WorldWideScience

Sample records for exhibit increased surface

  1. Telomerase-Deficient Mice Exhibit Bone Loss Owing to Defects in Osteoblasts and Increased Osteoclastogenesis by Inflammatory Microenvironment

    DEFF Research Database (Denmark)

    Saeed, H.; Abdallah, B. M.; Ditzel, N.

    2011-01-01

    Telomere shortening owing to telomerase deficiency leads to accelerated senescence of human skeletal (mesenchymal) stem cells (MSCs) in vitro, whereas overexpression leads to telomere elongation, extended life span, and enhanced bone formation. To study the role of telomere shortening in vivo, we...... studied the phenotype of telomerase-deficient mice (Terc(-/-)).Terc(-/-) mice exhibited accelerated age-related bone loss starting at 3 months of age and during 12 months of follow-up revealed by dual-energy X-ray absorptiometric (DXA) scanning and by micro-computed tomography (mu CT). Bone...... histomorphometry revealed decreased mineralized surface and bone-formation rate as well as increased osteoclast number and size in Terc(-/-) mice. Also, serum total deoxypyridinoline (tDPD) was increased in Terc(-/-) mice. MSCs and osteoprogenitors isolated from Terc(-l-) mice exhibited intrinsic defects...

  2. Implementing Mobile Virtual Exhibition to Increase Cultural Heritage Visibility

    Directory of Open Access Journals (Sweden)

    Cristian CIUREA

    2014-01-01

    Full Text Available The paper presents an implementation of iOS mobile application designed as a virtual exhibition, which aims to increase the accessibility and visibility of physical objects that composite cultural heritage elements. Mobile technologies have seen a huge evolution in the last years and people are very attracted by smartphones, tablets and other mobile devices. Taking into consideration the impact of mobile technologies in all the activity fields, an important research objective is to analyze the influence of mobile applications designed as virtual exhibitions on cultural heritage promotion and on people cultural needs.

  3. Citrobacter amalonaticus phytase on the cell surface of Pichia pastoris exhibits high pH stability as a promising potential feed supplement.

    Science.gov (United States)

    Li, Cheng; Lin, Ying; Huang, Yuanyuan; Liu, Xiaoxiao; Liang, Shuli

    2014-01-01

    Phytase expressed and anchored on the cell surface of Pichia pastoris avoids the expensive and time-consuming steps of protein purification and separation. Furthermore, yeast cells with anchored phytase can be used as a whole-cell biocatalyst. In this study, the phytase gene of Citrobacter amalonaticus was fused with the Pichia pastoris glycosylphosphatidylinositol (GPI)-anchored glycoprotein homologue GCW61. Phytase exposed on the cell surface exhibits a high activity of 6413.5 U/g, with an optimal temperature of 60°C. In contrast to secreted phytase, which has an optimal pH of 5.0, phytase presented on the cell surface is characterized by an optimal pH of 3.0. Moreover, our data demonstrate that phytase anchored on the cell surface exhibits higher pH stability than its secreted counterpart. Interestingly, our in vitro digestion experiments demonstrate that phytase attached to the cell surface is a more efficient enzyme than secreted phytase.

  4. Novel processing of Barkhausen noise signal for assessment of residual stress in surface ground components exhibiting poor magnetic response

    International Nuclear Information System (INIS)

    Vashista, M.; Paul, S.

    2011-01-01

    The Barkhausen Noise Analysis (BNA) technique has been utilised to assess surface integrity of steels. But the BNA technique is not very successful in evaluating surface integrity of ground steels that exhibit poor micro-magnetic response. A new approach has been proposed for the processing of BN signal and two newly proposed parameters, namely 'count' and 'event', have been shown to correlate linearly with the residual stress upon grinding, with judicious choice of user defined 'threshold', even when the micro-magnetic response of the work material is poor. In the present study, residual stress induced upon conventional plunge surface grinding of hardened bearing steel has been investigated along with unhardened bearing steel for benchmarking. Moreover, similar correlation has been established, when primarily compressive stress is induced upon high speed grinding using cBN wheel with moderately deep cut suppressing the micro-magnetic response from the ground medium carbon steel as the work material. - Highlights: → The problem of work materials exhibiting poor BN response and poor Barkhausen Noise response is identified. → A novel signal processing strategy is introduced to address the issue of poor micro-magnetic response of some ferromagnetic material. → Potential of newly introduced BN parameters has been studied. → These two BN parameters exhibited linear correlation with residual stress for work material with poor micro-magnetic response.

  5. Increasing awareness and preparedness by an exhibition and studying the effect of visuals

    Science.gov (United States)

    Charrière, Marie; Bogaard, Thom; Malet, Jean-Philippe; Mostert, Erik

    2013-04-01

    Damages caused by natural hazards can be reduced not only by protection, management and intervention activities, but also by information and communication to improve awareness and preparedness of local communities and tourists. Risk communication is particularly crucial for mountainous areas, such as the Ubaye Valley (France), as they are affected by multiple hazards and are particularly sensitive to the potential effects of climate and socio-economic changes which may increase the risk associated with natural hazards significantly. An exhibition is a powerful tool to communicate with the general public. It allows1: (1) targeting specific audiences, (2) transmitting technical and scientific knowledge using a suitable language, (3) anchoring the collective memory of past events, (4) visualize and emotionalize the topic of natural hazards, (5) strengthening the communication between peers, and (6) highlighting local resources and knowledge. In addition to these theoretical advantages, an exhibition may fulfill the requirements of a community. In the Ubaye Valley (France), this tool was proposed by the stakeholders themselves to increase awareness and preparedness of the general public. To meet this demand, the exhibition was designed following three general topics: (1) the natural phenomena and their potential consequences on the elements at risk, (2) the management and protection measures (individual and collective) and (3) the evolution of events and knowledge throughout past up to the present and the anticipation of the future situations. Besides being a real risk communication practice, this exhibition will be the setting for an extensive research project studying the effect of the use of visualization tools on the awareness and preparedness of a community. A wide range of visuals (photos, videos, maps, models, animations, multimedia, etc.) will present many dimensions of locally occurring natural hazards and risk problems. The aim of the research is (1) to

  6. Increased Adhesion of Listeria monocytogenes Strains to Abiotic Surfaces under Cold Stress

    Directory of Open Access Journals (Sweden)

    Bo-Hyung Lee

    2017-11-01

    Full Text Available Food contamination by Listeria monocytogenes remains a major concern for some food processing chains, particularly for ready-to-eat foods, including processed foods. Bacterial adhesion on both biotic and abiotic surfaces is a source of contamination by pathogens that have become more tolerant or even persistent in food processing environments, including in the presence of adverse conditions such as cold and dehydration. The most distinct challenge that bacteria confront upon entry into food processing environments is the sudden downshift in temperature, and the resulting phenotypic effects are of interest. Crystal violet staining and the BioFilm Ring Test® were applied to assess the adhesion and biofilm formation of 22 listerial strains from different serogroups and origins under cold-stressed and cold-adapted conditions. The physicochemical properties of the bacterial surface were studied using the microbial adhesion to solvent technique. Scanning electron microscopy was performed to visualize cell morphology and biofilm structure. The results showed that adhesion to stainless-steel and polystyrene was increased by cold stress, whereas cold-adapted cells remained primarily in planktonic form. Bacterial cell surfaces exhibited electron-donating properties regardless of incubation temperature and became more hydrophilic as temperature decreased from 37 to 4°C. Moreover, the adhesion of cells grown at 4°C correlated with affinity for ethyl acetate, indicating the role of cell surface properties in adhesion.

  7. Lipid-based Transfection Reagents Exhibit Cryo-induced Increase in Transfection Efficiency

    Directory of Open Access Journals (Sweden)

    Helena Sork

    2016-01-01

    Full Text Available The advantages of lipid-based transfection reagents have permitted their widespread use in molecular biology and gene therapy. This study outlines the effect of cryo-manipulation of a cationic lipid-based formulation, Lipofectamine 2000, which, after being frozen and thawed, showed orders of magnitude higher plasmid delivery efficiency throughout eight different cell lines, without compromising cell viability. Increased transfection efficiency with the freeze-thawed reagent was also seen with 2'-O-methyl phosphorothioate oligonucleotide delivery and in a splice-correction assay. Most importantly, a log-scale improvement in gene delivery using the freeze-thawed reagent was seen in vivo. Using three different methods, we detected considerable differences in the polydispersity of the different nucleic acid complexes as well as observed a clear difference in their surface spreading and sedimentation, with the freeze-thawed ones displaying substantially higher rate of dispersion and deposition on the glass surface. This hitherto overlooked elevated potency of the freeze-thawed reagent facilitates the targeting of hard-to-transfect cells, accomplishes higher transfection rates, and decreases the overall amount of reagent needed for delivery. Additionally, as we also saw a slight increase in plasmid delivery using other freeze-thawed transfection reagents, we postulate that freeze-thawing might prove to be useful for an even wider variety of transfection reagents.

  8. Increased Tolerance to Heavy Metals Exhibited by Swarming Bacteria

    Science.gov (United States)

    Anyan, M.; Shrout, J. D.

    2014-12-01

    Pseudomonas aeruginosa is a ubiquitous, Gram-negative bacterium that utilizes several different modes of motility to colonize surfaces, including swarming, which is the coordinated movement of cells over surfaces in groups. Swarming facilitates surface colonization and biofilm development for P. aeruginosa, and it is known that swarming behavior is influenced by changes in nutrient composition and surface moisture. To understand the fate and cycling of heavy metals in the environment, it is important to understand the interaction and toxicity of these metals upon bacteria. While previous studies have shown surface-attached bacterial biofilms to be highly resistant to heavy metal toxicity, little is known about the influence of heavy metals upon surface motile bacteria and developing biofilms. Using a combination of laboratory assays we examined differences in bacterial behavior in response to two metals, Cd and Ni. We find that surface swarming bacteria are able to grow on 4x and 2.5x more Cd and Ni, respectively, than planktonic cells (i.e., test tube cultures). P. aeruginosa was able to swarm in the presence ≤0.051mM Ni and ≤0.045mM Cd. To investigate the bioavailability of metals to bacteria growing under our examined conditions, we separated cell and supernatant fractions of P. aeruginosa cultures, and used ICP-MS techniques to measure Cd and Ni sorption. A greater percentage of Cd than Ni was sorbed by both cells and supernatant (which contains rhamnolipid, a surfactant known to sorb some metals and improve swarming). While we show that cell products such as rhamnolipid bind heavy metals (as expected) and should limit metal bioavailability, our results suggest at least one additional mechanism (as yet undetermined) that promotes cell survival during swarming in the presence of these heavy metals.

  9. Cancer cells recovering from damage exhibit mitochondrial restructuring and increased aerobic glycolysis

    Energy Technology Data Exchange (ETDEWEB)

    Akakura, Shin; Ostrakhovitch, Elena; Sanokawa-Akakura, Reiko [Frontiers in Bioscience Research Institute in Aging and Cancer, University of California, Irvine, CA (United States); Tabibzadeh, Siamak, E-mail: fbs@bioscience.org [Frontiers in Bioscience Research Institute in Aging and Cancer, University of California, Irvine, CA (United States); Dept of Oncologic Radiology, University of California, Irvine, CA (United States)

    2014-06-13

    Highlights: • Some cancer cells recover from severe damage that causes cell death in majority of cells. • Damage-Recovered (DR) cancer cells show reduced mitochondria, mDNA and mitochondrial enzymes. • DR cells show increased aerobic glycolysis, ATP, cell proliferation, and resistance to damage. • DR cells recovered from in vivo damage also show increased glycolysis and proliferation rate. - Abstract: Instead of relying on mitochondrial oxidative phosphorylation, most cancer cells rely heavily on aerobic glycolysis, a phenomenon termed as “the Warburg effect”. We considered that this effect is a direct consequence of damage which persists in cancer cells that recover from damage. To this end, we studied glycolysis and rate of cell proliferation in cancer cells that recovered from severe damage. We show that in vitro Damage-Recovered (DR) cells exhibit mitochondrial structural remodeling, display Warburg effect, and show increased in vitro and in vivo proliferation and tolerance to damage. To test whether cancer cells derived from tumor microenvironment can show similar properties, we isolated Damage-Recovered (T{sup DR}) cells from tumors. We demonstrate that T{sup DR} cells also show increased aerobic glycolysis and a high proliferation rate. These findings show that Warburg effect and its consequences are induced in cancer cells that survive severe damage.

  10. Design and Fabrication of a Hybrid Superhydrophobic-Hydrophilic Surface That Exhibits Stable Dropwise Condensation.

    Science.gov (United States)

    Mondal, Bikash; Mac Giolla Eain, Marc; Xu, QianFeng; Egan, Vanessa M; Punch, Jeff; Lyons, Alan M

    2015-10-28

    Condensation of water vapor is an essential process in power generation, water collection, and thermal management. Dropwise condensation, where condensed droplets are removed from the surface before coalescing into a film, has been shown to increase the heat transfer efficiency and water collection ability of many surfaces. Numerous efforts have been made to create surfaces which can promote dropwise condensation, including superhydrophobic surfaces on which water droplets are highly mobile. However, the challenge with using such surfaces in condensing environments is that hydrophobic coatings can degrade and/or water droplets on superhydrophobic surfaces transition from the mobile Cassie to the wetted Wenzel state over time and condensation shifts to a less-effective filmwise mechanism. To meet the need for a heat-transfer surface that can maintain stable dropwise condensation, we designed and fabricated a hybrid superhydrophobic-hydrophilic surface. An array of hydrophilic needles, thermally connected to a heat sink, was forced through a robust superhydrophobic polymer film. Condensation occurs preferentially on the needle surface due to differences in wettability and temperature. As the droplet grows, the liquid drop on the needle remains in the Cassie state and does not wet the underlying superhydrophobic surface. The water collection rate on this surface was studied using different surface tilt angles, needle array pitch values, and needle heights. Water condensation rates on the hybrid surface were shown to be 4 times greater than for a planar copper surface and twice as large for silanized silicon or superhydrophobic surfaces without hydrophilic features. A convection-conduction heat transfer model was developed; predicted water condensation rates were in good agreement with experimental observations. This type of hybrid superhydrophobic-hydrophilic surface with a larger array of needles is low-cost, robust, and scalable and so could be used for heat

  11. Investigation of zones with increased ground surface gamma radiation

    International Nuclear Information System (INIS)

    Butkus, D.V.; Morkunas, G.S.; Styro, B.I.

    1989-01-01

    Measurements of the increased gamma radiation zones of soils were conducted in the South-Western part of the Litvinian. The shores of lakes in the north-eastern part of the Suduva high land were investigated. the maximum values of the gamma radiation dose rates were distributed along the lake shores at a distance of 1 m from the water surface, while farther than 1.5 m from it the dose rate was close to the natural value. The increased gamma radiation intensity zones on the ground surface were found only at the northern (Lake Reketija) or the western shore (other lakes under investigation). The highest values of the gamma radiation dose 200-600 μR/h (0.5-1.5 nGy/s) were observed in the comparatively small areas (up to several square metres). The gamma radiation intensity of soil surface increased strongly moving towards the point where the maximum intensity was obsered. 10 figs

  12. Lunar Surface Potential Increases during Terrestrial Bow Shock Traversals

    Science.gov (United States)

    Collier, Michael R.; Stubbs, Timothy J.; Hills, H. Kent; Halekas, Jasper; Farrell, William M.; Delory, Greg T.; Espley, Jared; Freeman, John W.; Vondrak, Richard R.; Kasper, Justin

    2009-01-01

    Since the Apollo era the electric potential of the Moon has been a subject of interest and debate. Deployed by three Apollo missions, Apollo 12, Apollo 14 and Apollo 15, the Suprathermal Ion Detector Experiment (SIDE) determined the sunlit lunar surface potential to be about +10 Volts using the energy spectra of lunar ionospheric thermal ions accelerated toward the Moon. We present an analysis of Apollo 14 SIDE "resonance" events that indicate the lunar surface potential increases when the Moon traverses the dawn bow shock. By analyzing Wind spacecraft crossings of the terrestrial bow shock at approximately this location and employing current balancing models of the lunar surface, we suggest causes for the increasing potential. Determining the origin of this phenomenon will improve our ability to predict the lunar surface potential in support of human exploration as well as provide models for the behavior of other airless bodies when they traverse similar features such as interplanetary shocks, both of which are goals of the NASA Lunar Science Institute's Dynamic Response of the Environment At the Moon (DREAM) team.

  13. Increased Surface Wind Speeds Follow Diminishing Arctic Sea Ice

    Science.gov (United States)

    Mioduszewski, J.; Vavrus, S. J.; Wang, M.; Holland, M. M.; Landrum, L.

    2017-12-01

    Projections of Arctic sea ice through the end of the 21st century indicate the likelihood of a strong reduction in ice area and thickness in all seasons, leading to a substantial thermodynamic influence on the overlying atmosphere. This is likely to have an effect on winds over the Arctic Basin, due to changes in atmospheric stability and/or baroclinicity. Prior research on future Arctic wind changes is limited and has focused mainly on the practical impacts on wave heights in certain seasons. Here we attempt to identify patterns and likely mechanisms responsible for surface wind changes in all seasons across the Arctic, particularly those associated with sea ice loss in the marginal ice zone. Sea level pressure, near-surface (10 m) and upper-air (850 hPa) wind speeds, and lower-level dynamic and thermodynamic variables from the Community Earth System Model Large Ensemble Project (CESM-LE) were analyzed for the periods 1971-2000 and 2071-2100 to facilitate comparison between a present-day and future climate. Mean near-surface wind speeds over the Arctic Ocean are projected to increase by late century in all seasons but especially during autumn and winter, when they strengthen by up to 50% locally. The most extreme wind speeds in the 90th percentile change even more, increasing in frequency by over 100%. The strengthened winds are closely linked to decreasing lower-tropospheric stability resulting from the loss of sea ice cover and consequent surface warming (locally over 20 ºC warmer in autumn and winter). A muted pattern of these future changes is simulated in CESM-LE historical runs from 1920-2005. The enhanced winds near the surface are mostly collocated with weaker winds above the boundary layer during autumn and winter, implying more vigorous vertical mixing and a drawdown of high-momentum air.The implications of stronger future winds include increased coastal hazards and the potential for a positive feedback with sea ice by generating higher winds and

  14. Surface Morphology and Hardness Analysis of TiCN Coated AA7075 Aluminium Alloy

    Science.gov (United States)

    Srinath, M. K.; Ganesha Prasad, M. S.

    2017-12-01

    Successful titanium carbonitride (TiCN) coating on AA7075 plates using the PVD technique depends upon many variables, including temperature, pressure, incident angle and energy of the reactive ions. Coated specimens have shown an increase in their surface hardness of 2.566 GPa. In this work, an attempt to further augment the surface hardness and understand its effects on the surface morphology was performed through heat treatments at 500°C for different duration of times. Specimen's heat treated at 500°C for 1 h exhibited a maximum surface hardness of 6.433 GPa, corresponding to an increase of 92.07%. The XRD results showed the presence of Al2Ti and AlTi3N and indicate the bond created between them. Unit cell lattice parameters in the XRD data are calculated using Bragg's law. The SEM images exhibit increasing crack sizes as the heat treatment time is increased. From the studies, the heat treatment duration can be optimized to 1 h, which exhibited an augmented surface hardness, as further increases in durations caused a drop in the surface hardness. The heat treatment effectively modified the surface hardness. Equations providing the relationships that temperature and time have with the reaction parameters are presented.

  15. Hydrodynamic Drag Force Measurement Of A Functionalized Surface Exhibiting Superhydrophobic Properties

    Science.gov (United States)

    2016-12-01

    hydrodynamic skin friction is greatly reduced and the water is said to slip over the air layer [12]. A number of direct numerical simulations ( DNS ) [13...practical means of reducing drag. It is therefore important to investigate materials where in the passive state exhibit the desired qualities of

  16. A Nanotube Surface Reinforced Graphite Fiber Exhibiting Significantly Enhanced Properties, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Nanotechnology which includes carbon nanotubes has the potential to produce materials that exhibit properties beyond those expected from conventional materials which...

  17. Mice lacking the kf-1 gene exhibit increased anxiety- but not despair-like behavior

    Directory of Open Access Journals (Sweden)

    Atsushi Tsujimura

    2008-09-01

    Full Text Available KF-1 was originally identified as a protein encoded by human gene with increased expression in the cerebral cortex of a patient with Alzheimer’s disease. In mouse brain, kf-1 mRNA is detected predominantly in the hippocampus and cerebellum, and kf-1 gene expression is elevated also in the frontal cortex of rats after chronic antidepressant treatments. KF-1 mediates E2-dependent ubiquitination and may modulate cellular protein levels as an E3 ubiquitin ligase, though its target proteins are not yet identified. To elucidate the role of kf-1 in the central nervous system, we generated kf-1 knockout mice by gene targeting, using Cre-lox recombination. The resulting kf-1−/− mice were normal and healthy in appearance. Behavioral analyses revealed that kf-1−/− mice showed significantly increased anxiety-like behavior compared with kf-1+/+ littermates in the light/dark transition and elevated plus maze tests; however, no significant differences were observed in exploratory locomotion using the open field test or in behavioral despair using the forced swim and tail suspension tests. These observations suggest that KF-1 suppresses selectively anxiety under physiological conditions probably through modulating protein levels of its unknown target(s. Interestingly, kf-1−/− mice exhibited significantly increased prepulse inhibition, which is usually reduced in human schizophrenic patients. Thus, the kf-1−/− mice provide a novel animal model for elucidating molecular mechanisms of psychiatric diseases such as anxiety/depression, and may be useful for screening novel anxiolytic/antidepressant compounds.

  18. Immersive Exhibitions

    DEFF Research Database (Denmark)

    Achiam, Marianne

    2015-01-01

    The immersive exhibition is a specialized exhibition genre in museums, which creates the illusion of time and place by representing key characteristics of a reference world and by integrating the visitor in this three-dimensionally reconstructed world (Mortensen 2010). A successful representation...... of the reference world depends on three criteria: whether the exhibition is staged as a coherent whole with all the displayed objects supporting the representation, whether the visitor is integrated as a component of the exhibition, and whether the content and message of the exhibition become dramatized...

  19. Bumblebees exhibit the memory spacing effect

    Science.gov (United States)

    Toda, Nicholas R. T.; Song, Jeremy; Nieh, James C.

    2009-10-01

    Associative learning is key to how bees recognize and return to rewarding floral resources. It thus plays a major role in pollinator floral constancy and plant gene flow. Honeybees are the primary model for pollinator associative learning, but bumblebees play an important ecological role in a wider range of habitats, and their associative learning abilities are less well understood. We assayed learning with the proboscis extension reflex (PER), using a novel method for restraining bees (capsules) designed to improve bumblebee learning. We present the first results demonstrating that bumblebees exhibit the memory spacing effect. They improve their associative learning of odor and nectar reward by exhibiting increased memory acquisition, a component of long-term memory formation, when the time interval between rewarding trials is increased. Bombus impatiens forager memory acquisition (average discrimination index values) improved by 129% and 65% at inter-trial intervals (ITI) of 5 and 3 min, respectively, as compared to an ITI of 1 min. Memory acquisition rate also increased with increasing ITI. Encapsulation significantly increases olfactory memory acquisition. Ten times more foragers exhibited at least one PER response during training in capsules as compared to traditional PER harnesses. Thus, a novel conditioning assay, encapsulation, enabled us to improve bumblebee-learning acquisition and demonstrate that spaced learning results in better memory consolidation. Such spaced learning likely plays a role in forming long-term memories of rewarding floral resources.

  20. Exhibit Engineering

    DEFF Research Database (Denmark)

    Mortensen, Marianne Foss

    Science museums define the objectives of their exhibitions in terms of visitor learning outcomes. Yet, exhibit designers lack theoretical and empirical research findings on which to base the creation of such educational environments. Here, this shortcoming is addressed through the development...... of tools and processes to guide the design of educational science exhibits. The guiding paradigm for this development is design-based research, which is characterised by an iterative cycle of design, enactment, and analysis. In the design phase, an educational intervention is planned and carried out based...... on the generation of theoretical ideas for exhibit design is offered in a fourth and parallel research undertaking, namely the application of the notion of cultural border-crossing to a hypothetical case of exhibit design....

  1. Increase of body surface temperature and blood flow by theanine

    International Nuclear Information System (INIS)

    Hasegawa, Takeo; Noguchi, Kenichi; Ando, Satoshi

    2002-01-01

    Suntheanine (Taiyo Kagaku Co.: Theanine) is the trade name for L-theanine which is a unique amino acid found almost solely in tea plants, responsible for the exotictaste of green tea. We investigated the effects of relate to relaxation, improves the taste of processed foods, radiation sensitization, and increase of body surface temperature in vivo study. The results of the present study confirmed, (1) Suntheanine is incorporated into the brain and induces the emission of α -waves an induced of relaxation. (2) Body surface temperature and blood flow on skin were increased after administration of Suntheanine. (3) There was effects of radiation sensitization in whole body irradiation of X-rays after Suntheanine IP injection on C3H mice. (4) Acute toxicity, subacute toxicity and mutagen testconfirm the safety Suntheanine in this study

  2. Offspring of prenatal IV nicotine exposure exhibit increased sensitivity to the reinforcing effects of methamphetamine

    Directory of Open Access Journals (Sweden)

    Steven Brown Harrod

    2012-06-01

    Full Text Available Maternal smoking during pregnancy is associated with increased substance abuse in offspring. Preclinical research shows that in utero exposure to nicotine, the primary psychoactive compound in tobacco smoke, influences the neurodevelopment of reward systems and alters motivated behavior in offspring. The present study determined if prenatal nicotine (PN exposure altered the sensitivity to the reinforcing and aversive effects of methamphetamine (METH in offspring using a low dose, intravenous (IV exposure method. Pregnant dams were administered nicotine (0.05 mg/kg/injection or prenatal saline (PS 3×/day on gestational days 8-21, and adult offspring were tested using METH self-administration (experiment 1 or METH-induced conditioned taste aversion (CTA; experiment 2 procedures. For METH self-administration, animals were trained to respond for IV METH (0.05 mg/kg/injection; fixed-ratio 3 and they were tested on varying doses the reinforcer (0.0005-1.0 mg/kg/injection. For METH CTA, rats received three saccharin and METH pairings (0, 0.3, or 0.5 mg/kg, sc followed by fourteen daily extinction trials. Experiment 1: PN and PS animals exhibited inverted U-shaped dose-response curves; however, the PN animal’s curve was shifted to the left, suggesting PN animals were more sensitive to the reinforcing effects of METH. Experiment 2: METH CTA was acquired in a dose-dependent manner and the factor of PN exposure was not related to the acquisition or extinction of METH-induced CTA. There were no sex differences in either experiment. These results indicate that adult offspring of IV PN exposure exhibited altered motivation for the reinforcing effects of METH. This suggests that PN exposure, via maternal smoking, will alter the reinforcing effects of METH during later stages of development, and furthermore, will influence substance use vulnerability in adult human offspring.

  3. Technology Exhibition

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1979-09-15

    Linked to the 25th Anniversary celebrations, an exhibition of some of CERN's technological achievements was opened on 22 June. Set up in a new 600 m{sup 2} Exhibition Hall on the CERN site, the exhibition is divided into eight technology areas — magnets, vacuum, computers and data handling, survey and alignment, radiation protection, beam monitoring and handling, detectors, and workshop techniques.

  4. Cancer-initiating cells derived from established cervical cell lines exhibit stem-cell markers and increased radioresistance

    International Nuclear Information System (INIS)

    López, Jacqueline; Poitevin, Adela; Mendoza-Martínez, Veverly; Pérez-Plasencia, Carlos; García-Carrancá, Alejandro

    2012-01-01

    Cancer-initiating cells (CICs) are proposed to be responsible for the generation of metastasis and resistance to therapy. Accumulating evidences indicates CICs are found among different human cancers and cell lines derived from them. Few studies address the characteristics of CICs in cervical cancer. We identify biological features of CICs from four of the best-know human cell lines from uterine cervix tumors. (HeLa, SiHa, Ca Ski, C-4 I). Cells were cultured as spheres under stem-cell conditions. Flow cytometry was used to detect expression of CD34, CD49f and CD133 antigens and Hoechst 33342 staining to identify side population (SP). Magnetic and fluorescence-activated cell sorting was applied to enrich and purify populations used to evaluate tumorigenicity in nude mice. cDNA microarray analysis and in vitro radioresistance assay were carried out under standard conditions. CICs, enriched as spheroids, were capable to generate reproducible tumor phenotypes in nu-nu mice and serial propagation. Injection of 1 × 10 3 dissociated spheroid cells induced tumors in the majority of animals, whereas injection of 1 × 10 5 monolayer cells remained nontumorigenic. Sphere-derived CICs expressed CD49f surface marker. Gene profiling analysis of HeLa and SiHa spheroid cells showed up-regulation of CICs markers characteristic of the female reproductive system. Importantly, epithelial to mesenchymal (EMT) transition-associated markers were found highly expressed in spheroid cells. More importantly, gene expression analysis indicated that genes required for radioresistance were also up-regulated, including components of the double-strand break (DSB) DNA repair machinery and the metabolism of reactive oxygen species (ROS). Dose-dependent radiation assay indicated indeed that CICs-enriched populations exhibit an increased resistance to ionizing radiation (IR). We characterized a self-renewing subpopulation of CICs found among four well known human cancer-derived cell lines (HeLa, Si

  5. Increased dose near the skin due to electromagnetic surface beacon transponder.

    Science.gov (United States)

    Ahn, Kang-Hyun; Manger, Ryan; Halpern, Howard J; Aydogan, Bulent

    2015-05-08

    The purpose of this study was to evaluate the increased dose near the skin from an electromagnetic surface beacon transponder, which is used for localization and tracking organ motion. The bolus effect due to the copper coil surface beacon was evaluated with radiographic film measurements and Monte Carlo simulations. Various beam incidence angles were evaluated for both 6 MV and 18 MV experimentally. We performed simulations using a general-purpose Monte Carlo code MCNPX (Monte Carlo N-Particle) to supplement the experimental data. We modeled the surface beacon geometry using the actual mass of the glass vial and copper coil placed in its L-shaped polyethylene terephthalate tubing casing. Film dosimetry measured factors of 2.2 and 3.0 enhancement in the surface dose for normally incident 6 MV and 18 MV beams, respectively. Although surface dose further increased with incidence angle, the relative contribution from the bolus effect was reduced at the oblique incidence. The enhancement factors were 1.5 and 1.8 for 6 MV and 18 MV, respectively, at an incidence angle of 60°. Monte Carlo simulation confirmed the experimental results and indicated that the epidermal skin dose can reach approximately 50% of the dose at dmax at normal incidence. The overall effect could be acceptable considering the skin dose enhancement is confined to a small area (~ 1 cm2), and can be further reduced by using an opposite beam technique. Further clinical studies are justified in order to study the dosimetric benefit versus possible cosmetic effects of the surface beacon. One such clinical situation would be intact breast radiation therapy, especially large-breasted women.

  6. SPECTRUM-DRIVEN PLANETARY DEGLACIATION DUE TO INCREASES IN STELLAR LUMINOSITY

    Energy Technology Data Exchange (ETDEWEB)

    Shields, Aomawa L.; Meadows, Victoria S. [Department of Astronomy and Astrobiology Program, University of Washington, Seattle, WA 98195 (United States); Bitz, Cecilia M. [Department of Atmospheric Sciences, University of Washington, Seattle, WA 98195 (United States); Joshi, Manoj M. [School of Environmental Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 7TJ (United Kingdom); Robinson, Tyler D., E-mail: aomawa@astro.washington.edu [NASA Ames Research Center, MS 245-3, Moffet Field, CA 94035 (United States)

    2014-04-10

    Distant planets in globally ice-covered, ''snowball'', states may depend on increases in their host stars' luminosity to become hospitable for surface life. Using a general circulation model, we simulated the equilibrium climate response of a planet to a range of instellations from an F-, G-, or M-dwarf star. The range of instellation that permits both complete ice cover and at least partially ice-free climate states is a measure of the climate hysteresis that a planet can exhibit. An ice-covered planet with high climate hysteresis would show a higher resistance to the initial loss of surface ice coverage with increases in instellation, and abrupt, extreme ice loss once deglaciation begins. Our simulations indicate that the climate hysteresis depends sensitively on the host star spectral energy distribution. Under fixed CO{sub 2} conditions, a planet orbiting an M-dwarf star exhibits a smaller climate hysteresis, requiring smaller instellation to initiate deglaciation than planets orbiting hotter, brighter stars. This is due to the higher absorption of near-infrared radiation by ice on the surfaces and greenhouse gases and clouds in the atmosphere of an M-dwarf planet. Increases in atmospheric CO{sub 2} further lower the climate hysteresis, as M-dwarf snowball planets exhibit a larger radiative response than G-dwarf snowball planets for the same increase in CO{sub 2}. For a smaller hysteresis, planets near the outer edge of the habitable zone will thaw earlier in their evolutionary history, and will experience a less abrupt transition out of global ice cover.

  7. 22nd Annual Logistics Conference and Exhibition

    Science.gov (United States)

    2006-04-20

    Bill” Kenwell, Vice President, Sales and Marketing, Maersk 5:30pm-7:30pm Reception in Exhibit Hall Wednesday, April 19, 2006 7:00am-5:30pm...some commercial sales of our products, services and platforms. We provide surface, air, and undersea applications on more than 460 programs for US...diagnostic system & process • Seamless B2B integration with maintenance systems Enabled By… EOATM Overview Sensor Data Maintenance Logs Repair Data Expert

  8. Increased Surface Roughness in Polydimethylsiloxane Films by Physical and Chemical Methods

    Directory of Open Access Journals (Sweden)

    Jorge Nicolás Cabrera

    2017-08-01

    Full Text Available Two methods, the first physical and the other chemical, were investigated to modify the surface roughness of polydimethylsiloxane (PDMS films. The physical method consisted of dispersing multi-walled carbon nanotubes (MWCNTs and magnetic cobalt ferrites (CoFe2O4 prior to thermal cross-linking, and curing the composite system in the presence of a uniform magnetic field H. The chemical method was based on exposing the films to bromine vapours and then UV-irradiating. The characterizing techniques included scanning electron microscopy (SEM, energy-dispersive spectroscopy (EDS, Fourier transform infrared (FTIR spectroscopy, optical microscopy, atomic force microscopy (AFM and magnetic force microscopy (MFM. The surface roughness was quantitatively analyzed by AFM. In the physical method, the random dispersion of MWCNTs (1% w/w and magnetic nanoparticles (2% w/w generated a roughness increase of about 200% (with respect to PDMS films without any treatment, but that change was 400% for films cured in the presence of H perpendicular to the surface. SEM, AFM and MFM showed that the magnetic particles always remained attached to the carbon nanotubes, and the effect on the roughness was interpreted as being due to a rupture of dispersion randomness and a possible induction of structuring in the direction of H. In the chemical method, the increase in roughness was even greater (1000%. Wells were generated with surface areas that were close to 100 μm2 and depths of up to 500 nm. The observations of AFM images and FTIR spectra were in agreement with the hypothesis of etching by Br radicals generated by UV on the polymer chains. Both methods induced important changes in the surface roughness (the chemical method generated the greatest changes due to the formation of surface wells, which are of great importance in superficial technological processes.

  9. Laser assisted decontamination of metal surface: Evidence of increased surface absorptivity due to field enhancement caused by transparent/semi-transparent contaminant particulates

    International Nuclear Information System (INIS)

    Nilaya, J. Padma; Biswas, Dhruba J.

    2010-01-01

    Small signal absorption measurements of the incident coherent radiation by the metal surface have revealed an increase in the absorption by the surface in presence of transparent/semi-transparent particulates on it. This effect, identified as field enhanced surface absorption, has been found to increase with reduction in the average particulate size. Consequently higher laser assisted removal efficiency of contamination from a metal surface has been observed for smaller contaminant particulates. These measurements have been carried out utilizing coherent radiations of two different wavelengths so chosen that for one the particulates are totally transparent while for the other they are partially transparent.

  10. Exhibition

    CERN Document Server

    Staff Association

    2017-01-01

    A Look of Hope Islam Mahmoud Sweity From 19 to 30 June 2017 CERN Meyrin, Main Building Islam Mahmoud Sweity Islam Mahmoud Sweity was born in 1997 at Beit Awwa, Palestine. She is currently following a course to get an Art diploma of Painting at the college of Fine Arts at An-Najah National University under the supervision of Esmat Al As'aad. Her portraits, landscapes and still life paintings are full of life and shining colours. Charged of emotional empathy they catch the attention of the viewer and are reminding us that life is beautiful and worth living in spite of all difficulties we have to go through. She participated in many exhibitions and has exposed her drawings in 2015 at CERN and in France in the framework of the exhibition "The Origin“, and in 2017 in the Former Yugoslav Republic of Macedonia, Palestina and Jordan. In this exhibition the oil paintings made in the past year will be presented. For more information : staff.association@cern.ch | T&eacu...

  11. Design of textured surfaces for super-hydrophobicity

    Indian Academy of Sciences (India)

    Prithvi Raj Jelia

    2017-11-11

    Nov 11, 2017 ... as silicon wafer [1, 10, 11]. Yoon et al [12] used a modified ... The explanation for the increase in the contact angle or hydrophobicity on the ... water droplets on super-hydrophobic surfaces that exhibit large contact angles are ...

  12. Exhibiting Epistemic Objects

    DEFF Research Database (Denmark)

    Tybjerg, Karin

    2017-01-01

    of exhibiting epistemic objects that utilize their knowledge-generating potential and allow them to continue to stimulate curiosity and generate knowledge in the exhibition. The epistemic potential of the objects can then be made to work together with the function of the exhibition as a knowledge-generating set...

  13. The Particular Aspects of Science Museum Exhibits That Encourage Students' Engagement

    Science.gov (United States)

    Shaby, Neta; Assaraf, Orit Ben-Zvi; Tal, Tali

    2017-06-01

    This research explores learning in science museums through the most common activity in a science museum—interaction with exhibits. The goal of this study was to characterize the learning behaviors exhibited by students as they engage with interactive exhibits in order to draw insight regarding the design of the exhibits. In order to do so, we used a qualitative method of observation as well as the Visitor Engagement Framework (VEF) model, a visitor-based framework for assessing visitors' learning experiences with exhibits in a science center setting. The combined method produced a framework of nine learning behaviors exhibited during the visitors' interaction with the exhibits, grouped into three categories that reflect increasing levels of engagement and depth of the learning experience. Our research participants consisted of a total 1800 students aged 10-12 (4th, 5th, and 6th graders) who came to the museum with their class for a day visit. We observed nine exhibits, each visited by 200 students. Our observations revealed several design elements that contribute to engagement with exhibits in science museums. For example, exhibits that have familiar activation encourage visitors' interaction, exhibits that facilitate social interaction are more likely to increase engagement, and the highest levels of engagement can be found in exhibits that support large groups.

  14. Molecular simulation insights on the in vacuo adsorption of amino acids on graphene oxide surfaces with varying surface oxygen densities

    Energy Technology Data Exchange (ETDEWEB)

    Rahmani, Farzin; Nouranian, Sasan, E-mail: sasan@olemiss.edu; Mahdavi, Mina [University of Mississippi, Department of Chemical Engineering (United States); Al-Ostaz, Ahmed [University of Mississippi, Department of Civil Engineering (United States)

    2016-11-15

    In this fundamental study, a series of molecular dynamics simulations were performed in vacuo to investigate the energetics and select geometries of 20 standard amino acids (AAs) on pristine graphene (PG) and graphene oxide (GO) surfaces as a function of graphene surface oxygen density. These interactions are of key interest to graphene/biomolecular systems. Our results indicate that aromatic AAs exhibit the strongest total interactions with the PG surfaces due to π-π stacking. Tryptophan (Trp) has the highest aromaticity due to its indole side chain and, hence, has the strongest interaction among all AAs (−16.66 kcal/mol). Aliphatic, polar, and charged AAs show various levels of affinity to the PG sheets depending on the strength of their side chain hydrophobic interactions. For example, arginine (Arg) with its guanidinium side chain exhibits the strongest interaction with the PG sheets (−13.81 kcal/mol) following aromatic AAs. Also, glycine (Gly; a polar AA) has the weakest interaction with the PG sheets (−7.29 kcal/mol). When oxygen-containing functional groups are added to the graphene sheets, the π-π stacking in aromatic AAs becomes disrupted and perfect parallelism of the aromatic rings is lost. Moreover, hydrogen bonding and/or electrostatic interactions become more pronounced. Charged AAs exhibit the strongest interactions with the GO surfaces. In general, the AA-GO interactions increase with increasing surface oxygen density, and the effect is more pronounced at higher O/C ratios. This study provides a quantitative measure of AA-graphene interactions for the design and tuning of biomolecular systems suitable for biosensing, drug delivery, and gene delivery applications.

  15. Effects of shrub and tree cover increase on the near-surface atmosphere in northern Fennoscandia

    Directory of Open Access Journals (Sweden)

    J. H. Rydsaa

    2017-09-01

    Full Text Available Increased shrub and tree cover in high latitudes is a widely observed response to climate change that can lead to positive feedbacks to the regional climate. In this study we evaluate the sensitivity of the near-surface atmosphere to a potential increase in shrub and tree cover in the northern Fennoscandia region. We have applied the Weather Research and Forecasting (WRF model with the Noah-UA land surface module in evaluating biophysical effects of increased shrub cover on the near-surface atmosphere at a fine resolution (5.4 km  ×  5.4 km. Perturbation experiments are performed in which we prescribe a gradual increase in taller vegetation in the alpine shrub and tree cover according to empirically established bioclimatic zones within the study region. We focus on the spring and summer atmospheric response. To evaluate the sensitivity of the atmospheric response to inter-annual variability in climate, simulations were conducted for two contrasting years, one warm and one cold. We find that shrub and tree cover increase leads to a general increase in near-surface temperatures, with the highest influence seen during the snowmelt season and a more moderate effect during summer. We find that the warming effect is stronger in taller vegetation types, with more complex canopies leading to decreases in the surface albedo. Counteracting effects include increased evapotranspiration, which can lead to increased cloud cover, precipitation, and snow cover. We find that the strength of the atmospheric feedback is sensitive to snow cover variations and to a lesser extent to summer temperatures. Our results show that the positive feedback to high-latitude warming induced by increased shrub and tree cover is a robust feature across inter-annual differences in meteorological conditions and will likely play an important role in land–atmosphere feedback processes in the future.

  16. DPPC Monolayers Exhibit an Additional Phase Transition at High Surface Pressure

    DEFF Research Database (Denmark)

    Shen, Chen; de la Serna, Jorge B.; Struth, Bernd

    2015-01-01

    Pulmonary surfactant forms a monolayer at the air/aqueous interface within the lung. During the breath process, the surface pressure (Π) periodically varies from ~40mN/m up to ~70mN/m. The film is mechanically stable during this rapid and reversible expansion. Pulmonary surfactant consists of ~90......% of lipid with 10% integrated proteins. Among its lipid compounds, di-palmitoyl-phosphatidylcholine (DPPC) dominates (~45wt%). DPPC is the only known lipid that can be compressed to very high surface pressure (~70mN/m) before its monolayer collapses. Most probably, this feature contributes to the mechanical...... stability of the alveoli monolayer. Still, to the best of our knowledge, some details of the compression isotherm presented here and the related structures of the DPPC monolayer were not studied so far. The liquid-expanded/liquid-condensed phase transition of the DPPC monolayer at ~10mN/m is well known...

  17. Increasing the reliability of the Olkiluoto surface and near-surface hydrological model

    International Nuclear Information System (INIS)

    Karvonen, T.

    2009-05-01

    the overburden during periods when supply (rainfall or snowmelt) to overburden is low but influence of water leaking to ONKALO disappears almost totally after rainy periods. Effect of ONKALO on pressure heads in the shallow bedrock drillholes is much more pronounced than in overburden tubes. However, the effect of ONKALO is almost totally reversible in all shallow bedrock drillholes when total inflow to ONKALO is at the present measured level (17-20 l/min or 25-30 m 3 /d). The results obtained from the surface hydrological model support the earlier geochemical and isotope measurements that there has been infiltration from the Korvensuo reservoir before the construction of ONKALO started. The computed results indicate that there has been at least a slight increase in estimated outflow rate from the Korvensuo reservoir after the construction of the ONKALO. (orig.)

  18. Rapid surface accumulation of NMDA receptors increases glutamatergic excitation during status epilepticus.

    Science.gov (United States)

    Naylor, David E; Liu, Hantao; Niquet, Jerome; Wasterlain, Claude G

    2013-06-01

    After 1h of lithium-pilocarpine status epilepticus (SE), immunocytochemical labeling of NMDA receptor NR1 subunits reveals relocation of subunits from the interior to the cell surface of dentate gyrus granule cells and CA3 pyramidal cells. Simultaneously, an increase in NMDA-miniature excitatory postsynaptic currents (mEPSC) as well as an increase in NMDA receptor-mediated tonic currents is observed in hippocampal slices after SE. Mean-variance analysis of NMDA-mEPSCs estimates that the number of functional postsynaptic NMDA receptors per synapse increases 38% during SE, and antagonism by ifenprodil suggests that an increase in the surface representation of NR2B-containing NMDA receptors is responsible for the augmentation of both the phasic and tonic excitatory currents with SE. These results provide a potential mechanism for an enhancement of glutamatergic excitation that maintains SE and may contribute to excitotoxic injury during SE. Therapies that directly antagonize NMDA receptors may be a useful therapeutic strategy during refractory SE. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Investigation of magnetic fluids exhibiting field-induced increasing loss peaks

    International Nuclear Information System (INIS)

    Fannin, P.C.; Marin, C.N.; Couper, C.

    2010-01-01

    A theoretical analysis to explain an increase of the Brownian loss peak with increasing polarizing field, H, in a magnetic fluid, is presented. The model is based on the competition between the Brownian and Neel relaxation processes. It is demonstrated that in magnetic fluids with particles having small anisotropy constant, small average magnetic diameter and narrow particle size distribution an increase of the Brownian loss peak with the polarizing field can be observed. The theoretical results are compared with the experimental results of an Isopar M-based magnetic fluid with magnetite particles stabilized with oleic acid and the model explains qualitatively the main characteristics of the experimental results.

  20. Sponsorship and exhibitions at Nordic science centres and museums

    DEFF Research Database (Denmark)

    Davidsson, Eva; Sørensen, Helene

    2010-01-01

    Science and technology centres (STC) and science museums tend increasingly to rely on external economic support in order to create new exhibitions. But in what ways may the economic situation affect what is presented in their exhibitions? This article aims to explore how staff members consider...

  1. The presentation of energy topics at exhibitions

    International Nuclear Information System (INIS)

    Moergeli, H.P.

    1984-01-01

    The author examines the problems confronting an electricity supply company when trying to communicate its energy policy to the general public at exhibitions and fairs. The company has to convey a message of reliable power supplies, increasing demand, the advantages of nuclear energy, the safe storage of radioactive waste and the need for new generating plants. The author describes some of the displays being used to attract the public to the Bern Power Stations stand at the Bern Exhibition 1984. (R.S.)

  2. Development of titanium alloys and surface treatments to increase the implants lifetime

    Directory of Open Access Journals (Sweden)

    Joan Lario-Femenía

    2016-12-01

    Full Text Available The population aging together with increase of life expectancy forces the development of new prosthesis which may present a higher useful life. The clinical success of implants is based on the osseointegration achievement. Therefore, metal implants must have a mechanical compatibility with the substituted bone, which is achieved through a combination of low elastic modulus, high flexural and fatigue strength. The improvement, in the short and long term, of the osseointegration depends on several factors, where the macroscopic design and dimensional, material and implant surface topography are of great importance. This article is focused on summarizing the advantages that present the titanium and its alloys to be used as biomaterials, and the development that they have suffered in recent decades to improve their biocompatibility. Consequently, the implants evolution has been recapitulated and summarized through three generations. In the recent years the interest on the surface treatments for metallic prostheses has been increased, the main objective is achieve a lasting integration between implant and bone tissue, in the shortest time possible. On this article various surface treatments currently used to modify the surface roughness or to obtain coatings are described it; it is worthy to mention the electrochemical oxidation with post-heat treated to modify the titanium oxide crystalline structure. After the literature review conducted for prepare this article, the ? titanium alloys, with a nanotubes surface of obtained by electrochemical oxidation and a subsequent step of heat treatment to obtain a crystalline structure are the future option to improve long term biocompatibility of titanium prostheses.

  3. Council Chamber exhibition

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    To complete the revamp of CERN’s Council Chamber, a new exhibition is being installed just in time for the June Council meetings.   Panels will showcase highlights of CERN’s history, using some of the content prepared for the exhibitions marking 50 years of the PS, which were displayed in the main building last November. The previous photo exhibition in the Council Chamber stopped at the 1970s. To avoid the new panels becoming quickly out of date, photos are grouped together around specific infrastructures, rather than following a classic time-line. “We have put the focus on the accelerators – the world-class facilities that CERN has been offering researchers over the years, from the well-known large colliders to the lesser-known smaller facilities,” says Emma Sanders, who worked on the content. The new exhibition will be featured in a future issue of the Bulletin with photos and an interview with Fabienne Marcastel, designer of the exhibit...

  4. Informing the Development of Science Exhibitions through Educational Research

    Science.gov (United States)

    Laherto, Antti

    2013-01-01

    This paper calls for greater use of educational research in the development of science exhibitions. During the past few decades, museums and science centres throughout the world have placed increasing emphasis on their educational function. Although exhibitions are the primary means of promoting visitors' learning, educational research is not…

  5. Significant increase of surface ozone at a rural site, north of eastern China

    Directory of Open Access Journals (Sweden)

    Z. Ma

    2016-03-01

    Full Text Available Ozone pollution in eastern China has become one of the top environmental issues. Quantifying the temporal trend of surface ozone helps to assess the impacts of the anthropogenic precursor reductions and the likely effects of emission control strategies implemented. In this paper, ozone data collected at the Shangdianzi (SDZ regional atmospheric background station from 2003 to 2015 are presented and analyzed to obtain the variation in the trend of surface ozone in the most polluted region of China, north of eastern China or the North China Plain. A modified Kolmogorov–Zurbenko (KZ filter method was performed on the maximum daily average 8 h (MDA8 concentrations of ozone to separate the contributions of different factors from the variation of surface ozone and remove the influence of meteorological fluctuations on surface ozone. Results reveal that the short-term, seasonal and long-term components of ozone account for 36.4, 57.6 and 2.2 % of the total variance, respectively. The long-term trend indicates that the MDA8 has undergone a significant increase in the period of 2003–2015, with an average rate of 1.13 ± 0.01 ppb year−1 (R2 = 0.92. It is found that meteorological factors did not significantly influence the long-term variation of ozone and the increase may be completely attributed to changes in emissions. Furthermore, there is no significant correlation between the long-term O3 and NO2 trends. This study suggests that emission changes in VOCs might have played a more important role in the observed increase of surface ozone at SDZ.

  6. Health-promoting properties exhibited by Lactobacillus helveticus strains.

    Science.gov (United States)

    Skrzypczak, Katarzyna; Gustaw, Waldemar; Waśko, Adam

    2015-01-01

    Many strains belonging to lactobacilli exert a variety of beneficial health effects in humans and some of the bacteria are regarded as probiotic microorganisms. Adherence and capabilities of colonization by Lactobacillus strains of the intestinal tract is a prerequisite for probiotic strains to exhibit desired functional properties. The analysis conducted here aimed at screening strains of Lactobacillus helveticus possessing a health-promoting potential. The molecular analysis performed, revealed the presence of a slpA gene encoding the surface S-layer protein SlpA (contributing to the immunostimulatory activity of L. helveticus M 92 probiotic strain) in all B734, DSM, T80, and T105 strains. The product of gene amplification was also identified in a Bifidobacterium animalis ssp. lactis BB12 probiotic strain. SDS-PAGE of a surface protein extract demonstrated the presence of a protein with a mass of about 50 kDa in all strains, which refers to the mass of the S-layer proteins. These results are confirmed by observations carried with transmission electron microscopy, where a clearly visible S-layer was registered in all the strains analyzed. The in vitro study results obtained indicate that the strongest adhesion capacity to epithelial cells (HT-29) was demonstrated by L. helveticus B734, while coaggregation with pathogens was highly diverse among the tested strains. The percentage degree of coaggregation was increasing with the incubation time. After 5 h of incubation, the strongest ability to coaggregate with Escherichia coli was expressed by T104. The T80 strain demonstrated a significant ability to co-aggregate with Staphylococcus aureus, while DSM with Bacillus subtilis. For B734, the highest values of co-aggregation coefficient was noted in samples with Salmonella. The capability of autoaggregation, antibiotic susceptibility, resistance to increasing salt concentrations, and strain survival in simulated small intestinal juice were also analyzed.

  7. STEM promotion through museum exhibits on cardiac monitoring & cardiac rhythm management.

    Science.gov (United States)

    Countryman, Jordan D; Dow, Douglas E

    2014-01-01

    Formal education in science, technology, engineering and math (STEM) does not successfully engage all of the students who have potential to become skilled in STEM activities and careers. Museum exhibits may be able to reach and engage a broader range of the public. STEM Exhibits that are both understandable and capture the imagination of viewers may contribute toward increased interest in STEM activities. One such topic for such an exhibit could be cardiac pacemakers and cardioverter defibrillators that sustain life. Although museums have existed for centuries, the available types of exhibit designs has dramatically increased in recent decades due to innovations in technology. Science and technology museums have especially taken advantage of the progression of exhibit design to developed new ways to communicate to their viewers. These novel presentation tools allow museums to more effectively convey to and engage viewers. This paper examines the techniques employed by museums in exhibits and considers the practices of several museums with exhibits related to cardiac monitoring (CM) and cardiac rhythm management (CRM).

  8. EXHIBITION: Accelerated Particles

    CERN Multimedia

    2004-01-01

    An exhibition of plastic arts and two evenings of performances by sound and visual artists as part of CERN's 50th anniversary celebrations. Fifty candles for CERN, an international laboratory renowned for fundamental research, is a cause for celebration. Since March this year, Geneva and neighbouring parts of France have been the venues for a wealth of small and large-scale events, which will continue until November. Given CERN's location in the commune of Meyrin, the ForuMeyrin is hosting exhibitions of plastic arts and performances entitled: Accelerated Particles. Several works will be exhibited and performed in two 'salons'. Salon des matières: An exhibition of plastic arts From Tues 12 October to Wed 3 November 2004 Tuesdays to Fridays: 16:00 to 19:00 Saturdays: 14:00 to 18:00 Exhibition open late on performance nights, entrance free Salon des particules: Musical and visual performances Tues 12 and Mon 25 October from 20:00 to 23:00 Preview evening for both events: Tues 12 October from 18:...

  9. Unimode metamaterials exhibiting negative linear compressibility and negative thermal expansion

    International Nuclear Information System (INIS)

    Dudek, Krzysztof K; Attard, Daphne; Caruana-Gauci, Roberto; Grima, Joseph N; Wojciechowski, Krzysztof W

    2016-01-01

    Unimode metamaterials made from rotating rigid triangles are analysed mathematically for their mechanical and thermal expansion properties. It is shown that these unimode systems exhibit positive Poisson’s ratios irrespective of size, shape and angle of aperture, with the Poisson’s ratio exhibiting giant values for certain conformations. When the Poisson’s ratio in one loading direction is larger than +1, the systems were found to exhibit the anomalous property of negative linear compressibility along this direction, that is, the systems expand in this direction when hydrostatically compressed. Also discussed are the thermal expansion properties of these systems under the assumption that the units exhibit increased rotational agitation once subjected to an increase in temperature. The effect of the geometric parameters on the aforementioned thermo-mechanical properties of the system, are discussed, with the aim of identifying negative behaviour. (paper)

  10. Variation on wettability of anodic zirconium oxide nanotube surface

    International Nuclear Information System (INIS)

    Wang, Lu-Ning; Shen, Chen; Shinbine, Alyssa; Luo, Jing-Li

    2013-01-01

    The present study reports the effect of fabrication conditions and environmental conditions, such as anodization voltage and aging period, on the wetting of zirconium dioxide nanotube (ZrNT) surfaces. Comparing with intact zirconium foil, which was inherently less hydrophilic, possessing an approximate contact angle of 60–70°, the as-formed ZrNT surfaces were much hydrophilic with an approximate contact angle of 18°. However, the hydrophilicity of the surfaces exhibited a decrease when the nanotubular opening diameters decreased while maintaining the nanotubular layer thickness. This phenomenon was attributed to the balance of capillary force and force generated by compressed air in the ZrNTs. The annealing treatment further increased the hydrophilic property of the ZrNTs. In addition, it was found that the wettability of ZrNTs, when aged in air over a period of 105 days, demonstrated a decrease in hydrophilic characteristics and exhibited, to some extent, an increase in hydrophobic characteristics. It was believed that the surface wettability was able to be changed due to the decreasing content of hydroxyl groups in ambient atmosphere. This work can provide guidelines for improving the structural and environmental conditions responsible for changing surface wettability of ZrNT surfaces for biomedical application. - Highlights: ► Wettability of zirconium oxide nanotubes (ZrNTs) was observed and characterized. ► Increasing of nanotubular diameter decreased the hydrophilicity of ZrNTs. ► Annealing processes enhanced the hydrophilicity of ZrNTs. ► Long term aging resulted in the hydrophobicity of ZrNTs

  11. Mechanical properties and fractal analysis of the surface texture of sputtered hydroxyapatite coatings

    International Nuclear Information System (INIS)

    Bramowicz, Miroslaw; Braic, Laurentiu; Azem, Funda Ak; Kulesza, Slawomir; Birlik, Isil; Vladescu, Alina

    2016-01-01

    Highlights: • Hydroxyapatite were prepared at temperatures in the range from 400 to 800 °C. • The coatings prepared at 800 °C is closer to the stoichiometric hydroxyapatite. • Hardness and elastic modulus decreased with increasing deposition temperature. • The surface morphology strongly depends on the deposition temperature. • Mesokurtic height distribution pulled towards larger heights were formed at high temperature. - Abstract: This aim of this work is to establish a relationship between the surface morphology and mechanical properties of hydroxyapatite coatings prepared using RF magnetron sputtering at temperatures in the range from 400 to 800 °C. The topography of the samples was scanned using atomic force microscopy, and the obtained 3D maps were analyzed using fractal methods to derive the spatial characteristics of the surfaces. X-ray photoelectron spectroscopy revealed the strong influence of the deposition temperature on the Ca/P ratio in the growing films. The coatings deposited at 600–800 °C exhibited a Ca/P ratio between 1.63 and 1.69, close to the stoichiometric hydroxyapatite (Ca/P = 1.67), which is crucial for proper osseointegration. Fourier-transform infrared spectroscopy showed that the intensity of phosphate absorption bands increased with increasing substrate temperature. Each sample exhibited well defined and sharp hydroxyapatite band at 566 cm"−"1, although more pronounced for the coatings deposited above 500 °C. Both the hardness and elastic modulus of the coated samples decrease with increasing deposition temperature. The surface morphology strongly depends on the deposition temperature. The sample deposited at 400 °C exhibits circular cavities dug in an otherwise flat surface. At higher deposition temperatures, these cavities increase in size and start to overlap each other so that at 500 °C the surface is composed of closely packed peaks and ridges. At that point, the characteristics of the surface turns from the

  12. Mechanical properties and fractal analysis of the surface texture of sputtered hydroxyapatite coatings

    Energy Technology Data Exchange (ETDEWEB)

    Bramowicz, Miroslaw [University of Warmia and Mazury in Olsztyn, Faculty of Technical Sciences, Oczapowskiego 11, 10-719 Olsztyn (Poland); Braic, Laurentiu [National Institute for Optoelectronics, 409 Atomistilor, 077125, Magurele (Romania); Azem, Funda Ak [Dokuz Eylul University, Engineering Faculty, Metallurgical and Materials Engineering Department, Tinaztepe Campus, 35397, Izmir (Turkey); Kulesza, Slawomir [University of Warmia and Mazury in Olsztyn, Faculty of Mathematics and Computer Science, Sloneczna 54, 10-710 Olsztyn (Poland); Birlik, Isil [Dokuz Eylul University, Engineering Faculty, Metallurgical and Materials Engineering Department, Tinaztepe Campus, 35397, Izmir (Turkey); Vladescu, Alina, E-mail: alinava@inoe.ro [National Institute for Optoelectronics, 409 Atomistilor, 077125, Magurele (Romania)

    2016-08-30

    Highlights: • Hydroxyapatite were prepared at temperatures in the range from 400 to 800 °C. • The coatings prepared at 800 °C is closer to the stoichiometric hydroxyapatite. • Hardness and elastic modulus decreased with increasing deposition temperature. • The surface morphology strongly depends on the deposition temperature. • Mesokurtic height distribution pulled towards larger heights were formed at high temperature. - Abstract: This aim of this work is to establish a relationship between the surface morphology and mechanical properties of hydroxyapatite coatings prepared using RF magnetron sputtering at temperatures in the range from 400 to 800 °C. The topography of the samples was scanned using atomic force microscopy, and the obtained 3D maps were analyzed using fractal methods to derive the spatial characteristics of the surfaces. X-ray photoelectron spectroscopy revealed the strong influence of the deposition temperature on the Ca/P ratio in the growing films. The coatings deposited at 600–800 °C exhibited a Ca/P ratio between 1.63 and 1.69, close to the stoichiometric hydroxyapatite (Ca/P = 1.67), which is crucial for proper osseointegration. Fourier-transform infrared spectroscopy showed that the intensity of phosphate absorption bands increased with increasing substrate temperature. Each sample exhibited well defined and sharp hydroxyapatite band at 566 cm{sup −1}, although more pronounced for the coatings deposited above 500 °C. Both the hardness and elastic modulus of the coated samples decrease with increasing deposition temperature. The surface morphology strongly depends on the deposition temperature. The sample deposited at 400 °C exhibits circular cavities dug in an otherwise flat surface. At higher deposition temperatures, these cavities increase in size and start to overlap each other so that at 500 °C the surface is composed of closely packed peaks and ridges. At that point, the characteristics of the surface turns from the

  13. Surface morphology and electronic structure of Ni/Ag(100)

    International Nuclear Information System (INIS)

    Hite, D. A.; Kizilkaya, O.; Sprunger, P. T.; Howard, M. M.; Ventrice, C. A. Jr.; Geisler, H.; Zehner, D. M.

    2000-01-01

    The growth morphology and electronic structure of Ni on Ag(100) has been studied with scanning tunneling microscopy (STM) and synchrotron based angle resolved photoemission spectroscopy. At deposition temperatures at or below 300 K, STM reveals Ni cluster growth on the surface along with some subsurface growth. Upon annealing to 420 K, virtually all Ni segregates into the subsurface region forming embedded nanoclusters. The electronic structure of Ni d bands in the unannealed surface shows dispersion only perpendicular to the surface whereas the annealed surface has Ni d bands that exhibit a three-dimensional-like structure. This is a result of the increased Ni d-Ag sp hybridization bonding and increased coordination of the embedded Ni nanoclusters. (c) 2000 American Vacuum Society

  14. Britain exhibition at CERN

    CERN Multimedia

    Bertin; CERN PhotoLab

    1969-01-01

    The United Kingdom inaugurated the Industrial Exhibitions in 1968, and it wasn't till 1971 that other countries staged exhibitions at CERN. This photo was taken in 1969, at the second British exhibition, where 16 companies were present.

  15. Superhydrophobic surfaces

    Science.gov (United States)

    Wang, Evelyn N; McCarthy, Matthew; Enright, Ryan; Culver, James N; Gerasopoulos, Konstantinos; Ghodssi, Reza

    2015-03-24

    Surfaces having a hierarchical structure--having features of both microscale and nanoscale dimensions--can exhibit superhydrophobic properties and advantageous condensation and heat transfer properties. The hierarchical surfaces can be fabricated using biological nanostructures, such as viruses as a self-assembled nanoscale template.

  16. Long-term studies on the effects of nonvolatile organic compounds on porous media surface areas.

    Science.gov (United States)

    Khachikian, Crist S; Harmon, Thomas C

    2002-01-01

    This paper investigates the long-term behavior of porous media contaminated by nonvolatile organic compounds (NVOC) in terms of specific interfacial surface area. Specifically, a natural sand, Moffett sand (MS), was contaminated with naphthalene and the surface area was measured repeatedly over time using nitrogen adsorption-desorption techniques. A field-contaminated sand affected by lamp-black material (LB) from former manufactured gas plant operations was also studied. Lampblack is a carbonaceous skeleton containing polycyclic aromatic hydrocarbons (PAHs) and other hydrocarbons. It is hypothesized that soils contaminated by these types of chemicals will exhibit significantly less surface area than their clean counterparts. The surface areas for the contaminated MS samples increased toward their clean-MS values during the 700-h aging period, but achieved the clean values only after pentane extraction or heating at 60 degrees C. Heating at 50 degrees C failed to achieve a similar recovery of the clean-MS surface area value. Nonspecific mass loss tracked the increase in surface area as indirect evidence that naphthalene loss was the cause of the surface area increase. For the LB samples, aging at 100 degrees C produced a slight decrease in surface area and mass while aging at 250 degrees C caused the surface area to increase roughly threefold while the mass decreased by approximately 1%. These results suggest that, under moderate heating and over the time scale of this investigation, there is a redistribution of the complex contaminant mixture on the solid matrix. Greater temperatures remove mass more efficiently and therefore exhibited the surface area increase expected in this experiment.

  17. An Interactive Exhibition about Animal Skeletons: Did the Visitors Learn Any Zoology?

    Science.gov (United States)

    Tunnicliffe, Sue Dale; Laterveer-de Beer, Manon

    2002-01-01

    Explores museum visitors' understanding of skeleton exhibits and whether such exhibits increase their understanding of the zoology displayed. The exhibition under study focused on the diversity of vertebrae skeletons which were arranged according to the mode of locomotion. (DDR)

  18. Environmental enrichment for a mixed-species nocturnal mammal exhibit.

    Science.gov (United States)

    Clark, Fay E; Melfi, Vicky A

    2012-01-01

    Environmental enrichment (EE) is an integral aspect of modern zoo animal management but, empirical evaluation of it is biased toward species housed in single-species groups. Nocturnal houses, where several nocturnal species are housed together, are particularly overlooked. This study investigated whether three species (nine-banded armadillos, Dasypus novemcinctus; Senegal bush babies, Galago senegalensis; two-toed sloths, Choloepus didactylus) in the nocturnal house at Paignton Zoo Environmental Park, UK could be enriched using food-based and sensory EE. Subjects were an adult male and female of each species. EE was deemed effective if it promoted target species-typical behaviors, behavioral diversity, and increased use of enriched exhibit zones. Results from generalized linear mixed models demonstrated that food-based EE elicited the most positive behavioral effects across species. One set of food-based EEs (Kong®, termite mound and hanging food) presented together was associated with a significant increase in species-typical behaviors, increased behavioral diversity, and increased use of enriched exhibit zones in armadillos and bush babies. Although one type of sensory EE (scented pine cones) increased overall exhibit use in all species, the other (rainforest sounds) was linked to a significant decrease in species-typical behavior in bush babies and sloths. There were no intra or interspecies conflicts over EE, and commensalism occurred between armadillos and bush babies. Our data demonstrate that simple food-based and sensory EE can promote positive behavioral changes in a mixed-species nocturnal mammal exhibit. We suggest that both food and sensory EE presented concurrently will maximize opportunities for naturalistic activity in all species. © 2011 Wiley Periodicals, Inc.

  19. Digital collections and exhibits

    CERN Document Server

    Denzer, Juan

    2015-01-01

    Today's libraries are taking advantage of cutting-edge technologies such as flat panel displays using touch, sound, and hands-free motions to design amazing exhibits using everything from simple computer hardware to advanced technologies such as the Microsoft Kinect. Libraries of all types are striving to add new interactive experiences for their patrons through exciting digital exhibits, both online and off. Digital Collections and Exhibits takes away the mystery of designing stunning digital exhibits to spotlight library trea

  20. Urbanization increased metal levels in lake surface sediment and catchment topsoil of waterscape parks

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hong-Bo [Key Laboratory of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China); Graduate University of Chinese Academy of Sciences, Beijing 100049 (China); Yu, Shen, E-mail: syu@iue.ac.cn [Key Laboratory of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China); Li, Gui-Lin [Key Laboratory of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China); Liu, Yi; Yu, Guang-Bin [Key Laboratory of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China); Graduate University of Chinese Academy of Sciences, Beijing 100049 (China); Deng, Hong [Department of Environmental Sciences, Tiantong National Station of Forest Ecosystem, Key Laboratory of Urbanization and Ecological Restoration, East China Normal University, Shanghai 200062 (China); Wu, Sheng-Chun [State Key Laboratory in Marine Pollution, Biology and Chemistry Department, City University of Hong Kong, Hong Kong (China); Wong, Ming-Hung [Croucher Institute for Environmental Sciences, Hong Kong Baptist University, Hong Kong (China)

    2012-08-15

    Lake surface sediment is mainly derived from topsoil in its catchment. We hypothesized that distribution of anthropogenic metals would be homogenous in lake surface sediment and the lake's catchment topsoil. Anthropogenic metal distributions (cadmium (Cd), copper (Cu), lead (Pb), and zinc (Zn)) in fourteen waterscape parks were investigated in surface sediments and catchment topsoils and possible source homogeneity was tested using stable Pb isotopic ratio analysis. The parks were located along an urbanization gradient consisting of suburban (SU), developing urban (DIU), developed urban (DDU), and central urban core (CUC) areas in Shanghai, China. Results indicated that surface lake sediments and catchment topsoils in the CUC parks were highly contaminated by the investigated anthropogenic metals. Total metal contents in surface sediment and topsoil gradually increased along the urbanization gradient from the SU to CUC areas. Generally, the surface sediments had greater total metal contents than their catchment topsoils. These results suggest that urbanization drives the anthropogenic metal enrichment in both surface sediment and its catchment topsoil in the waterscape parks. Soil fine particles (< 63 {mu}m) and surface sediments had similar enrichment ratios of metals, suggesting that surface runoff might act as a carrier for metals transporting from catchment to lake. Stable Pb isotope ratio analysis revealed that the major anthropogenic Pb source in surface sediment was coal combustion as in the catchment topsoil. Urbanization also correlated with chemical fractionation of metals in both surface sediment and catchment topsoil. From the SU to the CUC parks, amounts of labile metal fractions increased while the residual fraction of those metals remained rather constant. In short, urbanization in Shanghai drives anthropogenic metal distribution in environmental matrices and the sources were homogenous. -- Highlights: Black-Right-Pointing-Pointer Obvious

  1. Urbanization increased metal levels in lake surface sediment and catchment topsoil of waterscape parks

    International Nuclear Information System (INIS)

    Li, Hong-Bo; Yu, Shen; Li, Gui-Lin; Liu, Yi; Yu, Guang-Bin; Deng, Hong; Wu, Sheng-Chun; Wong, Ming-Hung

    2012-01-01

    Lake surface sediment is mainly derived from topsoil in its catchment. We hypothesized that distribution of anthropogenic metals would be homogenous in lake surface sediment and the lake's catchment topsoil. Anthropogenic metal distributions (cadmium (Cd), copper (Cu), lead (Pb), and zinc (Zn)) in fourteen waterscape parks were investigated in surface sediments and catchment topsoils and possible source homogeneity was tested using stable Pb isotopic ratio analysis. The parks were located along an urbanization gradient consisting of suburban (SU), developing urban (DIU), developed urban (DDU), and central urban core (CUC) areas in Shanghai, China. Results indicated that surface lake sediments and catchment topsoils in the CUC parks were highly contaminated by the investigated anthropogenic metals. Total metal contents in surface sediment and topsoil gradually increased along the urbanization gradient from the SU to CUC areas. Generally, the surface sediments had greater total metal contents than their catchment topsoils. These results suggest that urbanization drives the anthropogenic metal enrichment in both surface sediment and its catchment topsoil in the waterscape parks. Soil fine particles (< 63 μm) and surface sediments had similar enrichment ratios of metals, suggesting that surface runoff might act as a carrier for metals transporting from catchment to lake. Stable Pb isotope ratio analysis revealed that the major anthropogenic Pb source in surface sediment was coal combustion as in the catchment topsoil. Urbanization also correlated with chemical fractionation of metals in both surface sediment and catchment topsoil. From the SU to the CUC parks, amounts of labile metal fractions increased while the residual fraction of those metals remained rather constant. In short, urbanization in Shanghai drives anthropogenic metal distribution in environmental matrices and the sources were homogenous. -- Highlights: ► Obvious urbanization effect on metal

  2. Modern maize hybrids in Northeast China exhibit increased yield potential and resource use efficiency despite adverse climate change.

    Science.gov (United States)

    Chen, Xiaochao; Chen, Fanjun; Chen, Yanling; Gao, Qiang; Yang, Xiaoli; Yuan, Lixing; Zhang, Fusuo; Mi, Guohua

    2013-03-01

    The impact of global changes on food security is of serious concern. Breeding novel crop cultivars adaptable to climate change is one potential solution, but this approach requires an understanding of complex adaptive traits for climate-change conditions. In this study, plant growth, nitrogen (N) uptake, and yield in relation to climatic resource use efficiency of nine representative maize cultivars released between 1973 and 2000 in China were investigated in a 2-year field experiment under three N applications. The Hybrid-Maize model was used to simulate maize yield potential in the period from 1973 to 2011. During the past four decades, the total thermal time (growing degree days) increased whereas the total precipitation and sunshine hours decreased. This climate change led to a reduction of maize potential yield by an average of 12.9% across different hybrids. However, the potential yield of individual hybrids increased by 118.5 kg ha(-1)  yr(-1) with increasing year of release. From 1973 to 2000, the use efficiency of sunshine hours, thermal time, and precipitation resources increased by 37%, 40%, and 41%, respectively. The late developed hybrids showed less reduction in yield potential in current climate conditions than old cultivars, indicating some adaptation to new conditions. Since the mid-1990s, however, the yield impact of climate change exhibited little change, and even a slight worsening for new cultivars. Modern breeding increased ear fertility and grain-filling rate, and delayed leaf senescence without modification in net photosynthetic rate. The trade-off associated with delayed leaf senescence was decreased grain N concentration rather than increased plant N uptake, therefore N agronomic efficiency increased simultaneously. It is concluded that modern maize hybrids tolerate the climatic changes mainly by constitutively optimizing plant productivity. Maize breeding programs in the future should pay more attention to cope with the limiting

  3. Surface tension and density of Si-Ge melts

    Science.gov (United States)

    Ricci, Enrica; Amore, Stefano; Giuranno, Donatella; Novakovic, Rada; Tuissi, Ausonio; Sobczak, Natalia; Nowak, Rafal; Korpala, Bartłomiej; Bruzda, Grzegorz

    2014-06-01

    In this work, the surface tension and density of Si-Ge liquid alloys were determined by the pendant drop method. Over the range of measurements, both properties show a linear temperature dependence and a nonlinear concentration dependence. Indeed, the density decreases with increasing silicon content exhibiting positive deviation from ideality, while the surface tension increases and deviates negatively with respect to the ideal solution model. Taking into account the Si-Ge phase diagram, a simple lens type, the surface tension behavior of the Si-Ge liquid alloys was analyzed in the framework of the Quasi-Chemical Approximation for the Regular Solutions model. The new experimental results were compared with a few data available in the literature, obtained by the containerless method.

