.

  13. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway. (United States)

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine


    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  14. IGFBP3 Promoter Methylation in Colorectal Cancer: Relationship with Microsatellite Instability, CpG Island Methylator Phenotype, p53

    Directory of Open Access Journals (Sweden)

    Takako Kawasaki


    Full Text Available Insulin-like growth factor binding protein 3 (IGFBP3, which is induced by wild-type p53, regulates IGF and interacts with the TGF-β pathway. IGFBP3 promoter methylation may occur in colorectal cancer with or without the CpG island methylator phenotype (CIMP, which is associated with microsatellite instability (MSI and TGFBR2 mutation. We examined the relationship between IGFBP3 methylation, p53 expression, CIMP and MSI in 902 population-based colorectal cancers. Utilizing real-time PCR (MethyLight, we quantified promoter methylation in IGFBP3 and eight other CIMP-high-specific promoters (CACNA1G, CDKN2A, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1. IGFBP3 methylation was far more frequent in non-MSI-high CIMP-high tumors (85% = 35/41 than in MSI-high CIMPhigh (49% = 44/90, P < .0001, MSI-high non-CIMP-high (17% = 6/36, P < .0001, non-MSI-high non-CIMP-high tumors (22% = 152/680, P < .0001. Among CIMPhigh tumors, the inverse relationship between MSI and IGFBP3 methylation persisted in p53-negative tumors (P < .0001, but not in p53-positive tumors. IGFBP3 methylation was associated inversely with TGFBR2 mutation in MSI-high non-CIMP-high tumors (P = .02. In conclusion, IGFBP3 methylation is inversely associated with MSI in CIMP-high colorectal cancers, this relationship is limited to p53-negative tumors. Our data suggest complex relationship between global genomic/epigenomic phenomena (such as MSI/ CIMP, single molecular events (e.g., IGFBP3 methylation, TP53 mutation, TGFBR2 mutation, the related pathways.

  15. G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1. (United States)

    Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi


    Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.

  16. Generation and characterization of p53 null transformed hepatic progenitor cells: oval cells give rise to hepatocellular carcinoma. (United States)

    Dumble, Melissa L; Croager, Emma J; Yeoh, George C T; Quail, Elizabeth A


    Oval cells are bipotential liver stem cells able to differentiate into hepatocytes and bile duct epithelia. In normal adult liver oval cells are quiescent, existing in low numbers around the periportal region, and proliferate following severe, prolonged liver trauma. There is evidence implicating oval cells in the development of hepatocellular carcinoma, and hence the availability of an immortalized oval cell line would be invaluable for the study of liver cell lineage differentiation and carcinogenesis. A novel approach in the generation of cell lines is the use of the p53 knockout mouse. Absence of p53 allows a cell to cycle past the normal Hayflick limit, rendering it immortalized, although subsequent genetic alterations are thought necessary for transformation. p53 knockout mice were fed a choline-deficient, ethionine-supplemented diet, previously shown to increase oval cell numbers in wild-type mice. The oval cells were isolated by centrifugal elutriation and maintained in culture. Colonies of hepatic cells were isolated and characterized with respect to phenotype, growth characteristics and tumorigenicity. Analysis of gene expression by Northern blotting and immunocytochemistry suggests they are oval-like cells by virtue of albumin and transferrin expression, as well as the oval cell markers alpha fetoprotein, M(2)-pyruvate kinase and A6. Injection into athymic nude mice shows the cell lines are capable of forming tumors which phenotypically resemble hepatocellular carcinoma. Thus, the use of p53 null hepatic cells successfully generated immortalized and tumorigenic hepatic stem cell lines. The results presented support the idea that deleting p53 allows immortalization and contributes to the transformation of the oval-like cell lines. Further, the tumorigenic status of the cell lines is direct evidence for the participation of oval cells in the formation of hepatocellular carcinoma.

  17. Modulation of the disordered conformational ensembles of the p53 transactivation domain by cancer-associated mutations.

    Directory of Open Access Journals (Sweden)

    Debabani Ganguly


    Full Text Available Intrinsically disordered proteins (IDPs are frequently associated with human diseases such as cancers, and about one-fourth of disease-associated missense mutations have been mapped into predicted disordered regions. Understanding how these mutations affect the structure-function relationship of IDPs is a formidable task that requires detailed characterization of the disordered conformational ensembles. Implicit solvent coupled with enhanced sampling has been proposed to provide a balance between accuracy and efficiency necessary for systematic and comparative assessments of the effects of mutations as well as post-translational modifications on IDP structure and interaction. Here, we utilize a recently developed replica exchange with guided annealing enhanced sampling technique to calculate well-converged atomistic conformational ensembles of the intrinsically disordered transactivation domain (TAD of tumor suppressor p53 and several cancer-associated mutants in implicit solvent. The simulations are critically assessed by quantitative comparisons with several types of experimental data that provide structural information on both secondary and tertiary levels. The results show that the calculated ensembles reproduce local structural features of wild-type p53-TAD and the effects of K24N mutation quantitatively. On the tertiary level, the simulated ensembles are overly compact, even though they appear to recapitulate the overall features of transient long-range contacts qualitatively. A key finding is that, while p53-TAD and its cancer mutants sample a similar set of conformational states, cancer mutants could introduce both local and long-range structural modulations to potentially perturb the balance of p53 binding to various regulatory proteins and further alter how this balance is regulated by multisite phosphorylation of p53-TAD. The current study clearly demonstrates the promise of atomistic simulations for detailed characterization of IDP

  18. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells. (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi


    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  19. Prognostic value of p53 in patients with muscle-invasive bladder cancer treated with preoperative radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Catherine S; Pollack, Alan; Czerniak, Bogdan A; Chyle, Valerian; Zagars, Gunar K; Dinney, Colin P; Benedict, William F


    Purpose/Objective: The overexpression of mutated and/or wild type p53 has been associated with poorer prognosis in patients with bladder cancer. However, most studies have involved a mixed patient population, including those with superficial and muscle-invasive disease, and some patients treated with adjuvant chemotherapy. In this study we examine the prognostic significance of p53 detected immunohistochemically in a cohort of patients with muscle-invasive transitional cell carcinoma of the bladder treated relatively uniformly with preoperative radiotherapy 4-6 weeks prior to radical cystectomy. Materials and Methods: Of 301 patients treated with preoperative radiotherapy (50 Gy in 25 fractions over 5 weeks) for muscle-invasive bladder cancer between 1960-1983, adequate material for immunohistochemical analysis of p53 was obtained in 107. Formalin-fixed paraffin-embedded archival tissue was stained using monoclonal anti-p53 antibody D01 (Oncogene Science, Manhasset, NY). The immunostaining of p53 was considered positive if greater than 20% of the tumor nuclei were stained. There were 82 men and 25 women with a mean age of 61 yr and no patient received neoadjuvant or adjuvant chemotherapy. All patients were without distant metastasis prior to treatment initiation. The median follow-up for those living (n=32) was 88 mo. The number of patients by clinical stage was 48 for T2, 30 for T3a, and 29 for T3b. Results: Overall, 46% of the patients were p53 positive, with 42% in Stage T2, 57% in Stage T3a, and 41% in Stage T3b. The distributions of potential patient prognostic factors by p53 positivity were investigated and the only association was with lymphatic-vascular invasion (p=0.04, chi-square). No correlation was seen between p53 staining and pathologic complete response (seen in 47%), clinical-to-pathologic downstaging (seen in 69%), clinical stage, tumor grade, tumor morphology, tumor number, tumor size, gender, patient age, pretreatment hemoglobin levels, BUN

  20. p53 expression in biopsies from children with Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik


    based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....

  1. Genomic alterations during p53-dependent apoptosis induced by γ-irradiation of Molt-4 leukemia cells.

    Directory of Open Access Journals (Sweden)

    Rouba Hage-Sleiman

    Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes

  2. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Widel, Maria, E-mail: [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)


    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  3. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    International Nuclear Information System (INIS)

    Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna


    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  4. The PRR11-SKA2 Bidirectional Transcription Unit Is Negatively Regulated by p53 through NF-Y in Lung Cancer Cells

    Directory of Open Access Journals (Sweden)

    Yitao Wang


    Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.