  4. Contribution of Adsorbed Protein Films to Nanoscopic Vibrations Exhibited by Bacteria Adhering through Ligand-Receptor Bonds

    NARCIS (Netherlands)

    Song, Lei; Sjollema, Jelmer; Norde, Willem; Busscher, Henk J.; van der Mei, Henny C.

    2015-01-01

    Bacteria adhering to surfaces exhibit nanoscopic vibrations that depend on the viscoelasticity of the bond. The quantification of the nanoscopic vibrations of bacteria adhering to surfaces provides new opportunities to better understand the properties of the bond through which bacteria adhere and

  5. Increase of porosity by combining semi-carbonization and KOH activation of formaldehyde resins to prepare high surface area carbons for supercapacitor applications

    Science.gov (United States)

    Heimböckel, Ruben; Kraas, Sebastian; Hoffmann, Frank; Fröba, Michael

    2018-01-01

    A series of porous carbon samples were prepared by combining a semi-carbonization process of acidic polymerized phenol-formaldehyde resins and a following chemical activation with KOH used in different ratios to increase specific surface area, micropore content and pore sizes of the carbons which is favourable for supercapacitor applications. Samples were characterized by nitrogen physisorption, powder X-ray diffraction, Raman spectroscopy and scanning electron microscopy. The results show that the amount of KOH, combined with the semi-carbonization step had a remarkable effect on the specific surface area (up to SBET: 3595 m2 g-1 and SDFT: 2551 m2 g-1), pore volume (0.60-2.62 cm3 g-1) and pore sizes (up to 3.5 nm). The carbons were tested as electrode materials for electrochemical double layer capacitors (EDLC) in a two electrode setup with tetraethylammonium tetrafluoroborate in acetonitrile as electrolyte. The prepared carbon material with the largest surface area, pore volume and pore sizes exhibits a high specific capacitance of 145.1 F g-1 at a current density of 1 A g-1. With a high specific energy of 31 W h kg-1 at a power density of 33028 W kg-1 and a short time relaxation constant of 0.29 s, the carbon showed high power capability as an EDLC electrode material.

  6. Presentation and exhibition activities for promoting theexportof transport services

    Directory of Open Access Journals (Sweden)

    Darya Vladimirovna Nesterova

    2012-03-01

    Full Text Available Development of presentation and exhibition activities is considered as an important factor in providing new competitive advantages at the strategic markets for exporting of transportation services. A specific role for exhibition activities as a factor to overcome market failures arose from imperfect information and incomplete markets is displayed. Exhibitions are considered as a true reflection of most market parameters, as a means to get correct information concerning market capacity and its borders, as an instrument to access to new markets. At the firm level presentation and branding activities should be considered as a modern technology (especially it concerns Russian companies which provide to hold up already existed markets and to conquer new ones. Presentation and branding activities are an effective technology to promote company trade-mark, competitive advantages for market demand increasing. Comparative analysis of the main exhibitions on transport and logistics issues is fulfilled on the data basecollected by authors. Data observes geographical distribution of transport exhibition and exhibition facilities development at several regions for the last years. The analyses allow to revealing a geographical structure of the exhibitions and its distribution by type of transport. The most promising and economically favorable exhibition areas for the promotion of Russian transport services are shown.

  7. Nanoscale zero-valent iron (nZVI) synthesis in a Mg-aminoclay solution exhibits increased stability and reactivity for reductive decontamination

    DEFF Research Database (Denmark)

    Hwang, Yuhoon; Lee, Young-Chul; Mines, Paul D.

    2014-01-01

    Nanoscale zero-valent iron (nZVI) has often been explored as a reductant for detoxification of pollutants in environmental clean-ups. Despite the large surface area and superior reactivity of nZVI, its limited stability is a major obstacle in applying nZVI for in situ subsurface remediation, e......ZVI particles with higher crystallinity were produced. Stability of nZVI particles were evaluated using a sedimentation test and a dynamic light scattering technique. The characteristic time increased from 6.71 to 83.8 min, and particle (aggregate diameter) size decreased from 5132 to 186 nm with increasing...

  8. Hydrogen-Bonding Surfaces for Ice Mitigation

    Science.gov (United States)

    Smith, Joseph G., Jr.; Wohl, Christopher J.; Kreeger, Richard E.; Hadley, Kevin R.; McDougall, Nicholas

    2014-01-01

    Ice formation on aircraft, either on the ground or in-flight, is a major safety issue. While ground icing events occur predominantly during the winter months, in-flight icing can happen anytime during the year. The latter is more problematic since it could result in increased drag and loss of lift. Under a Phase I ARMD NARI Seedling Activity, coated aluminum surfaces possessing hydrogen-bonding groups were under investigation for mitigating ice formation. Hydroxyl and methyl terminated dimethylethoxysilanes were prepared via known chemistries and characterized by spectroscopic methods. These materials were subsequently used to coat aluminum surfaces. Surface compositions were based on pure hydroxyl and methyl terminated species as well as mixtures of the two. Coated surfaces were characterized by contact angle goniometry. Receding water contact angle data suggested several potential surfaces that may exhibit reduced ice adhesion. Qualitative icing experiments performed under representative environmental temperatures using supercooled distilled water delivered via spray coating were inconclusive. Molecular modeling studies suggested that chain mobility affected the interface between ice and the surface more than terminal group chemical composition. Chain mobility resulted from the creation of "pockets" of increased free volume for longer chains to occupy.

  9. Discrimination? - Exhibition of posters

    OpenAIRE

    Jakimovska, Jana

    2017-01-01

    Participation in the exhibition with the students form the Art Academy. The exhibition consisted of 15 posters tackling the subjects of hate speech and discrimination. The exhibition happened thanks to the invitation of the Faculty of Law at UGD, and it was a part of a larger event of launching books on the aforementioned subjects.

  10. Biomimetic surface modification of polypropylene by surface chain transfer reaction based on mussel-inspired adhesion technology and thiol chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail: shisq@nwu.edu.cn; Gong, Yongkuan

    2016-11-15

    Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such

  11. Biomimetic surface modification of polypropylene by surface chain transfer reaction based on mussel-inspired adhesion technology and thiol chemistry

    International Nuclear Information System (INIS)

    Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan

    2016-01-01

    Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such

  12. Surface controlled dissolution rates of gypsum in aqueous solutions exhibit nonlinear dissolution kinetics

    Science.gov (United States)

    Jeschke, Alexander A.; Vosbeck, Katrin; Dreybrodt, Wolfgang

    2001-01-01

    The effective dissolution rates of gypsum are determined by mixed kinetics, where the rate constants of dissolution at the surface and the transport constant of molecular diffusion of dissolved material are similar. To obtain the surface reaction rate law it is necessary to know the transport constant. We have determined the surface rate law for monocrystalline selenite by using a rotating disc set-up, where the transport coefficients are well known. As a result, up to a calcium concentration of 0.6 · ceq, we find a nearly linear rate law Rs = ksl (1- cs/ ceq) n1, where cs is the total calcium concentration at the surface and ceq the equilibrium concentration with respect to gypsum, n1 = 1.2 ± 0.2, and ksl = 1.1 · 10 -4 mmol cm -2 s -1 ± 15%. We also employed batch-experiments for selenite, alabaster and gypsum rock samples. The result of these experiments were interpreted by using a transport constant determined by NaCl dissolution experiments under similar physical conditions. The batch experiments reveal a dissolution rate law Rs = ksl (1- cs/ ceq) n1, ksl = 1.3 · 10 -4 mmol · cm -2 s -1, n1 = 1.2 ± 0.2 for c ≤ 0.94 · ceq. Close to equilibrium a nonlinear rate law, Rs = ks2 (1- cs/ ceq) n2, is observed, where ks2 is in the order of 10 mmol · cm -2 s -1 and n2 ≈ 4.5. The experimentally observed gypsum dissolution rates from the batch experiments could be accurately fitted, with only minor variations of the surface reaction constant obtained from the rotating disk experiment and the transport coefficient from the NaCl dissolution batch experiment. Batch experiments on pure synthetic gypsum, reveal a linear rate law up to equilibrium. This indicates inhibition of dissolution in natural samples close to equilibrium, as is known also for calcite minerals.

  13. Shaping Watersheds Exhibit: An Interactive, Augmented Reality Sandbox for Advancing Earth Science Education

    Science.gov (United States)

    Reed, S. E.; Kreylos, O.; Hsi, S.; Kellogg, L. H.; Schladow, G.; Yikilmaz, M. B.; Segale, H.; Silverman, J.; Yalowitz, S.; Sato, E.

    2014-12-01

    One of the challenges involved in learning earth science is the visualization of processes which occur over large spatial and temporal scales. Shaping Watersheds is an interactive 3D exhibit developed with support from the National Science Foundation by a team of scientists, science educators, exhibit designers, and evaluation professionals, in an effort to improve public understanding and stewardship of freshwater ecosystems. The hands-on augmented reality sandbox allows users to create topographic models by shaping real "kinetic" sand. The exhibit is augmented in real time by the projection of a color elevation map and contour lines which exactly match the sand topography, using a closed loop of a Microsoft Kinect 3D camera, simulation and visualization software, and a data projector. When an object (such as a hand) is sensed at a particular height above the sand surface, virtual rain appears as a blue visualization on the surface and a flow simulation (based on a depth-integrated version of the Navier-Stokes equations) moves the water across the landscape. The blueprints and software to build the sandbox are freely available online (http://3dh2o.org/71/) under the GNU General Public License, together with a facilitator's guide and a public forum (with how-to documents and FAQs). Using these resources, many institutions (20 and counting) have built their own exhibits to teach a wide variety of topics (ranging from watershed stewardship, hydrology, geology, topographic map reading, and planetary science) in a variety of venues (such as traveling science exhibits, K-12 schools, university earth science departments, and museums). Additional exhibit extensions and learning modules are planned such as tsunami modeling and prediction. Moreover, a study is underway at the Lawrence Hall of Science to assess how various aspects of the sandbox (such as visualization color scheme and level of interactivity) affect understanding of earth science concepts.

  14. Soil macropores: Control on infiltration, hillslope and surface hydrology on a reclaimed surface-mined watershed

    International Nuclear Information System (INIS)

    Guebert, M.D.; Gardner, T.W.

    1992-01-01

    The hydrologic response of a surface-mined watershed in central Pennsylvania is controlled by rapid macropore flow within the unsaturated man-made topsoil. Newly reclaimed surface-mined watersheds in central Pennsylvania exhibit low steady-state infiltration rates (1--2 cm/hr) and produce runoff dominated by infiltration-excess overland flow. However, within four years after reclamation, infiltration rates on some mine surfaces approach premined rates (8 cm/hr). As infiltration rate increases, the volume of infiltrated water increases, but the total porosity of minesoil matrix remains constant. There is little change in the surface discharge volume, indicating that infiltrated water continues to contribute to the basin surface discharge by the processes of throughflow and return flow. Throughflow in the topsoil horizon occurs in rapid response to rainfall input, producing large volumes of water with throughflow rates closely related to rainfall rates and with throughflow peaks following rainfall peaks by only minutes. Increased return flow alters the shape of the surface runoff hydrograph by slightly lagging behind infiltration excess overland flow. These changes in the shape of the surface runoff hydrograph reduce the potential for severe gully erosion on the reclaimed site. In addition, throughflow water remains predominantly in the topsoil horizon, and therefore has limited contact with potentially acid-producing backfill. Better understanding of macropore flow processes in reclaimed minesoils will help investigators evaluate past strategies and develop new reclamation techniques that will minimize the short-term surface erosional effects of mining and reclamation, while optimizing the long-term effluent and groundwater quality

  15. EXHIBITION: Accelerated Particles

    CERN Multimedia

    2004-01-01

    http://www.cern.ch/cern50/ An exhibition of plastic arts and two evenings of performances by sound and visual artists as part of CERN's fiftieth anniversary celebrations. The fiftieth anniversary of a world famous organization like CERN, an international laboratory specializing in fundamental research, is a cause for celebration. Since March this year, Geneva and neighbouring parts of France have been the venues for a wealth of small and large-scale events, which will continue until November. Given CERN's location in the commune of Meyrin, the ForuMeyrin is hosting two "salons" consisting of an exhibition of plastic arts and evenings of music and visual arts performances with the collective title of "Accelerated Particles". Several works will be exhibited and performed. Salon des matières: An exhibition of plastic arts Until Wednesday 3 November 2004. Tuesdays to Fridays: 4.00 p.m. to 7.00 p.m. Saturdays: 2.00 p.m. to 6.00 p.m. Doors open late on the evening of the performances. Salon des ...

  16. Exhibiting the Human/Exhibiting the Cyborg: “Who Am I?”

    Directory of Open Access Journals (Sweden)

    Sophia C. Vackimes

    2013-08-01

    Full Text Available The role of the museum in shaping our relationship to science and technology, particularly cyborgization, is illuminated by a close examination of the Who Am I permanent exhibition in the Wellcome Wing of the Science Museum of London. This innovative exhibition raises real questions both about the human-technology-science relationship but also about museography. In the context of the history and current practices of museums engaging contemporary technological developments the evidence suggest that even as the Who am I? exhibit did break somewhat from previous approaches, especially the didactic presentation of the socially useful, it has not changed the feld as a whole.

  17. Composites in small and simple devices to increase mixing on detector surfaces

    Science.gov (United States)

    Hernandez, L. F.; Lima, R. R.; Leite, A. R.; Fachini, E. R.; Silva, M. L. P.

    2013-03-01

    This work aims at three different applications for the betterment of plasma generated-composite thin films: pre-mixing, spray formation in miniaturized structures and an increase in the performance of detector surfaces. Miniaturized structures were projected, simulated with FEMLAB® 3.2 software and then constructed. Clustered films made from tetraethoxysilane (TEOS) and nonafluoro(iso)butyl ether (HFE®) precursors were deposited on silicon, acrylic and quartz substrates for different kinds of film characterization/or in the projected structures. Physical and chemical characterization guided the selection of best films previous to/after UVC exposure. The active surfaces (plasma-deposited films) in structures were modified by UVC exposure and then tested. The applications include pre-mixing of liquids and/or spray formation, best results being obtained with surface covered by derivative-HFE films, which acted as passivation layers. Preliminary results show good humidity sensing for TEOS-derivative films.

  18. Composites in small and simple devices to increase mixing on detector surfaces

    International Nuclear Information System (INIS)

    Hernandez, L F; Lima, R R; Leite, A R; Silva, M L P; Fachini, E R

    2013-01-01

    This work aims at three different applications for the betterment of plasma generated-composite thin films: pre-mixing, spray formation in miniaturized structures and an increase in the performance of detector surfaces. Miniaturized structures were projected, simulated with FEMLAB ® 3.2 software and then constructed. Clustered films made from tetraethoxysilane (TEOS) and nonafluoro(iso)butyl ether (HFE ® ) precursors were deposited on silicon, acrylic and quartz substrates for different kinds of film characterization/or in the projected structures. Physical and chemical characterization guided the selection of best films previous to/after UVC exposure. The active surfaces (plasma-deposited films) in structures were modified by UVC exposure and then tested. The applications include pre-mixing of liquids and/or spray formation, best results being obtained with surface covered by derivative-HFE films, which acted as passivation layers. Preliminary results show good humidity sensing for TEOS-derivative films.

  19. Athletes who train on unstable compared to stable surfaces exhibit unique postural control strategies in response to balance perturbations

    Directory of Open Access Journals (Sweden)

    D.S. Blaise Williams, III

    2016-03-01

    Conclusion: USA exhibit unique postural strategies compared to SSA. These unique strategies seemingly exhibit a direction-specific attribute and may be associated with divergent motor control strategies.

  20. Application of an imaging system to a museum exhibition for developing interactive exhibitions

    Science.gov (United States)

    Miyata, Kimiyoshi; Inoue, Yuka; Takiguchi, Takahiro; Tsumura, Norimichi; Nakaguchi, Toshiya; Miyake, Yoichi

    2009-10-01

    In the National Museum of Japanese History, 215,759 artifacts are stored and used for research and exhibitions. In museums, due to the limitation of space in the galleries, a guidance system is required to satisfy visitors' needs and to enhance their understanding of the artifacts. We introduce one exhibition using imaging technology to improve visitors' understanding of a kimono (traditional Japanese clothing) exhibition. In the imaging technology introduced, one data projector, one display with touch panel interface, and magnifiers were used as exhibition tools together with a real kimono. The validity of this exhibition method was confirmed by results from a visitors' interview survey. Second, to further develop the interactive guidance system, an augmented reality system that consisted of cooperation between the projector and a digital video camera was also examined. A white paper board in the observer's hand was used as a projection screen and also as an interface to control the images projected on the board. The basic performance of the proposed system was confirmed; however continuous development was necessary for applying the system to actual exhibitions.

  1. Effects of an Informal Energy Exhibit on Knowledge and Attitudes of Fourth Grade Students

    Directory of Open Access Journals (Sweden)

    David Goodman

    2015-05-01

    Full Text Available The public has limited knowledge of renewable energy technologies. An increase in energy literacy can potentially lead to desired energy-related behavioral changes in the future. One potential solution is to increase the public’s access to renewable energy information by placing informal energy education exhibits in libraries, community centers, and parks. After calibrating the exhibit based on observations of children’s interactions at a children’s museum, the exhibit was displayed at a university, a private school, and a community center. The opinion surveys and interviews both showed that participants enjoyed and learned from the exhibit. Students showed no significant statistical improvement between the pretests and posttests, but interviews showed that they could recall facts, explain processes, and make inferences from the exhibit. Fourth-grade students can benefit from interacting with an informal energy exhibit in order to increase their knowledge of energy topics and technologies.

  2. Exhibition; Image display agency

    International Nuclear Information System (INIS)

    Normazlin Ismail

    2008-01-01

    This article touches on the role of Malaysian Nuclear Agency as nuclear research institutions to promote, develop and encourage the peaceful uses of nuclear technology in its agricultural, medical, manufacturing, industrial, health and environment for the development of the country running successfully. Maturity of Malaysian Nuclear Agency in dealing with nuclear technology that are very competitive and globalization cannot be denied. On this basis Malaysian Nuclear Agency was given the responsibility to strengthen the nuclear technology in Malaysia. One way is through an exhibition featuring the research, discoveries and new technology products of the nuclear technology. Through this exhibition is to promote the nuclear technology and introduce the image of the agency in the public eye. This article also states a number of exhibits entered by the Malaysian Nuclear Agency and achievements during the last exhibition. Authors hope that the exhibition can be intensified further in the future.

  3. Increase in compton scattering of gamma rays passing along metal surface

    International Nuclear Information System (INIS)

    Grigor'ev, A.N.; Bilyk, Z.V.; Sakun, A.V.; Marushchenko, V.V.; Chernyavskij, O.Yu.; Litvinov, Yu.V.

    2014-01-01

    The paper considers experimental study of changes in energy of 137 Cs gamma source as gamma rays pass along metal surface. Decrease in gamma energy was examined by reducing the number of gamma rays in the complete absorption peak to the Compton length level and increasing the Compton effect. The number of gamma rays in the complete absorption peak decreases by 3.5 times in the angle range under study

  4. Fabrication and surface transformation of FePt nanoparticle monolayer

    International Nuclear Information System (INIS)

    Wang Ying; Ding Baojun; Li Hua; Zhang Xiaoyan; Cai Bingchu; Zhang Yafei

    2007-01-01

    The monolayer of FePt nanoparticles with the mean size of ∼4 nm was fabricated on a glass substrate by the Langmuir--Blodgett (LB) technology. The monolayer of FePt nanoparticles has a smooth surface and a high density structure as shown by the AFM image. The array structure of FePt nanoparticles on the surface of the film is clearly with a cubic symmetry in appropriate condition. Small-angle X-ray diffraction (SXRD) measurement of multilayer structure for the FePt nanoparticles has indicated that the superlattices consist of well-defined smooth layers. The transfer of nanoparticle layers onto a solid substrate surface was quite efficient for the first few layers, exhibiting a proportional increase of optical absorption in the UV-vis range. This results potentially opens up a new approach to the long-range ordered array of FePt nanoparticles capped by organic molecules on substrate and provide a promising thin film, which may exhibit the excellent ultra-high density magnetic recording properties

  5. Contemporary Developments in Cinema Exhibition

    OpenAIRE

    Hanson, Stuart

    2014-01-01

    he work offered for this PhD by Published Works charts the history of cinema exhibition in Britain from the late 1950s to the present. At the start of this period, cinemagoing as a form of public entertainment entered a long period of decline that was only arrested with the development and growth of multiplex cinemas in the 1980s and 1990s. Despite these changes, the feature film itself remained a culturally and commercially valuable artefact, though increasingly this meant the Hollywood fil...

  6. Synthesis of ultrasmall Li-Mn spinel oxides exhibiting unusual ion exchange, electrochemical, and catalytic properties

    Science.gov (United States)

    Miyamoto, Yumi; Kuroda, Yoshiyuki; Uematsu, Tsubasa; Oshikawa, Hiroyuki; Shibata, Naoya; Ikuhara, Yuichi; Suzuki, Kosuke; Hibino, Mitsuhiro; Yamaguchi, Kazuya; Mizuno, Noritaka

    2015-10-01

    The efficient surface reaction and rapid ion diffusion of nanocrystalline metal oxides have prompted considerable research interest for the development of high functional materials. Herein, we present a novel low-temperature method to synthesize ultrasmall nanocrystalline spinel oxides by controlling the hydration of coexisting metal cations in an organic solvent. This method selectively led to Li-Mn spinel oxides by tuning the hydration of Li+ ions under mild reaction conditions (i.e., low temperature and short reaction time). These particles exhibited an ultrasmall crystallite size of 2.3 nm and a large specific surface area of 371 ± 15 m2 g-1. They exhibited unique properties such as unusual topotactic Li+/H+ ion exchange, high-rate discharge ability, and high catalytic performance for several aerobic oxidation reactions, by creating surface phenomena throughout the particles. These properties differed significantly from those of Li-Mn spinel oxides obtained by conventional solid-state methods.

  7. Synthesis of ultrasmall Li–Mn spinel oxides exhibiting unusual ion exchange, electrochemical, and catalytic properties

    Science.gov (United States)

    Miyamoto, Yumi; Kuroda, Yoshiyuki; Uematsu, Tsubasa; Oshikawa, Hiroyuki; Shibata, Naoya; Ikuhara, Yuichi; Suzuki, Kosuke; Hibino, Mitsuhiro; Yamaguchi, Kazuya; Mizuno, Noritaka

    2015-01-01

    The efficient surface reaction and rapid ion diffusion of nanocrystalline metal oxides have prompted considerable research interest for the development of high functional materials. Herein, we present a novel low-temperature method to synthesize ultrasmall nanocrystalline spinel oxides by controlling the hydration of coexisting metal cations in an organic solvent. This method selectively led to Li–Mn spinel oxides by tuning the hydration of Li+ ions under mild reaction conditions (i.e., low temperature and short reaction time). These particles exhibited an ultrasmall crystallite size of 2.3 nm and a large specific surface area of 371 ± 15 m2 g−1. They exhibited unique properties such as unusual topotactic Li+/H+ ion exchange, high-rate discharge ability, and high catalytic performance for several aerobic oxidation reactions, by creating surface phenomena throughout the particles. These properties differed significantly from those of Li–Mn spinel oxides obtained by conventional solid-state methods. PMID:26456216

  8. Reversible Surface Properties of Polybenzoxazine/Silica Nanocomposites Thin Films

    Directory of Open Access Journals (Sweden)

    Wei-Chen Su

    2013-01-01

    Full Text Available We report the reversible surface properties (hydrophilicity, hydrophobicity of a polybenzoxazine (PBZ thin film through simple application of alternating UV illumination and thermal treatment. The fraction of intermolecularly hydrogen bonded O–H⋯O=C units in the PBZ film increased after UV exposure, inducing a hydrophilic surface; the surface recovered its hydrophobicity after heating, due to greater O–H⋯N intramolecular hydrogen bonding. Taking advantage of these phenomena, we prepared a PBZ/silica nanocomposite coating through two simple steps; this material exhibited reversible transitions from superhydrophobicity to superhydrophilicity upon sequential UV irradiation and thermal treatment.

  9. Climatic response to a gradual increase of atmospheric carbon dioxide

    International Nuclear Information System (INIS)

    Stouffer, R.J.; Manabe, S.; Bryan, K.

    1990-01-01

    The transient response of a coupled ocean-atmosphere model to an increase of carbon dioxide has been the subject of several studies. The models used in these studies explicitly incorporate the effect of heat transport by ocean currents and are different from the model used by Hansen et al. Here the authors evaluate the climatic influence of increasing atmospheric carbon dioxide using a coupled model recently developed at the NOAA Geophysical Fluid Dynamics Laboratory. The model response exhibits a marked and unexpected interhemispheric asymmetry. In the circumpolar ocean of the southern hemisphere, a region of deep vertical mixing, the increase of surface air temperature is very slow. In the Northern hemisphere of the model, the rise of surface air temperature is faster and increases with latitude, with the exception of the northern North Atlantic, where it is relatively slow because of the weakening of the thermohaline circulation

  10. Ape Behavior in Two Alternating Environments: Comparing Exhibit and Short-Term Holding Areas

    DEFF Research Database (Denmark)

    Ross, Stephen R.; Wagner, Katherine E.; Schapiro, Steven J.

    2010-01-01

    be balanced with the desire to maintain enriching and naturalistic exhibit enclosures that benefit ape residents and attract the visiting public. In these settings, examinations of ape behavior and welfare typically focus exclusively on activity in the primary exhibit area. However, physical, social...... and sensory experiences unique to each area may shape different patterns of behavior. In the current study, zoo-living chimpanzees and gorillas were moved each day from exhibit areas to off-exhibit holding areas for a short duration as a part of regular management procedures. Behavioral data indicated species......-specific reactions to the holding area, including increased aggression and self-directed behavior by chimpanzees and increased activity and prosocial behavior among gorilla subjects. Both species showed more feeding-foraging behavior while in the exhibit enclosure. Results suggest that holding areas may not meet all...

  11. The reef-building coral Siderastrea siderea exhibits parabolic responses to ocean acidification and warming.

    Science.gov (United States)

    Castillo, Karl D; Ries, Justin B; Bruno, John F; Westfield, Isaac T

    2014-12-22

    Anthropogenic increases in atmospheric CO2 over this century are predicted to cause global average surface ocean pH to decline by 0.1-0.3 pH units and sea surface temperature to increase by 1-4°C. We conducted controlled laboratory experiments to investigate the impacts of CO2-induced ocean acidification (pCO2 = 324, 477, 604, 2553 µatm) and warming (25, 28, 32°C) on the calcification rate of the zooxanthellate scleractinian coral Siderastrea siderea, a widespread, abundant and keystone reef-builder in the Caribbean Sea. We show that both acidification and warming cause a parabolic response in the calcification rate within this coral species. Moderate increases in pCO2 and warming, relative to near-present-day values, enhanced coral calcification, with calcification rates declining under the highest pCO2 and thermal conditions. Equivalent responses to acidification and warming were exhibited by colonies across reef zones and the parabolic nature of the corals' response to these stressors was evident across all three of the experiment's 30-day observational intervals. Furthermore, the warming projected by the Intergovernmental Panel on Climate Change for the end of the twenty-first century caused a fivefold decrease in the rate of coral calcification, while the acidification projected for the same interval had no statistically significant impact on the calcification rate-suggesting that ocean warming poses a more immediate threat than acidification for this important coral species.

  12. Blowing Up Harry Potter: Leveraging an NLM Exhibition to Your Advantage

    Science.gov (United States)

    Faricy-Beredo, Bridget

    2013-01-01

    Libraries are constantly challenged to find ways to demonstrate their value to their institutions. Can hosting a National Library of Medicine (NLM) exhibition increase a library's impact? In 2012 the University of Toledo engaged their constituents by hosting and developing programming for the NLM exhibit Harry Potter's World: Renaissance Science,…

  13. Quantification of acute vocal fold epithelial surface damage with increasing time and magnitude doses of vibration exposure.

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Kojima

    Full Text Available Because the vocal folds undergo repeated trauma during continuous cycles of vibration, the epithelium is routinely susceptible to damage during phonation. Excessive and prolonged vibration exposure is considered a significant predisposing factor in the development of vocal fold pathology. The purpose of the present study was to quantify the extent of epithelial surface damage following increased time and magnitude doses of vibration exposure using an in vivo rabbit phonation model. Forty-five New Zealand white breeder rabbits were randomized to nine groups and received varying phonation time-doses (30, 60, or 120 minutes and magnitude-doses (control, modal intensity phonation, or raised intensity phonation of vibration exposure. Scanning electron microscopy and transmission electron microscopy was used to quantify the degree of epithelial surface damage. Results revealed a significant reduction in microprojection density, microprojection height, and depth of the epithelial surface with increasing time and phonation magnitudes doses, signifying increased epithelial surface damage risk with excessive and prolonged vibration exposure. Destruction to the epithelial cell surface may provide significant insight into the disruption of cell function following prolonged vibration exposure. One important goal achieved in the present study was the quantification of epithelial surface damage using objective imaging criteria. These data provide an important foundation for future studies of long-term tissue recovery from excessive and prolonged vibration exposure.

  14. The World of Virtual Exhibitions

    Directory of Open Access Journals (Sweden)

    Irena Eiselt

    2013-09-01

    Full Text Available EXTENDED ABSTRACTSpecial collections of the National and University Library (NUK hide a lot of items of precious value. The Slovenian cultural heritage is stored on paper or on other media as a part of the library’s Manuscripts, Incunabula and Rare Books Collection, Old Prints Collection, Maps and Pictorial Collection, Music Collection, Ephemera Collection, Serials Collection, and Slovenian Diaspora Publications Collection. Only a small part of the treasures is temporary revealed to the public on special exhibitions. The idea of virtual exhibitions of library treasures was born in 2005. The library aimed to exhibit precious items of special collections of high historical or artistic value. In 2008 the first two virtual exhibitions were created in-house offering access to the rich collections of old postcards of Ljubljana at the beginning of 20th century kept in the Maps and Pictorial Collection of NUK. They were soon followed by other virtual exhibitions. At the beginning they were organised in the same way as physical exhibitions, afterwards different programs were used for creation of special effects (for ex. 3D wall. About two years ago it was decided that the creation of virtual exhibitions will be simplified. Files of digitised and borndigital library materials in jpg format are imported to MS PowerPoint 2010. Each jpg file is now formatted by adding a frame, a description … to the slides which are saved as jpg files. The last step is the import of jpg files into Cooliris application used for NUK web exhibitions. In the paper the virtual exhibition design and creation, the technical point of view and criteria for the selection of exhibition content are explained following the example of the virtual exhibitions the Old Postcards of Ljubljana, Photo Ateliers in Slovenia, a collection of photographs Four Seasons by Fran Krašovec and photos of Post-Earthquake Ljubljana in 1895.

  15. Increasing shaft depth with rock hoisting to the surface. [USSR

    Energy Technology Data Exchange (ETDEWEB)

    Durov, E.M.

    1982-06-01

    Schemes of shaft construction with increasing shaft depth depend on: shaft depth, shaft diameter, types of hoisting systems, schemes of shaft reinforcement. Investigations carried out in underground coal mines in the USSR show that waste rock haulage to the surface by an independent hoisting system is most economical. Installation of this system depends on the existing hoisting scheme. When one of the operating cages or skips can be removed without a negative influence on mine operation the system of rock waste hoisting is used. The hoisting bucket used for rock removal from the shaft bottom moves in the shaft section from which one of the cages or skips has been removed. Examples of using this scheme in Donbass, Kuzbass and other coal basins are given. Economic aspects of waste material hoisting to the surface are analyzed. The system is economical when the remaining hoisting system can accept additional loads after removal of a cage or skip from the shaft. Investigations show that use of a bucket with a capacity from 2.5 to 3.0 m/sup 3/ for waste rock removal from the shaft being modernized and deepened is most economical.

  16. Working Fluids for Increasing Capacities of Heat Pipes

    Science.gov (United States)

    Chao, David F.; Zhang, Nengli

    2004-01-01

    A theoretical and experimental investigation has shown that the capacities of heat pipes can be increased through suitable reformulation of their working fluids. The surface tensions of all of the working fluids heretofore used in heat pipes decrease with temperature. As explained in more detail below, the limits on the performance of a heat pipe are associated with the decrease in the surface tension of the working fluid with temperature, and so one can enhance performance by reformulating the working fluid so that its surface tension increases with temperature. This improvement is applicable to almost any kind of heat pipe in almost any environment. The heat-transfer capacity of a heat pipe in its normal operating-temperature range is subject to a capillary limit and a boiling limit. Both of these limits are associated with the temperature dependence of surface tension of the working fluid. In the case of a traditional working fluid, the decrease in surface tension with temperature causes a body of the liquid phase of the working fluid to move toward a region of lower temperature, thus preventing the desired spreading of the liquid in the heated portion of the heat pipe. As a result, the available capillary-pressure pumping head decreases as the temperature of the evaporator end of the heat pipe increases, and operation becomes unstable. Water has widely been used as a working fluid in heat pipes. Because the surface tension of water decreases with increasing temperature, the heat loads and other aspects of performance of heat pipes that contain water are limited. Dilute aqueous solutions of long-chain alcohols have shown promise as substitutes for water that can offer improved performance, because these solutions exhibit unusual surface-tension characteristics: Experiments have shown that in the cases of an aqueous solution of an alcohol, the molecules of which contain chains of more than four carbon atoms, the surface tension increases with temperature when the

  17. Surface effects on the photoluminescence of Si quantum dots

    International Nuclear Information System (INIS)

    Wang, Chiang-Jing; Tsai, Meng-Yen; Chi, Cheng Chung; Perng, Tsong-Pyng

    2009-01-01

    Si quantum dots (SiQDs) with sizes ranging from 5 to 20 nm were fabricated by vapor condensation. They showed red photoluminescence (PL) in vacuum with the peak located at around 750 nm. After the specimen was exposed to air, the PL intensity became higher, and continued to increase during the PL test with a cycling of vacuum-air-vacuum. In pure oxygen, the PL intensity exhibited an irreversible decrease, while in nitrogen a smaller amount of reversible increase of PL intensity was observed. Furthermore, the PL intensity exhibited a remarkable enhancement if the SiQDs were treated with water. With HF treatment, the PL peak position showed a blue-shift to 680 nm, and was recovered after subsequent exposure to air. Si-O-H complexes were suggested to be responsible for this red luminescence. The irreversible decrease of PL intensity due to oxygen adsorption was speculated to be caused by the modification of chemical bonds on the surface. In the case of nitrogen adsorption, the PL change was attributed to the surface charging during adsorption.

  18. Effects of intraoral aging on surface properties of coated nickel-titanium archwires.

    Science.gov (United States)

    Rongo, Roberto; Ametrano, Gianluca; Gloria, Antonio; Spagnuolo, Gianrico; Galeotti, Angela; Paduano, Sergio; Valletta, Rosa; D'Antò, Vincenzo

    2014-07-01

    To evaluate the effects of intraoral aging on surface properties of esthetic and conventional nickel-titanium (NiTi) archwires. Five NiTi wires were considered for this study (Sentalloy, Sentalloy High Aesthetic, Superelastic Titanium Memory Wire, Esthetic Superelastic Titanium Memory Wire, and EverWhite). For each type of wire, four samples were analyzed as received and after 1 month of clinical use by an atomic force microscope (AFM) and a scanning electronic microscope (SEM). To evaluate sliding resistance, two stainless steel plates with three metallic or three monocrystalline brackets, bonded in passive configuration, were manufactured; four as-received and retrieved samples for every wire were pulled five times at 5 mm/min for 1 minute by means of an Instron 5566, recording the greatest friction value (N). Data were analyzed by one-way analysis of variance and by Student's t-test. After clinical use, surface roughness increased considerably. The SEM images showed homogeneity for the as-received control wires; however, after clinical use esthetic wires exhibited a heterogeneous surface with craters and bumps. The lowest levels of friction were observed with the as-received Superelastic Titanium Memory Wire on metallic brackets. When tested on ceramic brackets, all the wires exhibited an increase in friction (t-test; P Sentalloy, showed a statistically significant increase in friction between the as-received and retrieved groups (t-test; P < .05). Clinical use of the orthodontic wires increases their surface roughness and the level of friction.

  19. Exhibition at the AAA library

    DEFF Research Database (Denmark)

    2013-01-01

    Sonnesgade 11 The exhibition at the AAA library presents selected work produced by students prior to the exhibition of installations in project and praxis constructing an archive at Sonnesgade 11. The exhibition at Sonnesgade 11 was the culmination of collaboration with SLETH architects and studio...

  20. Microstructural evolution and surface properties of nanostructured Cu-based alloy by ultrasonic nanocrystalline surface modification technique

    Energy Technology Data Exchange (ETDEWEB)

    Amanov, Auezhan, E-mail: amanov_a@yahoo.com [Department of Mechanical Engineering, Sun Moon University, Asan 336-708 (Korea, Republic of); Cho, In-Sik [R& D Group, Mbrosia Co., Ltd., Asan 336-708 (Korea, Republic of); Pyun, Young-Sik [Department of Mechanical Engineering, Sun Moon University, Asan 336-708 (Korea, Republic of)

    2016-12-01

    Graphical abstract: - Highlights: • A nanostructured surface was produced by UNSM technique. • Porosities were eliminated from the surface by UNSM technique. • Extremely high hardness obtained at the top surface after UNSM treatment. • Friction and wear behavior was improved by UNSM technique. • Resistance to scratch behavior was improved by UNSM technique. - Abstract: A nanostructured surface layer with a thickness of about 180 μm was successfully produced in Cu-based alloy using an ultrasonic nanocrystalline surface modification (UNSM) technique. Cu-based alloy was sintered onto low carbon steel using a powder metallurgy (P/M) method. Transmission electron microscope (TEM) characterization revealed that the severe plastic deformation introduced by UNSM technique resulted in nano-sized grains in the topmost surface layer and deformation twins. It was also found by atomic force microscope (AFM) observations that the UNSM technique provides a significant reduction in number of interconnected pores. The effectiveness of nanostructured surface layer on the tribological and micro-scratch properties of Cu-based alloy specimens was investigated using a ball-on-disk tribometer and micro-scratch tester, respectively. Results exhibited that the UNSM-treated specimen led to an improvement in tribological and micro-scratch properties compared to that of the sintered specimen, which may be attributed to the presence of nanostructured surface layer having an increase in surface hardness and reduction in surface roughness. The findings from this study are expected to be implemented to the automotive industry, in particular connected rod bearings and bushings in order to increase the efficiency and performance of internal combustion engines (ICEs).

  1. Upcycling CERN Exhibitions

    CERN Multimedia

    Katarina Anthony

    2015-01-01

    Summer is coming - and with it, a new Microcosm exhibition showcasing CERN (see here). But while the new exhibit is preparing to enchant visitors, many have been asking about the site's former content. Will it simply be out with the old and in with the new? Not as such!   The plasma ball from Microcosm is now on display at the LHCb site. As Microcosm's new content is moving in, its old content is moving up. From LHCb to IdeaSquare, former Microcosm displays and objects are being installed across the CERN site. "Microcosm featured many elements that were well suited to life outside of the exhibition," says Emma Sanders, Microcosm project leader in the EDU group. "We didn't want this popular content to go to waste, and so set out to find them new homes across CERN." The LHCb experiment has received a number of Microcosm favourites, including the Rutherford experiment, the cosmic ray display and the Thomson experiment. "We&...

  2. Globe exhibit wins international acclaim

    CERN Multimedia

    Katarina Anthony

    2011-01-01

    The Globe’s “Universe of Particles” exhibition has recently received four prestigious awards for its avant-garde design. This external praise is great encouragement for the CERN exhibitions currently on the drawing board.   The Universe of Particles exhibition has won 4 awards for its avant-garde design. Back in 2008, the design company Atelier Brückner was presented with a challenge: to design the layout of a new permanent exhibition for CERN, one that would epitomize both the Organization and its research. The brief was concise but complex: the exhibit had to be symbolic of the Organization, use modern technology, engage and immerse visitors, and, preferably, use touch-screen technology. With the help of IArt, an interactive technology firm, and based on the content provided by CERN’s Education Group, Atelier Brückner developed the “Universe of Particles” exhibit as it is today. Its principal concept centred on the s...

  3. The influence of surface integrin binding patterns on specific biomaterial-cell interactions

    Science.gov (United States)

    Beranek, Maggi Marie

    aim, the response of surface-bound integrins to flow-related shear stress was examined. Based on fluorescent analysis, total alphavbeta 3, alpha1beta1, and alpha5beta 1 appeared to increase on stainless steel after 90-minute low shear stress exposure, whereas only alpha5beta1 appeared to increase when exposed to high shear. 65/35 poly(D, L-lactide-co-glycolide) exhibited increased total binding of alpha5beta1 and alphaMbeta2, when exposed to either shear stress level. Exposure to either shear stress regimen appeared to increase binding of all integrins on the combinational surface. These responses to shear stress suggest differential integrin binding affinity compared to stainless steel. Using antibodies specific to the integrin subunits, the apparent increase in surface-bound integrins was found to be related to a surface disassociation of alpha and beta subunits. The third aim evaluated human aortic endothelial cells and acute monocytic leukemia cells (THP-1) cell binding to the tested biomaterial surfaces under both static and flow conditions. Both stainless steel and the combinational surface had increased endothelial cell binding compared to monocyte attachment. Pre-incubation of the surface with the specific integrins significantly inhibited human aortic endothelial cell binding. Aim four was designed to investigate the influence of surface bound integrins on human aortic endothelial cell migration under shear stress. If biomaterial surface integrin binding patterns are specific, then pre-bound surface integrins should competitively inhibit binding of cellular integrins to the surface. Cell migration distance on to alphavbeta3, alpha 1beta1, and alpha5beta1 pre-incubated stainless steel was decreased ten-fold, and decreased by three-fold on both 65/35 poly(D, L-lactide-coglycolide) and combinational surfaces compared to the respective bare surfaces. In contrast, migration distance on to alphaMbeta2 pre-coated stainless steel and combinational surface was

  4. Nano-roughening n-side surface of AlGaInP-based LEDs for increasing extraction efficiency

    International Nuclear Information System (INIS)

    Lee, Y.J.; Lu, T.C.; Kuo, H.C.; Wang, S.C.; Hsu, T.C.; Hsieh, M.H.; Jou, M.J.; Lee, B.J.

    2007-01-01

    A chemical wet etching technique is presented to form a nano-roughened surface with triangle-like morphology on n-side-up AlGaInP-based LEDs fabricated by adopting adhesive layer bonding scheme. A simple and commonly used H 3 PO 4 -based solution was applied for chemical wet etching. The morphology of nano-roughened surfaces is analyzed by the atomic force microscope (AFM) and significantly related to the enhancement factor of the LED output power. The output power shows 80% increase after optimizing the nano-roughened morphology of n-side surface, as compared to the ordinary flat surface LED

  5. Anisotropic dehydration of hydrogel surfaces.

    Science.gov (United States)

    Kaklamani, Georgia; Cheneler, David; Grover, Liam M; Adams, Michael J; Anastasiadis, Spiros H; Bowen, James

    2017-12-01

    Efforts to develop tissue-engineered skin for regenerative medicine have explored natural, synthetic, and hybrid hydrogels. The creation of a bilayer material, with the stratification exhibited by native skin, is a complex problem. The mechanically robust, waterproof epidermis presents the stratum corneum at the tissue/air interface, which confers many of these protective properties. In this work, we explore the effect of high temperatures on alginate hydrogels, which are widely employed for tissue engineering due to their excellent mechanical properties and cellular compatibility. In particular, we investigate the rapid dehydration of the hydrogel surface which occurs following local exposure to heated surfaces with temperatures in the range 100-200 °C. We report the creation of a mechanically strengthened hydrogel surface, with improved puncture resistance and increased coefficient of friction, compared to an unheated surface. The use of a mechanical restraint during heating promoted differences in the rate of mass loss; the rate of temperature increase within the hydrogel, in the presence and absence of restraint, is simulated and discussed. It is hoped that the results will be of use in the development of processes suitable for preparing skin-like analogues; application areas could include wound healing and skin restoration.

  6. Methadone patients exhibit increased startle and cortisol response after intravenous yohimbine.

    Science.gov (United States)

    Stine, S M; Grillon, C G; Morgan, C A; Kosten, T R; Charney, D S; Krystal, J H

    2001-03-01

    Brain noradrenergic systems have been shown to be altered in opioid dependence and to mediate aspects of opioid withdrawal. Pre-clinical and clinical studies by others have shown that yohimbine, which increases noradrenergic activity, also increases both baseline and fear enhancement of the magnitude of the acoustic startle response (ASR). In a separate report from this experiment, it was shown that yohimbine produced opioid withdrawal-like symptoms, including anxiety, in clinically stable methadone-maintained patients and also produced elevations in the norepinepherine (NE) metabolite, 3-methoxy-4 hydroxyphenethyleneglycol (MHPG), and cortisol serum levels. The current study reports the effects of intravenous yohimbine hydrochloride, 0.4 mg/kg versus saline (double-blind), on ASR magnitude, plasma MHPG, and cortisol levels in eight methadone-maintained patients and 13 healthy subjects in a double-blind fashion. Yohimbine increased startle magnitude in both groups. There was no basal (placebo day) difference between the startle response of the two groups, but methadone patients had a larger startle magnitude increase in response to yohimbine than healthy controls. Methadone-maintained patients had lower baseline plasma levels of MHPG and similar baseline plasma cortisol levels compared with normal subjects. Yohimbine caused significant elevation in cortisol and MHPG in both groups. Methadone-maintained subjects had higher elevations in cortisol levels and MHPG (methadone main effect) levels in response to yohimbine. However, when MHPG levels were corrected for baseline differences by analysis of covariance (ANCOVA), the yohimbine effect, but not the methadone effect remained statistically significant. These results are consistent with the previous report and support the hypothesis that abnormalities of the hypothalamic-pituitary-adrenal (HPA) axis and of noradrenergic mechanisms of stress response persist in opioid-agonist maintenance. The ASR effect extends the

  7. Toward stimulated interaction of surface phonon polaritons

    Energy Technology Data Exchange (ETDEWEB)

    Kong, B. D.; Trew, R. J.; Kim, K. W., E-mail: kwk@ncsu.edu [Department of Electrical and Computer Engineering, North Carolina State University, Raleigh, North Carolina 27695-7911 (United States)

    2013-12-21

    Thermal emission spectra mediated by surface phonon polariton are examined by using a theoretical model that accounts for generation processes. Specifically, the acoustic phonon fusion mechanism is introduced to remedy theoretical deficiencies of the near thermal equilibrium treatments. The model clarifies the thermal excitation mechanism of surface phonon polaritons and the energy transfer path under non-zero energy flow. When applied to GaAs and SiC semi-infinite surfaces, the nonequilibrium model predicts that the temperature dependence of the quasi-monochromatic peak can exhibit distinctly different characteristics of either sharp increase or slow saturation depending on the materials, which is in direct contrast with the estimate made by the near-equilibrium model. The proposed theoretical tool can accurately analyze the nonequilibrium steady states, potentially paving a pathway to demonstrate stimulated interaction/emission of thermally excited surface phonon polaritons.

  8. Interactive Exhibits Foster Partnership and Engage Diverse Learners at Their Local Libraries

    Science.gov (United States)

    LaConte, K.; Dusenbery, P.; Fitzhugh, G.; Harold, J. B.; Holland, A.

    2016-12-01

    Learners frequently need to access increasingly complex information to help them understand our changing world. More and more libraries are transforming themselves into places where learners not only access STEM information, but interact with professionals and undertake hands-on learning. Libraries are beginning to position themselves as part of learning ecosystems that contribute to a collective impact on the community. Traveling STEM exhibits are catalyzing these partnerships and engaging students, families, and adults in repeat visits through an accessible venue: their public library. The impact of the STAR Library Education Network's (STAR_Net) Discover Earth: A Century of Change exhibit on partnerships, the circulation of STEM resources, and the engagement of learners was studied by an external evaluation team. The STAR_Net project's summative evaluation utilized mixed methods to investigate project implementation and its outcomes. Methods included pre- and post-exhibit surveys administered to staff from each library that hosted the exhibits; interviews with staff from host libraries; patron surveys; exhibit-related circulation records; web metrics regarding the online STAR_Net community of practice; and site visits. A subset of host libraries recruited professionals, who delivered programming that connected Earth systems science, weather, climate, and conservation themes from the exhibit to local issues. Library patrons improved their knowledge about STEM topics presented in the exhibits and associated programming, and patrons viewing the exhibit reflected the demographics of their communities. In a follow-up survey, patrons reported spending an average of 60 minutes looking at the exhibit over their cumulative visits to the library. In contrast, visitors might visit a museum only once to look at a comparably-sized traveling exhibit due to barriers such as cost and distance. Exhibit host libraries reported an increase in the circulation of Earth science

  9. Role of subsurface physics in the assimilation of surface soil moisture observations

    Science.gov (United States)

    Soil moisture controls the exchange of water and energy between the land surface and the atmosphere and exhibits memory that may be useful for climate prediction at monthly time scales. Though spatially distributed observations of soil moisture are increasingly becoming available from remotely sense...

  10. Effect of increased surface hydrophobicity via drug conjugation on the clearance of inhaled PEGylated polylysine dendrimers.

    Science.gov (United States)

    Haque, Shadabul; McLeod, Victoria M; Jones, Seth; Fung, Sandy; Whittaker, Michael; McIntosh, Michelle; Pouton, Colin; Owen, David J; Porter, Christopher J H; Kaminskas, Lisa M

    2017-10-01

    PEGylated polylysine dendrimers are attractive and well tolerated inhalable drug delivery platforms that have the potential to control the release, absorption kinetics and lung retention time of conjugated drugs. The clinical application of these systems though, would likely require partial substitution of surface PEG groups with drug molecules that are anticipated to alter their lung clearance kinetics and clearance pathways. In the current study, we therefore evaluated the impact of increased surface hydrophobicity via substitution of 50% surface PEG groups with a model hydrophobic drug (α-carboxyl OtButylated methotrexate) on the lung clearance of a Generation 5 PEGylated polylysine dendrimer in rats. PEG substitution with OtBu-methotrexate accelerated lung clearance of the dendrimer by increasing polylysine scaffold catabolism, improving systemic absorption of the intact dendrimer and low molecular weight products of scaffold catabolism, and enhancing mucociliary clearance. These results suggest that the conjugation of hydrophobic drug on the surface of a PEGylated dendrimer is likely to accelerate lung clearance when compared to a fully PEGylated dendrimer. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  11. Conformation evolution of oil contaminants onto aluminum oxide surface in aqueous solution: The effect of surface coverage

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Wenkun; Liu, Haitao, E-mail: xwk584523412@126.com; Sun, Yazhou; Fu, Hongya; Liang, Yingchun

    2017-01-15

    Highlights: • The dynamic conformational change of oil contaminations, at various surface coverages onto perfect α-Al{sub 2}O{sub 3}(0001) surface in aqueous solution is given. • The effect of surface coverage of oil molecules on the driving forces for the conformational change of oil contaminations is described. • The effect of interfacial water on the conformational change and even detachment of oil contaminations is considered. - Abstract: The microscopic conformational change process of oil contaminants adhered onto perfect α-Al{sub 2}O{sub 3} (0001) surface in aqueous solution was investigated by using all-atom classic molecular dynamics simulations. The change in removal mechanism of oil contaminants induced by surface coverage (surface area per molecule) was emphatically explored. Our simulation results strongly reveal that the increase in oil surface coverage induces an evident difference in microscopic detachment processes of oil contaminants. At a low surface coverage, oil contaminants can be thoroughly detached from solid surface. The whole detachment process could be divided into multi stages, including conformational change of oil contaminants on solid surface, dynamic motion of those in bulk solution and rapid migration of those from bulk solution to air/water interface. With surface coverage increasing, water diffusion becomes the key to induce conformational change and promote the detachment of oil contaminants. When oil surface coverage exceeds a threshold value, oil contaminants also undertake an evident conformational change process exhibiting typical characteristics but an incomplete detachment process occurs. All findings of the present study are helpful for the interpretation of the removal mechanism of oil contaminants on solid surface.

  12. Strains of Sarcocystis neurona exhibit differences in their surface antigens, including the absence of the major surface antigen SnSAG1.

    Science.gov (United States)

    Howe, Daniel K; Gaji, Rajshekhar Y; Marsh, Antoinette E; Patil, Bhagyashree A; Saville, William J; Lindsay, David S; Dubey, J P; Granstrom, David E

    2008-05-01

    A gene family of surface antigens is expressed by merozoites of Sarcocystis neurona, the primary cause of equine protozoal myeloencephalitis (EPM). These surface proteins, designated SnSAGs, are immunodominant and therefore excellent candidates for development of EPM diagnostics or vaccines. Prior work had identified an EPM isolate lacking the major surface antigen SnSAG1, thus suggesting there may be some diversity in the SnSAGs expressed by different S. neurona isolates. Therefore, a bioinformatic, molecular and immunological study was conducted to assess conservation of the SnSAGs. Examination of an expressed sequence tag (EST) database revealed several notable SnSAG polymorphisms. In particular, the EST information implied that the EPM strain SN4 lacked the major surface antigen SnSAG1. The absence of this surface antigen from the SN4 strain was confirmed by both Western blot and Southern blot. To evaluate SnSAG polymorphisms in the S. neurona population, 14 strains were examined by Western blots using monospecific polyclonal antibodies against the four described SnSAGs. The results of these analyses demonstrated that SnSAG2, SnSAG3, and SnSAG4 are present in all 14 S. neurona strains tested, although some variance in SnSAG4 was observed. Importantly, SnSAG1 was not detected in seven of the strains, which included isolates from four cases of EPM and a case of fatal meningoencephalitis in a sea otter. Genetic analyses by PCR using gene-specific primers confirmed the absence of the SnSAG1 locus in six of these seven strains. Collectively, the data indicated that there is heterogeneity in the surface antigen composition of different S. neurona isolates, which is an important consideration for development of serological tests and prospective vaccines for EPM. Furthermore, the diversity reported herein likely extends to other phenotypes, such as strain virulence, and may have implications for the phylogeny of the various Sarcocystis spp. that undergo sexual stages

  13. Evaluation of protein adsorption onto a polyurethane nanofiber surface having different segment distributions

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Yuko; Koizumi, Gaku [Frontier Fiber Technology and Science, Graduate School of Engineering, University of Fukui (Japan); Sakamoto, Hiroaki, E-mail: hi-saka@u-fukui.ac.jp [Tenure-Track Program for Innovative Research, University of Fukui (Japan); Suye, Shin-ichiro [Frontier Fiber Technology and Science, Graduate School of Engineering, University of Fukui (Japan)

    2017-02-01

    Electrospinning is well known to be an effective method for fabricating polymeric nanofibers with a diameter of several hundred nanometers. Recently, the molecular-level orientation within nanofibers has attracted particular attention. Previously, we used atomic force microscopy to visualize the phase separation between soft and hard segments of a polyurethane (PU) nanofiber surface prepared by electrospinning. The unstretched PU nanofibers exhibited irregularly distributed hard segments, whereas hard segments of stretched nanofibers prepared with a high-speed collector exhibited periodic structures along the long-axis direction. PU was originally used to inhibit protein adsorption, but because the surface segment distribution was changed in the stretched nanofiber, here, we hypothesized that the protein adsorption property on the stretched nanofiber might be affected. We investigated protein adsorption onto PU nanofibers to elucidate the effects of segment distribution on the surface properties of PU nanofibers. The amount of adsorbed protein on stretched PU nanofibers was increased compared with that of unstretched nanofibers. These results indicate that the hard segment alignment on stretched PU nanofibers mediated protein adsorption. It is therefore expected that the amount of protein adsorption can be controlled by rotation of the collector. - Highlights: • The hard segments of stretched PU nanofibers exhibit periodic structures. • The adsorbed protein on stretched PU nanofibers was increased compared with PU film. • The hard segment alignment on stretched PU nanofibers mediated protein adsorption.

  14. Greenhouse Earth: A Traveling Exhibition

    International Nuclear Information System (INIS)

    Booth, W.H.; Caesar, S.

    1992-09-01

    The Franklin Institute Science Museum provided an exhibit entitled the Greenhouse Earth: A Traveling Exhibition. This 3500 square-foot exhibit on global climate change was developed in collaboration with the Association of Science-Technology Centers. The exhibit opened at The Franklin Institute on February 14, 1992, welcoming 291,000 visitors over its three-month stay. During its three-year tour, Greenhouse Earth will travel to ten US cities, reaching two million visitors. Greenhouse Earth aims to deepen public understanding of the scientific issues of global warming and the conservation measures that can be taken to slow its effects. The exhibit features hands-on exhibitry, interactive computer programs and videos, a theater production, a ''demonstration cart,'' guided tours, and lectures. supplemental educational programs at the Institute included a teachers preview, a symposium on climate change, and a ''satellite field trip.'' The development of Greenhouse Earth included front-end and formative evaluation procedures. Evaluation includes interviews with visitors, prototypes, and summative surveys for participating museums. During its stay in Philadelphia, Greenhouse Earth was covered by the local and national press, with reviews in print and broadcast media. Greenhouse Earth is the first large-scale museum exhibit to address global climate change

  15. Cellulose nanocrystals with tunable surface charge for nanomedicine

    Science.gov (United States)

    Hosseinidoust, Zeinab; Alam, Md Nur; Sim, Goeun; Tufenkji, Nathalie; van de Ven, Theo G. M.

    2015-10-01

    Crystalline nanoparticles of cellulose exhibit attractive properties as nanoscale carriers for bioactive molecules in nanobiotechnology and nanomedicine. For applications in imaging and drug delivery, surface charge is one of the most important factors affecting the performance of nanocarriers. However, current methods of preparation offer little flexibility for controlling the surface charge of cellulose nanocrystals, leading to compromised colloidal stability under physiological conditions. We report a synthesis method that results in nanocrystals with remarkably high carboxyl content (6.6 mmol g-1) and offers continuous control over surface charge without any adjustment to the reaction conditions. Six fractions of nanocrystals with various surface carboxyl contents were synthesized from a single sample of softwood pulp with carboxyl contents varying from 6.6 to 1.7 mmol g-1 and were fully characterized. The proposed method resulted in highly stable colloidal nanocrystals that did not aggregate when exposed to high salt concentrations or serum-containing media. Interactions of these fractions with four different tissue cell lines were investigated over a wide range of concentrations (50-300 μg mL-1). Darkfield hyperspectral imaging and confocal microscopy confirmed the uptake of nanocrystals by selected cell lines without any evidence of membrane damage or change in cell density; however a charge-dependent decrease in mitochondrial activity was observed for charge contents higher than 3.9 mmol g-1. A high surface carboxyl content allowed for facile conjugation of fluorophores to the nanocrystals without compromising colloidal stability. The cellular uptake of fluoresceinamine-conjugated nanocrystals exhibited a time-dose dependent relationship and increased significantly with doubling of the surface charge.Crystalline nanoparticles of cellulose exhibit attractive properties as nanoscale carriers for bioactive molecules in nanobiotechnology and nanomedicine. For

  16. Exhibition

    CERN Multimedia

    Staff Association

    2016-01-01

    Encounters Hanne Blitz From February 1st to 12th 2016 CERN Meyrin, Main Building What is our reaction to a first encounter with a tourist attraction? Contemporary Dutch painter Hanne Blitz captures visitors' responses to art and architecture, sweeping vistas and symbolic memorials. Encounters, a series of oil paintings curated specially for this CERN exhibition, depicts tourists visiting cultural highlights around the world. A thought-provoking journey not to be missed, and a tip of the hat to CERN's large Hadron Collider.

  17. Increased field-emission site density from regrown carbon nanotube films

    International Nuclear Information System (INIS)

    Wang, Y.Y.; Gupta, S.; Liang, M.; Nemanich, R.J.

    2005-01-01

    Electron field-emission properties of as-grown, etched, and regrown carbon nanotube thin films were investigated. The aligned carbon nanotube films were deposited by the microwave plasma-assisted chemical vapor deposition technique. The surface of the as-grown film contained a carbon nanotube mat of amorphous carbon and entangled nanotubes with some tubes protruding from the surface. Hydrogen plasma etching resulted in the removal of the surface layer, and regrowth on the etched surface displayed the formation of a new carbon nanotube mat. The emission site density and the current-voltage dependence of the field emission from all of the samples were analyzed. The results showed that the as-grown sample had a few strong emission spots and a relatively high emission current density (∼20 μA/cm 2 at 1 V/μm), while the regrown sample exhibited a significantly increased emission site density

  18. Modifying TiO{sub 2} surface architecture by oxygen plasma to increase dye sensitized solar cell efficiency

    Energy Technology Data Exchange (ETDEWEB)

    Rajmohan, Gayathri Devi [Institute for Frontier Materials, Deakin University, Geelong Waurn Ponds, Victoria 3216 (Australia); Dai, Xiujuan J., E-mail: jane.dai@deakin.edu.au [Institute for Frontier Materials, Deakin University, Geelong Waurn Ponds, Victoria 3216 (Australia); Tsuzuki, Takuya; Lamb, Peter R. [Institute for Frontier Materials, Deakin University, Geelong Waurn Ponds, Victoria 3216 (Australia); Plessis, Johan du [School of Applied Sciences, RMIT University, GPO Box 2476 V, Melbourne, Victoria 3001 (Australia); Huang, Fuzhi; Cheng, Yi-Bing [Department of Materials Engineering, Monash University, Melbourne, Victoria 3800 (Australia)

    2013-10-31

    Oxygen plasma treatment of TiO{sub 2} films has been used to improve the efficiency of dye sensitized solar cells. Both a commercial TiO{sub 2} sample and a TiO{sub 2} thin film synthesized by a sol-gel technique were treated using a custom built inductively coupled plasma apparatus. X-ray photoelectron spectroscopy revealed that oxygen-plasma treatment increased the number of oxygen functional groups (hydroxyl groups) and introduced some Ti{sup 3+} species on the surface of TiO{sub 2}. A sample solar cell with plasma treated TiO{sub 2} showed an overall solar-to-electricity conversion efficiency of 4.3%, about a 13% increase over untreated TiO{sub 2}. The photon conversion efficiency for the plasma treated TiO{sub 2} was 34% higher than untreated TiO{sub 2}. This enhanced cell-performance is partly due to increased dye adsorption from an increase in surface oxygen functional groups and also may be partly due to Ti{sup 3+} states on the surface of TiO{sub 2}. - Highlights: • Oxygen plasma is used to generate hydroxyl groups on the surface of TiO{sub 2} • Parallel study was conducted using a spin coated TiO{sub 2} and a Commercial TiO{sub 2} film. • The plasma functionalization caused increased dye uptake. • Some species in Ti{sup 3+} state are also generated after oxygen plasma. • Dye sensitised solar cell with functionalised electrode showed improved efficiency.

  19. Surface recombination of oxygen atoms in O2 plasma at increased pressure: II. Vibrational temperature and surface production of ozone

    Science.gov (United States)

    Lopaev, D. V.; Malykhin, E. M.; Zyryanov, S. M.

    2011-01-01

    Ozone production in an oxygen glow discharge in a quartz tube was studied in the pressure range of 10-50 Torr. The O3 density distribution along the tube diameter was measured by UV absorption spectroscopy, and ozone vibrational temperature TV was found comparing the calculated ab initio absorption spectra with the experimental ones. It has been shown that the O3 production mainly occurs on a tube surface whereas ozone is lost in the tube centre where in contrast the electron and oxygen atom densities are maximal. Two models were used to analyse the obtained results. The first one is a kinetic 1D model for the processes occurring near the tube walls with the participation of the main particles: O(3P), O2, O2(1Δg) and O3 molecules in different vibrational states. The agreement of O3 and O(3P) density profiles and TV calculated in the model with observed ones was reached by varying the single model parameter—ozone production probability (\\gamma_{O_{3}}) on the quartz tube surface on the assumption that O3 production occurs mainly in the surface recombination of physisorbed O(3P) and O2. The phenomenological model of the surface processes with the participation of oxygen atoms and molecules including singlet oxygen molecules was also considered to analyse \\gamma_{O_{3}} data obtained in the kinetic model. A good agreement between the experimental data and the data of both models—the kinetic 1D model and the phenomenological surface model—was obtained in the full range of the studied conditions that allowed consideration of the ozone surface production mechanism in more detail. The important role of singlet oxygen in ozone surface production was shown. The O3 surface production rate directly depends on the density of physisorbed oxygen atoms and molecules and can be high with increasing pressure and energy inputted into plasma while simultaneously keeping the surface temperature low enough. Using the special discharge cell design, such an approach opens up the

  20. Surface recombination of oxygen atoms in O2 plasma at increased pressure: II. Vibrational temperature and surface production of ozone

    International Nuclear Information System (INIS)

    Lopaev, D V; Malykhin, E M; Zyryanov, S M

    2011-01-01

    Ozone production in an oxygen glow discharge in a quartz tube was studied in the pressure range of 10-50 Torr. The O 3 density distribution along the tube diameter was measured by UV absorption spectroscopy, and ozone vibrational temperature T V was found comparing the calculated ab initio absorption spectra with the experimental ones. It has been shown that the O 3 production mainly occurs on a tube surface whereas ozone is lost in the tube centre where in contrast the electron and oxygen atom densities are maximal. Two models were used to analyse the obtained results. The first one is a kinetic 1D model for the processes occurring near the tube walls with the participation of the main particles: O( 3 P), O 2 , O 2 ( 1 Δ g ) and O 3 molecules in different vibrational states. The agreement of O 3 and O( 3 P) density profiles and T V calculated in the model with observed ones was reached by varying the single model parameter-ozone production probability (γ O 3 ) on the quartz tube surface on the assumption that O 3 production occurs mainly in the surface recombination of physisorbed O( 3 P) and O 2 . The phenomenological model of the surface processes with the participation of oxygen atoms and molecules including singlet oxygen molecules was also considered to analyse γ O 3 data obtained in the kinetic model. A good agreement between the experimental data and the data of both models-the kinetic 1D model and the phenomenological surface model-was obtained in the full range of the studied conditions that allowed consideration of the ozone surface production mechanism in more detail. The important role of singlet oxygen in ozone surface production was shown. The O 3 surface production rate directly depends on the density of physisorbed oxygen atoms and molecules and can be high with increasing pressure and energy inputted into plasma while simultaneously keeping the surface temperature low enough. Using the special discharge cell design, such an approach opens up

  1. Brazilian air traffic controllers exhibit excessive sleepiness.

    Science.gov (United States)

    Ribas, Valdenilson Ribeiro; de Almeida, Cláudia Ângela Vilela; Martins, Hugo André de Lima; Alves, Carlos Frederico de Oliveira; Alves, Marcos José Pinheiro Cândido; Carneiro, Severino Marcos de Oliveira; Ribas, Valéria Ribeiro; de Vasconcelos, Carlos Augusto Carvalho; Sougey, Everton Botelho; de Castro, Raul Manhães

    2011-01-01

    Excessive sleepiness (ES) is an increased tendency to initiate involuntary sleep for naps at inappropriate times. The objective of this study was to assess ES in air traffic controllers (ATCo). 45 flight protection professionals were evaluated, comprising 30 ATCo, subdivided into ATCo with ten or more years in the profession (ATCo≥10, n=15) and ATCo with less than ten years in the profession (ATCoair traffic controllers exhibit excessive sleepiness.

  2. Investigating Design Research Landscapes through Exhibition

    DEFF Research Database (Denmark)

    Jönsson, Li; Hansen, Flemming Tvede; Mäkelä, Maarit

    2013-01-01

    What characterizes a design research exhibition compared to a traditional design and art exhibition? How do you show the very materialities of the design experiments as a means for communicating knowledge of research and of practice? How do you present, review and utilize such an exhibition......? With those questions in mind, the intention and challenge for the Nordes 2013 Design Research Exhibition was to expand on current notions of staging research enquires in design research conference contexts. Artefacts, installations, performances, and other materialities that relate to the theme...... of the conference - Experiments in Design Research – were displayed as tools to express and communicate different design research enquires. Through this paper we will describe the Nordes exhibition as a specific case that renders questions visible in relation to how to utilize a design research exhibition...

  3. Integrated CLOS and PN Guidance for Increased Effectiveness of Surface to Air Missiles

    Directory of Open Access Journals (Sweden)

    Binte Fatima Tuz ZAHRA

    2017-06-01

    Full Text Available In this paper, a novel approach has been presented to integrate command to line-of-sight (CLOS guidance and proportional navigation (PN guidance in order to reduce miss distance and to increase the effectiveness of surface to air missiles. Initially a comparison of command to line-of-sight guidance and proportional navigation has been presented. Miss distance, variation of angle-of-attack, normal and lateral accelerations and error of missile flight path from direct line-of-sight have been used as noteworthy criteria for comparison of the two guidance laws. Following this comparison a new approach has been proposed for determining the most suitable guidance gains in order to minimize miss distance and improve accuracy of the missile in delivering the warhead, while using CLOS guidance. This proposed technique is based on constrained nonlinear minimization to optimize the guidance gains. CLOS guidance has a further limitation of significant increase in normal and lateral acceleration demands during the terminal phase of missile flight. Furthermore, at large elevation angles, the required angle-of-attack during the terminal phase increases beyond design specifications. Subsequently, a missile with optical sensors only and following just the CLOS guidance has less likelihood to hit high speed targets beyond 45º in elevation plane. A novel approach has thus been proposed to overcome such limitations of CLOS-only guidance for surface to air missiles. In this approach, an integrated guidance algorithm has been proposed whereby the initial guidance law during rocket motor burnout phase remains CLOS, whereas immediately after this phase, the guidance law is automatically switched to PN guidance. This integrated approach has not only resulted in slight increase in range of the missile but also has significantly improved its likelihood to hit targets beyond 30 degrees in elevation plane, thus successfully overcoming various limitations of CLOS

  4. Transgenic tobacco plants constitutively expressing peanut BTF3 exhibit increased growth and tolerance to abiotic stresses.

    Science.gov (United States)

    Pruthvi, V; Rama, N; Parvathi, M S; Nataraja, K N

    2017-05-01

    Abiotic stresses limit crop growth and productivity worldwide. Cellular tolerance, an important abiotic stress adaptive trait, involves coordinated activities of multiple proteins linked to signalling cascades, transcriptional regulation and other diverse processes. Basal transcriptional machinery is considered to be critical for maintaining transcription under stressful conditions. From this context, discovery of novel basal transcription regulators from stress adapted crops like peanut would be useful for improving tolerance of sensitive plant types. In this study, we prospected a basal transcription factor, BTF3 from peanut (Arachis hypogaea L) and studied its relevance in stress acclimation by over expression in tobacco. AhBTF3 was induced under PEG-, NaCl-, and methyl viologen-induced stresses in peanut. The constitutive expression of AhBTF3 in tobacco increased plant growth under non stress condition. The transgenic plants exhibited superior phenotype compared to wild type under mannitol- and NaCl-induced stresses at seedling level. The enhanced cellular tolerance of transgenic plants was evidenced by higher cell membrane stability, reactive oxygen species (ROS) scavenging activity, seedling survival and vigour than wild type. The transgenic lines showed better in vitro regeneration capacity on growth media supplemented with NaCl than wild type. Superior phenotype of transgenic plants under osmotic and salinity stresses seems to be due to constitutive activation of genes of multiple pathways linked to growth and stress adaptation. The study demonstrated that AhBTF3 is a positive regulator of growth and stress acclimation and hence can be considered as a potential candidate gene for crop improvement towards stress adaptation. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  5. Tumor suppressor protein SMAR1 modulates the roughness of cell surface: combined AFM and SEM study

    Directory of Open Access Journals (Sweden)

    Mamgain Hitesh

    2009-10-01

    Full Text Available Abstract Background Imaging tools such as scanning electron microscope (SEM and atomic force microscope (AFM can be used to produce high-resolution topographic images of biomedical specimens and hence are well suited for imaging alterations in cell morphology. We have studied the correlation of SMAR1 expression with cell surface smoothness in cell lines as well as in different grades of human breast cancer and mouse tumor sections. Methods We validated knockdown and overexpression of SMAR1 using RT-PCR as well as Western blotting in human embryonic kidney (HEK 293, human breast cancer (MCF-7 and mouse melanoma (B16F1 cell lines. The samples were then processed for cell surface roughness studies using atomic force microscopy (AFM and scanning electron microscopy (SEM. The same samples were used for microarray analysis as well. Tumors sections from control and SMAR1 treated mice as well as tissues sections from different grades of human breast cancer on poly L-lysine coated slides were used for AFM and SEM studies. Results Tumor sections from mice injected with melanoma cells showed pronounced surface roughness. In contrast, tumor sections obtained from nude mice that were first injected with melanoma cells followed by repeated injections of SMAR1-P44 peptide, exhibited relatively smoother surface profile. Interestingly, human breast cancer tissue sections that showed reduced SMAR1 expression exhibited increased surface roughness compared to the adjacent normal breast tissue. Our AFM data establishes that treatment of cells with SMAR1-P44 results into increase in cytoskeletal volume that is supported by comparative gene expression data showing an increase in the expression of specific cytoskeletal proteins compared to the control cells. Altogether, these findings indicate that tumor suppressor function of SMAR1 might be exhibited through smoothening of cell surface by regulating expression of cell surface proteins. Conclusion Tumor suppressor

  6. A mini-exhibition with maximum content

    CERN Multimedia

    Laëtitia Pedroso

    2011-01-01

    The University of Budapest has been hosting a CERN mini-exhibition since 8 May. While smaller than the main travelling exhibition it has a number of major advantages: its compact design alleviates transport difficulties and makes it easier to find suitable venues in the Member States. Its content can be updated almost instantaneously and it will become even more interactive and high-tech as time goes by.   The exhibition on display in Budapest. The purpose of CERN's new mini-exhibition is to be more interactive and easier to install. Due to its size, the main travelling exhibition cannot be moved around quickly, which is why it stays in the same country for 4 to 6 months. But this means a long waiting list for the other Member States. To solve this problem, the Education Group has designed a new exhibition, which is smaller and thus easier to install. Smaller maybe, but no less rich in content, as the new exhibition conveys exactly the same messages as its larger counterpart. However, in the slimm...