  5. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin. (United States)

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph


    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or

  6. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells. (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R


    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  7. Stimulation of autophagy by the p53 target gene Sestrin2. (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido


    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  8. Stabilization and activation of p53 are regulated independently by different phosphorylation events (United States)

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.


    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  9. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra


    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  10. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage. (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine


    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  11. Essentials in clinical application of p53 for tumors intervention-example of liver cancer

    International Nuclear Information System (INIS)

    Guan Yongsong; He Qing


    Recombinant human adenovirus p53 (Ad-p53)injection has been used for treating tumors in combination with several local therapeutic methods. Taking liver cancer as an example, this article introduces the combination of Ad-p53 in procedures of interventional therapy. Mechanisms of their effects are emphasized to pursue an optimal synergism in killing tumors. Intratumoral injection is suggested as the first choice of Ad- p53 administration with the least recommended dosage for a single tumor. The optimal time for intervention of liver cancer is supposed to be 2 to 5 days after the administration of Ad-p53. There are several theories on the therapeutic method taking p53 as a target, some of them are contradictional; therefore one has to select either activating or inhibiting the p53 pathway beforehand. For advanced malignancies, the selection should be cautious for appropriater cases from the proper candidates. (authors)

  12. Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline

    Directory of Open Access Journals (Sweden)

    Noriko Mori


    Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.

  13. Association of p53 protein expression with clinical outcome in advanced supraglottic cancer

    International Nuclear Information System (INIS)

    Kang, Jin Oh; Hong, Seong Eon


    To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression

  14. Inhibition of Endothelial p53 Improves Metabolic Abnormalities Related to Dietary Obesity

    Directory of Open Access Journals (Sweden)

    Masataka Yokoyama


    Full Text Available Accumulating evidence has suggested a role for p53 activation in various age-associated conditions. Here, we identified a crucial role of endothelial p53 activation in the regulation of glucose homeostasis. Endothelial expression of p53 was markedly upregulated when mice were fed a high-calorie diet. Disruption of endothelial p53 activation improved dietary inactivation of endothelial nitric oxide synthase that upregulated the expression of peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscle, thereby increasing mitochondrial biogenesis and oxygen consumption. Mice with endothelial cell-specific p53 deficiency fed a high-calorie diet showed improvement of insulin sensitivity and less fat accumulation, compared with control littermates. Conversely, upregulation of endothelial p53 caused metabolic abnormalities. These results indicate that inhibition of endothelial p53 could be a novel therapeutic target to block the vicious cycle of cardiovascular and metabolic abnormalities associated with obesity.

  15. Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.

    Directory of Open Access Journals (Sweden)

    Damiano Conte

    Full Text Available Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU. Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors.

  16. Wild-type p53 binds to MYC promoter G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie


    Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016

  17. Inhibition of autophagy as a treatment strategy for p53 wild-type acute myeloid leukemia

    NARCIS (Netherlands)

    Folkerts, Hendrik; Hilgendorf, Susan; Wierenga, Albertus T J; Jaques, Jennifer; Mulder, André B; Coffer, Paul J; Schuringa, Jan Jacob; Vellenga, Edo


    Here we have explored whether inhibition of autophagy can be used as a treatment strategy for acute myeloid leukemia (AML). Steady-state autophagy was measured in leukemic cell lines and primary human CD34(+) AML cells with a large variability in basal autophagy between AMLs observed. The autophagy

  18. Binding of mutant and wild type p53 proteins to supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Pivoňková, Hana; Walter, K.; Warnecke, Gabriele; Živanovic, Marko; Krstic, Dušan; Paleček, Emil; Deppert, W.; Fojta, Miroslav


    Roč. 3, č. 1 (2005), S4-S5 ISSN 1214-021X. [Cells VI - Biological Days /18./. 24.10.2005-26.10.2005, České Budějovice] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GA301/05/0416 Institutional research plan: CEZ:AV0Z50040507 Keywords : wtp53 * hot spot mutp53 * SCS binding Subject RIV: BO - Biophysics

  19. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters. (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva


    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Involvement of p53 Mutation and Mismatch Repair Proteins Dysregulation in NNK-Induced Malignant Transformation of Human Bronchial Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Ying Shen


    Full Text Available Genome integrity is essential for normal cellular functions and cell survival. Its instability can cause genetic aberrations and is considered as a hallmark of most cancers. To investigate the carcinogenesis process induced by tobacco-specific carcinogen NNK, we studied the dynamic changes of two important protectors of genome integrity, p53 and MMR system, in malignant transformation of human bronchial epithelial cells after NNK exposure. Our results showed that the expression of MLH1, one of the important MMR proteins, was decreased early and maintained the downregulation during the transformation in a histone modification involved and DNA methylation-independent manner. Another MMR protein PMS2 also displayed a declined expression while being in a later stage of transformation. Moreover, we conducted p53 mutation analysis and revealed a mutation at codon 273 which led to the replacement of arginine by histidine. With the mutation, DNA damage-induced activation of p53 was significantly impaired. We further reintroduced the wild-type p53 into the transformed cells, and the malignant proliferation can be abrogated by inducing cell cycle arrest and apoptosis. These findings indicate that p53 and MMR system play an important role in the initiation and progression of NNK-induced transformation, and p53 could be a potential therapeutic target for tobacco-related cancers.

  1. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  2. NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

    Directory of Open Access Journals (Sweden)

    Labhart Paul


    Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

  3. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    Directory of Open Access Journals (Sweden)

    Iva Simeonova


    Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.

  4. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri


    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  5. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex. (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua


    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  6. miR-34 and p53: New Insights into a Complex Functional Relationship.

    Directory of Open Access Journals (Sweden)

    Francisco Navarro

    Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

  7. A Novel In Vitro CypD-Mediated p53 Aggregation Assay Suggests a Model for Mitochondrial Permeability Transition by Chaperone Systems. (United States)

    Lebedev, Ivan; Nemajerova, Alice; Foda, Zachariah H; Kornaj, Maja; Tong, Michael; Moll, Ute M; Seeliger, Markus A


    Tissue necrosis as a consequence of ischemia-reperfusion injury and oxidative damage is a leading cause of permanent disability and death worldwide. The complete mechanism by which cells undergo necrosis upon oxidative stress is not understood. In response to an oxidative insult, wild-type p53 has been implicated as a central regulatory component of the mitochondrial permeability transition (mPT), triggering necrosis. This process is associated with cellular stabilization and translocation of p53 into the mitochondrial matrix. Here, we probe the mechanism by which p53 activates the key mPT regulator cyclophilin D (CypD). We explore the involvement of Trap1, an Hsp90-related mitochondrial matrix protein and a member of the mitochondrial unfolded protein response, and its ability to suppress mPT in a p53-dependent manner. Our study finds that catalytically active CypD causes strong aggregation of wild-type p53 protein (both full-length and isolated DNA-binding domain) into amyloid-type fibrils in vitro. The responsible CypD residues for this activity were mapped by NMR to the active site amino acids R55, F60, F113, and W121. The data also present a new proline isomerization assay for CypD by monitoring the aggregation of p53 as an indicator of CypD activity. Moreover, we find that the inhibition of Trap1 by the mitochondria-specific HSP90 ATPase antagonist Gamitrinib strongly sensitizes primary mouse embryonic fibroblasts to mPT and permeability transition pore opening in a p53- and CypD-dependent manner. We propose a mechanism by which the influx of unfolded p53 into the mitochondrial matrix in response to oxidative stress indirectly activates the normally inhibited CypD by displacing it from Trap1 complexes. This activates CypD's isomerase activity. Liberated CypD then isomerizes multiple proteins including p53 (causing p53 aggregation) and the structural components of the mPTP pore, inducing pore opening. This working model can now be tested in the future

  8. Radiation could induce p53-independent and cell cycle - unrelated apoptosis in 5-fluorouracil radiosensitized head and neck carcinoma cells

    International Nuclear Information System (INIS)

    Didelot, C.; Mirjolet, J.F.; Barberi-Heyob, M.; Ramacci, C.; Merlin, J.L.