  7. Musealization without museology: national museums and fashion exhibitions between history, theory and practice

    Directory of Open Access Journals (Sweden)

    Stefan Žarić

    2016-03-01

    Full Text Available Studies of the theory and history of fashion, which were up until recently grouped with culture studies, gender studies, communicology, art history and anthropology are, on the academic map of the 21st century being established as separate disciplines. Consolidating these contexts, the affirmation of fashion studies has been most prevalent within the museology of fashion, as it - or rather – fashion museology is becoming one of the leading tendencies within contemporary museum practices. This paper views fashion as a specific kind of system, coded through sociocultural codes, and finds the reason for the ever-increasing number of exhibitions of fashion on the international as well as the national museum scene in the codes of fashion which oscillate between the aesthetic and the commercial. By affirming fashion as an art form on the one hand and increasing the profitability of the institution on the other, fashion exhibitions enable museums to become „fashionable“ – to keep up with contemporary, more liberal exhibition concepts. Despite the fact that in this year there have been a large number of fashion exhibitions in national museums, fashion is still without its own museology, a scientific theory which would explain it as a museum phenomenon. The exhibits are interpreted historically, while explaining their utilitarian and aesthetic value, while the question of why fashion is exhibited as an art form or a kind of cultural production to the consumer of the exhibition - the visitor – remains unanswered. By analyzing historical events which conditioned the museum exhibiting of fashion as well as the different conceptions of its exhibition, the author strives to – through the juxtaposition of international and national exhibitions catch sight of the causes of the lack of a museology of fashion, and open up the issue of its affirmation within the professional academic and museum community of Serbia.

  8. Influence of nanopore surface charge and magnesium ion on polyadenosine translocation

    International Nuclear Information System (INIS)

    Lepoitevin, Mathilde; Bechelany, Mikhael; Janot, Jean-Marc; Balme, Sebastien; Coulon, Pierre Eugène; Cambedouzou, Julien

    2015-01-01

    We investigate the influence of a nanopore surface state and the addition of Mg 2+ on poly-adenosine translocation. To do so, two kinds of nanopores with a low aspect ratio (diameter ∼3–5 nm, length 30 nm) were tailored: the first one with a negative charge surface and the second one uncharged. It was shown that the velocity and the energy barrier strongly depend on the nanopore surface. Typically if the nanopore and polyA exhibit a similar charge, the macromolecule velocity increases and its global energy barrier of entrance in the nanopore decreases, as opposed to the non-charged nanopore. Moreover, the addition of a divalent chelating cation induces an increase of energy barrier of entrance, as expected. However, for a negative nanopore, this effect is counterbalanced by the inversion of the surface charge induced by the adsorption of divalent cations. (paper)

  9. Slip length crossover on a graphene surface

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Zhi, E-mail: liangz3@rpi.edu [Rensselaer Nanotechnology Center, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Keblinski, Pawel, E-mail: keplip@rpi.edu [Rensselaer Nanotechnology Center, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Department of Materials Science and Engineering, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)

    2015-04-07

    Using equilibrium and non-equilibrium molecular dynamics simulations, we study the flow of argon fluid above the critical temperature in a planar nanochannel delimited by graphene walls. We observe that, as a function of pressure, the slip length first decreases due to the decreasing mean free path of gas molecules, reaches the minimum value when the pressure is close to the critical pressure, and then increases with further increase in pressure. We demonstrate that the slip length increase at high pressures is due to the fact that the viscosity of fluid increases much faster with pressure than the friction coefficient between the fluid and the graphene. This behavior is clearly exhibited in the case of graphene due to a very smooth potential landscape originating from a very high atomic density of graphene planes. By contrast, on surfaces with lower atomic density, such as an (100) Au surface, the slip length for high fluid pressures is essentially zero, regardless of the nature of interaction between fluid and the solid wall.

  10. Switchable directional excitation surface plasmon polaritons with dielectric nanoantennas

    DEFF Research Database (Denmark)

    Sinev, I.; Komissarenko, F.; Bogdanov, A.

    We demonstrate directional launching of surface plasmon polaritons on thin goldfilm with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation, which is driven by the mutual interference of magnetic and elect......We demonstrate directional launching of surface plasmon polaritons on thin goldfilm with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation, which is driven by the mutual interference of magnetic...

  11. Impacts of visitor number on Kangaroos housed in free-range exhibits.

    Science.gov (United States)

    Sherwen, Sally L; Hemsworth, Paul H; Butler, Kym L; Fanson, Kerry V; Magrath, Michael J L

    2015-01-01

    Free range exhibits are becoming increasingly popular in zoos as a means to enhance interaction between visitors and animals. However very little research exists on the impacts of visitors on animal behaviour and stress in free range exhibits. We investigated the effects of visitor number on the behaviour and stress physiology of Kangaroo Island (KI) Kangaroos, Macropus fuliginosus fuliginosus, and Red Kangaroos, Macropus rufus, housed in two free range exhibits in Australian zoos. Behavioural observations were conducted on individual kangaroos at each site using instantaneous scan sampling to record activity (e.g., vigilance, foraging, resting) and distance from the visitor pathway. Individually identifiable faecal samples were collected at the end of each study day and analysed for faecal glucocorticoid metabolite (FGM) concentration. When visitor number increased, both KI Kangaroos and Red Kangaroos increased the time spent engaged in visitor-directed vigilance and KI Kangaroos also increased the time spent engaged in locomotion and decreased the time spent resting. There was no effect of visitor number on the distance kangaroos positioned themselves from the visitor pathway or FGM concentration in either species. While there are limitations in interpreting these results in terms of fear of visitors, there was no evidence of adverse effects animal welfare in these study groups based on avoidance behaviour or stress physiology under the range of visitor numbers that we studied. © 2015 Wiley Periodicals, Inc.

  12. Interaction between D-fructose dehydrogenase and methoxy-substituent-functionalized carbon surface to increase productive orientations

    International Nuclear Information System (INIS)

    Xia, Hong-qi; Hibino, Yuya; Kitazumi, Yuki; Shirai, Osamu; Kano, Kenji

    2016-01-01

    Highlights: • Methoxy-functionalized surface improves the DET-type bioelectrocatalysis of FDH. • Methoxy-functionalized surface increases productive orientations. • The total catalytic activity of FDH is almost independent of the modification. • High current density as well as good stability is useful for biofuel cells. - Abstract: D-Fructose dehydrogenase (FDH) from Gluconobacter japonicus NBRC3260 catalyzes the two-electron oxidation of D-fructose to 5-keto-D-fructose, and it is widely used in biofuel cells and biosensors. In this study, methoxy-substituent-functionalized carbon electrodes are constructed by electrochemical oxidation of methoxy-aniline derivatives on Ketjen Black (KB)-modified electrodes to improve the immobilization and bioelectrocatalysis of FDH. It is proposed that the specific interaction between FDH, especially the heme c moiety, and methoxy substituent(s) of amines on carbon electrode increases the proportion of the productively oriented FDH molecules to the total FDHs. Consequently, the limiting catalytic current density of the D-fructose oxidation increases to as much as 23 ± 2 mA cm −2 in FDH/2,4-dimethoxyaniline/KB/glassy carbon electrode, for example.

  13. Effect of sealer coating and storage methods on the surface roughness of soft liners.

    Science.gov (United States)

    Usta Kutlu, Ilknur; Yanikoğlu, Nuran Dinckal; Kul, Esra; Duymuş, Zeynep Yesïl; Sağsöz, Nurdan Polat

    2016-03-01

    A soft lining is applied under a removable prosthesis for various reasons. The porosity of the lining material may increase colonization by microorganisms and cause tissue inflammation. The purpose of this in vitro study was to evaluate the effect of sealer coating on the surface roughness of soft lining materials under 4 different conditions. A total of 125 specimens were prepared. One high-temperature silicone-based soft lining material and 2 room-temperature-polymerized soft lining materials (1 silicone-based and 1 methacrylate-based) were used. Twenty-five specimens of each room-temperature soft lining material were coated with 2 layers of surface sealer. Additionally, 5 specimens of each material were stored in either distilled water, Coca-Cola, denture cleanser, saliva, or air. The surface roughness was measured at baseline and after 1, 7, 14, and 28 days. Surface roughness values were analyzed with repeated measures analysis of variance, and the Bonferroni multiple comparison test was performed using time-dependent groups and storage methods. In the time-dependent groups, methacrylate-based sealer-coated soft liners exhibited a significant increase in roughness (1.74-2.09 μm, P.05). Therefore, the sealer coating was not effective in reducing surface roughness. Among the time-dependent storage methods, the denture cleanser exhibited an almost significant increase in roughness (1.83-1.99 μm, P=.054). Coca-Cola and artificial saliva did not show a significant difference (P>.05). However, a significant decrease in roughness was found with distilled water (P=.02) and air (P<.001). Statistically significant differences in surface roughness were found among the different types of soft liners. The sealer coating had no significant effect, and denture cleanser slightly increased the surface roughness. Contrary to expectations, the roughness did not increase in all groups over time. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry

  14. Sea Surface Warming and Increased Aridity at Mid-latitudes during Eocene Thermal Maximum 2

    Science.gov (United States)

    Harper, D. T.; Zeebe, R. E.; Hoenisch, B.; Schrader, C.; Lourens, L. J.; Zachos, J. C.

    2017-12-01

    Early Eocene hyperthermals, i.e. abrupt global warming events characterized by the release of isotopically light carbon to the atmosphere, can provide insight into the sensitivity of the Earth's climate system and hydrologic cycle to carbon emissions. Indeed, the largest Eocene hyperthermal, the Paleocene-Eocene Thermal Maximum (PETM), has provided one case study of extreme and abrupt global warming, with a mass of carbon release roughly equivalent to total modern fossil fuel reserves and a release rate 1/10 that of modern. Global sea surface temperatures (SST) increased by 5-8°C during the PETM and extensive evidence from marine and terrestrial records indicates significant shifts in the hydrologic cycle consistent with an increase in poleward moisture transport in response to surface warming. The second largest Eocene hyperthermal, Eocene Thermal Maximum 2 (ETM-2) provides an additional calibration point for determining the sensitivity of climate and the hydrologic cycle to massive carbon release. Marine carbon isotope excursions (CIE) and warming at the ETM-2 were roughly half as large as at the PETM, but reliable evidence for shifts in temperature and the hydrologic cycle are sparse for the ETM-2. Here, we utilize coupled planktic foraminiferal δ18O and Mg/Ca to determine ΔSST and ΔSSS (changes in sea surface temperature and salinity) for ETM-2 at ODP Sites 1209 (28°N paleolatitude in the Pacific) and 1265 (42°S paleolatitude in the S. Atlantic), accounting for potential pH influence on the two proxies by using LOSCAR climate-carbon cycle simulated ΔpH. Our results indicate a warming of 2-4°C at both mid-latitude sites and an increase in SSS of 1-3ppt, consistent with simulations of early Paleogene hydroclimate that suggest an increase in low- to mid-latitude aridity due to an intensification of moisture transport to high-latitudes. Furthermore, the magnitude of the CIE and warming for ETM-2 scales with the CIE and warming for the PETM, suggesting that

  15. Universal method for protein bioconjugation with nanocellulose scaffolds for increased cell adhesion.

    Science.gov (United States)

    Kuzmenko, Volodymyr; Sämfors, Sanna; Hägg, Daniel; Gatenholm, Paul

    2013-12-01

    Bacterial nanocellulose (BNC) is an emerging biomaterial since it is biocompatible, integrates well with host tissue and can be biosynthesized in desired architecture. However, being a hydrogel, it exhibits low affinity for cell attachment, which is crucial for the cellular fate process. To increase cell attachment, the surface of BNC scaffolds was modified with two proteins, fibronectin and collagen type I, using an effective bioconjugation method applying 1-cyano-4-dimethylaminopyridinium (CDAP) tetrafluoroborate as the intermediate catalytic agent. The effect of CDAP treatment on cell adhesion to the BNC surface is shown for human umbilical vein endothelial cells and the mouse mesenchymal stem cell line C3H10T1/2. In both cases, the surface modification increased the number of cells attached to the surfaces. In addition, the morphology of the cells indicated more healthy and viable cells. CDAP activation of bacterial nanocellulose is shown to be a convenient method to conjugate extracellular proteins to the scaffold surfaces. CDAP treatment can be performed in a short period of time in an aqueous environment under heterogeneous and mild conditions preserving the nanofibrillar network of cellulose. © 2013.

  16. Fractal and multifractal characteristics of swift heavy ion induced self-affine nanostructured BaF{sub 2} thin film surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Yadav, R. P.; Mittal, A. K. [Department of Physics, University of Allahabad, Allahabad 211002 (India); Kumar, Manvendra, E-mail: kmanav@gmail.com; Pandey, A. C. [Nanotechnology Application Centre, University of Allahabad, Allahabad 211002 (India)

    2015-08-15

    Fractal and multifractal characteristics of self-affine surfaces of BaF{sub 2} thin films, deposited on crystalline Si 〈1 1 1〉 substrate at room temperature, were studied. Self-affine surfaces were prepared by irradiation of 120 MeV Ag{sup 9+} ions which modified the surface morphology at nanometer scale. The surface morphology of virgin thin film and those irradiated with different ion fluences are characterized by atomic force microscopy technique. The surface roughness (interface width) shows monotonic decrease with ion fluences, while the other parameters, such as lateral correlation length, roughness exponent, and fractal dimension, did not show either monotonic decrease or increase in nature. The self-affine nature of the films is further confirmed by autocorrelation function. The power spectral density of thin films surfaces exhibits inverse power law variation with spatial frequency, suggesting the existence of fractal component in surface morphology. The multifractal detrended fluctuation analysis based on the partition function approach is also performed on virgin and irradiated thin films. It is found that the partition function exhibits the power law behavior with the segment size. Moreover, it is also seen that the scaling exponents vary nonlinearly with the moment, thereby exhibiting the multifractal nature.

  17. Photoionization microscopy of hydrogen atom near a metal surface

    International Nuclear Information System (INIS)

    Yang Hai-Feng; Wang Lei; Liu Xiao-Jun; Liu Hong-Ping

    2011-01-01

    We have studied the ionization of Rydberg hydrogen atom near a metal surface with a semiclassical analysis of photoionization microscopy. Interference patterns of the electron radial distribution are calculated at different scaled energies above the classical saddle point and at various atom—surface distances. We find that different types of trajectories contribute predominantly to different manifolds in a certain interference pattern. As the scaled energy increases, the structure of the interference pattern evolves smoothly and more types of trajectories emerge. As the atom approaches the metal surface closer, there are more types of trajectories contributing to the interference pattern as well. When the Rydberg atom comes very close to the metal surface or the scaled energy approaches the zero field ionization energy, the potential induced by the metal surface will make atomic system chaotic. The results also show that atoms near a metal surface exhibit similar properties like the atoms in the parallel electric and magnetic fields. (atomic and molecular physics)

  18. Transience of plasma surface modification as an adhesion promoter for polychlorotrifluorethylene

    CERN Document Server

    Subramanian, S; Love, B J; Romand, M; Charbonnier, M

    2002-01-01

    Poly(chlorotrifluoroethylene) (PCTFE) and other fluoropolymers are increasingly used as inner layer dielectrics. However, these polymers have low surface energies and correspondingly poor adhesive properties. Results are presented on the use of a low-pressure ammonia plasma to enhance the surface bondability of PCTFE. The plasma modified PCTFE film surfaces were characterized by x-ray photoelectron spectroscopy and contact angle measurements. Surface modified films exhibited improved adhesion to electroless copper deposits (180 deg. peel test) compared to coated PCTFE controls and that underwent no plasma exposure. Annealing studies were conducted between 30 and 100 deg. C to examine the stability of the plasma-modified surfaces. For samples annealed below T sub g , contact angle measurements indicated that the plasma-introduced groups remained bound on the surface for four weeks. For specimens annealed above T sub g , the surface functionalities were absorbed within the bulk and surface rearrangement occurre...

  19. In situ measurement of fixed charge evolution at silicon surfaces during atomic layer deposition

    International Nuclear Information System (INIS)

    Ju, Ling; Watt, Morgan R.; Strandwitz, Nicholas C.

    2015-01-01

    Interfacial fixed charge or interfacial dipoles are present at many semiconductor-dielectric interfaces and have important effects upon device behavior, yet the chemical origins of these electrostatic phenomena are not fully understood. We report the measurement of changes in Si channel conduction in situ during atomic layer deposition (ALD) of aluminum oxide using trimethylaluminum and water to probe changes in surface electrostatics. Current-voltage data were acquired continually before, during, and after the self-limiting chemical reactions that result in film growth. Our measurements indicated an increase in conductance on p-type samples with p + ohmic contacts and a decrease in conductance on analogous n-type samples. Further, p + contacted samples with n-type channels exhibited an increase in measured current and n + contacted p-type samples exhibited a decrease in current under applied voltage. Device physics simulations, where a fixed surface charge was parameterized on the channel surface, connect the surface charge to changes in current-voltage behavior. The simulations and analogous analytical relationships for near-surface conductance were used to explain the experimental results. Specifically, the changes in current-voltage behavior can be attributed to the formation of a fixed negative charge or the modification of a surface dipole upon chemisorption of trimethylaluminum. These measurements allow for the observation of fixed charge or dipole formation during ALD and provide further insight into the electrostatic behavior at semiconductor-dielectric interfaces during film nucleation

  20. Science Fiction Exhibits as STEM Gateways

    Science.gov (United States)

    Robie, Samantha

    Women continue to hold less than a quarter of all STEM jobs in the United States, prompting many museums to develop programs and exhibits with the express goal of interesting young girls in scientific fields. At the same time, a number of recent museum exhibits have harnessed the popularity of pop culture and science fiction in order to interest general audiences in STEM subject matter, as well as using the exhibits as springboards to expand or shift mission goals and focus. Because science fiction appears to be successful at raising interest in STEM fields, it may be an effective way to garner the interest of young girls in STEM in particular. This research seeks to describe the ways in which museums are currently using science fiction exhibits to interest young girls in STEM fields and careers. Research focused on four institutions across the country hosting three separate exhibits, and included staff interviews and content analysis of exhibit descriptions, promotional materials, a summative evaluation and supplementary exhibit productions. In some ways, science fiction exhibits do serve young girls, primarily through the inclusion of female role models, staff awareness, and prototype testing to ensure interactives are attractive to girls as well as to boys. However, STEM appears to be underutilized, which may be partly due to a concern within the field that the outcome of targeting a specific gender could be construed as "stereotyping".

  1. Surface effects on the mechanical properties of nanoporous materials

    International Nuclear Information System (INIS)

    Xia Re; Li Xide; Feng Xiqiao; Qin Qinghua; Liu Jianlin

    2011-01-01

    Using the theory of surface elasticity, we investigate the mechanical properties of nanoporous materials. The classical theory of porous materials is modified to account for surface effects, which become increasingly important as the characteristic sizes of microstructures shrink to nanometers. First, a refined Timoshenko beam model is presented to predict the effective elastic modulus of nanoporous materials. Then the surface effects on the elastic microstructural buckling behavior of nanoporous materials are examined. In particular, nanoporous gold is taken as an example to illustrate the application of the proposed model. The results reveal that both the elastic modulus and the critical buckling behavior of nanoporous materials exhibit a distinct dependence on the characteristic sizes of microstructures, e.g. the average ligament width.

  2. Surface effects on the mechanical properties of nanoporous materials

    Energy Technology Data Exchange (ETDEWEB)

    Xia Re [School of Power and Mechanical Engineering, Wuhan University, Wuhan 430072 (China); Li Xide; Feng Xiqiao [AML, Department of Engineering Mechanics, Tsinghua University, Beijing 100084 (China); Qin Qinghua [School of Engineering, Australian National University, Canberra, ACT 0200 (Australia); Liu Jianlin, E-mail: fengxq@tsinghua.edu.cn [Department of Engineering Mechanics, China University of Petroleum, Qingdao 266555 (China)

    2011-07-01

    Using the theory of surface elasticity, we investigate the mechanical properties of nanoporous materials. The classical theory of porous materials is modified to account for surface effects, which become increasingly important as the characteristic sizes of microstructures shrink to nanometers. First, a refined Timoshenko beam model is presented to predict the effective elastic modulus of nanoporous materials. Then the surface effects on the elastic microstructural buckling behavior of nanoporous materials are examined. In particular, nanoporous gold is taken as an example to illustrate the application of the proposed model. The results reveal that both the elastic modulus and the critical buckling behavior of nanoporous materials exhibit a distinct dependence on the characteristic sizes of microstructures, e.g. the average ligament width.

  3. Uranium(VI) sorption onto magnetite. Increasing confidence in surface complexation models using chemically evident surface chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Bok, Frank [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Surface Processes

    2017-06-01

    Surface complexation models have made great efforts in describing the sorption of various radionuclides on naturally occurring mineral phases. Unfortunately, many of the published sorption parameter sets are built upon unrealistic or even wrong surface chemistry. This work describes the benefit of combining spectroscopic and batch sorption experimental data to create a reliable and consistent surface complexation parameter set.

  4. Divergent surface and total soil moisture projections under global warming

    Science.gov (United States)

    Berg, Alexis; Sheffield, Justin; Milly, Paul C.D.

    2017-01-01

    Land aridity has been projected to increase with global warming. Such projections are mostly based on off-line aridity and drought metrics applied to climate model outputs but also are supported by climate-model projections of decreased surface soil moisture. Here we comprehensively analyze soil moisture projections from the Coupled Model Intercomparison Project phase 5, including surface, total, and layer-by-layer soil moisture. We identify a robust vertical gradient of projected mean soil moisture changes, with more negative changes near the surface. Some regions of the northern middle to high latitudes exhibit negative annual surface changes but positive total changes. We interpret this behavior in the context of seasonal changes in the surface water budget. This vertical pattern implies that the extensive drying predicted by off-line drought metrics, while consistent with the projected decline in surface soil moisture, will tend to overestimate (negatively) changes in total soil water availability.

  5. Surface modification of carbon fibers by a polyether sulfone emulsion sizing for increased interfacial adhesion with polyether sulfone

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Haojie [National Engineering Laboratory for Carbon Fiber Technology, Institute of Coal Chemistry, Chinese Academy of Sciences, Taiyuan 030001 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhang, Shouchun, E-mail: zschun@sxicc.ac.cn [National Engineering Laboratory for Carbon Fiber Technology, Institute of Coal Chemistry, Chinese Academy of Sciences, Taiyuan 030001 (China); Lu, Chunxiang [National Engineering Laboratory for Carbon Fiber Technology, Institute of Coal Chemistry, Chinese Academy of Sciences, Taiyuan 030001 (China)

    2014-10-30

    Highlights: • A polyether sulfone emulsion (PES) sizing was prepared for the first time. • The sizing enhanced the surface activity and wettability of carbon fibers. • Compared to the original sizing, the PES emulsion sizing resulted in an 18.4% increase in the interlaminar shear strength of carbon fiber/PES composites. • Important influences of emulsifier on the fiber surface and composite interface were demonstrated. • The reinforcing mechanisms are the improved fiber surface wettability and interfacial compatibility in composites. - Abstract: Interests on carbon fiber-reinforced thermoplastic composites are growing rapidly, but the challenges with poor interfacial adhesion have slowed their adoption. In this work, a polyether sulfone (PES) emulsion sizing was prepared successfully for increased interfacial adhesion of carbon fiber/PES composites. To obtain a high-quality PES emulsion sizing, the key factor, emulsifier concentration, was studied by dynamic light scattering technique. The results demonstrated that the suitable weight ratio of PES to emulsifier was 8:3, and the resulting PES emulsion sizing had an average particle diameter of 117 nm and Zeta potential of −52.6 mV. After sizing, the surface oxygen-containing functional groups, free energy and wettability of carbon fibers increased significantly, which were advantageous to promote molecular-level contact between carbon fiber and PES. Finally, short beam shear tests were performed to evaluate the interfacial adhesion of carbon fiber/PES composites. The results indicated that PES emulsion sizing played a critical role for the enhanced interfacial adhesion in carbon fiber/PES composites, and a 26% increase of interlaminar shear strength was achieved, because of the improved fiber surface wettability and interfacial compatibility between carbon fiber and PES.

  6. Surface modification of carbon fibers by a polyether sulfone emulsion sizing for increased interfacial adhesion with polyether sulfone

    International Nuclear Information System (INIS)

    Yuan, Haojie; Zhang, Shouchun; Lu, Chunxiang

    2014-01-01

    Highlights: • A polyether sulfone emulsion (PES) sizing was prepared for the first time. • The sizing enhanced the surface activity and wettability of carbon fibers. • Compared to the original sizing, the PES emulsion sizing resulted in an 18.4% increase in the interlaminar shear strength of carbon fiber/PES composites. • Important influences of emulsifier on the fiber surface and composite interface were demonstrated. • The reinforcing mechanisms are the improved fiber surface wettability and interfacial compatibility in composites. - Abstract: Interests on carbon fiber-reinforced thermoplastic composites are growing rapidly, but the challenges with poor interfacial adhesion have slowed their adoption. In this work, a polyether sulfone (PES) emulsion sizing was prepared successfully for increased interfacial adhesion of carbon fiber/PES composites. To obtain a high-quality PES emulsion sizing, the key factor, emulsifier concentration, was studied by dynamic light scattering technique. The results demonstrated that the suitable weight ratio of PES to emulsifier was 8:3, and the resulting PES emulsion sizing had an average particle diameter of 117 nm and Zeta potential of −52.6 mV. After sizing, the surface oxygen-containing functional groups, free energy and wettability of carbon fibers increased significantly, which were advantageous to promote molecular-level contact between carbon fiber and PES. Finally, short beam shear tests were performed to evaluate the interfacial adhesion of carbon fiber/PES composites. The results indicated that PES emulsion sizing played a critical role for the enhanced interfacial adhesion in carbon fiber/PES composites, and a 26% increase of interlaminar shear strength was achieved, because of the improved fiber surface wettability and interfacial compatibility between carbon fiber and PES

  7. Photowalk Exhibition opens at Microcosm

    CERN Document Server

    Katarina Anthony

    2011-01-01

    The winning photographs from the 2010 Global Particle Physics Photowalk competition will go on display at Microcosm from 11 February to 2 April. The exhibition is part of a global photography event taking place over three continents, with Photowalk exhibitions opening simultaneously at Fermilab in the US, KEK in Japan and here at CERN.   DESY wire chamber - First place people's choice; second place global jury competition. Photographer: Hans-Peter Hildebrandt  If you were one of the 1,300 photography lovers who voted in last year’s Photowalk competition, this exhibition is your chance to see the winning entries in print. The exhibition will take place in the downstairs gallery of Microcosm, overlooking the garden. 15 photographs will be on display, with each of the laboratories that participated in Photowalk represented by their 3 winning entries. Among them will be the “people’s choice” sunburst photo of a particle detector at DESY (Photo 1), and...

  8. Creating National Narrative: The Red Guard Art Exhibitions and the National Exhibitions in the Chinese Cultural Revolution 1966 - 1976

    Directory of Open Access Journals (Sweden)

    Winnie Tsang

    2014-06-01

    Full Text Available The artistic development in China experienced drastic changes during the Cultural Revolution from 1966 to 1976. Traditional Chinese art was denounced, whereas propaganda art became predominant in shaping the public’s loyalty towards the Communist Party and the country. Two major groups of art exhibitions emerged during the Revolution—the unofficial Red Guard art exhibitions organized by student activists in collaboration with local communes and art schools between 1966 and 1968, and the state-run national exhibitions from 1972 to 1975. These exhibitions were significant to this period because they were held frequently in the capital city Beijing and occasionally elsewhere, and through art they presented unique revolutionary beliefs to the Chinese people in a public setting. While the Red Guard art exhibitions and the national exhibitions certainly created different national narratives, I argue that the national exhibitions were in fact an attempt to revise the national narrative created by the Red Guard art exhibitions in order to re-establish a more utopian, consistent, and official national narrative. This paper unravels the intricate relationship between the two groups of exhibitions by comparing their exhibition venues, ideological focuses, work selection and quality editing. 

  9. Surface wave propagation in steady ideal Hall-magnetohydrodynamic magnetic slabs

    International Nuclear Information System (INIS)

    Miteva, Rossitsa; Zhelyazkov, Ivan; Erdelyi, Robert

    2003-01-01

    This paper studies the dispersion characteristics of sausage and kink surface waves traveling along a plasma layer within the framework of Hall magnetohydrodynamics in steady state. While in a static plasma slab these waves are Alfven ones (their phase velocities are close to the Alfven speed in the layer); in a slab with steady flows they may become super Alfvenic waves. Moreover, there exist two types of waves: forward and backward ones bearing in mind that the flow velocity defines the positive (forward) direction. As a typical representative of a magnetic slab in steady state here is considered a solar wind flux rope with a finite β plasma flow (typically β∼1).The forward sausage surface mode exhibits an increased dispersion at small wave numbers while the forward kink waves become practically non-dispersive. Both backward propagating sausage and kink surface modes show an increased dispersion for large wave numbers

  10. Luminescent Surface Quaternized Carbon Dots

    KAUST Repository

    Bourlinos, Athanasios B.

    2012-01-10

    Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.

  11. Luminescent Surface Quaternized Carbon Dots

    KAUST Repository

    Bourlinos, Athanasios B.; Zbořil, Radek; Petr, Jan; Bakandritsos, Aristides; Krysmann, Marta; Giannelis, Emmanuel P.

    2012-01-01

    Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.

  12. Photo-responsive surface topology in chiral nematic media

    Science.gov (United States)

    Liu, Danqing; Bastiaansen, Cees W. M.; Toonder, Jaap. M. J.; Broer, Dirk J.

    2012-03-01

    We report on the design and fabrication of 'smart surfaces' that exhibit dynamic changes in their surface topology in response to exposure to light. The principle is based on anisotropic geometric changes of a liquid crystal network upon a change of the molecular order parameter. The photomechanical property of the coating is induced by incorporating an azobenzene moiety into the liquid crystal network. The responsive surface topology consists of regions with two different types of molecular order: planar chiral-nematic areas and homeotropic. Under flood exposure with 365 nm light the surfaces deform from flat to one with a surface relief. The height of the relief structures is of the order of 1 um corresponding to strain difference of around 20%. Furthermore, we demonstrate surface reliefs can form either convex or concave structures upon exposure to UV light corresponding to the decrease or increase molecular order parameter, respectively, related to the isomeric state of the azobenzene crosslinker. The reversible deformation to the initial flat state occurs rapidly after removing the light source.

  13. Topographic design and application of hierarchical polymer surfaces replicated by microinjection compression molding

    Science.gov (United States)

    Guan, Wei-Sheng; Huang, Han-Xiong; Wang, Bin

    2013-10-01

    In recent years, the fast growing demand for biomimetic surfaces featuring unique wettability and functionality in various fields highlights the necessity of developing a reliable technique for mass production. In this work, hierarchical topography designs of templates were applied to prepare superhydrophobic surfaces via microinjection compression molding, comprehensively considering the feasibility of mechanical demolding and the superhydrophobicity and mechanical robustness of the molded polypropylene parts. Mimicking the wettability of a lotus leaf or rose petal, superhydrophobic surfaces were replicated. An unstable wetting state formed on the surface exhibiting the petal effect. On such a surface, the increased water pressure could cause water penetration into the micro gaps between the hierarchical asperities featuring low-roughness sidewalls and bottom surface; the resultant water membrane led to drastically increased water adhesion of the surface. Moreover, the low-adhesion superhydrophobicity of the molded surface was changed into superhydrophilicity, by means of introducing carbonyl groups via ultraviolet/ozone treatment and the subsequent water membrane preserved in microstructures via the pre-wetting process. Patterning the superhydrophilic micro channel on the superhydrophobic surface developed the surface microfluidic devices for micro-liter fluid pumping and mixing processes driven by surface tension.

  14. Designing immersion exhibits as border-crossing environments

    DEFF Research Database (Denmark)

    Mortensen, Marianne Foss

    2010-01-01

    be applied to achieve an understanding of the immersion exhibit form. The argument proceeds by demonstrating how the characteristics of immersion exhibits, and visitors to them, classify them as microcultures, and examining the implications of this for exhibit design using a hypothetical immersion exhibit...

  15. Men with Sickle Cell Anemia and Priapism Exhibit Increased Hemolytic Rate, Decreased Red Blood Cell Deformability and Increased Red Blood Cell Aggregate Strength.

    Directory of Open Access Journals (Sweden)

    Kizzy-Clara Cita

    Full Text Available To investigate the association between priapism in men with sickle cell anemia (SCA and hemorheological and hemolytical parameters.Fifty-eight men with SCA (median age: 38 years were included; 28 who had experienced priapism at least once during their life (priapism group and 30 who never experienced this complication (control group. Twenty-two patients were treated with hydroxycarbamide, 11 in each group. All patients were at steady state at the time of inclusion. Hematological and biochemical parameters were obtained through routine procedures. The Laser-assisted Optical Rotational Cell Analyzer was used to measure red blood cell (RBC deformability at 30 Pa (ektacytometry and RBC aggregation properties (laser backscatter versus time. Blood viscosity was measured at a shear rate of 225 s-1 using a cone/plate viscometer. A principal component analysis was performed on 4 hemolytic markers (i.e., lactate dehydrogenase (LDH, aspartate aminotransferase (ASAT, total bilirubin (BIL levels and reticulocyte (RET percentage to calculate a hemolytic index.Compared to the control group, patients with priapism exhibited higher ASAT (p = 0.01, LDH (p = 0.03, RET (p = 0.03 levels and hemolytic indices (p = 0.02. Higher RBC aggregates strength (p = 0.01 and lower RBC deformability (p = 0.005 were observed in patients with priapism compared to controls. After removing the hydroxycarbamide-treated patients, RBC deformability (p = 0.01 and RBC aggregate strength (p = 0.03 were still different between the two groups, and patients with priapism exhibited significantly higher hemolytic indices (p = 0.01 than controls.Our results confirm that priapism in SCA is associated with higher hemolytic rates and show for the first time that this complication is also associated with higher RBC aggregate strength and lower RBC deformability.

  16. Exhibition

    CERN Multimedia

    Staff Association

    2017-01-01

    Sintropie Flavio Pellegrini From 13 to 24 March 2017 CERN Meyrin, Main Building Energia imprigionata - Flavio Pellegrini. The exhibition is composed by eleven wood artworks with the expression of movement as theme. The artworks are the result of harmonics math applied to sculpture. The powerful black colour is dominated by the light source, generating reflexes and modulations. The result is a continuous variation of perspective visions. The works generate, at a first approach, an emotion of mystery and incomprehension, only a deeper contemplation lets one discover entangling and mutative details, evidencing the elegance of the lines and letting the meaning emerge. For more information : staff.association@cern.ch | Tél: 022 766 37 38

  17. The Culture of Exhibitions and Conservation

    Directory of Open Access Journals (Sweden)

    Dimitrios Doumas

    2013-11-01

    Full Text Available The article reflects on temporary exhibitions from a theoretical as well as practical perspective. Regarded as a particularly effective mass-communication medium, exhibitions have a dual nature: they are scholarly undertakings, bringing off a curator’s vision and, simultaneously, they are projects with economic implications that need to be well managed and administered. The role of conservation in the making of temporary exhibitions, either in-house or touring, is here discussed in relation to how work is planned and prioritized as well as how time is managed and staff is allocated. Reference to weaknesses that lessen the crucial input of conservation in the decision-making process is also made. Much of the debate, which focuses on art exhibitions, concerns practicalities encountered in a private museum that extend from the very early stages of selecting objects for display to the mounting of an exhibition.

  18. InSAR detects increase in surface subsidence caused by an Arctic tundra fire

    Science.gov (United States)

    Liu, Lin; Jafarov, Elchin E.; Schaefer, Kevin M.; Jones, Benjamin M.; Zebker, Howard A.; Williams, Christopher A.; Rogan, John; Zhang, Tingjun

    2014-01-01

    Wildfire is a major disturbance in the Arctic tundra and boreal forests, having a significant impact on soil hydrology, carbon cycling, and permafrost dynamics. This study explores the use of the microwave Interferometric Synthetic Aperture Radar (InSAR) technique to map and quantify ground surface subsidence caused by the Anaktuvuk River fire on the North Slope of Alaska. We detected an increase of up to 8 cm of thaw-season ground subsidence after the fire, which is due to a combination of thickened active layer and permafrost thaw subsidence. Our results illustrate the effectiveness and potential of using InSAR to quantify fire impacts on the Arctic tundra, especially in regions underlain by ice-rich permafrost. Our study also suggests that surface subsidence is a more comprehensive indicator of fire impacts on ice-rich permafrost terrain than changes in active layer thickness alone.

  19. Analysis of water microdroplet condensation on silicon surfaces

    Science.gov (United States)

    Honda, Takuya; Fujimoto, Kenya; Yoshimoto, Yuta; Mogi, Katsuo; Kinefuchi, Ikuya; Sugii, Yasuhiko; Takagi, Shu; Univ. of Tokyo Team; Tokyo Inst. of Tech. Team

    2016-11-01

    We observed the condensation process of water microdroplets on flat silicon (100) surfaces by means of the sequential visualization of the droplets using an environmental scanning electron microscope. As previously reported for nanostructured surfaces, the condensation process of water microdroplets on the flat silicon surfaces also exhibits two modes: the constant base (CB) area mode and the constant contact angle (CCA) mode. In the CB mode, the contact angle increases with time while the base diameter is constant. Subsequently, in the CCA mode, the base diameter increases with time while the contact angle remains constant. The dropwise condensation model regulated by subcooling temperature does not reproduce the experimental results. Because the subcooling temperature is not constant in the case of a slow condensation rate, this model is not applicable to the condensation of the long time scale ( several tens of minutes). The contact angle of water microdroplets ( several μm) tended to be smaller than the macro contact angle. Two hypotheses are proposed as the cause of small contact angles: electrowetting and the coalescence of sub- μm water droplets.

  20. Preparation of MgO with High Surface Area, and Modification of Its Pore Characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Moon Hee; Park, Dong Gon [Sookmyung Women' s University, Seoul (Korea, Republic of)

    2003-10-15

    Thermal decomposition of hydrated surface layer of Mg(OH){sub 2} at 500 .deg. C in vacuum turned non-porous MgO into porous one with high surface area of around 270 m{sup 2}/g. Most of its surface area, 74 %, was from micropores, and rest of it was from mesopores in wedge-shaped slits, exhibiting bimodal size distribution centered around 30 and 90 A. Rehydration followed by subsequent dehydration at 300 .deg. C in dynamic vacuum further raised the surface area to 340 m{sup 2}/g. Fraction of microporous surface area was increased to 93%, and the shape of the mesopores was modified into parallel slits with a specific dimension of 32 A. Application of Fe{sub 2}O{sub 3} over MgO via iron complex formation did not alter the pore characteristics of MgO core, except slightly increased pore dimension. Over the course of the modification, Fe{sub 2}O{sub 3} stayed on the surface possibly via spill-over reaction.

  1. Temporal Arctic longwave surface emissivity feedbacks in the Community Earth System Model

    Science.gov (United States)

    Kuo, C.; Feldman, D.; Huang, X.; Flanner, M.; Yang, P.; Chen, X.

    2017-12-01

    We have investigated how the inclusion of realistic and consistent surface emissivity in both land-surface and atmospheric components of the CESM coupled-climate model affects a wide range of climate variables. We did this by replacing the unit emissivity values in RRTMG_LW for water, fine-grained snow, and desert scenes with spectral emissivity values, and by replacing broadband emissivity values in surface components with the Planck-curve weighted counterparts. We find that this harmonized treatment of surface emissivity within CESM can be important for reducing high-latitude temperature biases. We also find that short-term effects of atmospheric dynamics and spectral information need to be considered to understand radiative effects in higher detail, and are possible with radiative kernels computed for every grid and time point for the entire model integration period. We find that conventional climatological feedback calculations indicate that sea-ice emissivity feedback is positive in sign, but that the radiative effects of the difference in emissivity between frozen and unfrozen surfaces exhibit seasonal dependence. Furthermore, this seasonality itself exhibits meridional asymmetry due to differences in sea-ice response to climate forcing between the Arctic and the Antarctic. In the Arctic, this seasonal, temporally higher order analysis exhibits increasing outgoing surface emissivity radiative response in a warming climate. While the sea-ice emissivity feedback and seasonal sea-ice emissivity radiative response amplitudes are a few percent of surface albedo feedbacks, the feedback analysis methods outlined in this work demonstrate that spatially and temporally localized feedback analysis can give insight into the mechanisms at work on those scales which differ in amplitude and sign from conventional climatological analyses. We note that the inclusion of this realistic physics leads to improved agreement between CESM model results and Arctic surface

  2. Surface and bulk MHD instabilities due to insulator coating imperfections

    International Nuclear Information System (INIS)

    Xu Zengyu; Reed, C.B.; Pan Chuanjie

    2002-01-01

    Experiments were performed using copper electrodes inserted into the wall of a perfectly insulated duct to simulate insulator coating flaking or cracking. The results show that surface electric potential U and MHD pressure drop ΔP exhibit a non-monotonic behavior with increasing V 0 , while the magnetic field B 0 is held constant. Additional experiments were also performed keeping all external experimental conditions fixed while measuring the change of U, V 0 , B 0 , and ΔP with increasing time. It was found that while all external experimental conditions were kept constant, the system changed by itself and U, V 0 and ΔP exhibited a non-monotonic behavior with increasing time. The results seem contrary to the law of ΔP∝V 0 B 0 n , but are consistent with conservation of energy, which implies that the change is due to some inherent feature of the system, or possibly instabilities, which may occur due to insulator coating imperfections

  3. Temperature increases on the external root surface during ...

    African Journals Online (AJOL)

    2015-02-25

    Feb 25, 2015 ... surface caused bone resorption and tooth ankyloses.[9] The .... thickness is important because it acts as a protective coating against thermal damage. .... heat stress proteins by human periodontal ligament cells. J Oral Pathol.

  4. Online Exhibits & Concept Maps

    Science.gov (United States)

    Douma, M.

    2009-12-01

    Presenting the complexity of geosciences to the public via the Internet poses a number of challenges. For example, utilizing various - and sometimes redundant - Web 2.0 tools can quickly devour limited time. Do you tweet? Do you write press releases? Do you create an exhibit or concept map? The presentation will provide participants with a context for utilizing Web 2.0 tools by briefly highlighting methods of online scientific communication across several dimensions. It will address issues of: * breadth and depth (e.g. from narrow topics to well-rounded views), * presentation methods (e.g. from text to multimedia, from momentary to enduring), * sources and audiences (e.g. for experts or for the public, content developed by producers to that developed by users), * content display (e.g. from linear to non-linear, from instructive to entertaining), * barriers to entry (e.g. from an incumbent advantage to neophyte accessible, from amateur to professional), * cost and reach (e.g. from cheap to expensive), and * impact (e.g. the amount learned, from anonymity to brand awareness). Against this backdrop, the presentation will provide an overview of two methods of online information dissemination, exhibits and concept maps, using the WebExhibits online museum (www.webexhibits.org) and SpicyNodes information visualization tool (www.spicynodes.org) as examples, with tips on how geoscientists can use either to communicate their science. Richly interactive online exhibits can serve to engage a large audience, appeal to visitors with multiple learning styles, prompt exploration and discovery, and present a topic’s breadth and depth. WebExhibits, which was among the first online museums, delivers interactive information, virtual experiments, and hands-on activities to the public. While large, multidisciplinary exhibits on topics like “Color Vision and Art” or “Calendars Through the Ages” require teams of scholars, user interface experts, professional writers and editors

  5. Effect of the size of silica nanoparticles on wettability and surface chemistry of sol–gel superhydrophobic and oleophobic nanocomposite coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lakshmi, R.V., E-mail: lakshmi_rv@nal.res.in; Bera, Parthasarathi; Anandan, C.; Basu, Bharathibai J.

    2014-11-30

    Highlights: • Superhydrophobic coatings from Cab-O-Sil EH5 and M5 particles in MTEOS sol. • Particle size of Cab-O-Sil influenced its optimum concentration in coating. • FAS-13 modification improved the oleophobicity of the coating. • Coating surface exhibited porous structure with nanovoids and microscale bumps. • Coatings with Cab-O-Sil EH5 retained water repelling property for a long time. - Abstract: Superhydrophobic sol–gel nanocomposite coatings have been fabricated by incorporating silica nanoparticles with different particle sizes separately in an acid-catalyzed sol of methyltriethoxysilane (MTEOS). Water contact angle (WCA) of the coatings increased with increase in the concentration of silica nanoparticles in both the cases. The coatings became superhydrophobic at an optimum silica concentration. The water repellency was further improved by the addition of fluoroalkylsilane (FAS). The optimum silica concentration was found to depend on the size of silica nanoparticles and FAS content and the coatings exhibited WCA of about 160° and water sliding angle (WSA) of <2°. FAS addition also improved the oleophobicity of the coatings. The coatings exhibited oil-repellency with a lubricant oil contact angle of 126° and ethylene glycol contact angle of 153.3°. Surface morphology of the coatings analyzed using field emission scanning electron microscopy (FESEM) showed a rough surface with microscale bumps and nanoscale pores. XPS was used to study the surface composition of the coatings. The superhydrophobic property of the coatings was due to the synergistic effect of surface chemistry and surface microstructure and can be explained using Cassie-Baxter model.

  6. Affordances and distributed cognition in museum exhibitions

    DEFF Research Database (Denmark)

    Achiam, Marianne; May, Michael; Marandino, Martha

    2014-01-01

    consistent framework. Here, we invoke the notions of affordance and distributed cognition to explain in a coherent way how visitors interact with exhibits and exhibit spaces and make meaning from those interactions, and we exemplify our points using observations of twelve visitors to exhibits at a natural...... history museum. We show how differences in exhibit characteristics give rise to differences in the interpretive strategies used by visitors in their meaning-making process, and conclude by discussing how the notions of affordance and distributed cognition can be used in an exhibit design perspective....

  7. Holland at CERN – Industrial exhibition

    CERN Multimedia

    GS Department

    2010-01-01

    Sponsored by EVD, an agency of the Dutch Ministry of the Economy From 8 to 11 November 2010 Industrial Exhibition Administration Building Bldg. 61 9-00 - 17-30 Twenty seven companies will present their latest technology at the industrial exhibition "Holland at CERN". Dutch industry will exhibit products and technologies which are related to the field of particle physics. Individual interviews will take place directly at the stands in the Main Building. The firms will contact relevant users/technicians but any user wishing to make contact with a particular firm is welcome to use the contact details which are available from each departmental secretariat or at the following URL: http://gs-dep.web.cern.ch/gs-dep/groups/sem/ls/Industrial_Exhibitions.htm#Industrial_exhibitions You will find the list of exhibitors below. LIST OF EXHIBITORS: Schelde Exotech Vernooy BV Triumph Group INCAA Computers DeMaCo Holland bv TNO Science & Industry Janssen Precision Engi...

  8. Osteoblast cell response to surface-modified carbon nanotubes

    International Nuclear Information System (INIS)

    Zhang Faming; Weidmann, Arne; Nebe, J. Barbara; Burkel, Eberhard

    2012-01-01

    In order to investigate the interaction of cells with modified multi-walled carbon nanotubes (MWCNTs) for their potential biomedical applications, the MWCNTs were chemically modified with carboxylic acid groups (–COOH), polyvinyl alcohol (PVA) polymer and biomimetic apatite on their surfaces. Additionally, human osteoblast MG-63 cells were cultured in the presence of the surface-modified MWCNTs. The metabolic activities of osteoblastic cells, cell proliferation properties, as well as cell morphology were studied. The surface modification of MWCNTs with biomimetic apatite exhibited a significant increase in the cell viability of osteoblasts, up to 67.23%. In the proliferation phases, there were many more cells in the biomimetic apatite-modified MWCNT samples than in the MWCNTs–COOH. There were no obvious changes in cell morphology in osteoblastic MG-63 cells cultured in the presence of these chemically-modified MWCNTs. The surface modification of MWCNTs with apatite achieves an effective enhancement of their biocompatibility.

  9. Superconductive microstrip exhibiting negative differential resistivity

    International Nuclear Information System (INIS)

    Huebener, R.P.; Gallus, D.E.

    1975-01-01

    A device capable of exhibiting negative differential electrical resistivity over a range of values of current and voltage is formed by vapor-depositing a thin layer of a material capable of exhibiting superconductivity on an insulating substrate, establishing electrical connections at opposite ends of the deposited strip, and cooling the alloy into its superconducting range. The device will exhibit negative differential resistivity when biased in the current-induced resistive state

  10. Surface channeling

    International Nuclear Information System (INIS)

    Sizmann, R.; Varelas, C.

    1976-01-01

    There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)

  11. Effects of acid and alkaline based surface preparations on spray deposited cerium based conversion coatings on Al 2024-T3

    Energy Technology Data Exchange (ETDEWEB)

    Pinc, W. [Department of Materials Science Engineering, Materials Research Center, Missouri University of Science and Technology, Rolla, MO 65409 (United States)], E-mail: wrphw5@mst.edu; Geng, S.; O' Keefe, M.; Fahrenholtz, W.; O' Keefe, T. [Department of Materials Science Engineering, Materials Research Center, Missouri University of Science and Technology, Rolla, MO 65409 (United States)

    2009-01-15

    Cerium based conversion coatings were spray deposited on Al 2024-T3 and characterized to determine the effect of surface preparation on the deposition rate and surface morphology. It was found that activation of the panel using a 1-wt.% sulfuric acid solution increased the coating deposition rate compared to alkaline cleaning alone. Analysis of the surface morphology of the coatings showed that the coatings deposited on the acid treated panels exhibited fewer visible cracks compared to coatings on alkaline cleaned panels. Auger electron spectroscopy depth profiling showed that the acid activation decreased the thickness of the aluminum oxide layer and the concentration of magnesium on the surface of the panels compared to the alkaline treatment. Additionally, acid activation increased the copper concentration at the surface of the aluminum substrate. Based on the results, the acid based surface treatment appeared to expose copper rich intermetallics, thus increasing the number of cathodic sites on the surface, which led to an overall increase in the deposition rate.

  12. Elite suppressor-derived HIV-1 envelope glycoproteins exhibit reduced entry efficiency and kinetics.

    Directory of Open Access Journals (Sweden)

    Kara G Lassen

    2009-04-01

    Full Text Available Elite suppressors (ES are a rare subset of HIV-1-infected individuals who are able to maintain HIV-1 viral loads below the limit of detection by ultra-sensitive clinical assays in the absence of antiretroviral therapy. Mechanism(s responsible for this elite control are poorly understood but likely involve both host and viral factors. This study assesses ES plasma-derived envelope glycoprotein (env fitness as a function of entry efficiency as a possible contributor to viral suppression. Fitness of virus entry was first evaluated using a novel inducible cell line with controlled surface expression levels of CD4 (receptor and CCR5 (co-receptor. In the context of physiologic CCR5 and CD4 surface densities, ES envs exhibited significantly decreased entry efficiency relative to chronically infected viremic progressors. ES envs also demonstrated slow entry kinetics indicating the presence of virus with reduced entry fitness. Overall, ES env clones were less efficient at mediating entry than chronic progressor envs. Interestingly, acute infection envs exhibited an intermediate phenotypic pattern not distinctly different from ES or chronic progressor envs. These results imply that lower env fitness may be established early and may directly contribute to viral suppression in ES individuals.

  13. Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds

    Science.gov (United States)

    Chen, Zhenliang; Liao, Rongrong; Zhang, Xiangzhe; Wang, Qishan; Pan, Yuchun

    2014-01-01

    Copper is required for structural and catalytic properties of a variety of enzymes participating in many vital biological processes for growth and development. Feeds provide most of the copper as an essential micronutrient consumed by animals, but inorganic copper could not be utilized effectively. In the present study, we aimed to develop transgenic mouse models to test if copper utilization will be increased by providing the animals with an exogenous gene for generation of copper chelatin in saliva. Considering that the S. cerevisiae CUP1 gene encodes a Cys-rich protein that can bind copper as specifically as copper chelatin in yeast, we therefore constructed a transgene plasmid containing the CUP1 gene regulated for specific expression in the salivary glands by a promoter of gene coding pig parotid secretory protein. Transgenic CUP1 was highly expressed in the parotid and submandibular salivary glands and secreted in saliva as a 9-kDa copper-chelating protein. Expression of salivary copper-chelating proteins reduced fecal copper contents by 21.61% and increased body-weight by 12.97%, suggesting that chelating proteins improve the utilization and absorbed efficacy of copper. No negative effects on the health of the transgenic mice were found by blood biochemistry and histology analysis. These results demonstrate that the introduction of the salivary CUP1 transgene into animals offers a possible approach to increase the utilization efficiency of copper and decrease the fecal copper contents. PMID:25265503

  14. Different properties exhibited on the two typical crystal faces of hydroxyapatite in a simulated body environment

    Energy Technology Data Exchange (ETDEWEB)

    Hagio, T; Iwai, K [Department of Materials, Physics and Energy Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya, 464-8603 (Japan); Tanase, T [Toho Gas Corporation, 19-18 Sakurada-cho, Atsuta-ku, Nagoya, 456-8511 (Japan); Akiyama, J [Institute for Molecular Science, National Institute of Natural Sciences, 38 Nishigonaka, Myodaiji, Okazaki, 444-8585 (Japan); Asai, S [Innovation Plaza Tokai Japan Science and Technology Agency, 23-1 Ahara-cho, Minami-ku, Nagoya, 457-0063 (Japan)], E-mail: hagio.takeshi@h.mbox.nagoya-u.ac.jp

    2009-03-01

    Hydroxyapatite is a main mineral constituent of hard tissues and is extensively used as a biomaterial in the medical field. Hydroxyapatite exhibits anisotropic chemical properties on its two typical crystal faces, the a-face and c-face, due to its hexagonal crystal structure. In polycrystalline bodies, such anisotropy can be enhanced by controlling the crystal orientation. Hydroxyapatite nanocrystals that constitute long bones also form a crystal oriented structure. Therefore, clarification of the difference between the properties of a-face and c-face in hydroxyapatite using in vitro experiments is useful to understand the structure and function of actual hard tissues. Hydroxyapatite ceramics with controlled crystal orientation were prepared by a slip casting method under application of a magnetic field. The fabricated hydroxyapatite ceramics had surfaces consisting mainly of a-face, or otherwise c-face hydroxyapatite. These hydroxyapatite ceramics were immersed into simulated body fluids to investigate the difference in bioactivity. The precipitation behavior observed on the surface of each hydroxyapatite ceramic was different. The thickness of the precipitate was increased and formed earlier on the HAp c-face compared to that on the a-face.

  15. Different properties exhibited on the two typical crystal faces of hydroxyapatite in a simulated body environment

    International Nuclear Information System (INIS)

    Hagio, T; Iwai, K; Tanase, T; Akiyama, J; Asai, S

    2009-01-01

    Hydroxyapatite is a main mineral constituent of hard tissues and is extensively used as a biomaterial in the medical field. Hydroxyapatite exhibits anisotropic chemical properties on its two typical crystal faces, the a-face and c-face, due to its hexagonal crystal structure. In polycrystalline bodies, such anisotropy can be enhanced by controlling the crystal orientation. Hydroxyapatite nanocrystals that constitute long bones also form a crystal oriented structure. Therefore, clarification of the difference between the properties of a-face and c-face in hydroxyapatite using in vitro experiments is useful to understand the structure and function of actual hard tissues. Hydroxyapatite ceramics with controlled crystal orientation were prepared by a slip casting method under application of a magnetic field. The fabricated hydroxyapatite ceramics had surfaces consisting mainly of a-face, or otherwise c-face hydroxyapatite. These hydroxyapatite ceramics were immersed into simulated body fluids to investigate the difference in bioactivity. The precipitation behavior observed on the surface of each hydroxyapatite ceramic was different. The thickness of the precipitate was increased and formed earlier on the HAp c-face compared to that on the a-face.

  16. Reverse Non-Equilibrium Molecular Dynamics Demonstrate That Surface Passivation Controls Thermal Transport at Semiconductor-Solvent Interfaces.

    Science.gov (United States)

    Hannah, Daniel C; Gezelter, J Daniel; Schaller, Richard D; Schatz, George C

    2015-06-23

    We examine the role played by surface structure and passivation in thermal transport at semiconductor/organic interfaces. Such interfaces dominate thermal transport in semiconductor nanomaterials owing to material dimensions much smaller than the bulk phonon mean free path. Utilizing reverse nonequilibrium molecular dynamics simulations, we calculate the interfacial thermal conductance (G) between a hexane solvent and chemically passivated wurtzite CdSe surfaces. In particular, we examine the dependence of G on the CdSe slab thickness, the particular exposed crystal facet, and the extent of surface passivation. Our results indicate a nonmonotonic dependence of G on ligand-grafting density, with interfaces generally exhibiting higher thermal conductance for increasing surface coverage up to ∼0.08 ligands/Å(2) (75-100% of a monolayer, depending on the particular exposed facet) and decreasing for still higher coverages. By analyzing orientational ordering and solvent penetration into the ligand layer, we show that a balance of competing effects is responsible for this nonmonotonic dependence. Although the various unpassivated CdSe surfaces exhibit similar G values, the crystal structure of an exposed facet nevertheless plays an important role in determining the interfacial thermal conductance of passivated surfaces, as the density of binding sites on a surface determines the ligand-grafting densities that may ultimately be achieved. We demonstrate that surface passivation can increase G relative to a bare surface by roughly 1 order of magnitude and that, for a given extent of passivation, thermal conductance can vary by up to a factor of ∼2 between different surfaces, suggesting that appropriately tailored nanostructures may direct heat flow in an anisotropic fashion for interface-limited thermal transport.

  17. Air-spun PLA nanofibers modified with reductively sheddable hydrophilic surfaces for vascular tissue engineering: synthesis and surface modification.

    Science.gov (United States)

    Ko, Na Re; Sabbatier, Gad; Cunningham, Alexander; Laroche, Gaétan; Oh, Jung Kwon

    2014-02-01

    Polylactide (PLA) is a class of promising biomaterials that hold great promise for various biological and biomedical applications, particularly in the field of vascular tissue engineering where it can be used as a fibrous mesh to coat the inside of vascular prostheses. However, its hydrophobic surface providing nonspecific interactions and its limited ability to further modifications are challenges that need to be overcome. Here, the development of new air-spun PLA nanofibers modified with hydrophilic surfaces exhibiting reduction response is reported. Surface-initiated atom transfer radical polymerization allows for grafting pendant oligo(ethylene oxide)-containing polymethacrylate (POEOMA) from PLA air-spun fibers labeled with disulfide linkages. The resulting PLA-ss-POEOMA fibers exhibit enhanced thermal stability and improved surface properties, as well as thiol-responsive shedding of hydrophilic POEOMA by the cleavage of its disulfide linkages in response to reductive reactions, thus tuning the surface properties. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Assessing the User Resistance to Recommender Systems in Exhibition

    Directory of Open Access Journals (Sweden)

    Chulmo Koo

    2017-11-01

    Full Text Available Under the paradigm shift toward smart tourism, the exhibition industry is making efforts to introduce innovative technologies that can provide more diverse and valuable experiences to attendees. However, various new information technologies have failed in a market in practice due to the user’s resistance against it. Since innovative technology, such as booth recommender systems (BRS, is changing, creating uncertainty among consumers, consumer’s resistance to innovative technology can be considered a normal reaction. Therefore, it is important for a company to understand the psychological aspect of the consumer’s resistance and make measures to overcome the resistance. Accordingly, based on the model of Kim and Kankanhalli (2009, by applying the perceived value, the technology acceptance model, and the status quo bias theory, this study focused on the importance of self-efficacy and technical support in the context of using BRS. To do this purpose, a total of 455 survey data that was collected from “Korea franchise exhibition” attendees were used to analyze the proposed model. Structural equation modeling was applied for data analysis. The result shows that perceived value was affected by relative advantage and switching cost, also switching cost reduced the perceived value. However, self-efficacy reduced the switching cost, thereby decreasing the resistance of exhibition attendees. In addition, technical support increased the relative advantage switching cost and the perceived value. Exhibition attendee’s resistance was significantly negatively affected by perceived value, and positively affected by switching cost. The results will provide balanced viewpoints between the relative advantage and switching cost for exhibition marketers, helping to strengthen the competitiveness in terms of sustainable tourism of exhibition.

  19. Surface modification of malachite with ethanediamine and its effect on sulfidization flotation

    Science.gov (United States)

    Feng, Qicheng; Zhao, Wenjuan; Wen, Shuming

    2018-04-01

    Ethanediamine was used to modify the mineral surface of malachite to improve its sulfidization and flotation behavior. The activation mechanism was investigated by adsorption experiments, X-ray photoelectron spectroscopy (XPS) analysis, and zeta potential measurements. Microflotation experiments showed that the flotation recovery of malachite was enhanced after the pretreatment of the mineral particles with ethanediamine prior to the addition of Na2S. Adsorption tests revealed that numerous sulfide ion species in the pulp solution were transferred onto the mineral surface through the formation of more copper sulfide species. This finding was confirmed by the results of the XPS measurements. Ethanediamine modification not only increased the contents of copper sulfide species on the malachite surface but also enhanced the reactivity of the sulfidization products. During sulfidization, Cu(II) species on the mineral surface were reduced into Cu(I) species, and the percentages of S22- and Sn2- relative to the total S increased after modification, resulting in increased surface hydrophobicity. The results of zeta potential measurements showed that the ethanediamine-modified mineral surface adsorbed with more sulfide ion species was advantageous to the attachment of xanthate species, thereby improving malachite floatability. The proposed ethanediamine modification followed by sulfidization xanthate flotation exhibits potential for industrial application.

  20. The role of bed surface configuration on river response under increasing flows

    Science.gov (United States)

    Ferrer-Boix, Carles; Elgueta, María A.; Hassan, Marwan A.

    2017-04-01

    This research aims to explore how bed surface configuration influence channel evolution, vertical and downstream sediment sorting, and sediment transport in gravel bed streams under varying flows. While a significant body of research has been focused on channel evolution under constant flow regimes, few studies have focused on the impacts of flow variations in channel adjustments. Particularly, we are interested in examining the impact of the degree of bed surface coarsening and particle arrangement on channel adjustments and sediment transport rates. To this end, we conducted a set of experiments in a 0.55 m-wide, 5 m-long tilting flume. Flow discharge during the runs was initially held constant at 25 l/s for a period of time after which discharge was gradually increased at steps of certain duration. Flow rates during the rising limb of the hydrographs ranged from 26 l/s to 40 l/s. Initial bed slope was 0.04 m/m for all runs. Some of the experiments were conducted under no feed conditions while others were carried out with sediment supply, which ranged from 1 kg/h to 10 kg/h. The feed texture in these latter runs was identical to that of the original mixture (Dg = 5.65 mm and σg = 3.05). Bed slopes and surface configuration were obtained after varying times of conditioning under constant flow and no feed. Data acquisition included: 1) bed surface images covering the entire flume, 2) bed scans at 2 mm resolution of the whole flume and 3) real-time measurements of bedload transport (rate and texture) at the outlet of the flume. This set up allows us to obtain fractional particle mobility, i.e. how much bed area covered by a particular grain size changed at a given time and to link to sediment transport rates. Data gathered from this study 1) will contribute to better understanding of river dynamics under unsteady flow conditions (floods) and 2) will help us improve sediment transport predictions under such conditions.

  1. Hydrogel brushes grafted from stainless steel via surface-initiated atom transfer radical polymerization for marine antifouling

    Science.gov (United States)

    Wang, Jingjing; Wei, Jun

    2016-09-01

    Crosslinked hydrogel brushes were grafted from stainless steel (SS) surfaces for marine antifouling. The brushes were prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of 2-methacryloyloxyethyl phosphorylcholine (MPC) and poly(ethylene glycol) methyl ether methacrylate (PEGMA) respectively with different fractions of crosslinker in the feed. The grafted layers prepared with different thickness were characterized by X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), ellipsometry and water contact angle measurements. With the increase in the fraction of crosslinker in the feed, the thickness of the grafted layer increased and the surface became smooth. All the brush-coated SS surfaces could effectively reduce the adhesion of bacteria and microalgae and settlement of barnacle cyprids, as compared to the pristine SS surface. The antifouling efficacy of the PEGMA polymer (PPEGMA)-grafted surface was higher than that of the MPC polymer (PMPC)-grafted surfaces. Furthermore, the crosslinked hydrogel brush-grafted surfaces exhibited better fouling resistance than the non-crosslinked polymer brush-grafted surfaces, and the antifouling efficacy increased with the crosslinking density. These hydrogel coatings of low toxicity and excellent anti-adhesive characteristics suggested their useful applications as environmentally friendly antifouling coatings.

  2. A study of laser surface treatment in bonded repair of composite aircraft structures.

    Science.gov (United States)

    Li, Shaolong; Sun, Ting; Liu, Chang; Yang, Wenfeng; Tang, Qingru

    2018-03-01

    Surface pre-treatment is one of the key processes in bonded repair of aircraft carbon fibre reinforced polymer composites. This paper investigates the surface modification of physical and chemical properties by laser ablation and conventional polish treatment techniques. Surface morphology analysed by laser scanning confocal microscopy and scanning electron microscopy showed that a laser-treated surface displayed higher roughness than that of a polish-treated specimen. The laser-treated laminate exhibited more functional groups in the form of O 1 s/C 1 s atomic ratio of 30.89% for laser-treated and 20.14% for polish-treated as evidenced by X-ray photoelectron spectroscopy observation. Contact angle goniometry demonstrated that laser treatment can provide increased surface free energy and wettability. In the light of mechanical interlocking, molecular bonding and thermodynamics theories on adhesion, laser etching process displayed enhanced bonding performance relative to the polishing surface treatment. These properties resulted in an increased single lap shear strength and a cohesive failure mode for laser etching while an adhesive failure mode occurred in polish-treated specimen.

  3. Lessons from life: Learning from exhibits, animals and interaction in a museum

    Science.gov (United States)

    Goldowsky, Alexander Noah

    This study examines the effect of interaction on visitor behavior at a public aquarium, experimentally comparing one exhibit under interactive and noninteractive conditions. A quantitative analysis showed that the time visitor groups spent in the study area significantly increased in the interactive condition (median 73 vs. 32 seconds). Further, this effect extended only to those groups within the interactive condition in which at least one member operated the exhibit (median 102 vs. 36 seconds). Both median times and survival curves are compared, and the analysis controlled for group size, age and sex ratios, visitor density, queuing time, and animal activity. Qualitative analyses focused on visitors' spontaneous conversation at the exhibit. Interactive visitors were found to engage in more in-depth exploration, including conducting informal experiments. The amount of discussion was found to correlate with stay time (r = 0.47). Visitor discussion centered on the exhibit, with frequent observations of penguin behavior. Greater enthusiasm was observed for interactive visitors, and coding showed interactive visitors laughed more frequently, and were significantly more likely to speculate on the penguins' reactions and motivations for behaviors. The experimental setup included a control condition consisting of a typical aquarium exhibit, including live penguins, naturalistic habitat, and graphics. The interactive condition added a device designed to mediate a two-way interaction between the visitors and penguins: visitors moved a light beam across the bottom of the pool. The penguins, intern, chased the light. This exhibit was designed both to benefit visitors and to serve as behavioral enrichment for the penguins. A third condition employed an automatically moving light, which elicited similar penguin behaviors, but without allowing visitor interaction. Videotaped data was analyzed for 301 visitor groups (756 individuals). A supplemental study employed video recall

  4. Triiodothyronine Acutely Stimulates Glucose Transport into L6 Muscle Cells Without Increasing Surface GLUT4, GLUT1, or GLUT3

    Science.gov (United States)

    Teixeira, Silvania Silva; Tamrakar, Akhilesh K.; Goulart-Silva, Francemilson; Serrano-Nascimento, Caroline; Klip, Amira

    2012-01-01

    Background Thyroid hormones (THs) act genomically to stimulate glucose transport by elevating glucose transporter (Slc2a) expression and glucose utilization by cells. However, nongenomic effects of THs are now emerging. Here, we assess how triiodothyronine (T3) acutely affects glucose transport and the content of GLUT4, GLUT1, and GLUT3 at the surface of muscle cells, and possible interactions between T3 and insulin action. Methods Differentiated L6 myotubes transfected with myc-tagged Slc2a4 (L6-GLUT4myc) or Slc2a1 (L6-GLUT1myc) and wild-type L6 myotubes were studied in the following conditions: control, hypothyroid (Tx), Tx plus T3, Tx plus insulin, and Tx plus insulin and T3. Results Glucose uptake and GLUT4 content at the cell surface decreased in the Tx group relative to controls. T3 treatment for 30 minutes increased glucose transport into L6-GLUT4myc cells without altering surface GLUT4 content, which increased only thereafter. The total amount of GLUT4 protein remained unchanged among the groups studied. The surface GLUT1 content of L6-GLUT1myc cells also remained unaltered after T3 treatment; however, in these cells glucose transport was not stimulated by T3. In wild-type L6 cells, although T3 treatment increased the total amount of GLUT3, it did not change the surface GLUT3 content. Moreover, within 30 minutes, T3 stimulation of glucose uptake was additive to that of insulin in L6-GLUT4myc cells. As expected, insulin elevated surface GLUT4 content and glucose uptake. However, interestingly, surface GLUT4 content remained unchanged or even dropped with T3 plus insulin. Conclusions These data reveal that T3 rapidly increases glucose uptake in L6-GLUT4myc cells, which, at least for 30 minutes, did not depend on an increment in GLUT4 at the cell surface yet potentiates insulin action. We propose that this rapid T3 effect involves activation of GLUT4 transporters at the cell surface, but cannot discount the involvement of an unknown GLUT. PMID:22663547

  5. INCREASE OF ADHESION OF PAINT-AND-LACQUER MATERIALS TO WOOD THROUGH THE MODIFICATION OF ITS SURFACE BY BORON-NITROGEN COMPOUNDS

    Directory of Open Access Journals (Sweden)

    Koteneva Irina Vasil'evna

    2012-10-01

    Full Text Available The authors demonstrate that the efficiency of protection of wooden structures, covered with paints and lacquer materials, from the influence of the environment, depends on the adhesion size. It is common knowledge that improvement of adhesion of capillary-porous materials to the wood, and, hence, the increase of the service life of the sheeting requires the reduction in the dimensions of the wood surface, as the reduction of diameters of capillaries leads to the growth of forces of capillary condensation and to the increase in the depth of penetration of paints into the material. Adhesion of a water-soluble acrylic paint and organic-soluble enamels to the surface of the wood modified by boron-nitrogen compounds and to unmodified wood is the subject of the research. It is identified that the increase in the adhesive durability of paint and varnish coverings if glued to the surface of the wood modified by boron-nitrogen compounds, is driven by the growth of the polarity of a substrate and the reduction of dimensions of the wood surface.

  6. Students-exhibits interaction at a science center

    Science.gov (United States)

    Botelho, Agostinho; Morais, Ana M.

    2006-12-01

    In this study we investigate students' learning during their interaction with two exhibits at a science center. Specifically, we analyze both students' procedures when interacting with exhibits and their understanding of the scientific concepts presented therein. Bernstein's theory of pedagogic discourse (1990, 2000) provided the sociological foundation to assess the exhibit-student interaction and allowed analysis of the influence of the characteristics of students, exhibits, and interactions on students' learning. Eight students (ages 12ndash;13 years of age) with distinct sociological characteristics participated in the study. Several findings emerged from the results. First, the characteristics of the students, exhibits, and interactions appeared to influence student learning. Second, to most students, what they did interactively (procedures) seems not to have had any direct consequence on what they learned (concept understanding). Third, the data analysis suggest an important role for designers and teachers in overcoming the limitations of exhibit-student interaction.

  7. Small-molecule compounds exhibiting target-mediated drug disposition - A case example of ABT-384.

    Science.gov (United States)

    An, Guohua; Liu, Wei; Dutta, Sandeep

    2015-10-01

    Nonlinearities are frequently encountered in pharmacokinetics, and they can occur when 1 or more processes of absorption, distribution, metabolism, and excretion are saturable. One special source of nonlinearity that has been noticed recently is the saturable binding of the drug to a high-affinity-low-capacity target, a phenomenon known as target-mediated drug disposition (TMDD). Although TMDD can occur in both small-molecule compounds and large-molecule compounds, the latter has received much more attention because of its high prevalence. With the development of more potent small-molecule drugs acting on highly specific targets and the availability of increasingly sensitive analytical techniques, small-molecule compounds exhibiting TMDD have been increasingly reported in the past several years. ABT-384 is a small-molecule drug candidate that exhibited significant nonlinear pharmacokinetics, potentially imparted by TMDD, in a first-in-human clinical trial conducted in healthy volunteers. Compared with published small-molecule compounds exhibiting TMDD, ABT-384 pharmacokinetic characteristics are more consistent with TMDD. To expand current knowledge of TMDD of small-molecule compounds and increase awareness of this interesting and clinically important phenomenon, in this review the general features of small-molecule compounds exhibiting TMDD are highlighted, with ABT-384 provided as an example. © 2015, The American College of Clinical Pharmacology.