    The effect of chemoresistance induction in radio sensitivity and cellular behavior after irradiation remains misunderstood. This study was designed to understand the relationship between radiation-induced cell cycle arrest, apoptosis, and radiosensitivity in KB cell line and KB3 subline selected after 5-fluorouracil (5FU) exposure. Exposure of KB cells to 5FU led to an increase in radiosensitivity. G 2 /M cell cycle arrest was observed in the two cell lines after irradiation. The radioresistant KB cell line reached the maximum arrest two hours before KB3. The cellular exit from this arrest was found to be related to the wild type p53 protein expression induction. After irradiation, only KB3 cell line underwent apoptosis. This apoptosis induction seemed to be independent of G 2 /M arrest exit, which was carried out later. The difference in radiosensitivity between KB and KB3 subline may result therefore from both a difference in apoptosis induction and a difference in G 2 /M arrest maximum duration. Moreover, 5FU exposure has led to an increase in constitutive p53 protein expression, which may be associated with an increase in basal apoptosis cell fraction. Given the existing correlation between radiosensitivity and the percentage of basal apoptosis. the constitutive p53 protein expression may be related to intrinsic radiosensitivity in our cellular model. (author)

  9. Increased Arf/p53 activity in stem cells, aging and cancer. (United States)

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander


    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  10. Functions of MDMX in the Modulation of the p53-Response

    Directory of Open Access Journals (Sweden)

    Kristiaan Lenos


    Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.

  11. The role of p53 in lung macrophages following exposure to a panel of manufactured nanomaterials

    DEFF Research Database (Denmark)

    Belade, Esther; Chrusciel, Sandra; Armand, Lucie


    is a key transcription factor implicated in cellular defence and reparative responses to various stress factors. Additionally, p53 has been implicated in cellular responses following exposure to some MNMs. Here, the role of the MNM mediated p53 induction and activation and its downstream effects following...... exposure to five well-characterised materials [namely two types of TiO2, two carbon black (CB), and one single-walled carbon nanotube (SWCNT)] were investigated. MNM internalisation, cellular viability, p53 protein induction and activation, oxidative stress, inflammation and apoptosis were measured...... in murine cell line and primary pulmonary macrophage models. It was observed that p53 was implicated in the biological responses to MNMs, with oxidative stress associated with p53 activation (only following exposure to the SWCNT). We demonstrate that p53 acted as an antioxidant and anti...

  12. The pro-survival function of p53 in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)


    The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

  13. Conserved CPEs in the p53 3' untranslated region influence mRNA stability and protein synthesis

    DEFF Research Database (Denmark)

    Rosenstierne, Maiken W; Vinther, Jeppe; Mittler, Gerhard


    CaT skin and MCF-7 breast cancer cell lines were established. Quantitative PCR and an enzymatic assay were used to quantify the reporter mRNA and protein levels, respectively. Proteins binding to the CPEs were identified by RNA-immunoprecipitation (IP) and quantitative mass spectroscopy. RESULTS: The wild...... irradiation. Several proteins (including GAPDH, heterogeneous nuclear ribonucleoprotein (hnRNP) D and A/B) were identified from the MCF-7 cytoplasmic extracts that bound specifically to the CPEs. CONCLUSION: Two conserved CPEs in the p53 3'UTR regulate stability and translation of a reporter mRNA in non...

  14. Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress

    International Nuclear Information System (INIS)

    Sakitani, Kosuke; Hirata, Yoshihiro; Hikiba, Yohko; Hayakawa, Yoku; Ihara, Sozaburo; Suzuki, Hirobumi; Suzuki, Nobumi; Serizawa, Takako; Kinoshita, Hiroto; Sakamoto, Kei; Nakagawa, Hayato; Tateishi, Keisuke; Maeda, Shin; Ikenoue, Tsuneo; Kawazu, Shoji; Koike, Kazuhiko


    Although some molecularly targeted drugs for colorectal cancer are used clinically and contribute to a better prognosis, the current median survival of advanced colorectal cancer patients is not sufficient. Autophagy, a basic cell survival mechanism mediated by recycling of cellular amino acids, plays an important role in cancer. Recently, autophagy has been highlighted as a promising new molecular target. The unfolded protein response (UPR) reportedly act in complementary fashion with autophagy in intestinal homeostasis. However, the roles of UPR in colon cancer under autophagic inhibition remain to be elucidated. We aim to clarify the inhibitory effect of autophagy on colon cancer. We crossed K19 CreERT and Atg5 flox/flox mice to generate Atg5 flox/flox /K19 CreERT mice. Atg5 flox/flox /K19 CreERT mice were first treated with azoxymethane/dextran sodium sulfate and then injected with tamoxifen to inhibit autophagy in CK19-positive epithelial cells. To examine the anti-cancer mechanisms of autophagic inhibition, we used colon cancer cell lines harboring different p53 gene statuses, as well as small interfering RNAs (siRNAs) targeting Atg5 and immunoglobulin heavy-chain binding protein (BiP), a chaperone to aid folding of unfolded proteins. Colon tumors in Atg5 flox/flox /K19 CreERT mice showed loss of autophagic activity and decreased tumor size (the total tumor diameter was 28.1 mm in the control and 20.7 mm in Atg5 flox/flox /K19 CreERT mice, p = 0.036). We found that p53 and UPR/endoplasmic reticulum (ER) stress-related proteins, such as cleaved caspase 3, and CAAT/enhancer-binding protein homologous protein, are up-regulated in colon tumors of Atg5 flox/flox /K19 CreERT mice. Although Atg5 and BiP silencing, respectively, increased apoptosis in p53 wild type cells, Atg5 silencing alone did not show the same effect on apoptosis in p53 mutant cells. However, co-transfection of Atg5 and BiP siRNAs led to increased apoptosis in p53 mutant cells. Blocking autophagy

  15. A case-control study on the combined effects of p53 and p73 polymorphisms on head and neck cancer risk in an Italian population

    International Nuclear Information System (INIS)

    Gallì, Paola; Boccia, Stefania; Cadoni, Gabriella; Volante, Mariangela; De Feo, Emma; Amore, Rosarita; Giorgio, Arianna; Arzani, Dario; Paludetti, Gaetano; Ricciardi, Gualtiero


    The purpose of this study is to analyze the combined effects of selected p53 and p73 polymorphisms and their interaction with lifestyle habits on squamous cell carcinoma of the head and neck (SCCHN) risk and progression in an Italian population. Two hundred and eighty-three cases and 295 hospital controls were genotyped for p53 polymorphisms on exon 4 (Arg72Pro), intron 3 and 6, and p73 G4C14-to-A4T14. Their association with SCCHN was estimated using a logistic regression analysis, while a multinomial logistic regression approach was applied to calculate the effect of the selected polymorphisms on SCCHN different sites (oral cavity, oropharynx, hypopharynx and larynx). We performed an haplotype analysis of the p53 polymorphisms, and a gene-gene interaction analysis for the combined effects of p73 G4C14-to-A4T14 and p53 polymorphisms. We found a significant increased risk of SCCHN among individuals with combined p73 exon 2 G4A and p53 intron 3 variant alleles (OR = 2.22, 95% CI: 1.08–4.56), and a protective effect for those carrying the p53 exon 4-p53 intron 6 diplotype combination (OR = 0.67; 95% CI: 0.47–0.92). From the gene-environment interaction analysis we found that individuals aged < 45 years carrying p73 exon 2 G4A variant allele have a 12.85-increased risk of SCCHN (95% CI: 2.10–78.74) compared with persons of the same age with the homozygous wild type genotype. Improved survival rate was observed among p53 intron 6 variant allele carriers (Hazard Ratio = 0.51 (95% CI: 0.23–1.16). Our study provides for the first time evidence that individuals carrying p53 exon 4 and p53 intron 6 variant alleles are significantly protected against SCCHN, and also shows that an additional risk is conferred by the combination of p73 exon 2 G4C14-to-A4T14 and p53 intron 3 variant allele. Larger studies are required to confirm these findings