  8. Crystal step edges can trap electrons on the surfaces of n-type organic semiconductors.

    Science.gov (United States)

    He, Tao; Wu, Yanfei; D'Avino, Gabriele; Schmidt, Elliot; Stolte, Matthias; Cornil, Jérôme; Beljonne, David; Ruden, P Paul; Würthner, Frank; Frisbie, C Daniel

    2018-05-30

    Understanding relationships between microstructure and electrical transport is an important goal for the materials science of organic semiconductors. Combining high-resolution surface potential mapping by scanning Kelvin probe microscopy (SKPM) with systematic field effect transport measurements, we show that step edges can trap electrons on the surfaces of single crystal organic semiconductors. n-type organic semiconductor crystals exhibiting positive step edge surface potentials display threshold voltages that increase and carrier mobilities that decrease with increasing step density, characteristic of trapping, whereas crystals that do not have positive step edge surface potentials do not have strongly step density dependent transport. A device model and microelectrostatics calculations suggest that trapping can be intrinsic to step edges for crystals of molecules with polar substituents. The results provide a unique example of a specific microstructure-charge trapping relationship and highlight the utility of surface potential imaging in combination with transport measurements as a productive strategy for uncovering microscopic structure-property relationships in organic semiconductors.

  9. Photoemission spectroscopy of surfaces and adsorbates

    International Nuclear Information System (INIS)

    Chiang, T.C.; Kaindl, G.; Himpsel, F.J.; Eastman, D.E.

    1982-01-01

    Core level photoelectron spectroscopy is providing new information concerning the electronic properties of adsorbates and surfaces. Several examples will be discussed, including studies of adsorbed rare gas submonolayers and multilayers as well as clean metal surfaces. For rare gas multilayers adsorbed on metal surfaces, the photoelectrons and Auger electrons exhibit well-resolved increases in kinetic energy with decreasing distance between the excited atom and the substrate, allowing a direct labeling of the layers. These energy shifts are mainly due to the substrate screening effects, and can be described well by an image-charge model. For a Kr/Xe bilayer system prepared by first coating a Pd substrate with a monolayer of Kr and then overcoating with a layer of Xe, a thermally activated layer inversion process is observed when the temperature is raised, with Xe coming in direct contact with the substrate. For rare gas submonolayers adsorbed on the Al(111) surface, coverage-dependent core level shift and work function measurements provide information about the adatom spatial distributions, polarizabilities, and dipole moments for the ground and excited states. We have also studied the 2p core level shifts for a clean Al(001) surface relative to the bulk. The shifts have a large contribution from the initial-state effects

  10. Hydrogel brushes grafted from stainless steel via surface-initiated atom transfer radical polymerization for marine antifouling

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jingjing, E-mail: jjwang1@hotmail.com; Wei, Jun

    2016-09-30

    Highlights: • Crosslinked hydrogel brushes were grafted from SS surfaces for marine antifouling. • All brush-coated SS surfaces could effectively reduce the adhesion of biofouling. • The antifouling efficacy increased with the crosslinking density of hydrogels. - Abstract: Crosslinked hydrogel brushes were grafted from stainless steel (SS) surfaces for marine antifouling. The brushes were prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of 2-methacryloyloxyethyl phosphorylcholine (MPC) and poly(ethylene glycol) methyl ether methacrylate (PEGMA) respectively with different fractions of crosslinker in the feed. The grafted layers prepared with different thickness were characterized by X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), ellipsometry and water contact angle measurements. With the increase in the fraction of crosslinker in the feed, the thickness of the grafted layer increased and the surface became smooth. All the brush-coated SS surfaces could effectively reduce the adhesion of bacteria and microalgae and settlement of barnacle cyprids, as compared to the pristine SS surface. The antifouling efficacy of the PEGMA polymer (PPEGMA)-grafted surface was higher than that of the MPC polymer (PMPC)-grafted surfaces. Furthermore, the crosslinked hydrogel brush-grafted surfaces exhibited better fouling resistance than the non-crosslinked polymer brush-grafted surfaces, and the antifouling efficacy increased with the crosslinking density. These hydrogel coatings of low toxicity and excellent anti-adhesive characteristics suggested their useful applications as environmentally friendly antifouling coatings.

  11. Hydrogel brushes grafted from stainless steel via surface-initiated atom transfer radical polymerization for marine antifouling

    International Nuclear Information System (INIS)

    Wang, Jingjing; Wei, Jun

    2016-01-01

    Highlights: • Crosslinked hydrogel brushes were grafted from SS surfaces for marine antifouling. • All brush-coated SS surfaces could effectively reduce the adhesion of biofouling. • The antifouling efficacy increased with the crosslinking density of hydrogels. - Abstract: Crosslinked hydrogel brushes were grafted from stainless steel (SS) surfaces for marine antifouling. The brushes were prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of 2-methacryloyloxyethyl phosphorylcholine (MPC) and poly(ethylene glycol) methyl ether methacrylate (PEGMA) respectively with different fractions of crosslinker in the feed. The grafted layers prepared with different thickness were characterized by X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), ellipsometry and water contact angle measurements. With the increase in the fraction of crosslinker in the feed, the thickness of the grafted layer increased and the surface became smooth. All the brush-coated SS surfaces could effectively reduce the adhesion of bacteria and microalgae and settlement of barnacle cyprids, as compared to the pristine SS surface. The antifouling efficacy of the PEGMA polymer (PPEGMA)-grafted surface was higher than that of the MPC polymer (PMPC)-grafted surfaces. Furthermore, the crosslinked hydrogel brush-grafted surfaces exhibited better fouling resistance than the non-crosslinked polymer brush-grafted surfaces, and the antifouling efficacy increased with the crosslinking density. These hydrogel coatings of low toxicity and excellent anti-adhesive characteristics suggested their useful applications as environmentally friendly antifouling coatings.

  12. Importance of Surface Texture to Infrared Remote Sensing Interpretations

    Science.gov (United States)

    Kirkland, L. E.; Adams, P. M.; Herr, K. C.; Salisbury, J. W.

    2001-11-01

    Thermal infrared remote sensing may be used to identify minerals present on the surface using diagnostic spectral bands. As band depth (spectral contrast) exhibited by the mineral increases, the mineral is easier to detect. In order to determine the expected spectral contrast, thermal infrared spectra of typical mineral endmembers are commonly measured in the laboratory. For example, for calcite, well-crystalline limestone is commonly studied. However, carbonates occur in several forms, including thin coatings, indurated carbonate (calcrete), and hot springs deposits. Different formation pathways may cause different microstructures and surface textures. This in turn can also affect the surface texture of the weathered material. Different surface textures can affect the measured band contrast, through roughness that causes a cavity (hohlraum) effect, and particle size and roughness on a scale that causes volume scattering. Thus since detection limits vary with the spectral contrast, surface texture can be an important variable in how detectable a mineral is. To study these issues, we have examined limestone and calcrete deposits at Mormon Mesa, Nevada that have two distinctly different microstructures and surface texture [Kirkland et al., 2001]. The limestone studied has larger grains and the grains frequently have flat, smooth surfaces on the order of 10-50 microns in cross-section length. The calcrete has smaller, more angular calcite grains, which exhibit almost no flat surfaces longer than 5 microns in cross-section length. We will show scanning electron microscope images to compare the different microstructures and surface textures of both the fresh and weathered surfaces, and we will show corresponding thermal infrared spectra to illustrate the different spectral signatures. The results demonstrate the importance of understanding the microstructure of mineral deposits to accurately interpret infrared remote sensing data, especially for studies that lack ground

  13. Resveratrol enhances airway surface liquid depth in sinonasal epithelium by increasing cystic fibrosis transmembrane conductance regulator open probability.

    Directory of Open Access Journals (Sweden)

    Shaoyan Zhang

    Full Text Available Chronic rhinosinusitis engenders enormous morbidity in the general population, and is often refractory to medical intervention. Compounds that augment mucociliary clearance in airway epithelia represent a novel treatment strategy for diseases of mucus stasis. A dominant fluid and electrolyte secretory pathway in the nasal airways is governed by the cystic fibrosis transmembrane conductance regulator (CFTR. The objectives of the present study were to test resveratrol, a strong potentiator of CFTR channel open probability, in preparation for a clinical trial of mucociliary activators in human sinus disease.Primary sinonasal epithelial cells, immortalized bronchoepithelial cells (wild type and F508del CFTR, and HEK293 cells expressing exogenous human CFTR were investigated by Ussing chamber as well as patch clamp technique under non-phosphorylating conditions. Effects on airway surface liquid depth were measured using confocal laser scanning microscopy. Impact on CFTR gene expression was measured by quantitative reverse transcriptase polymerase chain reaction.Resveratrol is a robust CFTR channel potentiator in numerous mammalian species. The compound also activated temperature corrected F508del CFTR and enhanced CFTR-dependent chloride secretion in human sinus epithelium ex vivo to an extent comparable to the recently approved CFTR potentiator, ivacaftor. Using inside out patches from apical membranes of murine cells, resveratrol stimulated an ~8 picosiemens chloride channel consistent with CFTR. This observation was confirmed in HEK293 cells expressing exogenous CFTR. Treatment of sinonasal epithelium resulted in a significant increase in airway surface liquid depth (in µm: 8.08+/-1.68 vs. 6.11+/-0.47,control,p<0.05. There was no increase CFTR mRNA.Resveratrol is a potent chloride secretagogue from the mucosal surface of sinonasal epithelium, and hydrates airway surface liquid by increasing CFTR channel open probability. The foundation for a

  14. Ozone-surface reactions in five homes: surface reaction probabilities, aldehyde yields, and trends.

    Science.gov (United States)

    Wang, H; Morrison, G

    2010-06-01

    Field experiments were conducted in five homes during three seasons (summer 2005, summer 2006 and winter 2007) to quantify ozone-initiated secondary aldehyde yields, surface reaction probabilities, and trends any temporal over a 1.5-year interval. Surfaces examined include living room carpets, bedroom carpets, kitchen floors, kitchen counters, and living room walls. Reaction probabilities for all surfaces for all seasons ranged from 9.4 x 10(-8) to 1.0 x 10(-4). There were no significant temporal trends in reaction probabilities for any surfaces from summer 2005 to summer 2006, nor over the entire 1.5-year period, indicating that it may take significantly longer than this period for surfaces to exhibit any 'ozone aging' or lowering of ozone-surface reactivity. However, all surfaces in three houses exhibited a significant decrease in reaction probabilities from summer 2006 to winter 2007. The total yield of aldehydes for the summer of 2005 were nearly identical to that for summer of 2006, but were significantly higher than for winter 2007. We also observed that older carpets were consistently less reactive than in newer carpets, but that countertops remained consistently reactive, probably because of occupant activities such as cooking and cleaning. Ozone reactions taking place at indoor surfaces significantly influence personal exposure to ozone and volatile reaction products. These field studies show that indoor surfaces only slowly lose their ability to react with ozone over several year time frames, and that this is probably because of a combination of large reservoirs of reactive coatings and periodic additions of reactive coatings in the form of cooking, cleaning, and skin-oil residues. When considering exposure to ozone and its reaction products and in the absence of dramatic changes in occupancy, activities or furnishings, indoor surface reactivity is expected to change very slowly.

  15. Exhibition - Mathematics, A Beautiful Elsewhere

    CERN Multimedia

    2011-01-01

    From 21 October 2011 to 18 March 2012, the Fondation Cartier pour l’art contemporain will present the exhibition Mathematics: A Beautiful Elsewhere, an exhibition developed in association with the Institut des Hautes Études Scientifiques (IHÉS) and under the patronage of UNESCO. For this unprecedented event, the foundation invited mathematicians to work with artists with whom it has previously worked to create an exhibition that allows visitors to see, hear, do, interpret and think about mathematics. By bringing mathematics into its premises, the Fondation Cartier is itself undergoing the “sudden change of scenery” described by mathematician Alexandre Grothendieck. More information is available here. Fondation Cartier pour l’art contemporain 261, boulevard Raspail 75014 Paris http://fondation.cartier.com Private Visit For professors, researchers and all the staff of Mathematics departments...

  16. Decreased surface albedo driven by denser vegetation on the Tibetan Plateau

    International Nuclear Information System (INIS)

    Tian, Li; Zhang, Yangjian; Zhu, Juntao

    2014-01-01

    The Tibetan Plateau (TP) has fundamental ecological and environmental significance to China and Asia through its influence on regional and continental climates. In recent years, climate warming has caused unprecedented changes to land surface processes on the TP, which would unavoidably undermine the ecological and environmental functions of the TP. Among the numerous land surface processes potentially impacted by climate warming, the effect of vegetation greenness on surface energy balance is one of the most critical, but has been long ignored. In this study, we investigated the spatial and temporal patterns of land surface albedo (LSA) on the TP and evaluated the vegetation greenness in relation to patterns of LSA. We found that LSA has been decreasing in most of the vegetated grasslands on the TP from 2000 to 2013, as compared to a flat trend for desert area. The regions where LSA has been decreasing were spatially correlated to areas of increased vegetation greenness. Along rising altitude, LSA decreasing rate exhibited an overall decreasing trend. Across the TP, elevated vegetation greenness in grasslands acted as a primary factor pulling down LSA. The driving effects of vegetation greenness on LSA vary with grassland types, as revealed by a more significant relationship between vegetation greenness and LSA for the sparsely vegetated zone (i.e. steppe) than the more densely vegetated zone (i.e. meadow). Furthermore, the driving effect of vegetation greenness on LSA exhibited an obvious dependence on altitude as effects with rising altitude were relatively strong up to 3000 m, then weakened from 3500 m to 5000 m, and then the effects again increased from 5000 to 6000 m. The growing season LSA trend revealed in this study emphasizes the need to give greater attention to the growing season LSA flux in future surface energy balance studies. (letter)

  17. Evaluation of an educational exhibition on global issues and consumer responsibility: From involvement to hopelessness

    Directory of Open Access Journals (Sweden)

    Jan Činčera

    2013-09-01

    Full Text Available The article presents the evaluation of an interactive exhibition for secondary education students (15-19 years old, focusing on global problems and consumer responsibility. The evaluation was conducted in three schools. Data were obtained from interviews with teachers (N=3 and questionnaires (N=204 distributed among students after the exhibition. For the analysis, both quantitative and qualitative approaches were used. The results suggest that the exhibition was successful in terms of involving students and increasing their awareness of the problems. Some students evaluated the exhibition as manipulative. An unintended effect of the exhibition was students’ feeling of hopelessness. This article discusses the results and suggests a change in strategy when dealing with global problems in schools.

  18. Human Exhibitions

    DEFF Research Database (Denmark)

    Andreassen, Rikke

    light on the staging of exhibitions, the daily life of the exhibitees, the wider connections between shows across Europe and the thinking of the time on matters of race, science, gender and sexuality. A window onto contemporary racial understandings, the book presents interviews with the descendants...... of displayed people, connecting the attitudes and science of the past with both our (continued) modern fascination with ‘the exotic’, and contemporary language and popular culture. As such, it will be of interest to scholars of sociology, anthropology and history working in the areas of gender and sexuality...

  19. Anniversary Exhibition. Nechvolodov.

    Directory of Open Access Journals (Sweden)

    - -

    2006-03-01

    Full Text Available On the 10th of August, 2005 in Tartu (the second biggest educational and cultural city in Estonia Stanislav Nechvolodov's exhibition was opened to show the 5-year cycle of his work, traditional for the author and his admirers. At the opening ceremony Nechvolodov said that the exhibition was the last one and appointed on his 70th anniversary.The architectural and building society in Irkutsk remembers Stanislav Nechvolodov as an architect working on dwelling and civil buildings in 1960-70s. Below are some extracts from the Estonian press.«Postimees» newspaper, December 1993. The interview «Expressionistic naturalist, conservative Nechvolodov» by journalist Eric Linnumyagi. He asks about all the details and describes the troubles experienced by Nechvolodov during the perestroika period in Estonia, for example: the Tartu University refused to install the sculpture of Socrat, the art school refused to engage him as an instructor, the sculpture of Socrat moved to Vrotzlav, Poland, and Nechvolodov moved to Poland to read lectures there.«Tartu» newspaper, November 2000. Mats Oun, artist, says in the article «Nechvolodov: a man of Renaissance»: «Nechvolodov works in Estonia, his works are placed in many local and foreign museums. Regardless some insignificant faults, he deserves a high estimation, and his manysided open exhibition can be an example for other artists. He is a man of Renaissance».

  20. Creating Virtual Exhibitions for Educational and Cultural Development

    Directory of Open Access Journals (Sweden)

    Gabriela DUMITRESCU

    2014-01-01

    Full Text Available The paper presents different tools and mechanisms to implement a virtual exhibition in different cultural areas, such as museums and libraries. Quality characteristics of virtual exhibitions are identified and described. The possibility to create native mobile applications for virtual exhibitions presentation is analyzed. The functional flow of creating a virtual exhibition is presented and discussed. The Seals - History Treasure exhibition is presented and significant historical documents are revealed.

  1. cGMP-dependent protein kinase type II knockout mice exhibit working memory impairments, decreased repetitive behavior, and increased anxiety-like traits.

    Science.gov (United States)

    Wincott, Charlotte M; Abera, Sinedu; Vunck, Sarah A; Tirko, Natasha; Choi, Yoon; Titcombe, Roseann F; Antoine, Shannon O; Tukey, David S; DeVito, Loren M; Hofmann, Franz; Hoeffer, Charles A; Ziff, Edward B

    2014-10-01

    Neuronal activity regulates AMPA receptor trafficking, a process that mediates changes in synaptic strength, a key component of learning and memory. This form of plasticity may be induced by stimulation of the NMDA receptor which, among its activities, increases cyclic guanosine monophosphate (cGMP) through the nitric oxide synthase pathway. cGMP-dependent protein kinase type II (cGKII) is ultimately activated via this mechanism and AMPA receptor subunit GluA1 is phosphorylated at serine 845. This phosphorylation contributes to the delivery of GluA1 to the synapse, a step that increases synaptic strength. Previous studies have shown that cGKII-deficient mice display striking spatial learning deficits in the Morris Water Maze compared to wild-type littermates as well as lowered GluA1 phosphorylation in the postsynaptic density of the prefrontal cortex (Serulle et al., 2007; Wincott et al., 2013). In the current study, we show that cGKII knockout mice exhibit impaired working memory as determined using the prefrontal cortex-dependent Radial Arm Maze (RAM). Additionally, we report reduced repetitive behavior in the Marble Burying task (MB), and heightened anxiety-like traits in the Novelty Suppressed Feeding Test (NSFT). These data suggest that cGKII may play a role in the integration of information that conveys both anxiety-provoking stimuli as well as the spatial and environmental cues that facilitate functional memory processes and appropriate behavioral response. Published by Elsevier Inc.

  2. Control and characterization of textured, hydrophobic ionomer surfaces

    Science.gov (United States)

    Wang, Xueyuan

    Polymer thin films are of increasing interest in many industrial and technological applications. Superhydrophobic, self-cleaning surfaces have attracted a lot of attention for their application in self-cleaning, anti-sticking coatings, stain resistance, or anti-contamination surfaces in diverse technologies, including medical, transportation, textiles, electronics and paints. This thesis focuses on the preparation of nanometer to micrometer-size particle textured surfaces which are desirable for super water repellency. Textured surfaces consisting of nanometer to micrometer-sized lightly sulfonated polystyrene ionomer (SPS) particles were prepared by rapid evaporation of the solvent from a dilute polymer solution cast onto silica. The effect of the solvent used to spin coat the film, the molecular weight of the ionomer, and the rate of solvent evaporation were investigated. The nano-particle or micron-particle textured ionomer surfaces were prepared by either spin coating or solution casting ionomer solutions at controlled evaporation rates. The surface morphologies were consistent with a spinodal decomposition mechanism where the surface first existed as a percolated-like structure and then ripened into droplets if molecular mobility was retained for sufficient time. The SPS particles or particle aggregates were robust and resisted deformation even after annealing at 120°C for one week. The water contact angles on as-prepared surfaces were relatively low, ~ 90° since the polar groups in ionomer reduce the surface hydrophobicity. After chemical vapor deposition of 1H,1H,2H,2H-perfluorooctyltrichlorosilane, the surface contact angles increased to ~ 109° on smooth surfaces and ~140° on the textured surfaces. Water droplets stuck to these surfaces even when tilted 90 degrees. Superhydrophobic surfaces were prepared by spraying coating ionomer solutions and Chemical Vapor Deposition (CVD) of 1H,1H,2H,2H-perfluorooctyltrichlorosilane onto textured surfaces. The

  3. Fabrication of hydrophobic compressed oil palm trunk surface by sol-gel process

    Science.gov (United States)

    Muzakir, Syafiqah; Salim, Nurjannah; Huda Abu Bakar, Nurul; Roslan, Rasidi; Sin, Lim Wan; Hashim, Rokiah

    2018-04-01

    Improvement of the robustness of hydrophobic surfaces is crucial to achieving commercial applications of these surfaces in such various areas as self-cleaning, water repellency and corrosion resistance. Compressed oil palm trunk (OPT) panel is one of potential product which can be used as panelling and indoor furniture application. By adding hydrophobic properties to compressed oil palm trunk panel might increase the application of compressed oil palm trunk especially for outdoor application. In this study, fabrication is using the sol-gel technique. Sol-gel was prepared by adding ethanol with Hexadecyl Trimethyl Ammonium Bromide (CTAB) solution with Tetraethyl Orthosilicate (TEOS) with surface modification of chlorotrimethylsilane (CTMS). The surface with hydrophobic coating was undergone surface analysis with contact angle machine with the aid of software SCA 20 and the determined of the morphology of surface with scanning electron microscope (SEM). The produced compressed oil palm trunk surfaces exhibited promising hydrophobic properties with a contact angle of 104° and the relatively better mechanical robustness.

  4. The exploration of the exhibition informatization

    Science.gov (United States)

    Zhang, Jiankang

    2017-06-01

    The construction and management of exhibition informatization is the main task and choke point during the process of Chinese exhibition industry’s transformation and promotion. There are three key points expected to realize a breakthrough during the construction of Chinese exhibition informatization, and the three aspects respectively are adopting service outsourcing to construct and maintain the database, adopting advanced chest card technology to collect various kinds of information, developing statistics analysis to maintain good cutomer relations. The success of Chinese exhibition informatization mainly calls for mature suppliers who can provide construction and maintenance of database, the proven technology, a sense of data security, advanced chest card technology, the ability of data mining and analysis and the ability to improve the exhibition service basing on the commercial information got from the data analysis. Several data security measures are expected to apply during the process of system developing, including the measures of the terminal data security, the internet data security, the media data security, the storage data security and the application data security. The informatization of this process is based on the chest card designing. At present, there are several types of chest card technology: bar code chest card; two-dimension code card; magnetic stripe chest card; smart-chip chest card. The information got from the exhibition data will help the organizers to make relevant service strategies, quantify the accumulated indexes of the customers, and improve the level of the customer’s satisfaction and loyalty, what’s more, the information can also provide more additional services like the commercial trips, VIP ceremonial reception.

  5. Transience of plasma surface modification as an adhesion promoter for polychlorotrifluorethylene

    International Nuclear Information System (INIS)

    Subrahmanyan, S.; Dillard, J.G.; Love, B.J.; Romand, M.; Charbonnier, M.

    2002-01-01

    Poly(chlorotrifluoroethylene) (PCTFE) and other fluoropolymers are increasingly used as inner layer dielectrics. However, these polymers have low surface energies and correspondingly poor adhesive properties. Results are presented on the use of a low-pressure ammonia plasma to enhance the surface bondability of PCTFE. The plasma modified PCTFE film surfaces were characterized by x-ray photoelectron spectroscopy and contact angle measurements. Surface modified films exhibited improved adhesion to electroless copper deposits (180 deg. peel test) compared to coated PCTFE controls and that underwent no plasma exposure. Annealing studies were conducted between 30 and 100 deg. C to examine the stability of the plasma-modified surfaces. For samples annealed below T g , contact angle measurements indicated that the plasma-introduced groups remained bound on the surface for four weeks. For specimens annealed above T g , the surface functionalities were absorbed within the bulk and surface rearrangement occurred within 10 h of annealing time. As a result of rearrangement, the benefit of adhesion enhancement by plasma is lost and the adhesion to copper is reduced

  6. Acetazolamide on the ventral medulla of the cat increases phrenic output and delays the ventilatory response to CO sub 2

    Energy Technology Data Exchange (ETDEWEB)

    Coates, E.L.; Aihua Li; Nattie, E.E. (Dartmouth College, Hanover, NH (United States))

    1991-03-11

    Acetazolamide applied to the surface of the rostral ventrolateral medulla or microinjected beneath the medullary surface in chloralose-urethan-anesthetized, vagotomized, carotid denervated, paralyzed, servo-ventilated cats produced a long-lasting increase in phrenic minute ventilation. Extracellular pH measured beneath the rostral ventrolateral medulla exhibited a long-lasting decrease after surface acetazolamide but was not a good predictor, in each individual animal, of changes in phrenic activity. Medullary carbonic anhydrase inhibition reduced the slope and the half-time of the phrenic response to rapid step CO{sub 2} increases. Conversely, acetazolamide did not effect the phrenic response to steady state CO{sub 2} increases. These data indicate that localized inhibition of medullary carbonic anhydrase causes a centrally mediated increase in ventilation that the authors attribute to medullary tissue acidosis. In addition, these data indicate that medullary carbonic anhydrase may play a role in central CO{sub 2} chemotransduction.

  7. Mirror-finished superhydrophobic aluminum surfaces modified by anodic alumina nanofibers and self-assembled monolayers

    Science.gov (United States)

    Nakajima, Daiki; Kikuchi, Tatsuya; Natsui, Shungo; Suzuki, Ryosuke O.

    2018-05-01

    We demonstrate mirror-finished superhydrophobic aluminum surfaces fabricated via the formation of anodic alumina nanofibers and subsequent modification with self-assembled monolayers (SAMs). High-density anodic alumina nanofibers were formed on the aluminum surface via anodizing in a pyrophosphoric acid solution. The alumina nanofibers became tangled and bundled by further anodizing at low temperature because of their own weight, and the aluminum surface was completely covered by the long falling nanofibers. The nanofiber-covered aluminum surface exhibited superhydrophilic behavior, with a contact angle measuring less than 10°. As the nanofiber-covered aluminum surface was modified with n-alkylphosphonic acid SAMs, the water contact angle drastically shifted to superhydrophobicity, measuring more than 150°. The contact angle increased with the applied voltage during pyrophosphoric acid anodizing, the anodizing time, and the number of carbon atoms contained in the SAM molecules modified on the alumina nanofibers. By optimizing the anodizing and SAM-modification conditions, superhydrophobic behavior could be achieved with only a brief pyrophosphoric acid anodizing period of 3 min and subsequent simple immersion in SAM solutions. The superhydrophobic aluminum surface exhibited a high reflectance, measuring approximately 99% across most of the visible spectrum, similar to that of an electropolished aluminum surface. Therefore, our mirror-finished superhydrophobic aluminum surface based on anodic alumina nanofibers and SAMs can be used as a reflective mirror in various optical applications such as concentrated solar power systems.

  8. Social Media and Scientific Meetings: Education Exhibit "Likes" at the Radiological Society of North America Annual Meeting.

    Science.gov (United States)

    Bunch, Paul M; Wortman, Jeremy R; Andriole, Katherine P

    2016-03-01

    Viewers of electronic education exhibits at the 2013 and 2014 Radiological Society of North America meetings had the opportunity to "like" exhibits, as one might "like" a Facebook or an Instagram post. The purposes of this study were (1) to evaluate for a relationship between exhibit popularity and receiving an award or RadioGraphics invitation, (2) to evaluate for a relationship between exhibit recognition and subsequent popularity, and (3) to quantify and compare the electronic education exhibit likes at the 2013 and the 2014 meetings. Exhibit likes were recorded at the midpoints and ends of both meetings. Data analyses were performed by means of one-way analysis of variance and chi-square tests. There were similar numbers of electronic education exhibits at the 2013 (1856) and 2014 (1793) meetings with no significant difference between meeting years in the number of exhibits chosen for awards (423 vs. 404, P = 0.88) or for RadioGraphics solicitation (190 vs. 169, P = 0.46). In both meeting years, there were statistically significant associations between initial and overall exhibit popularity and exhibit recognition, as well as between exhibit recognition and subsequent popularity. A 152% increase in total likes recorded was observed at the 2014 meeting as compared to the 2013 meeting (11074 vs. 4391, P < 0.0001). Popular exhibits were significantly more likely to receive awards and RadioGraphics invitations. Receiving an award or RadioGraphics invitation was associated with subsequent increased exhibit popularity. Significantly more likes were recorded at the 2014 Radiological Society of North America meeting than at the 2013 meeting. Copyright © 2015 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

  9. Digital Natives: Creating Emergent Exhibitions through Digital Technologies

    DEFF Research Database (Denmark)

    Smith, Rachel Charlotte; Iversen, Ole Sejer; Dindler, Christian

    2011-01-01

    . In this way, digital technology can contribute to the creation of emergent exhibitions in which the exhibition is created in dialogue between audiences and the museum. We present experiences from a current research project, the Digital Natives exhibition, in which digital technology was designed......Digital Technology can support the creation of dialogical spaces in the museum, both playful and reflective, that allow audiences to engage in the ongoing construction and reproduction of cultural heritage creating novel connections between self and others and between past, present and future...... as an integral part of the exhibition to encourage dialogue between audiences and the exhibition materials and thereby investigate how the exhibition emerge as a result of this dialogic co-construction inside the exhibition space. In short, the opportunities offered by digital technologies prompts us to consider...

  10. Artefacts and the performance of an exhibition

    DEFF Research Database (Denmark)

    Svabo, Connie

    2008-01-01

    The article explores the role of mediating artefacts in children's encounters with a museum of natural history. Using actor network theory it explores how a specific artefact shapes the way users relate to exhibited objects and how the artefact guides users' movements in the exhibition....... The mediated performance of an exhibition is explored through an empirical case....

  11. A content-oriented model for science exhibit engineering

    DEFF Research Database (Denmark)

    Achiam, Marianne

    2013-01-01

    Recently, science museums have begun to review their educational purposes and redesign their pedagogies. At the most basic level, this entails accounting for the performance of individual exhibits, and indeed, in some cases, research indicates shortcomings in exhibit design: While often successful......: as a means to operationalize the link between exhibit features and visitor activities; and as a template to transform scientists’ practices in the research context into visitors’ activities in the exhibit context. The resulting model of science exhibit engineering is presented and exemplified, and its...... implications for science exhibit design are discussed at three levels: the design product, the design process, and the design methodology....

  12. France at CERN – Industrial exhibition

    CERN Multimedia

    FP Department

    2012-01-01

    Industrial Exhibition Administration Building Bldg 61 – 1st Floor Tuesday 27 March: 9 a.m. – 5.30 p.m. Wednesday 28 March: 9 a.m. – 2 p.m.   About thirty French companies are presenting their latest technological advances during the industrial exhibition "France at CERN", featuring products and technologies specifically related to CERN activities. Individual B2B meetings can be organized with the sales and technical representatives of participating firms and will take place at either the companies’ exhibition stands or in conference rooms in the Main Building. Individuals wishing to make contact with one or more companies must use the contact details available from each secretariat of department or by using this link. B2B meetings will be coordinated by UBIFRANCE. You will also find the list of exhibiting and participating companies online here. This event is sponsored by the French subsidiary of RS Components, the most important distri...

  13. Effects of surface roughness, texture and polymer degradation on cathodic delamination of epoxy coated steel samples

    International Nuclear Information System (INIS)

    Khun, N.W.; Frankel, G.S.

    2013-01-01

    Highlights: ► Cathodic delamination of epoxy coated steel samples was studied using SKP. ► Delamination of the coating decreased with increased substrate surface roughness. ► Delamination of the coating was faster on the substrate with parallel surface scratches. ► Delamination of the coating exposed to weathering conditions increased with prolonged exposure. - Abstract: The Scanning Kelvin Probe (SKP) technique was used to investigate the effects of surface roughness, texture and polymer degradation on cathodic delamination of epoxy coated steel. The cathodic delamination rate of the epoxy coatings dramatically decreased with increased surface roughness of the underlying steel substrate. The surface texture of the steel substrates also had a significant effect in that samples with parallel abrasion lines exhibiting faster cathodic delamination in the direction of the lines compared to the direction perpendicular to the lines. The cathodic delamination kinetics of epoxy coatings previously exposed to weathering conditions increased with prolonged exposure due to pronounced polymer degradation. SEM observation confirmed that the cyclic exposure to UV radiation and water condensation caused severe deterioration in the polymer structures with surface cracking and erosion. The SKP results clearly showed that the cathodic delamination of the epoxy coatings was significantly influenced by the surface features of the underlying steel substrates and the degradation of the coatings.

  14. Temporary and Travelling Exhibitions. Museums and Monuments, X.

    Science.gov (United States)

    Daifuku, Hiroshi; And Others

    The permanent exhibition, the most typical form of museum exhibition, has failed to attract repeated visitation, since visitors quickly become familiar with the objects shown. The temporary exhibition evolved as a result for the need of repeated visitation. The temporary exhibition, set up for a period of one to six months, introduces fresh…

  15. Water on a Hydrophobic surface

    Science.gov (United States)

    Scruggs, Ryan; Zhu, Mengjue; Poynor, Adele

    2012-02-01

    Hydrophobicity, meaning literally fear of water, is exhibited on the surfaces of non-stick cooking pans and water resistant clothing, on the leaves of the lotus plan, or even during the protein folding process in our bodies. Hydrophobicity is directly measured by determining a contact angle between water and an objects surface. Associated with a hydrophobic surface is the depletion layer, a low density region approximately 0.2 nm thick. We study this region by comparing data found in lab using surface plasmon resonance techniques to theoretical calculations. Experiments use gold slides coated in ODT and Mercapto solutions to model both hydrophobic and hydrophilic surfaces respectively.

  16. Creating gradient wetting surfaces via electroless displacement of zinc-coated carbon steel by nickel ions

    Science.gov (United States)

    Xu, Chang; Liu, Huicong; Liang, Weitao; Zhu, Liqun; Li, Weiping; Chen, Haining

    2018-03-01

    Gradient wetting surfaces are getting increasing attention due to their wide application in multiple fields such as droplet movement and biosorption. However, the fabrication processes of full gradient wetting surfaces are still complex and costly. In present work, a facile and low-cost chemical immersion method was used to create a full gradient wetting surface. By controlling the displacement time in Ni2+ solution, the prepared surfaces perform hydrophilic to superhydrophilic. After being modified by stearic acid, the gradient hydrophilic surfaces convert into hydrophobic. The surface morphology, composition, and wetting behaviors of the as-prepared surfaces were systematically studied and discussed. The gradient wetting property could be attributed to the change in microroughness and surface energy. In addition, these surfaces also exhibited excellent self-cleaning and wax prevention properties. Furthermore, high stability and corrosion resistance were also found for these surfaces, which further highlight their promising practical applications in many fields.

  17. Borneol Is a TRPM8 Agonist that Increases Ocular Surface Wetness.

    Directory of Open Access Journals (Sweden)

    Gui-Lan Chen

    Full Text Available Borneol is a compound widely used in ophthalmic preparations in China. Little is known about its exact role in treating eye diseases. Here we report that transient receptor potential melastatin 8 (TRPM8 channel is a pharmacological target of borneol and mediates its therapeutic effect in the eyes. Ca2+ measurement and electrophysiological recordings revealed that borneol activated TRPM8 channel in a temperature- and dose-dependent manner, which was similar to but less effective than the action of menthol, an established TRPM8 agonist. Borneol significantly increased tear production in guinea pigs without evoking nociceptive responses at 25°C, but failed to induce tear secretion at 35°C. In contrast, menthol evoked tearing response at both 25 and 35°C. TRPM8 channel blockers N-(3-Aminopropyl-2-[(3-methylphenylmethoxy]-N-(2-thienylmethylbenzamide hydrochloride (AMTB and N-(4-tert-butylphenyl-4-(3-chloropyridin-2-ylpiperazine-1-carboxamide (BCTC abolished borneol- and menthol-induced tear secretion. Borneol at micromolar concentrations did not affect the viability of human corneal epithelial cells. We conclude that borneol can activate the cold-sensing TRPM8 channel and modestly increase ocular surface wetness, which suggests it is an active compound in ophthalmic preparations and particularly useful in treating dry eye syndrome.

  18. CERN Industrials Exhibitions - Over 30 Years of Tradition

    CERN Multimedia

    2001-01-01

    Industrial exhibitions have been part of the CERN landscape for 33 years. At least once each year several companies from the same country come to CERN to present their products and services. Now, a new scheme of one-day visits is giving potential exhibitors at CERN a lighter option. The United Kingdom inaugurated the Industrial Exhibitions in 1968, and it wasn't till 1971 that other countries staged exhibitions at CERN. This photo was taken in 1969, at the second British exhibition, where 16 companies were present. Four years after joining CERN, Poland inaugurated its first exhibition at CERN in 1995 in the presence of the former Director-General Chris Llewellyn-Smith. Almost all the Member States have held industrial exhibitions at the Organization. May '68 wasn't only revolutionary in Paris. For the very first time, an industrial exhibition took place at CERN. Great Britain was first to come with eight companies and remains until this day the most devoted country to the programme with 17 exhibitions and ...

  19. The surface learned from nature

    Science.gov (United States)

    Lim, H.; Kim, W. D.

    2010-07-01

    In this work, I would like to introduce the emerging surface of nature. The surface in nature, has the multi and optimized function with well organized structure. There are so many examples that we learn and apply to technology. First example is self-cleaning surface. Some plants (such as lotus leaf, taro leaf) and the wings of many large-winged insects (such as moth, butterfly, dragonfly) remain their surface clean in the very dirty environment. This self cleaning effect is accomplished by the superhydrophobic surfaces which exhibit the water contact angle of more than 150° with low sliding angle. Generally, the superhydrophobic surface is made up the two factors. One is the surface composition having the low surface tension energy. The other is the surface morphology of hierarchical structure of micro and nano size. Because almost nature surface have the hierarchical structures range from macro to nano size, their topography strength their function to adjust the life in nature environment. The other example is the surface to use for drag reduction. The skin friction drag causes eruptions of air or water resulting in greater drag as the speed is increased. This drag requires more energy to overcome. The shark skin having the fine sharp-edged grooves about 0.1 mm wide known riblet reduces in skin friction drag by being far away the vortex. Among a lot of fuctional surface, the most exciting surface the back of stenocara a kind of desert beetles. Stenocara use the micrometre-sized patterns of hydrophobic, wax-coated and hydrophilic, non-waxy regions on their backs to capture water from fog. This fog-collecting structure improves the water collection of fog-capture film, condenser, engine, and future building. Here, the efforts to realize these emerging functional surfaces in nature on technology are reported with the fabrication method and their properties, especially for the control of surface wettability.

  20. Reactively sputtered epitaxial γ′-Fe4N films: Surface morphology, microstructure, magnetic and electrical transport properties

    KAUST Repository

    Mi, Wenbo

    2013-10-01

    Epitaxial γ′-Fe4N films with (1 0 0) and (1 1 0) orientations have been fabricated by reactive sputtering; these films were characterized by X-ray θ-2θ and φ scans, pole figures and high-resolution transmission electron microscopy. The film surface is very smooth as the film is less than 58 nm thick. The films exhibit soft ferromagnetism, and the saturation magnetization decreases with an increase in temperature, following Bloch\\'s spin wave theory. The films also exhibit a metallic conductance mechanism. Below 30 K, magnetoresistance (MR) is positive and increases linearly with the applied field in the high-field range. In the low-field range, MR increases abruptly. Above 30 K, MR is negative, and its value increases linearly with the applied field.

  1. Rock-dwelling lizards exhibit less sensitivity of sprint speed to increases in substrate rugosity.

    Science.gov (United States)

    Collins, Clint E; Self, Jessica D; Anderson, Roger A; McBrayer, Lance D

    2013-06-01

    Effectively moving across variable substrates is important to all terrestrial animals. The effects of substrates on lizard performance have ecological ramifications including the partitioning of habitat according to sprinting ability on different surfaces. This phenomenon is known as sprint sensitivity, or the decrease in sprint speed due to change in substrate. However, sprint sensitivity has been characterized only in arboreal Anolis lizards. Our study measured sensitivity to substrate rugosity among six lizard species that occupy rocky, sandy, and/or arboreal habitats. Lizards that use rocky habitats are less sensitive to changes in substrate rugosity, followed by arboreal lizards, and then by lizards that use sandy habitats. We infer from comparative phylogenetic analysis that forelimb, chest, and tail dimensions are important external morphological features related to sensitivity to changes in substrate rugosity. Copyright © 2013 Elsevier GmbH. All rights reserved.

  2. Memory and Mourning: An Exhibit History

    Science.gov (United States)

    Eberle, Scott G.

    2005-01-01

    Mounted by the Strong Museum in Rochester, New York, in 1993, and traveling nationally thereafter, the exhibit Memory and Mourning provided historical and contemporary perspectives to help museum guests explore their own reactions to loss and grief. In the process the exhibit's development team encountered a range of philosophical, historical,…

  3. An unscaled parameter to measure the order of surfaces: a new surface elaboration to increase cells adhesion.

    Science.gov (United States)

    Bigerelle, M; Anselme, K; Dufresne, E; Hardouin, P; Iost, A

    2002-08-01

    We present a new parameter to quantify the order of a surface. This parameter is scale-independent and can be used to compare the organization of a surface at different scales of range and amplitude. To test the accuracy of this roughness parameter versus a hundred existing ones, we created an original statistical bootstrap method. In order to assess the physical relevance of this new parameter, we elaborated a great number of surfaces with various roughness amplitudes on titanium and titanium-based alloys using different physical processes. Then we studied the influence of the roughness amplitude on in vitro adhesion and proliferation of human osteoblasts. It was then shown that our new parameter best discriminates among the cell adhesion phenomena than others' parameters (Average roughness (Ra em leader )): cells adhere better on isotropic surfaces with a low order, provided this order is quantified on a scale that is more important than that of the cells. Additionally, on these low ordered metallic surfaces, the shape of the cells presents the same morphological aspect as that we can see on the human bone trabeculae. The method used to prepare these isotropic surfaces (electroerosion) could be undoubtedly and easily applied to prepare most biomaterials with complex geometries and to improve bone implant integration. Moreover, the new order parameter we developed may be particularly useful for the fundamental understanding of the mechanism of bone cell installation on a relief and of the formation of bone cell-material interface.

  4. Tuning the hydrophobicity of mica surfaces by hyperthermal Ar ion irradiation

    International Nuclear Information System (INIS)

    Keller, Adrian; Ogaki, Ryosuke; Bald, Ilko; Dong Mingdong; Kingshott, Peter; Fritzsche, Monika; Facsko, Stefan; Besenbacher, Flemming

    2011-01-01

    The hydrophobicity of surfaces has a strong influence on their interactions with biomolecules such as proteins. Therefore, for in vitro studies of bio-surface interactions model surfaces with tailored hydrophobicity are of utmost importance. Here, we present a method for tuning the hydrophobicity of atomically flat mica surfaces by hyperthermal Ar ion irradiation. Due to the sub-100 eV energies, only negligible roughening of the surface is observed at low ion fluences and also the chemical composition of the mica crystal remains almost undisturbed. However, the ion irradiation induces the preferential removal of the outermost layer of K + ions from the surface, leading to the exposure of the underlying aluminosilicate sheets which feature a large number of centers for C adsorption. The irradiated surface thus exhibits an enhanced chemical reactivity toward hydrocarbons, resulting in the adsorption of a thin hydrocarbon film from the environment. Aging these surfaces under ambient conditions leads to a continuous increase of their contact angle until a fully hydrophobic surface with a contact angle >80 deg. is obtained after a period of about 3 months. This method thus enables the fabrication of ultrasmooth biological model surfaces with precisely tailored hydrophobicity.

  5. Polydopamine-mediated surface-functionalization of graphene oxide for heavy metal ions removal

    International Nuclear Information System (INIS)

    Dong, Zhihui; Zhang, Feng; Wang, Dong; Liu, Xia; Jin, Jian

    2015-01-01

    By utilizing polydopamine (PD) nano-thick interlayer as mediator, polyethylenimine (PEI) brushes with abundant amine groups were grafted onto the surface of PD coated graphene oxide (GO) uniformly via a Michael-Addition reaction and produced a PEI–PD/GO composite nanosheets. The PEI–PD/GO composite exhibited an improved performance for adsorption of heavy metal ions as compared to PEI-coated GO and pure GO. The adsorption capacities for Cu 2+ , Cd 2+ , Pb 2+ , Hg 2+ are up to 87, 106, 197, and 110 mg/g, respectively. To further make the GO based composite operable, PEI–PD/RGO aerogel was prepared through hydrothermal and achieved a high surface area up to 373 m 2 /g. Although the adsorption capacity of PEI–PD/RGO aerogel for heavy metal ions decreases a little as compared to PEI–PD/GO composite dispersion (38, 32, 95, 113 mg/g corresponding to Cu 2+ , Cd 2+ , Pb 2+ , and Hg 2+ , respectively), it could be recycled several times in a simple way by releasing adsorbed metal ions, indicating its potential application for cleaning wastewater. - Graphical abstract: Polyethylenimine (PEI) brushes were grafted onto the surface of graphene oxide (GO) uniformly via a Michael-Addition reaction between the PEI and polydopamine interlayer coated on GO surface. The PEI–PD/GO composite exhibited an improved performance for adsorption of heavy metal ions compared to PEI-coated GO and pure GO. - Highlights: • We prepared polyethylenimine grafted polydopamine-mediated graphene oxide composites. • Introduction of PD layer increases metal ions adsorption capacity. • PEI–PD/RGO aerogel exhibited a superior adsorption performance. • PEI–PD/RGO aerogel can be recycled several times in a simple way

  6. Influence of nanoscale topology on bactericidal efficiency of black silicon surfaces

    Science.gov (United States)

    Linklater, Denver P.; Khuong Duy Nguyen, Huu; Bhadra, Chris M.; Juodkazis, Saulius; Ivanova, Elena P.

    2017-06-01

    The nanostructuring of materials to create bactericidal and antibiofouling surfaces presents an exciting alternative to common methods of preventing bacterial adhesion. The fabrication of synthetic bactericidal surfaces has been inspired by the anti-wetting and anti-biofouling properties of insect wings, and other topologies found in nature. Black silicon is one such synthetic surfaces which has established bactericidal properties. In this study we show that time-dependent plasma etching of silicon wafers using 15, 30, and 45 min etching intervals, is able to produce different surface geometries with linearly increasing heights of approximately 280, 430, and 610 nm, respectively. After incubation on these surfaces with Gram-positive Staphylococcus aureus and Gram-negative Pseudomonas aeruginosa bacterial cells it was established that smaller, more densely packed pillars exhibited the greatest bactericidal activity with 85% and 89% inactivation of bacterial cells, respectively. The decrease in the pillar heights, pillar cap diameter and inter-pillar spacing corresponded to a subsequent decrease in the number of attached cells for both bacterial species.

  7. Synchrotron photoemission spectroscopy study of ammonium hydroxide etching to prepare well-ordered GaAs(1 0 0) surfaces

    International Nuclear Information System (INIS)

    Lebedev, Mikhail V.; Ensling, David; Hunger, Ralf; Mayer, Thomas; Jaegermann, Wolfram

    2004-01-01

    Synchrotron-induced photoelectron spectroscopy was used to investigate the native-oxide-covered GaAs(1 0 0) surface and changes induced by etching with aqueous ammonia solution and by annealing in vacuum. The etching step removes arsenic and gallium oxides from the surface and the surface gets covered by elemental arsenic and tiny amounts of gallium suboxide. The surface oxygen content is reduced by an order of magnitude after etching, whereas the surface carbon content is somewhat increased. Annealing of this surface at 450 deg. C results in the disappearance of elemental arsenic and a considerable decrease in surface carbon and oxygen contents. The valence band spectra exhibit clear features typical for As-terminated GaAs(1 0 0) surfaces, as also obtained after As decapping

  8. Antibacterial Au nanostructured surfaces

    Science.gov (United States)

    Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun

    2016-01-01

    We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all

  9. Lithium inclusion in indium metal-organic frameworks showing increased surface area and hydrogen adsorption

    Directory of Open Access Journals (Sweden)

    Mathieu Bosch

    2014-12-01

    Full Text Available Investigation of counterion exchange in two anionic In-Metal-Organic Frameworks (In-MOFs showed that partial replacement of disordered ammonium cations was achieved through the pre-synthetic addition of LiOH to the reaction mixture. This resulted in a surface area increase of over 1600% in {Li [In(1,3 − BDC2]}n and enhancement of the H2 uptake of approximately 275% at 80 000 Pa at 77 K. This method resulted in frameworks with permanent lithium content after repeated solvent exchange as confirmed by inductively coupled plasma mass spectrometry. Lithium counterion replacement appears to increase porosity after activation through replacement of bulkier, softer counterions and demonstrates tuning of pore size and properties in MOFs.

  10. Effects of Surface Wettability on the Porosity and Wickability of Frost

    Science.gov (United States)

    Witt, Katherine; Ahmadi, Farzad; Boreyko, Jonathan

    2017-11-01

    The wicking of liquids through porous media has been studied for many materials, but never for frost, despite its implications for arctic oil spills and oil-infused surfaces. Here, we characterize silicone oils wicking up frost sheets. A layer of frost was grown on aluminum plates of varying surface wettability: superhydrophilic, hydrophilic, hydrophobic, and superhydrophobic. Once the desired frost thickness was grown, a humidity chamber was used to maintain the frost at the dew point and the bottom of the plate was dipped in a reservoir of fluorescent silicone oil. For all surfaces, the wicking rate of the oil increased with increasing wettability. For the wetting surfaces, this is manifested in the length vs. time data following the classical Washburn equation, exhibiting a power slope of about 1/2 and resulting in a larger effective pore radius with increasing wettability. However, we observed that on the non-wetting surfaces, the discrete distribution of the frosted dew droplets resulted in a new scaling law with a slope much less than 1/2, especially for the superhydrophobic surface which promoted jumping-droplet condensation. This research shows that the wicking of oil up a layer of frost can give insight into the morphology of frost. Conversely, if the underlying wettability of a frost sheet can be controlled, the spread of oil can be widely tuned. This work was supported by a Virginia Space Grant Consortium Undergraduate Research Scholarship (PMPTX7EP).

  11. Wettability and Contact Time on a Biomimetic Superhydrophobic Surface

    Science.gov (United States)

    Liang, Yunhong; Peng, Jian; Li, Xiujuan; Huang, Jubin; Qiu, Rongxian; Zhang, Zhihui; Ren, Luquan

    2017-01-01

    Inspired by the array microstructure of natural superhydrophobic surfaces (lotus leaf and cicada wing), an array microstructure was successfully constructed by high speed wire electrical discharge machining (HS-WEDM) on the surfaces of a 7075 aluminum alloy without any chemical treatment. The artificial surfaces had a high apparent contact angle of 153° ± 1° with a contact angle hysteresis less than 5° and showed a good superhydrophobic property. Wettability, contact time, and the corresponding superhydrophobic mechanism of artificial superhydrophobic surface were investigated. The results indicated that the micro-scale array microstructure was an important factor for the superhydrophobic surface, while different array microstructures exhibited different effects on the wettability and contact time of the artificial superhydrophobic surface. The length (L), interval (S), and height (H) of the array microstructure are the main influential factors on the wettability and contact time. The order of importance of these factors is H > S > L for increasing the apparent contact angle and reducing the contact time. The method, using HS-WEDM to fabricate superhydrophobic surface, is simple, low-cost, and environmentally friendly and can easily control the wettability and contact time on the artificial surfaces by changing the array microstructure. PMID:28772613

  12. CERN exhibition a big hit in Bulgaria

    CERN Multimedia

    2005-01-01

    The first CERN exhibition in Bulgaria attracted many visitors. In the first ever CERN exhibition to be held in Bulgaria, over 1,400 visitors, many of them students and young physicists, visited the 10-day event in Sofia. The CERN mini-exhibition took place at the National Earth and Mankind Museum between 8 and 17 November. Permanently staffed by young physicists from Sofia University, there were exhibits on display about research activities at CERN, as well as four additional posters describing Bulgaria's participation. The inauguration took place on the morning of 8 November in the presence of the Vice-Minister for Science and Education, Mrs. Vanya Dobreva, and some 200 guests. A series of short speeches were followed by a visit to the exhibition. CERN's representative at the event, Ray Lewis, was then asked by Professor Matey Mateev, President of the Union of Physicists in Bulgaria, to say a few words on behalf of the Organization. Numerous journalists were also present at the inauguration. A painting enti...

  13. CERN’s travelling exhibition goes to Austria

    CERN Multimedia

    Mélissa Lanaro

    2011-01-01

    Since April 2009 CERN’s travelling exhibition has been touring through some of the Organization's Member States. After Italy and Denmark it has been on show since February at Austria’s Hartberg Ökopark, a very popular science museum situated some one hundred kilometres from Vienna. To coincide with the CERN exhibition, Austria’s scientific community has organised a series of events for the general public which have had marked success. The exhibition's next destination will be Portugal and preparations are already underway to ensure that it is another resounding success   The travelling exhibition was designed in collaboration with the University of Geneva, as part of the celebrations for its 450th anniversary, and has already notched up a good number of kilometres as it travels from country to country. “In 2010 the exhibition already had around 55,000 visitors,” explains Rolf Landua, who heads the Education Group. Since its inauguration ...

  14. “Accelerating Science” exhibition zooms to Turkey

    CERN Multimedia

    Joannah Caborn Wengler

    2012-01-01

    'Accelerating Science', CERN’s travelling science outreach exhibition, has just arrived at the Middle East Technical University (METU) in Ankara, Turkey for a four-month stay there. This is the first time it has moved outside the circle of the Member States. The Turkish venue will inaugurate some new exhibits that have recently been developed by CERN’s software developers.   “It’s been a very busy day,” says Bilge Demirkoz, an associate professor of physics at METU and a member of AMS-02, who had been overseeing the unloading of the lorries when we spoke to her. “As the University doesn’t have a specific exhibition space, the CERN exhibits are going to be housed in the covered tennis courts just behind the cultural and congress centre. It’s a beautiful venue, and there are plenty of parking spaces.” The University has sent invitations to the exhibition to high schools and to about 100 ...

  15. Increased adhesion of polydimethylsiloxane (PDMS) to acrylic adhesive tape for medical use by surface treatment with an atmospheric pressure rotating plasma jet

    International Nuclear Information System (INIS)

    Jofre-Reche, José Antonio; Martín-Martínez, José Miguel; Pulpytel, Jérôme; Arefi-Khonsari, Farzaneh

    2016-01-01

    The surface properties of polydimethylsiloxane (PDMS) were modified by treatment with an atmospheric pressure rotating plasma jet (APPJ) and the surface modifications were studied to assess its hydrophilicity and adhesion to acrylic adhesive tape intended for medical applications. Furthermore, the extent of hydrophobic recovery under different storage conditions was studied. The surface treatment of PDMS with the APPJ under optimal conditions noticeably increased the oxygen content and most of the surface silicon species were fully oxidized. A brittle silica-like layer on the outermost surface was created showing changes in topography due to the formation of grooves and cracks. A huge improvement in T-peel and the shear adhesive strength of the APPJ-treated PDMS surface/acrylic tape joints was obtained. On the other hand, the hydrophilicity of the PDMS surface increased noticeably after the APPJ treatment, but 24 h after treatment almost 80% hydrophobicity was recovered and the adhesive strength was markedly reduced with time after the APPJ treatment. However, the application of an acrylic adhesive layer on the just-APPJ-treated PDMS surface retained the adhesive strength, limiting the extent of hydrophobic recovery. (paper)

  16. Increasing the laser-induced damage threshold of single-crystal ZnGeP{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Zawilski, Kevin T; Setzler, Scott D; Schunemann, Peter G; Pollak, Thomas M [BAE Systems, Advanced Systems and Technology, P.O. Box 868, MER15-1813, Nashua, New Hampshire 03061-0868 (United States)

    2006-11-15

    The laser-induced damage threshold (LIDT) of single-crystal zinc germanium phosphide (ZGP), ZnGeP{sub 2}, was increased to 2 J/cm{sup 2} at 2.05 {mu}m and a 10 kHz pulse rate frequency (double the previously measured value of 1 J/cm{sup 2}). This increased LIDT was achieved by improving the polishing of ZGP optical parametric oscillator crystals. Two different polishing techniques were evaluated. Surfaces were characterized using scanning white-light interferometry to determine rms surface roughness and sample flatness. The photon backscatter technique was used to determine the degree of surface and subsurface damage in the sample induced through the fabrication process. The effect of subsurface damage in the samples was studied by removing different amounts of material during polishing for otherwise identical samples. Statistical LIDT was measured using a high-average-power, repetitively Q-switched Tm,Ho:YLF 2.05 {mu}m pump laser. On average, lower surface roughness and photon backscatter measurements were a good indicator of ZGP samples exhibiting higher LIDT. The removal of more material during polishing significantly improved the LIDT of otherwise identical samples, indicating the importance of subsurface damage defects in the LIDT of ZGP.

  17. Temperature dependence of coercivity behavior in iron films on silicone oil surfaces

    International Nuclear Information System (INIS)

    Xu Xiaojun; Ye Quanlin; Ye Gaoxiang

    2007-01-01

    A new iron film system, deposited on silicone oil surfaces by vapor phase deposition method, has been fabricated and its microstructure as well as magnetic properties has been studied. It is found that the temperature dependence of the coercive field H c (T) of the films exhibits a peak around a critical temperature T crit =10-15 K: for the temperature T crit ,H c (T) increases with the temperature; if T>T crit , however, it decreases rapidly and then approaches a steady value as T further increases. Our study shows that, for T>T crit , the observed coercivity behavior is mainly dominated by the effect of the non-uniform single-domain particle size distribution, and for T crit , the anomalous coercivity behavior may be resulted from the surface anisotropy, the surface effect and the characteristic internal stress distribution in the films. The influence of the shape and size of the particles on the thermal dependence of the magnetization is also investigated

  18. Solution-Processed Organic and Halide Perovskite Transistors on Hydrophobic Surfaces.

    Science.gov (United States)

    Ward, Jeremy W; Smith, Hannah L; Zeidell, Andrew; Diemer, Peter J; Baker, Stephen R; Lee, Hyunsu; Payne, Marcia M; Anthony, John E; Guthold, Martin; Jurchescu, Oana D

    2017-05-31

    Solution-processable electronic devices are highly desirable due to their low cost and compatibility with flexible substrates. However, they are often challenging to fabricate due to the hydrophobic nature of the surfaces of the constituent layers. Here, we use a protein solution to modify the surface properties and to improve the wettability of the fluoropolymer dielectric Cytop. The engineered hydrophilic surface is successfully incorporated in bottom-gate solution-deposited organic field-effect transistors (OFETs) and hybrid organic-inorganic trihalide perovskite field-effect transistors (HTP-FETs) fabricated on flexible substrates. Our analysis of the density of trapping states at the semiconductor-dielectric interface suggests that the increase in the trap density as a result of the chemical treatment is minimal. As a result, the devices exhibit good charge carrier mobilities, near-zero threshold voltages, and low electrical hysteresis.

  19. Improving Dry Powder Inhaler Performance by Surface Roughening of Lactose Carrier Particles.

    Science.gov (United States)

    Tan, Bernice Mei Jin; Chan, Lai Wah; Heng, Paul Wan Sia

    2016-08-01

    This study investigated the impact of macro-scale carrier surface roughness on the performance of dry powder inhaler (DPI) formulations. Fluid-bed processing and roller compaction were explored as processing methods to increase the surface roughness (Ra) of lactose carrier particles. DPI formulations containing either (a) different concentrations of fine lactose at a fixed concentration of micronized drug (isoniazid) or (b) various concentrations of drug in the absence of fine lactose were prepared. The fine particle fraction (FPF) and aerodynamic particle size of micronized drug of all formulations were determined using the Next Generation Impactor. Fluid-bed processing resulted in a modest increase in the Ra from 562 to 907 nm while roller compaction led to significant increases in Ra > 1300 nm. The roller compacted carriers exhibited FPF > 35%, which were twice that of the smoothest carriers. The addition of up to 5%, w/w of fine lactose improved the FPF of smoother carriers by 60-200% whereas only lactose carrier particles by roller compaction was immensely beneficial to improving DPI performance, primarily due to increased surface roughness at the macro-scale.

  20. Surface expression and limited proteolysis of ADAM10 are increased by a dominant negative inhibitor of dynamin

    Directory of Open Access Journals (Sweden)

    Slack Barbara E

    2011-05-01

    Full Text Available Abstract Background The amyloid precursor protein (APP is cleaved by β- and γ-secretases to generate toxic amyloid β (Aβ peptides. Alternatively, α-secretases cleave APP within the Aβ domain, precluding Aβ formation and releasing the soluble ectodomain, sAPPα. We previously showed that inhibition of the GTPase dynamin reduced APP internalization and increased release of sAPPα, apparently by prolonging the interaction between APP and α-secretases at the plasma membrane. This was accompanied by a reduction in Aβ generation. In the present study, we investigated whether surface expression of the α-secretase ADAM (a disintegrin and metalloprotease10 is also regulated by dynamin-dependent endocytosis. Results Transfection of human embryonic kidney (HEK cells stably expressing M3 muscarinic receptors with a dominant negative dynamin I mutant (dyn I K44A, increased surface expression of both immature, and mature, catalytically active forms of co-expressed ADAM10. Surface levels of ADAM10 were unaffected by activation of protein kinase C (PKC or M3 receptors, indicating that receptor-coupled shedding of the ADAM substrate APP is unlikely to be mediated by inhibition of ADAM10 endocytosis in this cell line. Dyn I K44A strongly increased the formation of a C-terminal fragment of ADAM10, consistent with earlier reports that the ADAM10 ectodomain is itself a target for sheddases. The abundance of this fragment was increased in the presence of a γ-secretase inhibitor, but was not affected by M3 receptor activation. The dynamin mutant did not affect the distribution of ADAM10 and its C-terminal fragment between raft and non-raft membrane compartments. Conclusions Surface expression and limited proteolysis of ADAM10 are regulated by dynamin-dependent endocytosis, but are unaffected by activation of signaling pathways that upregulate shedding of ADAM substrates such as APP. Modulation of ADAM10 internalization could affect cellular behavior in two

  1. One exhibition, many goals. Combining scientific research and risk communication

    Science.gov (United States)

    Charrière, Marie; Bogaard, Thom; Junier, Sandra; Malet, Jean-Philippe; Mostert, Erik

    2015-04-01

    How effective is visual communication to increase awareness of natural hazards and risks? To answer this research question, we developed a research design that was at the same time an experimental setting and an actual communication effort. Throughout the full length of the 2-years project held in the Ubaye valley (southeastern France), we collaborated with local and regional stakeholders (politicians and technicians). During a consultation phase, the communication context was determined, the audience of the project was defined and finally the testing activity-communication effort was determined. We were offered the opportunity to design an exhibition for the local public library. In a consultation phase that corresponded to the design of the exhibition, the stakeholders contributed to its content as well as helping with the funding of the exhibition. Finally, during the experimentation phase, the stakeholders participated in advertising the activity, gathering of participants and designing the scientific survey. In order to assess the effects of the exhibition on risk awareness, several groups of children, teenagers and adults were submitted to a research design, consisting of 1) a pre-test, 2) the visit of the exhibition and 3) a post-test similar to the pre-test. In addition, the children answered a second post-test 3 months after the visit. Close ended questions addressed the awareness indicators mentioned in the literature, i.e. worry level, previous experiences with natural hazards events, exposure to awareness raising, ability to mitigate/respond/prepare, attitude to risk, and demographics. In addition, the post-test included several satisfaction questions concerning the visual tools displayed in the exhibition. A statistical analysis of the changes between the pre- and post- tests (paired t-test, Wilcoxon signed-rank test and bootstrapping) allowed to verify whether the exhibition had an impact on risk awareness or not. In order to deduce which variable

  2. Osteoblasts generate an osteogenic microenvironment when grown on surfaces with rough microtopographies

    Directory of Open Access Journals (Sweden)

    Boyan B. D.

    2003-10-01

    Full Text Available Osteoblasts respond to microarchitectural features of their substrate. On smooth surfaces (tissue culture plastic, tissue culture glass, and titanium, the cells attach and proliferate but they exhibit relatively low expression of differentiation markers in monolayer cultures, even when confluent. When grown on microrough Ti surfaces with an average roughness (Ra of 4-7 µm, proliferation is reduced but differentiation is enhanced and in some cases, is synergistic with the effects of surface microtopography. In addition, cells on microrough Ti substrates form hydroxyapatite in a manner that is more typical of bone than do cells cultured on smooth surfaces. Osteoblasts also respond to growth factors and cytokines in a surface-dependent manner. On rougher surfaces, the effects of regulatory factors like 1alpha,25(OH2D3 or 17beta-estradiol are enhanced. The response to the surface is mediated by integrins, which signal to the cell through many of the same mechanisms used by growth factors and hormones. Studies using PEG-modified surfaces indicate that increased differentiation may be related to altered attachment to the surface. When osteoblasts are grown on surfaces with chemistries or microarchitectures that reduce cell attachment and proliferation, and enhance differentiation, the cells tend to increase production of factors like TGF-beta1 that promote osteogenesis while decreasing osteoclastic activity. Thus, on microrough Ti surface, osteoblasts create a microenvironment conducive to new bone formation.

  3. Demultiplexing Surface Waves With Silicon Nanoantennas

    DEFF Research Database (Denmark)

    Sinev, I.; Bogdanov, A.; Komissarenko, F.

    2017-01-01

    We demonstrate directional launching of surface plasmon polaritons on thin gold film with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation within extremely narrow spectral hand (! 50 nm), which is driven...... by the mutual interference of magnetic and electric dipole moments supported by the dielectric nanoantenna....

  4. Microstructure and surface mechanical properties of pulse electrodeposited nickel

    Energy Technology Data Exchange (ETDEWEB)

    Ul-Hamid, A., E-mail: anwar@kfupm.edu.sa [Center of Research Excellence in Corrosion (CoRE-C), Research Institute, King Fahd University of Petroleum and Minerals, P.O. Box 1073, Dhahran 31261 (Saudi Arabia); Dafalla, H.; Quddus, A.; Saricimen, H.; Al-Hadhrami, L.M. [Center of Research Excellence in Corrosion (CoRE-C), Research Institute, King Fahd University of Petroleum and Minerals, P.O. Box 1073, Dhahran 31261 (Saudi Arabia)

    2011-09-01

    The surface of carbon steel was modified by electrochemical deposition of Ni in a standard Watt's bath using dc and pulse plating electrodeposition. The aim was to compare the microstructure and surface mechanical properties of the deposit obtained by both techniques. Materials characterization was conducted using field emission scanning electron microscope fitted with scanning transmission electron detector, atomic force microscope and X-ray diffractometer. Nanoindentation hardness, elastic modulus, adhesion, coefficients of friction and wear rates were determined for both dc and pulse electrodeposits. Experimental results indicate that pulse electrodeposition produced finer Ni grains compared to dc plating. Size of Ni grains increased with deposition. Both dc and pulse deposition resulted in grain growth in preferred (2 0 0) orientation. However, presence of Ni (1 1 1) grains increased in deposits produced by pulse deposition. Pulse plated Ni exhibited higher hardness, creep and coefficient of friction and lower modulus of elasticity compared to dc plated Ni.

  5. Effect of increased surface tension and assisted ventilation on /sup 99m/Tc-DTPA clearance

    International Nuclear Information System (INIS)

    Jefferies, A.L.; Kawano, T.; Mori, S.; Burger, R.

    1988-01-01

    Experiments were performed to determine the effects of conventional mechanical ventilation (CMV) and high-frequency oscillation (HFO) on the clearance of technetium-99m-labeled diethylenetriamine pentaacetate (/sup 99m/Tc-DTPA) from lungs with altered surface tension properties. A submicronic aerosol of /sup 99m/Tc-DTPA was insufflated into the lungs of anesthetized, tracheotomized rabbits before and 1 h after the administration of the aerosolized detergent dioctyl sodium sulfosuccinate (OT). Rabbits were ventilated by one of four methods: 1) spontaneous breathing; 2) CMV at 12 cmH2O mean airway pressure (MAP); 3) HFO at 12 cmH2O MAP; 4) HFO at 16 cmH2O MAP. Administration of OT resulted in decreased arterial PO2 (PaO2), increased lung wet-to-dry weight ratios, and abnormal lung pressure-volume relationships, compatible with increased surface tension. /sup 99m/Tc-DTPA clearance was accelerated after OT in all groups. The post-OT rate of clearance (k) was significantly faster (P less than 0.05) in the CMV at 12 cmH2O MAP [k = 7.57 +/- 0.71%/min (SE)] and HFO at 16 cmH2O MAP (k = 6.92 +/- 0.61%/min) groups than in the spontaneously breathing (k = 4.32 +/- 0.55%/min) and HFO at 12 cmH2O MAP (4.68 +/- 0.63%/min) groups. The clearance curves were biexponential in the former two groups. We conclude that pulmonary clearance of /sup 99m/Tc-DTPA is accelerated in high surface tension pulmonary edema, and this effect is enhanced by both conventional ventilation and HFO at high mean airway pressure

  6. Arctic Forecasts Available from Polar Bear Exhibit as an Example of Formal/Informal Collaboration

    Science.gov (United States)

    Landis, C. E.; Cervenec, J.

    2012-12-01

    A subset of the general population enjoys and frequents informal education venues, offering an opportunity for lifelong learning that also enhances and supports formal education efforts. The Byrd Polar Research Center (BPRC) at The Ohio State University collaborated with the Columbus Zoo & Aquarium (CZA) in the development of their Polar Frontier exhibit, from its initial planning to the Grand Opening of the exhibit, through the present. Of course, the addition to the Zoo of polar bears and Arctic fox in the Polar Frontier has been very popular, with almost a 7% increase in visitors in 2010 when the exhibit opened. The CZA and BPRC are now investigating ways to increase the climate literacy impact of the exhibit, and to increase engagement with the topics through follow-on activities. For example, individuals or classes anywhere in the world can check forecasts from the Polar Weather and Research Forecasting model and compare them to observed conditions-- allowing deep investigation into changes in the Arctic. In addition, opportunities exist to adapt the Zoo School experience (affecting several Central Ohio school districts) and/or to enable regular participation through social media such as Facebook, Twitter, and other forms of digital communication. BPRC's sustained engagement with the CZA is an example of a trusted and meaningful partnership where open dialogue exists about providing the best learning experience for visitors. This presentation will share some of the lessons learned from this unique partnership, and strategies that are adopted to move it forward.

  7. "Big Science" exhibition at Balexert

    CERN Multimedia

    2008-01-01

    CERN is going out to meet those members of the general public who were unable to attend the recent Open Day. The Laboratory will be taking its "Big Science" exhibition from the Globe of Science and Innovation to the Balexert shopping centre from 19 to 31 May 2008. The exhibition, which shows the LHC and its experiments through the eyes of a photographer, features around thirty spectacular photographs measuring 4.5 metres high and 2.5 metres wide. Welcomed and guided around the exhibition by CERN volunteers, shoppers at Balexert will also have the opportunity to discover LHC components on display and watch films. "Fun with Physics" workshops will be held at certain times of the day. Main hall of the Balexert shopping centre, ground floor, from 9.00 a.m. to 7.00 p.m. Monday to Friday and from 10 a.m. to 6 p.m. on the two Saturdays. Call for volunteers All members of the CERN personnel are invited to enrol as volunteers to help welcom...

  8. Effect of softening precipitate composition and surface characteristics on natural organic matter adsorption.

    Science.gov (United States)

    Russell, Caroline G; Lawler, Desmond F; Speitel, Gerald E; Katz, Lynn E

    2009-10-15

    Natural organic matter (NOM) removal during water softening is thought to occur through adsorption onto or coprecipitation with calcium and magnesium solids. However, details of precipitate composition and surface chemistry and subsequent interactions with NOM are relatively unknown. In this study, zeta potentiometry analyses of precipitates formed from inorganic solutions under varying conditions (e.g., Ca-only, Mg-only, Ca + Mg, increasing lime or NaOH dose) indicated that both CaCO3 and Mg(OH)2 were positively charged at higher lime (Ca(OH)2) and NaOH doses (associated with pH values above 11.5), potentially yielding a greater affinity for adsorbing negatively charged organic molecules. Environmental scanning electron microscopy (ESEM) images of CaCO3 solids illustrated the rhombohedral shape characteristic of calcite. In the presence of increasing concentrations of magnesium, the CaCO3 rhombs shifted to more elongated crystals. The CaCO3 solids also exhibited increasingly positive surface charge from Mg incorporation into the crystal lattice, potentially creating more favorable conditions for adsorption of organic matter. NOM adsorption experiments using humic substances extracted from Lake Austin and Missouri River water elucidated the role of surface charge and surface area on adsorption.

  9. Patients with sepsis exhibit increased mitochondrial respiratory capacity in peripheral blood immune cells

    DEFF Research Database (Denmark)

    Sjövall, Fredrik; Morota, Saori; Persson, Johan Mikael

    2013-01-01

    to 7). Mitochondrial DNA (mtDNA), cytochrome c (Cyt c), and citrate synthase (CS) were measured as indicators of cellular mitochondrial content. RESULTS: In intact PBICs with endogenous substrates, a gradual increase in cellular respiration reached 173% of controls after 1 week (P = 0......INTRODUCTION: In sepsis, mitochondria have been associated with both initial dysfunction and subsequent upregulation (biogenesis). However, the evolvement of mitochondrial function in sepsis over time is largely unknown, and we therefore investigated mitochondrial respiration in peripheral blood.......001). In permeabilized cells, respiration using substrates of complex I, II, and IV were significantly increased days 1 to 2, reaching 137%, 130%, and 173% of controls, respectively. In parallel, higher levels of CS activity, mtDNA, and Cyt c content in PBICs (211%, 243%, and 331% of controls for the respective...

  10. Surface morphology effects on the light-controlled wettability of ZnO nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Khranovskyy, V., E-mail: volkh@ifm.liu.se [Department of Physics, Chemistry and Biology (IFM), Linkoping University (Sweden); Ekblad, T.; Yakimova, R.; Hultman, L. [Department of Physics, Chemistry and Biology (IFM), Linkoping University (Sweden)

    2012-08-01

    ZnO nanostructures of diverse morphology with shapes of corrals and cabbages as well as open and filled hexagons and sheaves prepared by APMOCVD technique, are investigated with water contact angle (CA) analysis. The as-grown ZnO nanostructures exhibit pure hydrophobic behavior, which is enhanced with the increase of the nanostructure's surface area. The most hydrophobic structures (CA = 124 Degree-Sign ) were found to be the complex nanosheaf, containing both the macro-and nanoscale features. It is concluded that the nanoscale roughness contributes significantly to the hydrophobicity increase. The character of wettability was possible to switch from hydrophobic-to-superhydrophilic state upon ultra violet irradiation. Both the rate and amplitude of the contact angle depend on the characteristic size of nanostructure. The observed effect is explained due to the semiconductor properties of zinc oxide enhanced by increased surface chemistry effect in nanostructures.

  11. Reconstruction of freeform surfaces for metrology

    International Nuclear Information System (INIS)

    El-Hayek, N; Nouira, H; Anwer, N; Damak, M; Gibaru, O

    2014-01-01

    The application of freeform surfaces has increased since their complex shapes closely express a product's functional specifications and their machining is obtained with higher accuracy. In particular, optical surfaces exhibit enhanced performance especially when they take aspheric forms or more complex forms with multi-undulations. This study is mainly focused on the reconstruction of complex shapes such as freeform optical surfaces, and on the characterization of their form. The computer graphics community has proposed various algorithms for constructing a mesh based on the cloud of sample points. The mesh is a piecewise linear approximation of the surface and an interpolation of the point set. The mesh can further be processed for fitting parametric surfaces (Polyworks ® or Geomagic ® ). The metrology community investigates direct fitting approaches. If the surface mathematical model is given, fitting is a straight forward task. Nonetheless, if the surface model is unknown, fitting is only possible through the association of polynomial Spline parametric surfaces. In this paper, a comparative study carried out on methods proposed by the computer graphics community will be presented to elucidate the advantages of these approaches. We stress the importance of the pre-processing phase as well as the significance of initial conditions. We further emphasize the importance of the meshing phase by stating that a proper mesh has two major advantages. First, it organizes the initially unstructured point set and it provides an insight of orientation, neighbourhood and curvature, and infers information on both its geometry and topology. Second, it conveys a better segmentation of the space, leading to a correct patching and association of parametric surfaces

  12. Life, the universe, and everything: an education outreach proposal to build a traveling astrobiology exhibit.

    Science.gov (United States)

    Barge, Laura M; Pulschen, André A; Emygdio, Ana Paula Mendes; Congreve, Curtis; Kishimoto, Darío E; Bendia, Amanda G; de Morais M Teles, Antonio; DeMarines, Julia; Stoupin, Daniel

    2013-03-01

    Astrobiology is a transdisciplinary field with extraordinary potential for the scientific community. As such, it is important to educate the community at large about the growing importance of this field to increase awareness and scientific content learning and expose potential future scientists. To this end, we propose the creation of a traveling museum exhibit that focuses exclusively on astrobiology and utilizes modern museum exhibit technology and design. This exhibit (the "Astrobiology Road Show"), organized and evaluated by an international group of astrobiology students and postdocs, is planned to tour throughout the Americas.

  13. Laser Ablation Increases PEM/Catalyst Interfacial Area

    Science.gov (United States)

    Whitacre, Jay; Yalisove, Steve

    2009-01-01

    An investigational method of improving the performance of a fuel cell that contains a polymer-electrolyte membrane (PEM) is based on the concept of roughening the surface of the PEM, prior to deposition of a thin layer of catalyst, in order to increase the PEM/catalyst interfacial area and thereby increase the degree of utilization of the catalyst. The roughening is done by means of laser ablation under carefully controlled conditions. Next, the roughened membrane surface is coated with the thin layer of catalyst (which is typically platinum), then sandwiched between two electrode/catalyst structures to form a membrane/ele c t - rode assembly. The feasibility of the roughening technique was demonstrated in experiments in which proton-conducting membranes made of a perfluorosulfonic acid-based hydrophilic, protonconducting polymer were ablated by use of femtosecond laser pulses. It was found that when proper combinations of the pulse intensity, pulse-repetition rate, and number of repetitions was chosen, the initially flat, smooth membrane surfaces became roughened to such an extent as to be converted to networks of nodules interconnected by filaments (see Figure 1). In further experiments, electrochemical impedance spectroscopy (EIS) was performed on a pristine (smooth) membrane and on two laser-roughened membranes after the membranes were coated with platinum on both sides. Some preliminary EIS data were interpreted as showing that notwithstanding the potential for laser-induced damage, the bulk conductivities of the membranes were not diminished in the roughening process. Other preliminary EIS data (see Figure 2) were interpreted as signifying that the surface areas of the laser-roughened membranes were significantly greater than those of the smooth membrane. Moreover, elemental analyses showed that the sulfur-containing molecular groups necessary for proton conduction remained intact, even near the laser-roughened surfaces. These preliminary results can be taken

  14. The fetal/neonatal mouse liver exhibits transcriptional features of the adult pancreas.

    Science.gov (United States)

    Metabolic homeostasis of the organism is maintained by the liver’s ability to detoxify and eliminate xenobiotics through the expression of xenobiotic metabolism enxymes (XME). The fetus and neonate have been hypothesized to exhibit increased sensitivity to xenobiotic toxicity. T...

  15. The Road Transport world exhibition in Paris

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Following the agreement between French and German professionals of automobile and industrial vehicle, the Road Transport world exhibition will take place alternatively in Paris and Hanover. The 1995 meeting has taken place in Paris (September 15-21) and about 20 countries were represented. Road transport is the principal way of goods transportation in France and represent 88% of the traffic explained in tons gross and 70% in tons km. The petroleum dependence of the transportation sector is becoming a worrying problem as the gasoline and diesel fuels taxes will be discussed in the 1996 financial laws project. According to the last ''Worldwide energetic perspectives'' report published by the IEA, in 2010 the transportation sector could absorb more than 60% of the worldwide petroleum consumption. This increase represents a challenge to the petroleum industry to increase the energetic efficiency of the vehicle fuels and the production of diesel fuels, and conversely to reduce the pollution effluents. (J.S.). 4 tabs

  16. Nanoscale crystallinity modulates cell proliferation on plasma sprayed surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Alan M. [School of Applied Sciences, University of Huddersfield, Huddersfield HD1 3DH (United Kingdom); Paxton, Jennifer Z.; Hung, Yi-Pei; Hadley, Martin J.; Bowen, James; Williams, Richard L. [School of Chemical Engineering, University of Birmingham, Edgbaston, B15 2TT (United Kingdom); Grover, Liam M., E-mail: l.m.grover@bham.ac.uk [School of Chemical Engineering, University of Birmingham, Edgbaston, B15 2TT (United Kingdom)

    2015-03-01

    Calcium phosphate coatings have been applied to the surface of metallic prostheses to mediate hard and soft tissue attachment for more than 40 years. Most coatings are formed of high purity hydroxyapatite, and coating methods are often designed to produce highly crystalline surfaces. It is likely however, that coatings of lower crystallinity can facilitate more rapid tissue attachment since the surface will exhibit a higher specific surface area and will be considerably more reactive than a comparable highly crystalline surface. Here we test this hypothesis by growing a population of MC3T3 osteoblast-like cells on the surface of two types of hip prosthesis with similar composition, but with differing crystallinity. The surfaces with lower crystallinity facilitated more rapid cell attachment and increased proliferation rate, despite having a less heterogeneous surface topography. This work highlights that the influence of the crystallinity of HA at the nano-scale is dominant over macro-scale topography for cell adhesion and growth. Furthermore, crystallinity could be easily adjusted by without compromising coating purity. These findings could facilitate designing novel coated calcium phosphate surfaces that more rapidly bond tissue following implantation. - Highlights: • Crystallinity of HA at the nano-scale was dominant over macro-scale topography. • Lower crystallinity caused rapid cell attachment and proliferation rate. • Crystallinity could be easily adjusted by without compromising coating purity.

  17. Nanoscale crystallinity modulates cell proliferation on plasma sprayed surfaces

    International Nuclear Information System (INIS)

    Smith, Alan M.; Paxton, Jennifer Z.; Hung, Yi-Pei; Hadley, Martin J.; Bowen, James; Williams, Richard L.; Grover, Liam M.

    2015-01-01

    Calcium phosphate coatings have been applied to the surface of metallic prostheses to mediate hard and soft tissue attachment for more than 40 years. Most coatings are formed of high purity hydroxyapatite, and coating methods are often designed to produce highly crystalline surfaces. It is likely however, that coatings of lower crystallinity can facilitate more rapid tissue attachment since the surface will exhibit a higher specific surface area and will be considerably more reactive than a comparable highly crystalline surface. Here we test this hypothesis by growing a population of MC3T3 osteoblast-like cells on the surface of two types of hip prosthesis with similar composition, but with differing crystallinity. The surfaces with lower crystallinity facilitated more rapid cell attachment and increased proliferation rate, despite having a less heterogeneous surface topography. This work highlights that the influence of the crystallinity of HA at the nano-scale is dominant over macro-scale topography for cell adhesion and growth. Furthermore, crystallinity could be easily adjusted by without compromising coating purity. These findings could facilitate designing novel coated calcium phosphate surfaces that more rapidly bond tissue following implantation. - Highlights: • Crystallinity of HA at the nano-scale was dominant over macro-scale topography. • Lower crystallinity caused rapid cell attachment and proliferation rate. • Crystallinity could be easily adjusted by without compromising coating purity

  18. Surface modification by electrolytic plasma processing for high Nb-TiAl alloys

    Science.gov (United States)

    Gui, Wanyuan; Hao, Guojian; Liang, Yongfeng; Li, Feng; Liu, Xiao; Lin, Junpin

    2016-12-01

    Metal surface modification by electrolytic plasma processing (EPP) is an innovative treatment widely commonly applied to material processing and pretreatment process of coating and galvanization. EPP involves complex processes and a great deal of parameters, such as preset voltage, current, solution temperature and processing time. Several characterization methods are presented in this paper for evaluating the micro-structure surfaces of Ti45Al8Nb alloys: SEM, EDS, XRD and 3D topography. The results showed that the oxide scale and other contaminants on the surface of Ti45Al8Nb alloys can be effectively removed via EPP. The typical micro-crater structure of the surface of Ti45Al8Nb alloys were observed by 3D topography after EPP to find that the mean diameter of the surface structure and roughness value can be effectively controlled by altering the processing parameters. The mechanical properties of the surface according to nanomechanical probe testing exhibited slight decrease in microhardness and elastic modulus after EPP, but a dramatic increase in surface roughness, which is beneficial for further processing or coating.

  19. Surge-Resistant Nanocomposite Enameled Wire Using Silica Nanoparticles with Binary Chemical Compositions on the Surface

    Directory of Open Access Journals (Sweden)

    Jeseung Yoo

    2015-01-01

    Full Text Available We developed polyesterimide (PEI nanocomposite enameled wires using surface-modified silica nanoparticles with binary chemical compositions on the surface. The modification was done using silanes assisted by ultrasound, which facilitated high density modification. Two different trimethoxysilanes were chosen for the modification on the basis of resemblance of chemical compositions on the silica surface to PEI varnish. The surface-modified silica was well dispersed in PEI varnish, which was confirmed by optical observation and viscosity measurement. The glass transition temperature of the silica-PEI nanocomposite increased with the silica content. The silica-dispersed PEI varnish was then used for enameled wire fabrication. The silica-PEI nanocomposite enameled wire exhibited a much longer lifetime compared to that of neat PEI enameled wire in partial discharge conditions.

  20. Surface modification effects of fluorine-doped tin dioxide by oxygen plasma ion implantation

    Science.gov (United States)

    Tang, Peng; Liu, Cai; Zhang, Jingquan; Wu, Lili; Li, Wei; Feng, Lianghuan; Zeng, Guanggen; Wang, Wenwu

    2018-04-01

    SnO2:F (FTO), as a kind of transparent conductive oxide (TCO), exhibits excellent transmittance and conductivity and is widely used as transparency electrodes in solar cells. It's very important to modifying the surface of FTO for it plays a critical role in CdTe solar cells. In this study, modifying effects of oxygen plasma on FTO was investigated systematically. Oxygen plasma treatment on FTO surface with ion accelerating voltage ranged from 0.4 kV to 1.6 kV has been processed. The O proportion of surface was increased after ion implantation. The Fermi level of surface measurement by XPS valance band spectra was lowered as the ion accelerating voltage increased to 1.2 kV and then raised as accelerating voltage was elevated to 1.6 kV. The work function measured by Kelvin probe force microscopy increased after ion implanting, and it was consistent with the variation of Fermi level. The change of energy band structure of FTO surface mainly originated from the surface composition variation. As FTO conduction was primarily due to oxyanion hole, the carrier was electron and its concentration was reduced while O proportion was elevated at the surface of FTO, as a result, the Fermi level lowered and the work function was enlarged. It was proved that oxygen plasma treatment is an effective method to modulate the energy band structure of the surface as well as other properties of FTO, which provides much more space for interface and surface modification and then photoelectric device performance promotion.

  1. Surface Adsorption in Nonpolarizable Atomic Models.

    Science.gov (United States)

    Whitmer, Jonathan K; Joshi, Abhijeet A; Carlton, Rebecca J; Abbott, Nicholas L; de Pablo, Juan J

    2014-12-09

    Many ionic solutions exhibit species-dependent properties, including surface tension and the salting-out of proteins. These effects may be loosely quantified in terms of the Hofmeister series, first identified in the context of protein solubility. Here, our interest is to develop atomistic models capable of capturing Hofmeister effects rigorously. Importantly, we aim to capture this dependence in computationally cheap "hard" ionic models, which do not exhibit dynamic polarization. To do this, we have performed an investigation detailing the effects of the water model on these properties. Though incredibly important, the role of water models in simulation of ionic solutions and biological systems is essentially unexplored. We quantify this via the ion-dependent surface attraction of the halide series (Cl, Br, I) and, in so doing, determine the relative importance of various hypothesized contributions to ionic surface free energies. Importantly, we demonstrate surface adsorption can result in hard ionic models combined with a thermodynamically accurate representation of the water molecule (TIP4Q). The effect observed in simulations of iodide is commensurate with previous calculations of the surface potential of mean force in rigid molecular dynamics and polarizable density-functional models. Our calculations are direct simulation evidence of the subtle but sensitive role of water thermodynamics in atomistic simulations.

  2. Extremely superhydrophobic surfaces with micro- and nanostructures fabricated by copper catalytic etching.

    Science.gov (United States)

    Lee, Jung-Pil; Choi, Sinho; Park, Soojin

    2011-01-18

    We demonstrate a simple method for the fabrication of rough silicon surfaces with micro- and nanostructures, which exhibited superhydrophobic behaviors. Hierarchically rough silicon surfaces were prepared by copper (Cu)-assisted chemical etching process where Cu nanoparticles having particle size of 10-30 nm were deposited on silicon surface, depending on the period of time of electroless Cu plating. Surface roughness was controlled by both the size of Cu nanoparticles and etching conditions. As-synthesized rough silicon surfaces showed water contact angles ranging from 93° to 149°. Moreover, the hierarchically rough silicon surfaces were chemically modified by spin-coating of a thin layer of Teflon precursor with low surface energy. And thus it exhibited nonsticky and enhanced hydrophobic properties with extremely high contact angle of nearly 180°.

  3. Mobile Technologies in Museum Exhibitions

    Directory of Open Access Journals (Sweden)

    Sandra Medić

    2014-10-01

    Full Text Available In order to be up–to–date and give visitors a memorable and unique experience, museums are including usage of digital technologies in their exhibitions. Even though museums in Serbia are very important part of tourism offer, they still have traditional settings that are poorly interpreted. The majority of them have a scientific and historical review which is unattractive for various target groups of visitors and for museums it’s important to continually try out new ways in interpretation of their settings. Because technology continues to rapidly change the way we communicate, cultural institutions should adapt to new ways of communication with their visitors. This paper examines mobile technologies that can be used in museums to give visitors a different experience and transfer the knowledge innovatively. In that way it will be presented the modern concept of presentation of museum exhibitions, focusing on usage of mobile devices through mobile applications and QR codes. The paper provides the broad understanding of usage mobile technologies in museum exhibitions with its advantages and limitations. The research results can help the museums management to improve interpretation and communication with visitors and enrich the visitor experience.

  4. Deuterium retention and surface modification of tungsten macrobrush samples exposed in FTU Tokamak

    Science.gov (United States)

    Maddaluno, G.; Giacomi, G.; Rufoloni, A.; Verdini, L.

    2007-06-01

    The effect of discrete structures such as macrobrush or castellated surfaces on power handling and deuterium retention of plasma facing components is to be assessed since such geometrical configurations are needed for increasing the lifetime of the armour to heat-sink joint. Four small macrobrush W and W + 1%La2O3 samples have been exposed in the Frascati Tokamak Upgrade (FTU) scrape-off layer up to the last closed flux surface by means of the Sample Introduction System. FTU is an all metal machine with no carbon source inside vacuum vessel; it exhibits ITER relevant energy and particle fluxes on the plasma facing components. Here, results on morphological surface changes (SEM), chemical composition (EDX) and deuterium retention (TDS) are reported.

  5. Effect of artificial aging on the surface roughness and microhardness of resin-based materials.

    Science.gov (United States)

    Santos, M Jacinta M C; Rêgo, Heleine Maria Chagas; Mukhopadhyay, Anuradha; El Najjar, Mai; Santos, Gildo C

    2016-01-01

    This study sought to verify the effects of aging on the surface roughness (Ra) and microhardness (Knoop hardness number [KHN]) of resin-based restorative materials protected with a surface sealer. Disc specimens of 2 resin-modified glass ionomers (RMGIs) and 1 composite resin (CR) were fabricated in a metal mold. Specimens of each material were divided into 1 group that was covered with surface sealer and 1 group that was not. Both groups of each material were then subdivided according to whether they were stored (aged) in cola or distilled water. Surface roughness and KHN values were obtained from each specimen before and after storage. After aging of the specimens, significantly higher Ra values were observed in the 2 RMGIs when they were not covered with a surface sealer, while the CR was not affected. The KHN values varied by materials and storage conditions (with and without a surface sealer). All the groups with a surface sealer exhibited increased Ra values after aging.

  6. Creating Learning Experiences that Promote Informal Science Education: Designing Conservation-Focused Interactive Zoo Exhibits through Action Research

    Science.gov (United States)

    Kalenda, Peter

    Research on exhibit design over the past twenty years has started to identify many different methods to increase the learning that occurs in informal education environments. This study utilized relevant research on exhibit design to create and study the effectiveness of a mobile interactive exhibit at the Seneca Park Zoo that promotes socialization, engagement in science, and conservation-related practices among guests. This study will serve as one component of a major redesign project at the Seneca Park Zoo for their Rocky Coasts exhibit. This action research study targeted the following question, "How can interactive exhibits be designed to promote socialization, engagement in science, and real-world conservation-related practices (RCPs) among zoo guests?" Specific research questions included: 1. In what ways did guests engage with the exhibit? 2. In what ways were guests impacted by the exhibit? a) What evidence exists, if any, of guests learning science content from the exhibit? b) What evidence exists, if any, of guests being emotionally affected by the exhibit? c) What evidence exists, if any, of guests changing their RCPs after visiting the exhibit? Data were collected through zoo guest surveys completed by zoo guests comparing multiple exhibits, interviews with guests before and after they used the prototype exhibit, observations and audio recordings of guests using the prototype exhibit, and follow-up phone interviews with guests who volunteered to participate. Data were analyzed collaboratively with members of the zoo's exhibit Redesign Team using grounded theory qualitative data analysis techniques to find patterns and trends among data. Initial findings from data analysis were used to develop shifts in the exhibit in order to increase visitor engagement and learning. This process continued for two full action research spirals, which resulted in three iterations of the prototype exhibit. The overall findings of this study highlight the ways in which

  7. Multifactor analysis and simulation of the surface runoff and soil infiltration at different slope gradients

    Science.gov (United States)

    Huang, J.; Kang, Q.; Yang, J. X.; Jin, P. W.

    2017-08-01

    The surface runoff and soil infiltration exert significant influence on soil erosion. The effects of slope gradient/length (SG/SL), individual rainfall amount/intensity (IRA/IRI), vegetation cover (VC) and antecedent soil moisture (ASM) on the runoff depth (RD) and soil infiltration (INF) were evaluated in a series of natural rainfall experiments in the South of China. RD is found to correlate positively with IRA, IRI, and ASM factors and negatively with SG and VC. RD decreased followed by its increase with SG and ASM, it increased with a further decrease with SL, exhibited a linear growth with IRA and IRI, and exponential drop with VC. Meanwhile, INF exhibits a positive correlation with SL, IRA and IRI and VC, and a negative one with SG and ASM. INF was going up and then down with SG, linearly rising with SL, IRA and IRI, increasing by a logit function with VC, and linearly falling with ASM. The VC level above 60% can effectively lower the surface runoff and significantly enhance soil infiltration. Two RD and INF prediction models, accounting for the above six factors, were constructed using the multiple nonlinear regression method. The verification of those models disclosed a high Nash-Sutcliffe coefficient and low root-mean-square error, demonstrating good predictability of both models.

  8. Surface tension and density of liquid In-Sn-Zn alloys

    Science.gov (United States)

    Pstruś, Janusz

    2013-01-01

    Using the dilatometric method, measurements of the density of liquid alloys of the ternary system In-Sn-Zn in four sections with a constant ratio Sn:In = 24:1, 3:1, 1:1, 1:3, for various Zn additions (5, 10, 14, 20, 3 5, 50 and 75 at.% Zn) were performed at the temperature ranges of 500-1150 K. Density decreases linearly for all compositions. The molar volume calculated from density data exhibits close to ideal dependence on composition. Measurements of the surface tension of liquid alloys have been conducted using the method of maximum pressure in the gas bubbles. There were observed linear dependences on temperature with a negative gradients dσ/dT. Generally, with two exceptions, there was observed the increase of surface tension with increasing content of zinc. Using the Butler's model, the surface tension isotherms were calculated for temperatures T = 673 and 1073 K. Calculations show that only for high temperatures and for low content of zinc (up to about 35 at.%), the modeling is in very good agreement with experiment. Using the mentioned model, the composition of the surface phase was defined at two temperatures T = 673 and 973 K. Regardless of the temperature and of the defined section, the composition of the bulk is very different in comparison with the composition of the surface.

  9. Angle-dependent lubricated tribological properties of stainless steel by femtosecond laser surface texturing

    Science.gov (United States)

    Wang, Zhuo; Li, Yang-Bo; Bai, Feng; Wang, Cheng-Wei; Zhao, Quan-Zhong

    2016-07-01

    Lubricated tribological properties of stainless steel were investigated by femtosecond laser surface texturing. Regular-arranged micro-grooved textures with different spacing and micro-groove inclination angles (between micro-groove path and sliding direction) were produced on AISI 304L steel surfaces by an 800 nm femtosecond laser. The spacing of micro-groove was varied from 25 to 300 μm, and the inclination angles of micro-groove were measured as 90° and 45°. The tribological properties of the smooth and textured surfaces with micro-grooves were investigated by reciprocating ball-on-flat tests against Al2O3 ceramic balls under starved oil lubricated conditions. Results showed that the spacing of micro-grooves significantly affected the tribological property. With the increase of micro-groove spacing, the average friction coefficients and wear rates of textured surfaces initially decreased then increased. The tribological performance also depended on the inclination angles of micro-grooves. Among the investigated patterns, the micro-grooves perpendicular to the sliding direction exhibited the lowest average friction coefficient and wear rate to a certain extent. Femtosecond laser-induced surface texturing may remarkably improve friction and wear properties if the micro-grooves were properly distributed.

  10. Reflection properties of hydrogen ions at helium irradiated tungsten surfaces

    International Nuclear Information System (INIS)

    Doi, K; Tawada, Y; Kato, S; Sasao, M; Kenmotsu, T; Wada, M; Lee, H T; Ueda, Y; Tanaka, N; Kisaki, M; Nishiura, M; Matsumoto, Y; Yamaoka, H

    2016-01-01

    Nanostructured W surfaces prepared by He bombardment exhibit characteristic angular distributions of hydrogen ion reflection upon injection of 1 keV H + beam. A magnetic momentum analyzer that can move in the vacuum chamber has measured the angular dependence of the intensity and the energy of reflected ions. Broader angular distributions were observed for He-irradiated tungsten samples compared with that of the intrinsic polycrystalline W. Both intensity and energy of reflected ions decreased in the following order: the polycrystalline W, the He-bubble containing W, and the fuzz W. Classical trajectory Monte Carlo simulations based on Atomic Collision in Amorphous Target code suggests that lower atom density near the surface can make the reflection coefficients lower due to increasing number of collisions. (paper)

  11. High Quality Virtual Reality for Architectural Exhibitions

    DEFF Research Database (Denmark)

    Kreutzberg, Anette

    2016-01-01

    This paper will summarise the findings from creating and implementing a visually high quality Virtual Reality (VR) experiment as part of an international architecture exhibition. It was the aim to represent the architectural spatial qualities as well as the atmosphere created from combining natural...... and artificial lighting in a prominent not yet built project. The outcome is twofold: Findings concerning the integration of VR in an exhibition space and findings concerning the experience of the virtual space itself. In the exhibition, an important aspect was the unmanned exhibition space, requiring the VR...... experience to be self-explanatory. Observations of different visitor reactions to the unmanned VR experience compared with visitor reactions at guided tours with personal instructions are evaluated. Data on perception of realism, spatial quality and light in the VR model were collected with qualitative...

  12. A Salamander Tale: Effective Exhibits and Attitude Change

    Science.gov (United States)

    Rollins, Jeffrey; Watson, Sunnie Lee

    2017-01-01

    Little information exists regarding intention behind the design and development of Extension outreach and educational exhibits. An evaluation of response to the exhibit "A Salamander Tale" indicates that the methods used to develop the exhibit resulted in an effective way to present information to an adult audience. Survey questions were…

  13. Knowledge Generation in Technology-Enhanced Health Exhibitions

    DEFF Research Database (Denmark)

    Magnussen, Rikke; Kharlamov, Nikita; Zachariasssen, Maria

    2016-01-01

    This paper presents results from eye-tracking studies of audience interaction and knowledge generation in the technology-enhanced health promotion exhibition PULSE at a science centre in Copenhagen, Denmark. The main purpose of the study was to understand what types of knowledge audiences build...... in health promotion exhibitions designed to include direct physical interaction. The current study is part of the larger PULSE project, which aims to develop innovative health promotion activities that include a science museum exhibition as a key setting. The primary target group is families with children...

  14. Durable anti-fogging effect and adhesion improvement on polymer surfaces

    Science.gov (United States)

    Moser, E. M.; Gilliéron, D.; Henrion, G.

    2010-01-01

    The hydrophobic properties of polymeric surfaces may cause fogging in transparent packaging and poor adhesion to printing colours and coatings. Novel plasma processes for durable functionalization of polypropylene and polyethylene terephthalate substrates were developed and analysed using optical emission spectroscopy. A worm-like nano pattern was created on the polypropylene surface prior to the deposition of thin polar plasma polymerised layers. For both substrates, highly polar surfaces exhibiting a surface tension of up to 69 mN/m and a water contact angle of about 10° were produced - providing the anti-fogging effect. The deposition of thin plasma polymerised layers protects the increased surface areas and enables to tailoring the surface energy of the substrate in a wide range. Wetting characteristics were determined by dynamic contact angle measurements. Investigations of the chemical composition of several layers using X-ray photoelectron spectroscopy and FT-infrared spectroscopy were correlated with functional testing. The surface topography was investigated using atomic force microscopy. The weldability and peeling-off characteristics of the plasma treated polymer films could be adjusted by varying the process parameters. Global and specific migration analyses were undertaken in order to ensure the manufacturing of plasma treated polymer surfaces for direct food contact purposes.

  15. Surface-plasmon resonance-enhanced multiphoton emission of high-brightness electron beams from a nanostructured copper cathode.

    Science.gov (United States)

    Li, R K; To, H; Andonian, G; Feng, J; Polyakov, A; Scoby, C M; Thompson, K; Wan, W; Padmore, H A; Musumeci, P

    2013-02-15

    We experimentally investigate surface-plasmon assisted photoemission to enhance the efficiency of metallic photocathodes for high-brightness electron sources. A nanohole array-based copper surface was designed to exhibit a plasmonic response at 800 nm, fabricated using the focused ion beam milling technique, optically characterized and tested as a photocathode in a high power radio frequency photoinjector. Because of the larger absorption and localization of the optical field intensity, the charge yield observed under ultrashort laser pulse illumination is increased by more than 100 times compared to a flat surface. We also present the first beam characterization results (intrinsic emittance and bunch length) from a nanostructured photocathode.

  16. Increasing the doping efficiency by surface energy control for ultra-transparent graphene conductors.

    Science.gov (United States)

    Chang, Kai-Wen; Hsieh, Ya-Ping; Ting, Chu-Chi; Su, Yen-Hsun; Hofmann, Mario

    2017-08-22

    Graphene's attractiveness in many applications is limited by its high resistance. Extrinsic doping has shown promise to overcome this challenge but graphene's performance remains below industry requirements. This issue is caused by a limited charge transfer efficiency (CTE) between dopant and graphene. Using AuCl 3 as a model system, we measure CTE as low as 5% of the expected values due to the geometrical capacitance of small adsorbate clusters. We here demonstrate a strategy for enhancing the CTE by a two-step optimization of graphene's surface energy prior to AuCl 3 doping. First, exposure to UV ozone modified the hydrophilicity of graphene and was found to decrease the cluster's geometric capacitance, which had a direct effect on the CTE. Occurrence of lattice defects at high UV exposure, however, deteriorated graphene's transport characteristics and limited the effectiveness of this pretreatment step. Thus, prior to UV exposure, a functionalized polymer layer was introduced that could further enhance graphene's surface energy while protecting it from damage. Combination of these treatment steps were found to increase the AuCl 3 charge transfer efficiency to 70% and lower the sheet resistance to 106 Ω/γ at 97% transmittance which represents the highest reported performance for doped single layer graphene and is on par with commercially available transparent conductors.

  17. Increased wind risk from sting-jet windstorms with climate change

    Science.gov (United States)

    Martínez-Alvarado, Oscar; Gray, Suzanne L.; Hart, Neil C. G.; Clark, Peter A.; Hodges, Kevin; Roberts, Malcolm J.

    2018-04-01

    Extra-tropical cyclones dominate autumn and winter weather over western Europe. The strongest cyclones, often termed windstorms, have a large socio-economic impact on landfall due to strong surface winds and coastal storm surges. Climate model integrations have predicted a future increase in the frequency of, and potential damage from, European windstorms and yet these integrations cannot properly represent localised jets, such as sting jets, that may significantly enhance damage. Here we present the first prediction of how the climatology of sting-jet-containing cyclones will change in a future warmer climate, considering the North Atlantic and Europe. A proven sting-jet precursor diagnostic is applied to 13 year present-day and future (~2100) climate integrations from the Met Office Unified Model in its Global Atmosphere 3.0 configuration. The present-day climate results are consistent with previously-published results from a reanalysis dataset (with around 32% of cyclones exhibiting the sing-jet precursor), lending credibility to the analysis of the future-climate integration. The proportion of cyclones exhibiting the sting-jet precursor in the future-climate integration increases to 45%. Furthermore, while the proportion of explosively-deepening storms increases only slightly in the future climate, the proportion of those storms with the sting-jet precursor increases by 60%. The European resolved-wind risk associated with explosively-deepening storms containing a sting-jet precursor increases substantially in the future climate; in reality this wind risk is likely to be further enhanced by the release of localised moist instability, unresolved by typical climate models.

  18. Antimicrobial and Antifouling Polymeric Agents for Surface Functionalization of Medical Implants.

    Science.gov (United States)

    Zeng, Qiang; Zhu, Yiwen; Yu, Bingran; Sun, Yujie; Ding, Xiaokang; Xu, Chen; Wu, Yu-Wei; Tang, Zhihui; Xu, Fu-Jian

    2018-05-09

    Combating implant-associated infections is an urgent demand due to the increasing numbers in surgical operations such as joint replacements and dental implantations. Surface functionalization of implantable medical devices with polymeric antimicrobial and antifouling agents is an efficient strategy to prevent bacterial fouling and associated infections. In this work, antimicrobial and antifouling branched polymeric agents (GPEG and GEG) were synthesized via ring-opening reaction involving gentamicin and ethylene glycol species. Due to their rich primary amine groups, they can be readily coated on the polydopamine-modified implant (such as titanium) surfaces. The resultant surface coatings of Ti-GPEG and Ti-GEG produce excellent in vitro antibacterial efficacy toward both Staphylococcus aureus and Escherichia coli, while Ti-GPEG exhibit better antifouling ability. Moreover, the infection model with S. aureus shows that implanted Ti-GPEG possessed excellent antibacterial and antifouling ability in vivo. This study would provide a promising strategy for the surface functionalization of implantable medical devices to prevent implant-associated infections.

  19. [Corrosion resistant properties of different anodized microtopographies on titanium surfaces].

    Science.gov (United States)

    Fangjun, Huo; Li, Xie; Xingye, Tong; Yueting, Wang; Weihua, Guo; Weidong, Tian

    2015-12-01

    To investigate the corrosion resistant properties of titanium samples prepared by anodic oxidation with different surface morphologies. Pure titanium substrates were treated by anodic oxidation to obtain porous titanium films in micron, submicron, and micron-submicron scales. The surface morphologies, coating cross-sectional morphologies, crystalline structures, and surface roughness of these samples were characterized. Electrochemical technique was used to measure the corrosion potential (Ecorr), current density of corrosion (Icorr), and polarization resistance (Rp) of these samples in a simulated body fluid. Pure titanium could be modified to exhibit different surface morphologies by the anodic oxidation technique. The Tafel curve results showed that the technique can improve the corrosion resistance of pure titanium. Furthermore, the corrosion resistance varied with different surface morphologies. The submicron porous surface sample demonstrated the best corrosion resistance, with maximal Ecorr and Rp and minimal Icorr. Anodic oxidation technology can improve the corrosion resistance of pure titanium in a simulated body fluid. The submicron porous surface sample exhibited the best corrosion resistance because of its small surface area and thick barrier layer.

  20. Surface protein composition of Aeromonas hydrophila strains virulent for fish: identification of a surface array protein

    International Nuclear Information System (INIS)

    Dooley, J.S.G.; Trust, T.J.

    1988-01-01

    The surface protein composition of members of a serogroup of Aeromonas hydrophila was examined. Immunoblotting with antiserum raised against formalinized whole cells of A. hydrophila TF7 showed a 52K S-layer protein to be the major surface protein antigen, and impermeant Sulfo-NHS-Biotin cell surface labeling showed that the 52K S-layer protein was the only protein accessible to the Sulfo-NHS-Biotin label and effectively masked underlying outer membrane (OM) proteins. In its native surface conformation the 52K S-layer protein was only weakly reactive with a lactoperoxidase 125 I surface iodination procedure. A UV-induced rough lipopolysaccharide (LPS) mutant of TF7 was found to produce an intact S layer, but a deep rough LPS mutant was unable to maintain an array on the cell surface and excreted the S-layer protein into the growth medium, indicating that a minimum LPS oligosaccharide size required for A. hydrophila S-layer anchoring. The native S layer was permeable to 125 I in the lactoperoxidase radiolabeling procedure, and two major OM proteins of molecular weights 30,000 and 48,000 were iodinated. The 48K species was a peptidoglycan-associated, transmembrane protein which exhibited heat-modifiable SDS solubilization behavior characteristic of a porin protein. A 50K major peptidoglycan-associated OM protein which was not radiolabeled exhibited similar SDS heat modification characteristics and possibly represents a second porin protein

  1. Removal of arsenate by ferrihydrite via surface complexation and surface precipitation

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Xiuli [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China); Peng, Changjun; Fu, Dun; Chen, Zheng [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Shen, Liang [Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China); Li, Qingbiao [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China); Ouyang, Tong, E-mail: yz3t@xmu.edu.cn [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Wang, Yuanpeng, E-mail: wypp@xmu.edu.cn [Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China)

    2015-10-30

    Graphical abstract: - Highlights: • Surface complexation and surface precipitation of As on ferrihydrite happen at pH 3–6. • The formation of surface precipitation enhanced As(V) adsorption. • The dissolved Fe{sup 3+} had a good linear relationship with the amount of arsenate re-adsorption. - Abstract: In this study, macroscopic and spectroscopic experimental methods accurately modeled the sorption process of arsenate on ferrihydrite. EXAFS, X-ray diffraction and infrared (IR) spectroscopy indicated that the behavior of As(V) adsorption onto ferrihydrite took place mainly via surface complexation and surface precipitation at acidic pH (3.0–6.0), while the surface precipitation was dominated at longer time intervals and higher Fe{sup 3+} concentration. The macroscopic competitive adsorption experiment between arsenate with phosphate indicated two types of adsorption sites existing on the surface of ferrihydrite, i.e., non-exchangeable sites, which are responsible for a rapid surface complex formation; and exchangeable sites for a slow build-up of surface precipitates. In the slow build-up precipitates, the As(V) surface coverage (mmol/g) exhibited a good linear relationship (R{sup 2} = 0.952) with the amount of dissolved Fe{sup 3+}. Three steps are involved during the process of surface precipitation, i.e., (1) an initial uptake of As(V) via surface complexation; (2) re-adsorption of Fe{sup 3+} leaching from ferrihydrite on the surface complex; and (3) As(V) adsorption via surface complexation again and finally forming the surface precipitate.

  2. Surface treatments of metal supports for photocatalysis applications

    Energy Technology Data Exchange (ETDEWEB)

    Montecchio, Francesco, E-mail: fmon@kth.se [KTH, Royal Institute of Technology, Dept. of Chemical Engineering and Technology, 100 44 Stockholm (Sweden); Chinungi, Don [KTH, Royal Institute of Technology, Dept. of Chemical Engineering and Technology, 100 44 Stockholm (Sweden); Lanza, Roberto [Verdant Chemical Technologies AB, 114 28 Stockholm (Sweden); Engvall, Klas [KTH, Royal Institute of Technology, Dept. of Chemical Engineering and Technology, 100 44 Stockholm (Sweden)

    2017-04-15

    Highlights: • Treated metals can be used as photocatalyst support in full-scale applications. • Various electrochemical treatments were performed, checking the surface corrugation. • Stainless steel etched in DC and aqua regia shows the highest surface modification. • P25 coated on the DC etched sample has a high stability, with constant activity. • The support modification increases the UV irradiated area and the activity of P25. - Abstract: One of the most important challenges, for scaling up a photocatalytic system for VOCs abatement to full-scale, is the design of a suitable photocatalyst support. The support has to firmly immobilize the photocatalyst, without using an organic adhesive, and should also withstand relatively high mechanical stresses. Metals may be effectively implemented as a support material, after a corrugation of the surface with electrochemical treatments. In the present work, we treated stainless steel and aluminum supports, evaluating the surface modifications due to the electrochemical treatments, with scanning electron microscopy (SEM) and confocal microscopy. Five samples showing the highest degree of restructuring were selected and spray coated with P25, a TiO{sub 2} photocatalyst, evaluating the mechanical stability of the coating with a standard tape test method. One particular stainless steel sample presented a superior surface restructuring and coating stability. The photocatalytic activity of this sample, evaluated measuring the complete oxidation of acetaldehyde, was tested for 15 h, and compared with sample of TiO{sub 2}-P25 on a ceramic support. The stainless steel exhibited a constant performance after an initial stabilization period. The stainless steel sample showed a slightly higher activity, due to the surface restructuring, increasing the irradiated area available for the coated photocatalyst.

  3. Surface half-metallicity of half-Heusler compound FeCrSe and interface half-metallicity of FeCrSe/GaP

    Energy Technology Data Exchange (ETDEWEB)

    Khalaf Al-zyadi, Jabbar M., E-mail: jabbar_alzyadi@yahoo.com [Department of Physics, College of Education for Pure Sciences, University of Basrah (Iraq); Jolan, Mudhahir H. [Department of Physics, College of Education for Pure Sciences, University of Basrah (Iraq); Yao, Kai-Lun, E-mail: klyao@mail.hust.edu.cn [School of Physics and Wuhan National High Magnetic Field Center, Huazhong University of Science and Technology, Wuhan 430074 (China); International Center of Materials Physics, Chinese Academy of Sciences, Shenyang 110015 (China)

    2016-04-01

    Recent studies showed that half-Heusler FeCrSe exhibits half-metallic ferromagnetism (Huang et al. [20]). In this paper, we investigate extensively the electronic, magnetic, and half-metallic properties of the half-Heusler alloy FeCrSe (111) and (001) surfaces and the interface with GaP (111) substrate by using the first-principles calculations within the density functional theory. The atomic density of states demonstrates that the half-me tallicity verified in the bulk FeCrSe is maintained at the CrSe-terminated (001) and Se-terminated (111) surfaces, but lost at both Cr- and Fe-terminated (111) surfaces and the Fe-terminated (001) surface. Alternatively, for the interface of FeCrSe/GaP (111), the bulk half-metallicity is destroyed at Se–P configuration while Se–Ga interface and subinterface show nearly 100% spin polarization. Moreover, the calculated interfacial adhesion energies exhibit that Se–Ga shape is more stable than the Se–P one. The calculated magnetic moments of Se, Ga at the Se–Ga (111) interface and P at the Se–P (111) interface increase with respect to the corresponding bulk values while the atomic magnetic moment of Se atom at the Se–P (111) interface decreases. We also notice that the magnetic moments of subinterface Fe at both Se–Ga and Se–P (111) interfaces decrease compared to the bulk values. - Highlights: • The half-metallicity verified in the bulk FeCrSe is kept at the CrSe-terminated (001) and Se-terminated (111) surfaces. • The calculated interfacial adhesion energies exhibit that Se–Ga shape is more stable than Se–P. • The magnetic moments of Se, Ga and P atoms at the interface increase. • The Se–Ga interface shows nearly 100% spin polarization.

  4. Fabrication of Superhydrophobic Surfaces with Controllable Electrical Conductivity and Water Adhesion.

    Science.gov (United States)

    Ye, Lijun; Guan, Jipeng; Li, Zhixiang; Zhao, Jingxin; Ye, Cuicui; You, Jichun; Li, Yongjin

    2017-02-14

    A facile and versatile strategy for fabricating superhydrophobic surfaces with controllable electrical conductivity and water adhesion is reported. "Vine-on-fence"-structured and cerebral cortex-like superhydrophobic surfaces are constructed by filtering a suspension of multiwalled carbon nanotubes (MWCNTs), using polyoxymethylene nonwovens as the filter paper. The nonwovens with micro- and nanoporous two-tier structures act as the skeleton, introducing a microscale structure. The MWCNTs act as nanoscale structures, creating hierarchical surface roughness. The surface topography and the electrical conductivity of the superhydrophobic surfaces are controlled by varying the MWCNT loading. The vine-on-fence-structured surfaces exhibit "sticky" superhydrophobicity with high water adhesion. The cerebral cortex-like surfaces exhibit self-cleaning properties with low water adhesion. The as-prepared superhydrophobic surfaces are chemically resistant to acidic and alkaline environments of pH 2-12. They therefore have potential in applications such as droplet-based microreactors and thin-film microextraction. These findings aid our understanding of the role that surface topography plays in the design and fabrication of superhydrophobic surfaces with different water-adhesion properties.

  5. Surface characterization and corrosion behavior of micro-arc oxidized Ti surface modified with hydrothermal treatment and chitosan coating

    International Nuclear Information System (INIS)

    Neupane, Madhav Prasad; Park, Il Song; Lee, Min Ho

    2014-01-01

    In the present work, we describe the surface modification of commercially pure titanium (CP-Ti) by a composite/multilayer coating approach for biomedical applications. CP-Ti samples were treated by micro-arc oxidation (MAO) and subsequently some of the samples were coated with chitosan (Chi) by dip coating method, while others were subjected to hydrothermal treatment (HT) followed by chitosan coating. The MAO, MAO/Chi, and MAO/HT/Chi coated Ti were characterized and their characteristics were compared with CP-Ti. X-ray diffraction and scanning electron microscopy were used to assess the structural and morphological characteristics. The average surface roughness was determined using a surface profilometer. The corrosion resistance of untreated and surface modified Ti in commercial saline at 298 K was evaluated by potentiodynamic polarization test. The results indicated that the chitosan coating is very well integrated with the MAO and MAO/HT coating by physically interlocking itself with the coated layer and almost sealed all the pores. The surface roughness of hydrothermally treated and chitosan coated MAO film was superior evidently to that with other sample groups. The corrosion studies demonstrated that the MAO, hydrothermally treated and chitosan coated sample enhanced the corrosion resistance of titanium. The result indicates that fabrication of hydrothermally treated MAO surface coatings with chitosan is a significant approach to protect the titanium from corrosion, hence enhancing the potential use of titanium as bio-implants. - Highlights: • Micro-arc oxidized (MAO) and hydrothermally treated (HT) Ti surfaces are coated with chitosan (Chi). • The MAO/HT/Chi surface exhibits pores sealing and enhanced the surface roughness. • The MAO/HT/Chi surface significantly increase the corrosion resistance. • The MAO/HT/Chi can be a potential surface of titanium for bio-implants

  6. 77 FR 31909 - Culturally Significant Objects Imported for Exhibition

    Science.gov (United States)

    2012-05-30

    ... exhibition ``50th Anniversary Remembrance of the Tragedy at Orly,'' imported from abroad by the High Museum of Art for temporary exhibition within the United States, is of cultural significance. The object is... exhibition or display of the exhibit object at the High Museum of Art in Atlanta, Georgia from on or about...

  7. Transport on the surface of a topological insulator

    International Nuclear Information System (INIS)

    Vargiamidis, V.; Vasilopoulos, P.

    2014-01-01

    We study theoretically dc and ac transport on the surface of a three-dimensional topological insulator when its time-reversal symmetry is broken. Starting with a Kubo formula, we derive an explicit expression for the dc Hall conductivity, valid for finite temperatures. At zero temperature this expression gives the dc half-quantum Hall conductivity, provided the Fermi level lies in the gap. Corrections when the Fermi level is outside the gap and scattering by impurities are quantified. The longitudinal conductivity is also examined. At finite frequencies, we find a modified Drude term in σ xx (ω) and logarithmic, frequency-dependent corrections in σ yx (ω). The ac Hall conductivity exhibits a robust logarithmic singularity for excitation energies equal to the gapwidth. For these energies, we also find that the power spectrum, which is pertinent to optical experiments, exhibits drastic increase. The Hall conductivity remains almost unaffected for temperatures up to approximately 300 K

  8. EU Climate Change Exhibition Held

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>On April 25, the CPAFFC, the China-EU Association (CEUA) and the Delegation of the European Commission to China jointly held the opening ceremony for the EU Exhibition on Climate Change in the CPAFFC. He Luli, former vice chairperson of the NPC Standing Committee and honorary president of the CEUA, Jose Manuel Barroso, president of the European Commission, and Li Jianping, vice president of the CPAFFC, attended the opening ceremony and made speeches. Honorary President He Luli highly praised the achievements made by China and the EU in their longtime cooperation of mutual benefits in various fields including environmental protection. She said, for many years China and EU have both committed to the development of all-round strategic partnership and establishment of a multi-level mechanism of political dialogue. She expressed, with increasing enthusiasm the CEUA would continue to actively carry out nongovernmental exchanges between China and the EU, and promote cooperation between the two sides in the fields of economy, society, environmental protection, science and technology, culture, etc.

  9. Covalent Attachment of Bent-Core Mesogens to Silicon Surfaces

    NARCIS (Netherlands)

    Scheres, L.; Achten, R.; Giesbers, M.; Smet, de L.; Arafat, A.; Sudhölter, E.J.R.; Marcelis, A.T.M.; Zuilhof, H.

    2009-01-01

    Two vinyl-terminated bent core-shaped liquid crystalline molecules that exhibit thermotropic antiferroelectric SmCPA phases have been covalently attached onto a hydrogen-terminated silicon(111) surface. The surface attachment was achieved via a mild procedure from a mesitylene solution, using

  10. Education or business? - exhibition of human corpses

    Directory of Open Access Journals (Sweden)

    Grzegorz Wróbel

    2017-09-01

    Full Text Available Exhibition "BODY WORLDS" which are presented exhibits of human remains are presented all over the world and are a major problem for the modern man, as presented on the preparations of the human not only serve scientific research, are not transferred to the medical schools to educate future doctors, but they were made available to the general public in the form of commercial and ambiguous. The aim of this study was to assess the ethical commercialization of human corpses "BODY WORLDS" exhibitions. Individual approach to the problems presented the dignity and value of human remains after death, of course, strongly related to the professed worldview. In the exhibits can be seen in both the scientific interest anatomical structures, as well as desecrated human remains or beautiful by its functional perfection of the body, understood also in terms of art. The question of ethics determines the right to decide for themselves, on the other hand, allows you to protect bodily integrity even after death. "BODY WORLDS" exhibition goes for the moral and ethical boundaries. In terms of people Gunther von Hagens for plastination of human remains which became a very profitable business, and its current activities defined as "plastination business" should be firmly said about the lack of moral principles.

  11. A nanostructured surface increases friction exponentially at the solid-gas interface.

    Science.gov (United States)

    Phani, Arindam; Putkaradze, Vakhtang; Hawk, John E; Prashanthi, Kovur; Thundat, Thomas

    2016-09-06

    According to Stokes' law, a moving solid surface experiences viscous drag that is linearly related to its velocity and the viscosity of the medium. The viscous interactions result in dissipation that is known to scale as the square root of the kinematic viscosity times the density of the gas. We observed that when an oscillating surface is modified with nanostructures, the experimentally measured dissipation shows an exponential dependence on kinematic viscosity. The surface nanostructures alter solid-gas interplay greatly, amplifying the dissipation response exponentially for even minute variations in viscosity. Nanostructured resonator thus allows discrimination of otherwise narrow range of gaseous viscosity making dissipation an ideal parameter for analysis of a gaseous media. We attribute the observed exponential enhancement to the stochastic nature of interactions of many coupled nanostructures with the gas media.

  12. A nanostructured surface increases friction exponentially at the solid-gas interface

    Science.gov (United States)

    Phani, Arindam; Putkaradze, Vakhtang; Hawk, John E.; Prashanthi, Kovur; Thundat, Thomas

    2016-09-01

    According to Stokes’ law, a moving solid surface experiences viscous drag that is linearly related to its velocity and the viscosity of the medium. The viscous interactions result in dissipation that is known to scale as the square root of the kinematic viscosity times the density of the gas. We observed that when an oscillating surface is modified with nanostructures, the experimentally measured dissipation shows an exponential dependence on kinematic viscosity. The surface nanostructures alter solid-gas interplay greatly, amplifying the dissipation response exponentially for even minute variations in viscosity. Nanostructured resonator thus allows discrimination of otherwise narrow range of gaseous viscosity making dissipation an ideal parameter for analysis of a gaseous media. We attribute the observed exponential enhancement to the stochastic nature of interactions of many coupled nanostructures with the gas media.

  13. Increase of surface solar irradiance across East China related to changes in aerosol properties during the past decade

    Science.gov (United States)

    Li, Jing; Jiang, Yiwei; Xia, Xiangao; Hu, Yongyun

    2018-03-01

    Previously, it was widely documented that an overall decrease in surface solar radiation occurred in China at least until 2005, in contrast to the general background of ‘global brightening’. Increased anthropogenic aerosol emissions were speculated to be the source of the reduction. In this study, we extend the trend analysis to the most recent decade from 2005-2015 and find that surface solar radiation has shifted from ‘dimming’ to ‘brightening’ over East China, with the largest increase over the northeast and southeast parts. Meanwhile, satellite and ground observation both indicate a reduction in aerosol optical depth (AOD) during the same period, whereas no significant trends in cloud amount show up. Detailed analysis using co-located radiation and aerosol observation at the XiangHe station in North China suggests that both AOD and single scattering albedo (SSA) changes contribute to the radiation trends. AOD reduction contributes to the increase of direct solar radiation, also decreasing the diffuse radiation, while the increase of SSA serves to increase the diffuse fraction. Simple calculations using a radiative transfer model confirm that the two effects combined explain changes in the global solar radiation and its components effectively. Our results have implications for potential climate effects with the reduction of China’s aerosol emissions, and the necessity to monitor aerosol composition in addition to its loading.

  14. Spatial and thickness dependence of coupling interaction of surface states and influence on transport and optical properties of few-layer Bi2Se3

    Science.gov (United States)

    Li, Zhongjun; Chen, Shi; Sun, Jiuyu; Li, Xingxing; Qiu, Huaili; Yang, Jinlong

    2018-02-01

    Coupling interaction between the bottom and top surface electronic states and the influence on transport and optical properties of Bi2Se3 thin films with 1-8 quintuple layers (QLs) have been investigated by first principles calculations. Obvious spatial and thickness dependences of coupling interaction are found by analyzing hybridization of two surface states. In the thin film with a certain thickness, from the outer to inner atomic layers, the coupling interaction exhibits an increasing trend. On the other hand, as thickness increases, the coupling interaction shows a disproportionate decrease trend. Moreover, the system with 3 QLs exhibits stronger interaction than that with 2 QLs. The presence of coupling interaction would suppress destructive interference of surface states and enhance resistance in various degrees. In view of the inversely proportional relation to transport channel width, the resistance of thin films should show disproportionate thickness dependence. This prediction is qualitatively consistent with the transport measurements at low temperature. Furthermore, the optical properties also exhibit obvious thickness dependence. Especially as the thickness increases, the coupling interaction results in red and blue shifts of the multiple-peak structures in low and high energy regions of imaginary dielectric function, respectively. The red shift trend is in agreement with the recent experimental observation and the blue shift is firstly predicted by the present calculation. The present results give a concrete understanding of transport and optical properties in devices based on Bi2Se3 thin films with few QLs.

  15. Medan Convention & Exhibition Center (Arsitektur Ekspresionisme)

    OpenAIRE

    Iskandar, Nurul Auni

    2015-01-01

    Medan is one of the third largest city in Indonesia, which is currently being developed, and a city with lots of activities. In the city of Medan has a high investment opportunities for a convention, because of its strategic position in Southeast Asia and also supported by the facility and the potential for tourism in North Sumatra, Medan city has the potential for industrial MICE (Meeting, Incentive, Conference, Exhibition). The construction of Medan Convention & Exhibition Cente...

  16. Oxidation of hydrogen terminated Ge(1 0 0) surface in the presence of iodine in methanol

    International Nuclear Information System (INIS)

    Lee, Younghwan; Park, Kibyung; Lim, Sangwoo

    2008-01-01

    Surface reaction on Ge(1 0 0) in liquid methanol (MeOH) was systematically studied. In particular, the characteristics of the Ge surface in the presence of iodine (I 2 ) in MeOH were investigated. MeOH treatment of the Ge surface in the presence of 0.05 or 0.005 mM of I 2 exhibited a similar result to that without I 2 , which produces a GeO x -dominant oxide structure. However, when the concentration of I 2 in MeOH increased to 0.5 mM, Ge surface revealed a GeO 2 -dominant oxide structure. Therefore, it is believed that the addition of enough I 2 in MeOH modifies the Ge oxidation mechanism. Hydroxide produced by the reaction between MeOH and the iodine radical may oxidize the Ge surface to form a Ge-O layer. Because MeOH is greatly consumed by chain and series reactions when I 2 concentration is high, a GeO 2 structure is not etched and a GeO 2 -dominant oxide structure is obtained with the addition of 0.5 mM I 2 in MeOH. The modified oxide layer prepared in MeOH with 0.5 mM I 2 exhibited an atomically smoother surface compared to a pure MeOH- or H 2 O 2 -treated Ge surface and a much thinner oxide layer than H 2 O 2 treatment.

  17. Transmittance enhancement of sapphires with antireflective subwavelength grating patterned UV polymer surface structures by soft lithography.

    Science.gov (United States)

    Lee, Soo Hyun; Leem, Jung Woo; Yu, Jae Su

    2013-12-02

    We report the total and diffuse transmission enhancement of sapphires with the ultraviolet curable SU8 polymer surface structures consisting of conical subwavelength gratings (SWGs) at one- and both-side surfaces for different periods. The SWGs patterns on the silicon templates were transferred into the SU8 polymer film surface on sapphires by a simple and cost-effective soft lithography technique. For the fabricated samples, the surface morphologies, wetting behaviors, and optical characteristics were investigated. For theoretical optical analysis, a rigorous coupled-wave analysis method was used. At a period of 350 nm, the sample with SWGs on SU8 film/sapphire exhibited a hydrophobic surface and higher total transmittance compared to the bare sapphire over a wide wavelength of 450-1000 nm. As the period of SWGs was increased, the low total transmittance region of < 85% was shifted towards the longer wavelengths and became broader while the diffuse transmittance was increased (i.e., larger haze ratio). For the samples with SWGs at both-side surfaces, the total and diffuse transmittance spectra were further enhanced compared to the samples with SWGs at one-side surface. The theoretical optical calculation results showed a similar trend to the experimentally measured data.

  18. A Heuristic for Improving Transmedia Exhibition Experience

    DEFF Research Database (Denmark)

    Selvadurai, Vashanth; Rosenstand, Claus Andreas Foss

    2017-01-01

    in the scientific field of designing transmedia experience in an exhibition context that links the pre- and post-activities to the actual visit (during-activities). The result of this study is a preliminary heuristic for establishing a relation between the platform and content complexity in transmedia exhibitions....

  19. Friction surfaced Stellite6 coatings

    International Nuclear Information System (INIS)

    Rao, K. Prasad; Damodaram, R.; Rafi, H. Khalid; Ram, G.D. Janaki; Reddy, G. Madhusudhan; Nagalakshmi, R.

    2012-01-01

    Solid state Stellite6 coatings were deposited on steel substrate by friction surfacing and compared with Stellite6 cast rod and coatings deposited by gas tungsten arc and plasma transferred arc welding processes. Friction surfaced coatings exhibited finer and uniformly distributed carbides and were characterized by the absence of solidification structure and compositional homogeneity compared to cast rod, gas tungsten arc and plasma transferred coatings. Friction surfaced coating showed relatively higher hardness. X-ray diffraction of samples showed only face centered cubic Co peaks while cold worked coating showed hexagonally close packed Co also. - Highlights: ► Stellite6 used as coating material for friction surfacing. ► Friction surfaced (FS) coatings compared with casting, GTA and PTA processes. ► Finer and uniformly distributed carbides in friction surfaced coatings. ► Absence of melting results compositional homogeneity in FS Stellite6 coatings.

  20. Surface-enhanced Raman scattering sensing on black silicon

    International Nuclear Information System (INIS)

    Gervinskas, Gediminas; Seniutinas, Gediminas; Hartley, Jennifer S.; Stoddart, Paul R.; Juodkazis, Saulius; Kandasamy, Sasikaran; Fahim, Narges F.

    2013-01-01

    Reactive ion etching was used to fabricate black-Si over the entire surface area of 4-inch Si wafers. After 20 min of the plasma treatment, surface reflection well below 2% was achieved over the 300-1000 nm spectral range. The spikes of the black-Si substrates were coated by gold, resulting in an island film for surface-enhanced Raman scattering (SERS) sensing. A detection limit of 1 x 10 -6 M (at count rate > 10 2 s -1 . mW -1 ) was achieved for rhodamine 6G in aqueous solution when drop cast onto a ∝ 100-nm-thick Au coating. The sensitivity increases for thicker coatings. A mixed mobile-on-immobile platform for SERS sensing is introduced by using dog-bone Au nanoparticles on the Au/black-Si substrate. The SERS intensity shows a non-linear dependence on the solid angle (numerical aperture of excitation/collection optics) for a thick gold coating that exhibits a 10 times higher enhancement. This shows promise for augmented sensitivity in SERS applications. (copyright 2013 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  1. CERN exhibition wins yet another design prize

    CERN Multimedia

    Joannah Caborn Wengler

    2012-01-01

    The “Universe of Particles” exhibition in CERN’s Globe wins the silver design prize from the German direct business communications association FAMAB.   Not only do tens of thousands of people visit the “Universe of Particles” exhibition each year, but juries for design prizes are crossing its threshold more and more frequently too. In 2011 alone it claimed 8 awards, including winning outright the 2011 Annual Multimedia award, the iF Communication Design for Corporate Architecture award and the Modern Decoration Media award (the Bulletin already reported on some of these in July 2011). The FAMAB award is the latest to join the prestigious list. The jury of FAMAB’s “ADAM 2011” award was particularly impressed by the hands-on nature of the exhibition, which encourages visitors to get interested in science. They also appreciated the way that the space in the Globe is not just a container for the exhibits, but itself ...

  2. Dutch hi-tech companies exhibit at CERN

    CERN Multimedia

    Roberto Cantoni

    2010-01-01

    Twenty-seven Dutch companies will present the state of the art of their technological developments at the industrial exhibition Holland @ CERN from 8 to 11 November. The exhibition is designed to help strengthen the ties between fundamental science and Dutch industry.   The exhibition, supported by the Dutch Ministry of Economic Affairs and organised by the Netherlands National Institute for Subatomic Physics (Nikhef), in cooperation with the Foundation for Fundamental Research on Matter (FOM), the FOM Institute for Plasma Physics Rijnhuizen, and Dutch Scientific, an association of manufacturers of scientific equipment, will be held in the Main Building from 8 to11 November. “The last Holland @ CERN exhibition took place fifteen years ago”, says Robert Klöpping from Nikhef, Dutch Industrial Liaison Officer for CERN and Purchasing Advisor for Grenoble ESRF. “This kind of event is very important for Dutch industry as it allows us to show what Dutch companies c...

  3. A simple way to achieve bioinspired hybrid wettability surface with micro/nanopatterns for efficient fog collection.

    Science.gov (United States)

    Yin, Kai; Du, Haifeng; Dong, Xinran; Wang, Cong; Duan, Ji-An; He, Jun

    2017-10-05

    Fog collection is receiving increasing attention for providing water in semi-arid deserts and inland areas. Inspired by the fog harvesting ability of the hydrophobic-hydrophilic surface of Namib desert beetles, we present a simple, low-cost method to prepare a hybrid superhydrophobic-hydrophilic surface. The surface contains micro/nanopatterns, and is prepared by incorporating femtosecond-laser fabricated polytetrafluoroethylene nanoparticles deposited on superhydrophobic copper mesh with a pristine hydrophilic copper sheet. The as-prepared surface exhibits enhanced fog collection efficiency compared with uniform (super)hydrophobic or (super)hydrophilic surfaces. This enhancement can be tuned by controlling the mesh number, inclination angle, and fabrication structure. Moreover, the surface shows excellent anti-corrosion ability after immersing in 1 M HCl, 1 M NaOH, and 10 wt% NaCl solutions for 2 hours. This work may provide insight into fabricating hybrid superhydrophobic-hydrophilic surfaces for efficient atmospheric water collection.

  4. Spectral curves of surface reflectance in some Antarctic regions

    International Nuclear Information System (INIS)

    Lupi, A.; Tomasi, C.; Orsini, A.; Cacciari, A.; Vitale, V.; Georgiadis, T.; Casacchia, R.; Salvatori, R.; Salvi, S.

    2001-01-01

    Four surface reflectance models of solar radiation were determined by examining several sets of field measurements taken for clear-sky conditions at various sites in Antarctica. Each model consists of the mean spectral curve of surface reflectance in the 0.25-2.7 μm wavelength range and of the dependence curve of total abedo on the solar elevation angle h, within the range from 5 0 to 55 0 . The TNB (Terra Nova Bay) model refers to a rocky terrain where granites are predominant; the NIS (Nansen Ice Sheet) model to a glacier surface made uneven by sastrugi and streaked by irregular fractures; the HAP (High Altitude Plateau) model to a flat ice surface covered by fresh snow and scored by light sastrugi; and the RIS (Ross Ice Shelf) model to an area covered by the sea ice pack presenting many discontinuities in the reflectance features, due to melt water lakes, puddles, refrozen ice and snow pots. The reflectance curve obtained for the TNB model presents gradually increasing values as wavelength increases through the visible spectral range and almost constant values at infrared wavelengths, giving a total albedo value equal to 0.264 at = 30 0 , which increases by about 80% through the lower range of h and decreases by 12% through the upper range. The reflectance curves of the NIS, HAP and RIS models are all peaked at visible wavelengths and exhibit decreasing values throughout the infrared spectral range, giving values of total albedo equal to 0.464, 0.738 and 0.426 at h 30 0 , respectively. These values were estimated to increase by 8-14% as h decreases from 30 0 to 5 0 and to decrease by 2-4% only as h increases from 30 0 to 55 0

  5. Surface modification of ultra thin PES-zeolite using thermal annealing to increase flux and rejection of produced water treatment

    Energy Technology Data Exchange (ETDEWEB)

    Kusworo, T. D., E-mail: tdkusworo@che.undip.ac.id; Widayat,; Pradini, A. W.; Armeli, Y. P. [Department of Chemical Engineering, University of Diponegoro Prof. Soedarto, Tembalang, Semarang, 50239, Phone/Fax : (024) 7460058 (Indonesia)

    2015-12-29

    Membrane technology is an alternative of water treatment based on filtration that is being developed. Surface Modification using heat treatment has been investigated to improve the performance of ultra thin PES-Zeolite nanocomposite membrane for produced water treatment from Pertamina Balongan. Two types of membranes with surface modification and without modification were prepared to study the effect of surface modification on its permeation properties. Asymmetric ultra thin PES-Zeolite nanocomposite membrane for produced water treatment was casted using the dry/wet phase inversion technique from dope solutions containing polyethersulfone, N-methyl-2-pyrrolidone (NMP) as a solvent and zeolite as a filler. Experimental results showed that the heat treatment at near glass transition temperature was increase the rejection of COD, Turbidity and ion Ca{sup 2+}. The better adherence of zeolite particles in the polymer matrix combined with formation of charge transfer complexes (CTCs) and cross-linking might be the main factors to enhance the percent of rejection. Field emission scanning electron microscopy (FESEM) micrographs showed that the selective layer and the substructure of PES-zeolite membrane became denser and more compact after the heat treatment. The FESEM micrographs also showed that the heat treatment was increased the adherence of zeolite particle and polymer. Membranes treated at 180 °C for 15 seconds indicated increase the rejection and small decrease in flux for produced water treatment.

  6. Longer Contact Times Increase Cross-Contamination of Enterobacter aerogenes from Surfaces to Food.

    Science.gov (United States)

    Miranda, Robyn C; Schaffner, Donald W

    2016-11-01

    Bacterial cross-contamination from surfaces to food can contribute to foodborne disease. The cross-contamination rate of Enterobacter aerogenes on household surfaces was evaluated by using scenarios that differed by surface type, food type, contact time (food types were watermelon, bread, bread with butter, and gummy candy. Surfaces (25 cm 2 ) were spot inoculated with 1 ml of inoculum and allowed to dry for 5 h, yielding an approximate concentration of 10 7 CFU/surface. Foods (with a 16-cm 2 contact area) were dropped onto the surfaces from a height of 12.5 cm and left to rest as appropriate. Posttransfer, surfaces and foods were placed in sterile filter bags and homogenized or massaged, diluted, and plated on tryptic soy agar. The transfer rate was quantified as the log percent transfer from the surface to the food. Contact time, food, and surface type all had highly significant effects (P food, while the least bacteria transferred to gummy candy (∼0.1 to 62%). Transfer of bacteria to bread (∼0.02 to 94%) was similar to transfer of bacteria to bread with butter (∼0.02 to 82%), and these transfer rates under a given set of conditions were more variable than with watermelon and gummy candy. The popular notion of the "five-second rule" is that food dropped on the floor and left there for foods (watermelon, bread, bread with butter, and gummy candy), four different contact times (food and the surface, are of equal or greater importance. Some transfer takes place "instantaneously," at times of <1 s, disproving the five-second rule. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. Hydroxy-Al and cell-surface negativity are responsible for the enhanced sensitivity of Rhodotorula taiwanensis to aluminum by increased medium pH.

    Science.gov (United States)

    Zhao, Xue Qiang; Bao, Xue Min; Wang, Chao; Xiao, Zuo Yi; Hu, Zhen Min; Zheng, Chun Li; Shen, Ren Fang

    2017-10-01

    Aluminum (Al) is ubiquitous and toxic to microbes. High Al 3+ concentration and low pH are two key factors responsible for Al toxicity, but our present results contradict this idea. Here, an Al-tolerant yeast strain Rhodotorula taiwanensis RS1 was incubated in glucose media containing Al with a continuous pH gradient from pH 3.1-4.2. The cells became more sensitive to Al and accumulated more Al when pH increased. Calculations using an electrostatic model Speciation Gouy Chapman Stern indicated that, the increased Al sensitivity of cells was associated with AlOH 2+ and Al(OH) 2 + rather than Al 3+ . The alcian blue (a positively charged dye) adsorption and zeta potential determination of cell surface indicated that, higher pH than 3.1 increased the negative charge and Al adsorption at the cell surface. Taken together, the enhanced sensitivity of R. taiwanensis RS1 to Al from pH 3.1-4.2 was associated with increased hydroxy-Al and cell-surface negativity.

  8. Structure in a confined smectic liquid crystal with competing surface and sample elasticities

    International Nuclear Information System (INIS)

    Idziak, S.H.; Koltover, I.; Israelachvili, J.N.; Safinya, C.R.

    1996-01-01

    We report on studies using the x-ray surface forces apparatus (XSFA) to compare the structure of a liquid crystal confined between hard surfaces and, for the first time, between soft surfaces that can deform due to the stresses imposed by the confined fluid. We find that the alignment of smectic domains in confined films depends critically on both the shape and compliance of the confining walls or surfaces: open-quote open-quote Soft surfaces close-quote close-quote exhibit a critical gap thickness of 3.4 μm for the liquid crystal studied at which maximum alignment occurs, while open-quote open-quote hard surfaces close-quote close-quote do not exhibit gap-dependent alignment. copyright 1996 The American Physical Society

  9. Surface functionalization by fine ultraviolet-patterning of nanometer-thick liquid lubricant films

    International Nuclear Information System (INIS)

    Lu, Renguo; Zhang, Hedong; Komada, Suguru; Mitsuya, Yasunaga; Fukuzawa, Kenji; Itoh, Shintaro

    2014-01-01

    Highlights: • We present fine UV-patterning of nm-thick liquid films for surface functionalization. • The patterned films exhibit both a morphological pattern and a functional pattern of different surface properties. • The finest pattern linewidth was 0.5 μm. • Fine patterning is crucial for improving surface and tribological properties. - Abstract: For micro/nanoscale devices, surface functionalization is essential to achieve function and performance superior to those that originate from the inherent bulk material properties. As a method of surface functionalization, we dip-coated nanometer-thick liquid lubricant films onto solid surfaces and then patterned the lubricant films with ultraviolet (UV) irradiation through a photomask. Surface topography, adhesion, and friction measurements demonstrated that the patterned films feature a concave–convex thickness distribution with thicker lubricant in the irradiated regions and a functional distribution with lower adhesion and friction in the irradiated convex regions. The pattern linewidth ranged from 100 to as fine as 0.5 μm. The surface functionalization effect of UV-patterning was investigated by measuring the water contact angles, surface energies, friction forces, and depletion of the patterned, as-dipped, and full UV-irradiated lubricant films. The full UV-irradiated lubricant film was hydrophobic with a water contact angle of 102.1°, and had lower surface energy, friction, and depletion than the as-dipped film, which was hydrophilic with a water contact angle of 80.7°. This demonstrates that UV irradiation substantially improves the surface and tribological properties of the nanometer-thick liquid lubricant films. The UV-patterned lubricant films exhibited superior surface and tribological properties than the as-dipped film. The water contact angle increased and the surface energy, friction, and depletion decreased as the pattern linewidth decreased. In particular, the 0.5-μm patterned lubricant

  10. Exhibiting health and medicine as culture

    DEFF Research Database (Denmark)

    Whiteley, Louise; Tybjerg, Karin; Pedersen, Bente Vinge

    2017-01-01

    -being of their visitors, we instead focus on how museums should communicate about health and medicine. Methods: The paper describes three examples of exhibitions at Medical Museion that attempt to display medicine as culture, and draws out three of the key strategies they employ. Results: The three key strategies are: (1......Introduction: This paper discusses the potential role of medical museums in public engagement with health and medicine, based on the work of Medical Museion at the University of Copenhagen. Rather than asking whether cultural venues such as museums can directly improve the well......: There is increasing emphasis on the need for health communication to recognize people’s multiple, lived cultures. We argue that we should also recognize that medical research and practice is itself a form of culture, and as such is multiple and historically shifting. This paper demonstrates that museums are an ideal...

  11. Antibacterial Au nanostructured surfaces.

    Science.gov (United States)

    Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun

    2016-02-07

    We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.

  12. Niobium thin film deposition studies on copper surfaces for superconducting radio frequency cavity applications

    Energy Technology Data Exchange (ETDEWEB)

    W. M. Roach, D. B. Beringer, J. R. Skuza, W. A. Oliver, C. Clavero, C. E. Reece, R. A. Lukaszew

    2012-06-01

    Thin film coatings have the potential to increase both the thermal efficiency and accelerating gradient in superconducting radio frequency accelerator cavities. However, before this potential can be realized, systematic studies on structure-property correlations in these thin films need to be carried out since the reduced geometry, combined with specific growth parameters, can modify the physical properties of the materials when compared to their bulk form. Here, we present our systematic studies of Nb thin films deposited onto Cu surfaces to clarify possible reasons for the limited success that this process exhibited in previous attempts. We compare these films with Nb grown on other surfaces. In particular, we study the crystal structure and surface morphology and their effect on superconducting properties, such as critical temperature and lower critical field. We found that higher deposition temperature leads to a sharper critical temperature transition, but also to increased roughness indicating that there are competing mechanisms that must be considered for further optimization.

  13. Niobium thin film deposition studies on copper surfaces for superconducting radio frequency cavity applications

    Directory of Open Access Journals (Sweden)

    W. M. Roach

    2012-06-01

    Full Text Available Thin film coatings have the potential to increase both the thermal efficiency and accelerating gradient in superconducting radio frequency accelerator cavities. However, before this potential can be realized, systematic studies on structure-property correlations in these thin films need to be carried out since the reduced geometry, combined with specific growth parameters, can modify the physical properties of the materials when compared to their bulk form. Here, we present our systematic studies of Nb thin films deposited onto Cu surfaces to clarify possible reasons for the limited success that this process exhibited in previous attempts. We compare these films with Nb grown on other surfaces. In particular, we study the crystal structure and surface morphology and their effect on superconducting properties, such as critical temperature and lower critical field. We found that higher deposition temperature leads to a sharper critical temperature transition, but also to increased roughness indicating that there are competing mechanisms that must be considered for further optimization.

  14. Niobium thin film deposition studies on copper surfaces for superconducting radio frequency cavity applications

    International Nuclear Information System (INIS)

    Roach, W.M.; Beringer, D.B.; Skuza, J.R.; Oliver, W.A.; Clavero, C.; Reece, C.E.; Lukaszew, R.A.

    2012-01-01

    Thin film coatings have the potential to increase both the thermal efficiency and accelerating gradient in superconducting radio frequency accelerator cavities. However, before this potential can be realized, systematic studies on structure-property correlations in these thin films need to be carried out since the reduced geometry, combined with specific growth parameters, can modify the physical properties of the materials when compared to their bulk form. Here, we present our systematic studies of Nb thin films deposited onto Cu surfaces to clarify possible reasons for the limited success that this process exhibited in previous attempts. We compare these films with Nb grown on other surfaces. In particular, we study the crystal structure and surface morphology and their effect on superconducting properties, such as critical temperature and lower critical field. We found that higher deposition temperature leads to a sharper critical temperature transition, but also to increased roughness indicating that there are competing mechanisms that must be considered for further optimization.

  15. Nanoporous Ni with High Surface Area for Potential Hydrogen Storage Application.

    Science.gov (United States)

    Zhou, Xiaocao; Zhao, Haibo; Fu, Zhibing; Qu, Jing; Zhong, Minglong; Yang, Xi; Yi, Yong; Wang, Chaoyang

    2018-06-01

    Nanoporous metals with considerable specific surface areas and hierarchical pore structures exhibit promising applications in the field of hydrogen storage, electrocatalysis, and fuel cells. In this manuscript, a facile method is demonstrated for fabricating nanoporous Ni with a high surface area by using SiO₂ aerogel as a template, i.e., electroless plating of Ni into an SiO₂ aerogel template followed by removal of the template at moderate conditions. The effects of the prepared conditions, including the electroless plating time, temperature of the structure, and the magnetism of nanoporous Ni are investigated in detail. The resultant optimum nanoporous Ni with a special 3D flower-like structure exhibited a high specific surface area of about 120.5 m²/g. The special nanoporous Ni exhibited a promising prospect in the field of hydrogen storage, with a hydrogen capacity of 0.45 wt % on 4.5 MPa at room temperature.

  16. 19 CFR 212.11 - Net worth exhibit.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Net worth exhibit. 212.11 Section 212.11 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT Information Required From Applicants § 212.11 Net worth exhibit...

  17. Modified titanium surface with gelatin nano gold composite increases osteoblast cell biocompatibility

    International Nuclear Information System (INIS)

    Lee, Young-Hee; Bhattarai, Govinda; Aryal, Santosh; Lee, Nan-Hee; Lee, Min-Ho; Kim, Tae-Gun; Jhee, Eun-Chung; Kim, Hak-Yong; Yi, Ho-Keun

    2010-01-01

    This study examined the gelatin nano gold (GnG) composite for surface modification of titanium in addition to insure biocompatibility on dental implants or biomaterials. The GnG composite was constructed by gelatin and hydrogen tetrachloroaurate in presence of reducing agent, sodium borohydrate (NabH 4 ). The GnG composite was confirmed by UV-VIS spectroscopy and transmission electron microscopy (TEM). A dipping method was used to modify the titanium surface by GnG composite. Surface was characterized by scanning electron microscopy (SEM) and energy dispersive X-ray (EDX). The MC-3T3 E1 cell viability was assessed by trypan blue and the expression of proteins to biocompatibility were analyzed by Western blotting. The GnG composite showed well dispersed character, the strong absorption at 530 nm, roughness, regular crystal and clear C, Na, Cl, P, and Au signals onto titanium. Further, this composite allowed MC-3T3 E1 growth and viability compared to gelatin and pure titanium. It induced ERK activation and the expression of cell adherent molecules, FAK and SPARC, and growth factor, VEGF. However, GnG decreased the level of SAPK/JNK. This shows that GnG composite coated titanium surfaces have a good biocompatibility for osteoblast growth and attachment than in intact by simple and versatile dipping method. Furthermore, it offers good communication between cell and implant surfaces by regulating cell signaling and adherent molecules, which are useful to enhance the biocompatibility of titanium surfaces.

  18. Surface modification of an Mg-1Ca alloy to slow down its biocorrosion by chitosan

    International Nuclear Information System (INIS)

    Gu, X N; Zheng, Y F; Lan, Q X; Cheng, Y; Xi, T F; Zhang, Z X; Zhang, D Y

    2009-01-01

    The surface morphologies before and after immersion corrosion test of various chitosan-coated Mg-1Ca alloy samples were studied to investigate the effect of chitosan dip coating on the slowdown of biocorrosion. It showed that the corrosion resistance of the Mg-Ca alloy increased after coating with chitosan, and depended on both the chitosan molecular weight and layer numbers of coating. The Mg-Ca alloy coated by chitosan with a molecular weight of 2.7 x 10 5 for six layers has smooth and intact surface morphology, and exhibits the highest corrosion resistance in a simulated body fluid.

  19. Surface modification of an Mg-1Ca alloy to slow down its biocorrosion by chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Gu, X N; Zheng, Y F; Lan, Q X [State Key Laboratory for Turbulence and Complex System and College of Engineering, Peking University, Beijing 100871 (China); Cheng, Y; Xi, T F [Center for Biomedical Materials and Tissue Engineering, Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); Zhang, Z X [Biomedical Engineering Research Center, Research Institute of Peking University in Shenzhen, Shenzhen 518057 (China); Zhang, D Y, E-mail: gxn139888@pku.edu.c, E-mail: yfzheng@pku.edu.c, E-mail: 8lanqiuxiang@163.co, E-mail: chengyan@pku.edu.c, E-mail: top5460@163.co, E-mail: xitingfei@tom.co, E-mail: zhangdeyuan@lifetechmed.co [Lifetech Scientific (Shenzhen) Co. Ltd, Hi-Tech Park, Shenzhen 518000 (China)

    2009-08-15

    The surface morphologies before and after immersion corrosion test of various chitosan-coated Mg-1Ca alloy samples were studied to investigate the effect of chitosan dip coating on the slowdown of biocorrosion. It showed that the corrosion resistance of the Mg-Ca alloy increased after coating with chitosan, and depended on both the chitosan molecular weight and layer numbers of coating. The Mg-Ca alloy coated by chitosan with a molecular weight of 2.7 x 10{sup 5} for six layers has smooth and intact surface morphology, and exhibits the highest corrosion resistance in a simulated body fluid.

  20. Surface modification of an Mg-1Ca alloy to slow down its biocorrosion by chitosan.

    Science.gov (United States)

    Gu, X N; Zheng, Y F; Lan, Q X; Cheng, Y; Zhang, Z X; Xi, T F; Zhang, D Y

    2009-08-01

    The surface morphologies before and after immersion corrosion test of various chitosan-coated Mg-1Ca alloy samples were studied to investigate the effect of chitosan dip coating on the slowdown of biocorrosion. It showed that the corrosion resistance of the Mg-Ca alloy increased after coating with chitosan, and depended on both the chitosan molecular weight and layer numbers of coating. The Mg-Ca alloy coated by chitosan with a molecular weight of 2.7 x 10(5) for six layers has smooth and intact surface morphology, and exhibits the highest corrosion resistance in a simulated body fluid.

  1. 77 FR 31420 - Culturally Significant Objects Imported for Exhibition

    Science.gov (United States)

    2012-05-25

    ... also determine that the exhibition or display of the exhibit objects at The Museum of Modern Art, New...: Game Plan'' imported from abroad for temporary exhibition within the United States, are of cultural...

  2. Surface Water Quality Trends from EPA's LTM Network

    Science.gov (United States)

    Funk, C.; Lynch, J. A.

    2013-12-01

    Surface water chemistry provides direct indicators of the potential effects of anthropogenic impacts, such as acid deposition and climate change, on the overall health of aquatic ecosystems. Long-term surface water monitoring networks provide a host of environmental data that can be used, in conjunction with other networks, to assess how water bodies respond to stressors and if they are potentially at risk (e.g., receiving pollutant deposition beyond its critical load). Two EPA-administered monitoring programs provide information on the effects of acidic deposition on headwater aquatic systems: the Long Term Monitoring (LTM) program and the Temporally Integrated Monitoring of Ecosystems (TIME) program, designed to track the effectiveness of the 1990 Clean Air Act Amendments (CAAA) in reducing the acidity of surface waters in acid sensitive ecoregions of the Northeast and Mid-Atlantic. Here we present regional variability of long term trends in surface water quality in response to substantial reductions in atmospheric deposition. Water quality trends at acid sensitive LTM sites exhibit decreasing concentrations of sulfate at 100% of monitored sites in the Adirondack Mountains and New England, 80% of Northern Appalachian Plateau sites, and yet only 15% of sites in the Ridge and Blue Ridge Provinces over the 1990-2011 period of record. Across all regions, most LTM sites exhibited constant or only slightly declining nitrate concentrations over the same time period. Acid Neutralizing Capacity (ANC) levels improved at 68% and 45% of LTM sites in the Adirondacks and Northern Appalachian Plateau, respectively, but few sites showed increases in New England or the Ridge and Blue Ridge Provinces due to lagging improvements in base cation concentration. The ANC of northeastern TIME lakes was also evaluated from 1991 to 1994 and 2008 to 2011. The percentage of lakes with ANC values below 50 μeq/L, lakes of acute or elevated concern, dropped by about 7%, indicating improvement

  3. Quasi-one-dimensional metals on semiconductor surfaces with defects

    International Nuclear Information System (INIS)

    Hasegawa, Shuji

    2010-01-01

    Several examples are known in which massive arrays of metal atomic chains are formed on semiconductor surfaces that show quasi-one-dimensional metallic electronic structures. In this review, Au chains on Si(557) and Si(553) surfaces, and In chains on Si(111) surfaces, are introduced and discussed with regard to the physical properties determined by experimental data from scanning tunneling microscopy (STM), angle-resolved photoemission spectroscopy (ARPES) and electrical conductivity measurements. They show quasi-one-dimensional Fermi surfaces and parabolic band dispersion along the chains. All of them are known from STM and ARPES to exhibit metal-insulator transitions by cooling and charge-density-wave formation due to Peierls instability of the metallic chains. The electrical conductivity, however, reveals the metal-insulator transition only on the less-defective surfaces (Si(553)-Au and Si(111)-In), but not on a more-defective surface (Si(557)-Au). The latter shows an insulating character over the whole temperature range. Compared with the electronic structure (Fermi surfaces and band dispersions), the transport property is more sensitive to the defects. With an increase in defect density, the conductivity only along the metal atomic chains was significantly reduced, showing that atomic-scale point defects decisively interrupt the electrical transport along the atomic chains and hide the intrinsic property of transport in quasi-one-dimensional systems.

  4. Turning energy around: an interactive exhibition experience

    Directory of Open Access Journals (Sweden)

    Sarah Kellberg

    2018-05-01

    Full Text Available A transition from the fossil-fuel driven to a sustainable energy system is an enormous global challenge: climate change and finite resources require countries all over the world to change their way of producing, transporting and using energy. The Energiewende (energy transition will require major changes in the current energy supply system in Germany – but also worldwide. These changes will not only affect the technical sector but will also include ecological questions, social issues and political matters. Whether any transition is going to favour large scale solutions or decentralised technologies depends on local situations and global interconnections, and above all on a democratic process. Hence energy transition succeeds or fails with the acceptance and participation of society. To deal with this overwhelmingly complex topic and its multi-layered dependencies, the Deutsches Museum has designed an exhibition providing visitors with background knowledge about the necessities and challenges of energy transition, unpicking the links between the different technical, economic and social challenges. The exhibition accomplishes the task with an engaging and facilitating approach while taking into account the highly emotive aspects of energy transition as a societal issue. This paper presents the concept of the travelling exhibition energie.wenden, relating it to the Deutsches Museum´s tradition of exhibitions as well as to the challenge of how to deal with socio-scientific topics in scientific exhibitions.

  5. Enhanced energy storage and suppressed dielectric loss in oxide core-shell-polyolefin nanocomposites by moderating internal surface area and increasing shell thickness

    Energy Technology Data Exchange (ETDEWEB)

    Fredin, Lisa A.; Li, Zhong; Ratner, Mark A.; Marks, Tobin J. [Department of Chemistry Northwestern University, 2145 Sheridan Road, Evanston, IL 60208 (United States); Lanagan, Michael T. [Center for Dielectric Studies, Materials Research Institute, The Pennsylvania State University, University Park, PA 16802-4800 (United States)

    2012-11-20

    Dielectric loss in metal oxide core/Al{sub 2}O{sub 3} shell polypropylene nanocomposites scales with the particle surface area. By moderating the interfacial surface area between the phases and using increasing shell thicknesses, dielectric loss is significantly reduced, and thus the energy stored within, and recoverable from, capacitors fabricated from these materials is significantly increased, to as high as 2.05 J/cm{sup 3}. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  6. Increase in stability of cellulase immobilized on functionalized magnetic nanospheres

    Science.gov (United States)

    Zhang, Wenjuan; Qiu, Jianhui; Feng, Huixia; Zang, Limin; Sakai, Eiichi

    2015-02-01

    Functionalized magnetic nanospheres were prepared by co-condensation of tetraethylorthosilicate with three different amino-silanes: 3-(2-aminoethylamino propyl)-triethoxysilane (AEAPTES), 3-(2-aminoethylamino propyl)-trimethoxysilane (AEAPTMES) and 3-aminopropyltriethoxysilane (APTES). Then three functionalized magnetic nanospheres were used as supports for immobilization of cellulase. The three functionalized magnetic nanospheres with core-shell morphologies exhibited higher capacity for cellulase immobilization than unfunctionalized magnetic nanospheres. The increasing of surface charge of functionalized magnetic nanospheres leads to an enhancement of the capacity of cellulase immobilization. Particularly, AEAPTMES with methoxy groups was favored to be hydrolyzed and grafted on unfunctionalized magnetic nanospheres than the others. AEAPTMES functionalized magnetic nanospheres with the highest zeta potential (29 mV) exhibited 87% activity recovery and the maximum amount of immobilized cellulase was 112 mg/g support at concentration of initial cellulase of 8 mg/mL. Immobilized cellulase on AEAPTMES functionalized magnetic nanospheres had higher temperature stability and broader pH stability than other immobilized cellulases and free cellulase. In particular, it can be used in about 40 °C, demonstrating the potential of biofuel production using this immobilized cellulase.

  7. Let's play game exhibitions : A curator's perspective

    NARCIS (Netherlands)

    de Vos, Jesse; Glas, M.A.J.|info:eu-repo/dai/nl/330981447; van Vught, J.F.|info:eu-repo/dai/nl/413532682

    2017-01-01

    The Netherlands Institute for Sound and Vision is home to The Experience, a museum exhibiting the history of media in the Netherlands. For ten months in 2016 and 2017, The Experience hosted a temporary exhibition entitled Let’s YouTube . During the Let’s YouTube game month, we programmed a ten-day

  8. High-risk human papillomavirus E7 expression reduces cell-surface MHC class I molecules and increases susceptibility to natural killer cells

    DEFF Research Database (Denmark)

    Bottley, G; Watherston, O G; Hiew, Y-L

    2007-01-01

    a role for E7 in tumour immune evasion. We show that knockdown of E7 expression in HPV16- and HPV18-transformed cervical carcinoma cells by RNA interference increased expression of major histocompatibility complex (MHC) class I at the cell surface and reduced susceptibility of these cells to natural...... killer (NK) cells. Tetracycline-regulated induction of HPV16 E7 resulted in reduced expression of cell surface MHC class I molecules and increased NK cell killing. Our results suggest that, for HPV-associated malignancies, reduced MHC class I expression is the result of an active immune evasion strategy...

  9. One stone, two birds: silica nanospheres significantly increase photocatalytic activity and colloidal stability of photocatalysts

    Science.gov (United States)

    Rasamani, Kowsalya D.; Foley, Jonathan J., IV; Sun, Yugang

    2018-03-01

    Silver-doped silver chloride [AgCl(Ag)] nanoparticles represent a unique class of visible-light-driven photocatalysts, in which the silver dopants introduce electron-abundant mid-gap energy levels to lower the bandgap of AgCl. However, free-standing AgCl(Ag) nanoparticles, particularly those with small sizes and large surface areas, exhibit low colloidal stability and low compositional stability upon exposure to light irradiation, leading to easy aggregation and conversion to metallic silver and thus a loss of photocatalytic activity. These problems could be eliminated by attaching the small AgCl(Ag) nanoparticles to the surfaces of spherical dielectric silica particles with submicrometer sizes. The high optical transparency in the visible spectral region (400-800 nm), colloidal stability, and chemical/electronic inertness displayed by the silica spheres make them ideal for supporting photocatalysts and significantly improving their stability. The spherical morphology of the dielectric silica particles can support light scattering resonances to generate significantly enhanced electric fields near the silica particle surfaces, on which the optical absorption cross-section of the AgCl(Ag) nanoparticles is dramatically increased to promote their photocatalytic activity. The hybrid silica/AgCl(Ag) structures exhibit superior photocatalytic activity and stability, suitable for supporting photocatalysis sustainably; for instance, their efficiency in the photocatalytic decomposition of methylene blue decreases by only ˜9% even after ten cycles of operation.

  10. Surface modification of carbon fibers by a polyether sulfone emulsion sizing for increased interfacial adhesion with polyether sulfone

    Science.gov (United States)

    Yuan, Haojie; Zhang, Shouchun; Lu, Chunxiang

    2014-10-01

    Interests on carbon fiber-reinforced thermoplastic composites are growing rapidly, but the challenges with poor interfacial adhesion have slowed their adoption. In this work, a polyether sulfone (PES) emulsion sizing was prepared successfully for increased interfacial adhesion of carbon fiber/PES composites. To obtain a high-quality PES emulsion sizing, the key factor, emulsifier concentration, was studied by dynamic light scattering technique. The results demonstrated that the suitable weight ratio of PES to emulsifier was 8:3, and the resulting PES emulsion sizing had an average particle diameter of 117 nm and Zeta potential of -52.6 mV. After sizing, the surface oxygen-containing functional groups, free energy and wettability of carbon fibers increased significantly, which were advantageous to promote molecular-level contact between carbon fiber and PES. Finally, short beam shear tests were performed to evaluate the interfacial adhesion of carbon fiber/PES composites. The results indicated that PES emulsion sizing played a critical role for the enhanced interfacial adhesion in carbon fiber/PES composites, and a 26% increase of interlaminar shear strength was achieved, because of the improved fiber surface wettability and interfacial compatibility between carbon fiber and PES.

  11. Corrosion protection of ENIG surface finishing using electrochemical methods

    International Nuclear Information System (INIS)

    Bui, Q.V.; Nam, N.D.; Choi, D.H.; Lee, J.B.; Lee, C.Y.; Kar, A.; Kim, J.G.; Jung, S.B.

    2010-01-01

    Four types of thin film coating were carried out on copper for electronic materials by the electroless plating method at a pH range from 3 to 9. The coating performance was evaluated by electrochemical impedance spectroscopy and potentiodynamic polarization testing in a 3.5 wt.% NaCl solution. In addition, atomic force microscopy and X-ray diffraction were also used to analyze the coating surfaces. The electrochemical behavior of the coatings was improved using the electroless nickel plating solution of pH 5. The electroless nickel/immersion gold on the copper substrate exhibited high protective efficiency, charge transfer resistance and very low porosity, indicating an increase in corrosion resistance. Atomic force microscopy and X-ray diffraction analyses confirmed the surface uniformity and the formation of the crystalline-refined NiP {1 2 2} phase at pH 5.

  12. The Rashba-split surface state of Sb{sub 2}Te{sub 3}(0 0 0 1) and its interaction with bulk states

    Energy Technology Data Exchange (ETDEWEB)

    Seibel, Christoph; Maaß, Henriette [Experimentelle Physik VII and Röntgen Research Center for Complex Materials (RCCM), Universität Würzburg, Am Hubland, D-97074 Würzburg (Germany); Bentmann, Hendrik, E-mail: Hendrik.Bentmann@physik.uni-wuerzburg.de [Experimentelle Physik VII and Röntgen Research Center for Complex Materials (RCCM), Universität Würzburg, Am Hubland, D-97074 Würzburg (Germany); Braun, Jürgen [Department Chemie, Physikalische Chemie, Universität München, Butenandtstrasse 5-13, D-81377 München (Germany); Sakamoto, Kazuyuki [Department of Nanomaterials Science, Chiba University, Chiba 263-8522 (Japan); Arita, Masashi; Shimada, Kenya [Hiroshima Synchrotron Radiation Center, Hiroshima University, Kagamiyama 2-313, Higashi-Hiroshima 739-0046 (Japan); Minár, Jan [Department Chemie, Physikalische Chemie, Universität München, Butenandtstrasse 5-13, D-81377 München (Germany); New Technologies – Research Center, University of West Bohemia, Univerzitni 8, 306 14 Pilsen (Czech Republic); Ebert, Hubert [Department Chemie, Physikalische Chemie, Universität München, Butenandtstrasse 5-13, D-81377 München (Germany); and others

    2015-05-15

    Highlights: • We investigate a spin–orbit split surface state on the Sb{sub 2}Te{sub 3}(0 0 0 1) surface. • The spin-splitting and dispersion follow the Rashba model at small wave vectors. • At higher wave vectors the spin-splitting shows an unsual non-monotonic evolution. • The spin-polarized surface bands connect with different bulk bands at the gap edge. - Abstract: The electronic structure of the Sb{sub 2}Te{sub 3}(0 0 0 1) surface exhibits a spin–orbit split surface state in a local energy gap of the projected bulk valence band continuum. We investigate this surface state by high-resolution angle-resolved photoemission spectroscopy (ARPES), spin-resolved ARPES and relativistic one-step photoemission calculations. At low wave vectors the dispersion and spin splitting are well-captured by the predictions of the Rashba model for a two-dimensional electron system. With increasing wave vectors, however, the surface state dispersion becomes more complex and the spin splitting size exhibits an unusual non-monotonic evolution. These deviations from the Rashba model arise from the influence of bulk continuum states near the edge of the projected gap. The spin polarization of the surface state remains intact despite the coupling to bulk states.

  13. VIRTUAL EXHIBITION AND FRUITION OF ARCHAEOLOGICAL FINDS

    Directory of Open Access Journals (Sweden)

    A. M. Manferdini

    2012-09-01

    Full Text Available During the last two decades, since digital technologies have become more sophisticated in acquiring real data and building faithful copies of them, their improvements have suggested interesting applications in the field of valorisation of Historical, Cultural and Artistic Heritage, with significant consequences in the share and widespread of knowledge. But although several technologies and methodologies for 3d digitization have recently been developed and improved, the lack of a standard procedure and the costs connected to their use still doesn't encourage the systematic digital acquisition of wide collections and heritage. The aim of this paper is to show the state of the art of a project whose aim is to provide a methodology and a procedure to create digital reproductions of artefacts for Institutions called to preserve, manage and enhance the fruition of archaeological finds inside museums or through digital exhibitions. Our project’s aim is to find the most suitable procedure to digitally acquire archaeo logical artefacts that usually have small dimensions and have very complex and detailed surfaces. Within our methodology, particular attention has been paid to the use of widely shared and open-source visualization systems that enhance the involvement of the user by emphasizing three-dimensional characteristics of artefacts through virtual reality.

  14. MHC class II super-enhancer increases surface expression of HLA-DR and HLA-DQ and affects cytokine production in autoimmune vitiligo.

    Science.gov (United States)

    Cavalli, Giulio; Hayashi, Masahiro; Jin, Ying; Yorgov, Daniel; Santorico, Stephanie A; Holcomb, Cherie; Rastrou, Melinda; Erlich, Henry; Tengesdal, Isak W; Dagna, Lorenzo; Neff, C Preston; Palmer, Brent E; Spritz, Richard A; Dinarello, Charles A

    2016-02-02

    Genetic risk for autoimmunity in HLA genes is most often attributed to structural specificity resulting in presentation of self-antigens. Autoimmune vitiligo is strongly associated with the MHC class II region. Here, we fine-map vitiligo MHC class II genetic risk to three SNPs only 47 bp apart, located within a predicted super-enhancer in an intergenic region between HLA-DRB1 and HLA-DQA1, localized by a genome-wide association study of 2,853 Caucasian vitiligo patients. The super-enhancer corresponds to an expression quantitative trait locus for expression of HLA-DR and HLA-DQ RNA; we observed elevated surface expression of HLA-DR (P = 0.008) and HLA-DQ (P = 0.02) on monocytes from healthy subjects homozygous for the high-risk SNP haplotype. Unexpectedly, pathogen-stimulated peripheral blood mononuclear cells from subjects homozygous for the high-risk super-enhancer haplotype exhibited greater increase in production of IFN-γ and IL-1β than cells from subjects homozygous for the low-risk haplotype. Specifically, production of IFN-γ on stimulation of dectin-1, mannose, and Toll-like receptors with Candida albicans and Staphylococcus epidermidis was 2.5- and 2.9-fold higher in high-risk subjects than in low-risk subjects, respectively (P = 0.007 and P = 0.01). Similarly, production of IL-1β was fivefold higher in high-risk subjects than in low-risk subjects (P = 0.02). Increased production of immunostimulatory cytokines in subjects carrying the high-risk haplotype may act as an "adjuvant" during the presentation of autoantigens, tying together genetic variation in the MHC with the development of autoimmunity. This study demonstrates that for risk of autoimmune vitiligo, expression level of HLA class II molecules is as or more important than antigen specificity.

  15. O2 Plasma Etching and Antistatic Gun Surface Modifications for CNT Yarn Microelectrode Improve Sensitivity and Antifouling Properties.

    Science.gov (United States)

    Yang, Cheng; Wang, Ying; Jacobs, Christopher B; Ivanov, Ilia N; Venton, B Jill

    2017-05-16

    Carbon nanotube (CNT) based microelectrodes exhibit rapid and selective detection of neurotransmitters. While different fabrication strategies and geometries of CNT microelectrodes have been characterized, relatively little research has investigated ways to selectively enhance their electrochemical properties. In this work, we introduce two simple, reproducible, low-cost, and efficient surface modification methods for carbon nanotube yarn microelectrodes (CNTYMEs): O 2 plasma etching and antistatic gun treatment. O 2 plasma etching was performed by a microwave plasma system with oxygen gas flow and the optimized time for treatment was 1 min. The antistatic gun treatment flows ions by the electrode surface; two triggers of the antistatic gun was the optimized number on the CNTYME surface. Current for dopamine at CNTYMEs increased 3-fold after O 2 plasma etching and 4-fold after antistatic gun treatment. When the two treatments were combined, the current increased 12-fold, showing the two effects are due to independent mechanisms that tune the surface properties. O 2 plasma etching increased the sensitivity due to increased surface oxygen content but did not affect surface roughness while the antistatic gun treatment increased surface roughness but not oxygen content. The effect of tissue fouling on CNT yarns was studied for the first time, and the relatively hydrophilic surface after O 2 plasma etching provided better resistance to fouling than unmodified or antistatic gun treated CNTYMEs. Overall, O 2 plasma etching and antistatic gun treatment improve the sensitivity of CNTYMEs by different mechanisms, providing the possibility to tune the CNTYME surface and enhance sensitivity.

  16. Mechanochemical activation and patterning of an adhesive surface toward nanoparticle deposition.

    Science.gov (United States)

    Baytekin, H Tarik; Baytekin, Bilge; Huda, Sabil; Yavuz, Zelal; Grzybowski, Bartosz A

    2015-02-11

    Mechanical pulling of adhesive tape creates radicals on the tape's surface. These radicals are capable of reducing metal salts to the corresponding metal nanoparticles. In this way, the mechanically activated tape can be decorated with various types of nanoparticles, including Au, Ag, Pd, or Cu. While retaining their mechanical properties and remaining "sticky," the tapes can exhibit new properties derived from the presence of metal nanoparticles (e.g., bacteriostaticity, increased electrical conductivity). They can also be patterned with nanoparticles only at selective locations of mechanical activation.

  17. Increased spring flooding of agricultural fields will exhibit altered production of greenhouse gases

    Science.gov (United States)

    Paul, R. F.; Smith, C. M.; Smyth, E. M.; Kantola, I. B.; DeLucia, E. H.

    2013-12-01

    The U.S. Corn Belt currently is a net source of carbon dioxide and nitrous oxide to the atmosphere, but is also a sink of methane. Among the proposed effects of climate change in the North American Midwest region is an increase in the frequency and duration of spring flooding events. This would cause ponding in fields which may change the greenhouse gas balance of the region, especially by providing a suitable anoxic environment for the proliferation of methanogens, increasing methane emissions. To determine whether methanogenesis occurs in flooded agricultural soils of the Midwest and how other gas fluxes are affected, we installed collars into the ground of a research field located in central Illinois. The control group was maintained at the same conditions as the surrounding field. Two groups of collars were sustained with water flooding the headspaces via a drip irrigation system; one treatment was analyzed for gas fluxes of CH4, N2O, and CO2 evolving from the collars, and a separate treatment of flooded collars was used for soil sampling. Comparing flooded soils versus control we measured reduced N2O fluxes (-3.12 x 10-6 × 6.8 x 10-7 g N m-2 min-1), reduced CO2 fluxes (-6.13 x 10-3 × 9.3 x 10-4 g CO2 m-2 min-1), and increased methane fluxes (+2.72 x 10-6 × 5.8 x 10-7 g CH4 m-2 min-1). After only one week of treatment the flooded soils switched from being sinks to sources of methane, which continued across the duration of the experiment. These preliminary results indicate that methanogenesis occurs in flooded agricultural fields, and suggest including regional modeling into further study. Although the global warming potential of methane is 25 times greater than CO2, our measured rates of methane production were compensated by reductions in nitrous oxide and CO2 fluxes, reducing the total 100-year horizon global warming potential of the flooded soils we studied by 64.8%. This indicates that accounting for more frequent seasonal ponding would significantly

  18. The Eugenides Foundation Interactive Exhibition of Science and Technology

    Science.gov (United States)

    Kontogiannis, Ioannis

    2010-01-01

    The Interactive Exhibition of Science and Technology is installed in an area of 1200 m2 at the Eugenides Foundation. 65 interactive exhibits, designed by the "Cites des Science et de l' Industrie" are organised in themes, stimulate the visitors' mind and provoke scientific thinking. Parallel activities take place inside the exhibition, such as live science demonstrations, performed by young scientists. Extra material such as news bulletins (short news, science comics and portraits), educational paths and treasure-hunting based games, all available online as well, are prepared on a monthly basis and provided along with the visit to the exhibition. Through these exhibits and activities, scientific facts are made simple and easy to comprehend using modern presentation tools. We present details on how this exhibition acts complementary to the science education provided by schools, making it a highly sophisticated educational tool.

  19. Plasma-surface interactions

    International Nuclear Information System (INIS)

    Goeckner, M J; Nelson, C T; Sant, S P; Jindal, A K; Joseph, E A; Zhou, B S; Padron-Wells, G; Jarvis, B; Pierce, R; Overzet, L J

    2008-01-01

    Materials processing is at a crossroads. Currently a large fraction of industrially viable materials processing is via plasmas. Until recently it has been economical to just examine the influence the plasma properties on the desired surface processes and through this ultimately optimize manufacturing. For example, it is well known that the surface processes (etch or deposition), occur in the top few mono-layers of the surface. Thus, in film growth one requires that molecules from the gas-phase land and bond on the surface. However as processing has reached the nano-scale, development of viable processes has become more and more difficult. In part, this is because of all of the free parameters that exist in plasmas. To overcome this economic issue, tool vendors and semiconductor companies have turned to complex computational models of processing plasmas. For those models to work, one requires a through understanding of all of the gas-phase and surface-phase processes that are exhibited in plasmas. Unfortunately, these processes, particularly those at the surface, are not well understood. In this article we describe a viable model of the surface-phase based on cross sections for processes that occur. While originally developed of fluorocarbon systems, the model also appears to be applicable to hydrocarbon systems.

  20. Plasma-surface interactions

    Energy Technology Data Exchange (ETDEWEB)

    Goeckner, M J; Nelson, C T; Sant, S P; Jindal, A K; Joseph, E A; Zhou, B S; Padron-Wells, G; Jarvis, B; Pierce, R; Overzet, L J [Department of Electrical Engineering, University of Texas at Dallas (United States)], E-mail: goeckner@utdallas.edu

    2008-10-01

    Materials processing is at a crossroads. Currently a large fraction of industrially viable materials processing is via plasmas. Until recently it has been economical to just examine the influence the plasma properties on the desired surface processes and through this ultimately optimize manufacturing. For example, it is well known that the surface processes (etch or deposition), occur in the top few mono-layers of the surface. Thus, in film growth one requires that molecules from the gas-phase land and bond on the surface. However as processing has reached the nano-scale, development of viable processes has become more and more difficult. In part, this is because of all of the free parameters that exist in plasmas. To overcome this economic issue, tool vendors and semiconductor companies have turned to complex computational models of processing plasmas. For those models to work, one requires a through understanding of all of the gas-phase and surface-phase processes that are exhibited in plasmas. Unfortunately, these processes, particularly those at the surface, are not well understood. In this article we describe a viable model of the surface-phase based on cross sections for processes that occur. While originally developed of fluorocarbon systems, the model also appears to be applicable to hydrocarbon systems.

  1. Surface enhanced Raman scattering

    CERN Document Server

    Furtak, Thomas

    1982-01-01

    In the course of the development of surface science, advances have been identified with the introduction of new diagnostic probes for analytical characterization of the adsorbates and microscopic structure of surfaces and interfaces. Among the most recently de­ veloped techniques, and one around which a storm of controversy has developed, is what has now been earmarked as surface enhanced Raman scattering (SERS). Within this phenomenon, molecules adsorbed onto metal surfaces under certain conditions exhibit an anomalously large interaction cross section for the Raman effect. This makes it possible to observe the detailed vibrational signature of the adsorbate in the ambient phase with an energy resolution much higher than that which is presently available in electron energy loss spectroscopy and when the surface is in contact with a much larger amount of material than that which can be tolerated in infrared absorption experiments. The ability to perform vibrational spectroscopy under these conditions would l...

  2. Evolution of atomic-scale surface structures during ion bombardment: A fractal simulation

    International Nuclear Information System (INIS)

    Shaheen, M.A.; Ruzic, D.N.

    1993-01-01

    Surfaces of interest in microelectronics have been shown to exhibit fractal topographies on the atomic scale. A model utilizing self-similar fractals to simulate surface roughness has been added to the ion bombardment code TRIM. The model has successfully predicted experimental sputtering yields of low energy (less then 1000 eV) Ar on Si and D on C using experimentally determined fractal dimensions. Under ion bombardment the fractal surface structures evolve as the atoms in the collision cascade are displaced or sputtered. These atoms have been tracked and the evolution of the surface in steps of one monolayer of flux has been determined. The Ar--Si system has been studied for incidence energies of 100 and 500 eV, and incidence angles of 0 degree, 30 degree, and 60 degree. As expected, normally incident ion bombardment tends to reduce the roughness of the surface, whereas large angle ion bombardment increases the degree of surface roughness. Of particular interest though, the surfaces are still locally self-similar fractals after ion bombardment and a steady state fractal dimension is reached, except at large angles of incidence

  3. Synthesis of thermoresponsive poly(N-isopropylacrylamide) brush on silicon wafer surface via atom transfer radical polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Turan, Eylem; Demirci, Serkan [Department of Chemistry, Faculty of Art and Science, Gazi University, 06500 Besevler, Ankara (Turkey); Caykara, Tuncer, E-mail: caykara@gazi.edu.t [Department of Chemistry, Faculty of Art and Science, Gazi University, 06500 Besevler, Ankara (Turkey)

    2010-08-31

    Thermoresponsive poly(N-isopropylacrylamide) [poly(NIPAM)] brush on silicon wafer surface was prepared by combining the self-assembled monolayer of initiator and atom transfer radical polymerization (ATRP). The resulting polymer brush was characterized by in situ reflectance Fourier transform infrared spectroscopy, atomic force microscopy and ellipsometry techniques. Gel permeation chromatography determination of the number-average molecular weight and polydispersity index of the brush detached from the silicon wafer surface suggested that the surface-initiated ATRP method can provide relatively homogeneous polymer brush. Contact angle measurements exhibited a two-stage increase upon heating over the board temperature range 25-45 {sup o}C, which is in contrast to the fact that free poly(NIPAM) homopolymer in aqueous solution exhibits a phase transition at ca. 34 {sup o}C within a narrow temperature range. The first de-wetting transition takes place at 27 {sup o}C, which can be tentatively attributed to the n-cluster induced collapse of the inner region of poly(NIPAM) brush close to the silicon surface; the second de-wetting transition occurs at 38 {sup o}C, which can be attributed to the outer region of poly(NIPAM) brush, possessing much lower chain density compared to that of the inner part.

  4. Surface rheology and interface stability.

    Energy Technology Data Exchange (ETDEWEB)

    Yaklin, Melissa A.; Cote, Raymond O.; Moffat, Harry K.; Grillet, Anne Mary; Walker, Lynn; Koehler, Timothy P.; Reichert, Matthew D. (Carnegie Mellon University, Pittsburgh, PA); Castaneda, Jaime N.; Mondy, Lisa Ann; Brooks, Carlton, F.

    2010-11-01

    We have developed a mature laboratory at Sandia to measure interfacial rheology, using a combination of home-built, commercially available, and customized commercial tools. An Interfacial Shear Rheometer (KSV ISR-400) was modified and the software improved to increase sensitivity and reliability. Another shear rheometer, a TA Instruments AR-G2, was equipped with a du Nouey ring, bicone geometry, and a double wall ring. These interfacial attachments were compared to each other and to the ISR. The best results with the AR-G2 were obtained with the du Nouey ring. A Micro-Interfacial Rheometer (MIR) was developed in house to obtain the much higher sensitivity given by a smaller probe. However, it was found to be difficult to apply this technique for highly elastic surfaces. Interfaces also exhibit dilatational rheology when the interface changes area, such as occurs when bubbles grow or shrink. To measure this rheological response we developed a Surface Dilatational Rheometer (SDR), in which changes in surface tension with surface area are measured during the oscillation of the volume of a pendant drop or bubble. All instruments were tested with various surfactant solutions to determine the limitations of each. In addition, foaming capability and foam stability were tested and compared with the rheology data. It was found that there was no clear correlation of surface rheology with foaming/defoaming with different types of surfactants, but, within a family of surfactants, rheology could predict the foam stability. Diffusion of surfactants to the interface and the behavior of polyelectrolytes were two subjects studied with the new equipment. Finally, surface rheological terms were added to a finite element Navier-Stokes solver and preliminary testing of the code completed. Recommendations for improved implementation were given. When completed we plan to use the computations to better interpret the experimental data and account for the effects of the underlying bulk

  5. Asian Dust Weather Categorization with Satellite and Surface Observations

    Science.gov (United States)

    Lin, Tang-Huang; Hsu, N. Christina; Tsay, Si-Chee; Huang, Shih-Jen

    2011-01-01

    This study categorizes various dust weather types by means of satellite remote sensing over central Asia. Airborne dust particles can be identified by satellite remote sensing because of the different optical properties exhibited by coarse and fine particles (i.e. varying particle sizes). If a correlation can be established between the retrieved aerosol optical properties and surface visibility, the intensity of dust weather can be more effectively and consistently discerned using satellite rather than surface observations. In this article, datasets consisting of collocated products from Moderate Resolution Imaging Spectroradiometer Aqua and surface measurements are analysed. The results indicate an exponential relationship between the surface visibility and the satellite-retrieved aerosol optical depth, which is subsequently used to categorize the dust weather. The satellite-derived spatial frequency distributions in the dust weather types are consistent with China s weather station reports during 2003, indicating that dust weather classification using satellite data is highly feasible. Although the period during the springtime from 2004 to 2007 may be not sufficient for statistical significance, our results reveal an increasing tendency in both intensity and frequency of dust weather over central Asia during this time period.

  6. Mycorrhiza Symbiosis Increases the Surface for Sunlight Capture in Medicago truncatula for Better Photosynthetic Production

    Science.gov (United States)

    Adolfsson, Lisa; Keresztes, Áron; Uddling, Johan; Schoefs, Benoît; Spetea, Cornelia

    2015-01-01

    Arbuscular mycorrhizal (AM) fungi play a prominent role in plant nutrition by supplying mineral nutrients, particularly inorganic phosphate (Pi), and also constitute an important carbon sink. AM stimulates plant growth and development, but the underlying mechanisms are not well understood. In this study, Medicago truncatula plants were grown with Rhizophagus irregularis BEG141 inoculum (AM), mock inoculum (control) or with Pi fertilization. We hypothesized that AM stimulates plant growth through either modifications of leaf anatomy or photosynthetic activity per leaf area. We investigated whether these effects are shared with Pi fertilization, and also assessed the relationship between levels of AM colonization and these effects. We found that increased Pi supply by either mycorrhization or fertilization led to improved shoot growth associated with increased nitrogen uptake and carbon assimilation. Both mycorrhized and Pi-fertilized plants had more and longer branches with larger and thicker leaves than the control plants, resulting in an increased photosynthetically active area. AM-specific effects were earlier appearance of the first growth axes and increased number of chloroplasts per cell section, since they were not induced by Pi fertilization. Photosynthetic activity per leaf area remained the same regardless of type of treatment. In conclusion, the increase in growth of mycorrhized and Pi-fertilized Medicago truncatula plants is linked to an increase in the surface for sunlight capture, hence increasing their photosynthetic production, rather than to an increase in the photosynthetic activity per leaf area. PMID:25615871

  7. Mycorrhiza symbiosis increases the surface for sunlight capture in Medicago truncatula for better photosynthetic production.

    Directory of Open Access Journals (Sweden)

    Lisa Adolfsson

    Full Text Available Arbuscular mycorrhizal (AM fungi play a prominent role in plant nutrition by supplying mineral nutrients, particularly inorganic phosphate (Pi, and also constitute an important carbon sink. AM stimulates plant growth and development, but the underlying mechanisms are not well understood. In this study, Medicago truncatula plants were grown with Rhizophagus irregularis BEG141 inoculum (AM, mock inoculum (control or with P(i fertilization. We hypothesized that AM stimulates plant growth through either modifications of leaf anatomy or photosynthetic activity per leaf area. We investigated whether these effects are shared with P(i fertilization, and also assessed the relationship between levels of AM colonization and these effects. We found that increased P(i supply by either mycorrhization or fertilization led to improved shoot growth associated with increased nitrogen uptake and carbon assimilation. Both mycorrhized and P(i-fertilized plants had more and longer branches with larger and thicker leaves than the control plants, resulting in an increased photosynthetically active area. AM-specific effects were earlier appearance of the first growth axes and increased number of chloroplasts per cell section, since they were not induced by P(i fertilization. Photosynthetic activity per leaf area remained the same regardless of type of treatment. In conclusion, the increase in growth of mycorrhized and P(i-fertilized Medicago truncatula plants is linked to an increase in the surface for sunlight capture, hence increasing their photosynthetic production, rather than to an increase in the photosynthetic activity per leaf area.

  8. Impacts of Climate Change on Surface Ozone and Intercontinental Ozone Pollution: A Multi-Model Study

    Science.gov (United States)

    Doherty, R. M.; Wild, O.; Shindell, D. T.; Zeng, G.; MacKenzie, I. A.; Collins, W. J.; Fiore, A. M.; Stevenson, D. S.; Dentener, F. J.; Schultz, M. G.; hide

    2013-01-01

    The impact of climate change between 2000 and 2095 SRES A2 climates on surface ozone (O)3 and on O3 source-receptor (S-R) relationships is quantified using three coupled climate-chemistry models (CCMs). The CCMs exhibit considerable variability in the spatial extent and location of surface O3 increases that occur within parts of high NOx emission source regions (up to 6 ppbv in the annual average and up to 14 ppbv in the season of maximum O3). In these source regions, all three CCMs show a positive relationship between surface O3 change and temperature change. Sensitivity simulations show that a combination of three individual chemical processes-(i) enhanced PAN decomposition, (ii) higher water vapor concentrations, and (iii) enhanced isoprene emission-largely reproduces the global spatial pattern of annual-mean surface O3 response due to climate change (R2 = 0.52). Changes in climate are found to exert a stronger control on the annual-mean surface O3 response through changes in climate-sensitive O3 chemistry than through changes in transport as evaluated from idealized CO-like tracer concentrations. All three CCMs exhibit a similar spatial pattern of annual-mean surface O3 change to 20% regional O3 precursor emission reductions under future climate compared to the same emission reductions applied under present-day climate. The surface O3 response to emission reductions is larger over the source region and smaller downwind in the future than under present-day conditions. All three CCMs show areas within Europe where regional emission reductions larger than 20% are required to compensate climate change impacts on annual-mean surface O3.

  9. Loss of FliL alters Proteus mirabilis surface sensing and temperature-dependent swarming.

    Science.gov (United States)

    Lee, Yi-Ying; Belas, Robert

    2015-01-01

    Proteus mirabilis is a dimorphic motile bacterium well known for its flagellum-dependent swarming motility over surfaces. In liquid, P. mirabilis cells are 1.5- to 2.0-μm swimmer cells with 4 to 6 flagella. When P. mirabilis encounters a solid surface, where flagellar rotation is limited, swimmer cells differentiate into elongated (10- to 80-μm), highly flagellated swarmer cells. In order for P. mirabilis to swarm, it first needs to detect a surface. The ubiquitous but functionally enigmatic flagellar basal body protein FliL is involved in P. mirabilis surface sensing. Previous studies have suggested that FliL is essential for swarming through its involvement in viscosity-dependent monitoring of flagellar rotation. In this study, we constructed and characterized ΔfliL mutants of P. mirabilis and Escherichia coli. Unexpectedly and unlike other fliL mutants, both P. mirabilis and E. coli ΔfliL cells swarm (Swr(+)). Further analysis revealed that P. mirabilis ΔfliL cells also exhibit an alteration in their ability to sense a surface: e.g., ΔfliL P. mirabilis cells swarm precociously over surfaces with low viscosity that normally impede wild-type swarming. Precocious swarming is due to an increase in the number of elongated swarmer cells in the population. Loss of fliL also results in an inhibition of swarming at <30°C. E. coli ΔfliL cells also exhibit temperature-sensitive swarming. These results suggest an involvement of FliL in the energetics and function of the flagellar motor. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. The Role of Ru Redox in pH-Dependent Oxygen Evolution on Rutile Ruthenium Dioxide Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Stoerzinger, Kelsey A.; Rao, Reshma R.; Wang, Xiao Renshaw; Hong, Wesley T.; Rouleau, Christopher M.; Shao-Horn, Yang

    2017-05-01

    Rutile RuO2 is known to exhibit high catalytic activity for the oxygen evolution reaction (OER) and large pseudocapacitance associated with redox of surface Ru, however the mechanistic link between these properties and the role of pH is yet to be understood. Here we report that the OER activities of the (101), (001) and (111) RuO2 surfaces were found to increase while the potential of a pseudocapacitive feature just prior to OER shifted to lower potentials (“super-Nernstian” shift) with increasing pH on the reversible hydrogen electrode (RHE) scale. This behavior is in contrast to the (100) and (110) surfaces that have pH-independent Ru redox and OER activity. The link in catalytic and pseudocapacitive behavior illustrates the importance of this redox feature in generating active sites, building new mechanistic understanding of the OER.

  11. Fermi surfaces in Kondo insulators

    Science.gov (United States)

    Liu, Hsu; Hartstein, Máté; Wallace, Gregory J.; Davies, Alexander J.; Ciomaga Hatnean, Monica; Johannes, Michelle D.; Shitsevalova, Natalya; Balakrishnan, Geetha; Sebastian, Suchitra E.

    2018-04-01

    We report magnetic quantum oscillations measured using torque magnetisation in the Kondo insulator YbB12 and discuss the potential origin of the underlying Fermi surface. Observed quantum oscillations as well as complementary quantities such as a finite linear specific heat capacity in YbB12 exhibit similarities with the Kondo insulator SmB6, yet also crucial differences. Small heavy Fermi sections are observed in YbB12 with similarities to the neighbouring heavy fermion semimetallic Fermi surface, in contrast to large light Fermi surface sections in SmB6 which are more similar to the conduction electron Fermi surface. A rich spectrum of theoretical models is suggested to explain the origin across different Kondo insulating families of a bulk Fermi surface potentially from novel itinerant quasiparticles that couple to magnetic fields, yet do not couple to weak DC electric fields.

  12. Topological surface states scattering in antimony

    KAUST Repository

    Narayan, Awadhesh

    2012-11-05

    In this work we study the topologically protected states of the Sb(111) surface by using ab initio transport theory. In the presence of a strong surface perturbation we obtain standing-wave states resulting from the superposition of spin-polarized surface states. By Fourier analysis, we identify the underlying two dimensional scattering processes and the spin texture. We find evidence of resonant transmission across surface barriers at quantum well state energies and evaluate their lifetimes. Our results are in excellent agreement with experimental findings. We also show that despite the presence of a step edge along a different high-symmetry direction, the surface states exhibit unperturbed transmission around the Fermi energy for states with near to normal incidence. © 2012 American Physical Society.

  13. Topological surface states scattering in antimony

    KAUST Repository

    Narayan, Awadhesh; Rungger, Ivan; Sanvito, Stefano

    2012-01-01

    In this work we study the topologically protected states of the Sb(111) surface by using ab initio transport theory. In the presence of a strong surface perturbation we obtain standing-wave states resulting from the superposition of spin-polarized surface states. By Fourier analysis, we identify the underlying two dimensional scattering processes and the spin texture. We find evidence of resonant transmission across surface barriers at quantum well state energies and evaluate their lifetimes. Our results are in excellent agreement with experimental findings. We also show that despite the presence of a step edge along a different high-symmetry direction, the surface states exhibit unperturbed transmission around the Fermi energy for states with near to normal incidence. © 2012 American Physical Society.

  14. Travelling CERN Exhibition ''When Energy Becomes Matter''

    International Nuclear Information System (INIS)

    2001-01-01

    Full text: The European Laboratory for Nuclear Research (CERN) and the H. Niewodniczanski Institute of Nuclear Physics together with the Institute of Physics of the Jagiellonian University and the University of Mining and Metallurgy, and under the auspices of the Polish National Atomic Energy Agency organized in the Museum of Nature in Cracow from October 16 till December 16, 2000 the exhibition ''When Energy Becomes Matter''. The Office of the ''Festival Cracow 2000'' was the main sponsor of that event. The exhibition was a part of the F estival Cracow 2000'' called ''Festival of Youngsters Cracow 2000''. Invitations, posters and information leaflets were sent to more than 3000 schools in southern Poland. The exhibition was divided into four specially designed quadrants. In the first the visitor was informed what kind of scales are in use to describe the Universe and the atom. The second introduced elementary particles via the cosmic ray demonstrations. Particle acceleration was demonstrated with the help of a TV set. The third segment was devoted to the Large Hadron Collider and its experiments: CMS, ATLAS, ALICE and LHCb. The last segment was an attempt to explain what are quarks, leptons and intermediate bosons. In addition it was also explained what is antimatter and why symmetry is broken in Nature. In one of the rooms we arranged the cinema where five movies was continuously presented. Thanks to the Cracow TV it was possible to prepare Polish translations of the films: B ack to creation , P owers of ten , L HC - time machine , S tars underground , and G eneva event . Another attraction of the exhibition was the Internet room equipped with the help of Polish Telecommunication. The exhibition was open seven days per week from 10 to 17 h. During the working days every 20 minutes a new group of about 25-30 people was visiting the exhibition. Each group was guided by students and PhD students from our Institute, Jagiellonian University and University of Mining

  15. A high resolution photoemission study of surface core-level shifts in clean and oxygen-covered Ir(2 1 0) surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Gladys, M.J.; Ermanoski, I.; Jackson, G.; Quinton, J.S.; Rowe, J.E.; Madey, T.E. E-mail: madey@physics.rutgers.edu

    2004-04-01

    High resolution soft X-ray photoemission electron spectroscopy (SXPS), using synchrotron radiation, is employed to investigate 4f core-level features of four differently-prepared Ir(2 1 0) surfaces: clean planar, oxygen-covered planar, oxygen-induced faceted, and clean faceted surfaces. Surface and bulk peak identifications are supported by measurements at different photon energies (thus probing different electron escape depths) and variable emission angles. Iridium 4f{sub 7/2} photoemission spectra are fitted with Doniach-Sunjic lineshapes. The surface components are identified with core levels positioned at lower binding energies than the bulk components, in contrast to previous reports of binding energy inversion on Ir(1 0 0) (1x1) and (5x1) surfaces. For clean planar Ir(2 1 0) three surface Ir 4f{sub 7/2} features are observed with core-level shifts of -765, -529, and -281 meV, with respect to the bulk; these are associated with the first, second and third layers of atoms, respectively, for atomically rough Ir(2 1 0). Adsorption of oxygen onto the planar Ir(2 1 0) surface is found to cause a suppression and shift of the surface features to higher binding energies. Annealing at T{>=}600 K in oxygen produces a faceted surface as verified by low energy electron diffraction (LEED). A comparison of planar and faceted oxygen-covered surfaces reveals minor differences in the normal emission SXPS spectra, while grazing emission spectra exhibit differences. The SXPS spectrum of the clean, faceted Ir(2 1 0) exhibits small differences in comparison to the clean planar case, with surface features having binding energy shifts of -710, -450, and -230 meV.

  16. Exhibition: Dialogue between Science and religion

    CERN Multimedia

    2001-01-01

    Can the theory of the Big Bang reached by physicists and the concept of creation beloved of religion ever be reconciled? The two approaches have at least one point in common: they do not provide a final answer to the mysteries of the birth of the Universe. And this means that dialogue is alays possible between the two. It is to show the potential of such an exchange that Geneva's Société Evangélique organization is opening an exhibition under the title 'Big Bang and Creation', at the Planète Charmilles shopping centre, to run from 19 to 30 March. View of the 'Big Bang and Creation' exhibition. The exhibition is divided into three sections, showing the views of the scientist and those of the believer without setting them up in opposition to one another. In the first section, under a representation of the vault of heaven, the visitor will discover the different ideas explaining the birth of the Universe: Genesis and the Big Bang, and the different dominant theories ...

  17. Study of RBC Efficiency in Aniline Removal by Increasing Contactor Specific Surface

    Directory of Open Access Journals (Sweden)

    Seyed Hossein Mousavi Aliani

    2011-01-01

    Full Text Available Aniline is a first type amino aromatic compound and has various applications in different pharmaceutical, synthetic dye, plastic, and petrochemical industries. It is poisonous and its discharge into the environment causes serious hazards that warrant it removal by an efficient treatment process.  In this study, the efficiency of rotating biological contactors in aniline removal was investigated using four 3-liter parallel systems (in two series. Two reactors in the first series had 27 disks. The second series had 14 discs with packings in each reactor with the same specific surfaces as compared to the first system.Aniline concentrations from 100 to 1200 mg/L and hydraulic loading rates from 1.57 to 6.28 L/m2.d were used throughout the study period in two treatments. The effect of disc rotation speed on system efficiency was also investigated. The results indicated that COD removal efficiency decreased with increasing hydraulic loading rate but increased with increasing disc speed from 5 to 15 rpm. The best removal efficiencies of 88 and 86 percent for RBCI and RBCII, respectively, were obtained for an aniline concentration of 400 mg/L, a hydraulic loading rate of 1.57 L/m2.d, and a disc speed of 15 rpm. Based on the results, although both systems yield almost equal efficiencies, the start-up period was shorter in RBCII with a clearer effluent due to the lower quantity of suspended microorganisms in the reactor than that in RBCI. Use of packing may decrease energy consumption for disc rotation due to the overall weight reduction of the system.

  18. Mobile exhibition in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1960-04-15

    Since January this year, a mobile atomic energy exhibition has been touring the principal cities of Mexico. In organizing this exhibition, the National Nuclear Energy Commission of Mexico was assisted by the International Atomic Energy Agency which has placed its second mobile radioisotope laboratory at the disposal of the Mexican authorities. In many States of the Republic, the visit of the mobile laboratory has given a powerful impetus to atomic training and research. Universities have made use of the laboratory for the training of young scientists in the basic isotope techniques. As a sequel to the work initiated with its aid, some universities are planning to start regular training courses in this field. The laboratory, which is a gift to the Agency from the United States, has been put to its first assignment in Mexico. It will shortly be sent to Argentina for a period of six months for use in training courses. IAEA's first mobile radioisotope unit, also donated by the United States, has been used for training purposes in Austria, the Federal Republic of Germany, Greece and Yugoslavia, and has now been sent to the Far East

  19. Mobile exhibition in Mexico

    International Nuclear Information System (INIS)

    1960-01-01

    Since January this year, a mobile atomic energy exhibition has been touring the principal cities of Mexico. In organizing this exhibition, the National Nuclear Energy Commission of Mexico was assisted by the International Atomic Energy Agency which has placed its second mobile radioisotope laboratory at the disposal of the Mexican authorities. In many States of the Republic, the visit of the mobile laboratory has given a powerful impetus to atomic training and research. Universities have made use of the laboratory for the training of young scientists in the basic isotope techniques. As a sequel to the work initiated with its aid, some universities are planning to start regular training courses in this field. The laboratory, which is a gift to the Agency from the United States, has been put to its first assignment in Mexico. It will shortly be sent to Argentina for a period of six months for use in training courses. IAEA's first mobile radioisotope unit, also donated by the United States, has been used for training purposes in Austria, the Federal Republic of Germany, Greece and Yugoslavia, and has now been sent to the Far East

  20. Enhanced protein retention on poly(caprolactone) via surface initiated polymerization of acrylamide

    International Nuclear Information System (INIS)

    Ma, Yuhao; Cai, Mengtan; He, Liu; Luo, Xianglin

    2016-01-01

    Graphical abstract: - Highlights: • Dense package of poly(acrylamide) on poly(caprolactone) surface was achieved by surface-initiated atom transfer radical polymerization. • Poly(acrylamide) grafted surface exhibited high protein retention ability. • Loaded protein was resistant to detachment and maintained its structure without denaturation. - Abstract: To enhance the biocompatibility or extend the biomedical application of poly(caprolactone) (PCL), protein retention on PCL surface is often required. In this study, poly(acrylamide) (PAAm) brushes were grown from PCL surface via surface-initiated atom transfer radical polymerization (SI-ATRP) and served as a protein-capturing platform. Grafted PAAm was densely packed on surface and exhibited superior protein retention ability. Captured protein was found to be resistant to washing under detergent environment. Furthermore, protein structure after being captured was investigated by circular dichroism (CD) spectroscopy, and the CD spectra verified that secondary structure of captured proteins was maintained, indicating no denaturation of protein happened for retention process.

  1. Rapid temperature increase near the anode and cathode in the afterglow of a pulsed positive streamer discharge

    Science.gov (United States)

    Ono, Ryo

    2018-06-01

    The spatiotemporal evolution of the temperature in the afterglow of point-to-plane, pulsed positive streamer discharge was measured near the anode tip and cathode surface using laser-induced predissociation fluorescence of OH radicals. The temperature exhibited a rapid increase and displayed a steep spatial gradient after a discharge pulse. The rate of temperature rise reached 84 K μs‑1 at mm, where z represents the distance from the anode tip. The temperature rise was much faster than in the middle of the gap; it was only 2.8 K μs‑1 at mm. The temperature reached 1700 K near the anode tip at s and 1500 K near the cathode surface at s, where t represents the postdischarge time. The spatial gradient reached 1280 K mm‑1 near the anode tip at s. The mechanism responsible for the rapid temperature increase was discussed, including rapid heating of the gas in the early postdischarge phase (s), and vibration-to-translation energy transfer in the later postdischarge phase (s). The high temperatures near the anode tip and cathode surface are particularly important for the ignition of combustible mixtures and for surface treatments, including solid-surface treatments, water treatments, and plasma medicine using pulsed streamer discharges.

  2. CERN exhibition attracts over 100,000 visitors in Belgrade

    CERN Multimedia

    Antonella Del Rosso

    2012-01-01

    “This must be an 'all-time record',” says Ray Lewis, CERN travelling exhibition manager. “In all my time with the various permanent and travelling exhibitions that have taken place locally and within our Member States I have never experienced such figures.”   Zarko Obradovic (left), Serbian Minister of Education, Science and Technology, and Rolf Heuer (right), CERN Director-General, at the CERN travelling exhibition in Belgrade. Indeed, in approximately 20 days of exhibition time about 120,000 people, mainly school visiters and the general public, visited the 100 m2 CERN mini-exhibition. It was set up in the centre of Belgrade in October, in association with the meeting of the Restricted European Committee for Future Accelerators (RECFA). After attending the RECFA meeting, CERN's Director-General Rofl Heuer opened the CERN exhibition on the evening of 19 October. Lectures about CERN were held every afternoon, and two public de...

  3. Designing museum exhibits that facilitate visitor reflection and discussion

    DEFF Research Database (Denmark)

    Skydsgaard, Morten Arnika; Andersen, Hanne Møller; King, Heather

    2016-01-01

    This paper explores how four design principles (curiosity, challenge, narratives and participation) facilitate reflection and discussion among young visitors in the issues-based exhibition Dear, Difficult Body. The investigation is based on a mixed-method approach combining questionnaire and inte......This paper explores how four design principles (curiosity, challenge, narratives and participation) facilitate reflection and discussion among young visitors in the issues-based exhibition Dear, Difficult Body. The investigation is based on a mixed-method approach combining questionnaire...... and interview data. The implementation of design principles resulted in a variety of exhibits which variously prompted reflection and discussion on the part of visitors. Exhibits with narratives, for example, here defined as both personal and expert narratives, were found to be effective in facilitating...... personal reflection but also prompted discussion. Participation, defined as including both physical interaction with exhibits, and dialogic interaction between visitors, facilitated the sharing of ideas and feelings between visitors. Exhibits with elements of curiosity and challenge were found to attract...

  4. Exhibits in libraries a practical guide

    CERN Document Server

    Brown, Mary E

    2005-01-01

    "Ccomprehensive...detailed"--Booklist; "thoroughly reseached...highly recommended"--Journal of Access Services. Library exhibits are more than entertainment for patrons. They can inspire and educate, stimulate an interest that can be explored in a book, or attract visitors who otherwise wouldn't stop by. Displays are also an opportunity for a library to put its creative foot forward or help patrons navigate the facility itself. This comprehensive "how-to" includes everything a librarian or staff member needs to know to put on an exhibit, from hatching ideas to evaluating the end result. Illustrations and photographs show practical methods of planning, labeling and displaying.

  5. Probing Anisotropic Surface Properties of Molybdenite by Direct Force Measurements.

    Science.gov (United States)

    Lu, Zhenzhen; Liu, Qingxia; Xu, Zhenghe; Zeng, Hongbo

    2015-10-27

    Probing anisotropic surface properties of layer-type mineral is fundamentally important in understanding its surface charge and wettability for a variety of applications. In this study, the surface properties of the face and the edge surfaces of natural molybdenite (MoS2) were investigated by direct surface force measurements using atomic force microscope (AFM). The interaction forces between the AFM tip (Si3N4) and face or edge surface of molybdenite were measured in 10 mM NaCl solutions at various pHs. The force profiles were well-fitted with classical DLVO (Derjaguin-Landau-Verwey-Overbeek) theory to determine the surface potentials of the face and the edge surfaces of molybdenite. The surface potentials of both the face and edge surfaces become more negative with increasing pH. At neutral and alkaline conditions, the edge surface exhibits more negative surface potential than the face surface, which is possibly due to molybdate and hydromolybdate ions on the edge surface. The point of zero charge (PZC) of the edge surface was determined around pH 3 while PZC of the face surface was not observed in the range of pH 3-11. The interaction forces between octadecyltrichlorosilane-treated AFM tip (OTS-tip) and face or edge surface of molybdenite were also measured at various pHs to study the wettability of molybdenite surfaces. An attractive force between the OTS-tip and the face surface was detected. The force profiles were well-fitted by considering DLVO forces and additional hydrophobic force. Our results suggest the hydrophobic feature of the face surface of molybdenite. In contrast, no attractive force between the OTS-tip and the edge surface was detected. This is the first study in directly measuring surface charge and wettability of the pristine face and edge surfaces of molybdenite through surface force measurements.

  6. Forced synchronization of large-scale circulation to increase predictability of surface states

    Science.gov (United States)

    Shen, Mao-Lin; Keenlyside, Noel; Selten, Frank; Wiegerinck, Wim; Duane, Gregory

    2016-04-01

    Numerical models are key tools in the projection of the future climate change. The lack of perfect initial condition and perfect knowledge of the laws of physics, as well as inherent chaotic behavior limit predictions. Conceptually, the atmospheric variables can be decomposed into a predictable component (signal) and an unpredictable component (noise). In ensemble prediction the anomaly of ensemble mean is regarded as the signal and the ensemble spread the noise. Naturally the prediction skill will be higher if the signal-to-noise ratio (SNR) is larger in the initial conditions. We run two ensemble experiments in order to explore a way to reduce the SNR of surface winds and temperature. One ensemble experiment is AGCM with prescribing sea surface temperature (SST); the other is AGCM with both prescribing SST and nudging the high-level temperature and winds to ERA-Interim. Each ensemble has 30 members. Larger SNR is expected and found over the tropical ocean in the first experiment because the tropical circulation is associated with the convection and the associated surface wind convergence as these are to a large extent driven by the SST. However, small SNR is found over high latitude ocean and land surface due to the chaotic and non-synchronized atmosphere states. In the second experiment the higher level temperature and winds are forced to be synchronized (nudged to reanalysis) and hence a larger SNR of surface winds and temperature is expected. Furthermore, different nudging coefficients are also tested in order to understand the limitation of both synchronization of large-scale circulation and the surface states. These experiments will be useful for the developing strategies to synchronize the 3-D states of atmospheric models that can be later used to build a super model.

  7. Aligned gold nanoneedle arrays for surface-enhanced Raman scattering

    International Nuclear Information System (INIS)

    Yang Yong; Huang Zhengren; Jiang Dongliang; Tanemura, Masaki; Yamaguchi, Kohei; Li Zhiyuan; Huang Yingping; Kawamura, Go; Nogami, Masayuki

    2010-01-01

    A simple Ar + -ion irradiation route has been developed to prepare gold nanoneedle arrays on glass substrates for surface-enhanced Raman scattering (SERS)-active substrates. The nanoneedles exhibited very sharp tips with an apex diameter of 20 nm. These arrays were evaluated as potential SERS substrates using malachite green molecules and exhibited a SERS enhancement factor of greater than 10 8 , which is attributed to the localized electron field enhancement around the apex of the needle and the surface plasmon coupling originating from the periodic structure. This work demonstrates a new technique for producing controllable and reproducible SERS substrates potentially applicable for chemical and biological assays.

  8. Bio-Inspired Polymer Membrane Surface Cleaning

    Directory of Open Access Journals (Sweden)

    Agnes Schulze

    2017-03-01

    Full Text Available To generate polyethersulfone membranes with a biocatalytically active surface, pancreatin was covalently immobilized. Pancreatin is a mixture of digestive enzymes such as protease, lipase, and amylase. The resulting membranes exhibit self-cleaning properties after “switching on” the respective enzyme by adjusting pH and temperature. Thus, the membrane surface can actively degrade a fouling layer on its surface and regain initial permeability. Fouling tests with solutions of protein, oil, and mixtures of both, were performed, and the membrane’s ability to self-clean the fouled surface was characterized. Membrane characterization was conducted by investigation of the immobilized enzyme concentration, enzyme activity, water permeation flux, fouling tests, porosimetry, X-ray photoelectron spectroscopy, and scanning electron microscopy.

  9. 78 FR 7849 - Culturally Significant Objects Imported for Exhibition

    Science.gov (United States)

    2013-02-04

    ... Century,'' imported from abroad for temporary exhibition within the United States, are of cultural... also determine that the exhibition or display of the exhibit objects at The Yale Center for British Art..., Bureau of Educational and Cultural Affairs, Department of State. [FR Doc. 2013-02401 Filed 2-1-13; 8:45...

  10. Peer review and competition in the Art Exhibition Game.

    Science.gov (United States)

    Balietti, Stefano; Goldstone, Robert L; Helbing, Dirk

    2016-07-26

    To investigate the effect of competitive incentives under peer review, we designed a novel experimental setup called the Art Exhibition Game. We present experimental evidence of how competition introduces both positive and negative effects when creative artifacts are evaluated and selected by peer review. Competition proved to be a double-edged sword: on the one hand, it fosters innovation and product diversity, but on the other hand, it also leads to more unfair reviews and to a lower level of agreement between reviewers. Moreover, an external validation of the quality of peer reviews during the laboratory experiment, based on 23,627 online evaluations on Amazon Mechanical Turk, shows that competition does not significantly increase the level of creativity. Furthermore, the higher rejection rate under competitive conditions does not improve the average quality of published contributions, because more high-quality work is also rejected. Overall, our results could explain why many ground-breaking studies in science end up in lower-tier journals. Differences and similarities between the Art Exhibition Game and scholarly peer review are discussed and the implications for the design of new incentive systems for scientists are explained.

  11. Galician mining and metallurgy in the light of the General Regional Exhibition of Lviv in 1894

    Directory of Open Access Journals (Sweden)

    Wojciech Paduchowski

    2014-12-01

    Full Text Available The General Regional Exhibition of Lviv was organized in 1894, on the 100 year anniversary of the Kosciuszko Uprising of 1794. The Exhibition was meant to demonstrate Galicia’s economical and cultural progress since its gaining political autonomy and to become an opportunity for the national integration of Poles. The Exhibition displays included various thematic groups which were devoted to both spiritual and material aspects of life in Galicia and were meant to show the abundance of its crops and produce, mining and metallurgy, agriculture, forestry and hunting. The shows pictured everyday life of the inhabitants of Galicia, its folk art, so-called domestic industry and craftwork. Other sections of the Exhibition demonstrated the development of the Galician financial institutions, public administration, healthcare, communication, engineering, construction, literature, general and vocational education and the bloom of the fine arts and architecture. The article analyzes only some parts of the great legacy of the Exhibition, its scope focuses on mining and metallurgy. The text points out the dynamic development of the oil industry and the increase in the branches such as: salt production, iron smelting, and brown and hard coal extraction. The only branch of the Galicia’s economy which had not offered good perspectives and was thus soon discontinued had been the production of earthwax (ozocerite. The organization of the exhibitions of such sort was regarded at that time as one of the best ways to stimulate economy and benefit the regions. The actual development itself, especially of the oil mining, aided many positive social and cultural changes and undoubtedly increased the societal potential and might have resulted in further initiatives.

  12. Surface-Assisted Dynamic Search Processes.

    Science.gov (United States)

    Shin, Jaeoh; Kolomeisky, Anatoly B

    2018-03-01

    Many chemical and biological systems exhibit intermittent search phenomena when participating particles alternate between dynamic regimes with different dimensionalities. Here we investigate theoretically a dynamic search process of finding a small target on a two-dimensional surface starting from a bulk solution, which is an example of such an intermittent search process. Both continuum and discrete-state stochastic descriptions are developed. It is found that depending on the scanning length λ, which describes the area visited by the reacting molecule during one search cycle, the system can exhibit three different search regimes: (i) For small λ values, the reactant finds the target mostly via three-dimensional bulk diffusion; (ii) for large λ values, the reactant molecule associates to the target mostly via surface diffusion; and (iii) for intermediate λ values, the reactant reaches the target via a combination of three-dimensional and two-dimensional search cycles. Our analysis also shows that the mean search times have different scalings as a function of the size of the surface segment depending on the nature of the dynamic search regime. Search dynamics are also sensitive to the position of the target for large scanning lengths. In addition, it is argued that the continuum description underestimates mean search times and does not always correctly describe the most optimal conditions for the surface-assisted dynamic processes. The importance of our findings for real natural systems is discussed.

  13. Environment construction and bottleneck breakthrough in the improvement of wisdom exhibition

    Science.gov (United States)

    Zhang, Jiankang

    2017-08-01

    Wisdom exhibition is an inexorable trend in convention and exhibition industry in China. Information technology must be utilized by exhibition industry to achieve intelligent application and wisdom management, breaking the limitation of time as well as space, which raise the quality of exhibition service and level of operation to a totally new standard. Accordingly, exhibition industry should optimize mobile internet, a fundamental technology platform, during the advancing process of wisdom exhibition and consummate the combination among three plates including wisdom connection of information, wisdom exhibition environment and wisdom application of technology. Besides, the industry should realize the wisdom of external environment including wisdom of exhibition city, exhibition place, exhibition resource deal etc and break through bottle-neck in construction of wisdom exhibition industry, which includes construction of big data center, development of Mobile Internet application platform, promotion of information construction, innovative design of application scenarios.

  14. 76 FR 68808 - Culturally Significant Objects Imported for Exhibition

    Science.gov (United States)

    2011-11-07

    ... also determine that the exhibition or display of the exhibit objects at the Onassis Cultural Center... Century AD,'' imported from abroad for temporary exhibition within the United States, are of cultural... Cultural Affairs, Department of State. [FR Doc. 2011-28805 Filed 11-4-11; 8:45 am] BILLING CODE 4710-05-P ...

  15. Definition of criteria for estimating alternative technologies of increasing quality of rotor shaft neck by electroerosive alloying and surface plastic deformation methods

    Science.gov (United States)

    Martsynkovskyy, V.; Kirik, G.; Tarelnyk, V.; Zharkov, P.; Konoplianchenko, Ie; Dovzhyk, M.

    2017-08-01

    There are represented the results of influence of the surface plastic deformation (SPD) methods, namely, diamond smoothing (DS) and ball-rolling surface roughness generation (BSRG) ones on the qualitative parameters (residual stresses, fatigue strength and wear resistance values) of the steel substrate surface layers formed by the electroerosive alloying (EEA) method. There are proposed the most rational methods of deformation and also the composition for electroerosive coatings providing the presence of the favorable residual compressive stresses in the surface layer, increasing fatigue strength and wear resistance values. There are stated the criteria for estimating the alternative variants of the combined technologies and choosing the most rational ones thereof.

  16. Temperature increases on the external root surface during endodontic treatment using single file systems.

    Science.gov (United States)

    Özkocak, I; Taşkan, M M; Gökt Rk, H; Aytac, F; Karaarslan, E Şirin

    2015-01-01

    The aim of this study is to evaluate increases in temperature on the external root surface during endodontic treatment with different rotary systems. Fifty human mandibular incisors with a single root canal were selected. All root canals were instrumented using a size 20 Hedstrom file, and the canals were irrigated with 5% sodium hypochlorite solution. The samples were randomly divided into the following three groups of 15 teeth: Group 1: The OneShape Endodontic File no.: 25; Group 2: The Reciproc Endodontic File no.: 25; Group 3: The WaveOne Endodontic File no.: 25. During the preparation, the temperature changes were measured in the middle third of the roots using a noncontact infrared thermometer. The temperature data were transferred from the thermometer to the computer and were observed graphically. Statistical analysis was performed using the Kruskal-Wallis analysis of variance at a significance level of 0.05. The increases in temperature caused by the OneShape file system were lower than those of the other files (P file showed the highest temperature increases. However, there were no significant differences between the Reciproc and WaveOne files. The single file rotary systems used in this study may be recommended for clinical use.

  17. Relationship between Leaf Surface Characteristics and Particle Capturing Capacities of Different Tree Species in Beijing

    Directory of Open Access Journals (Sweden)

    Weikang Zhang

    2017-03-01

    Full Text Available Leaf surface is a multifunctional interface between a plant and its environment, which affects both ecological and biological processes. Leaf surface topography directly affects microhabitat availability and ability for deposition. In this study, atomic force microscopy (AFM and the resuspended particulate matter method were applied to evaluate the adsorptive capacity of the leaf surface. Patterns of particulate‐capturing capacities in different tree species and the effect of leaf surface features on these capacities were explored. Results indicated the following: (1 more total suspended particles (TSP per unit leaf area were captured by coniferous tree species than by broad‐leaved tree species in a particular order—i.e., Pinus tabuliformis > Pinus bungeana > Salix matsudana > Acer truncatum > Ginkgo biloba > Populus tomentosa; (2 Significant seasonal variation in particulate‐capturing capacities were determined. During the observation period, the broad‐leaved tree species capturing TSP and coarse particulate matter (PM10 clearly exhibited a ∩‐shape pattern— that is, increasing initially and later on decreasing; meanwhile, the ∩‐shape pattern was not clearly shown in P. tabuliformis and P. bungeana. However, no obvious patterns in the absorption of fine particulate matter (PM2.5 were found in the tested tree species; (3 The leaf surface topography, as observed by AFM and scanning electron microscopy, revealed that the broad‐leaved tree exhibits a good correlation between micro‐roughness of leaf surfaces and density of particles settling on leaf surfaces over time. However, the main factors affecting the adsorptive capacities of the leaves in coniferous trees are the number of stomata as well as the amount of epicuticular wax and the properties of the cuticle in different seasons.

  18. Surface-confined electroactive molecules for multistate charge storage information.

    Science.gov (United States)

    Mas-Torrent, M; Rovira, C; Veciana, J

    2013-01-18

    Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.

  19. Art exhibit focuses on African astronomy

    Science.gov (United States)

    Showstack, Randy

    2012-07-01

    Connections between Africans and astronomy are the focus of a new exhibition in the National Museum of African Art in Washington, D. C. "African Cosmos: Stellar Arts," which includes artwork, cultural items, and scientific displays from ancient to contemporary times, is the first major exhibit "that brings together arts and science focused on Africa's contribution to keen observations of the heavens over time," curator Christine Mullen Kreamer said at a 20 June news briefing. Among the exhibit's nearly 100 objects are an ancient Egyptian mummy board that includes a representation of the sky goddess Nut, sculptures by the Dogon people of Mali depicting figures in relation to the cosmos, a video that uses data from two square degrees of the Hubble Space Telescope Cosmic Evolution Survey, and a nearly floor-to-ceiling "Rainbow Serpent" constructed of plastic containers by Benin artist Hazoume. An untitled acrylic painting (Figure 1) by South African Gavin Jantjes evokes a myth of the Khoi San people of southern Africa, as it portrays a girl throwing evening fire embers into the night sky, where they remained as the Milky Way.

  20. Cell surface hydrophobicity of dental plaque microorganisms in situ.

    OpenAIRE

    Rosenberg, M; Judes, H; Weiss, E

    1983-01-01

    The cell surface hydrophobicity of bacteria obtained directly from human tooth surfaces was assayed by measuring their adherence to liquid hydrocarbons. Fresh samples of supragingival dental plaque were washed and dispersed in buffer. Adherence of the plaque microorganisms to hexadecane, octane, and xylene was tested turbidimetrically and by direct microscopic observation. The results clearly show that the vast majority of bacteria comprising dental plaque exhibit pronounced cell surface hydr...

  1. A High Performance Silicon-on-Insulator LDMOSTT Using Linearly Increasing Thickness Techniques

    International Nuclear Information System (INIS)

    Yu-Feng, Guo; Zhi-Gong, Wang; Gene, Sheu; Jian-Bing, Cheng

    2010-01-01

    We present a new technique to achieve uniform lateral electric field and maximum breakdown voltage in lateral double-diffused metal-oxide-semiconductor transistors fabricated on silicon-on-insulator substrates. A linearly increasing drift-region thickness from the source to the drain is employed to improve the electric field distribution in the devices. Compared to the lateral linear doping technique and the reduced surface field technique, two-dimensional numerical simulations show that the new device exhibits reduced specific on-resistance, maximum off- and on-state breakdown voltages, superior quasi-saturation characteristics and improved safe operating area. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  2. Development of a High Slip-resistant Footwear Outsole Using a Hybrid Rubber Surface Pattern

    Science.gov (United States)

    YAMAGUCHI, Takeshi; HOKKIRIGAWA, Kazuo

    2014-01-01

    Abstract: The present study examined whether a new footwear outsole with tread blocks and a hybrid rubber surface pattern, composed of rough and smooth surfaces, could increase slip resistance and reduce the risk of fall while walking on a wet floor surface. A drag test was performed to measure static and dynamic coefficient of friction (SCOF and DCOF, respectively) values for the footwear with the hybrid rubber surface pattern outsole and two types of commercially available boots that are conventionally used in food factories and restaurant kitchens with respect to a stainless steel floor covered with glycerol solution. Gait trials were conducted with 14 participants who wore the footwear on the wet stainless steel floor. The drag test results indicated that the hybrid rubber surface pattern sole exhibited higher SCOF (≥0.44) and DCOF (≥0.39) values than the soles of the comparative footwear (pfootwear with the hybrid rubber surface pattern outsole were significantly lower than those for the comparative footwear, which resulted in no falls during trials. PMID:25055846

  3. High-throughput bioscreening system utilizing high-performance affinity magnetic carriers exhibiting minimal non-specific protein binding

    International Nuclear Information System (INIS)

    Hanyu, Naohiro; Nishio, Kosuke; Hatakeyama, Mamoru; Yasuno, Hiroshi; Tanaka, Toshiyuki; Tada, Masaru; Nakagawa, Takashi; Sandhu, Adarsh; Abe, Masanori; Handa, Hiroshi

    2009-01-01

    For affinity purification of drug target protein we have developed magnetic carriers, narrow in size distribution (184±9 nm), which exhibit minimal non-specific binding of unwanted proteins. The carriers were highly dispersed in aqueous solutions and highly resistant to organic solvents, which enabled immobilization of various hydrophobic chemicals as probes on the carrier surfaces. Utilizing the carriers we have automated the process of separation and purification of the target proteins that had been done by manual operation previously.

  4. Preserving half-metallic surface states in Cr O2 : Insights into surface reconstruction rules

    Science.gov (United States)

    Deng, Bei; Shi, X. Q.; Chen, L.; Tong, S. Y.

    2018-04-01

    The issue of whether the half-metallic (HM) nature of Cr O2 could be retained at its surface has been a standing problem under debate for a few decades, but until now is still controversial. Here, based on the density functional theory calculations we show, in startling contrast to the previous theoretical understandings, that the surfaces of Cr O2 favorably exhibit a half-metallic-semiconducting (SmC) transition driven by means of a surface electronic reconstruction largely attributed to the participation of the unexpected local charge carriers (LCCs), which convert the HM double exchange surface state into a SmC superexchange state and in turn, stabilize the surface as well. On the basis of the LCCs model, a new insight into the surface reconstruction rules is attained. Our novel finding not only provided an evident interpretation for the widely observed SmC character of Cr O2 surface, but also offered a novel means to improve the HM surface states for a variety of applications in spintronics and superconductors, and promote the experimental realization of the quantum anomalous Hall effect in half-metal based systems.

  5. Fractal approach to surface roughness of TiO{sub 2}/WO{sub 3} coatings formed by plasma electrolytic oxidation process

    Energy Technology Data Exchange (ETDEWEB)

    Rožić, L.J., E-mail: ljrozic@nanosys.ihtmbg.ac.rs [University of Belgrade, IChTM-Department of Catalysis and Chemical Engineering, Njegoševa 12, Belgrade (Serbia); Petrović, S.; Radić, N. [University of Belgrade, IChTM-Department of Catalysis and Chemical Engineering, Njegoševa 12, Belgrade (Serbia); Stojadinović, S. [University of Belgrade, Faculty of Physics, Studentski trg 12-16, Belgrade (Serbia); Vasilić, R. [Faculty of Environmental Governance and Corporate Responsibility, Educons University, Vojvode Putnika 87, Sremska Kamenica (Serbia); Stefanov, P. [Institute of General and Inorganic Chemistry, Bulgarian Academy of Sciences, Sofia 1113 (Bulgaria); Grbić, B. [University of Belgrade, IChTM-Department of Catalysis and Chemical Engineering, Njegoševa 12, Belgrade (Serbia)

    2013-07-31

    In this study, we have shown that atomic force microscopy is a powerful technique to study the fractal parameters of TiO{sub 2}/WO{sub 3} coatings prepared by plasma electrolytic oxidation (PEO) process. Since the surface roughness of obtained oxide coatings affects their physical properties, an accurate description of roughness parameters is highly desirable. The surface roughness, described by root mean squared and arithmetic average values, is analyzed considering the scans of a series of atomic force micrographs. The results show that the oxide coatings exhibit lower surface roughness in initial stage of PEO process. Also, the surfaces of TiO{sub 2}/WO{sub 3} coatings exhibit fractal behavior. Positive correlation between the fractal dimension and surface roughness of the surfaces of TiO{sub 2}/WO{sub 3} coatings in initial stage of PEO process was found. - Highlights: • TiO{sub 2}/WO{sub 3} coatings were obtained by plasma electrolytic oxidation. • Oxide coatings exhibit lower surface roughness in initial stage of process. • The surfaces of TiO{sub 2}/WO{sub 3} coatings exhibit fractal behavior.

  6. Surface modification of cotton fabrics by gas plasmas for color strength and adhesion by inkjet ink printing

    International Nuclear Information System (INIS)

    Pransilp, Porntapin; Pruettiphap, Meshaya; Bhanthumnavin, Worawan; Paosawatyanyong, Boonchoat; Kiatkamjornwong, Suda

    2016-01-01

    Graphical abstract: - Highlights: • Both O_2 and N_2 plasma increased cotton surface wettability and higher K/S. • SF6 plasma gave hydrophobicity on cotton surface and increased contact angle to 138°. • Plasma treatment on cotton fabric produced surface roughness. • XPS confirmed the generation of new functional groups on cotton fabric. • Wettability and surface roughness controlled K/S and good ink adhesion. - Abstract: Surface properties of cotton fabric were modified by three types of gas plasma pretreatment, namely, oxygen (O_2), nitrogen (N_2) and sulfur hexafluoride (SF_6), to improve ink absorption of water-based pigmented inkjet inks and color reproduction of the treated surfaces. Effects of gas plasma exposure parameters of power, exposure time and gas pressure on surface physical and chemical properties of the treated fabrics were investigated. XPS (X-ray photoelectron spectroscopy) was used to identify changes in functional groups on the fabric surface while AFM (atomic force microscopy) and SEM (scanning electron microscopy) were used to reveal surface topography of the fabric. Color spectroscopic technique was used to investigate changes in color strength caused by different absorptions of the printed fabrics. The O_2 plasma treatments produced new functional groups, −O−C−O/C=O and O−C=O while N_2 plasma treatments produced additionally new functional groups, C−N and O=C−NH, onto the fabric surface which increased hydrophilic properties and surface energy of the fabric. For cotton fabric treated with SF_6 plasma, the fluorine functionalization was additionally found on the surface. Color strength values (K/S) increased when compared with those of the untreated fabrics. SF_6 plasma-treated fabrics were hydrophobic and caused less ink absorption. Fabric surface roughness caused by plasma etching increased fabric surface areas, captured more ink, and enhanced a larger ink color gamut and ink adhesion. Cotton fabrics exhibited higher

  7. Surface-enhanced Raman scattering sensing on black silicon

    Energy Technology Data Exchange (ETDEWEB)

    Gervinskas, Gediminas; Seniutinas, Gediminas; Hartley, Jennifer S.; Stoddart, Paul R.; Juodkazis, Saulius [Centre for Micro-Photonics and Industrial Research Institute Swinburne, Faculty of Engineering and Industrial Sciences, Swinburne University of Technology, Hawthorn, VIC (Australia); The Australian National Fabrication Facility-ANFF, Victoria node, Faculty of Engineering and Industrial Sciences, Swinburne University of Technology, Hawthorn, VIC (Australia); Kandasamy, Sasikaran [Melbourne Centre for Nanofabrication, Clayton, VIC (Australia); Fahim, Narges F. [Centre for Micro-Photonics and Industrial Research Institute Swinburne, Faculty of Engineering and Industrial Sciences, Swinburne University of Technology, Hawthorn, VIC (Australia)

    2013-12-15

    Reactive ion etching was used to fabricate black-Si over the entire surface area of 4-inch Si wafers. After 20 min of the plasma treatment, surface reflection well below 2% was achieved over the 300-1000 nm spectral range. The spikes of the black-Si substrates were coated by gold, resulting in an island film for surface-enhanced Raman scattering (SERS) sensing. A detection limit of 1 x 10{sup -6} M (at count rate > 10{sup 2} s{sup -1}. mW{sup -1}) was achieved for rhodamine 6G in aqueous solution when drop cast onto a {proportional_to} 100-nm-thick Au coating. The sensitivity increases for thicker coatings. A mixed mobile-on-immobile platform for SERS sensing is introduced by using dog-bone Au nanoparticles on the Au/black-Si substrate. The SERS intensity shows a non-linear dependence on the solid angle (numerical aperture of excitation/collection optics) for a thick gold coating that exhibits a 10 times higher enhancement. This shows promise for augmented sensitivity in SERS applications. (copyright 2013 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  8. Surface studies of niobium chemically polished under conditions for superconducting radio frequency (SRF) cavity production

    Science.gov (United States)

    Tian, Hui; Reece, Charles E.; Kelley, Michael J.; Wang, Shancai; Plucinski, Lukasz; Smith, Kevin E.; Nowell, Matthew M.

    2006-11-01

    The performance of niobium superconducting radiofrequency (SRF) accelerator cavities is strongly impacted by the topmost several nanometers of the active (interior) surface, especially as influenced by the final surface conditioning treatments. We examined the effect of the most commonly employed treatment, buffered chemical polishing (BCP), on polycrystalline niobium sheet over a range of realistic solution flow rates using electron back scatter diffraction (EBSD), stylus profilometry, atomic force microscopy, laboratory XPS and synchrotron (variable photon energy) XPS, seeking to collect statistically significant datasets. We found that the predominant general surface orientation is (1 0 0), but others are also present and at the atomic-level details of surface plane orientation are more complex. The post-etch surface exhibits micron-scale roughness, whose extent does not change with treatment conditions. The outermost surface consists of a few-nm thick layer of niobium pentoxide, whose thickness increases with solution flow rate to a maximum of 1.3-1.4 times that resulting from static solution. The standard deviation of the roughness measurements is ±30% and that of the surface composition is ±5%.

  9. Surface studies of niobium chemically polished under conditions for superconducting radio frequency (SRF) cavity production

    Energy Technology Data Exchange (ETDEWEB)

    Tian Hui [Thomas Jefferson National Accelerator Facility and College of William and Mary (United States); Reece, Charles E. [Thomas Jefferson National Accelerator Facility and College of William and Mary (United States); Kelley, Michael J. [Thomas Jefferson National Accelerator Facility and College of William and Mary (United States)]. E-mail: mkelley@jlab.org; Wang Shancai [Department of Physics, Boston University (United States); Plucinski, Lukasz [Department of Physics, Boston University (United States); Smith, Kevin E. [Department of Physics, Boston University (United States); Nowell, Matthew M. [EDAX TSL (United States)

    2006-11-30

    The performance of niobium superconducting radiofrequency (SRF) accelerator cavities is strongly impacted by the topmost several nanometers of the active (interior) surface, especially as influenced by the final surface conditioning treatments. We examined the effect of the most commonly employed treatment, buffered chemical polishing (BCP), on polycrystalline niobium sheet over a range of realistic solution flow rates using electron back scatter diffraction (EBSD), stylus profilometry, atomic force microscopy, laboratory XPS and synchrotron (variable photon energy) XPS, seeking to collect statistically significant datasets. We found that the predominant general surface orientation is (1 0 0), but others are also present and at the atomic-level details of surface plane orientation are more complex. The post-etch surface exhibits micron-scale roughness, whose extent does not change with treatment conditions. The outermost surface consists of a few-nm thick layer of niobium pentoxide, whose thickness increases with solution flow rate to a maximum of 1.3-1.4 times that resulting from static solution. The standard deviation of the roughness measurements is {+-}30% and that of the surface composition is {+-}5%.

  10. Surface Studies of Niobium Chemically Polished Under Conditions for Superconducting Radio Frequency (SRF) Cavity Production

    Energy Technology Data Exchange (ETDEWEB)

    Tian,H.; Reece, C.; Kelley, M.; Wang, S.; Plucinski, L.; Smith, K.; Nowell, M.

    2006-01-01

    The performance of niobium superconducting radiofrequency (SRF) accelerator cavities is strongly impacted by the topmost several nanometers of the active (interior) surface, especially as influenced by the final surface conditioning treatments. We examined the effect of the most commonly employed treatment, buffered chemical polishing (BCP), on polycrystalline niobium sheet over a range of realistic solution flow rates using electron back scatter diffraction (EBSD), stylus profilometry, atomic force microscopy, laboratory XPS and synchrotron (variable photon energy) XPS, seeking to collect statistically significant datasets. We found that the predominant general surface orientation is (1 0 0), but others are also present and at the atomic-level details of surface plane orientation are more complex. The post-etch surface exhibits micron-scale roughness, whose extent does not change with treatment conditions. The outermost surface consists of a few-nm thick layer of niobium pentoxide, whose thickness increases with solution flow rate to a maximum of 1.3-1.4 times that resulting from static solution. The standard deviation of the roughness measurements is {+-}30% and that of the surface composition is {+-}5%.

  11. Science Museum Exhibits' Summative Evaluation with Knowledge Hierarchy Method

    Science.gov (United States)

    Yasar, Erkan; Gurel, Cem

    2016-01-01

    It is aimed in this research to measure via knowledge hierarchy the things regarding exhibit themes learned by the visitors of the exhibits and compare them with the purpose that the exhibits are designed for, thereby realizing a summative evaluation of the exhibits by knowledge hierarchy method. The research has been conducted in a children's…

  12. Displaying lives: the narrative of objects in biographical exhibitions

    Directory of Open Access Journals (Sweden)

    Caterina Albano

    2007-03-01

    Full Text Available Biographical exhibitions are a museum practice that asks for critical consideration. Grounding the argument in critical theory, social studies and museum theory, the article explores the narrative function of objects in biographical exhibitions by addressing the social significance of objects in relation to biography and their relevance when presented into an exhibition display. Central is the concept of objects as ‘biographical relics’ that are culturally fetishized in biographical narratives. This raises questions about biographical reliability and the cultural role that such objects plays in exhibition narratives as bearers of reality and as metonymical icons of the biographical subject. The article considers examples of biographical exhibitions of diverse figures such as Gregor Mendel, Madame de Pompadour and Roland Barthes, and the role that personal items, but also portraits and photographs, play in them.

  13. Switchable directional excitation surface plasmon polaritons with dielectric nanoantennas

    DEFF Research Database (Denmark)

    Sinev, I.; Komissarenko, F.; Bogdanov, A.

    2017-01-01

    We demonstrate directional launching of surface plasmon polaritons on thin goldfilm with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation, which is driven by the mutual interference of magnetic and elect...... and electric dipole moments supported by the dielectric nanoantenna....

  14. Electromechanical performance of an ionic polymer–metal composite actuator with hierarchical surface texture

    International Nuclear Information System (INIS)

    He, Qingsong; Yu, Min; Zhang, Xiaoqing; Dai, Zhendong

    2013-01-01

    Two stainless steel templates were fabricated using electric-spark machining, and a hierarchical surface texture of ionic polymer was produced using both polishing and replication methods, which produced microscale and nanoscale groove-shaped microstructures at the surface of the polymer. The surface morphology of the Nafion membrane and metal electrode were observed using scanning electron microscopy (SEM) and energy dispersive spectroscopy (EDS). SEM and EDS line-scan analysis indicated that the interfacial surface area was considerably increased and an excellent metal electrode was obtained with the production of a hierarchical surface texture. The displacement, blocking force, and electric current were measured using home-built apparatus. The results revealed that the combined polishing and replication method significantly improved the electromechanical performance of the ionic polymer–metal composite (IPMC). Compared with sandblasted Nafion-based IPMC, the blocking force, displacement, and electric current of the replicated Nafion-based IPMC were 4.39, 2.35, and 1.87 times higher, respectively. The IPMC fabricated in this work exhibited a competitive blocking force compared with recently reported actuators. (paper)

  15. Improved thrombogenicity on oxygen etched Ti6Al4V surfaces

    International Nuclear Information System (INIS)

    Riedel, Nicholas A.; Smith, Barbara S.; Williams, John D.; Popat, Ketul C.

    2012-01-01

    Thrombus formation on blood contacting biomaterials continues to be a key factor in initiating a critical mode of failure in implantable devices, requiring immediate attention. In the interest of evaluating a solution for one of the most widely used biomaterials, titanium and its alloys, this study focuses on the use of a novel surface oxidation treatment to improve the blood compatibility. This study examines the possibility of using oblique angle ion etching to produce a high quality oxide layer that enhances blood compatibility on medical grade titanium alloy Ti6Al4V. An X-ray photoelectron spectroscopy (XPS) analysis of these oxygen-rich surfaces confirmed the presence of TiO 2 peaks and also indicated increased surface oxidation as well as a reduction in surface defects. After 2 h of contact with whole human plasma, the oxygen etched substrates demonstrated a reduction in both platelet adhesion and activation as compared to bare titanium substrates. The whole blood clotting behavior was evaluated for up to 45 min, showing a significant decrease in clot formation on oxygen etched substrates. Finally, a bicinchoninic acid (BCA) total protein assay and XPS were used to evaluate the degree of key blood serum protein (fibrinogen, albumin, immunoglobulin G) adsorption on the substrates. The results showed similar protein levels for both the oxygen etched and control substrates. These results indicate that oblique angle oxygen etching may be a promising method to increase the thrombogenicity of Ti6Al4V. - Highlights: ►Oblique angle oxygen ion etching creates a high quality, uniform oxide surface. ►Oxygen etched substrates showed fewer adhered platelets. ►Platelet activation was reduced by the improved oxide surface. ►Oxygen etched substrates exhibited increased whole blood clotting times. ►Although clotting reductions were seen, protein adsorption remained similar.

  16. Surface characterization of plasma treated polymers for applications as biocompatible carriers

    Directory of Open Access Journals (Sweden)

    L. Bacakova

    2013-06-01

    Full Text Available The objective of this work was to determine surface properties of polymer surfaces after plasma treatment with the aim of further cytocompatibility tests. Examined polymers were poly(ethyleneterephthalate (PET, high-density polyethylene (HDPE, poly(tetrafluoro-ethylene (PTFE and poly(L-lactic acid (PLLA. Goniometry has shown that the plasma treatment was immediately followed by a sharp decrease of contact angle of the surface. In the course of ageing the contact angle increased due to the reorientation of polar groups into the surface layer of polymer. Ablation of polymer surfaces was observed during the degradation. Decrease of weight of polymer samples was measured by gravimetry. Surface morphology and roughness was studied by atomic force microscopy (AFM. The PLLA samples exhibited saturation of wettability (aged surface after approximately 100 hours, while the PET and PTFE achieved constant values of contact angle after 336 hours. Irradiation by plasma leads to polymer ablation, the highest mass loss being observed for PLLA. The changes in the surface roughness and morphology were observed, a lamellar structure being induced on PTFE. Selected polymer samples were seeded with VSMC (vascular smooth muscle cells and the adhesion and proliferation of cells was studied. It was proved that certain combination of input treatment parameters led to improvement of polymer cytocompatibility. The plasma exposure was confirmed to significantly improve the PTFE biocompatibility.

  17. Scattering of surface plasmons on graphene by a discontinuity in surface conductivity

    International Nuclear Information System (INIS)

    Rejaei, Behzad; Khavasi, Amin

    2015-01-01

    The scattering of graphene surface plasmons from an arbitrary, one-dimensional discontinuity in graphene surface conductivity is treated analytically by an exact solution of the quasi-static integral equation for surface current density in the spectral domain. It is found that the reflection and transmission coefficients are not governed by the Fresnel formulas obtained by means of the effective medium approach. Furthermore, the reflection coefficient generally exhibits an anomalous reflection phase, which has so far only been reported for the particular case of reflection from abrupt edges. This anomalous phase becomes frequency-independent in the regime where the effect of inter-band transitions on graphene conductivity is negligible. The results are in excellent agreement with full-wave electromagnetic simulations, and can serve as a basis for the analysis of inhomogeneous graphene layers with a piecewise-constant conductivity profile. (paper)

  18. “HOW DO YOU FEEL?”: EMOTIONS EXHIBITED WHILE PLAYING COMPUTER GAMES AND THEIR RELATIONSHIP TO GAMING BEHAVIORS

    Directory of Open Access Journals (Sweden)

    Rex P. Bringula

    2015-06-01

    Full Text Available This descriptive study utilized a validated questionnaire to determine the emotions exhibited by computer gamers in cyber cafés. We determined that gamers exhibited both positive and negative emotions while playing games. We observed that gamers were inclined to be more anxious about being defeated in a game as gaming became frequent and length of years spent playing games increased. They also had the tendency to become more stressed when length of years spent playing games increased. On the other hand, other gaming behaviors were not significantly related to other emotions. We concluded that not all emotions exhibited by gamers while playing computer games could be attributed to their gaming behaviors. We recommend that other emotions such as anger, frustration, boredom, amusement, etc. be included in future research.

  19. An Astrobiology Microbes Exhibit and Education Module

    Science.gov (United States)

    Lindstrom, Marilyn M.; Allen, Jaclyn S.; Stocco, Karen; Tobola, Kay; Olendzenski, Lorraine

    2001-01-01

    Telling the story of NASA-sponsored scientific research to the public in exhibits is best done by partnerships of scientists and museum professionals. Likewise, preparing classroom activities and training teachers to use them should be done by teams of teachers and scientists. Here we describe how we used such partnerships to develop a new astrobiology augmentation to the Microbes! traveling exhibit and a companion education module. "Additional information is contained in the original extended abstract."

  20. International Space Station exhibit

    Science.gov (United States)

    2000-01-01

    The International Space Station (ISS) exhibit in StenniSphere at John C. Stennis Space Center in Hancock County, Miss., gives visitors an up-close look at the largest international peacetime project in history. Step inside a module of the ISS and glimpse how astronauts will live and work in space. Currently, 16 countries contribute resources and hardware to the ISS. When complete, the orbiting research facility will be larger than a football field.

  1. The Signatures of the Invisible exhibition in Geneva

    CERN Multimedia

    Patrice Loïez

    2002-01-01

    The artist Paola Pivi with her work at the Signatures of the Invisible exhibition in Geneva during February 2002. This piece with needles suspended on nylon thread 'detects' people as they approach. The exhibition was for art inspired by research carried out at CERN.

  2. Fabrication of Self-Cleaning and Anti-Icing Durable Surface on Glass.

    Science.gov (United States)

    Zuo, Zhiping; Liao, Ruijin; Guo, Chao; Zhao, Xuetong; Zhuang, Aoyun; Yuan, Yuan

    2017-01-01

    Ice accumulation on insulators affected the safety of power system and may inflict serious consequences such as insulator flashover accidents and power failure. This article reported a simple method to prepare anti-icing polydimethylsiloxane superhydrophobic surface on glass by utilizing nano-particle filling method. The effect of concentration of silica nanoparticles on superhydrophobicity of the samples was investigated. The wettability, surface morphology and anti-icing property of the as-prepared superhydrophobic surface were characterized by corresponding methods. Results show that the as-prepared surface with addition amount of 7 g silica nanoparticles exhibited self-cleaning property and excellent superhydrophobicity with a contact angle of 165.7 ± 2.4° and a sliding angle of 3.8°. It was found that the ice formation was delayed for 29 min at −5 °C. Moreover, the as-prepared superhydrophobic surface showed superhydrophobicity in the pH range of 1–13 and exhibited excellent drop impact stability. The as-prepared superhydrophobic surface may be suitable for applications in cold regions owing to its flexibility, durability and anti-icing property.

  3. Modulating Protein Adsorption on Oxygen Plasma Modified Polysiloxane Surfaces

    International Nuclear Information System (INIS)

    Marletta, G.

    2006-01-01

    In the present paper we report the study on the adsorption behaviour of three model globular proteins, Human Serum Albumin, Lactoferrin and Egg Chicken Lysozyme onto both unmodified surfaces of a silicon-based polymer and the corresponding plasma treated surfaces. In particular, thin films of hydrophobic polysiloxane (about 90 degree of static water contact angle, WCA) were converted by oxygen plasma treatment at reduced pressure into very hydrophilic phases of SiOx (WCA less than 5 degree). The kinetics of protein adsorption processes were investigated by QCM-D technique, while the chemical structure and topography of the protein adlayer have been studied by Angular resolved-XPS and AFM respectively. It turned out that Albumin and Lysozyme exhibited the opposite preferential adsorption respectively onto the hydrophobic and hydrophilic surfaces, while Lactoferrin did not exhibit significant differences. The observed protein behaviour are discussed both in terms of surface-dependent parameters, including surface free energy and chemical structure, and in terms of protein-dependent parameters, including charge as well as the average molecular orientation in the adlayers. Finally, some examples of differential adsorption behaviour of the investigated proteins are reported onto nanopatterned polysiloxane surfaces consisting of hydrophobic nanopores surrounded by hydrophilic (plasma-treated) matrix and the reverse

  4. Nanosecond laser textured superhydrophobic metallic surfaces and their chemical sensing applications

    Science.gov (United States)

    Ta, Duong V.; Dunn, Andrew; Wasley, Thomas J.; Kay, Robert W.; Stringer, Jonathan; Smith, Patrick J.; Connaughton, Colm; Shephard, Jonathan D.

    2015-12-01

    This work demonstrates superhydrophobic behavior on nanosecond laser patterned copper and brass surfaces. Compared with ultrafast laser systems previously used for such texturing, infrared nanosecond fiber lasers offer a lower cost and more robust system combined with potentially much higher processing rates. The wettability of the textured surfaces develops from hydrophilicity to superhydrophobicity over time when exposed to ambient conditions. The change in the wetting property is attributed to the partial deoxidation of oxides on the surface induced during laser texturing. Textures exhibiting steady state contact angles of up to ∼152° with contact angle hysteresis of around 3-4° have been achieved. Interestingly, the superhydrobobic surfaces have the self-cleaning ability and have potential for chemical sensing applications. The principle of these novel chemical sensors is based on the change in contact angle with the concentration of methanol in a solution. To demonstrate the principle of operation of such a sensor, it is found that the contact angle of methanol solution on the superhydrophobic surfaces exponentially decays with increasing concentration. A significant reduction, of 128°, in contact angle on superhydrophobic brass is observed, which is one order of magnitude greater than that for the untreated surface (12°), when percent composition of methanol reaches to 28%.

  5. Learning from Exhibitions: Chuck Close.

    Science.gov (United States)

    Johnson, Mark M.

    1998-01-01

    Discusses the artwork of Chuck Close, who is well known for his over-sized portraits of fellow artists and anonymous sitters, and the exhibition of his work that premiered at New York's Museum of Modern Art before traveling to other cities in the United States. (CMK)

  6. Nitrate Accumulation and Leaching in Surface and Ground Water Based on Simulated Rainfall Experiments

    Science.gov (United States)

    Wang, Hong; Gao, Jian-en; Li, Xing-hua; Zhang, Shao-long; Wang, Hong-jie

    2015-01-01

    To evaluate the process of nitrate accumulation and leaching in surface and ground water, we conducted simulated rainfall experiments. The experiments were performed in areas of 5.3 m2 with bare slopes of 3° that were treated with two nitrogen fertilizer inputs, high (22.5 g/m2 NH4NO3) and control (no fertilizer), and subjected to 2 hours of rainfall, with. From the 1st to the 7th experiments, the same content of fertilizer mixed with soil was uniformly applied to the soil surface at 10 minutes before rainfall, and no fertilizer was applied for the 8th through 12th experiments. Initially, the time-series nitrate concentration in the surface flow quickly increased, and then it rapidly decreased and gradually stabilized at a low level during the fertilizer experiments. The nitrogen loss in the surface flow primarily occurred during the first 18.6 minutes of rainfall. For the continuous fertilizer experiments, the mean nitrate concentrations in the groundwater flow remained at less than 10 mg/L before the 5th experiment, and after the 7th experiment, these nitrate concentrations were greater than 10 mg/L throughout the process. The time-series process of the changing concentration in the groundwater flow exhibited the same parabolic trend for each fertilizer experiment. However, the time at which the nitrate concentration began to change lagged behind the start time of groundwater flow by approximately 0.94 hours on average. The experiments were also performed with no fertilizer. In these experiments, the mean nitrate concentration of groundwater initially increased continuously, and then, the process exhibited the same parabolic trend as the results of the fertilization experiments. The nitrate concentration decreased in the subsequent experiments. Eight days after the 12 rainfall experiments, 50.53% of the total nitrate applied remained in the experimental soil. Nitrate residues mainly existed at the surface and in the bottom soil layers, which represents a

  7. Exhibition at CERN's Globe of Science and Innovation

    CERN Multimedia

    Claudia Marcelloni

    2006-01-01

    Here we see pictures of displays at one of the exhibitions held at the Globe of Science and Innovation taken in September 2006. Located opposite the main CERN site, the Globe houses many public exhibitions throughout the year covering many topics from astronomy to particle physics.

  8. The AAAI 2006 Mobile Robot Competition and Exhibition

    OpenAIRE

    Rybski, Paul E.; Forbes, Jeffrey; Burhans, Debra; Dodds, Zach; Oh, Paul; Scheutz, Matthias; Avanzato, Bob

    2007-01-01

    The Fifteenth Annual AAAI Robot Competition and Exhibition was held at the Twenty-First National Conference on Artificial Intelligence in Boston, Massachusetts, in July 2006. This article describes the events that were held at the conference, including the Scavenger Hunt, Human Robot Interaction, and Robot Exhibition.

  9. Critical impact of vegetation physiology on the continental hydrologic cycle in response to increasing CO2

    Science.gov (United States)

    Lemordant, Léo; Gentine, Pierre; Swann, Abigail S.; Cook, Benjamin I.; Scheff, Jacob

    2018-04-01

    Predicting how increasing atmospheric CO2 will affect the hydrologic cycle is of utmost importance for a range of applications ranging from ecological services to human life and activities. A typical perspective is that hydrologic change is driven by precipitation and radiation changes due to climate change, and that the land surface will adjust. Using Earth system models with decoupled surface (vegetation physiology) and atmospheric (radiative) CO2 responses, we here show that the CO2 physiological response has a dominant role in evapotranspiration and evaporative fraction changes and has a major effect on long-term runoff compared with radiative or precipitation changes due to increased atmospheric CO2. This major effect is true for most hydrological stress variables over the largest fraction of the globe, except for soil moisture, which exhibits a more nonlinear response. This highlights the key role of vegetation in controlling future terrestrial hydrologic response and emphasizes that the carbon and water cycles are intimately coupled over land.

  10. Increased cell surface metallopeptidase activity in cells undergoing UV-induced apoptosis

    International Nuclear Information System (INIS)

    Piva, T.J.; Davern, C.M.; Ellem, K.A.O.

    1999-01-01

    Full text: We have previously shown that UVC irradiation activated a range of cell surface peptidases (CSP) in HeLa cell monolayer cultures 20 h post-irradiation (1). In cells undergoing apoptosis there is an increase in CSP activity compared to control viable cells in cultures which have been treated by a wide range of agents including UV-irradiation (2). In order to further understand the mechanism involved in this process, we induced apoptosis in HeLa cells using 500 Jm -2 UVB. The separation of viable, apoptotic and necrotic cells of irradiated HeLa cell cultures was made by FACS analysis and sorting. The three populations were distinguished by their staining with PI and Hoechst 33342 dyes. CSP activity was measured using the P9 assay developed in this laboratory (1-3). The viable fraction of the irradiated cells had a higher level of CSP activity compared to unirradiated controls. The level of CSP activity in the apoptotic fraction was higher than that of the viable fraction, however that of the necrotic fraction was significantly lower. This finding agreed with that seen in UVC-irradiated (50 Jm -2 ) cultures (2). In order to elucidate the mechanism by which CSP activity was increased in UVB-irradiated cells undergoing apoptosis, the cultures were treated with the following agents: bestatin, aminopeptidase inhibitor, DEVD, caspase 3 inhibitor, and 3-aminobenzamide (3AB), PARP activation inhibitor. Bestatin and DEVD did not affect the level of CSP activity in the different cell subpopulations following UVB-irradiation. Treatment with 3AB abolished the increased CSP activity seen in the viable and apoptotic fraction following UVB-irradiation. All treated cells had the same morphology as observed under EM. The degree of phosphatidylserine eversion on the cell membrane was similar as were the cleavage profiles of PARP and actin. Only DEVD-treated cells had reduced caspase 3 activity which confirmed that the activation of CSP activity in apoptotic cells is

  11. Understanding Surface Adhesion in Nature: A Peeling Model.

    Science.gov (United States)

    Gu, Zhen; Li, Siheng; Zhang, Feilong; Wang, Shutao

    2016-07-01

    Nature often exhibits various interesting and unique adhesive surfaces. The attempt to understand the natural adhesion phenomena can continuously guide the design of artificial adhesive surfaces by proposing simplified models of surface adhesion. Among those models, a peeling model can often effectively reflect the adhesive property between two surfaces during their attachment and detachment processes. In the context, this review summarizes the recent advances about the peeling model in understanding unique adhesive properties on natural and artificial surfaces. It mainly includes four parts: a brief introduction to natural surface adhesion, the theoretical basis and progress of the peeling model, application of the peeling model, and finally, conclusions. It is believed that this review is helpful to various fields, such as surface engineering, biomedicine, microelectronics, and so on.

  12. Increasing the Detection Limit of the Parkinson Disorder through a Specific Surface Chemistry Applied onto Inner Surface of the Titration Well

    Directory of Open Access Journals (Sweden)

    Fabienne Poncin-Epaillard

    2012-04-01

    Full Text Available The main objective of this paper was to illustrate the enhancement of the sensitivity of ELISA titration for neurodegenerative proteins by reducing nonspecific adsorptions that could lead to false positives. This goal was obtained thanks to the association of plasma and wet chemistries applied to the inner surface of the titration well. The polypropylene surface was plasma-activated and then, dip-coated with different amphiphilic molecules. These molecules have more or less long hydrocarbon chains and may be charged. The modified surfaces were characterized in terms of hydrophilic—phobic character, surface chemical groups and topography. Finally, the coated wells were tested during the ELISA titration of the specific antibody capture of the α-synuclein protein. The highest sensitivity is obtained with polar (Θ = 35°, negatively charged and smooth inner surface.

  13. The exhibition Lumiere d'Atomes (Atoms light)

    International Nuclear Information System (INIS)

    Foos, Jacques

    1995-01-01

    Full text: This exhibition has been conceived in order to show for everybody, whatever his scientific level, the peaceful uses of transformations (natural or made by Man) and energetic possibilities of the atomic nucleus. The key-ideas of this exhibition were-: - nuclear applications a world of high technology; - nuclear industry men as the others; - nuclear energy an energetic independence. 6 themes were proposed: 1- Atoms and radioactivity; 2- The nuclear power stations; 3- The nuclear fuel cycle; 4- Surety and environment; 5- The other uses of radioactivity; 6- The French choice: The world nuclear data. This exhibition that comprises information posters, paintings, demonstration models, films and video games, was shown for the first time in Paris in april 1991. From this time, it was shown in many regional cities, with the help of SFEN members. 'Lumiere d'Atomes' received in 1991 the SFEN prize for its information on nuclear energy. (author)

  14. Surface-active biopolymers from marine bacteria for potential biotechnological applications

    Directory of Open Access Journals (Sweden)

    Karina Sałek

    2016-03-01

    Full Text Available Surface-active agents are amphiphilic chemicals that are used in almost every sector of modern industry, the bulk of which are produced by organo-chemical synthesis. Those produced from biological sources (biosurfactants and bioemulsifiers, however, have gained increasing interest in recent years due to their wide structural and functional diversity, lower toxicities and high biodegradability, compared to their chemically-synthesised counterparts. This review aims to present a general overview on surface-active agents, including their classification, where new types of these biomolecules may lay awaiting discovery, and some of the main bottlenecks for their industrial-scale production. In particular, the marine environment is highlighted as a largely untapped source for discovering new types of surface-active agents. Marine bacteria, especially those living associated with micro-algae (eukaryotic phytoplankton, are a highly promising source of polymeric surface-active agents with potential biotechnological applications. The high uronic acids content of these macromolecules has been linked to conferring them with amphiphilic qualities, and their high structural diversity and polyanionic nature endows them with the potential to exhibit a wide range of functional diversity. Production yields (e.g. by fermentation for most microbial surface-active agents have often been too low to meet the volume demands of industry, and this principally remains as the most important bottleneck for their further commercial development. However, new developments in recombinant and synthetic biology approaches can offer significant promise to alleviate this bottleneck. This review highlights a particular biotope in the marine environment that offers promise for discovering novel surface-active biomolecules, and gives a general overview on specific areas that researchers and the industry could focus work towards increasing the production yields of microbial surface

  15. Contribution of Adsorbed Protein Films to Nanoscopic Vibrations Exhibited by Bacteria Adhering through Ligand-Receptor Bonds.

    Science.gov (United States)

    Song, Lei; Sjollema, Jelmer; Norde, Willem; Busscher, Henk J; van der Mei, Henny C

    2015-09-29

    Bacteria adhering to surfaces exhibit nanoscopic vibrations that depend on the viscoelasticity of the bond. The quantification of the nanoscopic vibrations of bacteria adhering to surfaces provides new opportunities to better understand the properties of the bond through which bacteria adhere and the mechanisms by which they resist detachment. Often, however, bacteria do not adhere to bare surfaces but to adsorbed protein films, on which adhesion involves highly specific ligand-receptor binding next to nonspecific DLVO interaction forces. Here we determine the contribution of adsorbed salivary protein and fibronectin films to vibrations exhibited by adhering streptococci and staphylococci, respectively. The streptococcal strain used has the ability to adhere to adsorbed salivary proteins films through antigen I/II ligand-receptor binding, while the staphylococcal strain used adheres to adsorbed fibronectin films through a proteinaceous ligand-receptor bond. In the absence of ligand-receptor binding, electrostatic interactions had a large impact on vibration amplitudes of adhering bacteria on glass. On an adsorbed salivary protein film, vibration amplitudes of adhering streptococci depended on the film softness as determined by QCM-D and were reduced after film fixation using glutaraldehyde. On a relatively stiff fibronectin film, cross-linking the film in glutaraldehyde hardly reduced its softness, and accordingly fibronectin film softness did not contribute to vibration amplitudes of adhering staphylococci. However, fixation of the staphylococcus-fibronectin bond further decreased vibration amplitudes, while fixation of the streptococcus bond hardly impacted vibration amplitudes. Summarizing, this study shows that both the softness of adsorbed protein films and the properties of the bond between an adhering bacterium and an adsorbed protein film play an important role in bacterial vibration amplitudes. These nanoscopic vibrations reflect the viscoelasticity of the

  16. Traitement de surface par explosif du cuivre polycristallin : caractérisation microstructurale et comportement en fatigue plastique

    Science.gov (United States)

    Gerland, M.; Dufour, J. P.; Presles, H. N.; Violan, P.; Mendez, J.

    1991-10-01

    A new surface treatment technique with a primary explosive deposited in thin layer was applied to a polycrystalline pure copper. After treatment, surface roughness remains of high quality especially when compared to shot peened surfaces. The treated zone extends over several hundreds microns in depth and the microhardness profile exhibits a significant increasing of hardness with a maximum reaching 100% at the surface. The transmission electron microscopy shows a microstructure which changes with depth : below the surface, there is a thin recrystallized layer with very small grains followed by a region with numerous mechanical twins the density of which decreases when depth increases. Tested in fatigue with a constant plastic strain amplitude, the treated copper specimens exhibit a strong hardening from the first cycles compared to the untreated specimen ; however this initial hardening erases after 2% of the fatigue life. The fatigue resistance is not modified by the treatment. Une nouvelle technique de traitement de surface à l'aide d'un explosif primaire déposé en couche mince a été utilisée sur du cuivre pur polycristallin. L'état de surface après traitement reste de très bonne qualité, surtout comparé aux surfaces grenaillées. La zone traitée s'étend sur une profondeur de quelques centaines de microns et le profil de microdureté montre une importante augmentation de dureté avec un maximum en surface pouvant atteindre 100%. La micrcrostructure, observée par microscopie électronique en transmission, est caractérisée par une fine recristallisation en surface, puis par un abondant maclage dont la densité décroît lorsque la profondeur augmente. Testé en fatigue à déformation plastique imposée, le cuivre traité présente un fort écrouissage initial dès les premiers cycles, mais qui s'efface progressivement au cours du cyclage après 2% de la durée de vie, cette dernière n'étant pas modifiée par le traitement.

  17. Rigid multipodal platforms for metal surfaces

    Directory of Open Access Journals (Sweden)

    Michal Valášek

    2016-03-01

    Full Text Available In this review the recent progress in molecular platforms that form rigid and well-defined contact to a metal surface are discussed. Most of the presented examples have at least three anchoring units in order to control the spatial arrangement of the protruding molecular subunit. Another interesting feature is the lateral orientation of these foot structures which, depending on the particular application, is equally important as the spatial arrangement of the molecules. The numerous approaches towards assembling and organizing functional molecules into specific architectures on metal substrates are reviewed here. Particular attention is paid to variations of both, the core structures and the anchoring groups. Furthermore, the analytical methods enabling the investigation of individual molecules as well as monomolecular layers of ordered platform structures are summarized. The presented multipodal platforms bearing several anchoring groups form considerably more stable molecule–metal contacts than corresponding monopodal analogues and exhibit an enlarged separation of the functional molecules due to the increased footprint, as well as restrict tilting of the functional termini with respect to the metal surface. These platforms are thus ideally suited to tune important properties of the molecule–metal interface. On a single-molecule level, several of these platforms enable the control over the arrangement of the protruding rod-type molecular structures (e.g., molecular wires, switches, rotors, sensors with respect to the surface of the substrate.

  18. Characterization of technical surfaces by structure function analysis

    Science.gov (United States)

    Kalms, Michael; Kreis, Thomas; Bergmann, Ralf B.

    2018-03-01

    The structure function is a tool for characterizing technical surfaces that exhibits a number of advantages over Fourierbased analysis methods. So it is optimally suited for analyzing the height distributions of surfaces measured by full-field non-contacting methods. The structure function is thus a useful method to extract global or local criteria like e. g. periodicities, waviness, lay, or roughness to analyze and evaluate technical surfaces. After the definition of line- and area-structure function and offering effective procedures for their calculation this paper presents examples using simulated and measured data of technical surfaces including aircraft parts.

  19. Surface ferromagnetism and superconducting properties of nanocrystalline niobium nitride

    International Nuclear Information System (INIS)

    Shipra, R.; Kumar, Nitesh; Sundaresan, A.

    2013-01-01

    Nanocrystalline δ-NbN x samples have been synthesized by reacting NbCl 5 and urea at three different temperatures. A comparison of their structural, magnetic, transport and thermal properties is reported in the present study. The size of the particles and their agglomeration extent increase with increasing reaction temperature. The sample prepared at 900 °C showed the highest superconducting transition temperature (T c ) of 16.2 K with a transition width, ∼1.8 K, as obtained from the resistivity measurement on cold-pressed bars. Above T c , magnetization measurements revealed the presence of surface ferromagnetism which coexists with superconductivity below T c . Heat capacity measurements confirm superconductivity with strong electron–phonon coupling constant. The sample prepared at 800 °C shows a lower T c (10 K) while that prepared at 700 °C exhibit no superconductivity down to the lowest temperature (3 K) measured. - Highlights: ► Synthesis of δ-NbN nanoparticles by urea nitridation of NbCl 5 . ► Superconducting transition temperature (T c ) is 16.2 K. ► Superconductivity and surface ferromagnetism coexist in the nanoparticles. ► Effect of size and agglomeration on the physical properties of nanoparticles

  20. Designing Art Exhibitions in an Educational Virtual World

    Science.gov (United States)

    Julian, June; Crooks, Julian

    2011-01-01

    Demonstrating the multiple features of the Cerulean Gallery in Second Life, this research report showcases several exemplar exhibits created by students, artists, and museums. Located in The Educational Media Center, a Second Life teaching and social space, the Cerulean Gallery exhibits functioned as case studies that tested its effectiveness as…

  1. A novel method to prepare superhydrophobic, UV resistance and anti-corrosion steel surface

    KAUST Repository

    Isimjan, Tayirjan T.

    2012-11-01

    Both TiO 2 and SiO 2 coated steel surfaces containing micro- and nanoscale binary structures with different surface roughness were successfully fabricated by means of a facile layer by layer deposition process followed by heat treatment. The resulting surfaces were modified by the low free energy chemical PTES (1H,1H,2H,2H-Perfluorodecyltriethoxysilane). The experimental results of wettability exhibit that such modified surfaces have a strong repulsive force to water droplets, their static contact angles exceed 165°, receding angle>160°, advanced angles>170° and slide angle<1°. The resulting surfaces not only exhibit superhydrophobic properties but also show strong UV resistance (after coating SiO 2 on top of TiO 2) and strong stability to various solvents including 0.01% HCl solution. © 2012 Elsevier B.V.

  2. Corrosion resistance and cytocompatibility of tantalum-surface-functionalized biomedical ZK60 Mg alloy

    International Nuclear Information System (INIS)

    Jin, Weihong; Wang, Guomin; Lin, Zhengjie; Feng, Hongqing; Li, Wan; Peng, Xiang; Qasim, Abdul Mateen; Chu, Paul K.

    2017-01-01

    Highlights: • Films comprising Ta_2O_5, Ta suboxide, and Ta are sputter-deposited on ZK60 Mg alloy. • The Ta-containing film significantly mitigates degradation of ZK60. • The modified ZK60 exhibits notably enhanced cell adhesion and proliferation. - Abstract: Tantalum (Ta) is introduced to the surface of the ZK60 Mg alloy by reactive magnetron sputtering to enhance the corrosion resistance and cytocompatibility. The film thickness and composition, corrosion behavior, and cytocompatibility are studied by various techniques systematically. The surface layer composed of Ta_2O_5, Ta suboxide, and Ta increases the corrosion resistance of ZK60 while simultaneously improving cell attachment, spreading, and proliferation in vitro. The enhancement mechanism is proposed and discussed.

  3. Temperature dependence of the bulk and surface properties of liquid Zn-Cd alloys

    Energy Technology Data Exchange (ETDEWEB)

    Awe, O.E. [University of Ibadan, Department of Physics, Ibadan (Nigeria); Azeez, A.A. [African University of Science and Technology, Abuja (Nigeria)

    2017-05-15

    The effects of temperature on the bulk and surface properties of liquid Zn-Cd alloys have been theoretically investigated, using a combination of self association model, Darken's thermodynamic equation for diffusion, empirical model for viscosity and a statistical mechanics model. The results from this study show that change in temperature resulted in cross-over effects in bulk and surface properties. We also found that with an increase in temperature, a pronounced asymmetry of viscosity isotherm is significantly reduced, and viscosity isotherm exhibited anomalous behaviour. Our results reveal that the homocoordination tendency in Zn-Cd liquid alloys is not strong and reduces with increasing temperature. The study further suggests a pronounced segregation of Cd-atoms at the surface of Zn-Cd liquid alloys and the extent of segregation reduces with temperature. We as well found that, in addition to the reported understanding that size-factor determines the compositional location of asymmetry of the viscosity isotherm, temperature is an operating parameter that has effect, not only on the composition of asymmetry, but also on the magnitude of asymmetry. In all the properties investigated, the most pronounced effect of temperature (52.9 %) is on the viscosity while the least effect (7.1 %) is on the surface tension. (orig.)

  4. Influence of soil surface structure on simulated infiltration and subsequent evaporation

    International Nuclear Information System (INIS)

    Verplancke, H.; Hartmann, R.; Boodt, M. de

    1983-01-01

    A laboratory rainfall and evaporation experiment was conducted to study the effectiveness of the soil surface structure on infiltration and subsequent evaporation. The stability of the surface layer was improved through the application of synthetic additives such as bituminous emulsion and a prepolymer of polyurea (Uresol). The soil column where the soil surface was treated with a bituminous emulsion shows a decrease in depth of wetting owing to the water repellency of that additive, and consequently an increased runoff. However, the application of Uresol to the surface layer improved the infiltration. The main reason for these differences is that in the untreated soils there is a greater clogging of macropores originating from aggregate breakdown under raindrop impact in the top layer. The evaporation experiment started after all columns were wetted to a similar soil-water content and was carried out in a controlled environmental tunnel. Soil-water content profiles were established during evaporation by means of a fully automatic γ-ray scanner. It appears that in both treatments the cumulative evaporation was less than in the untreated soil. This was due to the effect of an aggregated and stabilized surface layer. Under a treated soil surface the evaporation remains constant during the whole experiment. However, under an untreated soil surface different evaporation stages were recorded. From these experiments the impression is gained that the effect of aggregating the soil surface is an increase of the saturated hydraulic conductivity under conditions near saturation. On the other hand, a finely structured layer exhibits a greater hydraulic conductivity during evaporation in the lower soil-water potential range than a coarsely aggregated layer. So it may be concluded that, to obtain the maximum benefit from the available water - optimal water conservation - much attention must be given to the aggregation of the top soil and its stability. (author)

  5. The Inability to Screen Exhibition Swine for Influenza A Virus Using Body Temperature.

    Science.gov (United States)

    Bowman, A S; Nolting, J M; Workman, J D; Cooper, M; Fisher, A E; Marsh, B; Forshey, T

    2016-02-01

    Agricultural fairs create an unconventional animal-human interface that has been associated with swine-to-human transmission of influenza A virus (IAV) in recent years. Early detection of IAV-infected pigs at agricultural fairs would allow veterinarians to better protect swine and human health during these swine exhibitions. This study assessed the use of swine body temperature measurement, recorded by infrared and rectal thermometers, as a practical method to detect IAV-infected swine at agricultural fairs. In our first objective, infrared thermometers were used to record the body surface temperature of 1,092 pigs at the time of IAV nasal swab collection at the end of the exhibition period of 55 agricultural fairs. IAV was recovered from 212 (19.4%) pigs, and the difference in mean infrared body temperature measurement of IAV-positive and IAV-negative pigs was 0.83°C. In a second objective, snout wipes were collected from 1,948 pigs immediately prior to the unloading of the animals at a single large swine exhibition. Concurrent to the snout wipe collection, owners took the rectal temperatures of his/her pigs. In this case, 47 (2.4%) pigs tested positive for IAV before they entered the swine barn. The mean rectal temperatures differed by only 0.19°C between IAV-positive and IAV-negative pigs. The low prevalence of IAV among the pigs upon entry to the fair in the second objective provides evidence that limiting intraspecies spread of IAV during the fairs will likely have significant impacts on the zoonotic transmission. However, in both objectives, the high degree of similarity in the body temperature measurements between the IAV-positive and IAV-negative pigs made it impossible to set a diagnostically meaningful cut point to differentiate IAV status of the individual animals. Unfortunately, body temperature measurement cannot be used to accurately screen exhibition swine for IAV. © 2015 Blackwell Verlag GmbH.

  6. Switchable Hydrophobic-Hydrophilic Surfaces

    CERN Document Server

    Bunker, B C; Huber, D L; Kent, M S; Kushmerick, J G; Lopez, G P; Manginell, R P; Méndez, S E; Yim, H

    2002-01-01

    Tethered films of poly n-isopropylacrylamide (PNIPAM) films have been developed as materials that can be used to switch the chemistry of a surface in response to thermal activation. In water, PNIPAM exhibits a thermally-activated phase transition that is accompanied by significant changes in polymer volume, water contact angle, and protein adsorption characteristics. New synthesis routes have been developed to prepare PNIPAM films via in-situ polymerization on self-assembled monolayers. Swelling transitions in tethered films have been characterized using a wide range of techniques including surface plasmon resonance, attenuated total reflectance infrared spectroscopy, interfacial force microscopy, neutron reflectivity, and theoretical modeling. PNIPAM films have been deployed in integrated microfluidic systems. Switchable PNIPAM films have been investigated for a range of fluidic applications including fluid pumping via surface energy switching and switchable protein traps for pre-concentrating and separating...

  7. Exhibition: Linus Pauling and the Twentieth Century

    CERN Document Server

    2003-01-01

    On April 28 the exhibit Linus Pauling and the Twentieth Century organised by UNIDIR (United Nations Institute for Disarmament Research) and SGI (Soka Gakkai International) as well as with the contributions of CERN and the University of Geneva, opened at the United Nations Office of Geneva. Linus Pauling is the only person to date to have won two unshared Nobel Prizes: Chemistry in 1954 and Peace in 1962. The first was awarded for his landmark research on the nature of the chemical bond and its application in understanding the structure of complex substances. The second one acknowledged his courageous protest against atmospheric nuclear testing and his championship of international peace. The exhibit, for audience of all ages, traces seven decades of Linus Pauling's life and influence on the 20th century. Before starting its European tour at the UNESCO headquarters in Paris, the exhibit opened in 1998 in San Francisco and then travelled within the United-States and to Japan with an attendance of more than one...

  8. Exhibition: Linus Pauling and the Twentieth Century

    CERN Document Server

    2003-01-01

    On April 28 the exhibit Linus Pauling and the Twentieth Century organised by UNIDIR (United Nations Institute for Disarmament Research) and SGI (Soka Gakkai International) as well as with the contributions of CERN and the University of Geneva, opens at the United Nations Office of Geneva. Linus Pauling is the only person to date to have won two unshared Nobel Prizes: Chemistry in 1954 and Peace in 1962. The first was awarded for his landmark research on the nature of the chemical bond and its application in understanding the structure of complex substances. The second one acknowledged his courageous protest against atmospheric nuclear testing and his championship of international peace. The exhibit, for all ages' audiences, traces seven decades of Linus Pauling's life and influence on the 20th century. Before starting its European tour at the UNESCO headquarters in Paris, the exhibit opened in 1998 in San Francisco and then travelled within the United-States and to Japan with an attendance of more than one m...

  9. “Draw me a physicist” exhibition opens

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    From 12 to 23 June, the Globe of Science and Innovation will be hosting the “Draw me a physicist” exhibition: over 160 drawings and definitions that illustrate how children see the world of research.   In a child’s imagination, scientists are colourful, slightly eccentric figures with unusual powers. This is what emerges from the exhibition on the second floor of the Globe of Science and Innovation, opening on 12 June. “Draw me a physicist” brings together 160 drawings and definitions by children about the profession of research scientist. The exhibition is the result of a six-month project by CERN and 20 primary school classes from the Pays de Gex and the communes of Meyrin, Satigny and Vernier. Some 400 schoolchildren aged 9 to 11 were asked in class to make drawings and come up with definitions of a physicist. Subsequently they came to CERN, visited one of the Laboratory’s sites, and met and interviewed some physicists. They used t...

  10. Enhanced pool boiling critical heat flux induced by capillary wicking effect of a Cr-sputtered superhydrophilic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Son, Hong Hyun; Seo, Gwang Hyeok; Kim, Sung Joong [Hanyang University, Seoul (Korea, Republic of)

    2016-10-15

    In light of boiling heat transfer, the smooth surface potentially reduces active nucleation of bubbles and rewetting of dry spots near the critical heat flux (CHF). This kind of process is highly likely to deteriorate the CHF. Thus, it is essential to produce appropriate microstructures on the surface for the enhancement of the CHF. In this study, to investigate the microstructural effect of thin film-fabricated surfaces on the pool boiling CHF, we controlled the surface roughness in a narrow range of 0.1-0.25 μm and its morphologies, in the form of micro-scratches using PVD sputtering technique. Specifically for DC magnetron sputtering, pure chromium (Cr) was selected as a target material owing to its high oxidation resistance. In order to analyze the CHF trend with changes in roughness, we introduced existing capillary wicking-based models because superhydrophilic characteristics of microstructures are highly related to the capillary wicking behaviors in micro-flow channels. After Cr sputtering under given conditions, the Cr-sputtered surfaces showed superhydrophilic characteristics and its capability became more enhanced with an increase of surface roughness. Judging from spreading behavior of a liquid droplet, the presence of micro-wicking channels, coupled with Cr nanostructures, effectively enhanced the advancing rate of drop base diameter. The CHF exhibited an increasing trend with increasing surface roughness. However, the enhancement ratio agreed poorly with the predictions of the roughness factor-based models, all of which originated from a conventional static force balance.

  11. Analysis of surface contaminants on beryllium and aluminum windows

    International Nuclear Information System (INIS)

    Gmur, N.F.

    1987-06-01

    An effort has been made to document the types of contamination which form on beryllium window surfaces due to interaction with a synchrotron radiation beam. Beryllium windows contaminated in a variety of ways (exposure to water and air) exhibited surface powders, gels, crystals and liquid droplets. These contaminants were analyzed by electron diffraction, electron energy loss spectroscopy, energy dispersive x-ray spectroscopy and wet chemical methods. Materials found on window surfaces include beryllium oxide, amorphous carbon, cuprous oxide, metallic copper and nitric acid. Aluminum window surface contaminants were also examined

  12. Laminar boundary layer response to rotation of a finite diameter surface patch

    International Nuclear Information System (INIS)

    Klewicki, J.C.; Hill, R.B.

    2003-01-01

    The responses of the flat plate laminar boundary layer to perturbations generated by rotating a finite patch of the bounding surface are explored experimentally. The size of the surface patch was of the same order as the boundary layer thickness. The displacement thickness Reynolds number range of the boundary layers explored was 72-527. The rotation rates of the surface patch ranged from 2.14 to 62.8 s-1. Qualitative flow visualizations and quantitative molecular tagging velocimetry measurements revealed that rotation of a finite surface patch generates an asymmetric loop-like vortex. Significant features of this vortex include that, (i) the sign of the vorticity in the vortex head is opposite that of the boundary layer vorticity regardless of the sign of the input rotation, (ii) one leg of the vortex exhibits motion akin to solid body rotation while the other leg is best characterized as a spanwise shear layer, (iii) the vortex leg exhibiting near solid body rotation lifts more rapidly from the surface than the leg more like a shear layer, and (iv) the vortex leg exhibiting near solid body rotation always occurs on the side of the surface patch experiencing downstream motion. These asymmetries switch sides depending on the sign of the input rotation. The present results are interpreted and discussed relative to analytical solutions for infinite geometries. By way of analogy, plausible connections are drawn between the present results and the influences of wall normal vortices in turbulent boundary layer flows

  13. Exhibition: Fibre optics, the future is at hand

    CERN Multimedia

    Anaïs Schaeffer

    2012-01-01

    Until 20 June, the Pont de la Machine in Geneva will host an exhibition on fibre optics, sponsored by SIG. CERN, a major user of this technology, was invited to take part with a presentation of some of its scintillating fibre detectors.   The CERN module, designed for the SIG's fibre optics exhibition. Visitors can discover a cosmic ray detector (on the right) and its oscilloscope (on the left), as well as one of the ALFA detector modules (at the back). The Services industriels genevois (SIG), who are in the process of deploying an optical fibre network in Geneva, have decided to showcase this technology with an exhibition entitled “Fibre optique – Le futur à portée de main.” The exhibition, which will be open to the public from 26 April to 20 June, is being held at the Espace ExpoSIG, at the Pont de la Machine in the centre of Geneva. “CERN’s Physics Department was approached by SIG at the start of this year to ...

  14. Surface dependency in thermodynamics of ideal gases

    International Nuclear Information System (INIS)

    Sisman, Altug

    2004-01-01

    The Casimir-like size effect rises in ideal gases confined in a finite domain due to the wave character of atoms. By considering this effect, thermodynamic properties of an ideal gas confined in spherical and cylindrical geometries are derived and compared with those in rectangular geometry. It is seen that an ideal gas exhibits an unavoidable quantum surface free energy and surface over volume ratio becomes a control variable on thermodynamic state functions in microscale. Thermodynamics turns into non-extensive thermodynamics and geometry difference becomes a driving force since the surface over volume ratio depends on the geometry

  15. 75 FR 3862 - Photography in Public Exhibit Space

    Science.gov (United States)

    2010-01-25

    ...NARA has revised its regulations on the use of film, photographic and videotape equipment inside the National Archives Building in Washington, DC. Filming, photographing, and videotaping for personal use will be prohibited in exhibits of the National Archives Experience (NAE) in Washington, DC, including the Declaration of Independence, the Constitution and the Bill of Rights (known as the Charters of Freedom) in the Rotunda of the National Archives Building. In 2003 NARA installed exhibit cases for displaying the Charters and other NAE documents to provide better clarity for viewing the exhibits. NARA seeks to ensure the necessary protection for the documents from the cumulative effects of photographic flash and to enhance the overall visitor experience.

  16. Investigation of back surface fields effect on bifacial solar cells

    Science.gov (United States)

    Sepeai, Suhaila; Sulaiman, M. Y.; Sopian, Kamaruzzaman; Zaidi, Saleem H.

    2012-11-01

    A bifacial solar cell, in contrast with a conventional monofacial solar cell, produces photo-generated current from both front and back sides. Bifacial solar cell is an attractive candidate for enhancing photovoltaic (PV) market competitiveness as well as supporting the current efforts to increase efficiency and lower material costs. This paper reports on the fabrication of bifacial solar cells using phosphorus-oxytrichloride (POCl3) emitter formation on p-type, nanotextured silicon (Si) wafer. Backside surface field was formed through Al-diffusion using conventional screen-printing process. Bifacial solar cells with a structure of n+pp+ with and without back surface field (BSF) were fabricated in which silicon nitride (SiN) anti reflection and passivation films were coated on both sides, followed by screen printing of Argentum (Ag) and Argentum/Aluminum (Ag/Al) on front and back contacts, respectively. Bifacial solar cells without BSF exhibited open circuit voltage (VOC) of 535 mV for front and 480 mV for back surface. With Al-alloyed BSF bifacial solar cells, the VOC improved to 580 mV for the front surface and 560 mV for the back surface. Simulation of bifacial solar cells using PC1D and AFORS software demonstrated good agreement with experimental results. Simulations showed that best bifacial solar cells are achieved through a combination of high lifetime wafer, low recombination back surface field, reduced contact resistance, and superior surface passivation.

  17. Spiraling contaminant electrons increase doses to surfaces outside the photon beam of an MRI-linac with a perpendicular magnetic field.

    Science.gov (United States)

    Hackett, Sara L; van Asselen, Bram; Wolthaus, Jochem W H; Bluemink, J J; Ishakoglu, Kübra; Kok, Jan G M; Lagendijk, Jan J W; Raaymakers, Bas W

    2018-03-29

    The transverse magnetic field of an MRI-linac sweeps contaminant electrons away from the radiation beam. Films oriented perpendicular to the magnetic field and 5cm from the radiation beam edge show a projection of the divergent beam, indicating that contaminant electrons spiral along magnetic field lines and deposit dose on surfaces outside the primary beam perpendicular to the magnetic field. These spiraling contaminant electrons (SCE) could increase skin doses to protruding regions of the patient along the cranio-caudal axis. This study investigated doses from SCE for an MRI-linac comprising a 7MV linac and a 1.5T MRI scanner. Surface doses to films perpendicular to the magnetic field and 5cm from the radiation beam edge showed increased dose within the projection of the primary beam, whereas films parallel to the magnetic field and 5cm from the beam edge showed no region of increased dose. However, the dose from contaminant electrons is absorbed within a few millimeters. For large fields, the SCE dose is within the same order of magnitude as doses from scattered and leakage photons. Doses for both SCE and scattered photons decrease rapidly with decreasing beam size and increasing distance from the beam edge. © 2018 Institute of Physics and Engineering in Medicine.

  18. Increased short circuit current in organic photovoltaic using high-surface area electrode based on ZnO nanowires decorated with CdTe quantum dots.

    Science.gov (United States)

    Aga, R S; Gunther, D; Ueda, A; Pan, Z; Collins, W E; Mu, R; Singer, K D

    2009-11-18

    A photosensitized high-surface area transparent electrode has been employed to increase the short circuit current of a photovoltaic device with a blend of poly(3-hexylthiophene) (P3HT) and (6,6)-phenyl C61 butyric acid methyl ester (PCBM) as the active layer. This is achieved by directly growing ZnO nanowires on indium tin oxide (ITO) film via a physical vapor method. The nanowire surface is then decorated with CdTe quantum dots by pulsed electron-beam deposition (PED). The nanowires alone provided a 20-fold increase in the short circuit current under visible light illumination. This was further increased by a factor of approximately 1.5 by the photosensitization effect of CdTe, which has an optical absorption of up to 820 nm.

  19. Dynamic contact angle cycling homogenizes heterogeneous surfaces.

    Science.gov (United States)

    Belibel, R; Barbaud, C; Mora, L

    2016-12-01

    In order to reduce restenosis, the necessity to develop the appropriate coating material of metallic stent is a challenge for biomedicine and scientific research over the past decade. Therefore, biodegradable copolymers of poly((R,S)-3,3 dimethylmalic acid) (PDMMLA) were prepared in order to develop a new coating exhibiting different custom groups in its side chain and being able to carry a drug. This material will be in direct contact with cells and blood. It consists of carboxylic acid and hexylic groups used for hydrophilic and hydrophobic character, respectively. The study of this material wettability and dynamic surface properties is of importance due to the influence of the chemistry and the potential motility of these chemical groups on cell adhesion and polymer kinetic hydrolysis. Cassie theory was used for the theoretical correction of contact angles of these chemical heterogeneous surfaces coatings. Dynamic Surface Analysis was used as practical homogenizer of chemical heterogeneous surfaces by cycling during many cycles in water. In this work, we confirmed that, unlike receding contact angle, advancing contact angle is influenced by the difference of only 10% of acidic groups (%A) in side-chain of polymers. It linearly decreases with increasing acidity percentage. Hysteresis (H) is also a sensitive parameter which is discussed in this paper. Finally, we conclude that cycling provides real information, thus avoiding theoretical Cassie correction. H(10)is the most sensible parameter to %A. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. The Effect of Increasing Surface Albedo on Urban Climate and Air Quality: A Detailed Study for Sacramento, Houston, and Chicago

    Directory of Open Access Journals (Sweden)

    Zahra Jandaghian

    2018-03-01

    Full Text Available Increasing surface reflectivity in urban areas can decrease ambient temperature, resulting in reducing photochemical reaction rates, reducing cooling energy demands and thus improving air quality and human health. The weather research and forecasting model with chemistry (WRF-Chem is coupled with the multi-layer of the urban canopy model (ML-UCM to investigate the effects of surface modification on urban climate in a two-way nested approach over North America focusing on Sacramento, Houston, and Chicago during the 2011 heat wave period. This approach decreases the uncertainties associated with scale separation and grid resolution and equip us with an integrated simulation setup to capture the full impacts of meteorological and photochemical reactions. WRF-ChemV3.6.1 simulated the diurnal variation of air temperature reasonably well, overpredicted wind speed and dew point temperature, underpredicted relative humidity, overpredicted ozone and nitrogen dioxide concentrations, and underpredicted fine particular matters (PM2.5. The performance of PM2.5 is a combination of overprediction of particulate sulfate and underprediction of particulate nitrate and organic carbon. Increasing the surface albedo of roofs, walls, and pavements from 0.2 to 0.65, 0.60, and 0.45, respectively, resulted in a decrease in air temperature by 2.3 °C in urban areas and 0.7 °C in suburban areas; a slight increase in wind speed; an increase in relative humidity (3% and dew point temperature (0.3 °C; a decrease of PM2.5 and O3 concentrations by 2.7 µg/m3 and 6.3 ppb in urban areas and 1.4 µg/m3 and 2.5 ppb in suburban areas, respectively; minimal changes in PM2.5 subspecies; and a decrease of nitrogen dioxide (1 ppb in urban areas.

  1. A quantitative AFM analysis of nano-scale surface roughness in various orthodontic brackets.

    Science.gov (United States)

    Lee, Gi-Ja; Park, Ki-Ho; Park, Young-Guk; Park, Hun-Kuk

    2010-10-01

    In orthodontics, the surface roughnesses of orthodontic archwire and brackets affect the effectiveness of arch-guided tooth movement, corrosion behavior, and the aesthetics of orthodontic components. Atomic force microscopy (AFM) measurements were used to provide quantitative information on the surface roughness of the orthodontic material. In this study, the changes in surface roughness of various orthodontic bracket slots before and after sliding movement of archwire in vitro and in vivo were observed through the utilization of AFM. Firstly, we characterized the surface of four types of brackets slots as follows: conventional stainless steel (Succes), conventional ceramic (Perfect), self-ligating stainless steel (Damon) and self-ligating ceramic (Clippy-C) brackets. Succes) and Damon brackets showed relatively smooth surfaces, while Perfect had the roughest surface among the four types of brackets used. Secondly, after in vitro sliding test with beta titanium wire in two conventional brackets (Succes and Perfect), there were significant increases in only stainless steel bracket, Succes. Thirdly, after clinical orthodontic treatment for a maximum of 2 years, the self-ligating stainless steel bracket, Damon, showed a significant increase in surface roughness. But self-ligating ceramic brackets, Clippy-C, represented less significant changes in roughness parameters than self-ligating stainless steel ones. Based on the results of the AFM measurements, it is suggested that the self-ligating ceramic bracket has great possibility to exhibit less friction and better biocompatibility than the other tested brackets. This implies that these bracket slots will aid in the effectiveness of arch-guided tooth movement.

  2. Surface morphology of homoepitaxial GaN grown on non- and semipolar GaN substrates

    Energy Technology Data Exchange (ETDEWEB)

    Wernicke, Tim; Hoffmann, Veit; Netzel, Carsten; Knauer, Arne; Weyers, Markus [FBH, Berlin (Germany); Ploch, Simon; Rass, Jens [Institute of Solid State Physics, TU Berlin (Germany); Schade, Lukas; Schwarz, Ulrich [IAF, Freiburg (Germany); Kneissl, Michael [FBH, Berlin (Germany); Institute of Solid State Physics, TU Berlin (Germany)

    2010-07-01

    Recently a number of groups have reported laser diodes in the green spectral range on semi- and nonpolar GaN. Nevertheless the growth process on semipolar surfaces is not well understood. In this study 3.5 {mu} m thick MOVPE grown GaN layers on bulk m-plane, (11 anti 22), (10 anti 12), and (10 anti 11) GaN substrates were investigated. XRD rocking curves exhibit a FWHM of less than 150{sup ''}, indicating excellent crystalline quality. But the surface morphology exhibits hillocks with a height of 1 {mu}m and lateral extension of 150 {mu}m in many cases. Depending on the substrate orientation and the growth temperature different hillock shapes were observed. Morphology and luminescence data point to threading dislocations as formation sources. In QWs the hillock structure is reproduced in the emission intensity and wavelength distribution on (10 anti 11) but not on the m-plane surfaces. The hillocks could be eliminated for the semipolar planes (not for the m-plane) by increasing the reactor pressure and lowering the growth temperature. Hillock free separate confinement laser structures emitting at 405 nm feature a very homogeneous luminescence in micro-PL and show amplified spontaneous emission under high power stripe excitation. Furthermore the In incorporation was found to be highest in QWs on (10 anti 11).

  3. Changes in Land Surface Water Dynamics since the 1990s and Relation to Population Pressure

    Science.gov (United States)

    Prigent, C.; Papa, F.; Aires, F.; Jimenez, C.; Rossow, W. B.; Matthews, E.

    2012-01-01

    We developed a remote sensing approach based on multi-satellite observations, which provides an unprecedented estimate of monthly distribution and area of land-surface open water over the whole globe. Results for 1993 to 2007 exhibit a large seasonal and inter-annual variability of the inundation extent with an overall decline in global average maximum inundated area of 6% during the fifteen-year period, primarily in tropical and subtropical South America and South Asia. The largest declines of open water are found where large increases in population have occurred over the last two decades, suggesting a global scale effect of human activities on continental surface freshwater: denser population can impact local hydrology by reducing freshwater extent, by draining marshes and wetlands, and by increasing water withdrawals. Citation: Prigent, C., F. Papa, F. Aires, C. Jimenez, W. B. Rossow, and E. Matthews (2012), Changes in land surface water dynamics since the 1990s and relation to population pressure, in section 4, insisting on the potential applications of the wetland dataset.

  4. Surface active properties of lipid nanocapsules.

    Directory of Open Access Journals (Sweden)

    Celia R A Mouzouvi

    Full Text Available Lipid nanocapsules (LNCs are biomimetic nanocarriers used for the encapsulation of a broad variety of active ingredients. Similar to surface active compounds, LNCs contain both hydrophilic and hydrophobic parts in their structure. Moreover, the components of LNCs, macrogol 15 hydroxystearate (MHS and lecithin, are known for their surface active properties. Therefore, the aim of this paper was to investigate the capability of the LNCs to decrease surface tension using two techniques: drop tensiometry and the Wilhelmy plate method. LNCs with diameters ranging from 30 to 100 nm were successfully obtained using a phase inversion technique. The LNCs' properties, such as size and zeta potential, depend on the composition. LNCs exhibit a lower limiting surface tension compared to MHS (34.8-35.0 mN/m and 37.7-38.8 mN/m, respectively, as confirmed by both drop tensiometry and the Wilhelmy plate method. LNCs have exhibited a saturated interfacial concentration (SIC that was 10-fold higher than the critical micellar concentration (CMC of MHS or the SIC of binary and ternary mixtures of LNC ingredients. The SIC of the LNC formulations depended on the mass mixing ratio of the MHS/triglycerides but not on the presence of lecithin. The CMC/SIC values measured by the Wilhelmy plate method were higher than those obtained using drop tensiometry because of the longer duration of the tensiometry measurement. In conclusion, the surfactant-like properties of the LNCs offer new possibilities for medical and pharmaceutical applications.

  5. Secapin, a bee venom peptide, exhibits anti-fibrinolytic, anti-elastolytic, and anti-microbial activities.

    Science.gov (United States)

    Lee, Kwang Sik; Kim, Bo Yeon; Yoon, Hyung Joo; Choi, Yong Soo; Jin, Byung Rae

    2016-10-01

    Bee venom contains a variety of peptide constituents that have various biological, toxicological, and pharmacological actions. However, the biological actions of secapin, a venom peptide in bee venom, remain largely unknown. Here, we provide the evidence that Asiatic honeybee (Apis cerana) secapin (AcSecapin-1) exhibits anti-fibrinolytic, anti-elastolytic, and anti-microbial activities. The recombinant mature AcSecapin-1 peptide was expressed in baculovirus-infected insect cells. AcSecapin-1 functions as a serine protease inhibitor-like peptide that has inhibitory effects against plasmin, elastases, microbial serine proteases, trypsin, and chymotrypsin. Consistent with these functions, AcSecapin-1 inhibited the plasmin-mediated degradation of fibrin to fibrin degradation products, thus indicating the role of AcSecapin-1 as an anti-fibrinolytic agent. AcSecapin-1 also inhibited both human neutrophil and porcine pancreatic elastases. Furthermore, AcSecapin-1 bound to bacterial and fungal surfaces and exhibited anti-microbial activity against fungi and gram-positive and gram-negative bacteria. Taken together, our data demonstrated that the bee venom peptide secapin has multifunctional roles as an anti-fibrinolytic agent during fibrinolysis and an anti-microbial agent in the innate immune response. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Mechanism and Characteristics of Humidity Sensing with Polyvinyl Alcohol-Coated Fiber Surface Plasmon Resonance Sensor.

    Science.gov (United States)

    Shao, Yu; Wang, Ying; Cao, Shaoqing; Huang, Yijian; Zhang, Longfei; Zhang, Feng; Liao, Changrui; Wang, Yiping

    2018-06-25

    A surface plasmon resonance (SPR) sensor based on a side-polished single mode fiber coated with polyvinyl alcohol (PVA) is demonstrated for relative humidity (RH) sensing. The SPR sensor exhibits a resonant dip in the transmission spectrum in ambient air after PVA film coating, and the resonant wavelength shifts to longer wavelengths as the thickness of the PVA film increases. When RH changes, the resonant dip of the sensor with different film-thicknesses exhibits interesting characteristics for optical spectrum evolution. For sensors with initial wavelengths between 550 nm and 750 nm, the resonant dip shifts to longer wavelengths with increasing RH. The averaged sensitivity increases firstly and then drops, and shows a maximal sensitivity of 1.01 nm/RH%. Once the initial wavelength of the SPR sensor exceeds 850 nm, an inflection point of the resonant wavelength shift can be observed with RH increasing, and the resonant dip shifts to shorter wavelengths for RH values exceeding this point, and sensitivity as high as −4.97 nm/RH% can be obtained in the experiment. The sensor is expected to have potential applications in highly sensitive and cost effective humidity sensing.

  7. Mechanism and Characteristics of Humidity Sensing with Polyvinyl Alcohol-Coated Fiber Surface Plasmon Resonance Sensor

    Directory of Open Access Journals (Sweden)

    Yu Shao

    2018-06-01

    Full Text Available A surface plasmon resonance (SPR sensor based on a side-polished single mode fiber coated with polyvinyl alcohol (PVA is demonstrated for relative humidity (RH sensing. The SPR sensor exhibits a resonant dip in the transmission spectrum in ambient air after PVA film coating, and the resonant wavelength shifts to longer wavelengths as the thickness of the PVA film increases. When RH changes, the resonant dip of the sensor with different film-thicknesses exhibits interesting characteristics for optical spectrum evolution. For sensors with initial wavelengths between 550 nm and 750 nm, the resonant dip shifts to longer wavelengths with increasing RH. The averaged sensitivity increases firstly and then drops, and shows a maximal sensitivity of 1.01 nm/RH%. Once the initial wavelength of the SPR sensor exceeds 850 nm, an inflection point of the resonant wavelength shift can be observed with RH increasing, and the resonant dip shifts to shorter wavelengths for RH values exceeding this point, and sensitivity as high as −4.97 nm/RH% can be obtained in the experiment. The sensor is expected to have potential applications in highly sensitive and cost effective humidity sensing.

  8. Maintaining students’ Speaking Fluency through Exhibition Examination in Sociolinguistic Studies

    Directory of Open Access Journals (Sweden)

    Khusnul Qhotimah Yuliatuty

    2013-07-01

    Full Text Available Using exhibition for the final project in Sociolinguistic study is really interesting for Universitas Siswa Bangsa Internasional students, especially for 2011 English Department students. Exhibition becomes interesting because this is the new thing to conduct the final project for English Department students’ cohort 2011 at Universitas Siswa Bangsa Internasional. The lecturer divides the students into pairs and each pairs should master one content or topic in Sociolinguistic study.  The students will do the exhibition about the topic that they get in a pairs. The lecturer also gives the students rubric sheet to fill by the visitors. The exhibition will make the students prepare themselves well because they will face many questions about the content which will be delivered by them. Beside, this exhibition also maintains students’ fluency in speaking English because they will explain and answer the questions from visitors with English. This paper tries to focus on how exhibition examination can maintain students’ fluency in speaking English.

  9. Electrostatic attraction between overall neutral surfaces.

    Science.gov (United States)

    Adar, Ram M; Andelman, David; Diamant, Haim

    2016-08-01

    Two overall neutral surfaces with positively and negatively charged domains ("patches") have been shown in recent experiments to exhibit long-range attraction when immersed in an ionic solution. Motivated by the experiments, we calculate analytically the osmotic pressure between such surfaces within the Poisson-Boltzmann framework, using a variational principle for the surface-averaged free energy. The electrostatic potential, calculated beyond the linear Debye-Hückel theory, yields an overall attraction at large intersurface separations, over a wide range of the system's controlled length scales. In particular, the attraction is stronger and occurs at smaller separations for surface patches of larger size and charge density. In this large patch limit, we find that the attraction-repulsion crossover separation is inversely proportional to the square of the patch-charge density and to the Debye screening length.

  10. Secondary electron emission from textured surfaces

    Science.gov (United States)

    Huerta, C. E.; Patino, M. I.; Wirz, R. E.

    2018-04-01

    In this work, a Monte Carlo model is used to investigate electron induced secondary electron emission for varying effects of complex surfaces by using simple geometric constructs. Geometries used in the model include: vertical fibers for velvet-like surfaces, tapered pillars for carpet-like surfaces, and a cage-like configuration of interlaced horizontal and vertical fibers for nano-structured fuzz. The model accurately captures the secondary electron emission yield dependence on incidence angle. The model shows that unlike other structured surfaces previously studied, tungsten fuzz exhibits secondary electron emission yield that is independent of primary electron incidence angle, due to the prevalence of horizontally-oriented fibers in the fuzz geometry. This is confirmed with new data presented herein of the secondary electron emission yield of tungsten fuzz at incidence angles from 0-60°.

  11. Water at surfaces with tunable surface chemistries

    Science.gov (United States)

    Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

    2018-03-01

    Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

  12. Surface modification of electrospun PLGA scaffold with collagen for bioengineered skin substitutes

    Energy Technology Data Exchange (ETDEWEB)

    Sadeghi, A.R., E-mail: sadeghi_av@ymail.com [Materials Research Group, Iranian Academic Center for Education, Culture and Research, (ACECR), Mashhad Branch, Mashhad (Iran, Islamic Republic of); Nokhasteh, S. [Materials Research Group, Iranian Academic Center for Education, Culture and Research, (ACECR), Mashhad Branch, Mashhad (Iran, Islamic Republic of); Molavi, A.M. [Materials Research Group, Iranian Academic Center for Education, Culture and Research, (ACECR), Mashhad Branch, Mashhad (Iran, Islamic Republic of); Materials Engineering Department, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Khorsand-Ghayeni, M. [Materials Research Group, Iranian Academic Center for Education, Culture and Research, (ACECR), Mashhad Branch, Mashhad (Iran, Islamic Republic of); Naderi-Meshkin, H. [Stem Cell and Regenerative Medicine Research Department, Iranian Academic Center for Education, Culture and Research (ACECR), Mashhad Branch, Mashhad (Iran, Islamic Republic of); Mahdizadeh, A. [Nanotechnology Institute, University of Sistan and Baluchestan, Zahedan (Iran, Islamic Republic of)

    2016-09-01

    In skin tissue engineering, surface feature of the scaffolds plays an important role in cell adhesion and proliferation. In this study, non-woven fibrous substrate based on poly (lactic-co-glycolic acid) (PLGA) (75/25) were hydrolyzed in various concentrations of NaOH (0.05 N, 0.1 N, 0.3 N) to increase carboxyl and hydroxyl groups on the fiber surfaces. These functional groups were activated by EDC/NHS to create chemical bonding with collagen. To improve bioactivity, the activated substrates were coated with a collagen solution (2 mg/ml) and cross-linking was carried out using the EDC/NHS in MES buffer. The effectiveness of the method was evaluated by contact angle measurements, porosimetry, scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR), tensile and degradation tests as well as in vitro cell attachment and cytotoxicity assays. Cell culture results of human dermal fibroblasts (HDF) and keratinocytes cell line (HaCat) revealed that the cells could attach to the scaffold. Further investigation with MTT assay showed that the cell proliferation of HaCat significantly increases with collagen coating. It seems that sufficient stability of collagen on the surface due to proper chemical bonding and cross-linking has increased the bioactivity of surface remarkably which can be promising for bioengineered skin applications. - Highlights: • Surface activation was carried out by hydrolysis of PLGA fibers. • To improve bioactivity, the activated samples were coated with a collagen solution. • Functional groups were activated by EDC/NHS to create chemical bonding with collagen. • Cross-linking of collagen was carried out using EDC/NHS in MES buffer. • The coated samples exhibited better adhesion and proliferation of epidermal cells.

  13. Surface modification of electrospun PLGA scaffold with collagen for bioengineered skin substitutes

    International Nuclear Information System (INIS)

    Sadeghi, A.R.; Nokhasteh, S.; Molavi, A.M.; Khorsand-Ghayeni, M.; Naderi-Meshkin, H.; Mahdizadeh, A.

    2016-01-01

    In skin tissue engineering, surface feature of the scaffolds plays an important role in cell adhesion and proliferation. In this study, non-woven fibrous substrate based on poly (lactic-co-glycolic acid) (PLGA) (75/25) were hydrolyzed in various concentrations of NaOH (0.05 N, 0.1 N, 0.3 N) to increase carboxyl and hydroxyl groups on the fiber surfaces. These functional groups were activated by EDC/NHS to create chemical bonding with collagen. To improve bioactivity, the activated substrates were coated with a collagen solution (2 mg/ml) and cross-linking was carried out using the EDC/NHS in MES buffer. The effectiveness of the method was evaluated by contact angle measurements, porosimetry, scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR), tensile and degradation tests as well as in vitro cell attachment and cytotoxicity assays. Cell culture results of human dermal fibroblasts (HDF) and keratinocytes cell line (HaCat) revealed that the cells could attach to the scaffold. Further investigation with MTT assay showed that the cell proliferation of HaCat significantly increases with collagen coating. It seems that sufficient stability of collagen on the surface due to proper chemical bonding and cross-linking has increased the bioactivity of surface remarkably which can be promising for bioengineered skin applications. - Highlights: • Surface activation was carried out by hydrolysis of PLGA fibers. • To improve bioactivity, the activated samples were coated with a collagen solution. • Functional groups were activated by EDC/NHS to create chemical bonding with collagen. • Cross-linking of collagen was carried out using EDC/NHS in MES buffer. • The coated samples exhibited better adhesion and proliferation of epidermal cells.

  14. Surface properties of functional polymer systems

    Science.gov (United States)

    Wong, Derek

    Polymer surface modification typically involves blending with other polymers or chemical modification of the parent polymer. Such strategies inevitably result in polymer systems that are spatially and chemically heterogeneous, and which exhibit the phenomenon of surface segregation. This work investigates the effects of chain architecture on the surface segregation behavior of such functionally modified polymers using a series of end- and center-fluorinated poly(D,L-lactide). Surface segregation of the fluorinated functional groups was observed in both chain architectures via AMPS and water contact angle. Higher surface segregation was noted for functional groups located at the chain end as opposed to those in the middle of the chain. A self-consistent mean-field lattice theory was used to model the composition depth profiles of functional groups and excellent agreement was found between the model predictions and the experimental AMPS data in both chain architectures. Polymer properties are also in general dependent on both time and temperature, and exhibit a range of relaxation times in response to environmental stimuli. This behavior arises from the characteristic frequencies of molecular motions of the polymer chain and the interrelationship between time and temperature has been widely established for polymer bulk properties. There is evidence that surface properties also respond in a manner that is time and temperature dependent and that this dependence may not be the same as that observed for bulk properties. AMPS and water contact angle experiments were used to investigate the surface reorganization behavior of functional groups using a series of anionically synthesized end-fluorinated and end-carboxylated poly(styrene). It was found that both types of functional end-groups reorganized upon a change in the polarity of the surface environment in order to minimize the surface free energy. ADXPS and contact angle results suggest that the reorganization depth was

  15. Mixed quantum-classical equilibrium in global flux surface hopping

    International Nuclear Information System (INIS)

    Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.

    2015-01-01

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors

  16. Effects of different hierarchical hybrid micro/nanostructure surfaces on implant osseointegration.

    Science.gov (United States)

    Cheng, Bingkun; Niu, Qiang; Cui, Yajun; Jiang, Wei; Zhao, Yunzhuan; Kong, Liang

    2017-06-01

    Hierarchical hybrid micro/nanostructure implant surfaces are considered to better mimic the hierarchical structure of bone and the nanostructures substantively influence osseointegration through managing cell behaviors. To enhance implant osseointegration for further clinical application, we evaluated the material properties and osseointegration effects of hierarchical surfaces with different nano-morphologies, using a rat model. Two representative surface fabrication methods, hydrofluoric (HF) acid etching combined with anodization (HF + AN) or magnetron sputtering (HF + MS), were selected. Sample material properties were evaluated by scanning electron microscopy, atomic force microscopy, X-ray diffraction, X-ray photoemission spectroscopy, and epoxy resin docking tensile test. Implants with different surfaces were inserted into the distal femurs of rats. After 12 weeks, osseointegration was examined by microcomputed tomography (micro-CT), histological, and biomechanical tests. Tensile testing demonstrated high bonding strength at coating/implant in the HF + MS group. Micro-CT revealed increased bone volume/total volume and significantly reduced trabecular separation in HF + MS versus other groups. Histological analysis showed significantly higher HF + MS bone-to-implant contact (74.78 ± 4.40%) versus HF + AN (65.11 ± 5.10%) and machined samples (56.03 ± 3.23%). The maximal HF + MS pull-out force increased by 33.7% versus HF + AN. These results indicated that HF + MS surfaces exhibited superior material property in terms of bonding strength and favorable implant osseointegration compared to other groups. © 2017 Wiley Periodicals, Inc.

  17. The evaluation of hierarchical structured superhydrophobic coatings for the alleviation of insect residue to aircraft laminar flow surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Kok, Mariana [Department of Mechanical, Aeronautical and Biomedical Engineering, University of Limerick, Limerick (Ireland); Materials and Surface Science Institute, University of Limerick, Limerick (Ireland); Young, Trevor M., E-mail: Trevor.Young@ul.ie [Department of Mechanical, Aeronautical and Biomedical Engineering, University of Limerick, Limerick (Ireland); Materials and Surface Science Institute, University of Limerick, Limerick (Ireland)

    2014-09-30

    Surface contamination caused by insects on laminar flow wing surfaces causes a disruption of the flow, resulting in an increase in drag and fuel consumption. Consequently, the use of superhydrophobic coatings to mitigate insect residue adhesion was investigated. A range of hierarchical superhydrophobic coatings with different surface chemistry and topography was examined. Candidate coatings were characterized in terms of their morphology and hydrophobic properties by scanning electron microscopy (SEM) and static and dynamic contact angle measurements, respectively. Arithmetic mean surface roughness (R{sub a}) values were measured using profilometry. Only superhydrophobic coatings with a specific topography showed complete mitigation against insect residue adhesion. A surface which exhibited a specific microstructure (R{sub a} = 5.26 μm) combined with a low sliding angle (SA = 7.6°) showed the best anti-contamination properties. The dynamics of an insect impact event and its influence on the wetting and adhesion mechanisms of insect residue to a surface were discussed.

  18. Expansion of oil palm and other cash crops causes an increase of the land surface temperature in the Jambi province in Indonesia

    Directory of Open Access Journals (Sweden)

    C. R. Sabajo

    2017-10-01

    Full Text Available Indonesia is currently one of the regions with the highest transformation rate of land surface worldwide related to the expansion of oil palm plantations and other cash crops replacing forests on large scales. Land cover changes, which modify land surface properties, have a direct effect on the land surface temperature (LST, a key driver for many ecological functions. Despite the large historic land transformation in Indonesia toward oil palm and other cash crops and governmental plans for future expansion, this is the first study so far to quantify the impacts of land transformation on the LST in Indonesia. We analyze LST from the thermal band of a Landsat image and produce a high-resolution surface temperature map (30 m for the lowlands of the Jambi province in Sumatra (Indonesia, a region which suffered large land transformation towards oil palm and other cash crops over the past decades. The comparison of LST, albedo, normalized differenced vegetation index (NDVI and evapotranspiration (ET between seven different land cover types (forest, urban areas, clear-cut land, young and mature oil palm plantations, acacia and rubber plantations shows that forests have lower surface temperatures than the other land cover types, indicating a local warming effect after forest conversion. LST differences were up to 10.1 ± 2.6 °C (mean ± SD between forest and clear-cut land. The differences in surface temperatures are explained by an evaporative cooling effect, which offsets the albedo warming effect. Our analysis of the LST trend of the past 16 years based on MODIS data shows that the average daytime surface temperature in the Jambi province increased by 1.05 °C, which followed the trend of observed land cover changes and exceeded the effects of climate warming. This study provides evidence that the expansion of oil palm plantations and other cash crops leads to changes in biophysical variables, warming the land surface and thus

  19. Surface integrity and fatigue behaviour of electric discharged machined and milled austenitic stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Lundberg, Mattias, E-mail: mattias.lundberg@liu.se; Saarimäki, Jonas; Moverare, Johan J.; Calmunger, Mattias

    2017-02-15

    Machining of austenitic stainless steels can result in different surface integrities and different machining process parameters will have a great impact on the component fatigue life. Understanding how machining processes affect the cyclic behaviour and microstructure are of outmost importance in order to improve existing and new life estimation models. Milling and electrical discharge machining (EDM) have been used to manufacture rectangular four-point bend fatigue test samples; subjected to high cycle fatigue. Before fatigue testing, surface integrity characterisation of the two surface conditions was conducted using scanning electron microscopy, surface roughness, residual stress profiles, and hardness profiles. Differences in cyclic behaviour were observed between the two surface conditions by the fatigue testing. The milled samples exhibited a fatigue limit. EDM samples did not show the same behaviour due to ratcheting. Recrystallized nano sized grains were identified at the severely plastically deformed surface of the milled samples. Large amounts of bent mechanical twins were observed ~ 5 μm below the surface. Grain shearing and subsequent grain rotation from milling bent the mechanical twins. EDM samples showed much less plastic deformation at the surface. Surface tensile residual stresses of ~ 500 MPa and ~ 200 MPa for the milled and EDM samples respectively were measured. - Highlights: •Milled samples exhibit fatigue behaviour, but not EDM samples. •Four-point bending is not suitable for materials exhibiting pronounced ratcheting. •LAGB density can be used to quantitatively measure plastic deformation. •Grain shearing and rotation result in bent mechanical twins. •Nano sized grains evolve due to the heat of the operation.

  20. Kinetic Monte Carlo study on the evolution of silicon surface roughness under hydrogen thermal treatment

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Gang; Wang, Yu; Wang, Junzhuan; Pan, Lijia; Yu, Linwei; Zheng, Youdou; Shi, Yi, E-mail: yshi@nju.edu.cn

    2017-08-31

    Highlights: • The KMC method is adopted to investigate the relationships between surface evolution and hydrogen thermal treatment conditions. • The reduction in surface roughness is divided into two stages at relatively low temperatures, both exhibiting exponential dependence on the time. • The optimized surface structure can be obtained by precisely adjusting thermal treatment temperatures and hydrogen pressures. - Abstract: The evolution of a two-dimensional silicon surface under hydrogen thermal treatment is studied by kinetic Monte Carlo simulations, focusing on the dependence of the migration behaviors of surface atoms on both the temperature and hydrogen pressure. We adopt different activation energies to analyze the influence of hydrogen pressure on the evolution of surface morphology at high temperatures. The reduction in surface roughness is divided into two stages, both exhibiting exponential dependence on the equilibrium time. Our results indicate that a high hydrogen pressure is conducive to obtaining optimized surfaces, as a strategy in the applications of three-dimensional devices.

  1. Microstructures and wear properties of surface treated Ti–36Nb–2Ta–3Zr–0.35O alloy by electron beam melting (EBM)

    International Nuclear Information System (INIS)

    Chen, Zijin; Liu, Yong; Wu, Hong; Zhang, Weidong; Guo, Wei; Tang, Huiping; Liu, Nan

    2015-01-01

    Highlights: • Gum metal was firstly modified via electron beam melting method. • The surface hardness and the wear resistance of TNTZO alloys are significantly increased through EBM process. • The phase constitutions and microstructural features of EBM treated TNTZO alloys are sensitive to the processing parameters. • The relationship between the wear property and the surface microstructure of TNTZO alloy is discussed. - Abstract: Ti–36Nb–2Ta–3Zr–0.35O (wt.%) (TNTZO, also called gum metal) alloy was surface treated by electron beam melting (EBM), in order to improve wear properties. The microstructures and phase constitutions of the treated surface were characterized by optical microscopy (OM), scanning electron microscopy (SEM), grazing incidence X-ray diffraction (GIXD) and electron backscattered diffraction (EBSD). The results showed that the martensitic phase and dendrites were formed from the β phase alloy after the EBM treatment, and microstructures in the surface changed with the processing parameters. Compared with the untreated TNTZO alloy, the surface modified TNTZO alloys exhibited higher nano-hardness, 8.0 GPa, and the wear loss was also decreased apparently. The samples treated at a scanning speed of 0.5 m/s exhibited the highest wear resistance due to the fast cooling rate and the precipitation of acicular α″ phase. The relationship between the wear property and the surface microstructure of TNTZO alloy was discussed.

  2. Topological surface states in nodal superconductors.

    Science.gov (United States)

    Schnyder, Andreas P; Brydon, Philip M R

    2015-06-24

    Topological superconductors have become a subject of intense research due to their potential use for technical applications in device fabrication and quantum information. Besides fully gapped superconductors, unconventional superconductors with point or line nodes in their order parameter can also exhibit nontrivial topological characteristics. This article reviews recent progress in the theoretical understanding of nodal topological superconductors, with a focus on Weyl and noncentrosymmetric superconductors and their protected surface states. Using selected examples, we review the bulk topological properties of these systems, study different types of topological surface states, and examine their unusual properties. Furthermore, we survey some candidate materials for topological superconductivity and discuss different experimental signatures of topological surface states.

  3. Topological surface states in nodal superconductors

    International Nuclear Information System (INIS)

    Schnyder, Andreas P; Brydon, Philip M R

    2015-01-01

    Topological superconductors have become a subject of intense research due to their potential use for technical applications in device fabrication and quantum information. Besides fully gapped superconductors, unconventional superconductors with point or line nodes in their order parameter can also exhibit nontrivial topological characteristics. This article reviews recent progress in the theoretical understanding of nodal topological superconductors, with a focus on Weyl and noncentrosymmetric superconductors and their protected surface states. Using selected examples, we review the bulk topological properties of these systems, study different types of topological surface states, and examine their unusual properties. Furthermore, we survey some candidate materials for topological superconductivity and discuss different experimental signatures of topological surface states. (topical review)

  4. Increasing surface ozone concentrations in the background atmosphere of Southern China, 1994–2007

    Directory of Open Access Journals (Sweden)

    T. Wang

    2009-08-01

    Full Text Available Tropospheric ozone is of great importance with regard to air quality, atmospheric chemistry, and climate change. In this paper we report the first continuous record of surface ozone in the background atmosphere of South China. The data were obtained from 1994 to 2007 at a coastal site in Hong Kong, which is strongly influenced by the outflow of Asian continental air during the winter and the inflow of maritime air from the subtropics in the summer. Three methods are used to derive the rate of change in ozone. A linear fit to the 14-year record shows that the ozone concentration increased by 0.58 ppbv/yr, whereas comparing means in years 1994–2000 and 2001–2007 gives an increase of 0.87 ppbv/yr for a 7-year period. The ozone changes in air masses from various source regions are also examined. Using local wind and carbon monoxide (CO data to filter out local influence, we find that ozone increased by 0.94 ppbv/yr from 1994–2000 to 2001–2007 in air masses from Eastern China, with similar changes in the other two continent-influenced air-mass groups, but no statistically significant change in the marine air. An examination of the nitrogen dioxide (NO2 column obtained from GOME and SCIAMACHY reveals an increase in atmospheric NO2 in China's three fastest developing coastal regions, whereas NO2 in other parts of Asia decreased during the same period, and no obvious trend over the main shipping routes in the South China Sea was indicated. Thus the observed increase in background ozone in Hong Kong is most likely due to the increased emissions of NO2 (and possibly volatile organic compounds (VOCs as well in the upwind coastal regions of mainland China. The CO data at Hok Tsui showed less definitive changes compared to the satellite NO2 column. The increase in background ozone likely made a strong contribution (81% to the rate of increase in "total ozone" at an urban site in Hong Kong

  5. An investigation of phase transformation and crystallinity in laser surface modified H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-03-01

    This paper presents a laser surface modification process of AISI H13 tool steel using 0.09, 0.2 and 0.4 mm size of laser spot with an aim to increase hardness properties. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 tool steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, overlap percentage and pulse repetition frequency (PRF). X-ray diffraction analysis (XRD) was conducted to measure crystallinity of the laser-modified surface. X-ray diffraction patterns of the samples were recorded using a Bruker D8 XRD system with Cu K α ( λ=1.5405 Å) radiation. The diffraction patterns were recorded in the 2 θ range of 20 to 80°. The hardness properties were tested at 981 mN force. The laser-modified surface exhibited reduced crystallinity compared to the un-processed samples. The presence of martensitic phase was detected in the samples processed using 0.4 mm spot size. Though there was reduced crystallinity, a high hardness was measured in the laser-modified surface. Hardness was increased more than 2.5 times compared to the as-received samples. These findings reveal the phase source of the hardening mechanism and grain composition in the laser-modified surface.

  6. Surface states in thin versus thick organic quantum wells

    International Nuclear Information System (INIS)

    Nguyen Ba An; Hanamura, E.

    1995-08-01

    Surface states are studied in dependence on thickness or organic quantum wells within the nearest layer approximation. It is shown that there is a material-dependent critical thickness. Structures, that have thickness thinner or thicker than the critical one, exhibit qualitatively different characteristics of surface states. Criteria for existence and sign rules for location of energy levels of surface states are established which are general and contain the results of the previous works as particular cases. (author). 18 refs, 3 figs

  7. Preparation of protein- and cell-resistant surfaces by hyperthermal hydrogen induced cross-linking of poly(ethylene oxide).

    Science.gov (United States)

    Bonduelle, Colin V; Lau, Woon M; Gillies, Elizabeth R

    2011-05-01

    The functionalization of surfaces with poly(ethylene oxide) (PEO) is an effective means of imparting resistance to the adsorption of proteins and the attachment and growth of cells, properties that are critical for many biomedical applications. In this work, a new hyperthermal hydrogen induced cross-linking (HHIC) method was explored as a simple one-step approach for attaching PEO to surfaces through the selective cleavage of C-H bonds and subsequent cross-linking of the resulting carbon radicals. In order to study the effects of the process on the polymer, PEO-coated silicon wafers were prepared and the effects of different treatment times were investigated. Subsequently, using an optimized treatment time and a modified butyl polymer with increased affinity for PEO, the technique was applied to butyl rubber surfaces. All of the treated surfaces exhibited significantly reduced protein adsorption and cell growth relative to control surfaces and compared favorably with surfaces that were functionalized with PEO using conventional chemical methods. Thus HHIC is a simple and effective means of attaching PEO to non-functional polymer surfaces.

  8. Surface area loss and increased sphericity account for the splenic entrapment of subpopulations of Plasmodium falciparum ring-infected erythrocytes.

    Directory of Open Access Journals (Sweden)

    Innocent Safeukui

    Full Text Available Ex vivo perfusion of human spleens revealed innate retention of numerous cultured Plasmodium falciparum ring-infected red blood cells (ring-iRBCs. Ring-iRBC retention was confirmed by a microsphiltration device, a microbead-based technology that mimics the mechanical filtering function of the human spleen. However, the cellular alterations underpinning this retention remain unclear. Here, we use ImageStream technology to analyze infected RBCs' morphology and cell dimensions before and after fractionation with microsphiltration. Compared to fresh normal RBCs, the mean cell membrane surface area loss of trophozoite-iRBCs, ring-iRBCs and uninfected co-cultured RBCs (uRBCs was 14.2% (range: 8.3-21.9%, 9.6% (7.3-12.2% and 3.7% (0-8.4, respectively. Microsphilters retained 100%, ∼50% and 4% of trophozoite-iRBCs, ring-iRBCs and uRBCs, respectively. Retained ring-iRBCs display reduced surface area values (estimated mean, range: 17%, 15-18%, similar to the previously shown threshold of surface-deficient RBCs retention in the human spleen (surface area loss: >18%. By contrast, ring-iRBCs that successfully traversed microsphilters had minimal surface area loss and normal sphericity, suggesting that these parameters are determinants of their retention. To confirm this hypothesis, fresh normal RBCs were exposed to lysophosphatidylcholine to induce a controlled loss of surface area. This resulted in a dose-dependent retention in microsphilters, with complete retention occurring for RBCs displaying >14% surface area loss. Taken together, these data demonstrate that surface area loss and resultant increased sphericity drive ring-iRBC retention in microsphilters, and contribute to splenic entrapment of a subpopulation of ring-iRBCs. These findings trigger more interest in malaria research fields, including modeling of infection kinetics, estimation of parasite load, and analysis of risk factors for severe clinical forms. The determination of the threshold of

  9. Experimental Study on the Microstructure Evolution of Mixed Disposal Paste in Surface Subsidence Areas

    Directory of Open Access Journals (Sweden)

    Wei Sun

    2016-05-01

    Full Text Available The integrated disposal of surface subsidence pits and surface solid waste can be realized by backfilling a surface subsidence area with a paste made from the solid wastes of mines, such as tailings and waste rock. The microstructures of these wastes determine the macroscopic properties of a paste backfill. This paper presents an experimental study on the internal structure evolution of pasty fluid mixed with different waste rock concentrations (10%, 30%, and 50% and cement dosages (1% and 2% under damage. To this end, a real-time computed tomography (CT scan is conducted using medical CT and a small loading device. Results show that UCS (uniaxial compressive strength increases when the amount of cement increases. Given a constant amount of cement, UCS increases first and then decreases as waste rock content increases. UCS is maximized at 551 kPa when the waste rock content is 30%. The paste body is a typical medium used to investigate initial damage, which mainly consists of microholes, pores, and microcracks. The initial damages also exhibit a high degree of random inhomogeneity. After loading, cracks are initiated and expand gradually from the original damage location until the overall damages are generated. The mesostructure evolution model of the paste body is divided into six categories, and this mesostructure is reasonable when the waste rock content is 30%.

  10. Effects of electropolishing surface treatment on the cyclic fatigue resistance of BioRace nickel-titanium rotary instruments.

    Science.gov (United States)

    Lopes, Hélio P; Elias, Carlos N; Vieira, Victor T L; Moreira, Edson J L; Marques, Raquel V L; de Oliveira, Julio C Machado; Debelian, Gilberto; Siqueira, José F

    2010-10-01

    This study evaluated the influence of electropolishing surface treatment on the number of cycles to fracture of BioRace rotary nickel-titanium endodontic instruments. BioRace size BR5C instruments with or without electropolishing surface treatment were used in an artificial curved canal under rotational speed of 300 rpm until fracture. Fractured surfaces and the helical shafts of fractured instruments were analyzed by scanning electron microscopy (SEM). Polished instruments displayed a significantly higher number of cycles to fracture when compared with nonpolished instruments (P ductile morphologic characteristics. Evaluation of the separated fragments after cyclic fatigue testing showed the presence of microcracks near the fracture surface. Polished instruments exhibited fine cracks that assumed an irregular path (zigzag crack pattern), whereas nonpolished instruments showed cracks running along the machining grooves. Electropolishing surface treatment of BioRace endodontic instruments significantly increased the cyclic fatigue resistance. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  11. Time course of surface characteristics of alkali- and heat-treated titanium dental implants during vacuum storage.

    Science.gov (United States)

    Kamo, Michimasa; Kyomoto, Masayuki; Miyaji, Fumiaki

    2017-08-01

    Current efforts to shorten the healing times of life-long dental implants and prevent their fouling by organic impurities have focused on using surface-modification treatments and alternative packaging, respectively. In this study, we investigated the time course of the surface characteristics, including the wettability, a protein-adsorption and apatite-formation abilities, of alkali- and heat-treated (AH-treated) Ti samples during storage in vacuum over a period of 52 weeks. The AH treatment resulted in the formation of a nanometer-scale needle-like rougher surface of the Ti samples. Although the water contact angle of the AH-treated Ti sample increased slightly, it remained as low as approximately 10° even after storage in vacuum for 52 weeks. There was no significant difference in the protein-adsorption and apatite-formation abilities of the AH-treated Ti sample before and after storage. Further, the AH-treated Ti sample exhibited greater protein-adsorption and apatite-formation abilities compared with the untreated one; regardless of the samples stored in vacuum or not. Apatite formed only on the AH-treated Ti surface. Therefore, subjecting Ti dental implants to the AH treatment and storing them in vacuum should help prevent their surfaces from getting contaminated. Further, it is expected that AH-treated Ti dental implants controllably aged during a shelf storage will exhibit high stability and bone-bonding bioactivity. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1453-1460, 2017. © 2016 Wiley Periodicals, Inc.

  12. The 1997 AAAI Mobile Robot Competition and Exhibition

    OpenAIRE

    Arkin, Ronald C.

    1998-01-01

    In July 1997, the Sixth Annual Association for the Advancement of Artificial Intelligence (AAAI) Mobile Robot Competition and Exhibition was held. The competition consisted of four new events: (1) Find Life on Mars; (2) Find the Remote; (3) Home Vacuum; and (4) Hors d'Oeuvres, Anyone? The robot exhibition was the largest in AAAI history. This article presents the history, motivation, and contributions for the event.

  13. GaAs nanopillar-array solar cells employing in situ surface passivation

    Science.gov (United States)

    Mariani, Giacomo; Scofield, Adam C.; Hung, Chung-Hong; Huffaker, Diana L.

    2013-01-01

    Arrays of III–V direct-bandgap semiconductor nanopillars represent promising photovoltaic candidates due to their inherent high optical absorption coefficients and minimized reflection arising from light trapping, efficient charge collection in the radial direction and the ability to synthesize them on low-cost platforms. However, the increased surface area results in surface states that hamper the power conversion efficiency. Here, we report the first demonstration of GaAs nanopillar-array photovoltaics employing epitaxial passivation with air mass 1.5 global power conversion efficiencies of 6.63%. High-bandgap epitaxial InGaP shells are grown in situ and cap the radial p–n junctions to alleviate surface-state effects. Under light, the photovoltaic devices exhibit open-circuit voltages of 0.44 V, short-circuit current densities of 24.3 mA cm−2 and fill factors of 62% with high external quantum efficiencies >70% across the spectral regime of interest. A novel titanium/indium tin oxide annealed alloy is exploited as transparent ohmic anode. PMID:23422665

  14. Evaluating Education and Science in the KSC Visitor Complex Exhibits

    Science.gov (United States)

    Erickson, Lance K.

    2000-01-01

    The continuing development of exhibits at the Kennedy Space Center's Visitor Complex is an excellent opportunity for NASA personnel to promote science and provide insight into NASA programs and projects for the approximately 3 million visitors that come to KSC annually. Stated goals for the Visitor Complex, in fact, emphasize science awareness and recommend broadening the appeal of the displays and exhibits for all age groups. To this end, this summer project seeks to evaluate the science content of planned exhibits/displays in relation to these developing opportunities and identify specific areas for enhancement of existing or planned exhibits and displays. To help expand the educational and science content within the developing exhibits at the Visitor Complex, this project was structured to implement the goals of the Visitor Center Director. To accomplish this, the exhibits and displays planned for completion within the year underwent review and evaluation for science content and educational direction. Planning emphasis for the individual displays was directed at combining the elements of effective education with fundamental scientific integrity, within an appealing format.

  15. The effects of size and surface modification of amorphous silica particles on biodistribution and liver metabolism in mice

    Science.gov (United States)

    Lu, Xiaoyan; Ji, Cai; Jin, Tingting; Fan, Xiaohui

    2015-05-01

    Engineered nanoparticles, with unconventional properties, are promising platforms for biomedical applications. Since they may interact with a wide variety of biomolecules, it is critical to understand the impact of the physicochemical properties of engineered nanoparticles on biological systems. In this study, the effects of particle size and surface modification alone or in combination of amorphous silica particles (SPs) on biological responses were determined using a suite of general toxicological assessments and metabonomics analysis in mice model. Our results suggested that amino or carboxyl surface modification mitigated the liver toxicity of plain-surface SPs. 30 nm SPs with amino surface modification were found to be the most toxic SPs among all the surface-modified SP treatments at the same dosage. When treatment dose was increased, submicro-sized SPs with amino or carboxyl surface modification also induced liver toxicity. Biodistribution studies suggested that 70 nm SPs were mainly accumulated in liver and spleen regardless of surface modifications. Interestingly, these two organs exhibited different uptake trends. Furthermore, metabonomics studies indicated that surface modification plays a more dominant role to affect the liver metabolism than particle size.

  16. Weaker Seniors Exhibit Motor Cortex Hypoexcitability and Impairments in Voluntary Activation.

    Science.gov (United States)

    Clark, Brian C; Taylor, Janet L; Hong, S Lee; Law, Timothy D; Russ, David W

    2015-09-01

    Weakness predisposes seniors to a fourfold increase in functional limitations. The potential for age-related degradation in nervous system function to contribute to weakness and physical disability has garnered much interest of late. In this study, we tested the hypothesis that weaker seniors have impairments in voluntary (neural) activation and increased indices of GABAergic inhibition of the motor cortex, assessed using transcranial magnetic stimulation. Young adults (N = 46; 21.2±0.5 years) and seniors (N = 42; 70.7±0.9 years) had their wrist flexion strength quantified along with voluntary activation capacity (by comparing voluntary and electrically evoked forces). Single-pulse transcranial magnetic stimulation was used to measure motor-evoked potential amplitude and silent period duration during isometric contractions at 15% and 30% of maximum strength. Paired-pulse transcranial magnetic stimulation was used to measure intracortical facilitation and short-interval and long-interval intracortical inhibition. The primary analysis compared seniors to young adults. The secondary analysis compared stronger seniors (top two tertiles) to weaker seniors (bottom tertile) based on strength relative to body weight. The most novel findings were that weaker seniors exhibited: (i) a 20% deficit in voluntary activation; (ii) ~20% smaller motor-evoked potentials during the 30% contraction task; and (iii) nearly twofold higher levels of long-interval intracortical inhibition under resting conditions. These findings indicate that weaker seniors exhibit significant impairments in voluntary activation, and that this impairment may be mechanistically associated with increased GABAergic inhibition of the motor cortex. © The Author 2015. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. A peptide factor secreted by Staphylococcus pseudintermedius exhibits properties of both bacteriocins and virulence factors.

    Science.gov (United States)

    Wladyka, Benedykt; Piejko, Marcin; Bzowska, Monika; Pieta, Piotr; Krzysik, Monika; Mazurek, Łukasz; Guevara-Lora, Ibeth; Bukowski, Michał; Sabat, Artur J; Friedrich, Alexander W; Bonar, Emilia; Międzobrodzki, Jacek; Dubin, Adam; Mak, Paweł

    2015-09-28

    Staphylococcus pseudintermedius is a common commensal bacterium colonizing the skin and mucosal surfaces of household animals. However, it has recently emerged as a dangerous opportunistic pathogen, comparable to S. aureus for humans. The epidemiological situation is further complicated by the increasing number of methicillin-resistant S. pseudintermedius infections and evidence of gene transmission driving antibiotic resistance between staphylococci colonizing human and zoonotic hosts. In the present study, we describe a unique peptide, BacSp222, that possesses features characteristic of both bacteriocins and virulence factors. BacSp222 is secreted in high quantities by S. pseudintermedius strain 222 isolated from dog skin lesions. This linear, fifty-amino-acid highly cationic peptide is plasmid-encoded and does not exhibit significant sequence similarities to any other known peptides or proteins. BacSp222 kills gram-positive bacteria (at doses ranging from 0.1 to several micromol/l) but also demonstrates significant cytotoxic activities towards eukaryotic cells at slightly higher concentrations. Moreover, at nanomolar concentrations, the peptide also possesses modulatory properties, efficiently enhancing interferon gamma-induced nitric oxide release in murine macrophage-like cell lines. BacSp222 appears to be one of the first examples of multifunctional peptides that breaks the convention of splitting bacteriocins and virulence factors into two unrelated groups.

  18. Annealing induced low coercivity, nanocrystalline Co–Fe–Si thin films exhibiting inverse cosine angular variation

    Energy Technology Data Exchange (ETDEWEB)

    Hysen, T., E-mail: hysenthomas@gmail.com [Department of Physics, Cochin University of Science and Technology, Cochin 682022, Kerala (India); Al-Harthi, Salim; Al-Omari, I.A. [Department of Physics, Sultan Qaboos University, PC 123, Muscat, Sultanate of Oman (Oman); Geetha, P.; Lisha, R. [Department of Physics, Cochin University of Science and Technology, Cochin 682022, Kerala (India); Ramanujan, R.V. [School of Materials Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Sakthikumar, D. [Graduate School of Interdisciplinary New Science, Toyo University, Kawagoe, Saitama (Japan); Anantharaman, M.R., E-mail: mra@cusat.ac.in [Department of Physics, Cochin University of Science and Technology, Cochin 682022, Kerala (India)

    2013-09-15

    Co–Fe–Si based films exhibit high magnetic moments and are highly sought after for applications like soft under layers in perpendicular recording media to magneto-electro-mechanical sensor applications. In this work the effect of annealing on structural, morphological and magnetic properties of Co–Fe–Si thin films was investigated. Compositional analysis using X-ray photoelectron spectroscopy and secondary ion mass spectroscopy revealed a native oxide surface layer consisting of oxides of Co, Fe and Si on the surface. The morphology of the as deposited films shows mound like structures conforming to the Volmer–Weber growth model. Nanocrystallisation of amorphous films upon annealing was observed by glancing angle X-ray diffraction and transmission electron microscopy. The evolution of magnetic properties with annealing is explained using the Herzer model. Vibrating sample magnetometry measurements carried out at various angles from 0° to 90° to the applied magnetic field were employed to study the angular variation of coercivity. The angular variation fits the modified Kondorsky model. Interestingly, the coercivity evolution with annealing deduced from magneto-optical Kerr effect studies indicates a reverse trend compared to magetisation observed in the bulk. This can be attributed to a domain wall pinning at native oxide layer on the surface of thin films. The evolution of surface magnetic properties is correlated with morphology evolution probed using atomic force microscopy. The morphology as well as the presence of the native oxide layer dictates the surface magnetic properties and this is corroborated by the apparent difference in the bulk and surface magnetic properties. - Highlights: • The relation between grain size and magnetic properties in Co–Fe–Si thin films obeys the Herzer model. • Angular variation of coercivity is found to obey the Kondorsky model. • The MOKE measurements provide further evidence for domain wall pinning.

  19. CYP4F18-Deficient Neutrophils Exhibit Increased Chemotaxis to Complement Component C5a

    Directory of Open Access Journals (Sweden)

    Rachel Vaivoda

    2015-01-01

    Full Text Available CYP4Fs were first identified as enzymes that catalyze hydroxylation of leukotriene B4 (LTB4. CYP4F18 has an unusual expression in neutrophils and was predicted to play a role in regulating LTB4-dependent inflammation. We compared chemotaxis of wild-type and Cyp4f18 knockout neutrophils using an in vitro assay. There was no significant difference in the chemotactic response to LTB4, but the response to complement component C5a increased 1.9–2.25-fold in knockout cells compared to wild-type (P < 0.01. This increase was still observed when neutrophils were treated with inhibitors of eicosanoid synthesis. There were no changes in expression of other CYP4 enzymes in knockout neutrophils that might compensate for loss of CYP4F18 or lead to differences in activity. A mouse model of dextran sodium sulfate colitis was used to investigate the consequences of increased C5a-dependent chemotaxis in vivo, but there was no significant difference in weight loss, disease activity, or colonic tissue myeloperoxidase between wild-type and Cyp4f18 knockout mice. This study demonstrates the limitations of inferring CYP4F function based on an ability to use LTB4 as a substrate, points to expanding roles for CYP4F enzymes in immune regulation, and underscores the in vivo challenges of CYP knockout studies.

  20. Bio-Inspired Extreme Wetting Surfaces for Biomedical Applications

    Science.gov (United States)

    Shin, Sera; Seo, Jungmok; Han, Heetak; Kang, Subin; Kim, Hyunchul; Lee, Taeyoon

    2016-01-01

    Biological creatures with unique surface wettability have long served as a source of inspiration for scientists and engineers. More specifically, materials exhibiting extreme wetting properties, such as superhydrophilic and superhydrophobic surfaces, have attracted considerable attention because of their potential use in various applications, such as self-cleaning fabrics, anti-fog windows, anti-corrosive coatings, drag-reduction systems, and efficient water transportation. In particular, the engineering of surface wettability by manipulating chemical properties and structure opens emerging biomedical applications ranging from high-throughput cell culture platforms to biomedical devices. This review describes design and fabrication methods for artificial extreme wetting surfaces. Next, we introduce some of the newer and emerging biomedical applications using extreme wetting surfaces. Current challenges and future prospects of the surfaces for potential biomedical applications are also addressed. PMID:28787916

  1. Surface composition of Europa based on VLT observations

    Science.gov (United States)

    Ligier, N.; Poulet, F.; Carter, J.

    2016-12-01

    Jupiter's moon Europa may harbor a global salty ocean under an 80-170 km thick outer layer consisting of an icy crust (Anderson et al. 1998). Meanwhile, the 10-50 My old surface, dated by cratering rates (Pappalardo et al. 1999) implies rapid surface recycling and reprocessing that could result in tectonic activity (Kattenhorn et al. 2014) and plumes (Roth et al. 2014). The surface could thus exhibit fingerprints of chemical species, as minerals characteristics of an ocean-mantle interaction and/or organics of exobiological interest, directly originating from the subglacial ocean. In order to re-investigate the composition of Europa's surface, a global mapping campaign of the satellite was performed with the near-infrared integral field spectrograph SINFONI on the Very Large Telescope (VLT) in Chile. The high spectral binning of this instrument (0.5 nm) and large signal noise ratio in comparison to previous observations are adequate to detect sharp absorptions in the wavelength range 1.45-2.45 μm. In addition, the spatially resolved spectra we obtained over five epochs nearly cover the entire surface of Europa with a pixel scale of 12.5 by 25 m.a.s ( 35 by 70 km on Europa's surface), thus permitting a global scale study. Several icy and non-icy compounds were detected and mapped at <100 km resolution. They are unevenly distributed on the moon's surface. Amorphous and crystalline water ice are both present and, in spite of a particularly strong amorphization process likely engendered by the Io plasma torus, the crystalline form is found to be approximately twice as abundant as the amorphous ice based on the analysis of the 1.65 μm band. If the surface is dominated by small and mid-sized water ice grains (25-200 μm), crystalline water-ice grains exhibit spatial inhomogeneities in their distribution. The sulfuric acid hydrate distribution exhibits the typical "bullseye" feature on the trailing hemisphere. The presence of Mg-bearing chlorinated salts (chloride

  2. Developing a Novel Hydrogen Sponge with Ideal Binding Energy and High Surface Area for Practical Hydrogen Storage

    Energy Technology Data Exchange (ETDEWEB)

    Chung, T. C. Mike

    2018-04-19

    This Phase I (5 quarters) research project was to examine the validity of a new class of boron-containing polymer (B-polymer) frameworks, serving as the adsorbents for the practical onboard H2 storage applications. Three B-polymer frameworks were synthesized and investigated, which include B-poly(butyenylstyrene) (B-PBS) framework (A), B-poly(phenyldiacetyene) (B-PPDA) framework (B), and B-poly(phenyltriacetylene) (B-PPTA) framework (C). They are 2-D polymer structures with the repeating cyclic units that spontaneously form open morphology and the B-doped (p-type) π-electrons delocalized surfaces. The ideal B-polymer framework shall exhibit open micropores (pore size in the range of 1-1.5nm) with high surface area (>3000 m2/g), and the B-dopants in the conjugated framework shall provide high surface energy for interacting with H2 molecules (an ideal H2 binding energy in the range of 15-25 kJ/mol). The pore size distribution and H2 binding energy were investigated at both Penn State and NREL laboratories. So far, the experimental results show the successful synthesis of B-polymer frameworks with the relatively well-defined planar (2-D) structures. The intrinsically formed porous morphology exhibits a broad pore size distribution (in the range of 0.5-10 nm) with specific surface area (~1000 m2/g). The miss-alignment between 2-D layers may block some micropore channels and limit gas diffusion throughout the entire matrix. In addition, the 2-D planar conjugated structure may also allow free π-electrons delocalization throughout the framework, which significantly reduces the acidity of B-moieties (electron-deficiency).The resulting 2-D B-polymer frameworks only exhibit a small increase of H2 binding energy in the range of 8-9 KJ/mole (quite constant over the whole sorption range).

  3. Increase globe artichoke cropping sustainability using sub-surface drip-irrigation systems in a Mediterranean coastal area for reducing groundwater withdrawal

    Science.gov (United States)

    Mantino, Alberto; Marchina, Chiara; Bonari, Enrico; Fabbrizzi, Alessandro; Rossetto, Rudy

    2017-04-01

    During the last decades in coastal areas of the Mediterranean basin, human growth posed severe stresses on freshwater resources due to increasing demand by agricultural, industrial and civil activities, in particular on groundwater. This in turn led to worsening of water quality, loss/reduction of wetlands, up to soil salinization and abandonment of agricultural areas. Within the EU LIFE REWAT project a number of demonstration measures will take place in the lower Cornia valley (Livorno, Italy), both structural (pilot) and non-structural (education, dissemination and capacity building), aiming at achieving sustainable and participated water management. In particular, the five demonstration actions are related to: (1) set up of a managed aquifer recharge facility, (2) restoration of a Cornia river reach, (3) water saving in the civil water supply sector, (4) water saving in agriculture, (5) reuse of treated wastewater for irrigation purposes. Thus, the REWAT project general objective is to develop a new model of governance for sustainable development of the lower Cornia valley based on the water asset at its core. As per water use in agriculture, the lower Cornia valley is well known for the horticultural production. In this regard, globe artichoke (Cynara cardunculus L. var. scolymus L. (Fiori)) crops, a perennial cool-season vegetable, cover a surface of about 600 ha. In order to increase stability and productivity of the crop, about 2000 - 4000 m3 ha-1 yr-1 of irrigation water is required. Recent studies demonstrated that yield of different crops increases using Sub-surface Drip-Irrigation (SDI) system under high frequency irrigation management enhancing water use efficiency. In the SDI systems, the irrigation water is delivered to the plant root zone, below the soil surface by buried plastic tubes containing embedded emitters located at regular spacing. Within the LIFE REWAT, the specific objectives of the pilot on irrigation efficiency is to (i) demonstrate the

  4. Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.

    Science.gov (United States)

    Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan

    2018-05-07

    Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.

  5. Quantum field theory near surfaces of discontinuity

    International Nuclear Information System (INIS)

    Onishi, H.T.

    1981-01-01

    This work deals with the problem of a quantized scalar field propagating near a surface of discontinuity. The proper time formalism is employed to express the Green's function and stress tensor as proper time integrals of a transformation function. The transformation function is calculated by a WKB approximation which exhibits the essential singularities generated by the high frequency behavior of waves propagating near the surface. Two singularities are present, the usual direct singularity and an additional reflected singularity generated by the high frequency behavior of waves reflected by the discontinuity. The stress tensor is calculated by dimensional continuation. The results are employed to analyze energy generated by the surface

  6. A New Approach for Biologically-Inhibiting Surfaces

    DEFF Research Database (Denmark)

    Møller, Per; Hilbert, Lisbeth Rischel; Corfitzen, Charlotte B.

    2007-01-01

    in nanometers. Due to the difference in potentials, the biologically-inhibiting material will act as a galvanic element in contact with an electrolyte. The electrochemical processes taking place at the metal surface seem to exhibit a catalytic oxidation character more than an oligomeric effect from the silver....

  7. Electromagnetic excitation of phonons at C(001) surfaces

    International Nuclear Information System (INIS)

    Perez-Sanchez, F L; Perez-Rodriguez, F

    2009-01-01

    The photon-phonon coupling at C(001)-(2 x 1) surfaces and its manifestation in far-infrared reflectance anisotropy spectra (FIR-RAS) are theoretically investigated. We solve the coupled system of equations for the electromagnetic field and lattice vibrations, described within the adiabatic bond charge model (ABCM), with the method of expansion into bulk phonon and photon modes. The calculated FIR-RAS exhibit resonances associated with zone-center surface phonons in good agreement with available HREELS experiments and predictions of vibrational modes for diamond (001)-(2 x 1) surfaces from ABCM and ab initio calculations. Interestingly, the reflectance anisotropy spectra for a C(001)-(2 x 1) surface turn out to be qualitatively different from the spectra for a Si(001)-(2 x 1) surface, reported previously.

  8. Electromagnetic excitation of phonons at C(001) surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Sanchez, F L [Escuela de Ciencias, Universidad Autonoma ' Benito Juarez' de Oaxaca, Avenida Universidad S/N, Ex-Hacienda de Cinco Senores, Ciudad Universitaria, Oaxaca de Juarez, Oaxaca, 68120 (Mexico); Perez-Rodriguez, F, E-mail: fperez@sirio.ifuap.buap.m [Instituto de Fisica, Benemerita Universidad Autonoma de Puebla, Apartado Post. J-48, Puebla 72570 (Mexico)

    2009-09-02

    The photon-phonon coupling at C(001)-(2 x 1) surfaces and its manifestation in far-infrared reflectance anisotropy spectra (FIR-RAS) are theoretically investigated. We solve the coupled system of equations for the electromagnetic field and lattice vibrations, described within the adiabatic bond charge model (ABCM), with the method of expansion into bulk phonon and photon modes. The calculated FIR-RAS exhibit resonances associated with zone-center surface phonons in good agreement with available HREELS experiments and predictions of vibrational modes for diamond (001)-(2 x 1) surfaces from ABCM and ab initio calculations. Interestingly, the reflectance anisotropy spectra for a C(001)-(2 x 1) surface turn out to be qualitatively different from the spectra for a Si(001)-(2 x 1) surface, reported previously.

  9. Increased preference of surface ablation over laser in situ keratomileusis between 2008–2011 is correlated to risk of ecatasia

    Directory of Open Access Journals (Sweden)

    Moisseiev E

    2013-01-01

    Full Text Available Elad Moisseiev,1,3 Tzahi Sela,2 Liza Minkev,2 David Varssano1,31Department of Ophthalmology, Tel-Aviv Medical Center, Tel-Aviv, Israel; 2Care Vision, Tel Aviv, Israel; 3Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, IsraelPurpose: To evaluate the trends in corneal refractive procedure selection for the correction of myopia, focusing on the relative proportions of laser in situ keratomileusis (LASIK and surface ablation procedures.Methods: Only eyes that underwent LASIK or surface ablation for the correction of myopia between 2008–2011 were included in this retrospective study. Additional recorded parameters included patient age, preoperative manifest refraction, corneal thickness, and calculated residual corneal bed thickness. A risk score was given to each eye, based on these parameters, according to the Ectasia Risk Factor Score System (ERFSS, without the preoperative corneal topography.Results: This study included 16,163 eyes, of which 38.4% underwent LASIK and 61.6% underwent surface ablation. The risk score correlated with procedure selection, with LASIK being preferred in eyes with a score of 0 and surface ablation in eyes with a score of 2 or higher. When controlling for age, preoperative manifest refraction, corneal thickness, and all parameters, the relative proportion of surface ablation compared with LASIK was found to have grown significantly during the study period.Conclusions: Our results indicate that with time, surface ablation tended to be performed more often than LASIK for the correction of myopia in our cohort. Increased awareness of risk factors and preoperative risk assessment tools, such as the ERFSS, have shifted the current practice of refractive surgery from LASIK towards surface ablation despite the former's advantages, especially in cases in which the risk for ectasia is more than minimal (risk score 2 and higher.Keywords: surface ablation, LASIK, PRK, myopia correction, ectasia

  10. [Observation of topography and analysis of surface contamination of titanium implant after roughness treatment].

    Science.gov (United States)

    Cao, Hongdan; Yang, Xiaodong; Wu, Dayi; Zhang, Xingdong

    2007-04-01

    The roughness treatment of dental implant surface could improve the bone bonding and increase the success rate of implant, but the difference of diverse treatments is still unknown. In this study using scanning electron microscopy (SEM), energy disperse spectrometer (EDS) and the test of contact angle, we studied the microstructure, surface contamination and surface energy, and hence conducted a comparative analysis of the following surface roughness treatments: Polished Treatment (PT), Sandblasting with Alumina(SA), Sandblasting with Aluminia and Acid-etched (SAA), Sandblasting with Titanium Acid-etched (STA), Electro-erosion Treatment(ET). The result of SEM showed that the surface displayed irregularities after roughness treatments and that the surface properties of different roughness treatments had some distinctions. SAA and SA had some sharp edges and protrutions; the STA showed a regular pattern like honeycomb, but the ET sample treated by electric erosion exhibited the deeper pores of different sizes and the pores with a perforated secondary structure. The EDS indicated that the surface was contaminated after the treatment with foreign materials; the SA surface had some embedded contaminations even after acid etching. The measurement of water contact angle indicated that the morphology correlated with the surface treatments. These findings suggest that the distinction of surface structure and composition caused by different treatments may result in the disparity in biological behavior of dental implant.

  11. Fracture surfaces of granular pastes.

    Science.gov (United States)

    Mohamed Abdelhaye, Y O; Chaouche, M; Van Damme, H

    2013-11-01

    Granular pastes are dense dispersions of non-colloidal grains in a simple or a complex fluid. Typical examples are the coating, gluing or sealing mortars used in building applications. We study the cohesive rupture of thick mortar layers in a simple pulling test where the paste is initially confined between two flat surfaces. After hardening, the morphology of the fracture surfaces was investigated, using either the box counting method to analyze fracture profiles perpendicular to the mean fracture plane, or the slit-island method to analyze the islands obtained by cutting the fracture surfaces at different heights, parallel to the mean fracture plane. The fracture surfaces were shown to exhibit scaling properties over several decades. However, contrary to what has been observed in the brittle or ductile fracture of solid materials, the islands were shown to be mass fractals. This was related to the extensive plastic flow involved in the fracture process.

  12. Three-tier rough superhydrophobic surfaces

    International Nuclear Information System (INIS)

    Cao, Yuanzhi; Yuan, Longyan; Hu, Bin; Zhou, Jun

    2015-01-01

    A three-tier rough superhydrophobic surface was fabricated by growing hydrophobic modified (fluorinated silane) zinc oxide (ZnO)/copper oxide (CuO) hetero-hierarchical structures on silicon (Si) micro-pillar arrays. Compared with the other three control samples with a less rough tier, the three-tier surface exhibits the best water repellency with the largest contact angle 161° and the lowest sliding angle 0.5°. It also shows a robust Cassie state which enables the water to flow with a speed over 2 m s"−"1. In addition, it could prevent itself from being wetted by the droplet with low surface tension (mixed water and ethanol 1:1 in volume) which reveals a flow speed of 0.6 m s"−"1 (dropped from the height of 2 cm). All these features prove that adding another rough tier on a two-tier rough surface could futher improve its water-repellent properties. (paper)

  13. The spectrum of hyperbolic surfaces

    CERN Document Server

    Bergeron, Nicolas

    2016-01-01

    This text is an introduction to the spectral theory of the Laplacian on compact or finite area hyperbolic surfaces. For some of these surfaces, called “arithmetic hyperbolic surfaces”, the eigenfunctions are of arithmetic nature, and one may use analytic tools as well as powerful methods in number theory to study them. After an introduction to the hyperbolic geometry of surfaces, with a special emphasis on those of arithmetic type, and then an introduction to spectral analytic methods on the Laplace operator on these surfaces, the author develops the analogy between geometry (closed geodesics) and arithmetic (prime numbers) in proving the Selberg trace formula. Along with important number theoretic applications, the author exhibits applications of these tools to the spectral statistics of the Laplacian and the quantum unique ergodicity property. The latter refers to the arithmetic quantum unique ergodicity theorem, recently proved by Elon Lindenstrauss. The fruit of several graduate level courses at Orsay...

  14. The clear-sky greenhouse effect sensitivity to a sea surface temperature change

    Science.gov (United States)

    Duvel, J. PH.; Breon, F. M.

    1991-01-01

    The clear-sky greenhouse effect response to a sea surface temperature (SST or Ts) change is studied using outgoing clear-sky longwave radiation measurements from the Earth Radiation Budget Experiment. Considering geographical distributions for July 1987, the relation between the SST, the greenhouse effect (defined as the outgoing infrared flux trapped by atmospheric gases), and the precipitable water vapor content (W), estimated by the Special Sensor Microwave Imager, is analyzed first. A fairly linear relation between W and the normalized greenhouse effect g, is found. On the contrary, the SST dependence of both W and g exhibits nonlinearities with, especially, a large increase for SST above 25 C. This enhanced sensitivity of g and W can be interpreted in part by a corresponding large increase of atmospheric water vapor content related to the transition from subtropical dry regions to equatorial moist regions. Using two years of data (1985 and 1986), the normalized greenhouse effect sensitivity to the sea surface temperature is computed from the interannual variation of monthly mean values.

  15. Water droplet evaporation from sticky superhydrophobic surfaces

    Science.gov (United States)

    Lee, Moonchan; Kim, Wuseok; Lee, Sanghee; Baek, Seunghyeon; Yong, Kijung; Jeon, Sangmin

    2017-07-01

    The evaporation dynamics of water from sticky superhydrophobic surfaces was investigated using a quartz crystal microresonator and an optical microscope. Anodic aluminum oxide (AAO) layers with different pore sizes were directly fabricated onto quartz crystal substrates and hydrophobized via chemical modification. The resulting AAO layers exhibited hydrophobic or superhydrophobic characteristics with strong adhesion to water due to the presence of sealed air pockets inside the nanopores. After placing a water droplet on the AAO membranes, variations in the resonance frequency and Q-factor were measured throughout the evaporation process, which were related to changes in mass and viscous damping, respectively. It was found that droplet evaporation from a sticky superhydrophobic surface followed a constant contact radius (CCR) mode in the early stage of evaporation and a combination of CCR and constant contact angle modes without a Cassie-Wenzel transition in the final stage. Furthermore, AAO membranes with larger pore sizes exhibited longer evaporation times, which were attributed to evaporative cooling at the droplet interface.

  16. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  17. Carbon monoxide oxidation on bimetallic Ru/Au(111 surfaces

    Directory of Open Access Journals (Sweden)

    ROLF-JÜRGEN BEHM

    2001-02-01

    Full Text Available The electrochemical deposition of Ru on Au(111 was performed in 0.5 M H2SO4+10-4 M RuCl3 . The obtained bimetallic Ru/Au(111 surfaces were character-ised by cyclic voltammetry and in situ STM in 0.5 MH2SO4. The Ru deposit consists of nanoscale islands, which merge with increasing coverage. Two different types of bimetallic Ru/Au(111 surfaces with respect to the distribution of Ru islands over the Au(111 substrate surface were obtained. When the deposition was performed at potentials more positive than the range of Au(111 reconstruction, homogeneous nucleation occured resulting in a random distribution of Ru islands. When the deposition was performed on reconstructed Au(111 at low overpotentials, selective nucleation occured resulting in the replication of the Au(111 reconstruction. Only at higher deposition overpotentials, can multilayer deposits be formed, which exhibit a very rough surface morphology. The electrocatalytic activity of such structurally well defined Ru/Au(111 bimetallic surfaces was studied towards CO oxidation with the Ru coverage ranging from submonolayer to several monolayer. COstripping commences at about 0.2 Vand occurs over a broad potential range. The observed influence of the Ru structure on the CO stripping voltammetry is explained by local variations in the COadsorption energy, caused by differences in the local Ru structure and by effects induced by the Au(111 substrate.

  18. Unoccupied Surface State on Ag(110) as Revealed by Inverse Photoemission

    Science.gov (United States)

    Reihl, B.; Schlittler, R. R.; Neff, H.

    1984-05-01

    By use of the new technique of k-resolved inverse photoemission spectroscopy, an unoccupied s-like surface state on Ag(110) has been detected, which lies within the projected L2'-->L1 gap of the bulk. At the X¯ point of the surface Brillouin zone, the energy of the surface state is 1.65 eV above the Fermi level EF, and exhibits a band dispersion E(k∥) towards higher energies. The surface-state emission is immediately quenched when the surface is exposed to very small amounts of oxygen or hydrogen.

  19. A New Inter-Hemispheric Teleconnection Increases Predictability of Winter Precipitation in Southwestern US

    Science.gov (United States)

    Mamalakis, A.; Yu, J. Y.; Randerson, J. T.; AghaKouchak, A.; Foufoula-Georgiou, E.

    2017-12-01

    Early and reliable prediction of seasonal precipitation in the southwestern US (SWUS) remains a challenge with significant implications for the economy, water security and ecosystem management of the region. Traditional drivers of winter precipitation in the SWUS have been linked to the El Niño-Southern Oscillation (ENSO), decadal/multidecadal oscillations of the sea surface temperature in northern Pacific and Atlantic oceans, and persistent high-pressure ridges over the Gulf of Alaska. However, ENSO as well as other climate modes exhibit weak statistical relationships with precipitation and low predictability as lead time increases. Grounded on the hypothesis that still undiscovered relationships between large-scale atmosphere-ocean dynamics and SWUS precipitation might exist, here we followed a diagnostic approach by which instead of restricting ourselves to the established teleconnections, we analyzed systematically the correlation of global sea surface temperature (SST) and geopotential height (GPH) with winter precipitation amounts in all climatic divisions in the SWUS, for 1950-2015. Our results show that late-summer persistent SST and GPH anomalies in the subtropical southwestern Pacific are strongly connected with winter precipitation in most climatic divisions, exhibiting higher correlation values than ENSO, and thus increasing the potential for earlier and more accurate precipitation prediction. Cross validation and 30-year running average analysis starting in 1950 suggest an amplification of the detected teleconnections over the past three to four decades. The latter is most likely a result of the reported expansion of the tropics, which has started after the 1980s, and allows SST or GPH variability at lower latitudes to affect the meridional atmospheric circulation. Our work highlights the need to understand the dynamic nature of the coupled atmosphere-ocean system in a changing climate for improving future predictions of regional precipitation.

  20. Data-Driven Analysis of Virtual 3D Exploration of a Large Sculpture Collection in Real-World Museum Exhibitions

    KAUST Repository

    Agus, Marco

    2018-01-29

    We analyze use of an interactive system for the exploration of highly detailed three-dimensional (3D) models of a collection of protostoric Mediterranean sculptures. In this system, when the object of interest is selected, its detailed 3D model and associated information are presented at high resolution on a large display controlled by a touch-enabled horizontal surface at a suitable distance. The user interface combines an object-Aware interactive camera controller with an interactive point-ofinterest selector and is implemented within a scalable implementation based on multiresolution structures shared between the rendering and user interaction subsystems. The system was installed in several temporary and permanent exhibitions and was extensively used by tens of thousands of visitors. We provide a data-driven analysis of usage experience based on logs gathered during a 27-month period at four exhibitions in archeological museums for a total of more than 75K exploration sessions. We focus on discerning the main visitor behaviors during 3D exploration by employing tools for deriving interest measures on surfaces and tools for clustering and knowledge discovery from high-dimensional data. The results highlight the main trends in visitor behavior during the interactive sessions. These results provide useful insights for the design of 3D exploration user interfaces in future digital installations.© 2017 ACM 1556-4673/2017/12-ART2 $15.00.