  16. Distinct HIC1-SIRT1-p53 Loop Deregulation in Lung Squamous Carcinoma and Adenocarcinoma Patients

    Directory of Open Access Journals (Sweden)

    Ruo-Chia Tseng


    Full Text Available A HIC1-SIRT1-p53 circular loop in which hypermethylation in cancer 1 (HIC1 represses the transcription of SIRT1 that deacetylates and inactivates p53 thus leading to HIC1 inactivation has been identified in cell and animal models. However, the alteration and prognostic effects of HIC1-SIRT1-p53 circular loop have never been demonstrated in human cancer patients. We examine the HIC1-SIRT1-p53 alterations in 118 lung cancer patients to define their etiological roles in tumorigenesis. We found that patients with lung squamous cell carcinoma with low p53 acetylation and SIRT1 expression mostly showed low HIC1 expression, confirming deregulation of HIC1-SIRT1-p53 circular loop in the clinical model. Interestingly, the expression of deleted in breast cancer 1 (DBC1, which blocks the interaction between SIRT1 deacetylase and p53, led to acetylated p53 in patients with lung adenocarcinoma. However, epigenetic alteration of HIC1 promoter by posttranslational modifications of histones and promoter hypermethylation favoring the compacted chromatin production attenuated the transcriptional induction by acetylated p53. Importantly, lung cancer patients with altered HIC1-SIRT1-p53 circular regulation showed poor prognosis. Our data show the first valid clinical evidence of the deregulation of HIC1-SIRT1-p53 loop in lung tumorigenesis and prognosis. Distinct status of p53 acetylation/deacetylation and HIC1 alteration mechanism result from different SIRT1-DBC1 control and epigenetic alteration in lung squamous cell carcinoma and lung adenocarcinoma.

  17. Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer

    International Nuclear Information System (INIS)

    Fariña Sarasqueta, Arantza; Morreau, Hans; Forte, Giusi; Corver, Wim E; Miranda, Noel F de; Ruano, Dina; Eijk, Ronald van; Oosting, Jan; Tollenaar, Rob AEM; Wezel, Tom van


    p53 (encoded by TP53) is involved in DNA damage repair, cell cycle regulation, apoptosis, aging and cellular senescence. TP53 is mutated in around 50% of human cancers. Nevertheless, the consequences of p53 inactivation in colon cancer outcome remain unclear. Recently, a new role of p53 together with CSNK1A1 in colon cancer invasiveness has been described in mice. By combining data on different levels of p53 inactivation, we aimed to predict p53 functionality and to determine its effects on colon cancer outcome. Moreover, survival effects of CSNK1A1 together with p53 were also studied. Eighty-three formalin fixed paraffin embedded colon tumors were enriched for tumor cells using flow sorting, the extracted DNA was used in a custom SNP array to determine chr17p13-11 allelic state; p53 immunostaining, TP53 exons 5, 6, 7 and 8 mutations were determined in combination with mRNA expression analysis on frozen tissue. Patients with a predicted functional p53 had a better prognosis than patients with non functional p53 (Log Rank p=0.009). Expression of CSNK1A1 modified p53 survival effects. Patients with low CSNK1A1 expression and non-functional p53 had a very poor survival both in the univariate (Log Rank p<0.001) and in the multivariate survival analysis (HR=4.74 95% CI 1.45 – 15.3 p=0.009). The combination of mutational, genomic, protein and downstream transcriptional activity data predicted p53 functionality which is shown to have a prognostic effect on colon cancer patients. This effect was specifically modified by CSKN1A1 expression

  18. Stabilization and activation of p53 are regulated independently by different phosphorylation events


    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.


    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...

  19. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response


    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.


    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...

  20. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT (United States)

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.


    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxi