WorldWideScience

Sample records for excision dna repair

  1. Emerging roles for histone modifications in DNA excision repair.

    Science.gov (United States)

    Mao, Peng; Wyrick, John J

    2016-11-01

    DNA repair is critical to maintain genome stability. In eukaryotic cells, DNA repair is complicated by the packaging of the DNA 'substrate' into chromatin. DNA repair pathways utilize different mechanisms to overcome the barrier presented by chromatin to efficiently locate and remove DNA lesions in the genome. DNA excision repair pathways are responsible for repairing a majority of DNA lesions arising in the genome. Excision repair pathways include nucleotide excision repair (NER) and base excision repair (BER), which repair bulky and non-bulky DNA lesions, respectively. Numerous studies have suggested that chromatin inhibits both NER and BER in vitro and in vivo Growing evidence demonstrates that histone modifications have important roles in regulating the activity of NER and BER enzymes in chromatin. Here, we will discuss the roles of different histone modifications and the corresponding modifying enzymes in DNA excision repair, highlighting the role of yeast as a model organism for many of these studies. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    Neurons are terminally differentiated cells with a high rate of metabolism and multiple biological properties distinct from their undifferentiated precursors. Previous studies showed that nucleotide excision DNA repair is downregulated in postmitotic muscle cells and neurons. Here, we characterize...... DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  3. Repair of Oxidative DNA Damage and Cancer: Recent Progress in DNA Base Excision Repair

    OpenAIRE

    Scott, Timothy L.; Rangaswamy, Suganya; Wicker, Christina A.; Izumi, Tadahide

    2014-01-01

    Significance: Reactive oxygen species (ROS) are generated by exogenous and environmental genotoxins, but also arise from mitochondria as byproducts of respiration in the body. ROS generate DNA damage of which pathological consequence, including cancer is well established. Research efforts are intense to understand the mechanism of DNA base excision repair, the primary mechanism to protect cells from genotoxicity caused by ROS. Recent Advances: In addition to the notion that oxidative DNA dama...

  4. Dynamic control of strand excision during human DNA mismatch repair.

    Science.gov (United States)

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-03-22

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3'- or 5'-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5'-MMR excision reaction requires the HsMSH2-HsMSH6 heterodimer, the 5' → 3' exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1-HsPMS2 heterodimer substantially influences 5'-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2-HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1-HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5' MMR.

  5. Repair of oxidative DNA damage and cancer: recent progress in DNA base excision repair.

    Science.gov (United States)

    Scott, Timothy L; Rangaswamy, Suganya; Wicker, Christina A; Izumi, Tadahide

    2014-02-01

    Reactive oxygen species (ROS) are generated by exogenous and environmental genotoxins, but also arise from mitochondria as byproducts of respiration in the body. ROS generate DNA damage of which pathological consequence, including cancer is well established. Research efforts are intense to understand the mechanism of DNA base excision repair, the primary mechanism to protect cells from genotoxicity caused by ROS. In addition to the notion that oxidative DNA damage causes transformation of cells, recent studies have revealed how the mitochondrial deficiencies and ROS generation alter cell growth during the cancer transformation. The emphasis of this review is to highlight the importance of the cellular response to oxidative DNA damage during carcinogenesis. Oxidative DNA damage, including 7,8-dihydro-8-oxoguanine, play an important role during the cellular transformation. It is also becoming apparent that the unusual activity and subcellular distribution of apurinic/apyrimidinic endonuclease 1, an essential DNA repair factor/redox sensor, affect cancer malignancy by increasing cellular resistance to oxidative stress and by positively influencing cell proliferation. Technological advancement in cancer cell biology and genetics has enabled us to monitor the detailed DNA repair activities in the microenvironment. Precise understanding of the intracellular activities of DNA repair proteins for oxidative DNA damage should provide help in understanding how mitochondria, ROS, DNA damage, and repair influence cancer transformation.

  6. Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells

    Science.gov (United States)

    Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

    2014-01-01

    Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

  7. Polymorphism of the DNA Base Excision Repair Genes in Keratoconus

    Science.gov (United States)

    Wojcik, Katarzyna A.; Synowiec, Ewelina; Sobierajczyk, Katarzyna; Izdebska, Justyna; Blasiak, Janusz; Szaflik, Jerzy; Szaflik, Jacek P.

    2014-01-01

    Keratoconus (KC) is a degenerative corneal disorder for which the exact pathogenesis is not yet known. Oxidative stress is reported to be associated with this disease. The stress may damage corneal biomolecules, including DNA, and such damage is primarily removed by base excision repair (BER). Variation in genes encoding BER components may influence the effectiveness of corneal cells to cope with oxidative stress. In the present work we genotyped 5 polymorphisms of 4 BER genes in 284 patients and 353 controls. The A/A genotype of the c.–1370T>A polymorphism of the DNA polymerase γ (POLG) gene was associated with increased occurrence of KC, while the A/T genotype was associated with decreased occurrence of KC. The A/G genotype and the A allele of the c.1196A>G polymorphism of the X-ray repair cross-complementing group 1 (XRCC1) were associated with increased, and the G/G genotype and the G allele, with decreased KC occurrence. Also, the C/T and T as well as C/C genotypes and alleles of the c.580C>T polymorphism of the same gene displayed relationship with KC occurrence. Neither the g.46438521G>C polymorphism of the Nei endonuclease VIII-like 1 (NEIL1) nor the c.2285T>C polymorphism of the poly(ADP-ribose) polymerase-1 (PARP-1) was associated with KC. In conclusion, the variability of the XRCC1 and POLG genes may play a role in KC pathogenesis and determine the risk of this disease. PMID:25356504

  8. Polymorphism of the DNA Base Excision Repair Genes in Keratoconus

    Directory of Open Access Journals (Sweden)

    Katarzyna A. Wojcik

    2014-10-01

    Full Text Available Keratoconus (KC is a degenerative corneal disorder for which the exact pathogenesis is not yet known. Oxidative stress is reported to be associated with this disease. The stress may damage corneal biomolecules, including DNA, and such damage is primarily removed by base excision repair (BER. Variation in genes encoding BER components may influence the effectiveness of corneal cells to cope with oxidative stress. In the present work we genotyped 5 polymorphisms of 4 BER genes in 284 patients and 353 controls. The A/A genotype of the c.–1370T>A polymorphism of the DNA polymerase γ (POLG gene was associated with increased occurrence of KC, while the A/T genotype was associated with decreased occurrence of KC. The A/G genotype and the A allele of the c.1196A>G polymorphism of the X-ray repair cross-complementing group 1 (XRCC1 were associated with increased, and the G/G genotype and the G allele, with decreased KC occurrence. Also, the C/T and T as well as C/C genotypes and alleles of the c.580C>T polymorphism of the same gene displayed relationship with KC occurrence. Neither the g.46438521G>C polymorphism of the Nei endonuclease VIII-like 1 (NEIL1 nor the c.2285T>C polymorphism of the poly(ADP-ribose polymerase-1 (PARP-1 was associated with KC. In conclusion, the variability of the XRCC1 and POLG genes may play a role in KC pathogenesis and determine the risk of this disease.

  9. Nuclear translocation contributes to regulation of DNA excision repair activities

    DEFF Research Database (Denmark)

    Knudsen, Nina Østergaard; Andersen, Sofie Dabros; Lützen, Anne

    2009-01-01

    .T. Tomicic, W.P. Roos, B. Kaina, Mechanisms of human DNA repair: an update, Toxicology 193 (2003) 3-34; N.B. Larsen, M. Rasmussen, L.J. Rasmussen, Nuclear and mitochondrial DNA repair: similar pathways? Mitochondrion 5 (2005) 89-108]. Protein interactions are not only important for function, but also...

  10. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  11. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  12. Mismatch repair and nucleotide excision repair proteins cooperate in the recognition of DNA interstrand crosslinks

    Science.gov (United States)

    Zhao, Junhua; Jain, Aklank; Iyer, Ravi R.; Modrich, Paul L.; Vasquez, Karen M.

    2009-01-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, thus ICL-inducing agents such as psoralen, are clinically useful chemotherapeutics. Psoralen-modified triplex-forming oligonucleotides (TFOs) have been used to target ICLs to specific genomic sites to increase the selectivity of these agents. However, how TFO-directed psoralen ICLs (Tdp-ICLs) are recognized and processed in human cells is unclear. Previously, we reported that two essential nucleotide excision repair (NER) protein complexes, XPA–RPA and XPC–RAD23B, recognized ICLs in vitro, and that cells deficient in the DNA mismatch repair (MMR) complex MutSβ were sensitive to psoralen ICLs. To further investigate the role of MutSβ in ICL repair and the potential interaction between proteins from the MMR and NER pathways on these lesions, we performed electrophoretic mobility-shift assays and chromatin immunoprecipitation analysis of MutSβ and NER proteins with Tdp-ICLs. We found that MutSβ bound to Tdp-ICLs with high affinity and specificity in vitro and in vivo, and that MutSβ interacted with XPA–RPA or XPC–RAD23B in recognizing Tdp-ICLs. These data suggest that proteins from the MMR and NER pathways interact in the recognition of ICLs, and provide a mechanistic link by which proteins from multiple repair pathways contribute to ICL repair. PMID:19468048

  13. POLB: A new role of DNA polymerase beta in mitochondrial base excision repair.

    Science.gov (United States)

    Kaufman, Brett A; Van Houten, Bennett

    2017-12-01

    The mitochondrial genome is a matrilineally inherited DNA that encodes numerous essential subunits of the respiratory chain in all metazoans. As such mitochondrial DNA (mtDNA) sequence integrity is vital to organismal survival, but it has a limited cadre of DNA repair activities, primarily base excision repair (BER). We have known that the mtDNA is significantly oxidized by both endogenous and exogenous sources, but this does not lead to the expected preferential formation of transversion mutations, which suggest a robust base excision repair (BER) system. This year, two different groups reported compelling evidence that what was believed to be exclusively nuclear DNA repair polymerase, POLB, is located in the mitochondria and plays a significant role in mitochondrial BER, mtDNA integrity and mitochondrial function. In this commentary, we review the findings and highlight remaining questions for the field. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Fluorodeoxyuridine modulates cellular expression of the DNA base excision repair enzyme uracil-DNA glycosylase.

    Science.gov (United States)

    Fischer, Jennifer A; Muller-Weeks, Susan; Caradonna, Salvatore J

    2006-09-01

    The thymidylate synthase inhibitor 5-fluorouracil (5-FU) continues to play a pivotal role in the treatment of cancer. A downstream event of thymidylate synthase inhibition involves the induction of a self-defeating base excision repair process. With the depletion of TTP pools, there is also an increase in dUMP. Metabolism of dUMP to the triphosphate dUTP results in elevated pools of this atypical precursor for DNA synthesis. Under these conditions, there is a destructive cycle of dUMP incorporation into DNA, removal of uracil by the base excision repair enzyme uracil-DNA glycosylase (UDG), and reincorporation of dUMP during the synthesis phase of DNA repair. The end point is DNA strand breaks and loss of DNA integrity, which contributes to cell death. Evidence presented here indicates that both the nuclear and the mitochondrial isoforms of UDG are modulated by FdUrd (and 5-FU) treatment in certain cell lines but not in others. Modulation occurs at the transcriptional and post-translational levels. Under normal conditions, nUDG protein appears in G(1) and is degraded during the S to G(2) phase transition. The present study provides evidence that, in certain cell lines, FdUrd mediates an atypical turnover of nUDG. Additional data indicate that, for cell lines that do not down-regulate nUDG, small interfering RNA-mediated knockdown of nUDG significantly increases resistance to the cytotoxic effects of FdUrd. Results from these studies show that nUDG is an additional determinant in FdUrd-mediated cytotoxicity and bolster the notion that the self-defeating base excision repair pathway, instigated by elevated dUTP (FdUTP) pools, contributes to the cytotoxic consequences of 5-FU chemotherapy.

  15. Cloning and characterization of the human DNA-excision repair gene ERCC-1

    NARCIS (Netherlands)

    M. van Duin (Michel)

    1988-01-01

    textabstractIt is the aim of the work described in this thesis to isolate and characterize human genes involved DNA excision repair. This will facilitate the understanding of the mechanism of this repair process whereas it also provides an important step to better understand the relationship

  16. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona

    2016-01-01

    disease-free carotid specimens from patients with carotid plaques and 10 non-atherosclerotic control arteries. Genomic integrity, mitochondrial (mt) DNA copy number, oxidative DNA damage and BER proteins were evaluated in a subgroup of plaques and controls. Our major findings were: (i) The BER pathway...... genes in atherosclerosis may contribute to lesional nuclear DNA stability but appears insufficient to maintain mtDNA integrity, potentially influencing mitochondrial function in cells within the atherosclerotic lesion.......Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...

  17. Coupling of Human DNA Excision Repair and the DNA Damage Checkpoint in a Defined in Vitro System*

    Science.gov (United States)

    Lindsey-Boltz, Laura A.; Kemp, Michael G.; Reardon, Joyce T.; DeRocco, Vanessa; Iyer, Ravi R.; Modrich, Paul; Sancar, Aziz

    2014-01-01

    DNA repair and DNA damage checkpoints work in concert to help maintain genomic integrity. In vivo data suggest that these two global responses to DNA damage are coupled. It has been proposed that the canonical 30 nucleotide single-stranded DNA gap generated by nucleotide excision repair is the signal that activates the ATR-mediated DNA damage checkpoint response and that the signal is enhanced by gap enlargement by EXO1 (exonuclease 1) 5′ to 3′ exonuclease activity. Here we have used purified core nucleotide excision repair factors (RPA, XPA, XPC, TFIIH, XPG, and XPF-ERCC1), core DNA damage checkpoint proteins (ATR-ATRIP, TopBP1, RPA), and DNA damaged by a UV-mimetic agent to analyze the basic steps of DNA damage checkpoint response in a biochemically defined system. We find that checkpoint signaling as measured by phosphorylation of target proteins by the ATR kinase requires enlargement of the excision gap generated by the excision repair system by the 5′ to 3′ exonuclease activity of EXO1. We conclude that, in addition to damaged DNA, RPA, XPA, XPC, TFIIH, XPG, XPF-ERCC1, ATR-ATRIP, TopBP1, and EXO1 constitute the minimum essential set of factors for ATR-mediated DNA damage checkpoint response. PMID:24403078

  18. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  19. DNA polymerase β: A missing link of the base excision repair machinery in mammalian mitochondria.

    Science.gov (United States)

    Prasad, Rajendra; Çağlayan, Melike; Dai, Da-Peng; Nadalutti, Cristina A; Zhao, Ming-Lang; Gassman, Natalie R; Janoshazi, Agnes K; Stefanick, Donna F; Horton, Julie K; Krasich, Rachel; Longley, Matthew J; Copeland, William C; Griffith, Jack D; Wilson, Samuel H

    2017-12-01

    Mitochondrial genome integrity is fundamental to mammalian cell viability. Since mitochondrial DNA is constantly under attack from oxygen radicals released during ATP production, DNA repair is vital in removing oxidatively generated lesions in mitochondrial DNA, but the presence of a strong base excision repair system has not been demonstrated. Here, we addressed the presence of such a system in mammalian mitochondria involving the primary base lesion repair enzyme DNA polymerase (pol) β. Pol β was localized to mammalian mitochondria by electron microscopic-immunogold staining, immunofluorescence co-localization and biochemical experiments. Extracts from purified mitochondria exhibited base excision repair activity that was dependent on pol β. Mitochondria from pol β-deficient mouse fibroblasts had compromised DNA repair and showed elevated levels of superoxide radicals after hydrogen peroxide treatment. Mitochondria in pol β-deficient fibroblasts displayed altered morphology by electron microscopy. These results indicate that mammalian mitochondria contain an efficient base lesion repair system mediated in part by pol β and thus pol β plays a role in preserving mitochondrial genome stability. Published by Elsevier B.V.

  20. The hepatitis B virus x protein inhibits thymine DNA glycosylase initiated base excision repair.

    Directory of Open Access Journals (Sweden)

    Maarten A A van de Klundert

    Full Text Available The hepatitis B virus (HBV genome encodes the X protein (HBx, a ubiquitous transactivator that is required for HBV replication. Expression of the HBx protein has been associated with the development of HBV infection-related hepatocellular carcinoma (HCC. Previously, we generated a 3D structure of HBx by combined homology and ab initio in silico modelling. This structure showed a striking similarity to the human thymine DNA glycosylase (TDG, a key enzyme in the base excision repair (BER pathway. To further explore this finding, we investigated whether both proteins interfere with or complement each other's functions. Here we show that TDG does not affect HBV replication, but that HBx strongly inhibits TDG-initiated base excision repair (BER, a major DNA repair pathway. Inhibition of the BER pathway may contribute substantially to the oncogenic effect of HBV infection.

  1. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)

    2017-10-20

    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  2. Membrane association of mitochondrial DNA facilitates base excision repair in mammalian mitochondria.

    Science.gov (United States)

    Boesch, Pierre; Ibrahim, Noha; Dietrich, André; Lightowlers, Robert N

    2010-03-01

    Mitochondrial DNA encodes a set of 13 polypeptides and is subjected to constant oxidative stress due to ROS production within the organelle. It has been shown that DNA repair in the mitochondrion proceeds through both short- and long-patch base excision repair (BER). In the present article, we have used the natural competence of mammalian mitochondria to import DNA and study the sub-mitochondrial localization of the repair system in organello. Results demonstrate that sequences corresponding to the mtDNA non-coding region interact with the inner membrane in a rapid and saturable fashion. We show that uracil containing import substrates are taken into the mitochondrion and are used as templates for damage driven DNA synthesis. After further sub-fractionation, we show that the length of the repair synthesis patch differs in the soluble and the particulate fraction. Bona fide long patch BER synthesis occurs on the DNA associated with the particulate fraction, whereas a nick driven DNA synthesis occurs when the uracil containing DNA accesses the soluble fraction. Our results suggest that coordinate interactions of the different partners needed for BER is only found at sites where the DNA is associated with the membrane.

  3. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    Energy Technology Data Exchange (ETDEWEB)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D. (Imperial Cancer Research Fund, South Mimms, (United Kingdom))

    1991-07-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links.

  4. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah

    2015-01-01

    of proteins required for BER or proteins that regulate BER have been consistently associated with neurological dysfunction and disease in humans. Recent studies suggest that DNA lesions in the nuclear and mitochondrial compartments and the cellular response to those lesions have a profound effect on cellular......Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  5. Influence of some prostaglandins on DNA synthesis and DNA excision repair in mouse spleen cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Egg, D.; Altmann, H.; Guenther R.; Klein W.; Kocsis, F.

    1978-03-01

    In vitro experiments were performed on mouse spleen cells to establish possible influences of some naturally occurring prostaglandins on DNA synthesis and DNA excision repair. The prostaglandins A1, B1, E1, E2, and F2 alpha were tested in concentrations of lopg, 5 ng and 2.5 microgram per ml cell suspension. DNA synthesis was significantly increased by PgF2 alpha in all the three concentrations tested, while the other tested prostaglandins were essentially ineffective. DNA excision repair was significantly inhibited by PgE1 and PgE2 at 5 ng/ml and at 2.5 microgram/ml but increased by PgF2 alpha in the two lower concentrations. The rejoining of DNA-strand breaks after gamma-irradiation was slightly reduced by PgE1, PgE2 and PgF2 alpha at 2.5 microgram/ml.

  6. Mitochondrial base excision repair assays

    DEFF Research Database (Denmark)

    Maynard, Scott; de Souza-Pinto, Nadja C; Scheibye-Knudsen, Morten

    2010-01-01

    The main source of mitochondrial DNA (mtDNA) damage is reactive oxygen species (ROS) generated during normal cellular metabolism. The main mtDNA lesions generated by ROS are base modifications, such as the ubiquitous 8-oxoguanine (8-oxoG) lesion; however, base loss and strand breaks may also occur....... Many human diseases are associated with mtDNA mutations and thus maintaining mtDNA integrity is critical. All of these lesions are repaired primarily by the base excision repair (BER) pathway. It is now known that mammalian mitochondria have BER, which, similarly to nuclear BER, is catalyzed by DNA...

  7. DNA base excision repair and nucleotide excision repair synergistically contribute to survival of stationary-phase cells of the fission yeast Schizosaccharomyces pombe.

    Science.gov (United States)

    Senoo, Takanori; Kawano, Shinji; Ikeda, Shogo

    2017-03-01

    Defects of genome maintenance may causally contribute to aging. In general, base excision repair (BER) is involved in the repair of subtle base lesions and AP sites, and bulky helix-distorting lesions are restored by nucleotide excision repair (NER). Here, we measured the chronological lifespan (CLS) of BER- and NER-deficient mutants of the fission yeast Schizosaccharomyces pombe, and observed the aging process of cells. The CLS of the nth1 (gene for DNA glycosylase/AP lyase) mutant and the rad16 (a homolog of human XPF) mutant were slightly shorter than that of the wild-type (WT) strain. However, survival of the nth1Δ rad16Δ double mutant was significantly reduced after entry into the stationary phase. Deletion of rad16 in an AP endonuclease mutant apn2Δ also accelerated chronological aging. These results indicate that BER and NER synergistically contribute to genome maintenance in non-dividing cells. Reactive oxygen species (ROS) accumulated in cells during the stationary phase, and nth1Δ rad16Δ cells produced more ROS than WT cells. High mutation frequencies and nuclear DNA fragmentation were observed in nth1Δ rad16Δ stationary-phase cells concurrent with apoptotic-like cell death. Calorie restriction significantly reduced the level of ROS in the stationary phase and extended the CLS of nth1Δ rad16Δ cells. Therefore, ROS production critically affects the survival of the DNA repair mutant during chronological aging. © 2017 International Federation for Cell Biology.

  8. Excision and crosslink repair of DNA and sister chromatid exchanges in cultured human fibroblasts with different repair capacities

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Y.; Kano, Y.; Paul, P.; Goto, K.; Yamamoto, K. (Kobe Univ. (Japan). School of Medicine)

    1981-01-01

    Xeroderma pigmentosum (XP) groups A to G lacked the initial stage of ultraviolet (UV) excision repair in the order of A = G > C > D > E asymptotically equals F, while the XP variant was weakly defective in the later repair steps. Killing sensitivities were in the orders of A >= G > D > C > E asymptotically equals F asymptotically equals variant > normal to UV, A = G > D > F > C = E > variant > normal to 4-nitroquinoline-1-oxide (4NQO), and A > C > D = E = F = variant > G = normal to decarbamoyl mitomycin-C(DCMC). The induced sister chromatid exchange (SCE) frequency was unrelated to the extent of repair deficiency. The SCE induction rate was consistently 3 - 6 fold higher by these UV-like mutagens in XP group A cells than in normal cells. However, repair-proficient Cockayne's syndrome (CS) cells showed a higher SCE induction by UV, which was normalized by NAD/sup +/, suggesting that chromatin lesions as well as DNA damage contribute to SCE. Two-step crosslink repair involves a first rapid half-excision and a second slow nucleotide-excision repair. Fanconi's anemia (FA) cells had an impaired first half-excision and were supersensitive to MC, but not to UV and DCMC. The SCE frequency induced by MC (1 hr) was higher in FA cells than in normal cells despite their normal response to DCMC, and vice versa in XP cells. FA cells lacked the first rapid decline and showed higher remaining SCEs. Thus, part of the crosslink seems to lead to SCE formation. Caffeine synergistically elevated UV-induced SCEs, but not UV induced mutations in V79 cells, implying that SCE may not necessarily involve mutation.

  9. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    Science.gov (United States)

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A

    2016-06-21

    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  10. Molecular characterization of the human excision repair gene ERCC-1: cDNA cloning and aminoacid homology with the yeast DNA repair gene RAD10.

    NARCIS (Netherlands)

    M. van Duin (Mark); J. de Wit (Jan); H. Odijk (Hanny); A. Westerveld (Andries); A. Yasui (Akira); M.H.M. Koken (Marcel); J.H.J. Hoeijmakers (Jan); D. Bootsma (Dirk)

    1986-01-01

    textabstractThe human excision repair gene ERCC-7 was cloned after DNA mediated gene transfer to the CHO mutant 43-38, which is sensitive to ultraviolet light and mitomycin-C. We describe the cloning and sequence analysis of the ERCC-7 cDNA and partial characterization of the gene. ERCC.1 has a size

  11. Base excision repair of oxidative DNA damage: from mechanism to disease

    Science.gov (United States)

    Whitaker, Amy M.; Schaich, Matthew A.; Smith, Mallory S.; Flynn, Tony S.; Freudenthal, Bret. D.

    2017-01-01

    Reactive oxygen species continuously assault the structure of DNA resulting in oxidation and fragmentation of the nucleobases. Both oxidative DNA damage itself and its repair mediate the progression of many prevalent human maladies. The major pathway tasked with removal of oxidative DNA damage, and hence maintaining genomic integrity, is base excision repair (BER). The aphorism that structure often dictates function has proven true, as numerous recent structural biology studies have aided in clarifying the molecular mechanisms used by key BER enzymes during the repair of damaged DNA. This review focuses on the mechanistic details of the individual BER enzymes and the association of these enzymes during the development and progression of human diseases, including cancer and neurological diseases. Expanding on these structural and biochemical studies to further clarify still elusive BER mechanisms, and focusing our efforts toward gaining an improved appreciation of how these enzymes form co-complexes to facilitate DNA repair is a crucial next step toward understanding how BER contributes to human maladies and how it can be manipulated to alter patient outcomes. PMID:28199214

  12. Structure of UvrA nucleotide excision repair protein in complex with modified DNA

    Science.gov (United States)

    Jaciuk, Marcin; Nowak, Elżbieta; Skowronek, Krzysztof; Tańska, Anna; Nowotny, Marcin

    2012-01-01

    One of the primary pathways for removal of DNA damage is nucleotide excision repair (NER). In bacteria, the UvrA protein is the component of NER that locates the lesion. A notable feature of NER is its ability to act on many DNA modifications that vary in chemical structure. So far, the mechanism underlying this broad specificity has been unclear. Here, we report the first crystal structure of a UvrA protein in complex with a chemically modified oligonucleotide. The structure shows that the UvrA dimer does not contact the site of lesion directly, but rather binds the DNA regions on both sides of the modification. The DNA region harboring the modification is deformed, with the double helix bent and unwound. UvrA uses damage-induced deformations of the DNA and a less rigid structure of the modified double helix for indirect readout of the lesion. PMID:21240268

  13. Role of endonucleases XPF and XPG in nucleotide excision repair of platinated DNA and cisplatin/oxaliplatin cytotoxicity

    OpenAIRE

    Graf, Nora; Ang, Wee Han; Zhu, Guangyu; Myint, MyatNoeZin; Lippard, Stephen J.

    2011-01-01

    Resistance of tumor cells to platinum anticancer agents poses a major problem in cancer chemotherapy. One of the mechanisms associated with platinum-based drug resistance is the enhanced capacity of the cell to carry out nucleotide excision repair (NER) on platinum-damaged DNA. Endonucleases XPF and XPG are critical components of NER, responsible for excising the damaged DNA strand to remove the DNA lesion. Here, we investigated possible consequences of down-regulation of XPF and XPG gene exp...

  14. Oxidative DNA damage background estimated by a system model of base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sokhansanj, B A; Wilson, III, D M

    2004-05-13

    Human DNA can be damaged by natural metabolism through free radical production. It has been suggested that the equilibrium between innate damage and cellular DNA repair results in an oxidative DNA damage background that potentially contributes to disease and aging. Efforts to quantitatively characterize the human oxidative DNA damage background level based on measuring 8-oxoguanine lesions as a biomarker have led to estimates varying over 3-4 orders of magnitude, depending on the method of measurement. We applied a previously developed and validated quantitative pathway model of human DNA base excision repair, integrating experimentally determined endogenous damage rates and model parameters from multiple sources. Our estimates of at most 100 8-oxoguanine lesions per cell are consistent with the low end of data from biochemical and cell biology experiments, a result robust to model limitations and parameter variation. Our results show the power of quantitative system modeling to interpret composite experimental data and make biologically and physiologically relevant predictions for complex human DNA repair pathway mechanisms and capacity.

  15. Molecular Cloning and 3D Structure Modeling of APEX1, DNA Base Excision Repair Enzyme from the Camel, Camelus dromedarius

    OpenAIRE

    Dalia Fouad; Hesham Mahmoud Saeed; Farid Shokry Ataya; Ajamaluddin Malik

    2012-01-01

    The domesticated one-humped camel, Camelus dromedarius, is one of the most important animals in the Arabian Desert. It is exposed most of its life to both intrinsic and extrinsic genotoxic factors that are known to cause gross DNA alterations in many organisms. Ionic radiation and sunlight are known producers of Reactive Oxygen Species (ROS), one of the causes for DNA lesions. The damaged DNA is repaired by many enzymes, among of them Base Excision Repair enzymes, produci...

  16. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair.

    Science.gov (United States)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott; Scheibye-Knudsen, Morten; Desler, Claus; Hickson, Ian D; Bohr, Vilhelm A

    2014-04-01

    Base excision repair (BER) is the most prominent DNA repair pathway in human mitochondria. BER also results in a temporary generation of AP-sites, single-strand breaks and nucleotide gaps. Thus, incomplete BER can result in the generation of DNA repair intermediates that can disrupt mitochondrial DNA replication and transcription and generate mutations. We carried out BER analysis in highly purified mitochondrial extracts from human cell lines U2OS and HeLa, and mouse brain using a circular DNA substrate containing a lesion at a specific position. We found that DNA ligation is significantly slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I by rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional mitochondria by autophagy. Copyright © 2014. Published by Elsevier B.V.

  17. Recruitment of the nucleotide excision repair endonuclease XPG to sites of UV-induced DNA damage depends on functional TFIIH

    NARCIS (Netherlands)

    A. Zotter (Angelika); A.B. Houtsmuller (Adriaan); M.S. Luijsterburg (Martijn); D.O. Warmerdam (Daniël); S.M. Ibrahim (Shehu); A.L. Nigg (Alex); W.A. van Cappellen (Gert); J.H.J. Hoeijmakers (Jan); R. van Driel; W. Vermeulen (Wim)

    2006-01-01

    textabstractThe structure-specific endonuclease XPG is an indispensable core protein of the nucleotide excision repair (NER) machinery. XPG cleaves the DNA strand at the 3′ side of the DNA damage. XPG binding stabilizes the NER preincision complex and is essential for the 5′ incision by the

  18. Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers.

    Science.gov (United States)

    Fonseca, A S; Campos, V M A; Magalhães, L A G; Paoli, F

    2015-10-01

    Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers.

  19. Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers

    Energy Technology Data Exchange (ETDEWEB)

    Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G., E-mail: adnfonseca@ig.com.br [Instituto de Biologia Roberto Alcantara Gomes, Rio de Janeiro, RJ (Brazil). Departamento de Biofisica e Biometria. Lab. de Ciencias Radiologicas; Paoli, F. [Universidade Federal de Juiz de Fora (UFJF), Juiz de Fora, MG (Brazil). Instituto de Ciencias Biologicas. Departamento de Morfologia

    2015-10-15

    Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T{sub 4} endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T{sub 4} endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T{sub 4} endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)

  20. High-Resolution Mapping of Modified DNA Nucleobases Using Excision Repair Enzymes.

    Science.gov (United States)

    Ransom, Monica; Bryan, D Suzi; Hesselberth, Jay R

    2018-01-01

    Modification of DNA nucleobases has a profound effect on genome function. We developed a method that maps the positions of the modified DNA nucleobases throughout genomic DNA. This method couples in vitro nucleobase excision with massively parallel DNA sequencing to determine the location of modified DNA nucleobases with single base precision. This protocol was used to map uracil incorporation and UV photodimers in DNA, and a modification of the protocol has been used to map sparse modification events in cells. The Excision-seq protocol is broadly applicable to a variety of base modifications for which an excision enzyme is available.

  1. Excision repair of bulky lesions in the DNA of mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Setlow, R B; Grist, E

    1980-01-01

    The report examines the process of excision repair of pyrimidine dimers from uv-irradiated and chemically challenged human cells. It is shown by means of a sensitive endonuclease assay that the amount of excision observed depends upon the isotope used to label cells, and that XP heterozygotes are between normals and XPs. (ACR)

  2. Biochemical characterization and DNA repair pathway interactions of Mag1-mediated base excision repair in Schizosaccharomyces pombe.

    Science.gov (United States)

    Alseth, Ingrun; Osman, Fikret; Korvald, Hanne; Tsaneva, Irina; Whitby, Matthew C; Seeberg, Erling; Bjørås, Magnar

    2005-01-01

    The Schizosaccharomyces pombe mag1 gene encodes a DNA repair enzyme with sequence similarity to the AlkA family of DNA glycosylases, which are essential for the removal of cytotoxic alkylation products, the premutagenic deamination product hypoxanthine and certain cyclic ethenoadducts such as ethenoadenine. In this paper, we have purified the Mag1 protein and characterized its substrate specificity. It appears that the substrate range of Mag1 is limited to the major alkylation products, such as 3-mA, 3-mG and 7-mG, whereas no significant activity was found towards deamination products, ethenoadducts or oxidation products. The efficiency of 3-mA and 3-mG removal was 5-10 times slower for Mag1 than for Escherichia coli AlkA whereas the rate of 7-mG removal was similar to the two enzymes. The relatively low efficiency for the removal of cytotoxic 3-methylpurines is consistent with the moderate sensitivity of the mag1 mutant to methylating agents. Furthermore, we studied the initial steps of Mag1-dependent base excision repair (BER) and genetic interactions with other repair pathways by mutant analysis. The double mutants mag1 nth1, mag1 apn2 and mag1 rad2 displayed increased resistance to methyl methanesulfonate (MMS) compared with the single mutants nth1, apn2 and rad2, respectively, indicating that Mag1 initiates both short-patch (Nth1-dependent) and long-patch (Rad2-dependent) BER of MMS-induced damage. Spontaneous intrachromosomal recombination frequencies increased 3-fold in the mag1 mutant suggesting that Mag1 and recombinational repair (RR) are both involved in repair of alkylated bases. Finally, we show that the deletion of mag1 in the background of rad16, nth1 and rad2 single mutants reduced the total recombination frequencies of all three double mutants, indicating that abasic sites formed as a result of Mag1 removal of spontaneous base lesions are substrates for nucleotide excision repair, long- and short-patch BER and RR.

  3. Transcription factor TFIIH and DNA endonuclease Rad2 constitute yeast nucleotide excision repair factor 3: implications for nucleotide excision repair and Cockayne syndrome.

    Science.gov (United States)

    Habraken, Y; Sung, P; Prakash, S; Prakash, L

    1996-10-01

    Nucleotide excision repair (NER) of ultraviolet light-damaged DNA in eukaryotes requires a large number of highly conserved protein factors. Recent studies in yeast have suggested that NER involves the action of distinct protein subassemblies at the damage site rather than the placement there of a "preformed repairosome" containing all the essential NER factors. Neither of the two endonucleases, Rad1-Rad10 and Rad2, required for dual incision, shows any affinity for ultraviolet-damaged DNA. Rad1-Rad10 forms a ternary complex with the DNA damage recognition protein Rad14, providing a means for targeting this nuclease to the damage site. It has remained unclear how the Rad2 nuclease is targeted to the DNA damage site and why mutations in the human RAD2 counterpart, XPG, result in Cockayne syndrome. Here we examine whether Rad2 is part of a higher order subassembly. Interestingly, we find copurification of Rad2 protein with TFIIH, such that TFIIH purified from a strain that overexpresses Rad2 contains a stoichiometric amount of Rad2. By several independent criteria, we establish that Rad2 is tightly associated with TFIIH, exhibiting an apparent dissociation constant Cockayne syndrome.

  4. A presumed DNA helicase, encoded by the excision repair gene ERCC-3 is involved in the human repair disorders xeroderma pigmentosum and Cockayne's syndrome.

    NARCIS (Netherlands)

    G. Weeda (Geert); R.C.A. van Ham; W. Vermeulen (Wim); D. Bootsma (Dirk); A.J. van der Eb; J.H.J. Hoeijmakers (Jan)

    1990-01-01

    textabstractThe human gene ERCC-3 specifically corrects the defect in an early step of the DNA excision repair pathway of UV-sensitive rodent mutants of complementation group 3. The predicted 782 animo acid ERCC-3 protein harbors putative nucleotide, chromatin, and helix-turn-helix DNA binding

  5. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    Energy Technology Data Exchange (ETDEWEB)

    Soltys, Daniela Tathiana; Pereira, Carolina Parga Martins; Ishibe, Gabriela Naomi; Souza-Pinto, Nadja Cristhina de, E-mail: nadja@iq.usp.br

    2015-06-15

    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin.

  6. Nucleotide excision repair and human syndromes

    NARCIS (Netherlands)

    J. de Boer (Jan); J.H.J. Hoeijmakers (Jan)

    2000-01-01

    textabstractDNA damage is implicated in cancer and aging, and several DNA repair mechanisms exist that safeguard the genome from these deleterious consequences. Nucleotide excision repair (NER) removes a wide diversity of lesions, the main of which include UV-induced lesions, bulky chemical adducts

  7. Metal inhibition of human N-methylpurine-DNA glycosylase activity in base excision repair.

    Science.gov (United States)

    Wang, Ping; Guliaev, Anton B; Hang, Bo

    2006-10-25

    Cadmium (Cd2+), nickel (Ni2+) and cobalt (Co2+) are human and/or animal carcinogens. Zinc (Zn2+) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd2+, Ni2+, and Zn2+ can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (varepsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1,000 microM, both Cd2+ and Zn2+ showed metal-dependent inhibition of the MPG catalytic activity. Ni2+ also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co2+ and Mg2+ did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the varepsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd2+, Zn2+, and Ni2+ at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn2+ showed that the MPG active site has a potential binding site for Zn2+, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  8. APE1, the DNA base excision repair protein, regulates the removal of platinum adducts in sensory neuronal cultures by NER

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyun-Suk [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States); Guo, Chunlu; Thompson, Eric L. [Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Jiang, Yanlin [Department of Pediatrics and Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Kelley, Mark R. [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States); Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Department of Pediatrics and Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Vasko, Michael R. [Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Lee, Suk-Hee, E-mail: slee@iu.edu [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States)

    2015-09-15

    Peripheral neuropathy is one of the major side effects of treatment with the anticancer drug, cisplatin. One proposed mechanism for this neurotoxicity is the formation of platinum adducts in sensory neurons that could contribute to DNA damage. Although this damage is largely repaired by nuclear excision repair (NER), our previous findings suggest that augmenting the base excision repair pathway (BER) by overexpressing the repair protein APE1 protects sensory neurons from cisplatin-induced neurotoxicity. The question remains whether APE1 contributes to the ability of the NER pathway to repair platinum-damage in neuronal cells. To examine this, we manipulated APE1 expression in sensory neuronal cultures and measured Pt-removal after exposure to cisplatin. When neuronal cultures were treated with increasing concentrations of cisplatin for two or three hours, there was a concentration-dependent increase in Pt-damage that peaked at four hours and returned to near baseline levels after 24 h. In cultures where APE1 expression was reduced by ∼80% using siRNA directed at APE1, there was a significant inhibition of Pt-removal over eight hours which was reversed by overexpressing APE1 using a lentiviral construct for human wtAPE1. Overexpressing a mutant APE1 (C65 APE1), which only has DNA repair activity, but not its other significant redox-signaling function, mimicked the effects of wtAPE1. Overexpressing DNA repair activity mutant APE1 (226 + 177APE1), with only redox activity was ineffective suggesting it is the DNA repair function of APE1 and not its redox-signaling, that restores the Pt-damage removal. Together, these data provide the first evidence that a critical BER enzyme, APE1, helps regulate the NER pathway in the repair of cisplatin damage in sensory neurons.

  9. 1-beta-D-Arabinofuranosylcytosine is Cytotoxic in Quiescent Normal Lymphocytes Undergoing DNA Excision Repair

    OpenAIRE

    Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori

    2002-01-01

    We have sought to clarify the potential activity of S-phase specific antileukemic agent 1--D-arabinofuranosylcytosine (ara-C), an inhibitor of DNA synthesis, in quiescent cells that are substantially non-sensitive to nucleoside analogues. It was hypothesized that the combination of ara-C with DNA damaging agents that initiate DNA repair will expand ara-C cytotoxicity to non-cycling cells. The repair kinetics, which included incision of damaged DNA, gap filling by DNA synthesis and rejoinin...

  10. Alternative Excision Repair of Ultraviolet B- and C-Induced DNA Damage in Dormant and Developing Spores of Bacillus subtilis

    Science.gov (United States)

    Ramírez-Guadiana, Fernando H.; Barraza-Salas, Marcelo; Ramírez-Ramírez, Norma; Ortiz-Cortés, Mayte; Setlow, Peter

    2012-01-01

    The nucleotide excision repair (NER) and spore photoproduct lyase DNA repair pathways are major determinants of Bacillus subtilis spore resistance to UV radiation. We report here that a putative ultraviolet (UV) damage endonuclease encoded by ywjD confers protection to developing and dormant spores of B. subtilis against UV DNA damage. In agreement with its predicted function, a His6-YwjD recombinant protein catalyzed the specific incision of UV-irradiated DNA in vitro. The maximum expression of a reporter gene fusion to the ywjD opening reading frame occurred late in sporulation, and this maximal expression was dependent on the forespore-specific RNA polymerase sigma factor, σG. Although the absence of YwjD and/or UvrA, an essential protein of the NER pathway, sensitized developing spores to UV-C, this effect was lower when these cells were treated with UV-B. In contrast, UV-B but not UV-C radiation dramatically decreased the survival of dormant spores deficient in both YwjD and UvrA. The distinct range of lesions generated by UV-C and UV-B and the different DNA photochemistry in developing and dormant spores may cause these differences. We postulate that in addition to the UvrABC repair system, developing and dormant spores of B. subtilis also rely on an alternative excision repair pathway involving YwjD to deal with the deleterious effects of various UV photoproducts. PMID:22961846

  11. NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong-Min; Choi, Ji Ye [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Yi, Joo Mi [Research Center, Dongnam Institute of Radiological & Medical Sciences, Busan (Korea, Republic of); Chung, Jin Woong; Leem, Sun-Hee; Koh, Sang Seok [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Kang, Tae-Hong, E-mail: thkang@dau.ac.kr [Department of Biological Science, Dong-A University, Busan (Korea, Republic of)

    2015-06-05

    Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated in the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.

  12. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ping; Guliaev, Anton B.; Hang, Bo

    2006-02-28

    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  13. DNA Repair Systems

    Indian Academy of Sciences (India)

    nal factors such as UV radiation, high energy radiation such as X-. Keywords. DNA repair, DNA damage, base excision repair, nucleotide exci- sion repair, methlyl-directed mis- match repair, Nobel Prize. rays and gamma rays, mutagenic chemicals and viruses. Different types of DNA ... be especially important in plants.

  14. Variation in Base Excision Repair Capacity

    OpenAIRE

    Wilson, David M.; Kim, Daemyung; Berquist, Brian R.; Sigurdson, Alice J.

    2010-01-01

    The major DNA repair pathway for coping with spontaneous forms of DNA damage, such as natural hydrolytic products or oxidative lesions, is base excision repair (BER). In particular, BER processes mutagenic and cytotoxic DNA lesions such as non-bulky base modifications, abasic sites, and a range of chemically distinct single-strand breaks. Defects in BER have been linked to cancer predisposition, neurodegenerative disorders, and immunodeficiency. Recent data indicate a large degree of sequence...

  15. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta

    2008-01-01

    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...

  16. An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells.

    Directory of Open Access Journals (Sweden)

    Mirta M L Sousa

    Full Text Available Alterations in checkpoint and DNA repair pathways may provide adaptive mechanisms contributing to acquired drug resistance. Here, we investigated the levels of proteins mediating DNA damage signaling and -repair in RPMI8226 multiple myeloma cells and its Melphalan-resistant derivative 8226-LR5. We observed markedly reduced steady-state levels of DNA glycosylases UNG2, NEIL1 and MPG in the resistant cells and cross-resistance to agents inducing their respective DNA base lesions. Conversely, repair of alkali-labile sites was apparently enhanced in the resistant cells, as substantiated by alkaline comet assay, autoribosylation of PARP-1, and increased sensitivity to PARP-1 inhibition by 4-AN or KU58684. Reduced base-excision and enhanced single-strand break repair would both contribute to the observed reduction in genomic alkali-labile sites, which could jeopardize productive processing of the more cytotoxic Melphalan-induced interstrand DNA crosslinks (ICLs. Furthermore, we found a marked upregulation of proteins in the non-homologous end-joining (NHEJ pathway of double-strand break (DSB repair, likely contributing to the observed increase in DSB repair kinetics in the resistant cells. Finally, we observed apparent upregulation of ATR-signaling and downregulation of ATM-signaling in the resistant cells. This was accompanied by markedly increased sensitivity towards Melphalan in the presence of ATR-, DNA-PK, or CHK1/2 inhibitors whereas no sensitizing effect was observed subsequent to ATM inhibition, suggesting that replication blocking lesions are primary triggers of the DNA damage response in the Melphalan resistant cells. In conclusion, Melphalan resistance is apparently contributed by modulation of the DNA damage response at multiple levels, including downregulation of specific repair pathways to avoid repair intermediates that could impair efficient processing of cytotoxic ICLs and ICL-induced DSBs. This study has revealed several novel

  17. The amino-terminal tails of histones H2A and H3 coordinate efficient base excision repair, DNA damage signaling and postreplication repair in Saccharomyces cerevisiae

    Science.gov (United States)

    Meas, Rithy; Smerdon, Michael J.; Wyrick, John J.

    2015-01-01

    Histone amino-terminal tails (N-tails) are required for cellular resistance to DNA damaging agents; therefore, we examined the role of histone N-tails in regulating DNA damage response pathways in Saccharomyces cerevisiae. Combinatorial deletions reveal that the H2A and H3 N-tails are important for the removal of MMS-induced DNA lesions due to their role in regulating the basal and MMS-induced expression of DNA glycosylase Mag1. Furthermore, overexpression of Mag1 in a mutant lacking the H2A and H3 N-tails rescues base excision repair (BER) activity but not MMS sensitivity. We further show that the H3 N-tail functions in the Rad9/Rad53 DNA damage signaling pathway, but this function does not appear to be the primary cause of MMS sensitivity of the double tailless mutants. Instead, epistasis analyses demonstrate that the tailless H2A/H3 phenotypes are in the RAD18 epistasis group, which regulates postreplication repair. We observed increased levels of ubiquitylated PCNA and significantly lower mutation frequency in the tailless H2A/H3 mutant, indicating a defect in postreplication repair. In summary, our data identify novel roles of the histone H2A and H3 N-tails in (i) regulating the expression of a critical BER enzyme (Mag1), (ii) supporting efficient DNA damage signaling and (iii) facilitating postreplication repair. PMID:25897129

  18. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-09-01

    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Modulation of proteostasis counteracts oxidative stress and affects DNA base excision repair capacity in ATM-deficient cells.

    Science.gov (United States)

    Poletto, Mattia; Yang, Di; Fletcher, Sally C; Vendrell, Iolanda; Fischer, Roman; Legrand, Arnaud J; Dianov, Grigory L

    2017-09-29

    Ataxia telangiectasia (A-T) is a syndrome associated with loss of ATM protein function. Neurodegeneration and cancer predisposition, both hallmarks of A-T, are likely to emerge as a consequence of the persistent oxidative stress and DNA damage observed in this disease. Surprisingly however, despite these severe features, a lack of functional ATM is still compatible with early life, suggesting that adaptation mechanisms contributing to cell survival must be in place. Here we address this gap in our knowledge by analysing the process of human fibroblast adaptation to the lack of ATM. We identify profound rearrangement in cellular proteostasis occurring very early on after loss of ATM in order to counter protein damage originating from oxidative stress. Change in proteostasis, however, is not without repercussions. Modulating protein turnover in ATM-depleted cells also has an adverse effect on the DNA base excision repair pathway, the major DNA repair system that deals with oxidative DNA damage. As a consequence, the burden of unrepaired endogenous DNA lesions intensifies, progressively leading to genomic instability. Our study provides a glimpse at the cellular consequences of loss of ATM and highlights a previously overlooked role for proteostasis in maintaining cell survival in the absence of ATM function. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

    Directory of Open Access Journals (Sweden)

    Santosh K Katiyar

    Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

  1. Nucleotide sequence, DNA damage location and protein stoichiometry influence base excision repair outcome at CAG/CTG repeats

    Science.gov (United States)

    Goula, Agathi-Vasiliki; Pearson, Christopher E.; Della Maria, Julie; Trottier, Yvon; Tomkinson, Alan E.; Wilson, David M.; Merienne, Karine

    2012-01-01

    Expansion of CAG/CTG repeats is the underlying cause of >fourteen genetic disorders, including Huntington’s disease (HD) and myotonic dystrophy. The mutational process is ongoing, with increases in repeat size enhancing the toxicity of the expansion in specific tissues. In many repeat diseases the repeats exhibit high instability in the striatum, whereas instability is minimal in the cerebellum. We provide molecular insights as to how base excision repair (BER) protein stoichiometry may contribute to the tissue-selective instability of CAG/CTG repeats by using specific repair assays. Oligonucleotide substrates with an abasic site were mixed with either reconstituted BER protein stoichiometries mimicking the levels present in HD mouse striatum or cerebellum, or with protein extracts prepared from HD mouse striatum or cerebellum. In both cases, repair efficiency at CAG/CTG repeats and at control DNA sequences was markedly reduced under the striatal conditions, likely due to the lower level of APE1, FEN1 and LIG1. Damage located towards the 5’ end of the repeat tract was poorly repaired accumulating incompletely processed intermediates as compared to an AP lesion in the centre or at the 3’ end of the repeats or within a control sequences. Moreover, repair of lesions at the 5’ end of CAG or CTG repeats involved multinucleotide synthesis, particularly under the cerebellar stoichiometry, suggesting that long-patch BER processes lesions at sequences susceptible to hairpin formation. Our results show that BER stoichiometry, nucleotide sequence and DNA damage position modulate repair outcome, and suggest that a suboptimal LP-BER activity promotes CAG/CTG repeat instability. PMID:22497302

  2. The nucleotide sequence, DNA damage location, and protein stoichiometry influence the base excision repair outcome at CAG/CTG repeats.

    Science.gov (United States)

    Goula, Agathi-Vasiliki; Pearson, Christopher E; Della Maria, Julie; Trottier, Yvon; Tomkinson, Alan E; Wilson, David M; Merienne, Karine

    2012-05-08

    Expansion of CAG/CTG repeats is the underlying cause of >14 genetic disorders, including Huntington's disease (HD) and myotonic dystrophy. The mutational process is ongoing, with increases in repeat size enhancing the toxicity of the expansion in specific tissues. In many repeat diseases, the repeats exhibit high instability in the striatum, whereas instability is minimal in the cerebellum. We provide molecular insights into how base excision repair (BER) protein stoichiometry may contribute to the tissue-selective instability of CAG/CTG repeats by using specific repair assays. Oligonucleotide substrates with an abasic site were mixed with either reconstituted BER protein stoichiometries mimicking the levels present in HD mouse striatum or cerebellum, or with protein extracts prepared from HD mouse striatum or cerebellum. In both cases, the repair efficiency at CAG/CTG repeats and at control DNA sequences was markedly reduced under the striatal conditions, likely because of the lower level of APE1, FEN1, and LIG1. Damage located toward the 5' end of the repeat tract was poorly repaired, with the accumulation of incompletely processed intermediates as compared to an AP lesion in the center or at the 3' end of the repeats or within control sequences. Moreover, repair of lesions at the 5' end of CAG or CTG repeats involved multinucleotide synthesis, particularly at the cerebellar stoichiometry, suggesting that long-patch BER processes lesions at sequences susceptible to hairpin formation. Our results show that the BER stoichiometry, nucleotide sequence, and DNA damage position modulate repair outcome and suggest that a suboptimal long-patch BER activity promotes CAG/CTG repeat instability.

  3. Incomplete complementation of the DNA repair defect in cockayne syndrome cells by the denV gene from bacteriophage T4 suggests a deficiency in base excision repair.

    Science.gov (United States)

    Francis, M A; Bagga, P S; Athwal, R S; Rainbow, A J

    1997-10-01

    Endonuclease V (denV) from bacteriophage T4 has been examined for its ability to complement the repair defect in Cockayne syndrome (CS) cells of complementation groups A and B. CS is an autosomal recessive disorder characterized by hypersensitivity to UV light and a defect in the preferential repair of UV-induced lesions in transcriptionally active DNA by the nucleotide excision repair (NER) pathway. The denV gene was introduced into non-transformed normal and CS fibroblasts transiently via a recombinant adenovirus (Ad) vector and into SV40-transformed normal and CS cells via a retroviral vector. Expression of denV in CS-A cells resulted in partial correction of the UV-sensitive phenotype in assays of gene-specific repair and cell viability, while correction of CS-B cells by expression of denV in the same assays was minimal or non-existent. In contrast, denV expression led to enhanced host cell reactivation (HCR) of viral DNA synthesis in both CS complementation groups to near normal levels. DenV is a glycosylase which is specific for cyclobutane-pyrimidine dimers (CPDs) but does not recognize other UV-induced lesions. Previous work has indicated that CS cells can efficiently repair all non-CPD UV-induced transcription blocking lesions (S.F. Barrett et al.. Mutation Res. 255 (1991) 281-291 [1]) and that denV incised lesions are believed to be processed via the base excision repair (BER) pathway. The inability of denV to complement the NER defect in CS cells to normal levels implies an impaired ability to process denV incised lesions by the BER pathway, and suggests a role for the CS genes, particularly the CS-B gene, in BER.

  4. Poly(ADP-ribose) polymerase 1 regulates activity of DNA polymerase {beta} in long patch base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sukhanova, Maria; Khodyreva, Svetlana [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation); Lavrik, Olga, E-mail: lavrik@niboch.nsc.ru [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation)

    2010-03-01

    Poly(ADP-ribose)polymerase 1 (PARP1), functioning as DNA nick-sensor, interacts with base excision repair (BER) DNA intermediates containing single-strand breaks. When bound to DNA breaks, PARP1 catalyzes synthesis of poly(ADP-ribose) covalently attached to itself and some nuclear proteins. Autopoly(ADP-ribosyl)ation of PARP1 facilitates its dissociation from DNA breaks and is considered as a factor regulating DNA repair. In the study, using system reconstituted from purified BER proteins, bovine testis nuclear extract and model BER DNA intermediates, we examined the influence of PARP1 and its autopoly(ADP-ribosyl)ation on DNA polymerase {beta} (Pol {beta})-mediated long patch (LP) BER DNA synthesis that is accomplished through a cooperation between Pol {beta} and apurinic/apyrimidinic endonuclease1 (APE1) or flap endonuclease 1 (FEN1) and gap-filling activity of Pol {beta}. PARP1 upon interaction with nicked LP BER DNA intermediated, formed after gap-filling, was shown to suppress the subsequent steps in LP pathway. PARP1 interferes with APE1-dependent stimulation of DNA synthesis by Pol {beta} via strand-displacement mechanism. PARP1 also represses Pol {beta}/FEN1-mediated LP BER DNA synthesis via a 'gap translation' mechanism inhibiting FEN1 activity on the nicked DNA intermediate. Poly(ADP-ribosyl)ation of PARP1 abolishes its inhibitory influence on LP BER DNA synthesis catalyzed by Pol {beta} both via APE1-mediated strand-displacement and FEN1-mediated 'gap translation' mechanism. Thus PARP1 may act as a negative regulator of Pol {beta} activity in LP BER pathway and poly(ADP-ribosyl)ation of PARP1 seems to play a critical role in enablement of Pol {beta}-mediated DNA synthesis in this process. In contrast, interaction of PARP1 with one nucleotide gapped DNA mimicking the intermediate of short patch (SP) BER slightly inhibits the gap-filling activity of Pol {beta} and the overall efficiency of SP BER is practically unaffected by PARP1. Thus

  5. Quantitation of intracellular NAD(P)H can monitor an imbalance of DNA single strand break repair in base excision repair deficient cells in real time

    Science.gov (United States)

    Nakamura, Jun; Asakura, Shoji; Hester, Susan D.; de Murcia, Gilbert; Caldecott, Keith W.; Swenberg, James A.

    2003-01-01

    DNA single strand breaks (SSBs) are one of the most frequent DNA lesions in genomic DNA generated either by oxidative stress or during the base excision repair pathways. Here we established a new real-time assay to assess an imbalance of DNA SSB repair by indirectly measuring PARP-1 activation through the depletion of intracellular NAD(P)H. A water-soluble tetrazolium salt is used to monitor the amount of NAD(P)H in living cells through its reduction to a yellow colored water-soluble formazan dye. While this assay is not a direct method, it does not require DNA extraction or alkaline treatment, both of which could potentially cause an artifactual induction of SSBs. In addition, it takes only 4 h and requires less than a half million cells to perform this measurement. Using this assay, we demonstrated that the dose- and time-dependent depletion of NAD(P)H in XRCC1-deficient CHO cells exposed to methyl methanesulfonate. This decrease was almost completely blocked by a PARP inhibitor. Furthermore, methyl methanesulfonate reduced NAD(P)H in PARP-1+/+cells, whereas PARP-1–/– cells were more resistant to the decrease in NAD(P)H. These results indicate that the analysis of intracellular NAD(P)H level using water-soluble tetrazolium salt can assess an imbalance of SSB repair in living cells in real time. PMID:12930978

  6. Instability of CTG Repeats is Governed by the Position of a DNA Base Lesion through Base Excision Repair

    Science.gov (United States)

    Zhang, Zunzhen; Liu, Yuan

    2013-01-01

    Trinucleotide repeat (TNR) expansions and deletions are associated with human neurodegeneration and cancer. However, their underlying mechanisms remain to be elucidated. Recent studies have demonstrated that CAG repeat expansions can be initiated by oxidative DNA base damage and fulfilled by base excision repair (BER), suggesting active roles for oxidative DNA damage and BER in TNR instability. Here, we provide the first evidence that oxidative DNA damage can induce CTG repeat deletions along with limited expansions in human cells. Biochemical characterization of BER in the context of (CTG)20 repeats further revealed that repeat instability correlated with the position of a base lesion in the repeat tract. A lesion located at the 5′-end of CTG repeats resulted in expansion, whereas a lesion located either in the middle or the 3′-end of the repeats led to deletions only. The positioning effects appeared to be determined by the formation of hairpins at various locations on the template and the damaged strands that were bypassed by DNA polymerase β and processed by flap endonuclease 1 with different efficiency. Our study indicates that the position of a DNA base lesion governs whether TNR is expanded or deleted through BER. PMID:23468897

  7. The Base Excision Repair system of Salmonella enterica serovar typhimurium counteracts DNA damage by host nitric oxide.

    Directory of Open Access Journals (Sweden)

    Anthony R Richardson

    2009-05-01

    Full Text Available Intracellular pathogens must withstand nitric oxide (NO. generated by host phagocytes. Salmonella enterica serovar Typhimurium interferes with intracellular trafficking of inducible nitric oxide synthase (iNOS and possesses multiple systems to detoxify NO.. Consequently, the level of NO. stress encountered by S. Typhimurium during infection in vivo has been unknown. The Base Excision Repair (BER system recognizes and repairs damaged DNA bases including cytosine and guanine residues modified by reactive nitrogen species. Apurinic/apyrimidinic (AP sites generated by BER glycosylases require subsequent processing by AP endonucleases. S. Typhimurium xth nfo mutants lacking AP endonuclease activity exhibit increased NO. sensitivity resulting from chromosomal fragmentation at unprocessed AP sites. BER mutant strains were thus used to probe the nature and extent of nitrosative damage sustained by intracellular bacteria during infection. Here we show that an xth nfo S. Typhimurium mutant is attenuated for virulence in C3H/HeN mice, and virulence can be completely restored by the iNOS inhibitor L-NIL. Inactivation of the ung or fpg glycosylase genes partially restores virulence to xth nfo mutant S. Typhimurium, demonstrating that NO. fluxes in vivo are sufficient to modify cytosine and guanine bases, respectively. Mutants lacking ung or fpg exhibit NO.-dependent hypermutability during infection, underscoring the importance of BER in protecting Salmonella from the genotoxic effects of host NO.. These observations demonstrate that host-derived NO. damages Salmonella DNA in vivo, and the BER system is required to maintain bacterial genomic integrity.

  8. The amino-terminal tails of histones H2A and H3 coordinate efficient base excision repair, DNA damage signaling and postreplication repair in Saccharomyces cerevisiae.

    Science.gov (United States)

    Meas, Rithy; Smerdon, Michael J; Wyrick, John J

    2015-05-26

    Histone amino-terminal tails (N-tails) are required for cellular resistance to DNA damaging agents; therefore, we examined the role of histone N-tails in regulating DNA damage response pathways in Saccharomyces cerevisiae. Combinatorial deletions reveal that the H2A and H3 N-tails are important for the removal of MMS-induced DNA lesions due to their role in regulating the basal and MMS-induced expression of DNA glycosylase Mag1. Furthermore, overexpression of Mag1 in a mutant lacking the H2A and H3 N-tails rescues base excision repair (BER) activity but not MMS sensitivity. We further show that the H3 N-tail functions in the Rad9/Rad53 DNA damage signaling pathway, but this function does not appear to be the primary cause of MMS sensitivity of the double tailless mutants. Instead, epistasis analyses demonstrate that the tailless H2A/H3 phenotypes are in the RAD18 epistasis group, which regulates postreplication repair. We observed increased levels of ubiquitylated PCNA and significantly lower mutation frequency in the tailless H2A/H3 mutant, indicating a defect in postreplication repair. In summary, our data identify novel roles of the histone H2A and H3 N-tails in (i) regulating the expression of a critical BER enzyme (Mag1), (ii) supporting efficient DNA damage signaling and (iii) facilitating postreplication repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. UvrD Participation in Nucleotide Excision Repair Is Required for the Recovery of DNA Synthesis following UV-Induced Damage in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Kelley N. Newton

    2012-01-01

    Full Text Available UvrD is a DNA helicase that participates in nucleotide excision repair and several replication-associated processes, including methyl-directed mismatch repair and recombination. UvrD is capable of displacing oligonucleotides from synthetic forked DNA structures in vitro and is essential for viability in the absence of Rep, a helicase associated with processing replication forks. These observations have led others to propose that UvrD may promote fork regression and facilitate resetting of the replication fork following arrest. However, the molecular activity of UvrD at replication forks in vivo has not been directly examined. In this study, we characterized the role UvrD has in processing and restoring replication forks following arrest by UV-induced DNA damage. We show that UvrD is required for DNA synthesis to recover. However, in the absence of UvrD, the displacement and partial degradation of the nascent DNA at the arrested fork occur normally. In addition, damage-induced replication intermediates persist and accumulate in uvrD mutants in a manner that is similar to that observed in other nucleotide excision repair mutants. These data indicate that, following arrest by DNA damage, UvrD is not required to catalyze fork regression in vivo and suggest that the failure of uvrD mutants to restore DNA synthesis following UV-induced arrest relates to its role in nucleotide excision repair.

  10. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of th...

  11. Genomic Approaches to DNA repair and Mutagenesis

    OpenAIRE

    Wyrick, John J.; Roberts, Steven A.

    2015-01-01

    DNA damage is a constant threat to cells, causing cytotoxicity as well as inducing genetic alterations. The steady-state abundance of DNA lesions in a cell is minimized by a variety of DNA repair mechanisms, including DNA strand break repair, mismatch repair, nucleotide excision repair, base excision repair, and ribonucleotide excision repair. The efficiencies and mechanisms by which these pathways remove damage from chromosomes have been primarily characterized by investigating the processin...

  12. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair

    DEFF Research Database (Denmark)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott

    2014-01-01

    slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I...... by rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional...

  13. Role of the DNA Base Excision Repair Protein, APE1 in Cisplatin, Oxaliplatin, or Carboplatin Induced Sensory Neuropathy

    Science.gov (United States)

    Kelley, Mark R.; Jiang, Yanlin; Guo, Chunlu; Reed, April; Meng, Hongdi; Vasko, Michael R.

    2014-01-01

    Although chemotherapy-induced peripheral neuropathy (CIPN) is a dose-limiting side effect of platinum drugs, the mechanisms of this toxicity remain unknown. Previous work in our laboratory suggests that cisplatin-induced CIPN is secondary to DNA damage which is susceptible to base excision repair (BER). To further examine this hypothesis, we studied the effects of cisplatin, oxaliplatin, and carboplatin on cell survival, DNA damage, ROS production, and functional endpoints in rat sensory neurons in culture in the absence or presence of reduced expression of the BER protein AP endonuclease/redox factor-1 (APE1). Using an in situ model of peptidergic sensory neuron function, we examined the effects of the platinum drugs on hind limb capsaicin-evoked vasodilatation. Exposing sensory neurons in culture to the three platinum drugs caused a concentration-dependent increase in apoptosis and cell death, although the concentrations of carboplatin were 10 fold higher than cisplatin. As previously observed with cisplatin, oxaliplatin and carboplatin also increased DNA damage as indicated by an increase in phospho-H2AX and reduced the capsaicin-evoked release of CGRP from neuronal cultures. Both cisplatin and oxaliplatin increased the production of ROS as well as 8-oxoguanine DNA adduct levels, whereas carboplatin did not. Reducing levels of APE1 in neuronal cultures augmented the cisplatin and oxaliplatin induced toxicity, but did not alter the effects of carboplatin. Using an in vivo model, systemic injection of cisplatin (3 mg/kg), oxaliplatin (3 mg/kg), or carboplatin (30 mg/kg) once a week for three weeks caused a decrease in capsaicin-evoked vasodilatation, which was delayed in onset. The effects of cisplatin on capsaicin-evoked vasodilatation were attenuated by chronic administration of E3330, a redox inhibitor of APE1 that serendipitously enhances APE1 DNA repair activity in sensory neurons. These outcomes support the importance of the BER pathway, and particularly APE

  14. DNA Base-Excision Repair Genes OGG1 and NTH1 in Brazilian Lung Cancer Patients.

    Science.gov (United States)

    Couto, Patricia G; Bastos-Rodrigues, Luciana; Carneiro, Juliana G; Guieiro, Fernanda; Bicalho, Maria Aparecida; Leidenz, Franciele B; Bicalho, Ana J; Friedman, Eitan; De Marco, Luiz

    2015-12-01

    Lung cancer is the leading global cause of cancer-related mortality and is associated with poor prognosis. To improve survival rates of lung cancer patients, better understanding of tumorigenic mechanisms is necessary, which may lead to development of new therapeutic strategies. The hOGG1 and NTH1 genes act in the DNA BER repair pathway and their involvement in lung cancer pathogenesis has been analyzed in several populations. We analyzed targeted regions of the hOGG1 and NTH1 genes in 96 Brazilian patients with non-small-cell lung cancer (NSCLC) and 89 cancer-free, ethnically matched controls. The NTH1 c.98G>T polymorphism rs2302172 (p = 0.02 and p = 0.02 for allele and genotype frequency between cases and controls, respectively) and the 140-17C> T variant (rs2233518) (p = 0.02 and p = 0.02 for allele and genotype frequency between cases and controls, respectively) were detected in four lung cancer cases (4 %) while the NTH1 Q131K (C391A) polymorphism was found in seven lung cancer cases (7 %) (p = 0.001 and p = 0.008, for allele and genotype frequency between cases and controls, respectively). None of these sequence variants were detected in controls. The Ser326Cys (C1245G, rs1052133) polymorphism in the OGG1 gene was detected in 42 % of analyzed NSCLC patients and in 34 % of the controls (p = 0.11 and p = 0.25 for allele and genotype frequency between cases and controls, respectively). Our study provides preliminary evidence that polymorphisms in OGG1 do not contribute to development of NSCLC in Brazilian patients and that NTH1 polymorphisms may be associated with NSCLC pathogenesis.

  15. DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair

    NARCIS (Netherlands)

    W.L. de Laat (Wouter); E. Appeldoorn (Esther); K. Sugasawa (Kaoru); E.P.W.C. Weterings (Eric); J.H.J. Hoeijmakers (Jan); N.G.J. Jaspers (Nicolaas)

    1998-01-01

    textabstractThe human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a

  16. The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair.

    Science.gov (United States)

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2012-11-01

    Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. The role of Schizosaccharomyces pombe DNA repair enzymes Apn1p and Uve1p in the base excision repair of apurinic/apyrimidinic sites.

    Science.gov (United States)

    Tanihigashi, Haruna; Yamada, Ayako; Igawa, Emi; Ikeda, Shogo

    2006-09-08

    In Schizosaccharomyces pombe the repair of apurinic/apyrimidinic (AP) sites is mainly initiated by AP lyase activity of DNA glycosylase Nth1p. In contrast, the major AP endonuclease Apn2p functions by removing 3'-alpha,beta-unsaturated aldehyde ends induced by Nth1p, rather than by incising the AP sites. S. pombe possesses other minor AP endonuclease activities derived from Apn1p and Uve1p. In this study, we investigated the function of these two enzymes in base excision repair (BER) for methyl methanesulfonate (MMS) damage using the nth1 and apn2 mutants. Deletion of apn1 or uve1 from nth1Delta cells did not affect sensitivity to MMS. Exogenous expression of Apn1p failed to suppress the MMS sensitivity of nth1Delta cells. Although Apn1p and Uve1p incised the oligonucleotide containing an AP site analogue, these enzymes could not initiate repair of the AP sites in vivo. Despite this, expression of Apn1p partially restored the MMS sensitivity of apn2Delta cells, indicating that the enzyme functions as a 3'-phosphodiesterase to remove 3'-blocked ends. Localization of Apn1p in the nucleus and cytoplasm hints at an additional function of the enzyme other than nuclear DNA repair. Heterologous expression of Saccharomyces cerevisiae homologue of Apn1p completely restored the MMS resistance of the nth1Delta and apn2Delta cells. This result confirms a difference in the major pathway for processing the AP site between S. pombe and S. cerevisiae cells.

  18. Nucleotide Excision Repair in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Hannes Lans

    2011-01-01

    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  19. Haploinsufficiency for BRCA1 is associated with normal levels of DNA nucleotide excision repair in breast tissue and blood lymphocytes

    Directory of Open Access Journals (Sweden)

    Johnson Jennifer M

    2005-06-01

    Full Text Available Abstract Background Screening mammography has had a positive impact on breast cancer mortality but cannot detect all breast tumors. In a small study, we confirmed that low power magnetic resonance imaging (MRI could identify mammographically undetectable tumors by applying it to a high risk population. Tumors detected by this new technology could have unique etiologies and/or presentations, and may represent an increasing proportion of clinical practice as new screening methods are validated and applied. A very important aspect of this etiology is genomic instability, which is associated with the loss of activity of the breast cancer-predisposing genes BRCA1 and BRCA2. In sporadic breast cancer, however, there is evidence for the involvement of a different pathway of DNA repair, nucleotide excision repair (NER, which remediates lesions that cause a distortion of the DNA helix, including DNA cross-links. Case presentation We describe a breast cancer patient with a mammographically undetectable stage I tumor identified in our MRI screening study. She was originally considered to be at high risk due to the familial occurrence of breast and other types of cancer, and after diagnosis was confirmed as a carrier of a Q1200X mutation in the BRCA1 gene. In vitro analysis of her normal breast tissue showed no differences in growth rate or differentiation potential from disease-free controls. Analysis of cultured blood lymphocyte and breast epithelial cell samples with the unscheduled DNA synthesis (UDS assay revealed no deficiency in NER. Conclusion As new breast cancer screening methods become available and cost effective, patients such as this one will constitute an increasing proportion of the incident population, so it is important to determine whether they differ from current patients in any clinically important ways. Despite her status as a BRCA1 mutation carrier, and her mammographically dense breast tissue, we did not find increased cell

  20. Base excision repair of oxidative DNA damage and association with cancer and aging

    DEFF Research Database (Denmark)

    Maynard, Scott; Schurman, Shepherd H; Harboe, Charlotte

    2009-01-01

    Aging has been associated with damage accumulation in the genome and with increased cancer incidence. Reactive oxygen species (ROS) are produced from endogenous sources, most notably the oxidative metabolism in the mitochondria, and from exogenous sources, such as ionizing radiation. ROS attack DNA...... recently, BER was shown to also exist in the mitochondria. Here, we review the association of BER of oxidative DNA damage with aging, cancer and other diseases....... readily, generating a variety of DNA lesions, such as oxidized bases and strand breaks. If not properly removed, DNA damage can be potentially devastating to normal cell physiology, leading to mutagenesis and/or cell death, especially in the case of cytotoxic lesions that block the progression of DNA...

  1. SPT4 increases UV-induced mutagenesis in yeast through impaired nucleotide excision repair

    National Research Council Canada - National Science Library

    Kang, Mi-Sun; Yu, Sung-Lim; Kim, Ho-Yeol; Lim, Hyun-Sook; Lee, Sung-Keun

    2013-01-01

    .... As unrepaired DNA lesions inhibit transcription, UV-induced damage to transcribed DNA is repaired preferentially versus non-transcribed DNA through transcription-coupled nucleotide excision repair (TCR...

  2. A ubiquitylation site in Cockayne syndrome B required for repair of oxidative DNA damage, but not for transcription-coupled nucleotide excision repair.

    Science.gov (United States)

    Ranes, Michael; Boeing, Stefan; Wang, Yuming; Wienholz, Franziska; Menoni, Hervé; Walker, Jane; Encheva, Vesela; Chakravarty, Probir; Mari, Pierre-Olivier; Stewart, Aengus; Giglia-Mari, Giuseppina; Snijders, Ambrosius P; Vermeulen, Wim; Svejstrup, Jesper Q

    2016-06-20

    Cockayne syndrome B (CSB), best known for its role in transcription-coupled nucleotide excision repair (TC-NER), contains a ubiquitin-binding domain (UBD), but the functional connection between protein ubiquitylation and this UBD remains unclear. Here, we show that CSB is regulated via site-specific ubiquitylation. Mass spectrometry analysis of CSB identified lysine (K) 991 as a ubiquitylation site. Intriguingly, mutation of this residue (K991R) does not affect CSB's catalytic activity or protein stability, but greatly affects genome stability, even in the absence of induced DNA damage. Moreover, cells expressing CSB K991R are sensitive to oxidative DNA damage, but proficient for TC-NER. K991 becomes ubiquitylated upon oxidative DNA damage, and while CSB K991R is recruited normally to such damage, it fails to dissociate in a timely manner, suggesting a requirement for K991 ubiquitylation in CSB activation. Interestingly, deletion of CSB's UBD gives rise to oxidative damage sensitivity as well, while CSB ΔUBD and CSB K991R affects expression of overlapping groups of genes, further indicating a functional connection. Together, these results shed new light on the regulation of CSB, with K991R representing an important separation-of-function-mutation in this multi-functional protein. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Probing for DNA damage with β-hairpins: Similarities in incision efficiencies of bulky DNA adducts by prokaryotic and human nucleotide excision repair systems in vitro

    Science.gov (United States)

    Liu, Yang; Reeves, Dara; Kropachev, Konstantin; Cai, Yuqin; Ding, Shuang; Kolbanovskiy, Marina; Kolbanovskiy, Alexander; Bolton, Judith L.; Broyde, Suse; Van Houten, Bennett; Geacintov, Nicholas E.

    2011-01-01

    Nucleotide excision repair (NER) is an important prokaryotic and eukaryotic defense mechanism that removes a large variety of structurally distinct lesions in cellular DNA. While the proteins involved are completely different, the mode of action of these two repair systems is similar, involving a cut-and-patch mechanism in which an oligonucleotide sequence containing the lesion is excised. The prokaryotic and eukaryotic NER damage-recognition factors have common structural features of β-hairpin intrusion between the two DNA strands at the site of the lesion. In the present study, we explored the hypothesis that this common β-hairpin intrusion motif is mirrored in parallel NER incision efficiencies in the two systems. We have utilized human HeLa cell extracts and the prokaryotic UvrABC proteins to determine their relative NER incision efficiencies. We report here comparisons of relative NER efficiencies with a set of stereoisomeric DNA lesions derived from metabolites of benzo[a]pyrene and equine estrogens in different sequence contexts, utilizing 21 samples. We found a general qualitative trend towards similar relative NER incision efficiencies for ~ 65% of these substrates; the other cases deviate mostly by ~ 30% or less from a perfect correlation, although several more distant outliers are also evident. This resemblance is consistent with the hypothesis that lesion recognition through β-hairpin insertion, a common feature of the two systems, is facilitated by local thermodynamic destabilization induced by the lesions in both cases. In the case of the UvrABC system, varying the nature of the UvrC endonuclease, while maintaining the same UvrA/B proteins, can markedly affect the relative incision efficiencies. These observations suggest that, in addition to recognition involving the initial modified duplexes, downstream events involving UvrC can also play a role in distinguishing and processing different lesions in prokaryotic NER. PMID:21741328

  4. Distant neighbor base sequence context effects in human nucleotide excision repair of a benzo[a]pyrene-derived DNA lesion.

    Science.gov (United States)

    Cai, Yuqin; Kropachev, Konstantin; Xu, Rong; Tang, Yijin; Kolbanovskii, Marina; Kolbanovskii, Alexander; Amin, Shantu; Patel, Dinshaw J; Broyde, Suse; Geacintov, Nicholas E

    2010-06-11

    The effects of non-nearest base sequences, beyond the nucleotides flanking a DNA lesion on either side, on nucleotide excision repair (NER) in extracts from human cells were investigated. We constructed two duplexes containing the same minor groove-aligned 10S (+)-trans-anti-B[a]P-N(2)-dG (G*) DNA adduct, derived from the environmental carcinogen benzo[a]pyrene (B[a]P): 5'-C-C-A-T-C-G*-C-T-A-C-C-3' (CG*C-I), and 5'-C-A-C3-A4-C5-G*-C-A-C-A-C-3' (CG*C-II). We used polyacrylamide gel electrophoresis to compare the extent of DNA bending, and molecular dynamics simulations to analyze the structural characteristics of these two DNA duplexes. The NER efficiencies are 1.6(+/-0.2)-fold greater in the case of the CG*C-II than the CG*C-I sequence context in 135-mer duplexes. Gel electrophoresis and self-ligation circularization experiments revealed that the CG*C-II duplex is more bent than the CG*C-I duplex, while molecular dynamics simulations showed that the unique -C3-A4-C5- segment in the CG*C-II duplex plays a key role. The presence of a minor groove-positioned guanine amino group, the Watson-Crick partner to C3, acts as a wedge; facilitated by a highly deformable local -C3-A4- base step, this amino group allows the B[a]P ring system to produce a more enlarged minor groove in CG*C-II than in CG*C-I, as well as a local untwisting and enlarged and flexible Roll only in the CG*C-II sequence. These structural properties fit well with our earlier findings that in the case of the family of minor groove 10S (+)-trans-anti-B[a]P-N(2)-dG lesions, flexible bends and enlarged minor groove widths constitute NER recognition signals, and extend our understanding of sequence context effects on NER to the neighbors that are distant to the lesion. Copyright 2010 Elsevier Ltd. All rights reserved.

  5. Alcohol-induced one-carbon metabolism impairment promotes dysfunction of DNA base excision repair in adult brain.

    Science.gov (United States)

    Fowler, Anna-Kate; Hewetson, Aveline; Agrawal, Rajiv G; Dagda, Marisela; Dagda, Raul; Moaddel, Ruin; Balbo, Silvia; Sanghvi, Mitesh; Chen, Yukun; Hogue, Ryan J; Bergeson, Susan E; Henderson, George I; Kruman, Inna I

    2012-12-21

    The brain is one of the major targets of chronic alcohol abuse. Yet the fundamental mechanisms underlying alcohol-mediated brain damage remain unclear. The products of alcohol metabolism cause DNA damage, which in conditions of DNA repair dysfunction leads to genomic instability and neural death. We propose that one-carbon metabolism (OCM) impairment associated with long term chronic ethanol intake is a key factor in ethanol-induced neurotoxicity, because OCM provides cells with DNA precursors for DNA repair and methyl groups for DNA methylation, both critical for genomic stability. Using histological (immunohistochemistry and stereological counting) and biochemical assays, we show that 3-week chronic exposure of adult mice to 5% ethanol (Lieber-Decarli diet) results in increased DNA damage, reduced DNA repair, and neuronal death in the brain. These were concomitant with compromised OCM, as evidenced by elevated homocysteine, a marker of OCM dysfunction. We conclude that OCM dysfunction plays a causal role in alcohol-induced genomic instability in the brain because OCM status determines the alcohol effect on DNA damage/repair and genomic stability. Short ethanol exposure, which did not disturb OCM, also did not affect the response to DNA damage, whereas additional OCM disturbance induced by deficiency in a key OCM enzyme, methylenetetrahydrofolate reductase (MTHFR) in Mthfr(+/-) mice, exaggerated the ethanol effect on DNA repair. Thus, the impact of long term ethanol exposure on DNA repair and genomic stability in the brain results from OCM dysfunction, and MTHFR mutations such as Mthfr 677C→T, common in human population, may exaggerate the adverse effects of ethanol on the brain.

  6. Mammalian Transcription-Coupled Excision Repair

    Science.gov (United States)

    Vermeulen, Wim; Fousteri, Maria

    2013-01-01

    Transcriptional arrest caused by DNA damage is detrimental for cells and organisms as it impinges on gene expression and thereby on cell growth and survival. To alleviate transcriptional arrest, cells trigger a transcription-dependent genome surveillance pathway, termed transcription-coupled nucleotide excision repair (TC-NER) that ensures rapid removal of such transcription-impeding DNA lesions and prevents persistent stalling of transcription. Defective TC-NER is causatively linked to Cockayne syndrome, a rare severe genetic disorder with multisystem abnormalities that results in patients’ death in early adulthood. Here we review recent data on how damage-arrested transcription is actively coupled to TC-NER in mammals and discuss new emerging models concerning the role of TC-NER-specific factors in this process. PMID:23906714

  7. Recognition of Damaged DNA for Nucleotide Excision Repair: A Correlated Motion Mechanism with a Mismatched cis-syn Thymine Dimer Lesion.

    Science.gov (United States)

    Mu, Hong; Geacintov, Nicholas E; Zhang, Yingkai; Broyde, Suse

    2015-09-01

    Mammalian global genomic nucleotide excision repair requires lesion recognition by XPC, whose detailed binding mechanism remains to be elucidated. Here we have delineated the dynamic molecular pathway and energetics of lesion-specific and productive binding by the Rad4/yeast XPC lesion recognition factor, as it forms the open complex [Min, J. H., and Pavletich, N. P. (2007) Nature 449, 570-575; Chen, X., et al. (2015) Nat. Commun. 6, 5849] that is required for excision. We investigated extensively a cis-syn cyclobutane pyrimidine dimer in mismatched duplex DNA, using high-level computational approaches. Our results delineate a preferred correlated motion mechanism, which provides for the first time an atomistic description of the sequence of events as Rad4 productively binds to the damaged DNA.

  8. Base-Excision-Repair-Induced Construction of a Single Quantum-Dot-Based Sensor for Sensitive Detection of DNA Glycosylase Activity.

    Science.gov (United States)

    Wang, Li-Juan; Ma, Fei; Tang, Bo; Zhang, Chun-Yang

    2016-08-02

    DNA glycosylase is an initiating enzyme of cellular base excision repair pathway which is responsible for the repair of various DNA lesions and the maintenance of genomic stability, and the dysregulation of DNA glycosylase activity is associated with a variety of human pathology. Accurate detection of DNA glycosylase activity is critical to both clinical diagnosis and therapeutics, but conventional methods for the DNA glycosylase assay are usually time-consuming with poor sensitivity. Here, we demonstrate the base-excision-repair-induced construction of a single quantum dot (QD)-based sensor for highly sensitive measurement of DNA glycosylase activity. We use human 8-oxoguanine-DNA glycosylase 1 (hOGG1), which is responsible for specifically repairing the damaged 8-hydroxyguanine (8-oxoG, one of the most abundant and widely studied DNA damage products), as a model DNA glycosylase. In the presence of biotin-labeled DNA substrate, the hOGG1 may catalyze the removal of 8-oxo G from 8-oxoG·C base pairs to generate an apurinic/apyrimidinic (AP) site. With the assistance of apurinic/apyrimidinic endonuclease (APE1), the cleavage of the AP site results in the generation of a single-nucleotide gap. Subsequently, DNA polymerase β incorporates a Cy5-labeled dGTP into the DNA substrate to fill the gap. With the addition of streptavidin-coated QDs, a QD-DNA-Cy5 nanostructure is formed via specific biotin-streptavidin binding, inducing the occurrence of fluorescence resonance energy transfer (FRET) from the QD to Cy5. The resulting Cy5 signal can be simply monitored by total internal reflection fluorescence (TIRF) imaging. The proposed method enables highly sensitive measurement of hOGG1 activity with a detection limit of 1.8 × 10(-6) U/μL. Moreover, it can be used to measure the enzyme kinetic parameters and detect the hOGG1 activity in crude cell extracts, offering a powerful tool for biomedical research and clinical diagnosis.

  9. DICER- and MMSET-catalyzed H4K20me2 recruits the nucleotide excision repair factor XPA to DNA damage sites.

    Science.gov (United States)

    Chitale, Shalaka; Richly, Holger

    2017-12-12

    Ultraviolet (UV) irradiation triggers the recruitment of DNA repair factors to the lesion sites and the deposition of histone marks as part of the DNA damage response. The major DNA repair pathway removing DNA lesions caused by exposure to UV light is nucleotide excision repair (NER). We have previously demonstrated that the endoribonuclease DICER facilitates chromatin decondensation during lesion recognition in the global-genomic branch of NER. Here, we report that DICER mediates the recruitment of the methyltransferase MMSET to the DNA damage site. We show that MMSET is required for efficient NER and that it catalyzes the dimethylation of histone H4 at lysine 20 (H4K20me2). H4K20me2 at DNA damage sites facilitates the recruitment of the NER factor XPA. Our work thus provides evidence for an H4K20me2-dependent mechanism of XPA recruitment during lesion recognition in the global-genomic branch of NER. © 2018 Chitale and Richly.

  10. Xeroderma pigmentosum-Cockayne syndrome complex in two patients: absence of skin tumors despite severe deficiency of DNA excision repair.

    Science.gov (United States)

    Scott, R J; Itin, P; Kleijer, W J; Kolb, K; Arlett, C; Muller, H

    1993-11-01

    Two brothers had a complex combination of two DNA repair disorders: Cockayne syndrome and xeroderma pigmentosum. This rare combination has previously been observed in only two other patients. The clinical signs shared by these two brothers and the two other previously described patients include severe sun sensitivity, freckling, diminished stature, hearing and movement impairment, and neurologic degeneration. Although defective UV-induced unscheduled DNA synthesis has been demonstrated (5% of normal), no skin cancers have appeared in these 38- and 41-year-old brothers, whereas skin cancers developed at a relatively early age in the two previously described patients who also had defective UV-induced unscheduled DNA synthesis.

  11. Endonuclease IV Is the Main Base Excision Repair Enzyme Involved in DNA Damage Induced by UVA Radiation and Stannous Chloride

    Directory of Open Access Journals (Sweden)

    Ellen S. Motta

    2010-01-01

    Full Text Available Stannous chloride (SnCl2 and UVA induce DNA lesions through ROS. The aim of this work was to study the toxicity induced by UVA preillumination, followed by SnCl2 treatment. E. coli BER mutants were used to identify genes which could play a role in DNA lesion repair generated by these agents. The survival assays showed (i The nfo mutant was the most sensitive to SnCl2; (ii lethal synergistic effect was observed after UVA pre-illumination, plus SnCl2 incubation, the nfo mutant being the most sensitive; (iii wild type and nfo mutants, transformed with pBW21 plasmid (nfo+ had their survival increased following treatments. The alkaline agarose gel electrophoresis assays pointed that (i UVA induced DNA breaks and fpg mutant was the most sensitive; (ii SnCl2-induced DNA strand breaks were higher than those from UVA and nfo mutant had the slowest repair kinetics; (iii UVA+SnCl2 promoted an increase in DNA breaks than SnCl2 and, again, nfo mutant displayed the slowest repair kinetics. In summary, Nfo protects E. coli cells against damage induced by SnCl2 and UVA+ SnCl2.

  12. ATR- and ATM-Mediated DNA Damage Response Is Dependent on Excision Repair Assembly during G1 but Not in S Phase of Cell Cycle.

    Science.gov (United States)

    Ray, Alo; Blevins, Chessica; Wani, Gulzar; Wani, Altaf A

    2016-01-01

    Cell cycle checkpoint is mediated by ATR and ATM kinases, as a prompt early response to a variety of DNA insults, and culminates in a highly orchestrated signal transduction cascade. Previously, we defined the regulatory role of nucleotide excision repair (NER) factors, DDB2 and XPC, in checkpoint and ATR/ATM-dependent repair pathway via ATR and ATM phosphorylation and recruitment to ultraviolet radiation (UVR)-induced damage sites. Here, we have dissected the molecular mechanisms of DDB2- and XPC- mediated regulation of ATR and ATM recruitment and activation upon UVR exposures. We show that the ATR and ATM activation and accumulation to UVR-induced damage not only depends on DDB2 and XPC, but also on the NER protein XPA, suggesting that the assembly of an active NER complex is essential for ATR and ATM recruitment. ATR and ATM localization and H2AX phosphorylation at the lesion sites occur as early as ten minutes in asynchronous as well as G1 arrested cells, showing that repair and checkpoint-mediated by ATR and ATM starts early upon UV irradiation. Moreover, our results demonstrated that ATR and ATM recruitment and H2AX phosphorylation are dependent on NER proteins in G1 phase, but not in S phase. We reasoned that in G1 the UVR-induced ssDNA gaps or processed ssDNA, and the bound NER complex promote ATR and ATM recruitment. In S phase, when the UV lesions result in stalled replication forks with long single-stranded DNA, ATR and ATM recruitment to these sites is regulated by different sets of proteins. Taken together, these results provide evidence that UVR-induced ATR and ATM recruitment and activation differ in G1 and S phases due to the existence of distinct types of DNA lesions, which promote assembly of different proteins involved in the process of DNA repair and checkpoint activation.

  13. Cockayne syndrome: varied requirement of transcription-coupled nucleotide excision repair for the removal of three structurally different adducts from transcribed DNA.

    Directory of Open Access Journals (Sweden)

    Nataliya Kitsera

    Full Text Available Hereditary defects in the transcription-coupled nucleotide excision repair (TC-NER pathway of damaged DNA cause severe neurodegenerative disease Cockayne syndrome (CS, however the origin and chemical nature of the underlying DNA damage had remained unknown. To find out, to which degree the structural properties of DNA lesions determine the extent of transcription arrest in human CS cells, we performed quantitative host cell reactivation analyses of expression vectors containing various synthetic adducts. We found that a single 3-(deoxyguanosin-N2-yl-2-acetylaminofluorene adduct (dG(N2-AAF constitutes an unsurmountable obstacle to transcription in both CS-A and CS-B cells and is removed exclusively by the CSA- and CSB-dependent pathway. In contrast, contribution of the CS proteins to the removal of two other transcription-blocking DNA lesions - N-(deoxyguanosin-8-yl-2-acetylaminofluorene (dG(C8-AAF and cyclobutane thymine-thymine (TT dimer - is only minor (TT dimer or none (dG(C8-AAF. The unique properties of dG(N2-AAF identify this adduct as a prototype for a new class of DNA lesions that escape the alternative global genome repair and could be critical for the CS pathogenesis.

  14. Is the Oxidative DNA Damage Level of Human Lymphocyte Correlated with the Antioxidant Capacity of Serum or the Base Excision Repair Activity of Lymphocyte?

    Directory of Open Access Journals (Sweden)

    Yi-Chih Tsai

    2013-01-01

    Full Text Available A random screening of human blood samples from 24 individuals of nonsmoker was conducted to examine the correlation between the oxidative DNA damage level of lymphocytes and the antioxidant capacity of serum or the base excision repair (BER activity of lymphocytes. The oxidative DNA damage level was measured with comet assay containing Fpg/Endo III cleavage, and the BER activity was estimated with a modified comet assay including nuclear extract of lymphocytes for enzymatic cleavage. Antioxidant capacity was determined with trolox equivalent antioxidant capacity assay. We found that though the endogenous DNA oxidation levels varied among the individuals, each individual level appeared to be steady for at least 1 month. Our results indicate that the oxidative DNA damage level is insignificantly or weakly correlated with antioxidant capacity or BER activity, respectively. However, lymphocytes from carriers of Helicobacter pylori (HP or Hepatitis B virus (HBV tend to give higher levels of oxidative DNA damage (P<0.05. Though sera of this group of individuals show no particular tendency with reduced antioxidant capacity, the respective BER activities of lymphocytes are lower in average (P<0.05. Thus, reduction of repair activity may be associated with the genotoxic effect of HP or HBV infection.

  15. Conservation and Divergence in Nucleotide Excision Repair Lesion Recognition*

    Science.gov (United States)

    Wirth, Nicolas; Gross, Jonas; Roth, Heide M.; Buechner, Claudia N.; Kisker, Caroline; Tessmer, Ingrid

    2016-01-01

    Nucleotide excision repair is an important and highly conserved DNA repair mechanism with an exceptionally large range of chemically and structurally unrelated targets. Lesion verification is believed to be achieved by the helicases UvrB and XPD in the prokaryotic and eukaryotic processes, respectively. Using single molecule atomic force microscopy analyses, we demonstrate that UvrB and XPD are able to load onto DNA and pursue lesion verification in the absence of the initial lesion detection proteins. Interestingly, our studies show different lesion recognition strategies for the two functionally homologous helicases, as apparent from their distinct DNA strand preferences, which can be rationalized from the different structural features and interactions with other nucleotide excision repair protein factors of the two enzymes. PMID:27405761

  16. Monte Carlo simulation of base and nucleotide excision repair of clustered DNA damage sites. I. Model properties and predicted trends

    Energy Technology Data Exchange (ETDEWEB)

    Semenenko, Vladimir; Stewart, Robert D.; Ackerman, Eric J.

    2005-12-31

    Single-cell irradiators and new experimental assays are rapidly expanding our ability to quantify the molecular mechanisms responsible for phenomena such as toxicant-induced adaptations in DNA repair and signal-mediated changes to the genome stability of cells not directly damaged by radiation (i.e., bystander cells). To advance our understanding of, and ability to predict and mitigate, the potentially harmful effects of radiological agents, effective strategies must be devised to incorporate information from molecular and cellular studies into mechanism-based, hierarchical models. A key advantage of the hierarchical modeling approach is that information from DNA repair and other in vitro assays can be systematically integrated into higher-level cell transformation and, eventually, carcinogenesis models. This presentation will outline the hierarchical modeling strategy used to integrate information from in vitro studies into the Virtual Cell (VC) radiobiology software (see Endnote). A new multi-path genomic instability model will be introduced and used to link biochemical processing of double strand breaks (DSBs) to neoplastic cell transformation. Bystander and directly damaged cells are treated explicitly in the model using a microdosimetric approach, although many of the details of the bystander response model are of a necessarily preliminary nature. The new model will be tested against several published radiobiological datasets. Results illustrating how hypothesized bystander mechanisms affect the shape of dose-response curves for neoplastic transformation as a function of Linear Energy Transfer (LET) will be presented. EndNote: R.D. Stewart, Virtual Cell (VC) Radiobiology Software. PNNL-13579, July 2001. Available at http://www.pnl.gov/berc/kbem/vc/ The DNA repair model used in the VC computer program is based on the Two-Lesion Kinetic (TLK) model [Radiat. Res. 156(4), 365-378 October 2001].

  17. Chromatin Dynamics during Nucleotide Excision Repair: Histones on the Move

    Directory of Open Access Journals (Sweden)

    Sophie E. Polo

    2012-09-01

    Full Text Available It has been a long-standing question how DNA damage repair proceeds in a nuclear environment where DNA is packaged into chromatin. Several decades of analysis combining in vitro and in vivo studies in various model organisms ranging from yeast to human have markedly increased our understanding of the mechanisms underlying chromatin disorganization upon damage detection and re-assembly after repair. Here, we review the methods that have been developed over the years to delineate chromatin alterations in response to DNA damage by focusing on the well-characterized Nucleotide Excision Repair (NER pathway. We also highlight how these methods have provided key mechanistic insight into histone dynamics coupled to repair in mammals, raising new issues about the maintenance of chromatin integrity. In particular, we discuss how NER factors and central players in chromatin dynamics such as histone modifiers, nucleosome remodeling factors, and histone chaperones function to mobilize histones during repair.

  18. Chromatin Dynamics during Nucleotide Excision Repair: Histones on the Move

    Science.gov (United States)

    Adam, Salomé; Polo, Sophie E.

    2012-01-01

    It has been a long-standing question how DNA damage repair proceeds in a nuclear environment where DNA is packaged into chromatin. Several decades of analysis combining in vitro and in vivo studies in various model organisms ranging from yeast to human have markedly increased our understanding of the mechanisms underlying chromatin disorganization upon damage detection and re-assembly after repair. Here, we review the methods that have been developed over the years to delineate chromatin alterations in response to DNA damage by focusing on the well-characterized Nucleotide Excision Repair (NER) pathway. We also highlight how these methods have provided key mechanistic insight into histone dynamics coupled to repair in mammals, raising new issues about the maintenance of chromatin integrity. In particular, we discuss how NER factors and central players in chromatin dynamics such as histone modifiers, nucleosome remodeling factors, and histone chaperones function to mobilize histones during repair. PMID:23109890

  19. A general role of the DNA glycosylase Nth1 in the abasic sites cleavage step of base excision repair in Schizosaccharomyces pombe.

    Science.gov (United States)

    Alseth, Ingrun; Korvald, Hanne; Osman, Fekret; Seeberg, Erling; Bjørås, Magnar

    2004-01-01

    One of the most frequent lesions formed in cellular DNA are abasic (apurinic/apyrimidinic, AP) sites that are both cytotoxic and mutagenic, and must be removed efficiently to maintain genetic stability. It is generally believed that the repair of AP sites is initiated by the AP endonucleases; however, an alternative pathway seems to prevail in Schizosaccharomyces pombe. A mutant lacking the DNA glycosylase/AP lyase Nth1 is very sensitive to the alkylating agent methyl methanesulfonate (MMS), suggesting a role for Nth1 in base excision repair (BER) of alkylation damage. Here, we have further evaluated the role of Nth1 and the second putative S.pombe AP endonuclease Apn2, in abasic site repair. The deletion of the apn2 open reading frame dramatically increased the sensitivity of the yeast cells to MMS, also demonstrating that the Apn2 has an important function in the BER pathway. The deletion of nth1 in the apn2 mutant strain partially relieves the MMS sensitivity of the apn2 single mutant, indicating that the Apn2 and Nth1 act in the same pathway for the repair of abasic sites. Analysis of the AP site cleavage in whole cell extracts of wild-type and mutant strains showed that the AP lyase activity of Nth1 represents the major AP site incision activity in vitro. Assays with DNA substrates containing base lesions removed by monofunctional DNA glycosylases Udg and MutY showed that Nth1 will also cleave the abasic sites formed by these enzymes and thus act downstream of these enzymes in the BER pathway. We suggest that the main function of Apn2 in BER is to remove the resulting 3'-blocking termini following AP lyase cleavage by Nth1.

  20. Bypass of a 5′,8-cyclopurine-2′-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E.; Terzidis, Michael A.; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-01-01

    5′,8-cyclopurine-2′-deoxynucleosides including 5′,8-cyclo-dA (cdA) and 5′,8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5′,8-cyclopurine-2′-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5′R-cdA, but inefficiently bypassed a 5′S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5′,8-cyclopurine-2′-deoxynucleoside. Moreover, we found that bypass of a 5′S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5′,8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. PMID:26123757

  1. Biomolecular Simulation of Base Excision Repair and Protein Signaling

    Energy Technology Data Exchange (ETDEWEB)

    Straatsma, TP; McCammon, J A; Miller, John H; Smith, Paul E; Vorpagel, Erich R; Wong, Chung F; Zacharias, Martin W

    2006-03-03

    The goal of the Biomolecular Simulation of Base Excision Repair and Protein Signaling project is to enhance our understanding of the mechanism of human polymerase-β, one of the key enzymes in base excision repair (BER) and the cell-signaling enzymes cyclic-AMP-dependent protein kinase. This work used molecular modeling and simulation studies to specifically focus on the • dynamics of DNA and damaged DNA • dynamics and energetics of base flipping in DNA • mechanism and fidelity of nucleotide insertion by BER enzyme human polymerase-β • mechanism and inhibitor design for cyclic-AMP-dependent protein kinase. Molecular dynamics simulations and electronic structure calculations have been performed using the computer resources at the Molecular Science Computing Facility at the Environmental Molecular Sciences Laboratory.

  2. International congress on DNA damage and repair: Book of abstracts

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)

  3. Base excision repair of chemotherapeutically-induced alkylated DNA damage predominantly causes contractions of expanded GAA repeats associated with Friedreich's ataxia.

    Directory of Open Access Journals (Sweden)

    Yanhao Lai

    Full Text Available Expansion of GAA·TTC repeats within the first intron of the frataxin gene is the cause of Friedreich's ataxia (FRDA, an autosomal recessive neurodegenerative disorder. However, no effective treatment for the disease has been developed as yet. In this study, we explored a possibility of shortening expanded GAA repeats associated with FRDA through chemotherapeutically-induced DNA base lesions and subsequent base excision repair (BER. We provide the first evidence that alkylated DNA damage induced by temozolomide, a chemotherapeutic DNA damaging agent can induce massive GAA repeat contractions/deletions, but only limited expansions in FRDA patient lymphoblasts. We showed that temozolomide-induced GAA repeat instability was mediated by BER. Further characterization of BER of an abasic site in the context of (GAA20 repeats indicates that the lesion mainly resulted in a large deletion of 8 repeats along with small expansions. This was because temozolomide-induced single-stranded breaks initially led to DNA slippage and the formation of a small GAA repeat loop in the upstream region of the damaged strand and a small TTC loop on the template strand. This allowed limited pol β DNA synthesis and the formation of a short 5'-GAA repeat flap that was cleaved by FEN1, thereby leading to small repeat expansions. At a later stage of BER, the small template loop expanded into a large template loop that resulted in the formation of a long 5'-GAA repeat flap. Pol β then performed limited DNA synthesis to bypass the loop, and FEN1 removed the long repeat flap ultimately causing a large repeat deletion. Our study indicates that chemotherapeutically-induced alkylated DNA damage can induce large contractions/deletions of expanded GAA repeats through BER in FRDA patient cells. This further suggests the potential of developing chemotherapeutic alkylating agents to shorten expanded GAA repeats for treatment of FRDA.

  4. Base excision repair of chemotherapeutically-induced alkylated DNA damage predominantly causes contractions of expanded GAA repeats associated with Friedreich's ataxia.

    Science.gov (United States)

    Lai, Yanhao; Beaver, Jill M; Lorente, Karla; Melo, Jonathan; Ramjagsingh, Shyama; Agoulnik, Irina U; Zhang, Zunzhen; Liu, Yuan

    2014-01-01

    Expansion of GAA·TTC repeats within the first intron of the frataxin gene is the cause of Friedreich's ataxia (FRDA), an autosomal recessive neurodegenerative disorder. However, no effective treatment for the disease has been developed as yet. In this study, we explored a possibility of shortening expanded GAA repeats associated with FRDA through chemotherapeutically-induced DNA base lesions and subsequent base excision repair (BER). We provide the first evidence that alkylated DNA damage induced by temozolomide, a chemotherapeutic DNA damaging agent can induce massive GAA repeat contractions/deletions, but only limited expansions in FRDA patient lymphoblasts. We showed that temozolomide-induced GAA repeat instability was mediated by BER. Further characterization of BER of an abasic site in the context of (GAA)20 repeats indicates that the lesion mainly resulted in a large deletion of 8 repeats along with small expansions. This was because temozolomide-induced single-stranded breaks initially led to DNA slippage and the formation of a small GAA repeat loop in the upstream region of the damaged strand and a small TTC loop on the template strand. This allowed limited pol β DNA synthesis and the formation of a short 5'-GAA repeat flap that was cleaved by FEN1, thereby leading to small repeat expansions. At a later stage of BER, the small template loop expanded into a large template loop that resulted in the formation of a long 5'-GAA repeat flap. Pol β then performed limited DNA synthesis to bypass the loop, and FEN1 removed the long repeat flap ultimately causing a large repeat deletion. Our study indicates that chemotherapeutically-induced alkylated DNA damage can induce large contractions/deletions of expanded GAA repeats through BER in FRDA patient cells. This further suggests the potential of developing chemotherapeutic alkylating agents to shorten expanded GAA repeats for treatment of FRDA.

  5. Genomic approaches to DNA repair and mutagenesis.

    Science.gov (United States)

    Wyrick, John J; Roberts, Steven A

    2015-12-01

    DNA damage is a constant threat to cells, causing cytotoxicity as well as inducing genetic alterations. The steady-state abundance of DNA lesions in a cell is minimized by a variety of DNA repair mechanisms, including DNA strand break repair, mismatch repair, nucleotide excision repair, base excision repair, and ribonucleotide excision repair. The efficiencies and mechanisms by which these pathways remove damage from chromosomes have been primarily characterized by investigating the processing of lesions at defined genomic loci, among bulk genomic DNA, on episomal DNA constructs, or using in vitro substrates. However, the structure of a chromosome is heterogeneous, consisting of heavily protein-bound heterochromatic regions, open regulatory regions, actively transcribed genes, and even areas of transient single stranded DNA. Consequently, DNA repair pathways function in a much more diverse set of chromosomal contexts than can be readily assessed using previous methods. Recent efforts to develop whole genome maps of DNA damage, repair processes, and even mutations promise to greatly expand our understanding of DNA repair and mutagenesis. Here we review the current efforts to utilize whole genome maps of DNA damage and mutation to understand how different chromosomal contexts affect DNA excision repair pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Graphene oxide nanosheets induce DNA damage and activate the base excision repair (BER) signaling pathway both in vitro and in vivo.

    Science.gov (United States)

    Lu, Chun-Jiao; Jiang, Xue-Feng; Junaid, Muhammad; Ma, Yan-Bo; Jia, Pan-Pan; Wang, Hua-Bin; Pei, De-Sheng

    2017-10-01

    Graphene oxide (GO) has widespread concerns in the fields of biological sciences and medical applications. Currently, studies have reported that excessive GO exposure can cause cellular DNA damage through reactive oxygen species (ROS) generation. However, DNA damage mediated response of the base excision repair (BER) pathway due to GO exposure is not elucidated yet. Therefore, we exposed HEK293T cells and zebrafish embryos to different concentrations of GO for 24 h, and transcriptional profiles of BER pathway genes, DNA damage, and cell viability were analyzed both in vitro and in vivo. Moreover, the deformation of HEK293T cells before and after GO exposure was also investigated using atomic force microscopy (AFM) to identify the physical changes occurred in the cells' structure. CCK-8 and Comet assay revealed the significant decrease in cell viability and increase in DNA damage in HEK293T cells at higher GO doses (25 and 50 μg/mL). Among the investigated genetic markers in HEK293T cells, BER pathway genes (APEX1, OGG1, CREB1, UNG) were significantly up-regulated upon exposure to higher GO dose (50 μg/mL), however, low exposure concentration (5, 25 μg/mL) failed to induce significant genetic induction except for CREB1 at 25 μg/mL. Additionally, the viscosity of HEK293T cells decreased upon GO exposure. In zebrafish, the results of up-regulated gene expressions (apex1, ogg1, polb, creb1) were consistent with those in the HEK293T cells. Taken all together, the exposure to elevated GO concentration could cause DNA damage to HEK293T cells and zebrafish embryos; BER pathway could be proposed as the possible inner response mechanism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Involvement of two endonuclease III homologs in the base excision repair pathway for the processing of DNA alkylation damage in Saccharomyces cerevisiae.

    Science.gov (United States)

    Hanna, Michelle; Chow, Barbara L; Morey, Natalie J; Jinks-Robertson, Sue; Doetsch, Paul W; Xiao, Wei

    2004-01-05

    DNA base excision repair (BER) is initiated by DNA glycosylases that recognize and remove damaged bases. The phosphate backbone adjacent to the resulting apurinic/apyrimidinic (AP) site is then cleaved by an AP endonuclease or glycosylase-associated AP lyase to invoke subsequent BER steps. We have used a genetic approach in Saccharomyces cerevisiae to determine whether or not AP sites are blocks to DNA replication and the biological consequences if AP sites persist in the genome. We previously reported that yeast cells deficient in the two AP endonucleases (apn1 apn2 double mutant) are extremely sensitive to killing by a model DNA alkylating agent methyl methanesulfonate (MMS) and that this sensitivity can be reduced by deleting the MAG1 3-methyladenine DNA glycosylase gene. Here we report that in the absence of the AP endonucleases, deletion of two Escherichia coli endonuclease III homologs, NTG1 and NTG2, partially suppresses MMS-induced killing, which indicates that the AP lyase products are deleterious unless they are further processed by an AP endonuclease. The severe MMS sensitivity seen in AP endonuclease deficient strains can also be rescued by treatment of cells with the AP lyase inhibitor methoxyamine, which suggests that the product of AP lyase action on an AP site is indeed an extremely toxic lesion. In addition to the AP endonuclease interactions, deletion of NTG1 and NTG2 enhances the mag1 mutant sensitivity to MMS, whereas overexpression of MAG1 in either the ntg1 or ntg2 mutant severely affects cell growth. These results help to delineate alkylation base lesion flow within the BER pathway.

  8. Use of in vivo and in vitro assays for the characterization of mammalian excision repair and isolation of repair proteins.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan); A.P.M. Eker (André); R.D. Wood (Richard); P. Robins

    1990-01-01

    textabstractElucidation of the molecular mechanism of mammalian nucleotide excision repair requires the availability of purified proteins, DNA substrates with defined lesions and suitable repair assays. Repair assays introduced in recent years vary from testing individual steps and successions of

  9. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Directory of Open Access Journals (Sweden)

    Ana Osorio

    2014-04-01

    Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  10. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    Science.gov (United States)

    Osorio, Ana; Milne, Roger L.; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; SWE-BRCA; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I.; Beattie, Mary S.; Domchek, Susan M.; Nathanson, Katherine; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; John, Esther M.; Whittemore, Alice S.; Daly, Mary B.; Southey, Melissa; Hopper, John; Terry, Mary B.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Steele, Linda; Neuhausen, Susan L.; Ding, Yuan Chun; Hansen, Thomas v. O.; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N.; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K.; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A.; van Os, Theo A. M.; van der Kolk, Lizet; de Lange, J. L.; Meijers-Heijboer, Hanne E. J.; van der Hout, A. H.; van Asperen, Christi J.; Gómez Garcia, Encarna B.; Hoogerbrugge, Nicoline; Collée, J. Margriet; van Deurzen, Carolien H. M.; van der Luijt, Rob B.; Devilee, Peter; HEBON; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th.; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R.; Healey, Sue; Investigators, kConFab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I.; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A.; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F.; Offit, Kenneth; Couch, Fergus J.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Benitez, Javier

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at pgenes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03–1.16), p = 2.7×10−3) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03–1.21, p = 4.8×10−3). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied. PMID:24698998

  11. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Science.gov (United States)

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón Y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Swe-Brca; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I; Beattie, Mary S; Domchek, Susan M; Nathanson, Katherine; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Walsh, Christine; Lester, Jenny; John, Esther M; Whittemore, Alice S; Daly, Mary B; Southey, Melissa; Hopper, John; Terry, Mary B; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Steele, Linda; Neuhausen, Susan L; Ding, Yuan Chun; Hansen, Thomas V O; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A; van Os, Theo A M; van der Kolk, Lizet; de Lange, J L; Meijers-Heijboer, Hanne E J; van der Hout, A H; van Asperen, Christi J; Gómez Garcia, Encarna B; Hoogerbrugge, Nicoline; Collée, J Margriet; van Deurzen, Carolien H M; van der Luijt, Rob B; Devilee, Peter; Hebon; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R; Healey, Sue; Investigators, Kconfab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F; Offit, Kenneth; Couch, Fergus J; Chenevix-Trench, Georgia; Antoniou, Antonis C; Benitez, Javier

    2014-04-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03-1.16), p = 2.7 × 10(-3)) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3)). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  12. DNA excision repair and double-strand break repair gene polymorphisms and the level of chromosome aberration in children with long-term exposure to radon.

    Science.gov (United States)

    Larionov, Aleksey V; Sinitsky, Maxim Y; Druzhinin, Vladimir G; Volobaev, Valentin P; Minina, Varvara I; Asanov, Maxim A; Meyer, Alina V; Tolochko, Tatiana A; Kalyuzhnaya, Ekaterina E

    2016-08-01

    To study polymorphic variants of repair genes in people affected by long-term exposure to radon. The chromosome aberration frequency in peripheral blood lymphocytes was used as the biological marker of genotoxicity. Genotyping of 12 single nucleotide polymorphisms in DNA repair genes (APE, XRCC1, OGG1, ADPRT, XpC, XpD, XpG, Lig4 and NBS1) was performed in children with long-term resident exposure to radon. Quantification of the aberrations was performed using light microscopy. The total frequency of aberrations was increased in carriers of the G/G genotype for the XpD gene (rs13181) polymorphism in recessive model confirmed by the results of ROC-analysis ('satisfactory predictor', AUC = 0.609). Single chromosome fragments frequency was increased in carriers of the G/G genotype in comparison with the T/T genotype. In respect to the total frequency of aberrations, the G/G genotype for the XpG gene (rs17655) polymorphism was also identified as a 'satisfactory predictor' (AUC = 0.605). Carriers of the T/C genotype for the ADPRT gene (rs1136410) polymorphism were characterized by an increased level of single fragments relative to the T/T genotype. The relationships with several types of cytogenetic damage suggest these three SNP (rs13181, rs17655 and rs1136410) may be considered radiosensitivity markers.

  13. Nucleotide excision repair of oxidised genomic DNA is not a source of urinary 8-oxo-7,8-dihydro-2'-deoxyguanosine.

    Science.gov (United States)

    Evans, Mark D; Mistry, Vilas; Singh, Rajinder; Gackowski, Daniel; Różalski, Rafał; Siomek-Gorecka, Agnieszka; Phillips, David H; Zuo, Jie; Mullenders, Leon; Pines, Alex; Nakabeppu, Yusaku; Sakumi, Kunihiko; Sekiguchi, Mutsuo; Tsuzuki, Teruhisa; Bignami, Margherita; Oliński, Ryszard; Cooke, Marcus S

    2016-10-01

    Urinary 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) is a widely measured biomarker of oxidative stress. It has been commonly assumed to be a product of DNA repair, and therefore reflective of DNA oxidation. However, the source of urinary 8-oxodGuo is not understood, although potential confounding contributions from cell turnover and diet have been ruled out. Clearly it is critical to understand the precise biological origins of this important biomarker, so that the target molecule that is oxidised can be identified, and the significance of its excretion can be interpreted fully. In the present study we aimed to assess the contributions of nucleotide excision repair (NER), by both the global genome NER (GG-NER) and transcription-coupled NER (TC-NER) pathways, and sanitisation of the dGTP pool (e.g. via the activity of the MTH1 protein), on the production of 8-oxodGuo, using selected genetically-modified mice. In xeroderma pigmentosum A (XPA) mice, in which GG-NER and TC-NER are both defective, the urinary 8-oxodGuo data were unequivocal in ruling out a contribution from NER. In line with the XPA data, the production of urinary 8-oxodGuo was not affected in the xeroderma pigmentosum C mice, specifically excluding a role of the GG-NER pathway. The bulk of the literature supports the mechanism that the NER proteins are responsible for removing damage to the transcribed strand of DNA via TC-NER, and on this basis we also examined Cockayne Syndrome mice, which have a functional loss of TC-NER. These mice showed no difference in urinary 8-oxodGuo excretion, compared to wild type, demonstrating that TC-NER does not contribute to urinary 8-oxodGuo levels. These findings call into question whether genomic DNA is the primary source of urinary 8-oxodGuo, which would largely exclude it as a biomarker of DNA oxidation. The urinary 8-oxodGuo levels from the MTH1 mice (both knock-out and hMTH1-Tg) were not significantly different to the wild-type mice. We suggest that these

  14. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  15. DNA Repair Deficiency in Neurodegeneration

    Science.gov (United States)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A.; Stevnsner, Tinna

    2011-01-01

    Deficiency in repair of nuclear and mitochondrial DNA damage has been linked to several neurodegenerative disorders. Many recent experimental results indicate that the post-mitotic neurons are particularly prone to accumulation of unrepaired DNA lesions potentially leading to progressive neurodegeneration. Nucleotide excision repair is the cellular pathway responsible for removing helix-distorting DNA damage and deficiency in such repair is found in a number of diseases with neurodegenerative phenotypes, including Xeroderma Pigmentosum and Cockayne syndrome. The main pathway for repairing oxidative base lesions is base excision repair, and such repair is crucial for neurons given their high rates of oxygen metabolism. Mismatch repair corrects base mispairs generated during replication and evidence indicates that oxidative DNA damage can cause this pathway to expand trinucleotide repeats, thereby causing Huntington’s disease. Single-strand breaks are common DNA lesions and are associated with the neurodegenerative diseases, ataxia-oculomotor apraxia-1 and spinocerebellar ataxia with axonal neuropathy-1. DNA double-strand breaks are toxic lesions and two main pathways exist for their repair: homologous recombination and non-homologous end-joining. Ataxia telangiectasia and related disorders with defects in these pathways illustrate that such defects can lead to early childhood neurodegeneration. Aging is a risk factor for neurodegeneration and accumulation of oxidative mitochondrial DNA damage may be linked with the age-associated neurodegenerative disorders Alzheimer’s disease, Parkinson’s disease and amyotrophic lateral sclerosis. Mutation in the WRN protein leads to the premature aging disease Werner syndrome, a disorder that features neurodegeneration. In this article we review the evidence linking deficiencies in the DNA repair pathways with neurodegeneration. PMID:21550379

  16. Radiation induced base excision repair (BER): a mechanistic mathematical approach.

    Science.gov (United States)

    Rahmanian, Shirin; Taleei, Reza; Nikjoo, Hooshang

    2014-10-01

    This paper presents a mechanistic model of base excision repair (BER) pathway for the repair of single-stand breaks (SSBs) and oxidized base lesions produced by ionizing radiation (IR). The model is based on law of mass action kinetics to translate the biochemical processes involved, step-by-step, in the BER pathway to translate into mathematical equations. The BER is divided into two subpathways, short-patch repair (SPR) and long-patch repair (LPR). SPR involves in replacement of single nucleotide via Pol β and ligation of the ends via XRCC1 and Ligase III, while LPR involves in replacement of multiple nucleotides via PCNA, Pol δ/ɛ and FEN 1, and ligation via Ligase I. A hallmark of IR is the production of closely spaced lesions within a turn of DNA helix (named complex lesions), which have been attributed to a slower repair process. The model presented considers fast and slow component of BER kinetics by assigning SPR for simple lesions and LPR for complex lesions. In the absence of in vivo reaction rate constants for the BER proteins, we have deduced a set of rate constants based on different published experimental measurements including accumulation kinetics obtained from UVA irradiation, overall SSB repair kinetic experiments, and overall BER kinetics from live-cell imaging experiments. The model was further used to calculate the repair kinetics of complex base lesions via the LPR subpathway and compared to foci kinetic experiments for cells irradiated with γ rays, Si, and Fe ions. The model calculation show good agreement with experimental measurements for both overall repair and repair of complex lesions. Furthermore, using the model we explored different mechanisms responsible for inhibition of repair when higher LET and HZE particles are used and concluded that increasing the damage complexity can inhibit initiation of LPR after the AP site removal step in BER. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    chromatin. The condensed nature of chromatin inhibits many DNA metabolizing activities, including NER. In order to promote efficient repair, detection of a lesion not only has to activate the NER pathway but also chromatin remodeling. In general, such remodeling is thought on the one hand to precede NER...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  18. Single-molecule fluorescence microscopy on nucleotide excision repair complexes using GFP fusion proteins

    NARCIS (Netherlands)

    Segers-Nolten, Gezina M.J.; Rademakers, Suzanne; Vermeulen, Wim; Lenferink, Aufrid T.M.; Otto, Cornelis; Hoeijmakers, Jan; Greve, Jan; Koenig, Karsten; Tanke, Hans J.; Schneckenburger, Herbert

    2000-01-01

    Scanning Confocal Fluorescence Microscopy is used for single molecule studies on DNA-protein complexes that occur in Nucleotide Excision Repair (NER). During DNA-damage elimination by the NER-pathway, complex protein structures assemble over DNA. It is our aim to resolve the architecture of these

  19. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  20. Mutational analysis of the human nucleotide excision repair gene ERCC1.

    NARCIS (Netherlands)

    A.M. Sijbers (Anneke); P.J. van der Spek (Peter); H. Odijk (Hanny); J.H. van den Berg (Jan); M. van Duin (Mark); A. Westerveld (Andries); N.G.J. Jaspers (Nicolaas); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1996-01-01

    textabstractThe human DNA repair protein ERCC1 resides in a complex together with the ERCC4, ERCC11 and XP-F correcting activities, thought to perform the 5' strand incision during nucleotide excision repair (NER). Its yeast counterpart, RAD1-RAD10, has an additional engagement in a mitotic

  1. Localization of the nucleotide excision repair gene ERCC-6 to human chromosome 10q11-q21.

    NARCIS (Netherlands)

    C. Troelstra (Christine); R.M. Landsvater; J. Wiegant; M. van der Ploeg; G. Viel; C.H.C.M. Buys; J.H.J. Hoeijmakers (Jan)

    1992-01-01

    textabstractWe have cloned the human DNA excision repair gene ERCC6 by virtue of its ability to correct the uv sensitivity of Chinese hamster overy cell mutant UV61. This mutant is a member of complementation group 6 of the nucleotide excision repair-deficient rodent mutants. By means of in situ

  2. Base excision repair: a critical player in many games.

    Science.gov (United States)

    Wallace, Susan S

    2014-07-01

    This perspective reviews the many dimensions of base excision repair from a 10,000 foot vantage point and provides one person's view on where the field is headed. Enzyme function is considered under the lens of X-ray diffraction and single molecule studies. Base excision repair in chromatin and telomeres, regulation of expression and the role of posttranslational modifications are also discussed in the context of enzyme activities, cellular localization and interacting partners. The specialized roles that base excision repair play in transcriptional activation by active demethylation and targeted oxidation as well as how base excision repair functions in the immune processes of somatic hypermutation and class switch recombination and its possible involvement in retroviral infection are also discussed. Finally the complexities of oxidative damage and its repair and its link to neurodegenerative disorders, as well as the role of base excision repair as a tumor suppressor are examined in the context of damage, repair and aging. By outlining the many base excision repair-related mysteries that have yet to be unraveled, hopefully this perspective will stimulate further interest in the field. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Ku80-deleted cells are defective at base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Li, Han [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain); Marple, Teresa [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Hasty, Paul, E-mail: hastye@uthscsa.edu [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain)

    2013-05-15

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H{sub 2}O{sub 2} and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs.

  4. Regulation of nucleotide excision repair by nuclear lamin b1.

    Directory of Open Access Journals (Sweden)

    Veronika Butin-Israeli

    Full Text Available The nuclear lamins play important roles in the structural organization and function of the metazoan cell nucleus. Recent studies on B-type lamins identified a requirement for lamin B1 (LB1 in the regulation of cell proliferation in normal diploid cells. In order to further investigate the function of LB1 in proliferation, we disrupted its normal expression in U-2 OS human osteosarcoma and other tumor cell lines. Silencing LB1 expression induced G1 cell cycle arrest without significant apoptosis. The arrested cells are unable to mount a timely and effective response to DNA damage induced by UV irradiation. Several proteins involved in the detection and repair of UV damage by the nucleotide excision repair (NER pathway are down-regulated in LB1 silenced cells including DDB1, CSB and PCNA. We propose that LB1 regulates the DNA damage response to UV irradiation by modulating the expression of specific genes and activating persistent DNA damage signaling. Our findings are relevant to understanding the relationship between the loss of LB1 expression, DNA damage signaling, and replicative senescence.

  5. Genetic polymorphisms in DNA base excision repair gene XRCC1 and the risk of squamous cell carcinoma of the head and neck

    Directory of Open Access Journals (Sweden)

    Pietruszewska Wioletta

    2009-03-01

    Full Text Available Abstract Background The genes of base excision repair (BER pathway have been extensively studied in the association with various human cancers. We performed a case-control study to test the association between two common single nucleotide polymorphisms (SNPs of XRCC1 gene with human head and neck squamous cell carcinoma (HNSCC. Methods The genotype analysis of Arg194Trp and Arg399Gln gene polymorphisms for 92 HNSCC patients and 124 controls of cancer free subjects, in Polish population were performed using the PCR-based restriction fragment length polymorphism (PCR-RFLP with endonuclease MspI. Results No altered risk has been found individually for these SNPs, however haplotypes analysis showed high association with head and neck cancer. The highest frequency, according to wild-type of Arg194Arg and Arg399Arg genotypes, was identified for Arg194Trp-Arg399Arg haplotype (OR, 2.96; 95% CI, 1.01–8.80. Conclusion Finally, we identified the combined Arg194Trp-Arg399Arg genotype of base excision repair gene XRCC1 that was associated with HNSCC and may have an impact on identification of a high-risk cancer population.

  6. Base Sequence Context Effects on Nucleotide Excision Repair

    Science.gov (United States)

    Cai, Yuqin; Patel, Dinshaw J.; Broyde, Suse; Geacintov, Nicholas E.

    2010-01-01

    Nucleotide excision repair (NER) plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P), 10S (+)-trans-anti-B[a]P-N2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair. PMID:20871811

  7. A general role of the DNA glycosylase Nth1 in the abasic sites cleavage step of base excision repair in Schizosaccharomyces pombe

    OpenAIRE

    Alseth, Ingrun; Korvald, Hanne; Osman, Fekret; Seeberg, Erling; Bjørås, Magnar

    2004-01-01

    One of the most frequent lesions formed in cellular DNA are abasic (apurinic/apyrimidinic, AP) sites that are both cytotoxic and mutagenic, and must be removed efficiently to maintain genetic stability. It is generally believed that the repair of AP sites is initiated by the AP endonucleases; however, an alternative pathway seems to prevail in Schizosaccharomyces pombe. A mutant lacking the DNA glycosylase/AP lyase Nth1 is very sensitive to the alkylating agent methyl methanesulfonate (MMS), ...

  8. DNA repair in Cockayne syndrome.

    Science.gov (United States)

    Hoar, D I; Waghorne, C

    1978-11-01

    Cockayne syndrome (CS) is a rare recessive genetic disease characterized in part by premature ageing and photosensitive skin. Because of the latter characteristic, this syndrome was considered to be an example of a UV-sensitive DNA repair-defective human disorder. We demonstrated normal levels of UV-induced unscheduled DNA synthesis (UDS) in four unrelated CS patients that show hypersensitivity to both UV and Mitomycin C (MMC). At low UV exposure, CS DNA shows a dose-dependent decrease in size. By contrast, heterozygotes appear to have a threshold below which there is little change in size of single strand DNA. Immediately following UV or MMC treatment, CS DNA is deficient in high molecular weight species, but undergoes a normal transition to larger DNA during a chase interval in the presence or absence of caffeine. This suggests a defect in replication or excision repair and no defect in post-replication repair (PRR). Pulse studies performed in the presence of hydroxyurea (HU) also reveal a deficient production of large DNA, suggesting the defect is in repair. As these cells have normal UDS and normal PRR, the basis for their UV sensitivity must be distinct from that observed in xeroderma pigmentosum (XP).

  9. Nucleotide Excision Repair Lesion-Recognition Protein Rad4 Captures a Pre-Flipped Partner Base in a Benzo[a]pyrene-Derived DNA Lesion: How Structure Impacts the Binding Pathway.

    Science.gov (United States)

    Mu, Hong; Geacintov, Nicholas E; Min, Jung-Hyun; Zhang, Yingkai; Broyde, Suse

    2017-06-19

    The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N 2 -dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the "pre-flipped" base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [ Mu , H. , ( 2015 ) Biochemistry , 54 ( 34 ), 5263 - 7 ]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER.

  10. Dynamics of DNA Mismatch Repair

    Science.gov (United States)

    Coats, Julie; Lin, Yuyen; Rasnik, Ivan

    2009-11-01

    DNA mismatch repair protects the genome from spontaneous mutations by recognizing errors, excising damage, and re-synthesizing DNA in a pathway that is highly conserved. Mismatch recognition is accomplished by the MutS family of proteins which are weak ATPases that bind specifically to damaged DNA, but the specific molecular mechanisms by which these proteins recognize damage and initiate excision are not known. Previous structural investigations have implied that protein-induced conformational changes are central to mismatch recognition. Because damage detection is a highly dynamic process in which conformational changes of the protein-DNA complexes occur on a time scale of a few seconds, it is difficult to obtain meaningful kinetic information with traditional ensemble techniques. In this work, we use single molecule fluorescence resonance energy transfer (smFRET) to study the conformational dynamics of fluorescently labeled DNA substrates in the presence of the mismatch repair protein MutS from E. coli and its human homolog MSH2/MSH6. Our studies allow us to obtain quantitative kinetic information about the rates of binding and dissociation and to determine the conformational states for each protein-DNA complex.

  11. Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress

    DEFF Research Database (Denmark)

    Akbari, M; Otterlei, M; Pena Diaz, Javier

    2007-01-01

    , indicating regulatory effects of oxidative stress on mitochondrial BER. To examine the overall organization of uracil-BER in nuclei and mitochondria, we constructed cell lines expressing EYFP (enhanced yellow fluorescent protein) fused to UNG1 or UNG2. These were used to investigate the possible presence...... BER processes are differently organized. Furthermore, the upregulation of mRNA for mitochondrial UNG1 after oxidative stress indicates that it may have an important role in repair of oxidized pyrimidines....

  12. Structure and expression of the excision repair gene ERCC6, involved in the human disorder Cockayne's syndrome group B.

    NARCIS (Netherlands)

    C. Troelstra (Christine); W. Hesen; D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractThe human repair gene ERCC6--a presumed DNA (or RNA) helicase--has recently been found to function specifically in preferential nucleotide excision repair (NER). This NER subpathway is primarily directed towards repair of (the transcribed strand of) active genes. Mutations in the ERCC6

  13. Molecular Mechanisms of the Whole DNA Repair System: A Comparison of Bacterial and Eukaryotic Systems

    Directory of Open Access Journals (Sweden)

    Rihito Morita

    2010-01-01

    Full Text Available DNA is subjected to many endogenous and exogenous damages. All organisms have developed a complex network of DNA repair mechanisms. A variety of different DNA repair pathways have been reported: direct reversal, base excision repair, nucleotide excision repair, mismatch repair, and recombination repair pathways. Recent studies of the fundamental mechanisms for DNA repair processes have revealed a complexity beyond that initially expected, with inter- and intrapathway complementation as well as functional interactions between proteins involved in repair pathways. In this paper we give a broad overview of the whole DNA repair system and focus on the molecular basis of the repair machineries, particularly in Thermus thermophilus HB8.

  14. Loss of Nucleotide Excision Repair as a Source of Genomic Instability in Breast Cancer

    Science.gov (United States)

    2005-06-01

    sequence-specific mechanism of nucleotide excision repair. Genes Dev., 13, 768-785. DNA binding by short single strands of DNA requires the p53 C... Arabidopsis thaliana . The advantage signal (27). CPD-3 cells were further subcloned by single cell dilution, of using XP-A cells completely deficient...developed and optimized a novel technique for the detection of localized DNA damage and damage binding proteins in individual cells, using targeted

  15. Structure and Stability of ERCC1-XPF DNA Repair Complexes

    NARCIS (Netherlands)

    Faridounnia, M.

    2015-01-01

    Understanding DNA repair pathways such as Nucleotide Excision Repair, Double Strand Break repair and Interstrand Cross-Link repair is of basic interest for understanding fundamental cellular processes. It also forms the basis for understanding molecular details of diseases when defects occur in

  16. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...

  17. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  18. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including......In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  19. A polymorphism in the base excision repair gene PARP2 is associated with differential prognosis by chemotherapy among postmenopausal breast cancer patients

    NARCIS (Netherlands)

    P. Seibold (Petra); P. Schmezer (Peter); T.W. Behrens (Timothy); K. Michailidou (Kyriaki); M.K. Bolla (Manjeet); Q. Wang (Qing); D. Flesch-Janys (Dieter); H. Nevanlinna (Heli); R. Fagerholm (Rainer); K. Aittomäki (Kristiina); C. Blomqvist (Carl); S. Margolin (Sara); A. Mannermaa (Arto); V. Kataja (Vesa); V-M. Kosma (Veli-Matti); J.M. Hartikainen (J.); D. Lambrechts (Diether); H. Wildiers (Hans); V. Kristensen (Vessela); G.G. Alnæs (Grethe Grenaker); S. Nord (Silje); A.-L. Borresen-Dale (Anne-Lise); M.J. Hooning (Maartje); A. Hollestelle (Antoinette); A. Jager (Agnes); C.M. Seynaeve (Caroline); J. Li (Jingmei); J. Liu (Jianjun); M.K. Humphreys (Manjeet); A.M. Dunning (Alison); V. Rhenius (Valerie); M. Shah (Mitul); M. Kabisch (Maria); D. Torres (Diana); H.U. Ulmer (Hans); U. Hamann (Ute); J.M. Schildkraut (Joellen M.); K.S. Purrington (Kristen S.); F.J. Couch (Fergus); P. Hall (Per); P.D.P. Pharoah (Paul); D.F. Easton (Douglas); M.K. Schmidt (Marjanka); J. Chang-Claude (Jenny); O. Popanda (Odilia)

    2015-01-01

    textabstractBackground: Personalized therapy considering clinical and genetic patient characteristics will further improve breast cancer survival. Two widely used treatments, chemotherapy and radiotherapy, can induce oxidative DNA damage and, if not repaired, cell death. Since base excision repair

  20. Polynucleotide kinase/phosphatase, Pnk1, is involved in base excision repair in Schizosaccharomyces pombe.

    Science.gov (United States)

    Kashkina, Ekaterina; Qi, Tao; Weinfeld, Michael; Young, Dallan

    2012-08-01

    We previously reported that Schizosaccharomyces pombe pnk1 cells are more sensitive than wild-type cells to γ-radiation and camptothecin, indicating that Pnk1 is required for DNA repair. Here, we report that pnk1pku70 and pnk1rhp51 double mutants are more sensitive to γ-radiation than single mutants, from which we infer that Pnk1's primary role is independent of either homologous recombination or non-homologous end joining mechanisms. We also report that pnk1 cells are more sensitive than wild-type cells to oxidizing and alkylating agents, suggesting that Pnk1 is involved in base excision repair. Mutational analysis of Pnk1 revealed that the DNA 3'-phosphatase activity is necessary for repair of DNA damage, whereas the 5'-kinase activity is dispensable. A role for Pnk1 in base excision repair is supported by genetic analyses which revealed that pnk1apn2 is synthetically lethal, suggesting that Pnk1 and Apn2 may function in parallel pathways essential for the repair of endogenous DNA damage. Furthermore, the nth1pnk1apn2 and tdp1pnk1apn2 triple mutants are viable, implying that single-strand breaks with 3'-blocked termini produced by Nth1 and Tdp1 contribute to synthetic lethality. We also examined the sensitivity to methyl methanesulfonate of all single and double mutant combinations of nth1, apn2, tdp1 and pnk1. Together, our results support a model where Tdp1 and Pnk1 act in concert in an Apn2-independent base excision repair pathway to repair 3'-blocked termini produced by Nth1; and they also provide evidence that Pnk1 has additional roles in base excision repair. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Excision repair in mammalian cells. [uv radiation, N-acetoxy-2-acetylaminofluorene

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, F.E.; Setlow, R.B.

    1978-01-01

    Excision repair after combined treatments of uv and N-acetoxy-2-acetylaminofluorene (AAAF) was studied by three different techniques in cells proficient in uv excision repair and in cells deficient in uv repair. Two patterns of repair were observed: in repair proficient cells total repair was additive, and in repair deficient cells total repair was much less than additive--usually less than observed for separate treatments--and AAAF inhibited dimer excision. We conclude that in the 1st class of cells pathways for repair of uv and AAAF lesions are not identical, and in the 2nd class the residual excision enzymes are different from those in repair proficient cells.

  2. Roles of base excision repair enzymes Nth1p and Apn2p from Schizosaccharomyces pombe in processing alkylation and oxidative DNA damage.

    Science.gov (United States)

    Sugimoto, Takanori; Igawa, Emi; Tanihigashi, Haruna; Matsubara, Mayumi; Ide, Hiroshi; Ikeda, Shogo

    2005-11-21

    Schizosaccharomyces pombe Nthpl, an ortholog of the endonuclease III family, is the sole bifunctional DNA glycosylase encoded in its genome. The enzyme removes oxidative pyrimidine and incises 3' to the apurinic/apyrimidinic (AP) site, leaving 3'-alpha,beta-unsaturated aldehyde. Analysis of nth1 cDNA revealed an intronless structure including 5'- and 3'-untranslated regions. An Nth1p-green fluorescent fusion protein was predominantly localized in the nuclei of yeast cells, indicating a nuclear function. Deletion of nth1 confirmed that Nth1p is responsible for the majority of activity for thymine glycol and AP site incision in the absence of metal ions, while nth1 mutants exhibit hypersensitivity to methylmethanesulfonate (MMS). Complementation of sensitivity by heterologous expression of various DNA glycosylases showed that the methyl-formamidopyrimidine (me-fapy) and/or AP sites are plausible substrates for Nth1p in repairing MMS damage. Apn2p, the major AP endonuclease in S. pombe, also greatly contributes to the repair of MMS damage. Deletion of nth1 from an apn2 mutant resulted in tolerance to MMS damage, indicating that Nth1p-induced 3'-blocks are responsible for MMS sensitivity in apn2 mutants. Overexpression of Apn2p in nth1 mutants failed to suppress MMS sensitivity. These results indicate that Nth1p, not Apn2p, primarily incises AP sites and that the resultant 3'-blocks are removed by the 3'-phosphodiesterase activity of Apn2p. Nth1p is dispensable for cell survival against low levels of oxidative stress, but wild-type yeast became more sensitive than the nth1 mutant at high levels. Overexpression of Nth1p in heavily damaged cells probably induced cell death via the formation of 3'-blocked single-strand breaks.

  3. Molecular cloning of the human excision repair gene ERCC-6.

    NARCIS (Netherlands)

    C. Troelstra (Christine); H. Odijk (Hanny); J. de Wit (Jan); A. Westerveld (Andries); L.H. Thompson; D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1990-01-01

    textabstractThe UV-sensitive, nucleotide excision repair-deficient Chinese hamster mutant cell line UV61 was used to identify and clone a correcting human gene, ERCC-6. UV61, belonging to rodent complementation group 6, is only moderately UV sensitive in comparison with mutant lines in groups 1 to

  4. Cloning and characterization of excision repair genes

    NARCIS (Netherlands)

    P.J. van der Spek (Peter)

    1996-01-01

    textabstractFor all living organisms, it is of vital importance to maintain intact the genetic information stored in the nucleotide sequence of DNA. Numerous environmental and genotoxic agents can affect the DNA and lead to, for example, mutagenesis or carcinogenesis. Study of the mechanism of

  5. Celebrating DNA's Repair Crew.

    Science.gov (United States)

    Kunkel, Thomas A

    2015-12-03

    This year, the Nobel Prize in Chemistry has been awarded to Tomas Lindahl, Aziz Sancar, and Paul Modrich for their seminal studies of the mechanisms by which cells from bacteria to man repair DNA damage that is generated by normal cellular metabolism and stress from the environment. These studies beautifully illustrate the remarkable power of DNA repair to influence life from evolution through disease susceptibility. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Energy and Technology Review: Unlocking the mysteries of DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Quirk, W.A.

    1993-04-01

    DNA, the genetic blueprint, has the remarkable property of encoding its own repair following diverse types of structural damage induced by external agents or normal metabolism. We are studying the interplay of DNA damaging agents, repair genes, and their protein products to decipher the complex biochemical pathways that mediate such repair. Our research focuses on repair processes that correct DNA damage produced by chemical mutagens and radiation, both ionizing and ultraviolet. The most important type of DNA repair in human cells is called excision repair. This multistep process removes damaged or inappropriate pieces of DNA -- often as a string of 29 nucleotides containing the damage -- and replaces them with intact ones. We have isolated, cloned, and mapped several human repair genes associated with the nucleotide excision repair pathway and involved in the repair of DNA damage after exposure to ultraviolet light or mutagens in cooked food. We have shown that a defect in one of these repair genes, ERCC2, is responsible for the repair deficiency in one of the groups of patients with the recessive genetic disorder xeroderma pigmentosum (XP group D). We are exploring ways to purify sufficient quantities (milligrams) of the protein products of these and other repair genes so that we can understand their functions. Our long-term goals are to link defective repair proteins to human DNA repair disorders that predispose to cancer, and to produce DNA-repair-deficient mice that can serve as models for the human disorders.

  7. Extracts of proliferating and non-proliferating human cells display different base excision pathways and repair fidelity

    DEFF Research Database (Denmark)

    Akbari, Mansour; Pena Diaz, Javier; Andersen, Sonja

    2009-01-01

    Base excision repair (BER) of damaged or inappropriate bases in DNA has been reported to take place by single nucleotide insertion or through incorporation of several nucleotides, termed short-patch and long-patch repair, respectively. We found that extracts from proliferating and non-proliferati...

  8. Mammalian transcription-coupled excision repair

    NARCIS (Netherlands)

    W. Vermeulen (Wim); M.I. Fousteri (Maria)

    2013-01-01

    textabstractTranscriptional arrest caused by DNA damage is detrimental for cells and organisms as it impinges on gene expression and thereby on cell growth and survival. To alleviate transcrip-tional arrest, cells trigger a transcription-dependent genome surveillance pathway, termed

  9. U. V. induces long-lived DNA breaks in Cockayne's syndrome and cells from an immunodeficient individual (46BR): defects and disturbance in post incision steps of excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Squires, S.; Johnson, R.T.

    1983-01-01

    In normal cells exposed to low U.V. doses the several enzymic steps of the excision repair process are closely coupled with the result that DNA gaps are transient and present at such low frequency that it is very difficult to detect them. Cells from a U.V.-sensitive human genetic disorder, Cockayne's Syndrome (CS) and from an immunodeficient individual 46BR, have been examined with respect to their incision capacity after U.V. in the presence and absence of inhibitors of DNA synthesis. We have measured the initial rates of DNA break accumulation in the presence of hydroxyurea and 1-beta-D arabinofuranosylcytosine and find that in both these groups the rate is only slightly lower than in normal cells. However, there is a marked difference between U.V. sensitive cells and normal in the accumulation of long-lived DNA breaks in the absence of inhibitors. While in normal cells practically no breaks could be detected, the U.V. sensitive cells accumulated significant numbers of DNA breaks within 15 min of incubation; 46BR cells showed almost the same level of DNA breaks without the inhibitors as with them. In CS break accumulation can be detected in the absence of inhibitors for only a short time after irradiation (approximately 30 min), but less so when deoxyribonucleosides are provided. The spontaneous break accumulation is related to the time elapsed since proteolytic detachment of the cells from monolayer; 24 h after replating CS breaks no longer accumulate in response to U.V. 46BR cells, on the other hand, accumulate breaks even 1 day after replating and express unligated gaps 2 h after irradiation with a relatively low U.V. dose such as 4 Jm-2. Provision of DNA precursors does not greatly reduce break accumulation. The extremely slow rate of gap sealing in 46BR cells is consistent with the hypothesis that a ligase defect is expressed in these cells.

  10. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A., E-mail: sarah.martin@qmul.ac.uk [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ (United Kingdom)

    2014-08-05

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting.

  11. Defects in Base Excision Repair Sensitize Cells to Manganese in S. cerevisiae

    Directory of Open Access Journals (Sweden)

    Adrienne P. Stephenson

    2013-01-01

    Full Text Available Manganese (Mn is essential for normal physiologic functioning; therefore, deficiencies and excess intake of manganese can result in disease. In humans, prolonged exposure to manganese causes neurotoxicity characterized by Parkinson-like symptoms. Mn2+ has been shown to mediate DNA damage possibly through the generation of reactive oxygen species. In a recent publication, we showed that Mn induced oxidative DNA damage and caused lesions in thymines. This study further investigates the mechanisms by which cells process Mn2+-mediated DNA damage using the yeast S. cerevisiae. The strains most sensitive to Mn2+ were those defective in base excision repair, glutathione synthesis, and superoxide dismutase mutants. Mn2+ caused a dose-dependent increase in the accumulation of mutations using the CAN1 and lys2-10A mutator assays. The spectrum of CAN1 mutants indicates that exposure to Mn results in accumulation of base substitutions and frameshift mutations. The sensitivity of cells to Mn2+ as well as its mutagenic effect was reduced by N-acetylcysteine, glutathione, and Mg2+. These data suggest that Mn2+ causes oxidative DNA damage that requires base excision repair for processing and that Mn interferes with polymerase fidelity. The status of base excision repair may provide a biomarker for the sensitivity of individuals to manganese.

  12. Removal of misincorporated ribonucleotides from prokaryotic genomes: an unexpected role for nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Alexandra Vaisman

    2013-11-01

    Full Text Available Stringent steric exclusion mechanisms limit the misincorporation of ribonucleotides by high-fidelity DNA polymerases into genomic DNA. In contrast, low-fidelity Escherichia coli DNA polymerase V (pol V has relatively poor sugar discrimination and frequently misincorporates ribonucleotides. Substitution of a steric gate tyrosine residue with alanine (umuC_Y11A reduces sugar selectivity further and allows pol V to readily misincorporate ribonucleotides as easily as deoxynucleotides, whilst leaving its poor base-substitution fidelity essentially unchanged. However, the mutability of cells expressing the steric gate pol V mutant is very low due to efficient repair mechanisms that are triggered by the misincorporated rNMPs. Comparison of the mutation frequency between strains expressing wild-type and mutant pol V therefore allows us to identify pathways specifically directed at ribonucleotide excision repair (RER. We previously demonstrated that rNMPs incorporated by umuC_Y11A are efficiently removed from DNA in a repair pathway initiated by RNase HII. Using the same approach, we show here that mismatch repair and base excision repair play minimal back-up roles in RER in vivo. In contrast, in the absence of functional RNase HII, umuC_Y11A-dependent mutagenesis increases significantly in ΔuvrA, uvrB5 and ΔuvrC strains, suggesting that rNMPs misincorporated into DNA are actively repaired by nucleotide excision repair (NER in vivo. Participation of NER in RER was confirmed by reconstituting ribonucleotide-dependent NER in vitro. We show that UvrABC nuclease-catalyzed incisions are readily made on DNA templates containing one, two, or five rNMPs and that the reactions are stimulated by the presence of mispaired bases. Similar to NER of DNA lesions, excision of rNMPs proceeds through dual incisions made at the 8(th phosphodiester bond 5' and 4(th-5(th phosphodiester bonds 3' of the ribonucleotide. Ribonucleotides misinserted into DNA can therefore be

  13. Nucleotide excision repair at the single-molecule level : analysis of the E. coli UvrA protein

    NARCIS (Netherlands)

    Wagner, Koen

    2011-01-01

    In this thesis, the characteristics of the Escherichia coli UvrA protein were analyzed with microscopy techniques that allow detection of protein complexes at the single-molecule level. Together with UvrB and UvrC, UvrA catalyzes the excision of damaged DNA from the bacterial genome. This DNA repair

  14. E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    David G. Johnson

    2012-10-01

    Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.

  15. Molecular regulation of UV-induced DNA repair.

    Science.gov (United States)

    Shah, Palak; He, Yu-Ying

    2015-01-01

    Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the United States, as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors. © 2014 The American Society of Photobiology.

  16. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  17. Faulty DNA-polymerase {delta}/{epsilon}-mediated excision-repair in response to gamma-radiation or ultraviolet-light in P53-deficient fibroblast strains from affected members of a cancer-prone family with Li-Fraumeni syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Mirzayans, R.; Enns, L.; Dietrich, K.; Barley, R.D.C.; Paterson, M.C. [Alberta Univ., Edmonton, AB (Canada). Cross Cancer Inst.]|[Alberta Univ., Edmonton, AB (Canada). Dept. of Oncology]|[Alberta Univ., Edmonton, AB (Canada). Dept. of Biological Science

    1996-04-01

    Dermal fibroblast strains cultured from affected members of a cancer-prone family with Li-Fraumeni syndrome (LFS) harbor a point mutation in one allele of the p53 tumor suppressor gene, resulting in loss of normal p53-deficient strains to carry out the long-patch mode of excision repair, mediated by DNA polymerases delta and epsilon, after exposure to Co-60 gamma radiation or far ultraviolet (UV) (chiefly 254 mm) light. Repair was monitored by incubation of the irradiated cultures in the presence of aphidicolin (ape) or 1-beta-D-arabinofuranosylcytosine (araC), each a specific inhibitor of long-patch repair, followed by measurement of drug-induced DNA strand breaks (reflecting non-ligated strand incision events) by alkaline surcrose velocity sedimentation. The LFS strains displayed deficient repair capacity in response to both gamma rays and UV light. The repair anomaly in UV-irradiated LFS cultures was manifested not only in the overall genome, but also in the transcriptionally active, preferentially repaired c-myc gene. Using autoradiography we also assessed unscheduled DNA synthesis (UDS) after UV irradiation and found this conventional measure of repair replication to be deficient in LFS strains. Moreover, both ape and araC decreased the level of UV-induced UDS by similar to 75% in normal cells, but each had only a marginal effect on LFS cells. We further demonstrated that the LFS strains are impaired in the recovery of both RNA and replicative DNA syntheses after UV treatment, two molecular anomalies of the DNA repair deficiency disorders xeroderma pigmentosum and Cockayne`s syndrome. Together these results imply a critical role for wild-type p53 protein in DNA polymerase delta/epsilon-mediated excision repair, both the mechanism operating on the entire genome and that acting on expressed genes. (Author).

  18. New design of nucleotide excision repair (NER) inhibitors for combination cancer therapy.

    Science.gov (United States)

    Gentile, Francesco; Tuszynski, Jack A; Barakat, Khaled H

    2016-04-01

    Many cancer chemotherapy agents act by targeting the DNA of cancer cells, causing substantial damage within their genome and causing them to undergo apoptosis. An effective DNA repair pathway in cancer cells can act in a reverse way by removing these drug-induced DNA lesions, allowing cancer cells to survive, grow and proliferate. In this context, DNA repair inhibitors opened a new avenue in cancer treatment, by blocking the DNA repair mechanisms from removing the chemotherapy-mediated DNA damage. In particular, the nucleotide excision repair (NER) involves more than thirty protein-protein interactions and removes DNA adducts caused by platinum-based chemotherapy. The excision repair cross-complementation group 1 (ERCC1)-xeroderma pigmentosum, complementation group A (XPA) protein (XPA-ERCC1) complex seems to be one of the most promising targets in this pathway. ERCC1 is over expressed in cancer cells and the only known cellular function so far for XPA is to recruit ERCC1 to the damaged point. Here, we build upon our recent advances in identifying inhibitors for this interaction and continue our efforts to rationally design more effective and potent regulators for the NER pathway. We employed in silico drug design techniques to: (1) identify compounds similar to the recently discovered inhibitors, but more effective at inhibiting the XPA-ERCC1 interactions, and (2) identify different scaffolds to develop novel lead compounds. Two known inhibitor structures have been used as starting points for two ligand/structure-hybrid virtual screening approaches. The findings described here form a milestone in discovering novel inhibitors for the NER pathway aiming at improving the efficacy of current platinum-based therapy, by modulating the XPA-ERCC1 interaction. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. DNA repair mechanisms and gametogenesis

    NARCIS (Netherlands)

    W.M. Baarends (Willy); R. van der Laan (Roald); J.A. Grootegoed (Anton)

    2001-01-01

    textabstractIn mammals, there is a complex and intriguing relationship between DNA repair and gametogenesis. DNA repair mechanisms are involved not only in the repair of different types of DNA damage in developing germline cells, but also take part in the meiotic

  20. DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae

    Science.gov (United States)

    Boiteux, Serge; Jinks-Robertson, Sue

    2013-01-01

    DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage. PMID:23547164

  1. Differential role of base excision repair proteins in mediating cisplatin cytotoxicity.

    Science.gov (United States)

    Sawant, Akshada; Floyd, Ashley M; Dangeti, Mohan; Lei, Wen; Sobol, Robert W; Patrick, Steve M

    2017-03-01

    Interstrand crosslinks (ICLs) are covalent lesions formed by cisplatin. The mechanism for the processing and removal of ICLs by DNA repair proteins involves nucleotide excision repair (NER), homologous recombination (HR) and fanconi anemia (FA) pathways. In this report, we monitored the processing of a flanking uracil adjacent to a cisplatin ICL by the proteins involved in the base excision repair (BER) pathway. Using a combination of extracts, purified proteins, inhibitors, functional assays and cell culture studies, we determined the specific BER proteins required for processing a DNA substrate with a uracil adjacent to a cisplatin ICL. Uracil DNA glycosylase (UNG) is the primary glycosylase responsible for the removal of uracils adjacent to cisplatin ICLs, whereas other uracil glycosylases can process uracils in the context of undamaged DNA. Repair of the uracil adjacent to cisplatin ICLs proceeds through the classical BER pathway, highlighting the importance of specific proteins in this redundant pathway. Removal of uracil is followed by the generation of an abasic site and subsequent cleavage by AP endonuclease 1 (APE1). Inhibition of either the repair or redox domain of APE1 gives rise to cisplatin resistance. Inhibition of the lyase domain of Polymerase β (Polβ) does not influence cisplatin cytotoxicity. In addition, lack of XRCC1 leads to increased DNA damage and results in increased cisplatin cytotoxicity. Our results indicate that BER activation at cisplatin ICLs influences crosslink repair and modulates cisplatin cytotoxicity via specific UNG, APE1 and Polβ polymerase functions. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Evidence for the involvement of nucleotide excision repair in the removal of abasic sites in yeast.

    Science.gov (United States)

    Torres-Ramos, C A; Johnson, R E; Prakash, L; Prakash, S

    2000-05-01

    In eukaryotes, DNA damage induced by ultraviolet light and other agents which distort the helix is removed by nucleotide excision repair (NER) in a fragment approximately 25 to 30 nucleotides long. In humans, a deficiency in NER causes xeroderma pigmentosum (XP), characterized by extreme sensitivity to sunlight and a high incidence of skin cancers. Abasic (AP) sites are formed in DNA as a result of spontaneous base loss and from the action of DNA glycosylases involved in base excision repair. In Saccharomyces cerevisiae, AP sites are removed via the action of two class II AP endonucleases, Apn1 and Apn2. Here, we provide evidence for the involvement of NER in the removal of AP sites and show that NER competes with Apn1 and Apn2 in this repair process. Inactivation of NER in the apn1Delta or apn1Delta apn2Delta strain enhances sensitivity to the monofunctional alkylating agent methyl methanesulfonate and leads to further impairment in the cellular ability to remove AP sites. A deficiency in the repair of AP sites may contribute to the internal cancers and progressive neurodegeneration that occur in XP patients.

  3. Structural and Functional Studies on Nucleotide Excision Repair From Recognition to Incision.

    Energy Technology Data Exchange (ETDEWEB)

    Caroline Kisker

    2001-01-01

    Maintenance of the correct genetic information is crucial for all living organisms because mutations are the primary cause of hereditary diseases, as well as cancer and may also be involved in aging. The importance of genomic integrity is underscored by the fact that 80 to 90% of all human cancers are ultimately due to DNA damage. Among the different repair mechanisms that have evolved to protect the genome, nucleotide excision repair (NER) is a universal pathway found in all organisms. NER removes a wide variety of bulky DNA adducts including the carcinogenic cyclobutane pyrimidine dimers induced by UV radiation, benzo(a)pyrene-guanine adducts caused by smoking and the guanine-cisplatin adducts induced by chemotherapy. The importance of this repair mechanism is reflected by three severe inherited diseases in humans, which are due to defects in NER: xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy.

  4. DNA repair, damage signaling and carcinogenesis.

    Science.gov (United States)

    Lavelle, Christophe; Salles, Bernard; Wiesmüller, Lisa

    2008-04-02

    The First joint meeting of the German DGDR (German Society for Research on DNA Repair) and the French SFTG (French Society of Genotoxicology) on DNA Repair was held in Toulouse, France, from September 15 to 19, 2007. It was organized by Lisa Wiesmüller and Bernard Salles together with the scientific committee consisting of Gilbert de Murcia, Jean-Marc Egly, Frank Grosse, Karl-Peter Hopfner, Georges Iliakis, Bernd Kaina, Markus Löbrich, Bernard Lopez, Daniel Marzin and Alain Sarasin. This report summarizes information presented by the speakers (invited lectures and oral communications) during the seven plenary sessions, which include (1) excision repair, (2) DNA repair and carcinogenesis, (3) double-strand break repair, (4) replication in repair and lesion bypass, (5) cellular responses to genotoxic stress, (6) DNA repair machinery within the chromatin context and (7) genotoxicology and testing. A total of 23 plenary lectures, 32 oral communications and 66 posters were presented in this rather intense 4 days meeting, which stimulated extensive discussions and highly interdisciplinary scientific exchanges among the approximately 250 participants.

  5. Repair of damaged DNA in vivo: Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Hanawalt, P.C.

    1987-09-01

    This contract was initiated in 1962 with the US Atomic Energy Commission to carry out basic research on the effects of radiation on the process of DNA replication in bacteria. Within the first contract year we discovered repair replication at the same time that Setlow and Carrier discovered pyrimidine dimer excision. These discoveries led to the elucidation of the process of excision-repair, one of the most important mechanisms by which living systems, including humans, respond to structural damage in their genetic material. We improved methodology for distinguishing repair replication from semiconservative replication and instructed others in these techniques. Painter then was the first to demonstrate repair replication in ultraviolet irradiated human cells. He, in turn, instructed James Cleaver who discovered that skin fibroblasts from patients with xeroderma pigmentosum were defective in excision-repair. People with this genetic defect are extremely sensitive to sunlight and they develop carcinomas and melanomas of the skin with high frequency. The existence of this hereditary disease attests to the importance of DNA repair in man. We certainly could not survive in the normal ultraviolet flux from the sun if our DNA were not continuously monitored for damage and repaired. Other hereditary diseases such as ataxia telangiectasia, Cockayne's syndrome, Blooms syndrome and Fanconi's anemia also involve deficiencies in DNA damage processing. The field of DNA repair has developed rapidly as we have learned that most environmental chemical carcinogens as well as radiation produce repairable damage in DNA. 251 refs.

  6. ATP-dependent chromatin remodeling by the Cockayne syndrome B DNA repair-transcription-coupling factor

    NARCIS (Netherlands)

    E. Citterio (Elisabetta); V. van den Boom (Vincent); G. Schnitzler; R. Kanaar (Roland); E. Bonte (Edgar); R.E. Kingston; W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan)

    2000-01-01

    textabstractThe Cockayne syndrome B protein (CSB) is required for coupling DNA excision repair to transcription in a process known as transcription-coupled repair (TCR). Cockayne syndrome patients show UV sensitivity and severe neurodevelopmental abnormalities. CSB is a

  7. Laparoscopic Excision of a Scar Pregnancy and Isthmocele Repair.

    Science.gov (United States)

    Kiyak, Huseyin; Wetherilt, Lale Susan; Seckin, Kerem Doga; Polat, Ibrahim; Kadirogullari, Pınar; Karacan, Tolga

    2017-10-13

    Laparoscopic excision of a scar pregnancy and isthmocele repair with a barbed suture. A step-by-step explanation of the laparoscopic excision technique of a scar pregnancy and isthmocele repair. Cesarean scar pregnancy occurs as a result of attachment of the products of conception to the uterine scar [1-3]. In the present case, a 34-year-old, gravida 4, para 1 patient with a history of 1 miscarriage and 1 ectopic pregnancy was diagnosed with type 2 cesarean scar pregnancy at 7 weeks of gestation. Dilation and curretage was performed at the 8th week of gestation to terminate the pregnancy. On ultrasonography performed 1 month later, placental material underlying the isthmocele was observed. Her beta human chorionic gonadotropin level was 13 836 mIU/mL. She was followed up for 1.5 months until the beta human chorionic gonadotropin levels were negative. However, the mass underneath the scar had grown larger, measuring up to 5 × 6 cm. Laparoscopy was performed because the patient reported vaginal spotting and pelvic pain. The incision was sutured with a synthetic absorbable unidirectional barbed suture (Stratafix Knotless Tissue Control Device; Ethicon Inc., Somerville, NJ). No residual scar defect was visible on follow-up ultrasonography 1 week and 1 month after surgery. Barbed sutures ease the repair of uterine scar defects and can provide ideal reapproximation of thick myometrial tissue. Laparoscopic treatment of a scar pregnancy and isthmocele repair are effective and safe modes of treatment. Copyright © 2017 American Association of Gynecologic Laparoscopists. Published by Elsevier Inc. All rights reserved.

  8. Oxidative and energy metabolism as potential clues for clinical heterogeneity in nucleotide excision repair disorders.

    Science.gov (United States)

    Hosseini, Mohsen; Ezzedine, Khaled; Taieb, Alain; Rezvani, Hamid R

    2015-02-01

    Nucleotide excision repair (NER) is an important DNA repair pathway involved in the removal of a wide array of DNA lesions. The absence or dysfunction of NER results in the following distinct disorders: xeroderma pigmentosum (XP), Cockayne syndrome (CS), cerebro-oculo-facio-skeletal (COFS) syndrome, UV-sensitive syndrome (UVSS), trichothiodystrophy (TTD), or combined syndromes including XP/CS, XP/TTD, CS/TTD, and COFS/TTD. In addition to their well-characterized role in the NER signaling pathway, NER factors also seem to be important in biological processes that are not directly associated with DNA damage responses, including mitochondrial function and redox homeostasis. The potential causative role of these factors in the large clinical spectrum seen in NER diseases is discussed in this review.

  9. The journey of DNA repair.

    Science.gov (United States)

    Saini, Natalie

    2015-12-01

    21 years ago, the DNA Repair Enzyme was declared "Molecule of the Year". Today, we are celebrating another "year of repair", with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  10. Processing closely spaced lesions during Nucleotide Excision Repair triggers mutagenesis in E. coli.

    Directory of Open Access Journals (Sweden)

    Régine Janel-Bintz

    2017-07-01

    Full Text Available It is generally assumed that most point mutations are fixed when damage containing template DNA undergoes replication, either right at the fork or behind the fork during gap filling. Here we provide genetic evidence for a pathway, dependent on Nucleotide Excision Repair, that induces mutations when processing closely spaced lesions. This pathway, referred to as Nucleotide Excision Repair-induced Mutagenesis (NERiM, exhibits several characteristics distinct from mutations that occur within the course of replication: i following UV irradiation, NER-induced mutations are fixed much more rapidly (t ½ ≈ 30 min than replication dependent mutations (t ½ ≈ 80-100 min ii NERiM specifically requires DNA Pol IV in addition to Pol V iii NERiM exhibits a two-hit dose-response curve that suggests processing of closely spaced lesions. A mathematical model let us define the geometry (infer the structure of the toxic intermediate as being formed when NER incises a lesion that resides in close proximity of another lesion in the complementary strand. This critical NER intermediate requires Pol IV / Pol II for repair, it is either lethal if left unrepaired or mutation-prone when repaired. Finally, NERiM is found to operate in stationary phase cells providing an intriguing possibility for ongoing evolution in the absence of replication.

  11. THE EFFECTS OF STRESS ON DNA REPAIR CAPACITY.

    Science.gov (United States)

    Forlenza, Michael J; Latimer, Jean J; Baum, Andrew

    Research has shown that lymphocytes of high-distress patients have reduced DNA repair relative to that of low-distress patients and healthy controls. Furthermore, deficits in repair are associated with an increased risk of cancer. Using and academic stress model, we hypothesized that students would exhibit lower levels of Nucleotide Excision Repair (NER) during a stressful exam period when compared to a lower stress period. Participants were 19 healthy graduate level students. NER was measured in lymphocytes using the unscheduled DNA synthesis (UDS) assay with slide autoradiography. Contrary to prediction, mean values for NER significantly increased during the higher stress period relative to the lower stress period controlling for background differences in repair. Furthermore, lymphocytes had significantly increased repair of endogenous damage during the higher stress period. Stress appears to directly increase DNA repair. Additionally, stress may increase DNA repair indirectly by increasing damage to DNA.

  12. Neil3-dependent base excision repair regulates lipid metabolism and prevents atherosclerosis in Apoe-deficient mice

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; Holm, Sverre; Scheffler, Katja

    2016-01-01

    an atherogenic lipid profile, increased hepatic triglyceride levels and attenuated macrophage cholesterol efflux capacity. Apoe-/- Neil3-/- mice showed marked alterations in several pathways affecting hepatic lipid metabolism, but no genotypic alterations in genome integrity or genome-wide accumulation...... of oxidative DNA damage. These results suggest a novel role for the DNA glycosylase Neil3 in atherogenesis in balancing lipid metabolism and macrophage function, potentially independently of genome-wide canonical base excision repair of oxidative DNA damage....

  13. Nucleotide excision repair- and p53-deficient mouse models in cancer research

    Energy Technology Data Exchange (ETDEWEB)

    Hoogervorst, Esther M. [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Utrecht University, Department of Pathobiology, Utrecht (Netherlands); Steeg, Harry van [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Vries, Annemieke de [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail: Annemieke.de.Vries@rivm.nl

    2005-07-01

    Cancer is caused by the loss of controlled cell growth due to mutational (in)activation of critical genes known to be involved in cell cycle regulation. Three main mechanisms are known to be involved in the prevention of cells from becoming cancerous; DNA repair and cell cycle control, important to remove DNA damage before it will be fixed into mutations and apoptosis, resulting in the elimination of cells containing severe DNA damage. Several human syndromes are known to have (partially) deficiencies in these pathways, and are therefore highly cancer prone. Examples are xeroderma pigmentosum (XP) caused by an inborn defect in the nucleotide excision repair (NER) pathway and the Li-Fraumeni syndrome, which is the result of a germ line mutation in the p53 gene. XP patients develop skin cancer on sun exposed areas at a relatively early age, whereas Li-Fraumeni patients spontaneously develop a wide variety of early onset tumors, including sarcomas, leukemia's and mammary gland carcinomas. Several mouse models have been generated to mimic these human syndromes, providing us information about the role of these particular gene defects in the tumorigenesis process. In this review, spontaneous phenotypes of mice deficient for nucleotide excision repair and/or the p53 gene will be described, together with their responses upon exposure to either chemical carcinogens or radiation. Furthermore, possible applications of these and newly generated mouse models for cancer will be given.

  14. Repair of DNA damage in light sensitive human skin diseases

    Energy Technology Data Exchange (ETDEWEB)

    Horkay, I.; Varga, L.; Tam' asi P., Gundy, S.

    1978-12-01

    Repair of uv-light induced DNA damage and changes in the semiconservative DNA synthesis were studied by in vitro autoradiography in the skin of patients with lightdermatoses (polymorphous light eruption, porphyria cutanea tarda, erythropoietic protoporphyria) and xeroderma pigmentosum as well as in that of healthy controls. In polymorphous light eruption the semiconservative DNA replication rate was more intensive in the area of the skin lesions and in the repeated phototest site, the excision repair synthesis appeared to be unaltered. In cutaneous prophyrias a decreased rate of the repair incorporation could be detected. Xeroderma pigmentosum was characterized by a strongly reduced repair synthesis.

  15. Polymorphisms in nucleotide excision repair genes, smoking and intake of fruit and vegetables in relation to lung cancer

    DEFF Research Database (Denmark)

    Raaschou-Nielsen, Ole; Sørensen, Mette; Overvad, Kim

    2007-01-01

    in the XPC, XPA and XPD genes involved in the nucleotide excision DNA repair pathway and analysed possible interactions with smoking and dietary intake of fruit and vegetables in relation to risk for lung cancer. We found that intake of fruit was associated with lower risk for lung cancer only among carriers...

  16. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  17. Age-related neuronal degeneration: complementary roles of nucleotide excision repair and transcription-coupled repair in preventing neuropathology.

    Directory of Open Access Journals (Sweden)

    Dick Jaarsma

    2011-12-01

    Full Text Available Neuronal degeneration is a hallmark of many DNA repair syndromes. Yet, how DNA damage causes neuronal degeneration and whether defects in different repair systems affect the brain differently is largely unknown. Here, we performed a systematic detailed analysis of neurodegenerative changes in mouse models deficient in nucleotide excision repair (NER and transcription-coupled repair (TCR, two partially overlapping DNA repair systems that remove helix-distorting and transcription-blocking lesions, respectively, and that are associated with the UV-sensitive syndromes xeroderma pigmentosum (XP and Cockayne syndrome (CS. TCR-deficient Csa(-/- and Csb(-/- CS mice showed activated microglia cells surrounding oligodendrocytes in regions with myelinated axons throughout the nervous system. This white matter microglia activation was not observed in NER-deficient Xpa(-/- and Xpc(-/- XP mice, but also occurred in Xpd(XPCS mice carrying a point mutation (G602D in the Xpd gene that is associated with a combined XPCS disorder and causes a partial NER and TCR defect. The white matter abnormalities in TCR-deficient mice are compatible with focal dysmyelination in CS patients. Both TCR-deficient and NER-deficient mice showed no evidence for neuronal degeneration apart from p53 activation in sporadic (Csa(-/-, Csb(-/- or highly sporadic (Xpa(-/-, Xpc(-/- neurons and astrocytes. To examine to what extent overlap occurs between both repair systems, we generated TCR-deficient mice with selective inactivation of NER in postnatal neurons. These mice develop dramatic age-related cumulative neuronal loss indicating DNA damage substrate overlap and synergism between TCR and NER pathways in neurons, and they uncover the occurrence of spontaneous DNA injury that may trigger neuronal degeneration. We propose that, while Csa(-/- and Csb(-/- TCR-deficient mice represent powerful animal models to study the mechanisms underlying myelin abnormalities in CS, neuron

  18. DREMECELS: A Curated Database for Base Excision and Mismatch Repair Mechanisms Associated Human Malignancies.

    Directory of Open Access Journals (Sweden)

    Ankita Shukla

    Full Text Available DNA repair mechanisms act as a warrior combating various damaging processes that ensue critical malignancies. DREMECELS was designed considering the malignancies with frequent alterations in DNA repair pathways, that is, colorectal and endometrial cancers, associated with Lynch syndrome (also known as HNPCC. Since lynch syndrome carries high risk (~40-60% for both cancers, therefore we decided to cover all three diseases in this portal. Although a large population is presently affected by these malignancies, many resources are available for various cancer types but no database archives information on the genes specifically for only these cancers and disorders. The database contains 156 genes and two repair mechanisms, base excision repair (BER and mismatch repair (MMR. Other parameters include some of the regulatory processes that have roles in these disease progressions due to incompetent repair mechanisms, specifically BER and MMR. However, our unique database mainly provides qualitative and quantitative information on these cancer types along with methylation, drug sensitivity, miRNAs, copy number variation (CNV and somatic mutations data. This database would serve the scientific community by providing integrated information on these disease types, thus sustaining diagnostic and therapeutic processes. This repository would serve as an excellent accompaniment for researchers and biomedical professionals and facilitate in understanding such critical diseases. DREMECELS is publicly available at http://www.bioinfoindia.org/dremecels.

  19. Cloning of a human homolog of the yeast nucleotide excision repair gene MMS19 and interaction with transcription repair factor TFIIH via the XPB and XPD helicases

    NARCIS (Netherlands)

    T. Seroz; G.S. Winkler (Sebastiaan); J. Auriol; R.A. Verhage; W. Vermeulen (Wim); B. Smit (Bep); J. Brouwer (Jaap); G. Weeda (Geert); J.H.J. Hoeijmakers (Jan); A.P.M. Eker (André); J-M. Egly (Jean-Marc)

    2000-01-01

    textabstractNucleotide excision repair (NER) removes UV-induced photoproducts and numerous other DNA lesions in a highly conserved 'cut-and-paste' reaction that involves approximately 25 core components. In addition, several other proteins have been identified which are dispensable for NER in vitro

  20. Structure of the DNA Repair Helicase XPD

    OpenAIRE

    Liu, Huanting; Rudolf, Jana; Johnson, Kenneth A.; McMahon, Stephen A.; Oke, Muse; Carter, Lester; McRobbie, Anne-Marie; Brown, Sara E.; Naismith, James H.; White, Malcolm F.

    2008-01-01

    The XPD helicase (Rad3 in Saccharomyces cerevisiae) is a component of transcription factor IIH (TFIIH), which functions in transcription initiation and Nucleotide Excision Repair in eukaryotes, catalysing DNA duplex opening localised to the transcription start site or site of DNA damage, respectively. XPD has a 5′ to 3′ polarity and the helicase activity is dependent on an iron-sulfur cluster binding domain, a feature that is conserved in related helicases such as FancJ. The xpd gene is the t...

  1. DNA mismatch repair: Dr. Jekyll and Mr. Hyde?

    Science.gov (United States)

    Hsieh, Peggy

    2012-09-14

    In this issue, Peña-Diaz et al. (2012) describe a pathway for somatic mutation in nonlymphoid cells termed noncanonical DNA mismatch repair, whereby the error-prone translesion polymerase Pol-η substitutes for high-fidelity replicative polymerases to resynthesize excised regions opposite DNA damage. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Abnormal Base Excision Repair at Trinucleotide Repeats Associated with Diseases: A Tissue-Selective Mechanism

    Directory of Open Access Journals (Sweden)

    Agathi-Vasiliki Goula

    2013-07-01

    Full Text Available More than fifteen genetic diseases, including Huntington’s disease, myotonic dystrophy 1, fragile X syndrome and Friedreich ataxia, are caused by the aberrant expansion of a trinucleotide repeat. The mutation is unstable and further expands in specific cells or tissues with time, which can accelerate disease progression. DNA damage and base excision repair (BER are involved in repeat instability and might contribute to the tissue selectivity of the process. In this review, we will discuss the mechanisms of trinucleotide repeat instability, focusing more specifically on the role of BER.

  3. Nucleotide excision repair is not induced in human embryonic lung fibroblasts treated with environmental pollutants.

    Directory of Open Access Journals (Sweden)

    Pavel Rossner

    Full Text Available The cellular response to genotoxic treatment depends on the cell line used. Although tumor cell lines are widely used for genotoxicity tests, the interpretation of the results may be potentially hampered by changes in cellular processes caused by malignant transformation. In our study we used normal human embryonic lung fibroblasts (HEL12469 cells and tested their response to treatment with benzo[a]pyrene (B[a]P and extractable organic matter (EOM from ambient air particles <2.5 µm (PM2.5 collected in two Czech cities differing in levels and sources of air pollution. We analyzed multiple endpoints associated with exposure to polycyclic aromatic hydrocarbons (PAHs including the levels of bulky DNA adducts and the nucleotide excision repair (NER response [expression of XPE, XPC and XPA genes on the level of mRNA and proteins, unscheduled DNA synthesis (UDS]. EOMs were collected in the winter and summer of 2011 in two Czech cities with different levels and sources of air pollution. The effects of the studied compounds were analyzed in the presence (+S9 and absence (-S9 of the rat liver microsomal S9 fraction. The levels of bulky DNA adducts were highest after treatment with B[a]P, followed by winter EOMs; their induction by summer EOMs was weak. The induction of both mRNA and protein expression was observed, with the most pronounced effects after treatment with B[a]P (-S9; the response induced by EOMs from both cities and seasons was substantially weaker. The expression of DNA repair genes was not accompanied by the induction of UDS activity. In summary, our results indicate that the tested compounds induced low levels of DNA damage and affected the expression of NER genes; however, nucleotide excision repair was not induced.

  4. Base excision repair imbalance in colorectal cancer has prognostic value and modulates response to chemotherapy

    Science.gov (United States)

    Leguisamo, Natalia M.; Gloria, Helena C.; Kalil, Antonio N.; Martins, Talita V.; Azambuja, Daniel B.

    2017-01-01

    Colorectal cancer (CRC) is prevalent worldwide, and treatment often involves surgery and genotoxic chemotherapy. DNA repair mechanisms, such as base excision repair (BER) and mismatch repair (MMR), may not only influence tumour characteristics and prognosis but also dictate chemotherapy response. Defective MMR contributes to chemoresistance in colorectal cancer. Moreover, BER affects cellular survival by repairing genotoxic base damage in a process that itself can disrupt metabolism. In this study, we characterized BER and MMR gene expression in colorectal tumours and the association between this repair profile with patients’ clinical and pathological features. In addition, we exploited the possible mechanisms underlying the association between altered DNA repair, metabolism and response to chemotherapy. Seventy pairs of sporadic colorectal tumour samples and adjacent non-tumour mucosal specimens were assessed for BER and MMR gene and protein expression and their association with pathological and clinical features. MMR-deficient colon cancer cells (HCT116) transiently overexpressing MPG or XRCC1 were treated with 5-FU or TMZ and evaluated for viability and metabolic intermediate levels. Increase in BER gene and protein expression is associated with more aggressive tumour features and poor pathological outcomes in CRC. However, tumours with reduced MMR gene expression also displayed low MPG, OGG1 and PARP1 expression. Imbalancing BER by overexpression of MPG, but not XRCC1, sensitises MMR-deficient colon cancer cells to 5-FU and TMZ and leads to ATP depletion and lactate accumulation. MPG overexpression alters DNA repair and metabolism and is a potential strategy to overcome 5-FU chemotherapeutic resistance in MMR-deficient CRC. PMID:28903334

  5. Monogenic diseases of DNA repair

    DEFF Research Database (Denmark)

    Keijzers, Guido; Bakula, Daniela; Scheibye-Knudsen, Morten

    2017-01-01

    of a growing number of human diseases. Notably, many of these monogenic DNA-repair disorders display features of accelerated aging, supporting the notion that genome maintenance is a key factor for organismal longevity. This review focuses on the physiological consequences of loss of DNA repair, particularly...

  6. DNA Repair in Drosophila: Mutagens, Models, and Missing Genes.

    Science.gov (United States)

    Sekelsky, Jeff

    2017-02-01

    The numerous processes that damage DNA are counterbalanced by a complex network of repair pathways that, collectively, can mend diverse types of damage. Insights into these pathways have come from studies in many different organisms, including Drosophila melanogaster Indeed, the first ideas about chromosome and gene repair grew out of Drosophila research on the properties of mutations produced by ionizing radiation and mustard gas. Numerous methods have been developed to take advantage of Drosophila genetic tools to elucidate repair processes in whole animals, organs, tissues, and cells. These studies have led to the discovery of key DNA repair pathways, including synthesis-dependent strand annealing, and DNA polymerase theta-mediated end joining. Drosophila appear to utilize other major repair pathways as well, such as base excision repair, nucleotide excision repair, mismatch repair, and interstrand crosslink repair. In a surprising number of cases, however, DNA repair genes whose products play important roles in these pathways in other organisms are missing from the Drosophila genome, raising interesting questions for continued investigations. Copyright © 2017 by the Genetics Society of America.

  7. Nucleotide Excision Repair and Vitamin D--Relevance for Skin Cancer Therapy.

    Science.gov (United States)

    Pawlowska, Elzbieta; Wysokinski, Daniel; Blasiak, Janusz

    2016-04-06

    Ultraviolet (UV) radiation is involved in almost all skin cancer cases, but on the other hand, it stimulates the production of pre-vitamin D3, whose active metabolite, 1,25-dihydroxyvitamin D3 (1,25VD3), plays important physiological functions on binding with its receptor (vitamin D receptor, VDR). UV-induced DNA damages in the form of cyclobutane pyrimidine dimers or (6-4)-pyrimidine-pyrimidone photoproducts are frequently found in skin cancer and its precursors. Therefore, removing these lesions is essential for the prevention of skin cancer. As UV-induced DNA damages are repaired by nucleotide excision repair (NER), the interaction of 1,25VD3 with NER components can be important for skin cancer transformation. Several studies show that 1,25VD3 protects DNA against damage induced by UV, but the exact mechanism of this protection is not completely clear. 1,25VD3 was also shown to affect cell cycle regulation and apoptosis in several signaling pathways, so it can be considered as a potential modulator of the cellular DNA damage response, which is crucial for mutagenesis and cancer transformation. 1,25VD3 was shown to affect DNA repair and potentially NER through decreasing nitrosylation of DNA repair enzymes by NO overproduction by UV, but other mechanisms of the interaction between 1,25VD3 and NER machinery also are suggested. Therefore, the array of NER gene functioning could be analyzed and an appropriate amount of 1.25VD3 could be recommended to decrease UV-induced DNA damage important for skin cancer transformation.

  8. Structure-based insights into the repair of UV-damaged DNA

    NARCIS (Netherlands)

    Meulenbroek, Elisabeth Maria

    2012-01-01

    Repair of damage in the DNA is essential for an organism. Therefore, several repair mechanisms have evolved. In this thesis, the mechanism of Transcription-Coupled Nucleotide Excision Repair (TC-NER) and the UV Damage Endonuclease repair pathway (UVDE) have been studied. Central to TC-NER is the

  9. Polysulfide compounds as inhibitors of the key base excision repair enzymes

    Directory of Open Access Journals (Sweden)

    Salakhutdinov N. F.

    2012-06-01

    Full Text Available Aim. To increase the capacity of antitumor therapy based on DNA damage it is important to minimize the repair of DNA lesions that can be achieved by inhibiting the activity of key DNA repair enzymes. To this end several benzopentathiepine and benzo[1,3]dithiol derivatives were synthesized and tested as inhibitors of the key base excision repair (BER enzymes, PARP1, DNA polymerase β, and APE1. Methods. The procedure of synthesis of several new compounds was developed. The inhibitory capacity of the compounds was estimated by comparison of the enzyme activities in specific tests in the presence of compounds versus their absence. Results. Benzopentathiepine derivative bearing trifluoromethyl group at the 1st position was shown to be a weak inhibitor of PARP1. Cyclic substituents at the 1st position attached through amide bond bring about moderate enhancement of pol β inhibition. Each studied substituent at the 1st position considerably increases the inhibition of APE1-catalyzed hydrolysis of AP sites as compared to parent compound. Conclusions. Several new inhibitors of BER enzymes were revealed. The directions for further modification of compounds to improve their inhibitory activity were found out.

  10. Alkyltransferase-like proteins: Molecular switches between DNA repair pathways

    Science.gov (United States)

    Tubbs, Julie L.; Tainer, John A.

    2011-01-01

    Alkyltransferase-like proteins (ATLs) play a role in the protection of cells from the biological effects of DNA alkylation damage. Although ATLs share functional motifs with the DNA repair protein and cancer chemotherapy target O6-alkylguanine-DNA alkyltransferase, they lack the reactive cysteine residue required for alkyltransferase activity, so its mechanism for cell protection was previously unknown. Here, we review recent advances in unravelling the enigmatic cellular protection provided by ATLs against the deleterious effects of DNA alkylation damage. We discuss exciting new evidence that ATLs aid in the repair of DNA O6-alkylguanine lesions through a novel repair cross-talk between DNA-alkylation base damage responses and the DNA nucleotide excision repair pathway. PMID:20502938

  11. Induction of a mutant phenotype in human repair proficient cells after overexpression of a mutated human DNA repair gene.

    NARCIS (Netherlands)

    P.B.G.M. Belt; M.F. van Oostenrijk; H. Odijk (Hanny); J.H.J. Hoeijmakers (Jan); C.M.P. Backendorf (Claude)

    1991-01-01

    textabstractAntisense and mutated cDNA of the human excision repair gene ERCC-1 were overexpressed in repair efficient HeLa cells by means of an Epstein-Barr-virus derived CDNA expression vector. Whereas antisense RNA did not influence the survival of the transfected cells, a mutated cDNA generating

  12. MISMATCH REPAIR-DEPENDENT ITERATIVE EXCISION AT IRREPARABLE O6-METHYLGUANINE LESIONS IN HUMAN NUCLEAR EXTRACTS*

    Science.gov (United States)

    York, Sally J.; Modrich, Paul

    2008-01-01

    The response of mammalian cells to SN1 DNA methylators depends on functional MutSα and MutLα. Cells deficient in either of these activities are resistant to the cytotoxic effects of this class of chemotherapeutic drug. Because killing by SN1 methylators has been attributed to O6-methylguanine (MeG), we have constructed nicked circular heteroduplexes that contain a single MeG-T mispair and have examined processing of these molecules by mismatch repair in nuclear extracts of human cells. Excision provoked by MeG-T is restricted to the incised heteroduplex strand, leading to removal of the MeG when it resides on this strand. However, when the MeG is located on the continuous strand, the heteroduplex is irreparable. MeG-T-dependent repair DNA synthesis is observed on both reparable and irreparable, 3’ and 5’ heteroduplexes as judged by [32P]dAMP incorporation. Labeling with [α-32P]dATP followed by a cold dATP chase has demonstrated that newly synthesized DNA on irreparable molecules is subject to re-excision in a reaction that is MutLα-dependent, an effect attributable to presence of MeG on the template strand. Processing of the irreparable 3’ heteroduplex is also associated with incision of the discontinuous strand of a few percent of molecules near the thymidylate of the MeG-T base pair. These results provide the first direct evidence for mismatch repair-mediated iterative processing of DNA methylator damage, an effect that may be relevant to damage signaling events triggered by this class of chemotherapeutic agent. PMID:16772289

  13. The Association of Low-Penetrance Variants in DNA Repair Genes with Colorectal Cancer: A Systematic Review and Meta-Analysis

    OpenAIRE

    Aggarwal, Nikhil; Donald, Neil D; Malik, Salim; Selvendran, Subothini S; McPhail, Mark JW.; Monahan, Kevin J

    2017-01-01

    Objectives: Approximately 35% of colorectal cancer (CRC) risk is attributable to heritable factors known hereditary syndromes, accounting for 6%. The remainder may be due to lower penetrance polymorphisms particularly of DNA repair genes. DNA repair pathways, including base excision repair (BER), nucleotide excision repair (NER), mismatch repair (MMR), direct reversal repair (DRR), and double-strand break repair are complex, evolutionarily conserved, and critical in carcinogenesis. Germline m...

  14. Repair of oxidatively generated DNA damage in Cockayne syndrome.

    Science.gov (United States)

    Khobta, Andriy; Epe, Bernd

    2013-01-01

    Defects in the repair of endogenously (especially oxidatively) generated DNA modifications and the resulting genetic instability can potentially explain the clinical symptoms of Cockayne syndrome (CS), a hereditary disease characterized by developmental defects and neurological degeneration. In this review, we describe the evidence for the involvement of CSA and CSB proteins, which are mutated in most of the CS patients, in the repair and processing of DNA damage induced by reactive oxygen species and the implications for the induction of cell death and mutations. Taken together, the data demonstrate that CSA and CSB, in addition to their established role in transcription-coupled nucleotide excision repair, can modulate the base excision repair (BER) of oxidized DNA bases both directly (by interaction with BER proteins) and indirectly (by modulating the expression of the DNA repair genes). Both nuclear and mitochondrial DNA repair is affected by mutations in CSA and CSB genes. However, the observed retardations of repair and the resulting accumulation of unrepaired endogenously generated DNA lesions are often mild, thus pointing to the relevance of additional roles of the CS proteins, e.g. in the mitochondrial response to oxidatively generated DNA damage and in the maintenance of gene transcription. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  16. PARP-1 enhances the mismatch-dependence of 5′-directed excision in human mismatch repair in vitro

    Science.gov (United States)

    Liu, Yiyong; Kadyrov, Farid A.; Modrich, Paul

    2011-01-01

    End-directed mismatch-provoked excision has been reconstituted in several purified systems. While 3′-directed excision displays a mismatch dependence similar to that observed in nuclear extracts (≈ 20-fold), the mismatch dependence of 5′-directed excision is only 3 to 4-fold, significantly less than that in extracts (8 to 10-fold). Utilizing a fractionation-based approach, we have isolated a single polypeptide that enhances mismatch dependence of reconstituted 5′-directed excision and have shown it to be identical to poly[ADP-ribose] polymerase 1 (PARP-1). Titration of reconstituted excision reactions or PARP-1-depleted HeLa nuclear extract with purified PARP-1 showed that the protein specifically enhances mismatch dependence of 5′-directed excision. Analysis of a set of PARP-1 mutants revealed that the DNA binding domain and BRCT fold contribute to the regulation of excision specificity. Involvement of the catalytic domain is restricted to its ability to poly(ADP-ribosyl)ate PARP-1 in the presence of NAD+, likely through interference with DNA binding. Analysis of protein-protein interactions demonstrated that PARP-1 interacts with mismatch repair proteins MutSα, exonuclease 1, replication protein A (RPA), and as previously shown by others, replication factor C (RFC) and proliferating cell nuclear antigen (PCNA) as well. The BRCT fold plays an important role in the interaction of PARP-1 with the former three proteins. PMID:21945626

  17. Exposure of Human Lung Cells to Tobacco Smoke Condensate Inhibits the Nucleotide Excision Repair Pathway.

    Directory of Open Access Journals (Sweden)

    Nathaniel Holcomb

    Full Text Available Exposure to tobacco smoke is the number one risk factor for lung cancer. Although the DNA damaging properties of tobacco smoke have been well documented, relatively few studies have examined its effect on DNA repair pathways. This is especially true for the nucleotide excision repair (NER pathway which recognizes and removes many structurally diverse DNA lesions, including those introduced by chemical carcinogens present in tobacco smoke. The aim of the present study was to investigate the effect of tobacco smoke on NER in human lung cells. We studied the effect of cigarette smoke condensate (CSC, a surrogate for tobacco smoke, on the NER pathway in two different human lung cell lines; IMR-90 lung fibroblasts and BEAS-2B bronchial epithelial cells. To measure NER, we employed a slot-blot assay to quantify the introduction and removal of UV light-induced 6-4 photoproducts and cyclobutane pyrimidine dimers. We find a dose-dependent inhibition of 6-4 photoproduct repair in both cell lines treated with CSC. Additionally, the impact of CSC on the abundance of various NER proteins and their respective RNAs was investigated. The abundance of XPC protein, which is required for functional NER, is significantly reduced by treatment with CSC while the abundance of XPA protein, also required for NER, is unaffected. Both XPC and XPA RNA levels are modestly reduced by CSC treatment. Finally, treatment of cells with MG-132 abrogates the reduction in the abundance of XPC protein produced by treatment with CSC, suggesting that CSC enhances proteasome-dependent turnover of the protein that is mediated by ubiquitination. Together, these findings indicate that tobacco smoke can inhibit the same DNA repair pathway that is also essential for the removal of some of the carcinogenic DNA damage introduced by smoke itself, increasing the DNA damage burden of cells exposed to tobacco smoke.

  18. Both genetic and dietary factors underlie individual differences in DNA damage levels and DNA repair capacity.

    Science.gov (United States)

    Slyskova, Jana; Lorenzo, Yolanda; Karlsen, Anette; Carlsen, Monica H; Novosadova, Vendula; Blomhoff, Rune; Vodicka, Pavel; Collins, Andrew R

    2014-04-01

    The interplay between dietary habits and individual genetic make-up is assumed to influence risk of cancer, via modulation of DNA integrity. Our aim was to characterize internal and external factors that underlie inter-individual variability in DNA damage and repair and to identify dietary habits beneficial for maintaining DNA integrity. Habitual diet was estimated in 340 healthy individuals using a food frequency questionnaire and biomarkers of antioxidant status were quantified in fasting blood samples. Markers of DNA integrity were represented by DNA strand breaks, oxidized purines, oxidized pyrimidines and a sum of all three as total DNA damage. DNA repair was characterized by genetic variants and functional activities of base and nucleotide excision repair pathways. Sex, fruit-based food consumption and XPG genotype were factors significantly associated with the level of DNA damage. DNA damage was higher in women (p=0.035). Fruit consumption was negatively associated with the number of all measured DNA lesions, and this effect was mediated mostly by β-cryptoxanthin and β-tocopherol (pindividual antioxidants were also associated with DNA repair capacity; both the base and nucleotide excision repairs were lower in women and the latter increased with higher plasma levels of ascorbic acid and α-carotene (pgenetic and dietary factors that modulate DNA integrity. We propose that the positive health effect of fruit intake is partially mediated via DNA damage suppression and a simultaneous increase in DNA repair capacity. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Gastroesophageal junction adenocarcinoma displays abnormalities in homologous recombination and nucleotide excision repair

    Directory of Open Access Journals (Sweden)

    Dewalt RI

    2014-02-01

    Full Text Available Robin I Dewalt,1 Kenneth A Kesler,2 Zane T Hammoud,3 LeeAnn Baldridge,4 Eyas M Hattab,4 Shadia I Jalal1,5 1Division of Hematology/Oncology, Department of Medicine, 2Cardiothoracic Division, Department of Surgery, Indiana University School of Medicine, Indianapolis, IN, USA; 3Henry Ford Hospital, Detroit, MI, USA; 4Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, IN, USA; 5Indiana University Melvin and Bren Simon Cancer Center, Indianapolis, IN, USA Objective: Esophageal adenocarcinoma (EAC continues to be a disease associated with high mortality. Among the factors leading to poor outcomes are innate resistance to currently available therapies, advanced stage at diagnosis, and complex biology. Platinum and ionizing radiation form the backbone of treatment for the majority of patients with EAC. Of the multiple processes involved in response to platinum chemotherapy or ionizing radiation, deoxyribonucleic acid (DNA repair has been a major player in cancer sensitivity to these agents. DNA repair defects have been described in various malignancies. The purpose of this study was to determine whether alterations in DNA repair are present in EAC compared with normal gastroesophageal tissues. Methods: We analyzed the expression of genes involved in homologous recombination (HR, nonhomologous end-joining, and nucleotide excision repair (NER pathways in 12 EAC tumor samples with their matched normal counterparts. These pathways were chosen because they are the main pathways involved in the repair of platinum- or ionizing-radiation-induced damage. In addition, abnormalities in these pathways have not been well characterized in EAC. Results: We identified increased expression of at least one HR gene in eight of the EAC tumor samples. Alterations in the expression of EME1, a structure-specific endonuclease involved in HR, were the most prevalent, with messenger (mRNA overexpression in six of the EAC samples

  20. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Lefkofsky, Hailey B. [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Veloso, Artur [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Bioinformatics Program, Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI (United States); Ljungman, Mats, E-mail: ljungman@umich.edu [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, MI (United States)

    2015-06-15

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death.

  1. Polymorphisms within base and nucleotide excision repair pathways and risk of differentiated thyroid carcinoma.

    Science.gov (United States)

    Cipollini, Monica; Figlioli, Gisella; Maccari, Giuseppe; Garritano, Sonia; De Santi, Chiara; Melaiu, Ombretta; Barone, Elisa; Bambi, Franco; Ermini, Stefano; Pellegrini, Giovanni; Cristaudo, Alfonso; Foddis, Rudy; Bonotti, Alessandra; Romei, Cristina; Vivaldi, Agnese; Agate, Laura; Molinari, Eleonora; Barale, Roberto; Forsti, Asta; Hemminki, Kari; Elisei, Rossella; Gemignani, Federica; Landi, Stefano

    2016-05-01

    The thyrocytes are exposed to high levels of oxidative stress which could induce DNA damages. Base excision repair (BER) is one of the principal mechanisms of defense against oxidative DNA damage, however recent evidences suggest that also nucleotide excision repair (NER) could be involved. The aim of present work was to identify novel differentiated thyroid cancer (DTC) risk variants in BER and NER genes. For this purpose, the most strongly associated SNPs within NER and BER genes found in our previous GWAS on DTC were selected and replicated in an independent series of samples for a new case-control study. Although a positive signal was detected at the nominal level of 0.05 for rs7689099 (encoding for an aminoacid change proline to arginine at codon 117 within NEIL3), none of the considered SNPs (i.e. rs7990340 and rs690860 within RFC3, rs3744767 and rs1131636 within RPA1, rs16962916 and rs3136166 in ERCC4, and rs17739370 and rs7689099 in NEIL3) was associated with the risk of DTC when the correction of multiple testing was applied. In conclusion, a role of NER and BER pathways was evoked in the susceptibility to DTC. However, this seemed to be limited to few polymorphic genes and the overall effect size appeared weak. Copyright © 2016. Published by Elsevier B.V.

  2. Aging and DNA repair capability. [Review

    Energy Technology Data Exchange (ETDEWEB)

    Tice, R R

    1977-01-01

    A review of the literature on DNA repair processes in relation to aging is presented under the following headings: DNA repair processes; age-related occurrence of unrepaired DNA lesions; DNA repair capability as a function of age; tissue-specific DNA repair capability; acceleration of the aging process by exposure to DNA damaging agents; human genetic syndromes; and longevity and DNA repair processes. (HLW)

  3. Nucleotide excision repair and the 26S proteasome function together to promote trinucleotide repeat expansions.

    Science.gov (United States)

    Concannon, Claire; Lahue, Robert S

    2014-01-01

    Trinucleotide repeat (TNR) expansion underpins a number of inheritable neurological human disorders. Multiple mechanisms are thought to contribute to the expansion process. The incorrect processing of the repeat tract by DNA repair proteins can drive this mutation process forward, as expansions are suppressed following ablation of certain repair factors in mouse models and cell models of disease. Nucleotide excision repair (NER) is one repair pathway implicated in TNR instability, although most previous work focussed on TNR contractions, not expansions. Here we investigated the role of NER in modulating expansions of threshold-length (CTG·CAG) repeats in yeast. We show that both the global genome and transcription-coupled repair subpathways promote expansions of threshold-length TNRs. Furthermore, NER works with the 26S proteasome to drive expansions, based on analysis of double mutants defective in both pathways, and of Rad23, a protein involved in both NER and the shuttling of ubiquitinated proteins to the proteasome. This work provides the first evidence that both subpathways of NER can promote threshold-length TNR expansions and that NER interacts with the proteasome to drive expansions. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Abasic sites linked to dUTP incorporation in DNA are a major cause of spontaneous mutations in absence of base excision repair and Rad17-Mec3-Ddc1 (9-1-1) DNA damage checkpoint clamp in Saccharomyces cerevisiae.

    Science.gov (United States)

    Collura, Ada; Kemp, Patricia Auffret Van Der; Boiteux, Serge

    2012-03-01

    In Saccharomyces cerevisiae, inactivation of base excision repair (BER) AP endonucleases (Apn1p and Apn2p) results in constitutive phosphorylation of Rad53p and delay in cell cycle progression at the G2/M transition. These data led us to investigate genetic interactions between Apn1p, Apn2p and DNA damage checkpoint proteins. The results show that mec1 sml1, rad53 sml1 and rad9 is synthetic lethal with apn1 apn2. In contrast, apn1 apn2 rad17, apn1 apn2 ddc1 and apn1 apn2 rad24 triple mutants are viable, although they exhibit a strong Can(R) spontaneous mutator phenotype. In these strains, high Can(R) mutation rate is dependent upon functional uracil DNA N-glycosylase (Ung1p) and mutation spectra are dominated by AT to CG events. The results point to a role for Rad17-Mec3-Ddc1 (9-1-1) checkpoint clamp in the prevention of mutations caused by abasic (AP) sites linked to incorporation of dUTP into DNA followed by the excision of uracil by Ung1p. The antimutator role of the (9-1-1) clamp can either rely on its essential function in the induction of the DNA damage checkpoint or to another function that specifically impacts DNA repair and/or mutagenesis at AP sites. Here, we show that the abrogation of the DNA damage checkpoint is not sufficient to enhance spontaneous mutagenesis in the apn1 apn2 rad9 sml1 quadruple mutant. Spontaneous mutagenesis was also explored in strains deficient in the two major DNA N-glycosylases/AP-lyases (Ntg1p and Ntg2p). Indeed, apn1 apn2 ntg1 ntg2 exhibits a strong Ung1p-dependent Can(R) mutator phenotype with a spectrum enriched in AT to CG, like apn1 apn2 rad17. However, genetic analysis reveals that ntg1 ntg2 and rad17 are not epistatic for spontaneous mutagenesis in apn1 apn2. We conclude that under normal growth conditions, dUTP incorporation into DNA is a major source of AP sites that cause high genetic instability in the absence of BER factors (Apn1p, Apn2p, Ntg1p and Ntg2p) and Rad17-Mec3-Ddc1 (9-1-1) checkpoint clamp in yeast

  5. Exposure to low dose of gamma radiation enhances the excision repair in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, K.; Verma, N.C. [Bhabha Atomic Research Centre, Mumbai (India)

    1998-08-01

    The effect of low doses of ionizing and nonionizing radiation on the radiation response of yeast Saccharomyces cerevisiae toward ionizing and nonionizing radiation was studied. The wild-type strain D273-10B on exposure to 54 Gy gamma radiation (resulting in about 10% cell killing) showed enhanced resistance to subsequent exposure to UV radiation. This induced UV resistance increased with the incubation time between the initial gamma radiation stress and the UV irradiation. Exposure to low doses of UV light on the other hand showed no change in gamma or UV radiation response of this strain. The strains carrying a mutation at rad52 behaved in a way similar to the wild type, but with slightly reduced induced response. In contrast to this, the rad3 mutants, defective in excision repair, showed no induced UV resistance. Removal of UV-induced pyrimidine dimers in wild-type yeast DNA after UV irradiation was examined by analyzing the sites recognized by UV endonuclease from Micrococcus luteus. The samples that were exposed to low doses of gamma radiation before UV irradiation were able to repair the pyrimidine dimers more efficiently than the samples in which low gamma irradiation was omitted. The nature of enhanced repair was studied by scoring the frequency of induced gene conversion and reverse mutation at trp and ilv loci respectively in strain D7, which showed similar enhanced UV resistance induced by low-dose gamma irradiation. The induced repair was found to be essentially error-free. These results suggest that irradiation of strain D273-10B with low doses of gamma radiation enhances its capability for excision repair of UV-induced pyrimidine dimers. (author)

  6. How chromatin is remodelled during DNA repair of UV-induced DNA damage in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Shirong Yu

    2011-06-01

    Full Text Available Global genome nucleotide excision repair removes DNA damage from transcriptionally silent regions of the genome. Relatively little is known about the molecular events that initiate and regulate this process in the context of chromatin. We've shown that, in response to UV radiation-induced DNA damage, increased histone H3 acetylation at lysine 9 and 14 correlates with changes in chromatin structure, and these alterations are associated with efficient global genome nucleotide excision repair in yeast. These changes depend on the presence of the Rad16 protein. Remarkably, constitutive hyperacetylation of histone H3 can suppress the requirement for Rad7 and Rad16, two components of a global genome repair complex, during repair. This reveals the connection between histone H3 acetylation and DNA repair. Here, we investigate how chromatin structure is modified following UV irradiation to facilitate DNA repair in yeast. Using a combination of chromatin immunoprecipitation to measure histone acetylation levels, histone acetylase occupancy in chromatin, MNase digestion, or restriction enzyme endonuclease accessibility assays to analyse chromatin structure, and finally nucleotide excision repair assays to examine DNA repair, we demonstrate that global genome nucleotide excision repair drives UV-induced chromatin remodelling by controlling histone H3 acetylation levels in chromatin. The concerted action of the ATPase and C3HC4 RING domains of Rad16 combine to regulate the occupancy of the histone acetyl transferase Gcn5 on chromatin in response to UV damage. We conclude that the global genome repair complex in yeast regulates UV-induced histone H3 acetylation by controlling the accessibility of the histone acetyl transferase Gcn5 in chromatin. The resultant changes in histone H3 acetylation promote chromatin remodelling necessary for efficient repair of DNA damage. Recent evidence suggests that GCN5 plays a role in NER in human cells. Our work provides

  7. How chromatin is remodelled during DNA repair of UV-induced DNA damage in Saccharomyces cerevisiae.

    Science.gov (United States)

    Yu, Shirong; Teng, Yumin; Waters, Raymond; Reed, Simon H

    2011-06-01

    Global genome nucleotide excision repair removes DNA damage from transcriptionally silent regions of the genome. Relatively little is known about the molecular events that initiate and regulate this process in the context of chromatin. We've shown that, in response to UV radiation-induced DNA damage, increased histone H3 acetylation at lysine 9 and 14 correlates with changes in chromatin structure, and these alterations are associated with efficient global genome nucleotide excision repair in yeast. These changes depend on the presence of the Rad16 protein. Remarkably, constitutive hyperacetylation of histone H3 can suppress the requirement for Rad7 and Rad16, two components of a global genome repair complex, during repair. This reveals the connection between histone H3 acetylation and DNA repair. Here, we investigate how chromatin structure is modified following UV irradiation to facilitate DNA repair in yeast. Using a combination of chromatin immunoprecipitation to measure histone acetylation levels, histone acetylase occupancy in chromatin, MNase digestion, or restriction enzyme endonuclease accessibility assays to analyse chromatin structure, and finally nucleotide excision repair assays to examine DNA repair, we demonstrate that global genome nucleotide excision repair drives UV-induced chromatin remodelling by controlling histone H3 acetylation levels in chromatin. The concerted action of the ATPase and C3HC4 RING domains of Rad16 combine to regulate the occupancy of the histone acetyl transferase Gcn5 on chromatin in response to UV damage. We conclude that the global genome repair complex in yeast regulates UV-induced histone H3 acetylation by controlling the accessibility of the histone acetyl transferase Gcn5 in chromatin. The resultant changes in histone H3 acetylation promote chromatin remodelling necessary for efficient repair of DNA damage. Recent evidence suggests that GCN5 plays a role in NER in human cells. Our work provides important insight into

  8. EZH2 suppresses the nucleotide excision repair in nasopharyngeal carcinoma by silencing XPA gene.

    Science.gov (United States)

    Huang, Yuxiang; Wang, Xuanyi; Niu, Xiaoshuang; Wang, Xiaoshen; Jiang, Rui; Xu, Tingting; Liu, Yong; Liang, Liping; Ou, Xiaomin; Xing, Xing; Li, Weiwei; Hu, Chaosu

    2017-02-01

    The enhancer of zeste homolog 2 (EZH2) is involved in a number of fundamental pathological processes of cancer. However, its role in DNA repair pathway is still unclear. Here, we have identified XPA as a novel target gene of EZH2 via a DNA repair pathway PCR array. XPA plays a pivot role in nucleotide excision repair (NER). The expression of XPA was significantly increased by EZH2 specific inhibitor GSK126 or lentiviral shEZH2 in nasopharyngeal carcinoma (NPC) CNE and 8F cell lines. Chromatin immunoprecipitation assay demonstrated that EZH2 catalyzes H3K27 trimethylation at the XPA promoters. Furthermore, we validated the negative correlation of EZH2 and XPA in a NPC tissue microarray by immunohistochemistry staining. We also found that high expression of EZH2 was positively correlated with advanced T, N, and AJCC stage of NPC; and low expression of XPA was positively correlated with advanced T and N stage. In NPC cell lines, increased XPA expression by EZH2 inhibition resulted in a more rapid removal of UVC induced 6-4PP- and CPD-DNA adducts, as well as enhanced efficiency of DNA repair after UVC irradiation as detected by the Comet assay and immunofluorescence staining of γH2Ax. Consistently, increased cell clonogenic survival, decreased apoptosis, and necrosis after UVC irradiation, and increased resistance to DNA damaging agent cisplatin was also observed in EZH2 inhibited cells. These results illustrate that EZH2 may promote carcinogenesis and cancer development of NPC by transcriptional repression of XPA gene and inactivation of NER pathway. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Genome Instability in Development and Aging: Insights from Nucleotide Excision Repair in Humans, Mice, and Worms

    Directory of Open Access Journals (Sweden)

    Diletta Edifizi

    2015-08-01

    Full Text Available DNA damage causally contributes to aging and cancer. Congenital defects in nucleotide excision repair (NER lead to distinct cancer-prone and premature aging syndromes. The genetics of NER mutations have provided important insights into the distinct consequences of genome instability. Recent work in mice and C. elegans has shed new light on the mechanisms through which developing and aging animals respond to persistent DNA damage. The various NER mouse mutants have served as important disease models for Xeroderma pigmentosum (XP, Cockayne syndrome (CS, and trichothiodystrophy (TTD, while the traceable genetics of C. elegans have allowed the mechanistic delineation of the distinct outcomes of genome instability in metazoan development and aging. Intriguingly, highly conserved longevity assurance mechanisms respond to transcription-blocking DNA lesions in mammals as well as in worms and counteract the detrimental consequences of persistent DNA damage. The insulin-like growth factor signaling (IIS effector transcription factor DAF-16 could indeed overcome DNA damage-driven developmental growth delay and functional deterioration even when DNA damage persists. Longevity assurance mechanisms might thus delay DNA damage-driven aging by raising the threshold when accumulating DNA damage becomes detrimental for physiological tissue functioning.

  10. Genome Instability in Development and Aging: Insights from Nucleotide Excision Repair in Humans, Mice, and Worms.

    Science.gov (United States)

    Edifizi, Diletta; Schumacher, Björn

    2015-08-13

    DNA damage causally contributes to aging and cancer. Congenital defects in nucleotide excision repair (NER) lead to distinct cancer-prone and premature aging syndromes. The genetics of NER mutations have provided important insights into the distinct consequences of genome instability. Recent work in mice and C. elegans has shed new light on the mechanisms through which developing and aging animals respond to persistent DNA damage. The various NER mouse mutants have served as important disease models for Xeroderma pigmentosum (XP), Cockayne syndrome (CS), and trichothiodystrophy (TTD), while the traceable genetics of C. elegans have allowed the mechanistic delineation of the distinct outcomes of genome instability in metazoan development and aging. Intriguingly, highly conserved longevity assurance mechanisms respond to transcription-blocking DNA lesions in mammals as well as in worms and counteract the detrimental consequences of persistent DNA damage. The insulin-like growth factor signaling (IIS) effector transcription factor DAF-16 could indeed overcome DNA damage-driven developmental growth delay and functional deterioration even when DNA damage persists. Longevity assurance mechanisms might thus delay DNA damage-driven aging by raising the threshold when accumulating DNA damage becomes detrimental for physiological tissue functioning.

  11. A novel role for transcription-coupled nucleotide excision repair for the in vivo repair of 3,N4-ethenocytosine.

    Science.gov (United States)

    Chaim, Isaac A; Gardner, Alycia; Wu, Jie; Iyama, Teruaki; Wilson, David M; Samson, Leona D

    2017-04-07

    Etheno (ε) DNA base adducts are highly mutagenic lesions produced endogenously via reactions with lipid peroxidation (LPO) products. Cancer-promoting conditions, such as inflammation, can induce persistent oxidative stress and increased LPO, resulting in the accumulation of ε-adducts in different tissues. Using a recently described fluorescence multiplexed host cell reactivation assay, we show that a plasmid reporter bearing a site-specific 3,N4-ethenocytosine (εC) causes transcriptional blockage. Notably, this blockage is exacerbated in Cockayne Syndrome and xeroderma pigmentosum patient-derived lymphoblastoid and fibroblast cells. Parallel RNA-Seq expression analysis of the plasmid reporter identifies novel transcriptional mutagenesis properties of εC. Our studies reveal that beyond the known pathways, such as base excision repair, the process of transcription-coupled nucleotide excision repair plays a role in the removal of εC from the genome, and thus in the protection of cells and tissues from collateral damage induced by inflammatory responses. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Radiation- and drug-induced DNA repair in mammalian oocytes and embryos

    Energy Technology Data Exchange (ETDEWEB)

    Pedersen, R A; Brandriff, B

    1979-01-01

    A review of studies showing ultraviolet- or drug-induced unscheduled DNA synthesis in mammalian oocytes and embryos suggests that the female gamete has an excision repair capacity from the earliest stages of oocyte growth. The oocyte's demonstrable excision repair capacity decreases at the time of meiotic maturation for unknown reasons, but the fully mature oocyte maintans a repair capacity, in contrast to the mature sperm, and contributes this to the zygote. Early embryo cells maintain relatively constant levels of excision repair until late fetal stages, when they lose their capacity for excision repair. These apparent changes in excision repair capacity do not have a simple relationship to known differences in radiation sensitivity of germ cells and embryos.

  13. Mammalian DNA Repair. Final Report

    Energy Technology Data Exchange (ETDEWEB)

    None

    2003-01-24

    The Gordon Research Conference (GRC) on Mammalian DNA Repair was held at Harbortown Resort, Ventura Beach, CA. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  14. Crystal structure of the FeS cluster-containing nucleotide excision repair helicase XPD.

    Directory of Open Access Journals (Sweden)

    Stefanie C Wolski

    2008-06-01

    Full Text Available DNA damage recognition by the nucleotide excision repair pathway requires an initial step identifying helical distortions in the DNA and a proofreading step verifying the presence of a lesion. This proofreading step is accomplished in eukaryotes by the TFIIH complex. The critical damage recognition component of TFIIH is the XPD protein, a DNA helicase that unwinds DNA and identifies the damage. Here, we describe the crystal structure of an archaeal XPD protein with high sequence identity to the human XPD protein that reveals how the structural helicase framework is combined with additional elements for strand separation and DNA scanning. Two RecA-like helicase domains are complemented by a 4Fe4S cluster domain, which has been implicated in damage recognition, and an alpha-helical domain. The first helicase domain together with the helical and 4Fe4S-cluster-containing domains form a central hole with a diameter sufficient in size to allow passage of a single stranded DNA. Based on our results, we suggest a model of how DNA is bound to the XPD protein, and can rationalize several of the mutations in the human XPD gene that lead to one of three severe diseases, xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy.

  15. Nrf1 CNC-bZIP protein promotes cell survival and nucleotide excision repair through maintaining glutathione homeostasis.

    Science.gov (United States)

    Han, Weinong; Ming, Mei; Zhao, Rui; Pi, Jingbo; Wu, Chunli; He, Yu-Ying

    2012-05-25

    Skin cancer is the most common cancer in the United States. Its major environmental risk factor is UVB radiation in sunlight. In response to UVB damage, epidermal keratinocytes activate a specific repair pathway, i.e. nucleotide excision repair, to remove UVB-induced DNA lesions. However, the regulation of UVB response is not fully understood. Here we show that the long isoform of the nuclear factor erythroid 2-related factor 1 (Nrf1, also called NFE2L1), a cytoprotective transcription factor critical for the expression of multiple antioxidant response element-dependent genes, plays an important role in the response of keratinocytes to UVB. Nrf1 loss sensitized keratinocytes to UVB-induced apoptosis by up-regulating the expression of the proapoptotic Bcl-2 family member Bik through reducing glutathione levels. Knocking down Bik reduced UVB-induced apoptosis in Nrf1-inhibited cells. In UVB-irradiated surviving cells, however, disruption of Nrf1 impaired nucleotide excision repair through suppressing the transcription of xeroderma pigmentosum C (XPC), a factor essential for initiating the global genome nucleotide excision repair by recognizing the DNA lesion and recruiting downstream factors. Nrf1 enhanced XPC expression by increasing glutathione availability but was independent of the transcription repressor of XPC. Adding XPC or glutathione restored the DNA repair capacity in Nrf1-inhibited cells. Finally, we demonstrate that Nrf1 levels are significantly reduced by UVB radiation in mouse skin and are lower in human skin tumors than in normal skin. These results indicate a novel role of Nrf1 in UVB-induced DNA damage repair and suggest Nrf1 as a tumor suppressor in the skin.

  16. DNA polymerase beta participates in mitochondrial DNA repair

    DEFF Research Database (Denmark)

    Sykora, P; Kanno, S; Akbari, M

    2017-01-01

    in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...

  17. Age-Related Neuronal Degeneration: Complementary Roles of Nucleotide Excision Repair and Transcription-Coupled Repair in Preventing Neuropathology

    Science.gov (United States)

    de Waard, Monique C.; Haasdijk, Elize D.; Brandt, Renata; Vermeij, Marcel; Rijksen, Yvonne; Maas, Alex; van Steeg, Harry; Hoeijmakers, Jan H. J.; van der Horst, Gijsbertus T. J.

    2011-01-01

    Neuronal degeneration is a hallmark of many DNA repair syndromes. Yet, how DNA damage causes neuronal degeneration and whether defects in different repair systems affect the brain differently is largely unknown. Here, we performed a systematic detailed analysis of neurodegenerative changes in mouse models deficient in nucleotide excision repair (NER) and transcription-coupled repair (TCR), two partially overlapping DNA repair systems that remove helix-distorting and transcription-blocking lesions, respectively, and that are associated with the UV-sensitive syndromes xeroderma pigmentosum (XP) and Cockayne syndrome (CS). TCR–deficient Csa−/− and Csb−/− CS mice showed activated microglia cells surrounding oligodendrocytes in regions with myelinated axons throughout the nervous system. This white matter microglia activation was not observed in NER–deficient Xpa−/− and Xpc−/− XP mice, but also occurred in XpdXPCS mice carrying a point mutation (G602D) in the Xpd gene that is associated with a combined XPCS disorder and causes a partial NER and TCR defect. The white matter abnormalities in TCR–deficient mice are compatible with focal dysmyelination in CS patients. Both TCR–deficient and NER–deficient mice showed no evidence for neuronal degeneration apart from p53 activation in sporadic (Csa−/−, Csb−/−) or highly sporadic (Xpa−/−, Xpc−/−) neurons and astrocytes. To examine to what extent overlap occurs between both repair systems, we generated TCR–deficient mice with selective inactivation of NER in postnatal neurons. These mice develop dramatic age-related cumulative neuronal loss indicating DNA damage substrate overlap and synergism between TCR and NER pathways in neurons, and they uncover the occurrence of spontaneous DNA injury that may trigger neuronal degeneration. We propose that, while Csa−/− and Csb−/− TCR–deficient mice represent powerful animal models to study the mechanisms underlying myelin abnormalities

  18. DNA repair: Dynamic defenders against cancer and aging

    Energy Technology Data Exchange (ETDEWEB)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    You probably weren't thinking about your body's cellular DNA repair systems the last time you sat on the beach in the bright sunshine. Fortunately, however, while you were subjecting your DNA to the harmful effects of ultraviolet light, your cells were busy repairing the damage. The idea that our genetic material could be damaged by the sun was not appreciated in the early days of molecular biology. When Watson and Crick discovered the structure of DNA in 1953 [1], it was assumed that DNA is fundamentally stable since it carries the blueprint of life. However, over 50 years of research have revealed that our DNA is under constant assault by sunlight, oxygen, radiation, various chemicals, and even our own cellular processes. Cleverly, evolution has provided our cells with a diverse set of tools to repair the damage that Mother Nature causes. DNA repair processes restore the normal nucleotide sequence and DNA structure of the genome after damage [2]. These responses are highly varied and exquisitely regulated. DNA repair mechanisms are traditionally characterized by the type of damage repaired. A large variety of chemical modifications can alter normal DNA bases and either lead to mutations or block transcription if not repaired, and three distinct pathways exist to remove base damage. Base excision repair (BER) corrects DNA base alterations that do not distort the overall structure of the DNA helix such as bases damaged by oxidation resulting from normal cellular metabolism. While BER removes single damaged bases, nucleotide excision repair (NER) removes short segments of nucleotides (called oligonucleotides) containing damaged bases. NER responds to any alteration that distorts the DNA helix and is the mechanism responsible for repairing bulky base damage caused by carcinogenic chemicals such as benzo [a]pyrene (found in cigarette smoke and automobile exhaust) as well as covalent linkages between adjacent pyrimidine bases resulting from the ultraviolet

  19. Base excision repair dysfunction in a subgroup of patients with myelodysplastic syndrome.

    Science.gov (United States)

    Jankowska, A M; Gondek, L P; Szpurka, H; Nearman, Z P; Tiu, R V; Maciejewski, J P

    2008-03-01

    In myelodysplastic syndromes (MDS) increased chromosomal breaks point toward defects in DNA repair machinery including base excision repair (BER) pathway involved in handling of oxidative DNA damage. We investigated whether defects in this pathway can be found in MDS. Elevated levels of 8-oxoguanine (8-OG) were found in a significant proportion of MDS patients, indicating increased oxidative DNA damage or defective handling of oxidative load. In a distinct subgroup of patients, increased 8-OG content was associated with increased hOGG1 mRNA expression and activity. In some patients, increased numbers of abasic sites (AP sites) correlated with low levels of POLbeta. To further investigate the nature of this defect, we examined genetic lesions potentially explaining accumulation of 8-OG and AP sites. We genotyped a large cohort of MDS patients and found a correlation between increased oxidative damage and the presence of the hOGG1-Cys326 allele suggesting inadequate compensatory feedback. Overall, this hOGG1 variant was more frequent in MDS, particularly in advanced forms, as compared to controls. In summary, we demonstrated that BER dysfunction in some MDS patients may be responsible for the increased 8-OG incorporation and explains one aspect of the propensity to chromosomal breaks in MDS but other mechanisms may also be involved.

  20. Decreased nucleotide excision repair in steatotic livers associates with myeloperoxidase-immunoreactivity

    Energy Technology Data Exchange (ETDEWEB)

    Schults, Marten A.; Nagle, Peter W. [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Rensen, Sander S. [Department of Surgery, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Godschalk, Roger W. [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Munnia, Armelle; Peluso, Marco [Cancer Risk Factor Branch, ISPO Cancer Prevention and Research Institute, Via Cosimo il Vecchio 2, 50139 Florence (Italy); Claessen, Sandra M. [Department of Toxicogenomics, GROW-School for Oncology and Developmental Biology, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Greve, Jan W. [Department of Surgery, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Driessen, Ann [Department of Pathology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Verdam, Froukje J.; Buurman, Wim A. [Department of Surgery, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Schooten, Frederik J. van [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Chiu, Roland K., E-mail: r.k.chiu@med.umcg.nl [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands)

    2012-08-01

    Chronic inflammation is characterized by the influx of neutrophils and is associated with an increased production of reactive oxygen species that can damage DNA. Oxidative DNA damage is generally thought to be involved in the increased risk of cancer in inflamed tissues. We previously demonstrated that activated neutrophil mediated oxidative stress results in a reduction in nucleotide excision repair (NER) capacity, which could further enhance mutagenesis. Inflammation and oxidative stress are critical factors in the progression of nonalcoholic fatty liver disease that is linked with enhanced liver cancer risk. In this report, we therefore evaluated the role of neutrophils and the associated oxidative stress in damage recognition and DNA repair in steatotic livers of 35 severely obese subjects with either nonalcoholic steatohepatitis (NASH) (n = 17) or steatosis alone (n = 18). The neutrophilic influx in liver was assessed by myeloperoxidase (MPO) staining and the amount of oxidative DNA damage by measuring M{sub 1}dG adducts. No differences in M{sub 1}dG adduct levels were observed between patients with or without NASH and also not between individuals with high or low MPO immunoreactivity. However, we found that high expression of MPO in the liver, irrespective of disease status, reduced the damage recognition capacity as determined by staining for histone 2AX phosphorylation ({gamma}H2AX). This reduction in {gamma}H2AX formation in individuals with high MPO immunoreactivity was paralleled by a significant decrease in NER capacity as assessed by a functional repair assay, and was not related to cell proliferation. Thus, the observed reduction in NER capacity upon hepatic inflammation is associated with and may be a consequence of reduced damage recognition. These findings suggest a novel mechanism of liver cancer development in patients with nonalcoholic fatty liver disease.

  1. Mechanisms of interstrand DNA crosslink repair and human disorders.

    Science.gov (United States)

    Hashimoto, Satoru; Anai, Hirofumi; Hanada, Katsuhiro

    2016-01-01

    Interstrand DNA crosslinks (ICLs) are the link between Watson-Crick strands of DNAs with the covalent bond and prevent separation of DNA strands. Since the ICL lesion affects both strands of the DNA, the ICL repair is not simple. So far, nucleotide excision repair (NER), structure-specific endonucleases, translesion DNA synthesis (TLS), homologous recombination (HR), and factors responsible for Fanconi anemia (FA) are identified to be involved in ICL repair. Since the presence of ICL lesions causes severe defects in transcription and DNA replication, mutations in these DNA repair pathways give rise to a various hereditary disorders. NER plays an important role for the ICL recognition and removal in quiescent cells, and defects of NER causes congential progeria syndrome, such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. On the other hand, the ICL repair in S phase requires more complicated orchestration of multiple factors, including structure-specific endonucleases, and TLS, and HR. Disturbed this ICL repair orchestration in S phase causes genome instability resulting a cancer prone disease, Fanconi anemia. So far more than 30 factors in ICL repair have already identified. Recently, a new factor, UHRF1, was discovered as a sensor of ICLs. In addition to this, numbers of nucleases that are involved in the first incision, also called unhooking, of ICL lesions have also been identified. Here we summarize the recent studies of ICL associated disorders and repair mechanism, with emphasis in the first incision of ICLs.

  2. The role of Cockayne syndrome group A (CSA) protein in transcription-coupled nucleotide excision repair.

    Science.gov (United States)

    Saijo, Masafumi

    2013-01-01

    Nucleotide excision repair (NER) removes a variety of DNA lesions, including ultraviolet-induced cyclobutane pyrimidine dimers. NER comprises two subpathways: transcription-coupled NER (TC-NER) and global genome NER. TC-NER efficiently removes lesions from the transcribed strands of active genes. Mutations in Cockayne syndrome groups A and B genes (CSA and CSB) result in defective TC-NER. In mammalian cells, TC-NER is presumably initiated by the arrest of RNA polymerase II at a lesion on the transcribed strand of an active gene, but the molecular mechanism underlying TC-NER remains unclear. The CSA protein has seven WD40 repeat motifs and beta-propeller architecture. A protein complex consisting of CSA, DDB1, cullin 4A, and Roc1 exhibits ubiquitin ligase activity. The role of CSA protein in TC-NER is described in this review. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Role of Base Excision Repair (BER) in Transcription-associated Mutagenesis of Nutritionally Stressed Nongrowing Bacillus subtilis Cell Subpopulations.

    Science.gov (United States)

    Ambriz-Aviña, Verónica; Yasbin, Ronald E; Robleto, Eduardo A; Pedraza-Reyes, Mario

    2016-11-01

    Compelling evidence points to transcriptional processes as important factors contributing to stationary-phase associated mutagenesis. However, it has not been documented whether or not base excision repair mechanisms play a role in modulating mutagenesis under conditions of transcriptional derepression. Here, we report on a flow cytometry-based methodology that employs a fluorescent reporter system to measure at single-cell level, the occurrence of transcription-associated mutations in nutritionally stressed B. subtilis cultures. Using this approach, we demonstrate that (i) high levels of transcription correlates with augmented mutation frequency, and (ii) mutation frequency is enhanced in nongrowing population cells deficient for deaminated (Ung, YwqL) and oxidized guanine (GO) excision repair, strongly suggesting that accumulation of spontaneous DNA lesions enhance transcription-associated mutagenesis.

  4. DNA Repair Dysfunction and Neurodegeneration: Lessons From Rare Pediatric Disorders.

    Science.gov (United States)

    Shabbir, Syed H

    2016-03-01

    Nucleotide excision repair disorders display a wide range of clinical syndromes and presentations, all associated at the molecular level by dysfunction of genes participating in the nucleotide excision repair pathway. Genotype-phenotype relationships are remarkably complex and not well understood. This article outlines neurodegenerative symptoms seen in nucleotide excision repair disorders and explores the role that nucleotide excision repair dysfunction can play in the pathogenesis of chronic neurodegenerative diseases. © The Author(s) 2015.

  5. Mitochondrial base excision repair in mouse synaptosomes during normal aging and in a model of Alzheimer's disease

    DEFF Research Database (Denmark)

    Diaz, Ricardo Gredilla; Weissman, Lior; Yang, Jenq-Lin

    2010-01-01

    suggest that the age-related reduction in BER capacity in the synaptosomal fraction might contribute to mitochondrial and synaptic dysfunction during aging. The development of AD-like pathology in the 3xTgAD mouse model was, however, not associated with deficiencies of the BER mechanisms......Brain aging is associated with synaptic decline and synaptic function is highly dependent on mitochondria. Increased levels of oxidative DNA base damage and accumulation of mitochondrial DNA (mtDNA) mutations or deletions lead to mitochondrial dysfunction, playing an important role in the aging...... process and the pathogenesis of several neurodegenerative diseases. Here we have investigated the repair of oxidative base damage, in synaptosomes of mouse brain during normal aging and in an AD model. During normal aging, a reduction in the base excision repair (BER) capacity was observed...

  6. Effect of Amalaki rasayana on DNA damage and repair in randomized aged human individuals.

    Science.gov (United States)

    Vishwanatha, Udupi; Guruprasad, Kanive P; Gopinath, Puthiya M; Acharya, Raviraj V; Prasanna, Bokkasa V; Nayak, Jayakrishna; Ganesh, Rajeshwari; Rao, Jayalaxmi; Shree, Rashmi; Anchan, Suchitra; Raghu, Kothanahalli S; Joshi, Manjunath B; Paladhi, Puspendu; Varier, Panniampilly M; Muraleedharan, Kollath; Muraleedharan, Thrikovil S; Satyamoorthy, Kapaettu

    2016-09-15

    Preparations from Phyllanthus emblica called Amalaki rasayana is used in the Indian traditional medicinal system of Ayurveda for healthy living in elderly. The biological effects and its mechanisms are not fully understood. Since the diminishing DNA repair is the hallmark of ageing, we tested the influence of Amalaki rasayana on recognized DNA repair activities in healthy aged individuals. Amalaki rasayana was prepared fresh and healthy aged randomized human volunteers were administrated with either rasayana or placebo for 45 days strictly as per the traditional text. The DNA repair was analyzed in peripheral blood mononuclear cells before and after rasayana administration and after 45 days post-rasayana treatment regimen. UVC-induced DNA strand break repair (DSBR) based on extent of DNA unwinding by fluorometric analysis, nucleotide excision repair (NER) by flow cytometry and constitutive base excision repair (BER) by gap filling method were analyzed. Amalaki rasayana administration stably maintained/enhanced the DSBR in aged individuals. There were no adverse side effects. Further, subjects with different body mass index showed differential DNA strand break repair capacity. No change in unscheduled DNA synthesis during NER and BER was observed between the groups. Intake of Amalaki rasayana by aged individuals showed stable maintenance of DNA strand break repair without toxic effects. However, there was no change in nucleotide and base excision repair activities. Results warrant further studies on the effects of Amalaki rasayana on DSBR activities. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Triple Negative Breast Cancers Have a Reduced Expression of DNA Repair Genes

    Science.gov (United States)

    Andreis, Daniele; Bertoni, Ramona; Giardini, Roberto; Fox, Stephen B.; Broggini, Massimo; Bottini, Alberto; Zanoni, Vanessa; Bazzola, Letizia; Foroni, Chiara; Generali, Daniele; Damia, Giovanna

    2013-01-01

    DNA repair is a key determinant in the cellular response to therapy and tumor repair status could play an important role in tailoring patient therapy. Our goal was to evaluate the mRNA of 13 genes involved in different DNA repair pathways (base excision, nucleotide excision, homologous recombination, and Fanconi anemia) in paraffin embedded samples of triple negative breast cancer (TNBC) compared to luminal A breast cancer (LABC). Most of the genes involved in nucleotide excision repair and Fanconi Anemia pathways, and CHK1 gene were significantly less expressed in TNBC than in LABC. PARP1 levels were higher in TNBC than in LABC. In univariate analysis high level of FANCA correlated with an increased overall survival and event free survival in TNBC; however multivariate analyses using Cox regression did not confirm FANCA as independent prognostic factor. These data support the evidence that TNBCs compared to LABCs harbour DNA repair defects. PMID:23825533

  8. The cutting edges in DNA repair, licensing, and fidelity: DNA and RNA repair nucleases sculpt DNA to measure twice, cut once.

    Science.gov (United States)

    Tsutakawa, Susan E; Lafrance-Vanasse, Julien; Tainer, John A

    2014-07-01

    To avoid genome instability, DNA repair nucleases must precisely target the correct damaged substrate before they are licensed to incise. Damage identification is a challenge for all DNA damage response proteins, but especially for nucleases that cut the DNA and necessarily create a cleaved DNA repair intermediate, likely more toxic than the initial damage. How do these enzymes achieve exquisite specificity without specific sequence recognition or, in some cases, without a non-canonical DNA nucleotide? Combined structural, biochemical, and biological analyses of repair nucleases are revealing their molecular tools for damage verification and safeguarding against inadvertent incision. Surprisingly, these enzymes also often act on RNA, which deserves more attention. Here, we review protein-DNA structures for nucleases involved in replication, base excision repair, mismatch repair, double strand break repair (DSBR), and telomere maintenance: apurinic/apyrimidinic endonuclease 1 (APE1), Endonuclease IV (Nfo), tyrosyl DNA phosphodiesterase (TDP2), UV Damage endonuclease (UVDE), very short patch repair endonuclease (Vsr), Endonuclease V (Nfi), Flap endonuclease 1 (FEN1), exonuclease 1 (Exo1), RNase T and Meiotic recombination 11 (Mre11). DNA and RNA structure-sensing nucleases are essential to life with roles in DNA replication, repair, and transcription. Increasingly these enzymes are employed as advanced tools for synthetic biology and as targets for cancer prognosis and interventions. Currently their structural biology is most fully illuminated for DNA repair, which is also essential to life. How DNA repair enzymes maintain genome fidelity is one of the DNA double helix secrets missed by James Watson and Francis Crick, that is only now being illuminated though structural biology and mutational analyses. Structures reveal motifs for repair nucleases and mechanisms whereby these enzymes follow the old carpenter adage: measure twice, cut once. Furthermore, to measure

  9. DNA repair in the trinucleotide repeat disorders.

    Science.gov (United States)

    Jones, Lesley; Houlden, Henry; Tabrizi, Sarah J

    2017-01-01

    Inherited diseases caused by unstable repeated DNA sequences are rare, but together represent a substantial cause of morbidity. Trinucleotide repeat disorders are severe, usually life-shortening, neurological disorders caused by nucleotide expansions, and most have no disease-modifying treatments. Longer repeat expansions are associated with genetic anticipation (ie, earlier disease onset in successive generations), although the differences in age at onset are not entirely accounted for by repeat length. Such phenotypic variation within disorders implies the existence of additional modifying factors in pathways that can potentially be modulated to treat disease. A genome-wide association study detected genetic modifiers of age at onset in Huntington's disease. Similar findings were seen in the spinocerebellar ataxias, indicating an association between DNA damage-response and repair pathways and the age at onset of disease. These studies also suggest that a common genetic mechanism modulates age at onset across polyglutamine diseases and could extend to other repeat expansion disorders. Genetic defects in DNA repair underlie other neurodegenerative disorders (eg, ataxia-telangiectasia), and DNA double-strand breaks are crucial to the modulation of early gene expression, which provides a mechanistic link between DNA repair and neurodegeneration. Mismatch and base-excision repair are important in the somatic expansion of repeated sequences in mouse models of trinucleotide repeat disorders, and somatic expansion of the expanded CAG tract in HTT correlates with age at onset of Huntington's disease and other trinucleotide repeat disorders. WHERE NEXT?: To understand the common genetic architecture of trinucleotide repeat disorders and any further genetic susceptibilities in individual disorders, genetic analysis with increased numbers of variants and sample sizes is needed, followed by sequencing approaches to define the phenotype-modifying variants. The findings must

  10. Nucleotide excision repair: ERCC1 and TFIIH complexes

    NARCIS (Netherlands)

    A.J. van Vuuren (Hanneke)

    1995-01-01

    textabstractDNA is the carrier of genetic information in living organisms. The information stored in the nucleotide sequence of DNA is transmitted to the offspring by generating identical copies of the parental DNA molecules. Damage in DNA can cause loss of genetic information. Nevertheless, the DNA

  11. Recognition and repair of the cyclobutane thymine dimer, a major cause of skin cancers, by the human excision nuclease.

    Science.gov (United States)

    Reardon, Joyce T; Sancar, Aziz

    2003-10-15

    The cyclobutane thymine dimer is the major DNA lesion induced in human skin by sunlight and is a primary cause of skin cancer, the most prevalent form of cancer in the Northern Hemisphere. In humans, the only known cellular repair mechanism for eliminating the dimer from DNA is nucleotide excision repair. Yet the mechanism by which the dimer is recognized and removed by this repair system is not known. Here we demonstrate that the six-factor human excision nuclease recognizes and removes the dimer at a rate consistent with the in vivo rate of removal of this lesion, even though none of the six factors alone is capable of efficiently discriminating the dimer from undamaged DNA. We propose a recognition mechanism by which the low-specificity recognition factors, RPA, XPA, and XPC, act in a cooperative manner to locate the lesion and, aided by the kinetic proofreading provided by TFIIH, form a high-specificity complex at the damage site that initiates removal of thymine dimers at a physiologically relevant rate and specificity.

  12. The endoperoxide ascaridol shows strong differential cytotoxicity in nucleotide excision repair-deficient cells

    Energy Technology Data Exchange (ETDEWEB)

    Abbasi, Rashda [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Efferth, Thomas [Institute of Pharmacy und Biochemistry, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany); Kuhmann, Christine [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Opatz, Till [Institute of Organic Chemistry, Johannes Gutenberg University, Duesbergweg 10-14, 55128 Mainz (Germany); Hao, Xiaojiang [Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204 (China); Popanda, Odilia, E-mail: o.popanda@dkfz.de [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Schmezer, Peter [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2012-03-15

    Targeting synthetic lethality in DNA repair pathways has become a promising anti-cancer strategy. However little is known about such interactions with regard to the nucleotide excision repair (NER) pathway. Therefore, cell lines with a defect in the NER genes ERCC6 or XPC and their normal counterparts were screened with 53 chemically defined phytochemicals isolated from plants used in traditional Chinese medicine for differential cytotoxic effects. The screening revealed 12 drugs that killed NER-deficient cells more efficiently than proficient cells. Five drugs were further analyzed for IC{sub 50} values, effects on cell cycle distribution, and induction of DNA damage. Ascaridol was the most effective compound with a difference of > 1000-fold in resistance between normal and NER-deficient cells (IC{sub 50} values for cells with deficiency in ERCC6: 0.15 μM, XPC: 0.18 μM, and normal cells: > 180 μM). NER-deficiency combined with ascaridol treatment led to G2/M-phase arrest, an increased percentage of subG1 cells, and a substantially higher DNA damage induction. These results were confirmed in a second set of NER-deficient and -proficient cell lines with isogenic background. Finally, ascaridol was characterized for its ability to generate oxidative DNA damage. The drug led to a dose-dependent increase in intracellular levels of reactive oxygen species at cytotoxic concentrations, but only NER-deficient cells showed a strongly induced amount of 8-oxodG sites. In summary, ascaridol is a cytotoxic and DNA-damaging compound which generates intracellular reactive oxidative intermediates and which selectively affects NER-deficient cells. This could provide a new therapeutic option to treat cancer cells with mutations in NER genes. -- Highlights: ► Thousand-fold higher Ascaridol activity in NER-deficient versus proficient cells. ► Impaired repair of Ascaridol-induced oxidative DNA damage in NER-deficient cells. ► Selective activity of Ascaridol opens new therapy

  13. First reported patient with human ERCC1 deficiency has cerebro-oculo-facio- skeletal syndrome with a mild defect in nucleotide excision repair and severe developmental failure

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); A. Raams (Anja); M.C. Silengo; N. Wijgers (Nils); L.J. Niedernhofer (Laura); A.R. Robinson (Andria Rasile); G. Giglia-Mari (Giuseppina); D. Hoogstraten (Deborah); W.J. Kleijer (Wim); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2007-01-01

    textabstractNucleotide excision repair (NER) is a genome caretaker mechanism responsible for removing helix-distorting DNA lesions, most notably ultraviolet photodimers. Inherited defects in NER result in profound photosensitivity and the cancer-prone syndrome xeroderma pigmentosum (XP) or two

  14. DNA repair deficiency in neurodegeneration

    DEFF Research Database (Denmark)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2011-01-01

    causing Huntington's disease. Single-strand breaks are common DNA lesions and are associated with the neurodegenerative diseases, ataxia-oculomotor apraxia-1 and spinocerebellar ataxia with axonal neuropathy-1. DNA double-strand breaks are toxic lesions and two main pathways exist for their repair......: homologous recombination and non-homologous end-joining. Ataxia telangiectasia and related disorders with defects in these pathways illustrate that such defects can lead to early childhood neurodegeneration. Aging is a risk factor for neurodegeneration and accumulation of oxidative mitochondrial DNA damage...

  15. Drugging the Cancers Addicted to DNA Repair.

    Science.gov (United States)

    Nickoloff, Jac A; Jones, Dennie; Lee, Suk-Hee; Williamson, Elizabeth A; Hromas, Robert

    2017-11-01

    Defects in DNA repair can result in oncogenic genomic instability. Cancers occurring from DNA repair defects were once thought to be limited to rare inherited mutations (such as BRCA1 or 2). It now appears that a clinically significant fraction of cancers have acquired DNA repair defects. DNA repair pathways operate in related networks, and cancers arising from loss of one DNA repair component typically become addicted to other repair pathways to survive and proliferate. Drug inhibition of the rescue repair pathway prevents the repair-deficient cancer cell from replicating, causing apoptosis (termed synthetic lethality). However, the selective pressure of inhibiting the rescue repair pathway can generate further mutations that confer resistance to the synthetic lethal drugs. Many such drugs currently in clinical use inhibit PARP1, a repair component to which cancers arising from inherited BRCA1 or 2 mutations become addicted. It is now clear that drugs inducing synthetic lethality may also be therapeutic in cancers with acquired DNA repair defects, which would markedly broaden their applicability beyond treatment of cancers with inherited DNA repair defects. Here we review how each DNA repair pathway can be attacked therapeutically and evaluate DNA repair components as potential drug targets to induce synthetic lethality. Clinical use of drugs targeting DNA repair will markedly increase when functional and genetic loss of repair components are consistently identified. In addition, future therapies will exploit artificial synthetic lethality, where complementary DNA repair pathways are targeted simultaneously in cancers without DNA repair defects. © The Author 2017. Published by Oxford University Press.

  16. Purification of mammalian DNA repair protein XRCC1

    Energy Technology Data Exchange (ETDEWEB)

    Chen, I. [Univ. of California, Berkeley, CA (United States)

    1995-11-01

    Malfunctioning DNA repair systems lead to cancer mutations, and cell death. XRCC1 (X-ray Repair Cross Complementing) is a human DNA repair gene that has been found to fully correct the x-ray repair defect in Chinese hamster ovary (CHO) cell mutant EM9. The corresponding protein (XRCC1) encoded by this gene has been linked to a DNA repair pathway known as base excision repair, and affects the activity of DNA ligase III. Previously, an XRCC1 cDNA minigene (consisting of the uninterrupted coding sequence for XRCC1 protein followed by a decahistidine tag) was constructed and cloned into vector pET-16b for the purpose of: (1) overproduction of XRCC1 in both prokaryotic and eukaryotic cells; and (2) to facilitate rapid purification of XRCC1 from these systems. A vector is basically a DNA carrier that allows recombinant protein to be cloned and overexpressed in host cells. In this study, XRCC1 protein was overexpressed in E. coli and purified by immobilized metal affinity chromatography. Currently, the XRCC1 minigene is being inserted into a new vector [pET-26b(+)] in hopes to increase overexpression and improve purification. Once purified XRCC1 can be crystallized for structural studies, or studied in vitro for its biological function.

  17. DNA-Protein Crosslink Proteolysis Repair.

    Science.gov (United States)

    Vaz, Bruno; Popovic, Marta; Ramadan, Kristijan

    2017-06-01

    Proteins that are covalently bound to DNA constitute a specific type of DNA lesion known as DNA-protein crosslinks (DPCs). DPCs represent physical obstacles to the progression of DNA replication. If not repaired, DPCs cause stalling of DNA replication forks that consequently leads to DNA double-strand breaks, the most cytotoxic DNA lesion. Although DPCs are common DNA lesions, the mechanism of DPC repair was unclear until now. Recent work unveiled that DPC repair is orchestrated by proteolysis performed by two distinct metalloproteases, SPARTAN in metazoans and Wss1 in yeast. This review summarizes recent discoveries on two proteases in DNA replication-coupled DPC repair and establishes DPC proteolysis repair as a separate DNA repair pathway for genome stability and protection from accelerated aging and cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. DNA repair: a changing geography? (1964-2008).

    Science.gov (United States)

    Maisonobe, Marion; Giglia-Mari, Giuseppina; Eckert, Denis

    2013-07-01

    This article aims to explain the current state of DNA Repair studies' global geography by focusing on the genesis of the community. Bibliometric data is used to localize scientific activities related to DNA Repair at the city level. The keyword "DNA Repair" was introduced first by American scientists. It started to spread after 1964 that is to say, after P. Howard-Flanders (Yale University), P. Hanawalt (Stanford University) and R. Setlow (Oak Ridge Laboratories) found evidence for Excision Repair mechanisms. It was the first stage in the emergence of an autonomous scientific community. In this article, we will try to assess to what extent the geo-history of this scientific field is determinant in understanding its current geography. In order to do so, we will localize the places where the first "DNA Repair" publications were signed fifty years ago and the following spatial diffusion process, which led to the current geography of the field. Then, we will focus on the evolution of the research activity of "early entrants" in relation to the activity of "latecomers". This article is an opportunity to share with DNA Repair scientists some research results of a dynamic field in Science studies: spatial scientometrics. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. DNA Repair Variants, Indoor Tanning and Risk of Melanoma

    Science.gov (United States)

    Torres, Salina M.; Luo, Li; Lilyquist, Jenna; Stidley, Christine A; Flores, Kristina; White, Kirsten A. M.; Erdei, Esther; Gonzales, Melissa; Paine, Susan; Vogel, Rachel Isaksson; Lazovich, DeAnn; Berwick, Marianne

    2013-01-01

    Summary Although ultraviolet radiation (UV) exposure from indoor tanning has been linked to an increased risk of melanoma, the role of DNA repair genes in this process is unknown. We evaluated the association of 92 single nucleotide polymorphisms (SNPs) in 20 DNA repair genes with the risk of melanoma and indoor tanning among 929 melanoma patients and 817 controls from the Minnesota Skin Health Study. Significant associations with melanoma risk were identified for SNPs in ERCC4, ERCC6, RFC1, XPC, MGMT, and FBRSL1 genes; with a cut-off of p<0.05. ERCC6 and FBRSL1 gene variants and haplotypes interacted with indoor tanning. However, none of the 92 SNPs tested met the correction criteria for multiple comparisons. This study, based on an a priori interest in investigating the role of DNA repair capacity using variants in base excision and nucleotide excision repair, identified several genes that may play a role in resolving UV-induced DNA damage. PMID:23659246

  20. The recombination protein RAD52 cooperates with the excision repair protein OGG1 for the repair of oxidative lesions in mammalian cells

    DEFF Research Database (Denmark)

    de Souza-Pinto, Nadja C; Maynard, Scott; Hashiguchi, Kazunari

    2009-01-01

    Oxidized bases are common types of DNA modifications. Their accumulation in the genome is linked to aging and degenerative diseases. These modifications are commonly repaired by the base excision repair (BER) pathway. Oxoguanine DNA glycosylase (OGG1) initiates BER of oxidized purine bases. A small...... activities and RAD52 stimulates OGG1 incision activity, likely increasing its turnover rate. RAD52 colocalizes with OGG1 after oxidative stress to cultured cells, but not after the direct induction of double-strand breaks by ionizing radiation. Human cells depleted of RAD52 via small interfering RNA...... knockdown, and mouse cells lacking the protein via gene knockout showed increased sensitivity to oxidative stress. Moreover, cells depleted of RAD52 show higher accumulation of oxidized bases in their genome than cells with normal levels of RAD52. Our results indicate that RAD52 cooperates with OGG1...

  1. Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease.

    NARCIS (Netherlands)

    A.M. Sijbers (Anneke); W.L. de Laat (Wouter); R.A. Ariza (Rafael); M. Biggerstaff (Maureen); Y-F. Wei; J.G. Moggs (Jonathan); K.C. Carter (Kenneth); B.K. Shell (Brenda); E. Evans (Elizabeth); M.C. de Jong (Mariska); S. Rademakers (Suzanne); J.D. de Rooij (Johan); N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan); R.D. Wood (Richard)

    1996-01-01

    textabstractNucleotide excision repair, which is defective in xeroderma pigmentosum (XP), involves incision of a DNA strand on each side of a lesion. We isolated a human gene homologous to yeast Rad1 and found that it corrects the repair defects of XP group F as well as rodent groups 4 and 11.

  2. DNA repair activity in fish and interest in ecotoxicology: a review.

    Science.gov (United States)

    Kienzler, Aude; Bony, Sylvie; Devaux, Alain

    2013-06-15

    The knowledge of DNA repair in a target species is of first importance as it is the primary line of defense against genotoxicants, and a better knowledge of DNA repair capacity in fish could help to interpret genotoxicity data and/or assist in the choice of target species, developmental stage and tissues to focus on, both for environmental biomonitoring studies and DNA repair testing. This review focuses in a first part on what is presently known on a mechanistic basis, about the various DNA repair systems in fish, in vivo and in established cell lines. Data on base excision repair (BER), direct reversal with O⁶-alkylguanine transferase and double strand breaks repair, although rather scarce, are being reviewed, as well as nucleotide excision repair (NER) and photoreactivation repair (PER), which are by far the most studied repair mechanisms in fish. Most of these repair mechanisms seem to be strongly species and tissue dependent; they also depend on the developmental stage of the organisms. BER is efficient in vivo, although no data has been found on in vitro models. NER activity is quite low or even inexistent depending on the studies; however this lack is partly compensated by a strong PER activity, especially in early developmental stage. In a second part, a survey of the ecotoxicological studies integrating DNA repair as a parameter responding to single or mixture of contaminant is realized. Three main approaches are being used: the measurement of DNA repair gene expression after exposure, although it has not yet been clearly established whether gene expression is indicative of repair capacity; the monitoring of DNA damage removal by following DNA repair kinetics; and the modulation of DNA repair activity following exposure in situ, in order to assess the impact of exposure history on DNA repair capacity. Since all DNA repair processes are possible targets for environmental pollutants, we can also wonder at which extent such a modulation of repair capacities

  3. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  4. A Mathematical Model for DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Philip S. Crooke

    2010-01-01

    Full Text Available In cells, DNA repair has to keep up with DNA damage to maintain the integrity of the genome and prevent mutagenesis and carcinogenesis. While the importance of both DNA damage and repair is clear, the impact of imbalances between both processes has not been studied. In this paper, we created a combined mathematical model for the formation of DNA adducts from oxidative estrogen metabolism followed by base excision repair (BER of these adducts. The model encompasses a set of differential equations representing the sequence of enzymatic reactions in both damage and repair pathways. By combining both pathways, we can simulate the overall process by starting from a given time-dependent concentration of 17β-estradiol (E2 and 2′-deoxyguanosine, determine the extent of adduct formation and the correction by BER required to preserve the integrity of DNA. The model allows us to examine the effect of phenotypic and genotypic factors such as different concentrations of estrogen and variant enzyme haplotypes on the formation and repair of DNA adducts.

  5. The 2015 Nobel Prize in Chemistry The Discovery of Essential Mechanisms that Repair DNA Damage.

    Science.gov (United States)

    Lindahl, Tomas; Modrich, Paul; Sancar, Aziz

    2016-01-01

    The Royal Swedish Academy awarded the Nobel Prize in Chemistry for 2015 to Tomas Lindahl, Paul Modrich and Aziz Sancar for their discoveries in fundamental mechanisms of DNA repair. This pioneering research described three different essential pathways that correct DNA damage, safeguard the integrity of the genetic code to ensure its accurate replication through generations, and allow proper cell division. Working independently of each other, Tomas Lindahl, Paul Modrich and Aziz Sancar delineated the mechanisms of base excision repair, mismatch repair and nucleotide excision repair, respectively. These breakthroughs challenged and dismissed the early view that the DNA molecule was very stable, paving the way for the discovery of human hereditary diseases associated with distinct DNA repair deficiencies and a susceptibility to cancer. It also brought a deeper understanding of cancer as well as neurodegenerative or neurological diseases, and let to novel strategies to treat cancer.

  6. Small margin (2 mm) excision of peri-ocular basal cell carcinoma with delayed repair.

    Science.gov (United States)

    David, D B.; Gimblett, M L.; Potts, M J.; Harrad, R A.

    1999-03-01

    Successful surgical treatment of peri-ocular basal cell carcinomas requires complete excision. Mohs' micrographic surgery achieves this, but is not readily available in all hospitals. The standard 3-4 mm margin does not guarantee complete excision and histology is often not available until after a repair has been undertaken. The 3-4 mm margin has evolved to deal with all forms of BCC. In our opinion, this margin is unnecessarily large for nodular/ulcerative BCC. We report our interim results of excision of localised BCCs using a 2 mm margin in conjunction with a delayed repair following confirmation of histological clearance. Thirty-one patients were treated in this manner; there have been no recurrences after an average follow-up period of 36 months (range 24-57 months).

  7. Histone H3 Lys79 methylation is required for efficient nucleotide excision repair in a silenced locus of Saccharomyces cerevisiae

    Science.gov (United States)

    Chaudhuri, Shubho; Wyrick, John J.; Smerdon, Michael J.

    2009-01-01

    Methylation of specific histone lysine residues regulates gene expression and heterochromatin function, but little is known about its role in DNA repair. To examine how changes in conserved methylated residues of histone H3 affect nucleotide excision repair (NER), viable H3K4R and H3K79R mutants were generated in Saccharomyces cerevisiae. These mutants show decreased UV survival and impaired NER at the transcriptionally silent HML locus, while maintaining normal NER in the constitutively expressed RPB2 gene and transcriptionally repressed, nucleosome loaded GAL10 gene. Moreover, the HML chromatin in these mutants has reduced accessibility to Micrococcal nuclease (MNase). Importantly, chromatin immunoprecipitation analysis demonstrates there is enhanced recruitment of the Sir complex at the HML locus of these mutants, and deletion of the SIR2 or SIR3 genes restores the MNase accessibility and DNA repair efficiency at this locus. Furthermore, following UV irradiation expression of NER genes in these mutants remains at wild type levels, with the exception of RAD16 which decreases by more than 2-fold. These results indicate that impaired NER occurs in the silenced chromatin of H3K79R and H3K4,79R mutants as a result of increased binding of Sir complexes, which may reduce DNA lesion accessibility to repair enzymes. PMID:19155276

  8. The mitochondrial transcription factor A functions in mitochondrial base excision repair

    DEFF Research Database (Denmark)

    Canugovi, Chandrika; Maynard, Scott; Bayne, Anne-Cécile V

    2010-01-01

    Mitochondrial transcription factor A (TFAM) is an essential component of mitochondrial nucleoids. TFAM plays an important role in mitochondrial transcription and replication. TFAM has been previously reported to inhibit nucleotide excision repair (NER) in vitro but NER has not yet been detected i...

  9. Nucleotide excision repair, mismatch repair, and R-loops modulate convergent transcription-induced cell death and repeat instability.

    Directory of Open Access Journals (Sweden)

    Yunfu Lin

    Full Text Available Expansion of CAG•CTG tracts located in specific genes is responsible for 13 human neurodegenerative disorders, the pathogenic mechanisms of which are not yet well defined. These disease genes are ubiquitously expressed in human tissues, and transcription has been identified as one of the major pathways destabilizing the repeats. Transcription-induced repeat instability depends on transcription-coupled nucleotide excision repair (TC-NER, the mismatch repair (MMR recognition component MSH2/MSH3, and RNA/DNA hybrids (R-loops. Recently, we reported that simultaneous sense and antisense transcription-convergent transcription-through a CAG repeat not only promotes repeat instability, but also induces a cell stress response, which arrests the cell cycle and eventually leads to massive cell death via apoptosis. Here, we use siRNA knockdowns to investigate whether NER, MMR, and R-loops also modulate convergent-transcription-induced cell death and repeat instability. We find that siRNA-mediated depletion of TC-NER components increases convergent transcription-induced cell death, as does the simultaneous depletion of RNase H1 and RNase H2A. In contrast, depletion of MSH2 decreases cell death. These results identify TC-NER, MMR recognition, and R-loops as modulators of convergent transcription-induced cell death and shed light on the molecular mechanism involved. We also find that the TC-NER pathway, MSH2, and R-loops modulate convergent transcription-induced repeat instability. These observations link the mechanisms of convergent transcription-induced repeat instability and convergent transcription-induced cell death, suggesting that a common structure may trigger both outcomes.

  10. DNA repair in neurons: So if they don't divide what's to repair?

    Energy Technology Data Exchange (ETDEWEB)

    Fishel, Melissa L. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States); Vasko, Michael R. [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States); Kelley, Mark R. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States) and Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States) and Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States)]. E-mail: mkelley@iupui.edu

    2007-01-03

    Neuronal DNA repair remains one of the most exciting areas for investigation, particularly as a means to compare the DNA repair response in mitotic (cancer) vs. post-mitotic (neuronal) cells. In addition, the role of DNA repair in neuronal cell survival and response to aging and environmental insults is of particular interest. DNA damage caused by reactive oxygen species (ROS) such as generated by mitochondrial respiration includes altered bases, abasic sites, and single- and double-strand breaks which can be prevented by the DNA base excision repair (BER) pathway. Oxidative stress accumulates in the DNA of the human brain over time especially in the mitochondrial DNA (mtDNA) and is proposed to play a critical role in aging and in the pathogenesis of several neurological disorders including Parkinson's disease, ALS, and Alzheimer's diseases. Because DNA damage accumulates in the mtDNA more than nuclear DNA, there is increased interest in DNA repair pathways and the consequence of DNA damage in the mitochondria of neurons. The type of damage that is most likely to occur in neuronal cells is oxidative DNA damage which is primarily removed by the BER pathway. Following the notion that the bulk of neuronal DNA damage is acquired by oxidative DNA damage and ROS, the BER pathway is a likely area of focus for neuronal studies of DNA repair. BER variations in brain aging and pathology in various brain regions and tissues are presented. Therefore, the BER pathway is discussed in greater detail in this review than other repair pathways. Other repair pathways including direct reversal, nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination and non-homologous end joining are also discussed. Finally, there is a growing interest in the role that DNA repair pathways play in the clinical arena as they relate to the neurotoxicity and neuropathy associated with cancer treatments. Among the numerous side effects of cancer treatments, major

  11. The current state of eukaryotic DNA base damage and repair.

    Science.gov (United States)

    Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W

    2015-12-02

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering

    Directory of Open Access Journals (Sweden)

    Nørholm Morten HH

    2010-03-01

    Full Text Available Abstract Background The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Results Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. Conclusions The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.

  13. UV-induced de novo protein synthesis enhances nucleotide excision repair efficiency in a transcription-dependent manner in S. cerevisiae.

    Science.gov (United States)

    Al-Moghrabi, Nisreen M; Al-Sharif, Ibtehaj S; Aboussekhra, Abdelilah

    2003-11-21

    DNA damage results in the up-regulation of several genes involved in different cellular physiological processes, such as the nucleotide excision repair (NER) mechanism that copes with a broad range of DNA alterations, including the carcinogenic ultraviolet (UV) light-induced pyrimidine dimers (PDs). There are two NER sub-pathways: transcription coupled repair (TCR) that is specific for the transcribed strands (TS) of active genes and global genomic repair (GGR) that repairs non-transcribed DNA sequences (NTD) and the non-transcribed strands (NTS) of expressed genes. To elucidate the role of UV-dependent de novo protein synthesis in nucleotide excision repair in the budding yeast, we investigated the effect of the protein synthesis inhibitor, cycloheximide, on the removal of PDs. Log phase as well as G(1)-synchronized cells were treated with the drug shortly before UV irradiation and immediately thereafter, and the repair of damaged DNA was assessed with the high resolution primer extension technique. The results show that in both cellular conditions, the inhibition of UV-dependent de novo protein synthesis by cycloheximide impairs the excision repair of the transcriptionally active GAL10 and URA3 genes, with a greater effect on the non-transcribed strands. This indicates that UV-mediated de novo protein synthesis is required for efficient nucleotide excision repair, but not for the preferential repair of the TSs. On the other hand, cycloheximide did not affect the repair of either strand of the repressed GAL10 gene or the non-transcribed promoter region of the URA3 gene, showing that UV-induced de novo protein synthesis is not required for PD removal from transcriptionally inactive DNA sequences. Together, these data show that despite the fact that NTD and NTSs are normally repaired by the GGR sub-pathway, their requirement for UV-dependent de novo protein synthesis is different, which may suggest a difference in the processing of UV lesions in these non

  14. Isolating human DNA repair genes using rodent-cell mutants

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-03-23

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab.

  15. Actual state of knowledge in the field of diseases related with defective nucleotide excision repair.

    Science.gov (United States)

    Bukowska, Barbara; Karwowski, Bolesław T

    2018-02-15

    Xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS) are rare genetic diseases characterized by a large range of clinical symptoms. However, they are all associated with defects in nucleotide excision repair (NER), the system responsible for removing bulky DNA lesions such as those generated by UV light: cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone photoproducts (6-4 PPs). Over the past years, detailed structural and biochemical information on NER-associated proteins has emerged. In the first part of the article we briefly present the main steps of the NER pathway with an emphasis on the precise role of certain proteins. Further, we focus on clinical manifestations of the disorders and describe the diagnostic procedures. Then we consider how current therapy and advanced technology could improve patients' quality of life. Although to date the discussed diseases remain incurable, effective sun protection, a well thought out diet, and holistic medical care provide longer life and better health. This review summarizes the current state of knowledge regarding the epidemiology of NER-associated diseases, their genetic background, clinical features, and treatment options. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. DNA damage repair and response proteins as targets for cancer therapy.

    Science.gov (United States)

    Lieberman, Howard B

    2008-01-01

    The cellular response to DNA damage is critical for determining whether carcinogenesis, cell death or other deleterious biological effects will ensue. Numerous cellular enzymatic mechanisms can directly repair damaged DNA, or allow tolerance of DNA lesions, and thus reduce potential harmful effects. These processes include base excision repair, nucleotide excision repair, nonhomologous end joining, homologous recombinational repair and mismatch repair, as well as translesion synthesis. Furthermore, DNA damage-inducible cell cycle checkpoint systems transiently delay cell cycle progression. Presumably, this allows extra time for repair before entry of cells into critical phases of the cell cycle, an event that could be lethal if pursued with damaged DNA. When damage is excessive apoptotic cellular suicide mechanisms can be induced. Many of the survival-promoting pathways maintain genomic integrity even in the absence of exogenous agents, thus likely processing spontaneous damage caused by the byproducts of normal cellular metabolism. DNA damage can initiate cancer, and radiological as well as chemical agents used to treat cancer patients often cause DNA damage. Many genes are involved in each of the DNA damage processing mechanisms, and the encoded proteins could ultimately serve as targets for therapy, with the goal of neutralizing their ability to repair damage in cancer cells. Therefore, modulation of DNA damage responses coupled with more conventional radiotherapy and chemotherapy approaches could sensitize cancer cells to treatment. Alteration of DNA damage response genes and proteins should thus be considered an important though as of yet not fully exploited avenue to enhance cancer therapy.

  17. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA.

    OpenAIRE

    Guzder, S N; Sung, P; Prakash, L; Prakash, S

    1993-01-01

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A-G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. We have purified RAD14 protein to homogeneity from ...

  18. The NR4A2 nuclear receptor is recruited to novel nuclear foci in response to UV irradiation and participates in nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Kasturee Jagirdar

    Full Text Available Ultraviolet radiation (UVR is one of the most common mutagens encountered by humans and induces the formation of cyclobutane pyrimidine dimers (CPDs and pyrimidine-(6-4-pyrimidone photoproduct (6-4PP lesions in the genomic DNA. To prevent the accumulation of deleterious mutations these lesions must be efficiently repaired, primarily by nucleotide excision repair. We have previously demonstrated that the NR4A family of nuclear receptors are crucial mediators of the DNA repair function of the MC1R signalling pathway in melanocytes. Here we explore the role of the NR4A2 protein in the DNA repair process further. Using EYFP tagged-NR4A2 we have demonstrated a UVR induced recruitment to distinct nuclear foci where they co-localise with known DNA repair proteins. We reveal that the N-terminal domain of the receptor is required for this translocation and identify a role for p38 and PARP signalling in this process. Moreover disruption of the functional integrity of the Ligand Binding Domain of the receptor by deleting the terminal helix 12 effectively blocks co-localisation of the receptor with DNA repair factors. Restored co-localisation of the mutant receptor with DNA repair proteins in the presence of a Histone Deacetylase Inhibitor suggests that impaired chromatin accessibility underpins the mis-localisation observed. Finally NR4A2 over-expression facilitated a more efficient clearance of UVR induced CPD and 6-4PP lesions. Taken together these data uncover a novel role for the NR4A nuclear receptors as direct facilitators of nucleotide excision repair.

  19. Melatonin: A pleiotropic molecule that modulates DNA damage response and repair pathways.

    Science.gov (United States)

    Majidinia, Maryam; Sadeghpour, Alireza; Mehrzadi, Saeed; Reiter, Russel J; Khatami, Nasrin; Yousefi, Bahman

    2017-08-01

    DNA repair is responsible for maintaining the integrity of the genome. Perturbations in the DNA repair pathways have been identified in several human cancers. Thus, compounds targeting DNA damage response (DDR) hold great promise in cancer therapy. A great deal of effort, in pursuit of new anticancer drugs, has been devoted to understanding the basic mechanisms and functions of the cellular DNA repair machinery. Melatonin, a widely produced indoleamine in all organisms, is associated with a reduced risk of cancer and has multiple regulatory roles on the different aspects of the DDR and DNA repair. Herein, we have mainly discussed how defective components in different DNA repair machineries, including homologous recombination (HR), nonhomologous end-joining (NHEJ), base excision repair (BER), nucleotide excision repair (NER), and finally DNA mismatch repair (MMR), can contribute to the risk of cancer. Melatonin biosynthesis, mode of action, and antioxidant effects are reviewed along with the means by which the indoleamine regulates DDR at the transduction, mediation, and functional levels. Finally, we summarize recent studies that illustrate how melatonin can be combined with DNA-damaging agents to improve their efficacy in cancer therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. DNA Repair in Human Cells Exposed to Combinations of Carcinogenic Agents

    Energy Technology Data Exchange (ETDEWEB)

    Setlow, R. B.; Ahmed, F. E.

    1980-01-01

    Normal human and XP2 fibroblasts were treated with UV plus UV-mimetic chemicals. The UV dose used was sufficient to saturate the UV excision repair system. Excision repair after combined treatments was estimated by unscheduled DNA synthesis, BrdUrd photolysis, and the loss of sites sensitive to a UV specific endonuclease. Since the repair of damage from UV and its mimetics is coordinately controlled we expected that there would be similar rate-limiting steps in the repair of UV and chemical damage and that after a combined treatment the total amount of repair would be the same as from UV or the chemicals separately. The expectation was not fulfilled. In normal cells repair after a combined treatment was additive whereas in XP cells repair after a combined treatment was usually less than after either agent separately. The chemicals tested were AAAF, DMBA-epoxide, 4NQO, and ICR-170.

  1. Cytosine deamination and base excision repair cause R-loop-induced CAG repeat fragility and instability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Su, Xiaofeng A; Freudenreich, Catherine H

    2017-10-03

    CAG/CTG repeats are structure-forming repetitive DNA sequences, and expansion beyond a threshold of ∼35 CAG repeats is the cause of several human diseases. Expanded CAG repeats are prone to breakage, and repair of the breaks can cause repeat contractions and expansions. In this study, we found that cotranscriptional R-loops formed at a CAG-70 repeat inserted into a yeast chromosome. R-loops were further elevated upon deletion of yeast RNaseH genes and caused repeat fragility. A significant increase in CAG repeat contractions was also observed, consistent with previous human cell studies. Deletion of yeast cytosine deaminase Fcy1 significantly decreased the rate of CAG repeat fragility and contractions in the rnh1Δrnh201Δ background, indicating that Fcy1-mediated deamination is one cause of breakage and contractions in the presence of R-loops. Furthermore, base excision repair (BER) is responsible for causing CAG repeat contractions downstream of Fcy1, but not fragility. The Rad1/XPF and Rad2/XPG nucleases were also important in protecting against contractions, but through BER rather than nucleotide excision repair. Surprisingly, the MutLγ (Mlh1/Mlh3) endonuclease caused R-loop-dependent CAG fragility, defining an alternative function for this complex. These findings provide evidence that breakage at expanded CAG repeats occurs due to R-loop formation and reveal two mechanisms for CAG repeat instability: one mediated by cytosine deamination of DNA engaged in R-loops and the other by MutLγ cleavage. Since disease-causing CAG repeats occur in transcribed regions, our results suggest that R-loop-mediated fragility is a mechanism that could cause DNA damage and repeat-length changes in human cells.

  2. Initial steps of the base excision repair pathway within the nuclear architecture; Les etapes initiales du mecanisme de reparation par excision de bases au sein de l'architecture nucleaire

    Energy Technology Data Exchange (ETDEWEB)

    Amouroux, R

    2009-09-15

    Oxidative stress induced lesions threaten aerobic organisms by representing a major cause of genomic instability. A common product of guanine oxidation, 8-oxo-guanine (8- oxoG) is particularly mutagenic by provoking G to T transversions. Removal of oxidised bases from DNA is initiated by the recognition and excision of the damaged base by a DNA glycosylase, initiating the base excision repair (BER) pathway. In mammals, 8-oxoG is processed by the 8-oxoG-DNA-glycosylase I (OGG1), which biochemical mechanisms has been well characterised in vitro. However how and where this enzyme finds the modified base within the complex chromatin architecture is not yet understood. We show that upon induction of 8-oxoG, OGG1, together with at least two other proteins involved in BER, is recruited from a soluble fraction to chromatin. Formation kinetics of this patches correlates with 8-oxoG excision, suggesting a direct link between presence of this chromatin-associated complexes and 8-oxoG repair. More precisely, these repair patches are specifically directed to euchromatin regions, and completely excluded from heterochromatin regions. Inducing of artificial chromatin compaction results in a complete inhibition of the in vivo repair of 8-oxoG, probably by impeding the access of OGG1 to the lesion. Using OGG1 mutants, we show that OGG1 direct recognition of 8-oxoG did not trigger its re-localisation to the chromatin. We conclude that in response to the induction of oxidative DNA damage, the DNA glycosylase is actively recruited to regions of open chromatin allowing the access of the BER machinery to the lesions. (author)

  3. DNA DAMAGE AND REPAIR IN CANCER

    OpenAIRE

    Dizdaroglu, Miral

    2017-01-01

     Oxygen- and nitrogen-derived reactive species are constantly generated inliving organisms by endogenous and exogenous sources. Reactions of reactivespecies such as free radicals with DNA cause the formation of multiplemutagenic and cytotoxic lesions, leading to genetic instability, which is ahallmark of cancer. DNA repair mechanisms exist in living organisms to repairDNA lesions. Most effective cancer treatments work by causing DNA damage inmalignant tumors. Just like in normal cell...

  4. Modulation of base excision repair of 8-oxoguanine by the nucleotide sequence.

    Science.gov (United States)

    Allgayer, Julia; Kitsera, Nataliya; von der Lippen, Carina; Epe, Bernd; Khobta, Andriy

    2013-10-01

    8-Oxoguanine (8-oxoG) is a major product of oxidative DNA damage, which induces replication errors and interferes with transcription. By varying the position of single 8-oxoG in a functional gene and manipulating the nucleotide sequence surrounding the lesion, we found that the degree of transcriptional inhibition is independent of the distance from the transcription start or the localization within the transcribed or the non-transcribed DNA strand. However, it is strongly dependent on the sequence context and also proportional to cellular expression of 8-oxoguanine DNA glycosylase (OGG1)-demonstrating that transcriptional arrest does not take place at unrepaired 8-oxoG and proving a causal connection between 8-oxoG excision and the inhibition of transcription. We identified the 5'-CAGGGC[8-oxoG]GACTG-3' motif as having only minimal transcription-inhibitory potential in cells, based on which we predicted that 8-oxoG excision is particularly inefficient in this sequence context. This anticipation was fully confirmed by direct biochemical assays. Furthermore, in DNA containing a bistranded Cp[8-oxoG]/Cp[8-oxoG] clustered lesion, the excision rates differed between the two strands at least by a factor of 9, clearly demonstrating that the excision preference is defined by the DNA strand asymmetry rather than the overall geometry of the double helix or local duplex stability.

  5. Distribution of DNA repair-related ESTs in sugarcane

    Directory of Open Access Journals (Sweden)

    W.C. Lima

    2001-12-01

    Full Text Available DNA repair pathways are necessary to maintain the proper genomic stability and ensure the survival of the organism, protecting it against the damaging effects of endogenous and exogenous agents. In this work, we made an analysis of the expression patterns of DNA repair-related genes in sugarcane, by determining the EST (expressed sequence tags distribution in the different cDNA libraries of the SUCEST transcriptome project. Three different pathways - photoreactivation, base excision repair and nucleotide excision repair - were investigated by employing known DNA repair proteins as probes to identify homologous ESTs in sugarcane, by means of computer similarity search. The results showed that DNA repair genes may have differential expressions in tissues, depending on the pathway studied. These in silico data provide important clues on the potential variation of gene expression, to be confirmed by direct biochemical analysis.As vias de reparo de DNA são requeridas para manter a necessária estabilidade genômica e garantir a sobrevivência do organismo, frente aos efeitos deletérios causados por fatores endógenos e exógenos. Neste trabalho, realizamos a análise dos padrões de expressão dos genes de reparo de DNA encontrados na cana-de-açúcar, pela determinação da distribuição de ESTs nas diferentes bibliotecas de cDNA no projeto de transcriptoma SUCEST. Três vias de reparo - fotorreativação, reparo por excisão de bases e reparo por excisão de nucleotídeos - foram estudadas através do uso de proteínas de reparo como sondas para identificação de ESTs homólogos em cana-de-açúcar, com base na procura computacional de similaridade. Os resultados indicam que os genes de reparo de DNA possuem uma expressão diferencial nos tecidos, dependendo da via de reparo analisada. Esses dados in silico fornecem importantes indícios da expressão diferencial, a qual deve ser confirmada por análises bioquímicas diretas.

  6. First Reported Patient with Human ERCC1 Deficiency Has Cerebro-Oculo-Facio-Skeletal Syndrome with a Mild Defect in Nucleotide Excision Repair and Severe Developmental Failure

    OpenAIRE

    Jaspers, Nicolaas G.J.; Raams, Anja; Silengo, Margherita Cirillo; Wijgers, Nils; Niedernhofer, Laura J; Robinson, Andria Rasile; Giglia-Mari, Giuseppina; Hoogstraten, Deborah; Kleijer, Wim J.; Hoeijmakers, Jan H.J.; Vermeulen, Wim

    2007-01-01

    Nucleotide excision repair (NER) is a genome caretaker mechanism responsible for removing helix-distorting DNA lesions, most notably ultraviolet photodimers. Inherited defects in NER result in profound photosensitivity and the cancer-prone syndrome xeroderma pigmentosum (XP) or two progeroid syndromes: Cockayne and trichothiodystrophy syndromes. The heterodimer ERCC1-XPF is one of two endonucleases required for NER. Mutations in XPF are associated with mild XP and rarely with progeria. Mutati...

  7. Red meat and poultry intake, polymorphisms in the nucleotide excision repair and mismatch repair pathways and colorectal cancer risk

    Science.gov (United States)

    Joshi, Amit D.; Corral, Román; Siegmund, Kimberly D.; Haile, Robert W.; Le Marchand, Loïc; Martínez, Maria Elena; Ahnen, Dennis J.; Sandler, Robert S.; Lance, Peter; Stern, Mariana C.

    2009-01-01

    Diets high in red meat have been consistently associated with colorectal cancer (CRC) risk and may result in exposure to carcinogens that cause DNA damage [i.e polycyclic aromatic hydrocarbons, heterocyclic amines (HCAs) and N-nitroso compounds]. Using a family-based study, we investigated whether polymorphisms in the nucleotide excision repair (NER) (ERCC1 3′ untranslated region (UTR) G/T, XPD Asp312Asn and Lys751Gln, XPC intron 11 C/A, XPA 5′ UTR C/T, XPF Arg415Gln and XPG Asp1104His) and mismatch repair (MLH1 Ile219Val and MSH2 Gly322Asp) pathways modified the association with red meat and poultry intake. We tested for gene–environment interactions using case-only analyses (n = 577) and compared the results using case-unaffected sibling comparisons (n = 307 sibships). Increased risk of CRC was observed for intake of more than or equal to three servings per week of red meat [odds ratio (OR) = 1.8, 95% confidence interval (CI) = 1.3–2.5)] or high-temperature cooked red meat (OR = 1.6, 95% CI = 1.1–2.2). Intake of red meat heavily brown on the outside or inside increased CRC risk only among subjects who carried the XPD codon 751 Lys/Lys genotype (case-only interaction P = 0.006 and P = 0.001, respectively, for doneness outside or inside) or the XPD codon 312 Asp/Asp genotype (case-only interaction P = 0.090 and P < 0.001, respectively). These interactions were stronger for rectal cancer cases (heterogeneity test P = 0.002 for XPD Asp312Asn and P = 0.03 for XPD Lys751Gln) and remained statistically significant after accounting for multiple testing. Case-unaffected sibling analyses were generally supportive of the case-only results. These findings highlight the possible contribution of diets high in red meat to the formation of lesions that elicit the NER pathway, such as carcinogen-induced bulky adducts. PMID:19029193

  8. DNA repair phenotype and dietary antioxidant supplementation

    DEFF Research Database (Denmark)

    Guarnieri, Serena; Loft, Steffen; Riso, Patrizia

    2008-01-01

    -release vitamin C tablets had increased DNA repair activity (27 (95 % CI 12, 41) % higher incision activity). These subjects also benefited from the supplementation by reduced levels of oxidised guanines in MNBC. In conclusion, nutritional status, DNA repair activity and DNA damage are linked, and beneficial...... of DNA repair incisions were 65.2 (95 % CI 60.4, 70.0) and 86.1 (95 % CI 76.2, 99.9) among the male smokers and well-nourished subjects, respectively. The male smokers also had high baseline levels of oxidised guanines in MNBC. After supplementation, only the male smokers supplemented with slow...

  9. DNA repair pathways involved in repair of lesions induced by 5-fluorouracil and its active metabolite FdUMP.

    Science.gov (United States)

    Matuo, Renata; Sousa, Fabrício Garmus; Escargueil, Alexandre E; Soares, Daniele G; Grivicich, Ivana; Saffi, Jenifer; Larsen, Annette K; Henriques, João Antonio Pêgas

    2010-01-15

    5-Fluorouracil (5-FU) is an antitumor antimetabolite that can be converted into fluoronucleotides and FdUMP. Fluoronucleotides are incorporated into DNA and RNA, while FdUMP results in nucleotide pool imbalance. Saccharomyces cerevisiae is unable to convert 5-FU into FdUMP, making yeast a unique model system to study the cellular effects of 5-FU and FdUMP independently. A panel of repair-deficient yeast strains was used to identify the DNA repair pathways needed for repair of lesions generated by 5-FU or FdUMP. This included yeast deficient in base excision repair (BER), nucleotide excision repair (NER), translesion synthesis (TLS), mismatch repair (MMR), post-replication repair (PRR), homologous recombination (HR) and non-homologous end-joining (NHEJ). The results revealed an important role of BER, since BER-mutants (ntg1, ntg2, apn1, apn2) showed pronounced sensitivity to both 5-FU and FdUMP. MMR mutants also showed high sensitivity to both compounds. In contrast, deficiencies in NER, NHEJ and TLS repair had only minor influence on the sensitivity to FU and FdUMP. Interestingly, deficiencies in HR (rad52) and PPR (rad6, rad18) were associated with increased sensitivity to 5-FU, but not to FdUMP. Taken together, our study reveals an important contribution of DNA repair pathways on the sensitivity to 5-FU and its active metabolite FdUMP. Importantly, the repair mechanisms differed for the 2 antimetabolites since lesions induced by 5-FU were repaired by BER, MMR, HR and PRR, while only BER and MMR were required for repair of FdUMP-induced lesions.

  10. An unprecedented nucleic acid capture mechanism for excision of DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Rubinson, Emily H.; Prakasha Gowda, A.S.; Spratt, Thomas E.; Gold, Barry; Eichmanbrand, Brandt F. (Pitt); (Vanderbilt); (Penn)

    2010-11-18

    DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA-targeting anticancer compounds. The basis for glycosylase specificity towards N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing an illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how the HEAT repeats of AlkD distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation.

  11. 'Batman excision' of ventral skin in hypospadias repair, clue to aesthetic repair (point of technique).

    Science.gov (United States)

    Hoebeke, P B; De Kuyper, P; Van Laecke, E

    2002-11-01

    In the hypospadiac penis the ventral skin is poorly developed, while dorsal skin is redundant. The classical Byars' flaps are a way to use the excess dorsal skin to cover the penile shaft. The appearance after Byars' flaps however is not natural. We use a more natural looking skin allocation with superior aesthetic results. The clue in this reconstruction is an inverted triangle shaped excision of ventral skin expanding over the edges of the hooded prepuce (which makes it look like Batman). After excision of the ventral skin it is possible to close the penile skin in the midline, thus mimicking the natural raphe. In case of preputial reconstruction the excised ventral skin makes the prepuce look more natural. The trend of further refining aesthetic appearance of the hypospadiac penis often neglects the penile skin reconstruction. A technique is presented by which the total penile appearances after surgery ameliorates due to better skin reconstruction.

  12. DNA damage response and cancer therapeutics through the lens of the Fanconi Anemia DNA repair pathway.

    Science.gov (United States)

    Bhattacharjee, Sonali; Nandi, Saikat

    2017-10-10

    Fanconi Anemia (FA) is a rare, inherited genomic instability disorder, caused by mutations in genes involved in the repair of interstrand DNA crosslinks (ICLs). The FA signaling network contains a unique nuclear protein complex that mediates the monoubiquitylation of the FANCD2 and FANCI heterodimer, and coordinates activities of the downstream DNA repair pathway including nucleotide excision repair, translesion synthesis, and homologous recombination. FA proteins act at different steps of ICL repair in sensing, recognition and processing of DNA lesions. The multi-protein network is tightly regulated by complex mechanisms, such as ubiquitination, phosphorylation, and degradation signals that are critical for the maintenance of genome integrity and suppressing tumorigenesis. Here, we discuss recent advances in our understanding of how the FA proteins participate in ICL repair and regulation of the FA signaling network that assures the safeguard of the genome. We further discuss the potential application of designing small molecule inhibitors that inhibit the FA pathway and are synthetic lethal with DNA repair enzymes that can be used for cancer therapeutics.

  13. Enhancement of damage-specific DNA binding of XPA by interaction with the ERCC1 DNA repair protein

    NARCIS (Netherlands)

    A. Nagai; M. Saijo (Masafumi); I. Kuraoka; T. Matsuda (Toshiro); N. Kodo (Naohiko); Y. Nakatsu (Yoshimichi); T. Mimaki; M. Mino; M. Biggerstaff (Maureen); R.D. Wood (Richard); A.M. Sijbers (Anneke); J.H.J. Hoeijmakers (Jan); K. Tanaka (Kiyoji)

    1995-01-01

    textabstractThe human XPA and ERCC1 proteins, which are involved in early steps of nucleotide excision repair of DNA, specifically interacted in an in vitro binding assay and a yeast two-hybrid assay. A stretch of consecutive glutamic acid residues in XPA was needed for binding to ERCC1. Binding of

  14. Interactions involving the human RNA polymerase II transcription/nucleotide excision repair complex TFIIH, the nucleotide excision repair protein XPG, and Cockayne syndrome group B (CSB) protein.

    Science.gov (United States)

    Iyer, N; Reagan, M S; Wu, K J; Canagarajah, B; Friedberg, E C

    1996-02-20

    The human basal transcription factor TFIIH plays a central role in two distinct processes. TFIIH is an obligatory component of the RNA polymerase II (RNAP II) transcription initiation complex. Additionally, it is believed to be the core structure around which some if not all the components of the nucleotide excision repair (NER) machinery assemble to constitute a nucleotide excision repairosome. At least two of the subunits of TFIIH (XPB and XPD proteins) are implicated in the disease xeroderma pigmentosum (XP). We have exploited the availability of the cloned XPB, XPD, p62, p44, and p34 genes (all of which encode polypeptide subunits of TFIIH) to examine interactions between in vitro-translated polypeptides by co-immunoprecipitation. Additionally we have examined interactions between TFIIH components, the human NER protein XPG, and the CSB protein which is implicated in Cockayne syndrome (CS). Our analyses demonstrate that the XPB, XPD, p44, and p62 proteins interact with each other. XPG protein interacts with multiple subunits of TFIIH and with CSB protein.

  15. Hypomorphic PCNA mutation underlies a human DNA repair disorder.

    Science.gov (United States)

    Baple, Emma L; Chambers, Helen; Cross, Harold E; Fawcett, Heather; Nakazawa, Yuka; Chioza, Barry A; Harlalka, Gaurav V; Mansour, Sahar; Sreekantan-Nair, Ajith; Patton, Michael A; Muggenthaler, Martina; Rich, Phillip; Wagner, Karin; Coblentz, Roselyn; Stein, Constance K; Last, James I; Taylor, A Malcolm R; Jackson, Andrew P; Ogi, Tomoo; Lehmann, Alan R; Green, Catherine M; Crosby, Andrew H

    2014-07-01

    Numerous human disorders, including Cockayne syndrome, UV-sensitive syndrome, xeroderma pigmentosum, and trichothiodystrophy, result from the mutation of genes encoding molecules important for nucleotide excision repair. Here, we describe a syndrome in which the cardinal clinical features include short stature, hearing loss, premature aging, telangiectasia, neurodegeneration, and photosensitivity, resulting from a homozygous missense (p.Ser228Ile) sequence alteration of the proliferating cell nuclear antigen (PCNA). PCNA is a highly conserved sliding clamp protein essential for DNA replication and repair. Due to this fundamental role, mutations in PCNA that profoundly impair protein function would be incompatible with life. Interestingly, while the p.Ser228Ile alteration appeared to have no effect on protein levels or DNA replication, patient cells exhibited marked abnormalities in response to UV irradiation, displaying substantial reductions in both UV survival and RNA synthesis recovery. The p.Ser228Ile change also profoundly altered PCNA's interaction with Flap endonuclease 1 and DNA Ligase 1, DNA metabolism enzymes. Together, our findings detail a mutation of PCNA in humans associated with a neurodegenerative phenotype, displaying clinical and molecular features common to other DNA repair disorders, which we showed to be attributable to a hypomorphic amino acid alteration.

  16. Up-regulation of nucleotide excision repair in mouse lung and liver following chronic exposure to aflatoxin B{sub 1} and its dependence on p53 genotype

    Energy Technology Data Exchange (ETDEWEB)

    Mulder, Jeanne E. [Pharmacology and Toxicology Graduate Program, Department of Biomedical and Molecular Sciences, Queen' s University Kingston, Ontario K7L 3N6 (Canada); Bondy, Genevieve S.; Mehta, Rekha [Toxicology Research Division, 2202D, Bureau of Chemical Safety, Food Directorate, Health Products and Food Branch, Health Canada, Ottawa, Ontario K1A 0K9 (Canada); Massey, Thomas E., E-mail: masseyt@queensu.ca [Pharmacology and Toxicology Graduate Program, Department of Biomedical and Molecular Sciences, Queen' s University Kingston, Ontario K7L 3N6 (Canada)

    2014-03-01

    Aflatoxin B{sub 1} (AFB{sub 1}) is biotransformed in vivo into an epoxide metabolite that forms DNA adducts that may induce cancer if not repaired. p53 is a tumor suppressor gene implicated in the regulation of global nucleotide excision repair (NER). Male heterozygous p53 knockout (B6.129-Trp53{sup tm1Brd}N5, Taconic) and wild-type mice were exposed to 0, 0.2 or 1.0 ppm AFB{sub 1} for 26 weeks. NER activity was assessed with an in vitro assay, using AFB{sub 1}-epoxide adducted plasmid DNA as a substrate. For wild-type mice, repair of AFB{sub 1}–N7-Gua adducts was 124% and 96% greater in lung extracts from mice exposed to 0.2 ppm and 1.0 ppm AFB{sub 1} respectively, and 224% greater in liver extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05). In heterozygous p53 knockout mice, repair of AFB{sub 1}–N7-Gua was only 45% greater in lung extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05), and no effect was observed in lung extracts from mice treated with 1.0 ppm AFB{sub 1} or in liver extracts from mice treated with either AFB{sub 1} concentration. p53 genotype did not affect basal levels of repair. AFB{sub 1} exposure did not alter repair of AFB{sub 1}-derived formamidopyrimidine adducts in lung or liver extracts of either mouse genotype nor did it affect XPA or XPB protein levels. In summary, chronic exposure to AFB{sub 1} increased NER activity in wild-type mice, and this response was diminished in heterozygous p53 knockout mice, indicating that loss of one allele of p53 limits the ability of NER to be up-regulated in response to DNA damage. - Highlights: • Mice are chronically exposed to low doses of the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}). • The effects of AFB{sub 1} and p53 status on nucleotide excision repair are investigated. • AFB{sub 1} increases nucleotide excision repair in wild type mouse lung and liver. • This increase is attenuated in p53 heterozygous mouse lung and liver. • Results portray the role of p53 in

  17. GENETIC AND MOLECULAR ANALYSIS OF DNA DAMAGE REPAIR AND TOLERANCE PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    SUTHERLAND, B.M.

    2001-07-26

    Radiation can damage cellular components, including DNA. Organisms have developed a panoply of means of dealing with DNA damage. Some repair paths have rather narrow substrate specificity (e.g. photolyases), which act on specific pyrimidine photoproducts in a specific type (e.g., DNA) and conformation (double-stranded B conformation) of nucleic acid. Others, for example, nucleotide excision repair, deal with larger classes of damages, in this case bulky adducts in DNA. A detailed discussion of DNA repair mechanisms is beyond the scope of this article, but one can be found in the excellent book of Friedberg et al. [1] for further detail. However, some DNA damages and paths for repair of those damages important for photobiology will be outlined below as a basis for the specific examples of genetic and molecular analysis that will be presented below.

  18. Influence of Morinda citrifolia (Noni) on Expression of DNA Repair Genes in Cervical Cancer Cells.

    Science.gov (United States)

    Gupta, Rakesh Kumar; Bajpai, Deepti; Singh, Neeta

    2015-01-01

    Previous studies have suggested that Morinda citrifolia (Noni) has potential to reduce cancer risk. The purpose of this study was to investigate the effect of Noni, cisplatin, and their combination on DNA repair genes in the SiHa cervical cancer cell line. SiHa cells were cultured and treated with 10% Noni, 10 μg/dl cisplatin or their combination for 24 hours. Post culturing, the cells were pelleted, RNA extracted, and processed for investigating DNA repair genes by real time PCR. The expression of nucleotide excision repair genes ERCC1, ERCC2, and ERCC4 and base excision repair gene XRCC1 was increased 4 fold, 8.9 fold, 4 fold, and 5.5 fold, respectively, on treatment with Noni as compared to untreated controls (p<0.05). In contrast, expression was found to be decreased 22 fold, 13 fold, 16 fold, and 23 fold on treatment with cisplatin (p<0.05). However, the combination of Noni and cisplatin led to an increase of 2 fold, 1.6 fold, 3 fold, 1.2 fold, respectively (p<0.05). Noni enhanced the expression of DNA repair genes by itself and in combination with cisplatin. However, high expression of DNA repair genes at mRNA level only signifies efficient DNA transcription of the above mentioned genes; further investigations are needed to evaluate the DNA repair protein expression.

  19. Genotoxic stress and DNA repair in plants: emerging functions and tools for improving crop productivity.

    Science.gov (United States)

    Balestrazzi, Alma; Confalonieri, Massimo; Macovei, Anca; Donà, Mattia; Carbonera, Daniela

    2011-03-01

    Crop productivity is strictly related to genome stability, an essential requisite for optimal plant growth/development. Genotoxic agents (e.g., chemical agents, radiations) can cause both chemical and structural damage to DNA. In some cases, they severely affect the integrity of plant genome by inducing base oxidation, which interferes with the basal processes of replication and transcription, eventually leading to cell death. The cell response to oxidative stress includes several DNA repair pathways, which are activated to remove the damaged bases and other lesions. Information concerning DNA repair in plants is still limited, although results from gene profiling and mutant analysis suggest possible differences in repair mechanisms between plants and other eukaryotes. The present review focuses on the base- and nucleotide excision repair (BER, NER) pathways, which operate according to the most common DNA repair rule (excision of damaged bases and replacement by the correct nucleotide), highlighting the most recent findings in plants. An update on DNA repair in organelles, chloroplasts and mitochondria is also provided. Finally, it is generally acknowledged that DNA repair plays a critical role during seed imbibition, preserving seed vigor. Despite this, only a limited number of studies, described here, dedicated to seeds are currently available.

  20. Oxidative Stress, DNA Damage and DNA Repair in Female Patients with Diabetes Mellitus Type 2.

    Directory of Open Access Journals (Sweden)

    Annemarie Grindel

    Full Text Available Diabetes mellitus type 2 (T2DM is associated with oxidative stress which in turn can lead to DNA damage. The aim of the present study was to analyze oxidative stress, DNA damage and DNA repair in regard to hyperglycemic state and diabetes duration.Female T2DM patients (n = 146 were enrolled in the MIKRODIAB study and allocated in two groups regarding their glycated hemoglobin (HbA1c level (HbA1c≤7.5%, n = 74; HbA1c>7.5%, n = 72. In addition, tertiles according to diabetes duration (DD were created (DDI = 6.94±3.1 y, n = 49; DDII = 13.35±1.1 y, n = 48; DDIII = 22.90±7.3 y, n = 49. Oxidative stress parameters, including ferric reducing ability potential, malondialdehyde, oxidized and reduced glutathione, reduced thiols, oxidized LDL and F2-Isoprostane as well as the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase were measured. Damage to DNA was analyzed in peripheral blood mononuclear cells and whole blood with single cell gel electrophoresis. DNA base excision repair capacity was tested with the modified comet repair assay. Additionally, mRNA expressions of nine genes related to base excision repair were analyzed in a subset of 46 matched individuals.No significant differences in oxidative stress parameters, antioxidant enzyme activities, damage to DNA and base excision repair capacity, neither between a HbA1c cut off />7.5%, nor between diabetes duration was found. A significant up-regulation in mRNA expression was found for APEX1, LIG3 and XRCC1 in patients with >7.5% HbA1c. Additionally, we observed higher total cholesterol, LDL-cholesterol, LDL/HDL-cholesterol, triglycerides, Framingham risk score, systolic blood pressure, BMI and lower HDL-cholesterol in the hyperglycemic group.BMI, blood pressure and blood lipid status were worse in hyperglycemic individuals. However, no major disparities regarding oxidative stress, damage to DNA and DNA repair were present which might be due to good medical

  1. Oxidative Stress, DNA Damage and DNA Repair in Female Patients with Diabetes Mellitus Type 2.

    Science.gov (United States)

    Grindel, Annemarie; Guggenberger, Bianca; Eichberger, Lukas; Pöppelmeyer, Christina; Gschaider, Michaela; Tosevska, Anela; Mare, George; Briskey, David; Brath, Helmut; Wagner, Karl-Heinz

    2016-01-01

    Diabetes mellitus type 2 (T2DM) is associated with oxidative stress which in turn can lead to DNA damage. The aim of the present study was to analyze oxidative stress, DNA damage and DNA repair in regard to hyperglycemic state and diabetes duration. Female T2DM patients (n = 146) were enrolled in the MIKRODIAB study and allocated in two groups regarding their glycated hemoglobin (HbA1c) level (HbA1c≤7.5%, n = 74; HbA1c>7.5%, n = 72). In addition, tertiles according to diabetes duration (DD) were created (DDI = 6.94±3.1 y, n = 49; DDII = 13.35±1.1 y, n = 48; DDIII = 22.90±7.3 y, n = 49). Oxidative stress parameters, including ferric reducing ability potential, malondialdehyde, oxidized and reduced glutathione, reduced thiols, oxidized LDL and F2-Isoprostane as well as the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase were measured. Damage to DNA was analyzed in peripheral blood mononuclear cells and whole blood with single cell gel electrophoresis. DNA base excision repair capacity was tested with the modified comet repair assay. Additionally, mRNA expressions of nine genes related to base excision repair were analyzed in a subset of 46 matched individuals. No significant differences in oxidative stress parameters, antioxidant enzyme activities, damage to DNA and base excision repair capacity, neither between a HbA1c cut off />7.5%, nor between diabetes duration was found. A significant up-regulation in mRNA expression was found for APEX1, LIG3 and XRCC1 in patients with >7.5% HbA1c. Additionally, we observed higher total cholesterol, LDL-cholesterol, LDL/HDL-cholesterol, triglycerides, Framingham risk score, systolic blood pressure, BMI and lower HDL-cholesterol in the hyperglycemic group. BMI, blood pressure and blood lipid status were worse in hyperglycemic individuals. However, no major disparities regarding oxidative stress, damage to DNA and DNA repair were present which might be due to good medical treatment

  2. Anti-tumour compounds illudin S and Irofulven induce DNA lesions ignored by global repair and exclusively processed by transcription- and replication-coupled repair pathways.

    OpenAIRE

    Raams, Anja; Kelner, Michael; Ng, Jessica; Yamashita, Yukiko; Takeda, Shiunichi; McMorris, Trevor; Hoeijmakers, Jan; Jaspers, Nicolaas

    2002-01-01

    textabstractIlludin S is a natural sesquiterpene drug with strong anti-tumour activity. Inside cells, unstable active metabolites of illudin cause the formation of as yet poorly characterised DNA lesions. In order to identify factors involved in their repair, we have performed a detailed genetic survey of repair-defective mutants for responses to the drug. We show that 90% of illudin's lethal effects in human fibroblasts can be prevented by an active nucleotide excision repair (NER) system. C...

  3. Human DNA Glycosylase NEIL1’s Interactions with Downstream Repair Proteins Is Critical for Efficient Repair of Oxidized DNA Base Damage and Enhanced Cell Survival

    Directory of Open Access Journals (Sweden)

    Istvan Boldogh

    2012-11-01

    Full Text Available NEIL1 is unique among the oxidatively damaged base repair-initiating DNA glycosylases in the human genome due to its S phase-specific activation and ability to excise substrate base lesions from single-stranded DNA. We recently characterized NEIL1’s specific binding to downstream canonical repair and non-canonical accessory proteins, all of which involve NEIL1’s disordered C-terminal segment as the common interaction domain (CID. This domain is dispensable for NEIL1’s base excision and abasic (AP lyase activities, but is required for its interactions with other repair proteins. Here, we show that truncated NEIL1 lacking the CID is markedly deficient in initiating in vitro repair of 5-hydroxyuracil (an oxidative deamination product of C in a plasmid substrate compared to the wild-type NEIL1, thus suggesting a critical role of CID in the coordination of overall repair. Furthermore, while NEIL1 downregulation significantly sensitized human embryonic kidney (HEK 293 cells to reactive oxygen species (ROS, ectopic wild-type NEIL1, but not the truncated mutant, restored resistance to ROS. These results demonstrate that cell survival and NEIL1-dependent repair of oxidative DNA base damage require interactions among repair proteins, which could be explored as a cancer therapeutic target in order to increase the efficiency of chemo/radiation treatment.

  4. Differential contributory roles of nucleotide excision and homologous recombination repair for enhancing cisplatin sensitivity in human ovarian cancer cells

    Directory of Open Access Journals (Sweden)

    Wani Gulzar

    2011-03-01

    Full Text Available Abstract Background While platinum-based chemotherapeutic agents are widely used to treat various solid tumors, the acquired platinum resistance is a major impediment in their successful treatment. Since enhanced DNA repair capacity is a major factor in conferring cisplatin resistance, targeting of DNA repair pathways is an effective stratagem for overcoming cisplatin resistance. This study was designed to delineate the role of nucleotide excision repair (NER, the principal mechanism for the removal of cisplatin-induced DNA intrastrand crosslinks, in cisplatin resistance and reveal the impact of DNA repair interference on cisplatin sensitivity in human ovarian cancer cells. Results We assessed the inherent NER efficiency of multiple matched pairs of cisplatin-sensitive and -resistant ovarian cancer cell lines and their expression of NER-related factors at mRNA and protein levels. Our results showed that only the cisplatin-resistant ovarian cancer cell line PEO4 possessed an increased NER capacity compared to its inherently NER-inefficient parental line PEO1. Several other cisplatin-resistant cell lines, including CP70, CDDP and 2008C13, exhibited a normal and parental cell-comparable NER capacity for removing cisplatin-induced DNA intrastrand cross-links (Pt-GG. Concomitant gene expression analysis revealed discordance in mRNA and protein levels of NER factors in various ovarian cancer cell lines and NER proteins level were unrelated to the cisplatin sensitivity of these cell lines. Although knockdown of NER factors was able to compromise the NER efficiency, it only caused a minimal effect on cisplatin sensitivity. On the contrary, downregulation of BRCA2, a critical protein for homologous recombination repair (HRR, significantly enhanced the efficacy of cisplatin in killing ovarian cancer cell line PEO4. Conclusion Our studies indicate that the level of NER factors in ovarian cancer cell lines is neither a determinant of their NER capacity nor

  5. A UV-Induced Genetic Network Links the RSC Complex to Nucleotide Excision Repair and Shows Dose-Dependent Rewiring

    Directory of Open Access Journals (Sweden)

    Rohith Srivas

    2013-12-01

    Full Text Available Efficient repair of UV-induced DNA damage requires the precise coordination of nucleotide excision repair (NER with numerous other biological processes. To map this crosstalk, we generated a differential genetic interaction map centered on quantitative growth measurements of >45,000 double mutants before and after different doses of UV radiation. Integration of genetic data with physical interaction networks identified a global map of 89 UV-induced functional interactions among 62 protein complexes, including a number of links between the RSC complex and several NER factors. We show that RSC is recruited to both silenced and transcribed loci following UV damage where it facilitates efficient repair by promoting nucleosome remodeling. Finally, a comparison of the response to high versus low levels of UV shows that the degree of genetic rewiring correlates with dose of UV and reveals a network of dose-specific interactions. This study makes available a large resource of UV-induced interactions, and it illustrates a methodology for identifying dose-dependent interactions based on quantitative shifts in genetic networks.

  6. Irofulven cytotoxicity depends on transcription-coupled nucleotide excision repair and is correlated with XPG expression in solid tumor cells.

    Science.gov (United States)

    Koeppel, Florence; Poindessous, Virginie; Lazar, Vladimir; Raymond, Eric; Sarasin, Alain; Larsen, Annette K

    2004-08-15

    Irofulven is a novel alkylating agent with promising clinical activity, particularly toward ovarian and hormone-refractory prostate cancers. To facilitate additional clinical development, we have aimed to identify biological markers associated with sensitivity to the compound. Fibroblasts derived from patients with xeroderma pigmentosum or Cockayne's syndrome along with a panel of 20 human cancer cell lines (eight different tumor types) were examined to establish the importance of nucleotide excision repair proteins in the sensitivity to irofulven. Human cells deficient in nucleotide excision repair are up to 30-fold more sensitive to the cytotoxic effects of irofulven compared with repair-proficient controls, clearly indicating that nucleotide excision repair plays a crucial role in the sensitivity to the drug. Interestingly, our results show that irofulven-induced lesions are recognized by transcription-coupled repair but not by global genome repair. Another unique feature is the pronounced sensitivity of XPD and XPB helicase-deficient cells to the drug. Comparison of the IC50 values for irofulven, cisplatin, and ecteinascidin 743 with the expression levels of ERCC1, XPD, and XPG genes in different solid tumor cell lines shows no correlation between the expression levels of any of the three nucleotide excision repair proteins and the sensitivity to ecteinascidin 743. In contrast, expression of the XPG endonuclease was correlated with the cytotoxicity for irofulven and, to a lesser degree, for cisplatin. Importantly, XPG expression was also correlated with cellular nucleotide excision repair activity. Increasing evidence indicates that compromised nucleotide excision repair activity is frequent in several solid tumor types. The results presented here suggest that XPG expression in such tumors may be a useful marker to predict their sensitivity to irofulven.

  7. Structural basis for the initiation of eukaryotic transcription-coupled DNA repair

    OpenAIRE

    Xu, Jun; Lahiri, Indrajit; Wang, Wei; Wier, Adam; Cianfrocco, Michael A.; Chong, Jenny; Hare, Alissa A.; Dervan, Peter B.; DiMaio, Frank; Leschziner, Andres E.; Wang, Dong

    2017-01-01

    Eukaryotic transcription-coupled repair (TCR) is an important and well-conserved sub-pathway of nucleotide excision repair that preferentially removes DNA lesions from the template strand that block translocation of RNA polymerase II (Pol II). Cockayne syndrome group B (CSB, also known as ERCC6) protein in humans (or its yeast orthologues, Rad26 in Saccharomyces cerevisiae and Rhp26 in Schizosaccharomyces pombe) is among the first proteins to be recruited to the lesion-arrested Pol II during ...

  8. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Silvia Sterpone

    2010-01-01

    Full Text Available It is well known that ionizing radiation (IR can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER. In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  9. Accurate DNA Assembly and Genome Engineering with Optimized Uracil Excision Cloning.

    Science.gov (United States)

    Cavaleiro, Ana Mafalda; Kim, Se Hyeuk; Seppälä, Susanna; Nielsen, Morten T; Nørholm, Morten H H

    2015-09-18

    Simple and reliable DNA editing by uracil excision (a.k.a. USER cloning) has been described by several research groups, but the optimal design of cohesive DNA ends for multigene assembly remains elusive. Here, we use two model constructs based on expression of gfp and a four-gene pathway that produces β-carotene to optimize assembly junctions and the uracil excision protocol. By combining uracil excision cloning with a genomic integration technology, we demonstrate that up to six DNA fragments can be assembled in a one-tube reaction for direct genome integration with high accuracy, greatly facilitating the advanced engineering of robust cell factories.

  10. The nucleotide excision repair (NER) system of Helicobacter pylori: role in mutation prevention and chromosomal import patterns after natural transformation.

    Science.gov (United States)

    Moccia, Claudia; Krebes, Juliane; Kulick, Stefan; Didelot, Xavier; Kraft, Christian; Bahlawane, Christelle; Suerbaum, Sebastian

    2012-05-06

    Extensive genetic diversity and rapid allelic diversification are characteristics of the human gastric pathogen Helicobacter pylori, and are believed to contribute to its ability to cause chronic infections. Both a high mutation rate and frequent imports of short fragments of exogenous DNA during mixed infections play important roles in generating this allelic diversity. In this study, we used a genetic approach to investigate the roles of nucleotide excision repair (NER) pathway components in H. pylori mutation and recombination. Inactivation of any of the four uvr genes strongly increased the susceptibility of H. pylori to DNA damage by ultraviolet light. Inactivation of uvrA and uvrB significantly decreased mutation frequencies whereas only the uvrA deficient mutant exhibited a significant decrease of the recombination frequency after natural transformation. A uvrC mutant did not show significant changes in mutation or recombination rates; however, inactivation of uvrC promoted the incorporation of significantly longer fragments of donor DNA (2.2-fold increase) into the recipient chromosome. A deletion of uvrD induced a hyper-recombinational phenotype. Our data suggest that the NER system has multiple functions in the genetic diversification of H. pylori, by contributing to its high mutation rate, and by controlling the incorporation of imported DNA fragments after natural transformation.

  11. [The Rdh54 protein role in regulation of DNA repair in yeast Saccharomyces cerevisiae].

    Science.gov (United States)

    Latypov, V F; Kozhina, T N; Kozhin, S A; Korolev, V G

    2010-02-01

    In this work, we present the evidences of the involvement of Rdh54 in coordination of DNA repair by several pathways. Previously, we isolated rdh54-29 point mutation demonstrating unique properties different from the full deletion of RDH54 gene. Epistatic interaction between rdh54-29 and apn1delta mutations discloses the function of Rdh54p in the process of base excision repair. However, rdh54-29 mutant exhibits sensitivity to many DNA damaging agents including UV light, methylmethanesulphonate and nitrous acid. Such pleiotrophic effect of rdh54-29 mutation may indicate the role of Rdh54p in the regulation of different DNA repair systems. To check this hypothesis, we estimated the effect of rdh54-29 mutation on recombination and mutagenesis. The data confirm the involvement of Rdh54p in coordination of different DNA repair systems including mutagenic and recombinagenic pathways as well as nucleotide excision repair. Rdh54p presumably operates via chromatin remodulation at the site of damage rendering DNA accessible to the DNA repair enzymes.

  12. Accurate DNA assembly and genome engineering with optimized uracil excision cloning

    DEFF Research Database (Denmark)

    Cavaleiro, Mafalda; Kim, Se Hyeuk; Seppala, Susanna

    2015-01-01

    that produces β-carotene to optimize assembly junctions and the uracil excision protocol. By combining uracil excision cloning with a genomic integration technology, we demonstrate that up to six DNA fragments can be assembled in a one-tube reaction for direct genome integration with high accuracy, greatly...... facilitating the advanced engineering of robust cell factories....

  13. DNA Polymerase Gamma in Mitochondrial DNA Replication and Repair

    Directory of Open Access Journals (Sweden)

    William C. Copeland

    2003-01-01

    Full Text Available Mutations in mitochondrial DNA (mtDNA are associated with aging, and they can cause tissue degeneration and neuromuscular pathologies known as mitochondrial diseases. Because DNA polymerase γ (pol γ is the enzyme responsible for replication and repair of mitochondrial DNA, the burden of faithful duplication of mitochondrial DNA, both in preventing spontaneous errors and in DNA repair synthesis, falls on pol γ. Investigating the biological functions of pol γ and its inhibitors aids our understanding of the sources of mtDNA mutations. In animal cells, pol γ is composed of two subunits, a larger catalytic subunit of 125–140 kDa and second subunit of 35–55 kDa. The catalytic subunit contains DNA polymerase activity, 3’-5’ exonuclease activity, and a 5’-dRP lyase activity. The accessory subunit is required for highly processive DNA synthesis and increases the affinity of pol gamma to the DNA.

  14. Decreased transcription-coupled nucleotide excision repair capacity is associated with increased p53- and MLH1-independent apoptosis in response to cisplatin

    Directory of Open Access Journals (Sweden)

    Smith Jennifer M

    2010-05-01

    Full Text Available Abstract Background One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. Methods RNA interference (RNAi was used to reduce the transcription-coupled nucleotide excision repair (TC-NER capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. Results These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. Conclusion The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic.

  15. Molecular cloning of the human nucleotide-excision-repair gene ERCC4

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, L.H.; Brookman, K.W.; Weber, C.A.; Salazar, E.P. [Lawrence Livermore National Lab., CA (United States); Reardon, J.T.; Sancar, A. [Univ. of North Carolina, Chapel Hill, NC (United States); Deng, Z.; Siciliano, M.J. [Univ. of Texas Cancer Center, Houston, TX (United States)

    1994-07-19

    ERCC4 was previously identified in somatic cell hybrids as a human gene that corrects the nucleotide-excision-repair deficiency in mutant hamster cells. The cloning strategy for ERCC4 involved transfection of the repair-deficient hamster cell line UV41 with a human sCos-1 cosmid library derived from chromosome 16. Enhanced UV resistance was seen with one cosmid-library transformant and two secondary transformants of UV41. Cosmid clones carrying a functional ERCC4 gene were isolated from a library of a second transformant by selecting in Escherichia coli for expression of a linked neomycin-resistance gene that was present in the sCos-1 vector. The cosmids mapped to 16p13.13-p13.2, the location assigned to ERCC4 by using somatic cell hybrids. Upon transfection into UV41, six cosmid clones gave partial correction ranging from 30% to 64%, although all appeared to contain the complete gene. The capacity for in vitro excision of thymine dimers from a plasmid by transformant cell extracts correlated qualitatively with enhanced UV resistance.

  16. Chromatin challenges during DNA replication and repair

    DEFF Research Database (Denmark)

    Groth, Anja; Rocha, Walter; Verreault, Alain

    2007-01-01

    Inheritance and maintenance of the DNA sequence and its organization into chromatin are central for eukaryotic life. To orchestrate DNA-replication and -repair processes in the context of chromatin is a challenge, both in terms of accessibility and maintenance of chromatin organization. To meet...... the challenge of maintenance, cells have evolved efficient nucleosome-assembly pathways and chromatin-maturation mechanisms that reproduce chromatin organization in the wake of DNA replication and repair. The aim of this Review is to describe how these pathways operate and to highlight how the epigenetic...... landscape may be stably maintained even in the face of dramatic changes in chromatin structure....

  17. A Cross-Cancer Genetic Association Analysis of the DNA Repair and DNA Damage Signaling Pathways for Lung, Ovary, Prostate, Breast, and Colorectal Cancer.

    Science.gov (United States)

    Scarbrough, Peter M; Weber, Rachel Palmieri; Iversen, Edwin S; Brhane, Yonathan; Amos, Christopher I; Kraft, Peter; Hung, Rayjean J; Sellers, Thomas A; Witte, John S; Pharoah, Paul; Henderson, Brian E; Gruber, Stephen B; Hunter, David J; Garber, Judy E; Joshi, Amit D; McDonnell, Kevin; Easton, Doug F; Eeles, Ros; Kote-Jarai, Zsofia; Muir, Kenneth; Doherty, Jennifer A; Schildkraut, Joellen M

    2016-01-01

    DNA damage is an established mediator of carcinogenesis, although genome-wide association studies (GWAS) have identified few significant loci. This cross-cancer site, pooled analysis was performed to increase the power to detect common variants of DNA repair genes associated with cancer susceptibility. We conducted a cross-cancer analysis of 60,297 single nucleotide polymorphisms, at 229 DNA repair gene regions, using data from the NCI Genetic Associations and Mechanisms in Oncology (GAME-ON) Network. Our analysis included data from 32 GWAS and 48,734 controls and 51,537 cases across five cancer sites (breast, colon, lung, ovary, and prostate). Because of the unavailability of individual data, data were analyzed at the aggregate level. Meta-analysis was performed using the Association analysis for SubSETs (ASSET) software. To test for genetic associations that might escape individual variant testing due to small effect sizes, pathway analysis of eight DNA repair pathways was performed using hierarchical modeling. We identified three susceptibility DNA repair genes, RAD51B (P associations with cancer risk in the base excision repair, nucleotide excision repair, mismatch repair, and homologous recombination pathways. Only three susceptibility loci were identified, which had all been previously reported. In contrast, hierarchical modeling identified several pleiotropic cancer risk associations in key DNA repair pathways. Results suggest that many common variants in DNA repair genes are likely associated with cancer susceptibility through small effect sizes that do not meet stringent significance testing criteria. ©2015 American Association for Cancer Research.

  18. Mechanisms of Post-Replication DNA Repair

    Directory of Open Access Journals (Sweden)

    Yanzhe Gao

    2017-02-01

    Full Text Available Accurate DNA replication is crucial for cell survival and the maintenance of genome stability. Cells have developed mechanisms to cope with the frequent genotoxic injuries that arise from both endogenous and environmental sources. Lesions encountered during DNA replication are often tolerated by post-replication repair mechanisms that prevent replication fork collapse and avert the formation of DNA double strand breaks. There are two predominant post-replication repair pathways, trans-lesion synthesis (TLS and template switching (TS. TLS is a DNA damage-tolerant and low-fidelity mode of DNA synthesis that utilizes specialized ‘Y-family’ DNA polymerases to replicate damaged templates. TS, however, is an error-free ‘DNA damage avoidance’ mode of DNA synthesis that uses a newly synthesized sister chromatid as a template in lieu of the damaged parent strand. Both TLS and TS pathways are tightly controlled signaling cascades that integrate DNA synthesis with the overall DNA damage response and are thus crucial for genome stability. This review will cover the current knowledge of the primary mediators of post-replication repair and how they are regulated in the cell.

  19. The BER necessities: the repair of DNA damage in human-adapted bacterial pathogens.

    Science.gov (United States)

    van der Veen, Stijn; Tang, Christoph M

    2015-02-01

    During colonization and disease, bacterial pathogens must survive the onslaught of the host immune system. A key component of the innate immune response is the generation of reactive oxygen and nitrogen species by phagocytic cells, which target and disrupt pathogen molecules, particularly DNA, and the base excision repair (BER) pathway is the most important mechanism for the repair of such oxidative DNA damage. In this Review, we discuss how the human-specific pathogens Mycobacterium tuberculosis, Helicobacter pylori and Neisseria meningitidis have evolved specialized mechanisms of DNA repair, particularly their BER pathways, compared with model organisms such as Escherichia coli. This specialization in DNA repair is likely to reflect the distinct niches occupied by these important human pathogens in the host.

  20. Calcium-binding capacity of centrin2 is required for linear POC5 assembly but not for nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Tiago J Dantas

    Full Text Available Centrosomes, the principal microtubule-organising centres in animal cells, contain centrins, small, conserved calcium-binding proteins unique to eukaryotes. Centrin2 binds to xeroderma pigmentosum group C protein (XPC, stabilising it, and its presence slightly increases nucleotide excision repair (NER activity in vitro. In previous work, we deleted all three centrin isoforms present in chicken DT40 cells and observed delayed repair of UV-induced DNA lesions, but no centrosome abnormalities. Here, we explore how centrin2 controls NER. In the centrin null cells, we expressed centrin2 mutants that cannot bind calcium or that lack sites for phosphorylation by regulatory kinases. Expression of any of these mutants restored the UV sensitivity of centrin null cells to normal as effectively as expression of wild-type centrin. However, calcium-binding-deficient and T118A mutants showed greatly compromised localisation to centrosomes. XPC recruitment to laser-induced UV-like lesions was only slightly slower in centrin-deficient cells than in controls, and levels of XPC and its partner HRAD23B were unaffected by centrin deficiency. Interestingly, we found that overexpression of the centrin interactor POC5 leads to the assembly of linear, centrin-dependent structures that recruit other centrosomal proteins such as PCM-1 and NEDD1. Together, these observations suggest that assembly of centrins into complex structures requires calcium binding capacity, but that such assembly is not required for centrin activity in NER.

  1. Deficiency in nucleotide excision repair family gene activity, especially ERCC3, is associated with non-pigmented hair fiber growth.

    Directory of Open Access Journals (Sweden)

    Mei Yu

    Full Text Available We conducted a microarray study to discover gene expression patterns associated with a lack of melanogenesis in non-pigmented hair follicles (HF by microarray. Pigmented and non-pigmented HFs were collected and micro-dissected into the hair bulb (HB and the upper hair sheaths (HS including the bulge region. In comparison to pigmented HS and HBs, nucleotide excision repair (NER family genes ERCC1, ERCC2, ERCC3, ERCC4, ERCC5, ERCC6, XPA, NTPBP, HCNP, DDB2 and POLH exhibited statistically significantly lower expression in non- pigmented HS and HBs. Quantitative PCR verified microarray data and identified ERCC3 as highly differentially expressed. Immunohistochemistry confirmed ERCC3 expression in HF melanocytes. A reduction in ERCC3 by siRNA interference in human melanocytes in vitro reduced their tyrosinase production ability. Our results suggest that loss of NER gene function is associated with a loss of melanin production capacity. This may be due to reduced gene transcription and/or reduced DNA repair in melanocytes which may eventually lead to cell death. These results provide novel information with regard to melanogenesis and its regulation.

  2. DNA Repair and Photoprotection: Mechanisms of Overcoming Environmental Ultraviolet Radiation Exposure in Halophilic Archaea

    Science.gov (United States)

    Jones, Daniel L.; Baxter, Bonnie K.

    2017-01-01

    Halophilic archaea push the limits of life at several extremes. In particular, they are noted for their biochemical strategies in dealing with osmotic stress, low water activity and cycles of desiccation in their hypersaline environments. Another feature common to their habitats is intense ultraviolet (UV) radiation, which is a challenge that microorganisms must overcome. The consequences of high UV exposure include DNA lesions arising directly from bond rearrangement of adjacent bipyrimidines, or indirectly from oxidative damage, which may ultimately result in mutation and cell death. As such, these microorganisms have evolved a number of strategies to navigate the threat of DNA damage, which we differentiate into two categories: DNA repair and photoprotection. Photoprotection encompasses damage avoidance strategies that serve as a “first line of defense,” and in halophilic archaea include pigmentation by carotenoids, mechanisms of oxidative damage avoidance, polyploidy, and genomic signatures that make DNA less susceptible to photodamage. Photolesions that do arise are addressed by a number of DNA repair mechanisms that halophilic archaea efficiently utilize, which include photoreactivation, nucleotide excision repair, base excision repair, and homologous recombination. This review seeks to place DNA damage, repair, and photoprotection in the context of halophilic archaea and the solar radiation of their hypersaline environments. We also provide new insight into the breadth of strategies and how they may work together to produce remarkable UV-resistance for these microorganisms. PMID:29033920

  3. DNA Repair and Photoprotection: Mechanisms of Overcoming Environmental Ultraviolet Radiation Exposure in Halophilic Archaea

    Directory of Open Access Journals (Sweden)

    Daniel L. Jones

    2017-09-01

    Full Text Available Halophilic archaea push the limits of life at several extremes. In particular, they are noted for their biochemical strategies in dealing with osmotic stress, low water activity and cycles of desiccation in their hypersaline environments. Another feature common to their habitats is intense ultraviolet (UV radiation, which is a challenge that microorganisms must overcome. The consequences of high UV exposure include DNA lesions arising directly from bond rearrangement of adjacent bipyrimidines, or indirectly from oxidative damage, which may ultimately result in mutation and cell death. As such, these microorganisms have evolved a number of strategies to navigate the threat of DNA damage, which we differentiate into two categories: DNA repair and photoprotection. Photoprotection encompasses damage avoidance strategies that serve as a “first line of defense,” and in halophilic archaea include pigmentation by carotenoids, mechanisms of oxidative damage avoidance, polyploidy, and genomic signatures that make DNA less susceptible to photodamage. Photolesions that do arise are addressed by a number of DNA repair mechanisms that halophilic archaea efficiently utilize, which include photoreactivation, nucleotide excision repair, base excision repair, and homologous recombination. This review seeks to place DNA damage, repair, and photoprotection in the context of halophilic archaea and the solar radiation of their hypersaline environments. We also provide new insight into the breadth of strategies and how they may work together to produce remarkable UV-resistance for these microorganisms.

  4. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA.

    Science.gov (United States)

    Guzder, S N; Sung, P; Prakash, L; Prakash, S

    1993-06-15

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A-G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. We have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. We also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair.

  5. Base excision repair activities differ in human lung cancer cells and corresponding normal controls

    DEFF Research Database (Denmark)

    Karahalil, Bensu; Bohr, Vilhelm A; De Souza-Pinto, Nadja C

    2010-01-01

    for the repair of oxidized modifications both in nuclear and mitochondrial DNA. In order to ascertain whether diminished BER capacity might account for increased levels of oxidative DNA damage in cancer cells, the activities of BER enzymes in three different lung cancer cell lines and their non......-cancerous counterparts were measured using oligonucleotide substrates with single DNA lesions to assess specific BER enzymes. The activities of four BER enzymes, OGG1, NTH1, UDG and APE1, were compared in mitochondrial and nuclear extracts. For each specific lesion, the repair activities were similar among the three...... cell lines used. However, the specific activities and cancer versus control comparison differed significantly between the nuclear and mitochondrial compartments. OGG1 activity, as measured by 8-oxodA incision, was up-regulated in cancer cell mitochondria but down-regulated in the nucleus when compared...

  6. Molecular Mechanisms of Ultraviolet Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Rajesh P. Rastogi

    2010-01-01

    Full Text Available DNA is one of the prime molecules, and its stability is of utmost importance for proper functioning and existence of all living systems. Genotoxic chemicals and radiations exert adverse effects on genome stability. Ultraviolet radiation (UVR (mainly UV-B: 280–315 nm is one of the powerful agents that can alter the normal state of life by inducing a variety of mutagenic and cytotoxic DNA lesions such as cyclobutane-pyrimidine dimers (CPDs, 6-4 photoproducts (6-4PPs, and their Dewar valence isomers as well as DNA strand breaks by interfering the genome integrity. To counteract these lesions, organisms have developed a number of highly conserved repair mechanisms such as photoreactivation, base excision repair (BER, nucleotide excision repair (NER, and mismatch repair (MMR. Additionally, double-strand break repair (by homologous recombination and nonhomologous end joining, SOS response, cell-cycle checkpoints, and programmed cell death (apoptosis are also operative in various organisms with the expense of specific gene products. This review deals with UV-induced alterations in DNA and its maintenance by various repair mechanisms.

  7. Association of DNA repair gene XRCC1 and lung cancer susceptibility among nonsmoking Chinese women

    DEFF Research Database (Denmark)

    Yin, J.; Vogel, Ulla Birgitte; Ma, Y.

    2009-01-01

    Nonsmokers who develop lung cancer provide a good model for investigating the effect of genetic polymorphisms. XRCC1 is one of the major DNA repair proteins involved in the base-excision repair pathway. XRCC1 gene variations may lead to lower DNA repair capacity and thus confer inherited predispo......Nonsmokers who develop lung cancer provide a good model for investigating the effect of genetic polymorphisms. XRCC1 is one of the major DNA repair proteins involved in the base-excision repair pathway. XRCC1 gene variations may lead to lower DNA repair capacity and thus confer inherited...... predisposition to cancer risk. To address this question in more detail, we conducted a hospital-based case-control study consisting of 55 lung cancer cases and 74 cancer-free controls matched on age and ethnicity among nonsmoking Chinese women. We analyzed five coding single-nucleotide polymorphisms in the XRCC1...... gene: Agr194Trp, Arg280His, Arg399Gln, Pro206Pro, and Gln632Gln. Polymerase chain reaction-restriction fragment length polymorphism was used for genotyping. Carriers of the variant T-allele of Arg194Trp had a lower lung cancer risk than carriers of CC genotypes [odds ratio (OR)=0.46, 95% confidence...

  8. DNA repair: keeping it together

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2004-01-01

    A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest.......A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest....

  9. Human longevity and variation in DNA damage response and repair: Study of the contribution of sub-processes using competitive gene-set analysis

    DEFF Research Database (Denmark)

    Debrabant, Birgit; Sørensen, Mette; Flachsbart, Friederike

    2014-01-01

    others. Data were applied on 592 SNPs from 77 genes involved in nine sub-processes: DNA-damage response, base excision repair (BER), nucleotide excision repair, mismatch repair, non-homologous end-joining, homologous recombinational repair (HRR), RecQ helicase activities (RECQ), telomere functioning...... and mitochondrial DNA processes. The study population was 1089 long-lived and 736 middle-aged Danes. A self-contained set-based test of all SNPs displayed association with longevity (P-value=9.9 × 10-5), supporting that the overall pathway could affect longevity. Investigation of the nine sub-processes using...

  10. Biomarkers of oxidative damage to DNA and repair

    DEFF Research Database (Denmark)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone

    2008-01-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation......, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7......,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine...

  11. Oxidative stress alters base excision repair pathway and increases apoptotic response in apurinic/apyrimidinic endonuclease 1/redox factor-1 haploinsufficient mice.

    Science.gov (United States)

    Unnikrishnan, Archana; Raffoul, Julian J; Patel, Hiral V; Prychitko, Thomas M; Anyangwe, Njwen; Meira, Lisiane B; Friedberg, Errol C; Cabelof, Diane C; Heydari, Ahmad R

    2009-06-01

    Apurinic/apyrimidinic endonuclease 1/redox factor-1 (APE1/Ref-1) is the redox regulator of multiple stress-inducible transcription factors, such as NF-kappaB, and the major 5'-endonuclease in base excision repair (BER). We utilized mice containing a heterozygous gene-targeted deletion of APE1/Ref-1 (Apex(+/-)) to determine the impact of APE1/Ref-1 haploinsufficiency on the processing of oxidative DNA damage induced by 2-nitropropane (2-NP) in the liver tissue of mice. APE1/Ref-1 haploinsufficiency results in a significant decline in NF-kappaB DNA-binding activity in response to oxidative stress in liver. In addition, loss of APE1/Ref-1 increases the apoptotic response to oxidative stress, in which significant increases in GADD45g expression, p53 protein stability, and caspase activity are observed. Oxidative stress displays a differential impact on monofunctional (UNG) and bifunctional (OGG1) DNA glycosylase-initiated BER in the liver of Apex(+/-) mice. APE1/Ref-1 haploinsufficiency results in a significant decline in the repair of oxidized bases (e.g., 8-OHdG), whereas removal of uracil is increased in liver nuclear extracts of mice using an in vitro BER assay. Apex(+/-) mice exposed to 2-NP displayed a significant decline in 3'-OH-containing single-strand breaks and an increase in aldehydic lesions in their liver DNA, suggesting an accumulation of repair intermediates of failed bifunctional DNA glycosylase-initiated BER.

  12. Sensitivity of excision repair in normal human, xeroderma pigmentosum variant and Cockayne's syndrome fibroblasts to inhibition by cytosine arabinoside

    Energy Technology Data Exchange (ETDEWEB)

    Cleaver, J.E.

    1981-08-01

    Inhibition of the gap-filling, polymerizing step of excision repair by 1-..beta..-D-arabinofuranosylcytosine (ara-C) after irradiation with ultraviolet light in human diploid fibroblasts resulted in the formation of persistent DNA strand breaks in G/sub 1/, G/sub 2/, and plateau phase cells, but not in S phase cells. Addition of hydroxyurea to ara-C resulted in partial inhibition of repair in S phase cells. These observations can be explained either in terms of changing roles in repair for different DNA polymerases throughout the cell cycle or by the presence of a pool of deoxycytidine nucleotides during S phase equivalent to an external source of deoxycytidine at 50 ..mu..M concentration. A similar concentration dependence on ara-C was observed for inhibition of repair in normal human, xeroderma pigmentosum (XP) variant, and Cockayne's syndrome cells. Ara-C produced a similar number of breaks in normal and Cockayne's syndrome cells. Ara-C produced a similar number of breaks in normal and Cockayne's syndrome cells but slightly more in XP variant cells. Exonuclease III and S1 nuclease independently both degraded about 50% of the /sup 3/H-thymidine incorporated into repaired regions in the presence of ara-C. Sequential digestion with both enzymes degraded nearly 90% of the repaired regions. These observations can be explained if excision repair proceeds by displacing the damaged strand so that both the /sup 3/H-labeled patch and the damaged region are still ligated to high molecular weight DNA and compete for the same complementary strand during in vitro incubation with the nucleases. The amount of /sup 3/H-thymidine incorporated in DNA by repair decreased with increasing concentrations of ara-C and hydroxyurea, suggesting that the incomplete patches became shorter under these conditions. Extrapolation of the digestion kinetics with exonuclease III permits an estimate of the normal patch size of about 100 nucleotides, consistent with previous estimates.

  13. SERIES: Genomic instability in cancer Balancing repair and tolerance of DNA damage caused by alkylating agents

    Science.gov (United States)

    Fu, Dragony; Calvo, Jennifer A.; Samson, Leona D

    2013-01-01

    Alkylating agents comprise a major class of frontline chemotherapeutic drugs that inflict cytotoxic DNA damage as their main mode of action, in addition to collateral mutagenic damage. Numerous cellular pathways, including direct DNA damage reversal, base excision repair (BER), and mismatch repair (MMR) respond to alkylation damage to defend against alkylation-induced cell death or mutation. However, maintaining a proper balance of activity both within and between these pathways is crucial for an organism's favorable response to alkylating agents. Furthermore, an individual's response to alkylating agents can vary considerably from tissue to tissue and from person to person, pointing to genetic and epigenetic mechanisms that modulate alkylating agent toxicity. PMID:22237395

  14. Human DNA repair disorders in dermatology: A historical perspective, current concepts and new insight.

    Science.gov (United States)

    Moriwaki, Shinichi

    2016-02-01

    Products of DNA damage, such as cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts (6-4 PPs), are continually formed in genomes after exposure to UV radiation. When these DNA damages remain unrepaired in essential DNA sites for prolonged periods, DNA replication and transcription are hampered or mutation is induced, which may cause cell death, cellular senescence, and carcinogenesis of the skin. To protect against such UV-induced DNA damage, living organisms nicely retain "DNA repair systems", which can efficiently repair "harmful" DNA damage through precise mechanisms by the integrated functions of many proteins. In humans, the failure of DNA repair systems causes a variety of disorders. Dermatological conditions such as hereditary photodermatoses, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are caused by congenital functional defects in the nucleotide excision repair (NER) system or the translesion synthesis (TLS) system. In this review, we describe the historical progress, recent findings, and future prospects of studies of human diseases associated with DNA-repair defects. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. The Effect of Msh2 Knockdown on Toxicity Induced by tert-Butyl-hydroperoxide, Potassium Bromate, and Hydrogen Peroxide in Base Excision Repair Proficient and Deficient Cells

    Directory of Open Access Journals (Sweden)

    N. Cooley

    2013-01-01

    Full Text Available The DNA mismatch repair (MMR and base excision repair (BER systems are important determinants of cellular toxicity following exposure to agents that cause oxidative DNA damage. To examine the interactions between these different repair systems, we examined whether toxicity, induced by t-BOOH and KBrO3, differs in BER proficient (Mpg+/+, Nth1+/+ and deficient (Mpg−/−, Nth1−/− mouse embryonic fibroblasts (MEFs following Msh2 knockdown of between 79 and 88% using an shRNA expression vector. Msh2 knockdown in Nth1+/+ cells had no effect on t-BOOH and KBrO3 induced toxicity as assessed by an MTT assay; knockdown in Nth1−/− cells resulted in increased resistance to t-BOOH and KBrO3, a result consistent with Nth1 removing oxidised pyrimidines. Msh2 knockdown in Mpg+/+ cells had no effect on t-BOOH toxicity but increased resistance to KBrO3; in Mpg−/− cells, Msh2 knockdown increased cellular sensitivity to KBrO3 but increased resistance to t-BOOH, suggesting a role for Mpg in removing DNA damage induced by these agents. MSH2 dependent and independent pathways then determine cellular toxicity induced by oxidising agents. A complex interaction between MMR and BER repair systems, that is, exposure dependent, also exists to determine cellular toxicity.

  16. The Effect of Msh2 Knockdown on Toxicity Induced by tert-Butyl-hydroperoxide, Potassium Bromate, and Hydrogen Peroxide in Base Excision Repair Proficient and Deficient Cells

    Science.gov (United States)

    Cooley, N.; Elder, R. H.; Povey, A. C.

    2013-01-01

    The DNA mismatch repair (MMR) and base excision repair (BER) systems are important determinants of cellular toxicity following exposure to agents that cause oxidative DNA damage. To examine the interactions between these different repair systems, we examined whether toxicity, induced by t-BOOH and KBrO3, differs in BER proficient (Mpg +/+, Nth1 +/+) and deficient (Mpg −/−, Nth1 −/−) mouse embryonic fibroblasts (MEFs) following Msh2 knockdown of between 79 and 88% using an shRNA expression vector. Msh2 knockdown in Nth1 +/+ cells had no effect on t-BOOH and KBrO3 induced toxicity as assessed by an MTT assay; knockdown in Nth1 −/− cells resulted in increased resistance to t-BOOH and KBrO3, a result consistent with Nth1 removing oxidised pyrimidines. Msh2 knockdown in Mpg +/+ cells had no effect on t-BOOH toxicity but increased resistance to KBrO3; in Mpg −/− cells, Msh2 knockdown increased cellular sensitivity to KBrO3 but increased resistance to t-BOOH, suggesting a role for Mpg in removing DNA damage induced by these agents. MSH2 dependent and independent pathways then determine cellular toxicity induced by oxidising agents. A complex interaction between MMR and BER repair systems, that is, exposure dependent, also exists to determine cellular toxicity. PMID:23984319

  17. Cloning, comparative mapping, and RNA expression of the mouse homologues of the Saccharomyces cerevisiae nucleotide excision repair gene RAD23.

    NARCIS (Netherlands)

    P.J. van der Spek (Peter); C.E. Visser (Cécile); F. Hanaoka (Fumio); B. Smit (Bep); A. Hagemeijer (Anne); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1996-01-01

    textabstractThe Saccharomyces cerevisiae RAD23 gene is involved in nucleotide excision repair (NER). Two human homologs of RAD23, HHR23A and HHR23B (HGMW-approved symbols RAD23A and RAD23B), were previously isolated. The HHR23B protein is complexed with the protein defective in the cancer-prone

  18. A Ubiquitin-Binding Domain in Cockayne Syndrome B Required for Transcription-Coupled Nucleotide Excision Repair

    NARCIS (Netherlands)

    R. Anindya (Roy); P.O. Mari (Pierre-Olivier); U. Kristensen (Ulrik); H.J.M. Kool (Hanneke); G. Giglia-Mari (Giuseppina); L.H.F. Mullenders (Leon); M.I. Fousteri (Maria); W. Vermeulen (Wim); J-M. Egly (Jean-Marc); J.Q. Svejstrup (Jesper)

    2010-01-01

    textabstractTranscription-coupled nucleotide excision repair (TC-NER) allows RNA polymerase II (RNAPII)-blocking lesions to be rapidly removed from the transcribed strand of active genes. Defective TCR in humans is associated with Cockayne syndrome (CS), typically caused by defects in either CSA or

  19. 40 CFR 798.5500 - Differential growth inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA...

    Science.gov (United States)

    2010-07-01

    ... repair proficient and repair deficient bacteria: âBacterial DNA damage or repair tests.â 798.5500 Section... inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA damage or repair tests.” (a... killing or growth inhibition of repair deficient bacteria in a set of repair proficient and deficient...

  20. Expression of DNA repair genes in burned skin exposed to low-level red laser.

    Science.gov (United States)

    Trajano, Eduardo Tavares Lima; Mencalha, Andre Luiz; Monte-Alto-Costa, Andréa; Pôrto, Luís Cristóvão; de Souza da Fonseca, Adenilson

    2014-11-01

    Although red laser lights lie in the region of non-ionizing radiations in the electromagnetic spectrum, there are doubts whether absorption of these radiations causes lesions in the DNA molecule. Our aim was to investigate the expression of the genes involved with base excision and nucleotide excision repair pathways in skin tissue submitted to burn injury and exposed to low-level red laser. Wistar rats were divided as follows: control group-rats burned and not irradiated, laser group-rats burned and irradiated 1 day after injury for five consecutive days, and later laser group-rats injured and treated 4 days after injury for five consecutive days. Irradiation was performed according to a clinical protocol (20 J/cm(2), 100 mW, continuous wave emission mode). The animals were sacrificed on day 10, and scarred tissue samples were withdrawn for total RNA extraction, complementary DNA (cDNA) synthesis, and evaluation of gene expression by quantitative polymerase chain reaction. Low-level red laser exposure (1) reduces the expression of APE1 messenger (mRNA), (2) increases the expression of OGG1 mRNA, (3) reduces the expression of XPC mRNA, and (4) increases the expression of XPA mRNA both in laser and later laser groups. Red laser exposure at therapeutic fluences alters the expression of genes related to base excision and nucleotide excision pathways of DNA repair during wound healing of burned skin.

  1. Repair of DNA damage induced by anthanthrene, a polycyclic aromatic hydrocarbon (PAH) without bay or fjord regions

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Johannessen, Christian; Rasmussen, Lene Juel

    2009-01-01

    is known about the repair of DNA damage resulting from metabolites from PAHs without bay and fjord regions. We have investigated the six-ringed PAH anthanthrene (dibenzo[def,mno]chrysene), which does not posses bay or fjord motifs. We analyzed the repair profile of human cell extracts and of cell cultures...... in response to DNA damage induced by cytochrome P450-activated anthanthrene. In cell extracts, functional nucleotide excision repair (NER) and mismatch repair (MMR) activities were necessary to trigger a response to anthanthrene metabolite-induced DNA damage. In cell cultures, NER was responsible...... proposed for metabolic activation of PAHs involves the cytochrome P450 enzymes. The DNA damaging potential of cytochrome P450-activated PAHs is generally associated with their bay and fjord regions, and the DNA repair response of PAHs containing such regions has been thoroughly studied. However, little...

  2. ATP-Dependent Chromatin Remodeling Is Required for Base Excision Repair in Conventional but Not in Variant H2A.Bbd Nucleosomes▿

    Science.gov (United States)

    Menoni, Hervé; Gasparutto, Didier; Hamiche, Ali; Cadet, Jean; Dimitrov, Stefan; Bouvet, Philippe; Angelov, Dimitar

    2007-01-01

    In eukaryotes, base excision repair (BER) is responsible for the repair of oxidatively generated lesions. The mechanism of BER on naked DNA substrates has been studied in detail, but how it operates on chromatin remains unclear. Here we have studied the mechanism of BER by introducing a single 8-oxo-7,8-dihydroguanine (8-oxoG) lesion in the DNA of reconstituted positioned conventional and histone variant H2A.Bbd nucleosomes. We found that 8-oxoguanine DNA glycosylase, apurinic/apyrimidinic endonuclease, and polymerase β activities were strongly reduced in both types of nucleosomes. In conventional nucleosomes SWI/SNF stimulated the processing of 8-oxoG by each one of the three BER repair factors to efficiencies similar to those for naked DNA. Interestingly, SWI/SNF-induced remodeling, but not mobilization of conventional nucleosomes, was required to achieve this effect. A very weak effect of SWI/SNF on the 8-oxoG BER removal in H2A.Bbd histone variant nucleosomes was observed. The possible implications of our data for the understanding of in vivo mechanisms of BER are discussed. PMID:17591702

  3. A lncRNA to repair DNA

    DEFF Research Database (Denmark)

    Lukas, Jiri; Altmeyer, Matthias

    2015-01-01

    Long non-coding RNAs (lncRNAs) have emerged as regulators of various biological processes, but to which extent lncRNAs play a role in genome integrity maintenance is not well understood. In this issue of EMBO Reports, Sharma et al [1] identify the DNA damage-induced lncRNA DDSR1 as an integral...... player of the DNA damage response (DDR). DDSR1 has both an early role by modulating repair pathway choices, and a later function when it regulates gene expression. Sharma et al [1] thus uncover a dual role for a hitherto uncharacterized lncRNA during the cellular response to DNA damage....

  4. Exonuclease 1 and its versatile roles in DNA repair

    DEFF Research Database (Denmark)

    Keijzers, Guido; Liu, Dekang; Rasmussen, Lene Juel

    2016-01-01

    Exonuclease 1 (EXO1) is a multifunctional 5' → 3' exonuclease and a DNA structure-specific DNA endonuclease. EXO1 plays roles in DNA replication, DNA mismatch repair (MMR) and DNA double-stranded break repair (DSBR) in lower and higher eukaryotes and contributes to meiosis, immunoglobulin...

  5. Ancient bacteria show evidence of DNA repair

    DEFF Research Database (Denmark)

    Johnson, Sarah Stewart; Hebsgaard, Martin B; Christensen, Torben R

    2007-01-01

    Recent claims of cultivable ancient bacteria within sealed environments highlight our limited understanding of the mechanisms behind long-term cell survival. It remains unclear how dormancy, a favored explanation for extended cellular persistence, can cope with spontaneous genomic decay over...... geological timescales. There has been no direct evidence in ancient microbes for the most likely mechanism, active DNA repair, or for the metabolic activity necessary to sustain it. In this paper, we couple PCR and enzymatic treatment of DNA with direct respiration measurements to investigate long...... that this long-term survival is closely tied to cellular metabolic activity and DNA repair that over time proves to be superior to dormancy as a mechanism in sustaining bacteria viability....

  6. Hepatitis B virus X protein impedes the DNA repair via its association with transcription factor, TFIIH

    Directory of Open Access Journals (Sweden)

    AbdeL-Hafiz Hany

    2011-03-01

    Full Text Available Abstract Background Hepatitis B virus (HBV infections play an important role in the development of hepatocellular carcinoma (HCC. HBV X protein (HBx is a multifunctional protein that can modulate various cellular processes and plays a crucial role in the pathogenesis of HCC. HBx is known to interact with DNA helicase components of TFIIH, a basal transcriptional factor and an integral component of DNA excision repair. Results In this study, the functional relevance of this association was further investigated in the context to DNA repair. By site-directed mutagenesis HBx's critical residues for interaction with TFIIH were identified. Similarly, TFIIH mutants lacking ATPase domain and the conserved carboxyl-terminal domain failed to interact with HBx. Yeast and mammalian cells expressing HBxwt conferred hypersensitivity to UV irradiation, which is interpreted as a basic deficiency in nucleotide excision repair. HBxmut120 (Glu to Val was defective in binding to TFIIH and failed to respond to UV. Conclusions We conclude that HBx may act as the promoting factor by inhibiting DNA repair causing DNA damage and accumulation of errors, thereby contributing to HCC development.

  7. Photodynamic DNA damage induced by phycocyanin and its repair in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    M. Pádula

    1999-09-01

    Full Text Available In the present study, we analyzed DNA damage induced by phycocyanin (PHY in the presence of visible light (VL using a set of repair endonucleases purified from Escherichia coli. We demonstrated that the profile of DNA damage induced by PHY is clearly different from that induced by molecules that exert deleterious effects on DNA involving solely singlet oxygen as reactive species. Most of PHY-induced lesions are single strand breaks and, to a lesser extent, base oxidized sites, which are recognized by Nth, Nfo and Fpg enzymes. High pressure liquid chromatography coupled to electrochemical detection revealed that PHY photosensitization did not induce 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo at detectable levels. DNA repair after PHY photosensitization was also investigated. Plasmid DNA damaged by PHY photosensitization was used to transform a series of Saccharomyces cerevisiae DNA repair mutants. The results revealed that plasmid survival was greatly reduced in rad14 mutants, while the ogg1 mutation did not modify the plasmid survival when compared to that in the wild type. Furthermore, plasmid survival in the ogg1 rad14 double mutant was not different from that in the rad14 single mutant. The results reported here indicate that lethal lesions induced by PHY plus VL are repaired differently by prokaryotic and eukaryotic cells. Morever, nucleotide excision repair seems to play a major role in the recognition and repair of these lesions in Saccharomyces cerevisiae.

  8. In TFIIH, XPD helicase is exclusively devoted to DNA repair.

    Directory of Open Access Journals (Sweden)

    Jochen Kuper

    2014-09-01

    Full Text Available The eukaryotic XPD helicase is an essential subunit of TFIIH involved in both transcription and nucleotide excision repair (NER. Mutations in human XPD are associated with several inherited diseases such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. We performed a comparative analysis of XPD from Homo sapiens and Chaetomium thermophilum (a closely related thermostable fungal orthologue to decipher the different molecular prerequisites necessary for either transcription or DNA repair. In vitro and in vivo assays demonstrate that mutations in the 4Fe4S cluster domain of XPD abrogate the NER function of TFIIH and do not affect its transcriptional activity. We show that the p44-dependent activation of XPD is promoted by the stimulation of its ATPase activity. Furthermore, we clearly demonstrate that XPD requires DNA binding, ATPase, and helicase activity to function in NER. In contrast, these enzymatic properties are dispensable for transcription initiation. XPD helicase is thus exclusively devoted to NER and merely acts as a structural scaffold to maintain TFIIH integrity during transcription.

  9. Erythrosine B and quinoline yellow dyes regulate DNA repair gene expression in human HepG2 cells.

    Science.gov (United States)

    Chequer, Farah Md; Venancio, Vinicius P; Almeida, Mara R; Aissa, Alexandre F; Bianchi, Maria Lourdes P; Antunes, Lusânia Mg

    2017-10-01

    Erythrosine B (ErB) is a cherry pink food colorant and is widely used in foods, drugs, and cosmetics. Quinoline yellow (QY) is a chinophthalon derivative used in cosmetic compositions for application to the skin, lips, and/or body surface. Previously, ErB and QY synthetic dyes were found to induce DNA damage in HepG2 cells. The aim of this study was to investigate the molecular basis underlying the genotoxicity attributed to ErB and QY using the RT2 Profiler polymerase chain reaction array and by analyzing the expression profile of 84 genes involved in cell cycle arrest, apoptosis, and DNA repair in HepG2 cells. ErB (70 mg/L) significantly decreased the expression of two genes ( FEN1 and REV1) related to DNA base repair. One gene ( LIG1) was downregulated and 20 genes related to ATR/ATM signaling ( ATR, RBBP8, RAD1, CHEK1, CHEK2, TOPB1), nucleotide excision repair ( ERCC1, XPA), base excision repair ( FEN1, MBD4), mismatch repair ( MLH1, MSH3, TP73), double strand break repair ( BLM), other DNA repair genes ( BRIP1, FANCA, GADD45A, REV1), and apoptosis ( BAX, PPP1R15A) were significantly increased after treatment with QY (20 mg/L). In conclusion, our data suggest that the genotoxic mechanism of ErB and QY dyes involves the modulation of genes related to the DNA repair system and cell cycle.

  10. RAD51 interconnects between DNA replication, DNA repair and immunity.

    Science.gov (United States)

    Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame

    2017-05-05

    RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. First reported patient with human ERCC1 deficiency has cerebro-oculo-facio-skeletal syndrome with a mild defect in nucleotide excision repair and severe developmental failure.

    Science.gov (United States)

    Jaspers, Nicolaas G J; Raams, Anja; Silengo, Margherita Cirillo; Wijgers, Nils; Niedernhofer, Laura J; Robinson, Andria Rasile; Giglia-Mari, Giuseppina; Hoogstraten, Deborah; Kleijer, Wim J; Hoeijmakers, Jan H J; Vermeulen, Wim

    2007-03-01

    Nucleotide excision repair (NER) is a genome caretaker mechanism responsible for removing helix-distorting DNA lesions, most notably ultraviolet photodimers. Inherited defects in NER result in profound photosensitivity and the cancer-prone syndrome xeroderma pigmentosum (XP) or two progeroid syndromes: Cockayne and trichothiodystrophy syndromes. The heterodimer ERCC1-XPF is one of two endonucleases required for NER. Mutations in XPF are associated with mild XP and rarely with progeria. Mutations in ERCC1 have not been reported. Here, we describe the first case of human inherited ERCC1 deficiency. Patient cells showed moderate hypersensitivity to ultraviolet rays and mitomycin C, yet the clinical features were very severe and, unexpectedly, were compatible with a diagnosis of cerebro-oculo-facio-skeletal syndrome. This discovery represents a novel complementation group of patients with defective NER. Further, the clinical severity, coupled with a relatively mild repair defect, suggests novel functions for ERCC1.

  13. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  14. Human telomeres are hypersensitive to UV-induced DNA Damage and refractory to repair.

    Directory of Open Access Journals (Sweden)

    Patrick J Rochette

    2010-04-01

    Full Text Available Telomeric repeats preserve genome integrity by stabilizing chromosomes, a function that appears to be important for both cancer and aging. In view of this critical role in genomic integrity, the telomere's own integrity should be of paramount importance to the cell. Ultraviolet light (UV, the preeminent risk factor in skin cancer development, induces mainly cyclobutane pyrimidine dimers (CPD which are both mutagenic and lethal. The human telomeric repeat unit (5'TTAGGG/CCCTAA3' is nearly optimal for acquiring UV-induced CPD, which form at dipyrimidine sites. We developed a ChIP-based technique, immunoprecipitation of DNA damage (IPoD, to simultaneously study DNA damage and repair in the telomere and in the coding regions of p53, 28S rDNA, and mitochondrial DNA. We find that human telomeres in vivo are 7-fold hypersensitive to UV-induced DNA damage. In double-stranded oligonucleotides, this hypersensitivity is a property of both telomeric and non-telomeric repeats; in a series of telomeric repeat oligonucleotides, a phase change conferring UV-sensitivity occurs above 4 repeats. Furthermore, CPD removal in the telomere is almost absent, matching the rate in mitochondria known to lack nucleotide excision repair. Cells containing persistent high levels of telomeric CPDs nevertheless proliferate, and chronic UV irradiation of cells does not accelerate telomere shortening. Telomeres are therefore unique in at least three respects: their biophysical UV sensitivity, their prevention of excision repair, and their tolerance of unrepaired lesions. Utilizing a lesion-tolerance strategy rather than repair would prevent double-strand breaks at closely-opposed excision repair sites on opposite strands of a damage-hypersensitive repeat.

  15. Expression of a Human Cytochrome P450 in Yeast Permits Analysis of Pathways for Response to and Repair of Aflatoxin-Induced DNA Damage†

    Science.gov (United States)

    Guo, Yingying; Breeden, Linda L.; Zarbl, Helmut; Preston, Bradley D.; Eaton, David L.

    2005-01-01

    Aflatoxin B1 (AFB1) is a human hepatotoxin and hepatocarcinogen produced by the mold Aspergillus flavus. In humans, AFB1 is primarily bioactivated by cytochrome P450 1A2 (CYP1A2) and 3A4 to a genotoxic epoxide that forms N7-guanine DNA adducts. A series of yeast haploid mutants defective in DNA repair and cell cycle checkpoints were transformed with human CYP1A2 to investigate how these DNA adducts are repaired. Cell survival and mutagenesis following aflatoxin B1 treatment was assayed in strains defective in nucleotide excision repair (NER) (rad14), postreplication repair (PRR) (rad6, rad18, mms2, and rad5), homologous recombinational repair (HRR) (rad51 and rad54), base excision repair (BER) (apn1 apn2), nonhomologous end-joining (NHEJ) (yku70), mismatch repair (MMR) (pms1), translesion synthesis (TLS) (rev3), and checkpoints (mec1-1, mec1-1 rad53, rad9, and rad17). Together our data suggest the involvement of homologous recombination and nucleotide excision repair, postreplication repair, and checkpoints in the repair and/or tolerance of AFB1-induced DNA damage in the yeast model. Rev3 appears to mediate AFB1-induced mutagenesis when error-free pathways are compromised. The results further suggest unique roles for Rad5 and abasic endonuclease-dependent DNA intermediates in regulating AFB1-induced mutagenicity. PMID:15988000

  16. Expression of a human cytochrome p450 in yeast permits analysis of pathways for response to and repair of aflatoxin-induced DNA damage.

    Science.gov (United States)

    Guo, Yingying; Breeden, Linda L; Zarbl, Helmut; Preston, Bradley D; Eaton, David L

    2005-07-01

    Aflatoxin B1 (AFB1) is a human hepatotoxin and hepatocarcinogen produced by the mold Aspergillus flavus. In humans, AFB1 is primarily bioactivated by cytochrome P450 1A2 (CYP1A2) and 3A4 to a genotoxic epoxide that forms N7-guanine DNA adducts. A series of yeast haploid mutants defective in DNA repair and cell cycle checkpoints were transformed with human CYP1A2 to investigate how these DNA adducts are repaired. Cell survival and mutagenesis following aflatoxin B1 treatment was assayed in strains defective in nucleotide excision repair (NER) (rad14), postreplication repair (PRR) (rad6, rad18, mms2, and rad5), homologous recombinational repair (HRR) (rad51 and rad54), base excision repair (BER) (apn1 apn2), nonhomologous end-joining (NHEJ) (yku70), mismatch repair (MMR) (pms1), translesion synthesis (TLS) (rev3), and checkpoints (mec1-1, mec1-1 rad53, rad9, and rad17). Together our data suggest the involvement of homologous recombination and nucleotide excision repair, postreplication repair, and checkpoints in the repair and/or tolerance of AFB1-induced DNA damage in the yeast model. Rev3 appears to mediate AFB1-induced mutagenesis when error-free pathways are compromised. The results further suggest unique roles for Rad5 and abasic endonuclease-dependent DNA intermediates in regulating AFB1-induced mutagenicity.

  17. The DNA translocase RAD5A acts independently of the other main DNA repair pathways, and requires both its ATPase and RING domain for activity in Arabidopsis thaliana.

    Science.gov (United States)

    Klemm, Tobias; Mannuß, Anja; Kobbe, Daniela; Knoll, Alexander; Trapp, Oliver; Dorn, Annika; Puchta, Holger

    2017-08-01

    Multiple pathways exist to repair DNA damage induced by methylating and crosslinking agents in Arabidopsis thaliana. The SWI2/SNF2 translocase RAD5A, the functional homolog of budding yeast Rad5 that is required for the error-free branch of post-replicative repair, plays a surprisingly prominent role in the repair of both kinds of lesions in Arabidopsis. Here we show that both the ATPase domain and the ubiquitination function of the RING domain of the Arabidopsis protein are essential for the cellular response to different forms of DNA damage. To define the exact role of RAD5A within the complex network of DNA repair pathways, we crossed the rad5a mutant line with mutants of different known repair factors of Arabidopsis. We had previously shown that RAD5A acts independently of two main pathways of replication-associated DNA repair defined by the helicase RECQ4A and the endonuclease MUS81. The enhanced sensitivity of all double mutants tested in this study indicates that the repair of damaged DNA by RAD5A also occurs independently of nucleotide excision repair (AtRAD1), single-strand break repair (AtPARP1), as well as microhomology-mediated double-strand break repair (AtTEB). Moreover, RAD5A can partially complement for a deficient AtATM-mediated DNA damage response in plants, as the double mutant shows phenotypic growth defects. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  18. B lymphocytes of xeroderma pigmentosum or Cockayne syndrome patients with inherited defects in nucleotide excision repair are fully capable of somatic hypermutation of immunoglobulin genes.

    Science.gov (United States)

    Kim, N; Kage, K; Matsuda, F; Lefranc, M P; Storb, U

    1997-08-04

    Recent experiments have strongly suggested that the process of somatic mutation is linked to transcription initiation. It was postulated that a mutator factor loads onto the RNA polymerase and, during elongation, causes transcriptional arrest that activates DNA repair, thus occasionally causing errors in the DNA sequence. We report the analysis of the role of one of the known DNA repair systems, nucleotide excision repair (NER), in somatic mutation. Epstein-Barrvirus-transformed B cells from patients with defects in NER (XP-B, XP-D, XP-V, and CS-A) were studied. Their heavy and light chain genes show a high frequency of point mutations in the variable (V), but not in the constant (C) regions. This suggests that these B cells can undergo somatic hypermutation despite significant defects in NER. Thus, it is doubtful that NER is an essential part of the mechanism of somatic hypermutation of Ig genes. As an aside, NER seems also not involved in Ig gene switch recombination.

  19. The role of base excision repair in the development of primary open angle glaucoma in the Polish population

    Energy Technology Data Exchange (ETDEWEB)

    Cuchra, Magda; Markiewicz, Lukasz; Mucha, Bartosz [Department of Clinical Chemistry and Biochemistry, Medical University of Lodz (Poland); Pytel, Dariusz [The Abramson Family Cancer Research Institute, Department of Cancer Biology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104 (United States); Department of Biochemistry and Molecular Biology, Hollings Cancer Center, Medical University of South Carolina, Charleston, SC 29425 (United States); Szymanek, Katarzyna [Department of Ophthalmology, Medical University of Warsaw, SPKSO Hospital, Warsaw (Poland); Szemraj, Janusz [Department of Medical Biochemistry, Medical University of Lodz, Lodz (Poland); Szaflik, Jerzy; Szaflik, Jacek P. [Department of Ophthalmology, Medical University of Warsaw, SPKSO Hospital, Warsaw (Poland); Majsterek, Ireneusz, E-mail: ireneusz.majsterek@umed.lodz.pl [Department of Clinical Chemistry and Biochemistry, Medical University of Lodz (Poland)

    2015-08-15

    Highlights: • We suggested the association of XRCC1 gene with the increase risk of POAG development. • We indicated the association of clinical factor and XRCC1, MUTYH, ADPRT and APE1 genes with POAG progression. • We postulated the increase level of oxidative DNA damage in group of patients with POAG in relation to healthy controls. • We suggested the slightly decrease ability to repair of oxidative DNA damage. • This is the first data that showed the role of BER mechanism in POAG pathogenesis. - Abstract: Glaucoma is a leading cause of irreversible blindness in developing countries. Previous data have shown that progressive loss of human TM cells may be connected with chronic exposure to oxidative stress. This hypothesis may suggest a role of the base excision repair (BER) pathway of oxidative DNA damage in primary open angle glaucoma (POAG) patients. The aim of our study was to evaluate an association of BER gene polymorphism with a risk of POAG. Moreover, an association of clinical parameters was examined including cup disk ratio (c/d), rim area (RA) and retinal nerve fiber layer (RNFL) with glaucoma progression according to BER gene polymorphisms. Our research included 412 patients with POAG and 454 healthy controls. Gene polymorphisms were analyzed by PCR-RFLP. Heidelberg Retinal Tomography (HRT) clinical parameters were also analyzed. The 399Arg/Gln genotype of the XRCC1 gene (OR 1.38; 95% CI 1.02–1.89 p = 0.03) was associated with an increased risk of POAG occurrence. It was indicated that the 399Gln/Gln XRCC1 genotype might increase the risk of POAG progression according to the c/d ratio (OR 1.67; 95% CI 1.07–2.61 P = 0.02) clinical parameter. Moreover, the association of VF factor with 148Asp/Glu of APE1 genotype distribution and POAG progression (OR 2.25; 95% CI 1.30–3.89) was also found. Additionally, the analysis of the 324Gln/His MUTYH polymorphism gene distribution in the patient group according to RNFL factor showed that it might

  20. DNA Mismatch Repair in Eukaryotes and Bacteria

    Directory of Open Access Journals (Sweden)

    Kenji Fukui

    2010-01-01

    Full Text Available DNA mismatch repair (MMR corrects mismatched base pairs mainly caused by DNA replication errors. The fundamental mechanisms and proteins involved in the early reactions of MMR are highly conserved in almost all organisms ranging from bacteria to human. The significance of this repair system is also indicated by the fact that defects in MMR cause human hereditary nonpolyposis colon cancers as well as sporadic tumors. To date, 2 types of MMRs are known: the human type and Escherichia coli type. The basic features of the former system are expected to be universal among the vast majority of organisms including most bacteria. Here, I review the molecular mechanisms of eukaryotic and bacterial MMR, emphasizing on the similarities between them.

  1. Fragile DNA Repair Mechanism Reduces Ageing in Multicellular Model

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss; Juul, Jeppe Søgaard; Trusina, Ala

    2012-01-01

    DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn i...

  2. Functional capacity of XRCC1 protein variants identified in DNA repair-deficient Chinese hamster ovary cell lines and the human population

    DEFF Research Database (Denmark)

    Berquist, Brian R; Singh, Dharmendra Kumar; Fan, Jinshui

    2010-01-01

    XRCC1 operates as a scaffold protein in base excision repair, a pathway that copes with base and sugar damage in DNA. Studies using recombinant XRCC1 proteins revealed that: a C389Y substitution, responsible for the repair defects of the EM-C11 CHO cell line, caused protein instability; a V86R mu...

  3. Conservation of the nucleotide excision repair pathway: characterization of hydra Xeroderma Pigmentosum group F homolog.

    Directory of Open Access Journals (Sweden)

    Apurva Barve

    Full Text Available Hydra, one of the earliest metazoans with tissue grade organization and nervous system, is an animal with a remarkable regeneration capacity and shows no signs of organismal aging. We have for the first time identified genes of the nucleotide excision repair (NER pathway from hydra. Here we report cloning and characterization of hydra homolog of xeroderma pigmentosum group F (XPF gene that encodes a structure-specific 5' endonuclease which is a crucial component of NER. In silico analysis shows that hydra XPF amino acid sequence is very similar to its counterparts from other animals, especially vertebrates, and shows all features essential for its function. By in situ hybridization, we show that hydra XPF is expressed prominently in the multipotent stem cell niche in the central region of the body column. Ectoderm of the diploblastic hydra was shown to express higher levels of XPF as compared to the endoderm by semi-quantitative RT-PCR. Semi-quantitative RT-PCR analysis also demonstrated that interstitial cells, a multipotent and rapidly cycling stem cell lineage of hydra, express higher levels of XPF mRNA than other cell types. Our data show that XPF and by extension, the NER pathway is highly conserved during evolution. The prominent expression of an NER gene in interstitial cells may have implications for the lack of senescence in hydra.

  4. Conservation of the nucleotide excision repair pathway: characterization of hydra Xeroderma Pigmentosum group F homolog.

    Science.gov (United States)

    Barve, Apurva; Ghaskadbi, Saroj; Ghaskadbi, Surendra

    2013-01-01

    Hydra, one of the earliest metazoans with tissue grade organization and nervous system, is an animal with a remarkable regeneration capacity and shows no signs of organismal aging. We have for the first time identified genes of the nucleotide excision repair (NER) pathway from hydra. Here we report cloning and characterization of hydra homolog of xeroderma pigmentosum group F (XPF) gene that encodes a structure-specific 5' endonuclease which is a crucial component of NER. In silico analysis shows that hydra XPF amino acid sequence is very similar to its counterparts from other animals, especially vertebrates, and shows all features essential for its function. By in situ hybridization, we show that hydra XPF is expressed prominently in the multipotent stem cell niche in the central region of the body column. Ectoderm of the diploblastic hydra was shown to express higher levels of XPF as compared to the endoderm by semi-quantitative RT-PCR. Semi-quantitative RT-PCR analysis also demonstrated that interstitial cells, a multipotent and rapidly cycling stem cell lineage of hydra, express higher levels of XPF mRNA than other cell types. Our data show that XPF and by extension, the NER pathway is highly conserved during evolution. The prominent expression of an NER gene in interstitial cells may have implications for the lack of senescence in hydra.

  5. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay.

    Science.gov (United States)

    Nickson, Catherine M; Parsons, Jason L

    2014-01-01

    Base excision repair (BER) is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss, and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionizing radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation) in the regulation of cellular levels of BER proteins, and that subtle changes (∼20-50%) in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumor suppressor protein ARF, and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A-DDB1-STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA repair

  6. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay

    Directory of Open Access Journals (Sweden)

    Jason Luke Parsons

    2014-07-01

    Full Text Available Base excision repair (BER is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionising radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation in the regulation of cellular levels of BER proteins, and that subtle changes (~20-50 % in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumour suppressor protein ARF and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A-DDB1-STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA

  7. Importance of excision repair cross-complementation group 1 and ribonucleotide reductase M1 as prognostic biomarkers in malignant pleural mesothelioma treated with platinum-based induction chemotherapy followed by surgery.

    Science.gov (United States)

    Frischknecht, Lukas; Meerang, Mayura; Soltermann, Alex; Stahel, Rolf; Moch, Holger; Seifert, Burkhardt; Weder, Walter; Opitz, Isabelle

    2015-06-01

    Survival and response to platinum-based induction chemotherapy are heterogeneous among patients with malignant pleural mesothelioma. The aim of the present study was to assess the prognostic role of DNA repair markers, such as excision repair cross-complementation group 1 and ribonucleotide reductase M1, in multimodally treated patients with malignant pleural mesothelioma. Tumor tissue of a malignant pleural mesothelioma cohort (n = 107) treated with platinum/gemcitabine (n = 46) or platinum/pemetrexed (n = 61) induction chemotherapy followed by extrapleural pneumonectomy was assembled on a tissue microarray. Immunohistochemical expression of excision repair cross-complementation group 1 (nuclear) and ribonucleotide reductase M1 (nuclear and cytoplasmic) was assessed for its prognostic impact (association with overall survival or freedom from recurrence). Patients with high nuclear ribonucleotide reductase M1 expression before chemotherapy showed significantly longer freedom from recurrence (P = .03). When specifically analyzed in the subgroup of patients receiving platinum/gemcitabine followed by extrapleural pneumonectomy, high nuclear ribonucleotide reductase M1 was associated with prolonged freedom from recurrence (P = .03) and overall survival (P = .02). Low excision repair cross-complementation group 1 expression in prechemotherapy tumor tissues was associated with significantly longer freedom from recurrence (P = .04). Nuclear ribonucleotide reductase M1 and excision repair cross-complementation group 1 were independent prognosticators of freedom from recurrence in addition to pT stage in multivariate analysis. In the present study, nuclear ribonucleotide reductase M1 and excision repair cross-complementation group 1 expression were identified as independent prognosticators for freedom from recurrence of malignant pleural mesothelioma in patients undergoing induction chemotherapy followed by extrapleural pneumonectomy. Copyright © 2015 The American

  8. Base excision repair efficiency and mechanism in nuclear extracts are influenced by the ratio between volume of nuclear extraction buffer and nuclei-Implications for comparative studies

    DEFF Research Database (Denmark)

    Akbari, Mansour; Krokan, Hans E

    2012-01-01

    attention. Here we have examined BER activity of nuclear cell extracts from HeLa cells, using as substrate a circular DNA molecule with either uracil or an AP-site in a defined position. We show that BER activity of nuclear extracts from the same batch of cells varies inversely with the volume of nuclear......The base excision repair (BER) pathway corrects many different DNA base lesions and is important for genomic stability. The mechanism of BER cannot easily be investigated in intact cells and therefore in vitro methods that reflect the in vivo processes are in high demand. Reconstitution of BER...... using purified proteins essentially mirror properties of the proteins used, and does not necessarily reflect the mechanism as it occurs in the cell. Nuclear extracts from cultured cells have the capacity to carry out complete BER and can give important information on the mechanism. Furthermore...

  9. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  10. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and neck squamous cell carcinoma (HNSCC). Xeroderma pigmentosum group D (XPD) and X-ray repair cross-complementing proteins 1 (XRCC1) and 3 (XRCC3) genes are involved in DNA repair ...

  11. Role of nucleotide excision repair and photoreactivation in the solar UVB radiation survival of Pseudomonas syringae pv. syringae B728a.

    Science.gov (United States)

    Gunasekera, T S; Sundin, G W

    2006-05-01

    To assess the role of DNA repair and photoreactivation in the solar radiation survival of the plant pathogen and leaf surface epiphyte Pseudomonas syringae pv. syringae (Pss). Mutants of Pss B728a, with insertional mutations within the nucleotide excision repair gene uvrA, photolyase gene phr, or uvrA phr double mutants, were constructed to examine the importance of individual repair mechanisms in solar UV radiation (UVR) survival. The survival of either the uvrA mutant or the phr mutant was reduced by approx. 10(2)-fold following exposure to a dose of 4.5 kJ m(-2) solar UVB (290-320 nm wavelengths) while the uvrA phr double mutant was reduced >10(6)-fold by the same dose. We constructed a transcriptional fusion between the Pss recA promoter and gfp to examine the induction of the SOS response in wild-type and mutant strains. Initiation of the recA mediated SOS response was more rapid and peaked at higher levels in mutant strains suggesting both increased DNA damage in mutant strains and also that photoreactivation and nucleotide excision repair remove DNA damage as it is incurred which is reflected in a delay of recA expression. Visualization of expression of B728a cells containing the recA::gfp reporter on UVB-irradiated bean leaves highlighted the movement of cells to intercellular spaces over time and that SOS induction was detectable when leaves were irradiated 48 h following leaf inoculation. This study indicated that solar UVB is detrimental to Pss B728a, DNA repair mechanisms play an important role in strain survival and expression of the SOS regulon on leaf surfaces contributes to survival of UVR-exposed cells during plant colonization. This work links previous laboratory-based UVR analyses with solar UVB dose-response analyses and highlights the role of photoreactivation in delaying induction of the SOS response following solar irradiation. Knowledge of population dynamics following direct solar irradiation will enhance our understanding of the biology of

  12. REPAIR OF LARGE SKULL BASE DEFECT FOLLOWING EXCISION OF BASALOID SQUAMOUS CELL CARCINOMA OF MAXILLO - ETHMOID REGION : A CASE REPORT

    Directory of Open Access Journals (Sweden)

    Monoj Mukherjee

    2015-02-01

    Full Text Available AIM: To present a case of basaloid squamous cell carcinoma of maxillo - ethmoid region with intracranial extradural extention and its surgical management including repair of the skull base defect. MATERIAL : A 30 year female presented with progressive bilateral nasal obstruction, facial deformity for 5 years duration. She developed blindness in last 6 months. Recent CT s can showed large heterogeneous enhancing soft tissue mass in right maxillary sinus, nasal cavity and right ethmoid sinus invading the skull base . INTERVENTION : She underwent excision of the mass by modified weber ferguson incision and repair of skull base defect with temporalis muscle flap. Skin defect over the face and nose was repaired by median forehead flap. RESULT : There was total tumor clearance and no CSF leakage following surgery. CONCLUSION : Sinonasal malignancy with intracranial extradural extenti on is not a contraindication for successful surgical management. Resultant skull base defect can be repaired by a temporalis muscle flap to prevent CSF leak and intracranial infection

  13. Abasic sites in DNA: repair and biological consequences in Saccharomyces cerevisiae.

    Science.gov (United States)

    Boiteux, Serge; Guillet, Marie

    2004-01-05

    Apurinic/apyrimidinic (AP) sites are one of the most frequent spontaneous lesions in DNA. They are potentially mutagenic and lethal lesions that can block DNA replication and transcription. In addition, cleavage of AP sites by AP endonucleases or AP lyases generates DNA single-strand breaks (SSBs) with 5'- or 3'-blocked ends, respectively. Therefore, we suggest that AP sites and 3'- or 5'-blocked SSBs, we name "honorary AP sites", constitute a single class of lesions. In this review, we describe the different mechanisms used by the budding yeast Saccharomyces cerevisiae to remove or tolerate AP sites and related SSBs. In wild-type cells, AP sites are primarily repaired by the base excision repair (BER) pathway, with the nucleotide excision repair (NER) pathway as a back up activity. BER is initiated by one of the two AP endonucleases, Apn1 or Apn2. Three DNA N-glycosylases/AP lyases, Ntg1, Ntg2 and Ogg1, can also incise AP sites in DNA. Rad27, a structure specific endonuclease, is involved in the repair of 5'-blocked ends, whereas Apn1, Apn2 and Rad1-Rad10 are involved in the removal of 3'-blocked ends using their 3'-phosphodiesterase and 3'-flap endonuclease activities, respectively. AP sites can stall DNA replication forks, as well as they block in vitro DNA synthesis by DNA polymerase delta. Restart of stalled forks can occur through a recombination-associated pathway initiated by the Mus81-Mms4 endonuclease or mutagenic translesion DNA synthesis (TLS). The mutagenic bypass of AP sites is a two-polymerases affair with an inserter DNA polymerase (Poldelta, Poleta or Rev1) and an extender DNA polymerase (Polzeta). Under normal growth conditions, inactivation of Apn1, Apn2 and Rad1-Rad10 causes cell death. Therefore, the burden of spontaneous AP sites is not compatible with life, in the absence of excision repair pathways. These results in yeast demonstrate that AP sites are critical endogenous DNA damages that cause genetic instability and by analogy could be

  14. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  15. PARP10 deficiency manifests by severe developmental delay and DNA repair defect.

    Science.gov (United States)

    Shahrour, Maher Awni; Nicolae, Claudia M; Edvardson, Simon; Ashhab, Motee; Galvan, Adri M; Constantin, Daniel; Abu-Libdeh, Bassam; Moldovan, George-Lucian; Elpeleg, Orly

    2016-10-01

    DNA repair mechanisms such as nucleotide excision repair (NER) and translesion synthesis (TLS) are dependent on proliferating cell nuclear antigen (PCNA), a DNA polymerase accessory protein. Recently, homozygosity for p.Ser228Ile mutation in the PCNA gene was reported in patients with neurodegeneration and impaired NER. Using exome sequencing, we identified a homozygous deleterious mutation, c.648delAG, in the PARP10 gene, in a patient suffering from severe developmental delay. In agreement, PARP10 protein was absent from the patient cells. We have previously shown that PARP10 is recruited by PCNA to DNA damage sites and is required for DNA damage resistance. The patient cells were significantly more sensitive to hydroxyurea and UV-induced DNA damage than control cells, resulting in increased apoptosis, indicating DNA repair impairment in the patient cells. PARP10 deficiency joins the long list of DNA repair defects associated with neurodegenerative disorders, including ataxia telangiectasia, xeroderma pigmentosum, Cockayne syndrome, and the recently reported PCNA mutation.

  16. Stabilization of Ultraviolet (UV)-stimulated Scaffold Protein A by Interaction with Ubiquitin-specific Peptidase 7 Is Essential for Transcription-coupled Nucleotide Excision Repair*

    Science.gov (United States)

    Higa, Mitsuru; Zhang, Xue; Tanaka, Kiyoji; Saijo, Masafumi

    2016-01-01

    UV-sensitive syndrome is an autosomal recessive disorder characterized by hypersensitivity to UV light and deficiency in transcription-coupled nucleotide excision repair (TC-NER), a subpathway of nucleotide excision repair that rapidly removes transcription-blocking DNA damage. UV-sensitive syndrome consists of three genetic complementation groups caused by mutations in the CSA, CSB, and UVSSA genes. UV-stimulated scaffold protein A (UVSSA), the product of UVSSA, which is required for stabilization of Cockayne syndrome group B (CSB) protein and reappearance of the hypophosphorylated form of RNA polymerase II after UV irradiation, forms a complex with ubiquitin-specific peptidase 7 (USP7). In this study, we demonstrated that the deubiquitination activity of USP7 is suppressed by its interaction with UVSSA. The interaction required the tumor necrosis factor receptor-associated factor domain of USP7 and the central region of UVSSA and was disrupted by an amino acid substitution in the tumor necrosis factor receptor-associated factor-binding motif of UVSSA. Cells expressing mutant UVSSA were highly sensitive to UV irradiation and defective in recovery of RNA synthesis after UV irradiation. These results indicate that the interaction between UVSSA and USP7 is important for TC-NER. Furthermore, the mutant UVSSA was rapidly degraded by the proteasome, and CSB was also degraded after UV irradiation as observed in UVSSA-deficient cells. Thus, stabilization of UVSSA by interaction with USP7 is essential for TC-NER. PMID:27129218

  17. Genomic survey and expression analysis of DNA repair genes in the genus Leptospira.

    Science.gov (United States)

    Martins-Pinheiro, Marinalva; Schons-Fonseca, Luciane; da Silva, Josefa B; Domingos, Renan H; Momo, Leonardo Hiroyuki Santos; Simões, Ana Carolina Quirino; Ho, Paulo Lee; da Costa, Renata M A

    2016-04-01

    Leptospirosis is an emerging zoonosis with important economic and public health consequences and is caused by pathogenic leptospires. The genus Leptospira belongs to the order Spirochaetales and comprises saprophytic (L. biflexa), pathogenic (L. interrogans) and host-dependent (L. borgpetersenii) members. Here, we present an in silico search for DNA repair pathways in Leptospira spp. The relevance of such DNA repair pathways was assessed through the identification of mRNA levels of some genes during infection in animal model and after exposition to spleen cells. The search was performed by comparison of available Leptospira spp. genomes in public databases with known DNA repair-related genes. Leptospires exhibit some distinct and unexpected characteristics, for instance the existence of a redundant mechanism for repairing a chemically diverse spectrum of alkylated nucleobases, a new mutS-like gene and a new shorter version of uvrD. Leptospira spp. shares some characteristics from Gram-positive, as the presence of PcrA, two RecQ paralogs and two SSB proteins; the latter is considered a feature shared by naturally competent bacteria. We did not find a significant reduction in the number of DNA repair-related genes in both pathogenic and host-dependent species. Pathogenic leptospires were enriched for genes dedicated to base excision repair and non-homologous end joining. Their evolutionary history reveals a remarkable importance of lateral gene transfer events for the evolution of the genus. Up-regulation of specific DNA repair genes, including components of SOS regulon, during infection in animal model validates the critical role of DNA repair mechanisms for the complex interplay between host/pathogen.

  18. RNA-directed repair of DNA double-strand breaks.

    Science.gov (United States)

    Yang, Yun-Gui; Qi, Yijun

    2015-08-01

    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Understanding photodermatoses associated with defective DNA repair: Photosensitive syndromes without associated cancer predisposition.

    Science.gov (United States)

    Yew, Yik Weng; Giordano, Cerrene N; Spivak, Graciela; Lim, Henry W

    2016-11-01

    Photodermatoses associated with defective DNA repair are a group of photosensitive hereditary skin disorders. In this review, we focus on diseases and syndromes with defective nucleotide excision repair that are not accompanied by an increased risk of cutaneous malignancies despite having photosensitivity. Specifically, the gene mutations and transcription defects, epidemiology, and clinical features of Cockayne syndrome, cerebro-oculo-facial-skeletal syndrome, ultraviolet-sensitive syndrome, and trichothiodystrophy will be discussed. These conditions may also have other extracutaneous involvement affecting the neurologic system and growth and development. Rigorous photoprotection remains an important component of the management of these inherited DNA repair-deficiency photodermatoses. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  20. Ddc1 checkpoint protein and DNA polymerase ɛ interact with nick-containing DNA repair intermediate in cell free extracts of Saccharomyces cerevisiae.

    Science.gov (United States)

    Sukhanova, Maria V; D'Herin, Claudine; van der Kemp, Patricia Auffret; Koval, Vladimir V; Boiteux, Serge; Lavrik, Olga I

    2011-08-15

    To characterize proteins that interact with base excision/single-strand interruption repair DNA intermediates in cell free extracts of Saccharomyces cerevisiae, we used a combination of photoaffinity labeling with the protein identification by MALDI-TOF-MS peptide mapping. Photoreactive analogue of dCTP, namely exo-N-[4-(4-azido-2,3,5,6,-tetrafluorobenzylidenehydrazinocarbonyl)-butylcarbamoyl]-2'-deoxycytidine-5'-triphosphate, and [(32)P]-labeled DNA duplex containing one nucleotide gap were used to generate nick-containing DNA with a photoreactive dCMP residue at the 3'-margin of the nick. This photoreactive DNA derivative was incubated with the yeast cell extract and after UV irradiation a number of proteins were labeled. Two of the crosslinked proteins were identified as the catalytic subunit of DNA polymerase ɛ and Ddc1 checkpoint protein. Labeling of DNA polymerase ɛ catalytic subunit with the nick-containing DNA repair intermediate indicates that the DNA polymerase is involved in the DNA repair synthesis in yeast, at least at DNA single-strand interruptions. Crosslinking of Ddc1 to DNA nicks took place independently of the other components of checkpoint clamp, Mec3 and Rad17, suggesting that the protein alone is able to recognize DNA single-strand breaks. Indeed, purified GST-tagged Ddc1 protein was efficiently crosslinked to nick-containing DNA. The interaction of Ddc1 with DNA nicks may provide a link between the DNA damage checkpoint and DNA base excision/single-strand breaks repair pathways in yeast. In addition, we found that absence of Ddc1 protein greatly influences the overall pattern of other proteins crosslinked to DNA nick. We suggested that this last effect of Ddc1 is at least partially due to its capacity to prevent proteolytic degradation of the DNA-protein adducts. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Normal reconstruction of DNA supercoiling and chromatin structure in cockayne syndrome cells during repair of damage from ultraviolet light.

    Science.gov (United States)

    Cleaver, J E

    1982-07-01

    The chromatin of human cells undergoes structural rearrangements during excision repair of ultraviolet damage in DNA that were detected by transient relaxation of DNA supercoiling and increased staphylococcal nuclease digestibility of repaired sites. Inhibition of polymerization and/or ligation of repaired regions with inhibitors of DNA polymerase alpha (cytosine arabinoside and aphidicolin) resulted in the accumulation of single-strand breaks, delayed reconstruction of DNA supercoiling, and maintenance of the staphylococcal nuclease digestibility. These observations suggest that reconstruction of the native chromatin state requires completion of repaired regions with covalent ligation into the DNA strands. Although previous claims have been made that a late stage associated with ligation of repaired regions may be defective in cells from patients with Cockayne syndrome, complete reconstruction of the native chromatin occurred in cells from three unrelated patients after ultraviolet irradiation. No abnormality in repair was therefore detected in Cockayne syndrome cells. The hypersensitivity of cell survival and semiconservative DNA replication to damage by ultraviolet light in this human disorder must therefore be regarded as features of a primary defect in DNA metabolism unrelated to DNA repair.

  2. Differential participation of homologous recombination and nucleotide excision repair in yeast survival to ultraviolet light radiation.

    Science.gov (United States)

    Toussaint, Martin; Wellinger, Raymund J; Conconi, Antonio

    2010-04-30

    The purpose of this research was to assess the ultraviolet light (UV) phenotype of yeast sirDelta cells vs. WT cells, and to determine whether de-silenced chromatin or the intrinsic pseudoploidy of sirDelta mutants contributes to their response to UV. Additional aims were to study the participation of HR and NER in promoting UV survival during the cell cycle, and to define the extent of the co-participation for both repair pathways. The sensitivity of yeast Saccharomyces cerevisiae to UV light was determined using a method based on automatic measurements of optical densities of very small (100mul) liquid cell cultures. We show that pseudo-diploidy of sirDelta strains promotes resistance to UV irradiation and that HR is the main mechanism that is responsible for this phenotype. In addition, HR together with GG-NER renders cells in the G2-phase of the cell cycle more resistant to UV irradiation than cells in the G1-phase, which underscore the importance of HR when two copies of the chromosomes are present. Nevertheless, in asynchronously growing cells NER is the main repair pathway that responds to UV induced DNA damage. This study provides detailed and quantitative information on the co-participation of HR and NER in UV survival of yeast cells. Crown Copyright 2010. Published by Elsevier B.V. All rights reserved.

  3. Modulation of radiation-induced base excision repair pathway gene expression by melatonin

    Directory of Open Access Journals (Sweden)

    Saeed Rezapoor

    2017-01-01

    Full Text Available Objective: Approximately 70% of all cancer patients receive radiotherapy. Although radiotherapy is effective in killing cancer cells, it has adverse effects on normal cells as well. Melatonin (MLT as a potent antioxidant and anti-inflammatory agent has been proposed to stimulate DNA repair capacity. We investigated the capability of MLT in the modification of radiation-induced DNA damage in rat peripheral blood cells. Materials and Methods: In this experimental study, male rats (n = 162 were divided into 27 groups (n = 6 in each group including: irradiation only, vehicle only, vehicle with irradiation, 100 mg/kg MLT alone, 100 mg/kg MLT plus irradiation in 3 different time points, and control. Subsequently, they were irradiated with a single whole-body X-ray radiation dose of 2 and 8 Gy at a dose rate of 200 MU/min. Rats were given an intraperitoneal injection of MLT or the same volume of vehicle alone 1 h prior to irradiation. Blood samples were also taken 8, 24, and 48 h postirradiation, in order to measure the 8-oxoguanine glycosylase1 (Ogg1, Apex1, and Xrcc1 expression using quantitative real-time-polymerase chain reaction. Results: Exposing to the ionizing radiation resulted in downregulation of Ogg1, Apex1, and Xrcc1 gene expression. The most obvious suppression was observed in 8 h after exposure. Pretreatments with MLT were able to upregulate these genes when compared to the irradiation-only and vehicle plus irradiation groups (P < 0.05 in all time points. Conclusion: Our results suggested that MLT in mentioned dose may result in modulation of Ogg1, Apex1, and Xrcc1 gene expression in peripheral blood cells to reduce X-ray irradiation-induced DNA damage. Therefore, administration of MLT may increase the normal tissue tolerance to radiation through enhancing the cell DNA repair capacity. We believed that MLT could play a radiation toxicity reduction role in patients who have undergone radiation treatment as a part of cancer radiotherapy.

  4. Defining the functional footprint for recognition and repair of deaminated DNA.

    Science.gov (United States)

    Baldwin, Michael R; O'Brien, Patrick J

    2012-12-01

    Spontaneous deamination of DNA is mutagenic, if it is not repaired by the base excision repair (BER) pathway. Crystallographic data suggest that each BER enzyme has a compact DNA binding site. However, these structures lack information about poorly ordered termini, and the energetic contributions of specific protein-DNA contacts cannot be inferred. Furthermore, these structures do not reveal how DNA repair intermediates are passed between enzyme active sites. We used a functional footprinting approach to define the binding sites of the first two enzymes of the human BER pathway for the repair of deaminated purines, alkyladenine DNA glycosylase (AAG) and AP endonuclease (APE1). Although the functional footprint for full-length AAG is explained by crystal structures of truncated AAG, the footprint for full-length APE1 indicates a much larger binding site than is observed in crystal structures. AAG turnover is stimulated in the presence of APE1, indicating rapid exchange of AAG and APE1 at the abasic site produced by the AAG reaction. The coordinated reaction does not require an extended footprint, suggesting that each enzyme engages the site independently. Functional footprinting provides unique information relative to traditional footprinting approaches and is generally applicable to any DNA modifying enzyme or system of enzymes.

  5. Clustered DNA lesions containing 5-formyluracil and AP site: repair via the BER system.

    Science.gov (United States)

    Belousova, Ekaterina A; Vasil'eva, Inna A; Moor, Nina A; Zatsepin, Timofey S; Oretskaya, Tatiana S; Lavrik, Olga I

    2013-01-01

    Lesions in the DNA arise under ionizing irradiation conditions or various chemical oxidants as a single damage or as part of a multiply damaged site within 1-2 helical turns (clustered lesion). Here, we explored the repair opportunity of the apurinic/apyrimidinic site (AP site) composed of the clustered lesion with 5-formyluracil (5-foU) by the base excision repair (BER) proteins. We found, that if the AP site is shifted relative to the 5-foU of the opposite strand, it could be repaired primarily via the short-patch BER pathway. In this case, the cleavage efficiency of the AP site-containing DNA strand catalyzed by human apurinic/apyrimidinic endonuclease 1 (hAPE1) decreased under AP site excursion to the 3'-side relative to the lesion in the other DNA strand. DNA synthesis catalyzed by DNA polymerase lambda was more accurate in comparison to the one catalyzed by DNA polymerase beta. If the AP site was located exactly opposite 5-foU it was expected to switch the repair to the long-patch BER pathway. In this situation, human processivity factor hPCNA stimulates the process.

  6. Repair of base damage and genome maintenance in the nucleo-cytoplasmic large DNA viruses.

    Science.gov (United States)

    Redrejo-Rodríguez, Modesto; Salas, María L

    2014-01-22

    Among the DNA viruses, the so-called nucleo-cytoplasmic large DNA viruses (NCLDV) constitute a monophyletic group that currently consists of seven families of viruses infecting a very broad variety of eukaryotes, from unicellular marine protists to humans. Many recent papers have analyzed the sequence and structure of NCLDV genomes and their phylogeny, providing detailed analysis about their genomic structure and evolutionary history and proposing their inclusion in a new viral order named Megavirales that, according to some authors, should be considered as a fourth domain of life, aside from Bacteria, Archaea and Eukarya. The maintenance of genetic information protected from environmental attacks and mutations is essential not only for the survival of cellular organisms but also viruses. In cellular organisms, damaged DNA bases are removed in two major repair pathways: base excision repair (BER) and nucleotide incision repair (NIR) that constitute the major pathways responsible for repairing most endogenous base lesions and abnormal bases in the genome by precise repair procedures. Like cells, many NCLDV encode proteins that might constitute viral DNA repair pathways that would remove damages through BER/NIR pathways. However, the molecular mechanisms and, specially, the biological roles of those viral repair pathways have not been deeply addressed in the literature so far. In this paper, we review viral-encoded BER proteins and the genetic and biochemical data available about them. We propose and discuss probable viral-encoded DNA repair mechanisms and pathways, as compared with the functional and molecular features of known homologs proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. DNA repair and radiation sensitivity in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, D.J.C.; Stackhouse, M. [Los Alamos National Lab., NM (United States); Chen, D.S. [Rochester Univ., NY (United States). Dept. of Radiation Oncology

    1993-02-01

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population.

  8. DNA repair and radiation sensitivity in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, D.J.C.; Stackhouse, M. (Los Alamos National Lab., NM (United States)); Chen, D.S. (Rochester Univ., NY (United States). Dept. of Radiation Oncology)

    1993-01-01

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population.

  9. Convergence of The Nobel Fields of Telomere Biology and DNA Repair.

    Science.gov (United States)

    Fouquerel, Elise; Opresko, Patricia L

    2017-01-01

    The fields of telomere biology and DNA repair have enjoyed a great deal of cross-fertilization and convergence in recent years. Telomeres function at chromosome ends to prevent them from being falsely recognized as chromosome breaks by the DNA damage response and repair machineries. Conversely, both canonical and nonconical functions of numerous DNA repair proteins have been found to be critical for preserving telomere structure and function. In 2009, Elizabeth Blackburn, Carol Greider and Jack Szostak were awarded the Nobel prize in Physiology or Medicine for the discovery of telomeres and telomerase. Four years later, pioneers in the field of DNA repair, Aziz Sancar, Tomas Lindahl and Paul Modrich were recognized for their seminal contributions by being awarded the Nobel Prize in Chemistry. This review is part of a special issue meant to celebrate this amazing achievement, and will focus in particular on the convergence of nucleotide excision repair and telomere biology, and will discuss the profound implications for human health. © 2016 The American Society of Photobiology.

  10. Telomeric Allelic Imbalance Indicates Defective DNA Repair and Sensitivity to DNA-Damaging Agents

    DEFF Research Database (Denmark)

    Birkbak, Nicolai J.; Wang, Zhigang C.; Kim, Ji-Young

    2012-01-01

    DNA repair competency is one determinant of sensitivity to certain chemotherapy drugs, such as cisplatin. Cancer cells with intact DNA repair can avoid the accumulation of genome damage during growth and also can repair platinum-induced DNA damage. We sought genomic signatures indicative of defec...

  11. Hereditary Disorders with Defective Repair of UV-Induced DNA Damage

    Directory of Open Access Journals (Sweden)

    Shinichi Moriwaki

    2013-01-01

    Full Text Available Nucleotide excision repair (NER is an essential system for correcting ultraviolet (UV–-induced DNA damage. Lesions remaining in DNA due to reduced capacity of NER may result in cellular death, premature aging, mutagenesis and carcinogenesis of the skin. So, NER is an important protection against these changes. There are three representative genodermatoses resulting from genetic defects in NER: xeroderma pigmentosum (XP, Cockayne syndrome (CS, and trichothiodystrophy (TTD. In Japan, CS is similarly rare but XP is more common and TTD is less common compared to Western countries. In 1998, we established the system for the diagnosis of these disorders and we have been performing DNA repair and genetic analysis for more than 400 samples since then. At present, there is no cure for any human genetic disorder. Early diagnosis and symptomatic treatment of neurological, ocular and dermatological abnormalities should contribute to prolonging life and elevating QOL in patients.

  12. DNA repair in mammalian cells exposed to combinations of carcinogenic agents. [uv radiation; AAAF; 4-NQO; DMBA-epoxide; ICR-170

    Energy Technology Data Exchange (ETDEWEB)

    Setlow, R.B.; Ahmed, F.E.

    1979-01-01

    Cells defective in one or more aspects of repair are killed and often mutagenized more readily than normal cells by DNA damaging agents, and humans whose cells are deficient in repair are at an increased carcinogenic risk compared to normal individuals. The excision repair of uv induced pyrimidine dimers is a well studied system, but the details of the steps in this repair system are far from being understood in human cells. We know that there are a number of chemicals that mimic uv in that normal human cells repair DNA damage from both these agents and from uv by a long patch excision repair system, and that xeroderma pigmentosum cells defective in repair of uv are also defective in the repair of damage from these chemicals. The chemicals we have investigated are AAAF, 4-NQO, DMBA-epoxide, and ICR-170. We describe experiments, using several techniques, in which DNA excision repair is measured after treatment of various human cell strains with combinations of uv and these agents. If two agents have a common rate limiting step then, at doses high enough to saturate the repair system, one would expect the observed repair after a treatment with a combination of agents to be equal to that from one agent alone. Such is not the case for normal human or excision-deficient XP cells. In the former repair is additive and in the latter repair is usually appreciably less than that observed with either agent alone. Models that attempt to explain these surprising results involve complexes of enzymes and cofactors.

  13. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    Energy Technology Data Exchange (ETDEWEB)

    Dupuy, Aurélie [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Sarasin, Alain, E-mail: alain.sarasin@gustaveroussy.fr [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Service de Génétique, Institut Gustave Roussy (France)

    2015-06-15

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients.

  14. Recombinational DNA repair and human disease

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Larry H.; Schild, David

    2002-11-30

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities.

  15. Overexpression of PCNA Attenuates Oxidative Stress-Caused Delay of Gap-Filling during Repair of UV-Induced DNA Damage

    Directory of Open Access Journals (Sweden)

    Yi-Chih Tsai

    2017-01-01

    Full Text Available UVC irradiation-caused DNA lesions are repaired in mammalian cells solely by nucleotide excision repair (NER, which consists of sequential events including initial damage recognition, dual incision of damage site, gap-filling, and ligation. We have previously shown that gap-filling during the repair of UV-induced DNA lesions may be delayed by a subsequent treatment of oxidants or prooxidants such as hydrogen peroxide, flavonoids, and colcemid. We considered the delay as a result of competition for limiting protein/enzyme factor(s during repair synthesis between NER and base excision repair (BER induced by the oxidative chemicals. In this report, using colcemid as oxidative stress inducer, we showed that colcemid-caused delay of gap-filling during the repair of UV-induced DNA lesions was attenuated by overexpression of PCNA but not ligase-I. PCNA knockdown, as expected, delayed the gap-filling of NER but also impaired the repair of oxidative DNA damage. Fen-1 knockdown, however, did not affect the repair of oxidative DNA damage, suggesting repair of oxidative DNA damage is not of long patch BER. Furthermore, overexpression of XRCC1 delayed the gap-filling, and presumably increase of XRCC1 pulls PCNA away from gap-filling of NER for BER, consistent with our hypothesis that delay of gap-filling of NER attributes the competition between NER and BER.

  16. Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.

    Science.gov (United States)

    Wilson, David M; Rieckher, Matthias; Williams, Ashley B; Schumacher, Björn

    2017-09-19

    DNA interstrand crosslinks (ICLs) are generated by endogenous sources and chemotherapeutics, and pose a threat to genome stability and cell survival. Using Caenorhabditis elegans mutants, we identify DNA repair factors that protect against the genotoxicity of ICLs generated by trioxsalen/ultraviolet A (TMP/UVA) during development and aging. Mutations in nucleotide excision repair (NER) components (e.g. XPA-1 and XPF-1) imparted extreme sensitivity to TMP/UVA relative to wild-type animals, manifested as developmental arrest, defects in adult tissue morphology and functionality, and shortened lifespan. Compensatory roles for global-genome (XPC-1) and transcription-coupled (CSB-1) NER in ICL sensing were exposed. The analysis also revealed contributions of homologous recombination (BRC-1/BRCA1), the MUS-81, EXO-1, SLX-1 and FAN-1 nucleases, and the DOG-1 (FANCJ) helicase in ICL resolution, influenced by the replicative-status of the cell/tissue. No obvious or critical role in ICL repair was seen for non-homologous end-joining (cku-80) or base excision repair (nth-1, exo-3), the Fanconi-related proteins BRC-2 (BRCA2/FANCD1) and FCD-2 (FANCD2), the WRN-1 or HIM-6 (BLM) helicases, or the GEN-1 or MRT-1 (SNM1) nucleases. Our efforts uncover replication-dependent and -independent ICL repair networks, and establish nematodes as a model for investigating the repair and consequences of DNA crosslinks in metazoan development and in adult post-mitotic and proliferative germ cells. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  17. Mitochondrial DNA repair and association with aging--an update

    DEFF Research Database (Denmark)

    Diaz, Ricardo Gredilla; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2010-01-01

    Mitochondrial DNA is constantly exposed to oxidative injury. Due to its location close to the main site of reactive oxygen species, the inner mitochondrial membrane, mtDNA is more susceptible than nuclear DNA to oxidative damage. The accumulation of DNA damage is thought to play a critical role...... proteins and novel DNA repair pathways, thought to be exclusively present in the nucleus, have recently been described also to be present in mitochondria. Here we review the main mitochondrial DNA repair pathways and their association with the aging process....... in the aging process and to be particularly deleterious in post-mitotic cells. Thus, DNA repair is an important mechanism for maintenance of genomic integrity. Despite the importance of mitochondria in the aging process, it was thought for many years that mitochondria lacked an enzymatic DNA repair system...

  18. Repair capacity for platinum-DNA adducts determines the severity of cisplatin-induced peripheral neuropathy.

    Science.gov (United States)

    Dzagnidze, Anna; Katsarava, Zaza; Makhalova, Julia; Liedert, Bernd; Yoon, Min-Suk; Kaube, Holger; Limmroth, Volker; Thomale, Juergen

    2007-08-29

    The pronounced neurotoxicity of the potent antitumor drug cisplatin frequently results in the onset of peripheral polyneuropathy (PNP), which is assumed to be initially triggered by platination products in the nuclear DNA of affected tissues. To further elucidate the molecular mechanisms, we analyzed in a mouse model the formation and processing of the main cisplatin-induced DNA adduct (guanine-guanine intrastrand cross-link) in distinct neuronal cell types by adduct-specific monoclonal antibodies. Comparison of the adduct kinetics in cisplatin-injected mice either proficient or deficient for nucleotide excision repair (NER) functions revealed the essential role of this DNA repair pathway in protecting differentiated cells of the nervous system from excessive formation of such lesions. Hence, chronic exposure to cisplatin resulted in an accelerated accumulation of unrepaired intrastrand cross-links in neuronal cells of mice with dysfunctional NER. The augmented adduct levels in dorsal root ganglion (DRG) cells of those animals coincided with an earlier onset of PNP-like functional disturbance of their sensory nervous system. Independently from the respective repair phenotype, the amount of persisting DNA cross-links in DRG neurons at a given cumulative dose was significantly correlated to the degree of sensory impairment as measured by electroneurography. Collectively, these findings suggest a new model for the processing of cisplatin adducts in primary neuronal cells and accentuate the crucial role of effectual DNA repair capacity in the target cells for the individual risk of therapy-induced PNP.

  19. DNA Repair and Genome Maintenance in Bacillus subtilis

    Science.gov (United States)

    Lenhart, Justin S.; Schroeder, Jeremy W.; Walsh, Brian W.

    2012-01-01

    Summary: From microbes to multicellular eukaryotic organisms, all cells contain pathways responsible for genome maintenance. DNA replication allows for the faithful duplication of the genome, whereas DNA repair pathways preserve DNA integrity in response to damage originating from endogenous and exogenous sources. The basic pathways important for DNA replication and repair are often conserved throughout biology. In bacteria, high-fidelity repair is balanced with low-fidelity repair and mutagenesis. Such a balance is important for maintaining viability while providing an opportunity for the advantageous selection of mutations when faced with a changing environment. Over the last decade, studies of DNA repair pathways in bacteria have demonstrated considerable differences between Gram-positive and Gram-negative organisms. Here we review and discuss the DNA repair, genome maintenance, and DNA damage checkpoint pathways of the Gram-positive bacterium Bacillus subtilis. We present their molecular mechanisms and compare the functions and regulation of several pathways with known information on other organisms. We also discuss DNA repair during different growth phases and the developmental program of sporulation. In summary, we present a review of the function, regulation, and molecular mechanisms of DNA repair and mutagenesis in Gram-positive bacteria, with a strong emphasis on B. subtilis. PMID:22933559

  20. DNA Repair in Human Pluripotent Stem Cells Is Distinct from That in Non-Pluripotent Human Cells

    Science.gov (United States)

    Luo, Li Z.; Park, Sang-Won; Bates, Steven E.; Zeng, Xianmin; Iverson, Linda E.; O'Connor, Timothy R.

    2012-01-01

    The potential for human disease treatment using human pluripotent stem cells, including embryonic stem cells and induced pluripotent stem cells (iPSCs), also carries the risk of added genomic instability. Genomic instability is most often linked to DNA repair deficiencies, which indicates that screening/characterization of possible repair deficiencies in pluripotent human stem cells should be a necessary step prior to their clinical and research use. In this study, a comparison of DNA repair pathways in pluripotent cells, as compared to those in non-pluripotent cells, demonstrated that DNA repair capacities of pluripotent cell lines were more heterogeneous than those of differentiated lines examined and were generally greater. Although pluripotent cells had high DNA repair capacities for nucleotide excision repair, we show that ultraviolet radiation at low fluxes induced an apoptotic response in these cells, while differentiated cells lacked response to this stimulus, and note that pluripotent cells had a similar apoptotic response to alkylating agent damage. This sensitivity of pluripotent cells to damage is notable since viable pluripotent cells exhibit less ultraviolet light-induced DNA damage than do differentiated cells that receive the same flux. In addition, the importance of screening pluripotent cells for DNA repair defects was highlighted by an iPSC line that demonstrated a normal spectral karyotype, but showed both microsatellite instability and reduced DNA repair capacities in three out of four DNA repair pathways examined. Together, these results demonstrate a need to evaluate DNA repair capacities in pluripotent cell lines, in order to characterize their genomic stability, prior to their pre-clinical and clinical use. PMID:22412831

  1. Transcript RNA supports precise repair of its own DNA gene.

    Science.gov (United States)

    Keskin, Havva; Meers, Chance; Storici, Francesca

    2016-01-01

    The transfer of genetic information from RNA to DNA is considered an extraordinary process in molecular biology. Despite the fact that cells transcribe abundant amount of RNA with a wide range of functions, it has been difficult to uncover whether RNA can serve as a template for DNA repair and recombination. An increasing number of experimental evidences suggest a direct role of RNA in DNA modification. Recently, we demonstrated that endogenous transcript RNA can serve as a template to repair a DNA double-strand break (DSB), the most harmful DNA lesion, not only indirectly via formation of a DNA copy (cDNA) intermediate, but also directly in a homology driven mechanism in budding yeast. These results point out that the transfer of genetic information from RNA to DNA is more general than previously thought. We found that transcript RNA is more efficient in repairing a DSB in its own DNA (in cis) than in a homologous but ectopic locus (in trans). Here, we summarize current knowledge about the process of RNA-driven DNA repair and recombination, and provide further data in support of our model of DSB repair by transcript RNA in cis. We show that a DSB is precisely repaired predominately by transcript RNA and not by residual cDNA in conditions in which formation of cDNA by reverse transcription is inhibited. Additionally, we demonstrate that defects in ribonuclease (RNase) H stimulate precise DSB repair by homologous RNA or cDNA sequence, and not by homologous DNA sequence carried on a plasmid. These results highlight an antagonistic role of RNase H in RNA-DNA recombination. Ultimately, we discuss several questions that should be addressed to better understand mechanisms and implications of RNA-templated DNA repair and recombination.

  2. Site-specific analysis of UV-induced cyclobutane pyrimidine dimers in nucleotide excision repair-proficient and -deficient hamster cells: Lack of correlation with mutational spectra

    Energy Technology Data Exchange (ETDEWEB)

    Vreeswijk, Maaike P.G., E-mail: vreeswijk@lumc.nl [Department of Toxicogenetics, Leiden University Medical Center, Einthovenweg 20, P.O. Box 9600, Postzone S4-P, 2300 RC Leiden (Netherlands); Department of Human Genetics, Center for Human and Clinical Genetics, Leiden University Medical Center, Building 2, Postzone S-04, P.O. Box 9600, 2300 RC Leiden (Netherlands); Meijers, Caro M.; Giphart-Gassler, Micheline; Vrieling, Harry; Zeeland, Albert A. van; Mullenders, Leon H.F.; Loenen, Wil A.M. [Department of Toxicogenetics, Leiden University Medical Center, Einthovenweg 20, P.O. Box 9600, Postzone S4-P, 2300 RC Leiden (Netherlands)

    2009-04-26

    Irradiation of cells with UVC light induces two types of mutagenic DNA photoproducts, i.e. cyclobutane pyrimidine dimers (CPD) and pyrimidine (6-4) pyrimidone photoproducts (6-4PP). To investigate the relationship between the frequency of UV-induced photolesions at specific sites and their ability to induce mutations, we quantified CPD formation at the nucleotide level along exons 3 and 8 of the hprt gene using ligation-mediated PCR, and determined the mutational spectrum of 132 UV-induced hprt mutants in the AA8 hamster cell line and of 165 mutants in its nucleotide excision repair-defective derivative UV5. In AA8 cells, transversions predominated with a strong strand bias towards thymine-containing photolesions in the non-transcribed strand. As hamster AA8 cells are proficient in global genome repair of 6-4PP but selectively repair CPD from the transcribed strand of active genes, most mutations probably resulted from erroneous bypass of CPD in the non-transcribed strand. However, the relative incidence of CPD and the positions where mutations most frequently arose do not correlate. In fact some major damage sites hardly gave rise to the formation of mutations. In the repair-defective UV5 cells, mutations were almost exclusively C > T transitions caused by photoproducts at PyC sites in the transcribed strand. Even though CPD were formed at high frequencies at some TT sites in UV5, these photoproducts did not contribute to mutation induction at all. We conclude that, even in the absence of repair, large variations in the level of induction of CPD at different sites throughout the two exons do not correspond to frequencies of mutation induction.

  3. The repair of melphalan-induced DNA adducts in the transcribed strand of active genes is subject to a strong polarity effect.

    OpenAIRE

    Episkopou, Hara; Kyrtopoulos, Soterios A.; Sfikakis, Petros P.; Meletios A Dimopoulos; Souliotis, Vassilis L

    2011-01-01

    To investigate the mechanisms of the therapeutic action and drug resistance to the nitrogen mustard melphalan, melphalan-induced DNA damage repair and chromatin structure were examined along the p53, N-ras and d-globin gene loci in cells carrying different repair activities. In nucleotide excision repair-deficient XP-A cells, similar levels of adducts were found in all fragments examined, indicating uniform distribution of DNA damage. In both, repair-proficient CS-B and XP-C cells, faster rep...

  4. Mitotic regulator Nlp interacts with XPA/ERCC1 complexes and regulates nucleotide excision repair (NER) in response to UV radiation.

    Science.gov (United States)

    Ma, Xiao-Juan; Shang, Li; Zhang, Wei-Min; Wang, Ming-Rong; Zhan, Qi-Min

    2016-04-10

    Cellular response to DNA damage, including ionizing radiation (IR) and UV radiation, is critical for the maintenance of genomic fidelity. Defects of DNA repair often result in genomic instability and malignant cell transformation. Centrosomal protein Nlp (ninein-like protein) has been characterized as an important cell cycle regulator that is required for proper mitotic progression. In this study, we demonstrate that Nlp is able to improve nucleotide excision repair (NER) activity and protects cells against UV radiation. Upon exposure of cells to UVC, Nlp is translocated into the nucleus. The C-terminus (1030-1382) of Nlp is necessary and sufficient for its nuclear import. Upon UVC radiation, Nlp interacts with XPA and ERCC1, and enhances their association. Interestingly, down-regulated expression of Nlp is found to be associated with human skin cancers, indicating that dysregulated Nlp might be related to the development of human skin cancers. Taken together, this study identifies mitotic protein Nlp as a new and important member of NER pathway and thus provides novel insights into understanding of regulatory machinery involved in NER. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. DNA-repair gene variants are associated with glioblastoma survival

    DEFF Research Database (Denmark)

    Wibom, Carl; Sjöström, Sara; Henriksson, Roger

    2012-01-01

    Abstract Patient outcome from glioma may be influenced by germline variation. Considering the importance of DNA repair in cancer biology as well as in response to treatment, we studied the relationship between 1458 SNPs, which captured the majority of the common genetic variation in 136 DNA repair...

  6. Molecular spectrum of excision repair cross-complementation group 8 gene defects in Chinese patients with Cockayne syndrome type A

    OpenAIRE

    Wang, Xiaozhu; Huang, Yu; Yan, Ming; Li, Jiuwei; Ding, Changhong; Jin, Hong; Fang, Fang; Yang, Yanling; Wu, Baiyan; Chen, Dafang

    2017-01-01

    There are two genetics complementary groups Cockayne syndrome type A and B (CS-A and CS-B OMIM 216400, 133540), which is a rare autosomal recessive segmental progeroid syndrome. Homozygous or compound heterozygous mutations in the excision repair cross-complementation group 8 gene (ERCC8) result in CS-A, and mutations in ERCC6 result in CS-B. Homozygous ERCC6/ERCC8 mutations also result in UV-sensitive syndrome. In this study, twenty-one Han Chinese patients with CS were investigated to ident...

  7. Allele and Genotype Distributions of DNA Repair Gene Polymorphisms in South Indian Healthy Population

    Directory of Open Access Journals (Sweden)

    Katiboina Srinivasa Rao

    2014-01-01

    Full Text Available Various DNA repair pathways protect the structural and chemical integrity of the human genome from environmental and endogenous threats. Polymorphisms of genes encoding the proteins involved in DNA repair have been found to be associated with cancer risk and chemotherapeutic response. In this study, we aim to establish the normative frequencies of DNA repair genes in South Indian healthy population and compare with HapMap populations. Genotyping was done on 128 healthy volunteers from South India, and the allele and genotype distributions were established. The minor allele frequency of Xeroderma pigmentosum group A ( XPA G23A, Excision repair cross-complementing 2 ( ERCC2 /Xeroderma pigmentosum group D ( XPD Lys751Gln, Xeroderma pigmentosum group G ( XPG His46His, XPG Asp1104His, and X-ray repair cross-complementing group 1 ( XRCC1 Arg399Gln polymorphisms were 49.2%, 36.3%, 48.0%, 23.0%, and 34.0% respectively. Ethnic variations were observed in the frequency distribution of these polymorphisms between the South Indians and other HapMap populations. The present work forms the groundwork for cancer association studies and biomarker identification for treatment response and prognosis.

  8. Recent research in DNA repair, mutation and recombination: a report of the DNA Repair Network meeting, held at City University, London on 18 December 1995.

    Science.gov (United States)

    Jones, N J; Strike, P

    1996-09-02

    The now traditional one day Christmas DNA Repair meeting was held at City University, London for the third year in succession. With over 130 participants and a programme consisting of a total of 24 pre-offered presentations the meeting reached record dimensions. Attendees were from 24 institutions throughout the United Kingdom, and with several distinct research groups contained within the large contingents from the ICRF Clare Hall Laboratories and the MRC Cell Mutation Unit in Brighton, this indicates the increasing interest and depth of UK research in DNA repair. One slight disappointment of the meeting was the fall in the numbers of non-UK participants. Although the meeting in 1994 (Strike, 1995) saw an increase in presentations from Continental Europe (six countries including France, Germany. The Netherlands and Switzerland), the trend did not continue this year, with only Denmark being represented. The 24 contributors consisted of approximately equal numbers of postgraduate students, postdoctoral researchers and more "established' scientists reflecting the continuing policy of encouraging younger members of the repair community to present their work. The mix of presenters was particularly well illustrated by two excellent and consecutive talks by Professor Bryn Bridges (MRC Cell Mutation Unit) and Alison Mitchell, a postgraduate student in Stephen West's laboratory (ICRF, Clare Hall). The organisms under study were as equally disparate and included Archaebacteria, Escherichia coli. Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus, mice and men. The range of topics was also varied and included bacterial mutagenesis, NMR studies of Ada protein, preferential DNA repair, cell cycle checkpoint genes, reconstitution of nucleotide excision repair and V(D)J recombination in vitro, creation of repair deficient transgenic mice and mismatch defects in human cells. The result was a very successful meeting which was characterized by the consistently high

  9. DNA Repair Mechanisms in Cancer Development and Therapy

    Directory of Open Access Journals (Sweden)

    Alessandro eTorgovnick

    2015-04-01

    Full Text Available DNA damage has been long recognized as causal factor for cancer development. When erroneous DNA repair leads to mutations or chromosomal aberrations affecting oncogenes and tumor suppressor genes, cells undergo malignant transformation resulting in cancerous growth. Genetic defects can predispose to cancer: Mutations in distinct DNA repair systems elevate the susceptibility to various cancer types. However, DNA damage not only comprises a root cause for cancer development but also continues to provide an important avenue for chemo- and radiotherapy. Since the beginning of cancer therapy, genotoxic agents have been applied that trigger DNA damage checkpoints that halt the growth and trigger the apoptotic demise of cancer cells. We provide an overview about the involvement of DNA repair systems in cancer prevention and the classes of genotoxins that are commonly used for the treatment of cancer. A better understanding of the roles and interactions of the highly complex DNA repair machineries will lead to important improvements in cancer therapy.

  10. Anti-tumour compounds illudin S and Irofulven induce DNA lesions ignored by global repair and exclusively processed by transcription- and replication-coupled repair pathways.

    Science.gov (United States)

    Jaspers, Nicolaas G J; Raams, Anja; Kelner, Michael J; Ng, Jessica M Y; Yamashita, Yukiko M; Takeda, Shiunichi; McMorris, Trevor C; Hoeijmakers, Jan H J

    2002-12-05

    Illudin S is a natural sesquiterpene drug with strong anti-tumour activity. Inside cells, unstable active metabolites of illudin cause the formation of as yet poorly characterised DNA lesions. In order to identify factors involved in their repair, we have performed a detailed genetic survey of repair-defective mutants for responses to the drug. We show that 90% of illudin's lethal effects in human fibroblasts can be prevented by an active nucleotide excision repair (NER) system. Core NER enzymes XPA, XPF, XPG, and TFIIH are essential for recovery. However, the presence of global NER initiators XPC, HR23A/HR23B and XPE is not required, whereas survival, repair and recovery from transcription inhibition critically depend on CSA, CSB and UVS, the factors specific for transcription-coupled NER. Base excision repair and non-homologous end-joining of DNA breaks do not play a major role in the processing of illudin lesions. However, active RAD18 is required for optimal cell survival, indicating that the lesions also block replication forks, eliciting post-replication-repair-like responses. However, the translesion-polymerase DNA pol eta is not involved. We conclude that illudin-induced lesions are exceptional in that they appear to be ignored by all of the known global repair systems, and can only be repaired when trapped in stalled replication or transcription complexes. We show that the semisynthetic illudin derivative hydroxymethylacylfulvene (HMAF, Irofulven), currently under clinical trial for anti-tumour therapy, acts via the same mechanism. Copyright 2002 Elsevier Science B.V.

  11. Rad52 SUMOylation affects the efficiency of the DNA repair

    DEFF Research Database (Denmark)

    Altmannova, Veronika; Eckert-Boulet, Nadine; Arneric, Milica

    2010-01-01

    Homologous recombination (HR) plays a vital role in DNA metabolic processes including meiosis, DNA repair, DNA replication and rDNA homeostasis. HR defects can lead to pathological outcomes, including genetic diseases and cancer. Recent studies suggest that the post-translational modification...

  12. RNA polymerase II is released from the DNA template during transcription-coupled repair in mammalian cells.

    Science.gov (United States)

    Chiou, Yi-Ying; Hu, Jinchuan; Sancar, Aziz; Selby, Christopher P

    2018-02-16

    In mammalian cells, bulky DNA adducts located in the template but not the coding strand of genes block elongation by RNA polymerase II (RNAPII). The blocked RNAPII targets these transcription-blocking adducts to undergo more rapid excision repair than adducts located elsewhere in the genome. In excision repair, coupled incisions are made in the damaged DNA strand on both sides of the adduct. The fate of RNAPII in the course of this transcription-coupled repair (TCR) pathway is unclear. To address the fate of RNAPII, we used methods that control transcription to initiate a discrete "wave" of elongation complexes. Analyzing genome-wide transcription and repair by next-generation sequencing, we identified locations of elongation complexes and transcription-repair coupling events in genes throughout the genome. Using UV-exposed human skin fibroblasts, we found that, at the dose used, a single wave of elongation complexes was blocked within the first 25 kb of genes. TCR occurred where the elongation complexes were blocked, and repair was associated with the dissociation of these complexes. These results indicate that individual elongation complexes do not engage in multiple rounds of TCR with successive lesions. Our results are consistent with a model in which RNAPII is dissociated after the dual incision of the transcription-blocking lesion, perhaps by Cockayne syndrome group B translocase, or during the synthesis of a repair patch. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences.

    Science.gov (United States)

    Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

    2015-10-23

    The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences*

    Science.gov (United States)

    Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

    2015-01-01

    The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. PMID:26338705

  15. DNA repair diseases: what do they tell us about cancer and aging?

    Directory of Open Access Journals (Sweden)

    Carlos FM Menck

    2014-01-01

    Full Text Available The discovery of DNA repair defects in human syndromes, initially in xeroderma pigmentosum (XP but later in many others, led to striking observations on the association of molecular defects and patients' clinical phenotypes. For example, patients with syndromes resulting from defective nucleotide excision repair (NER or translesion synthesis (TLS present high levels of skin cancer in areas exposed to sunlight. However, some defects in NER also lead to more severe symptoms, such as developmental and neurological impairment and signs of premature aging. Skin cancer in XP patients is clearly associated with increased mutagenesis and genomic instability, reflecting the defective repair of DNA lesions. By analogy, more severe symptoms observed in NER-defective patients have also been associated with defective repair, likely involving cell death after transcription blockage of damaged templates. Endogenously induced DNA lesions, particularly through oxidative stress, have been identified as responsible for these severe pathologies. However, this association is not that clear and alternative explanations have been proposed. Despite high levels of exposure to intense sunlight, patients from tropical countries receive little attention or care, which likely also reflects the lack of understanding of how DNA damage causes cancer and premature aging.

  16. Salidroside stimulates DNA repair enzyme Parp-1 activity in mouse HSC maintenance.

    Science.gov (United States)

    Li, Xue; Sipple, Jared; Pang, Qishen; Du, Wei

    2012-05-03

    Salidroside is a phenylpropanoid glycoside isolated from the medicinal plant Rhodiola rosea, which has potent antioxidant properties. Here we show that salidroside prevented the loss of hematopoietic stem cells (HSCs) in mice under oxidative stress. Quiescent HSCs were recruited into cell cycling on in vivo challenge with oxidative stress, which was blocked by salidroside. Surprisingly, salidroside does not prevent the production of reactive oxygen species but reduces hydrogen peroxide-induced DNA-strand breaks in bone marrow cells enriched for HSCs. We tested whether salidroside enhances oxidative DNA damage repair in mice deficient for 5 DNA repair pathways known to be involved in oxidative DNA damage repair; we found that salidroside activated poly(ADP-ribose)polymerase-1 (PARP-1), a component of the base excision repair pathway, in mouse bone marrow HSCs as well as primary fibroblasts and human lymphoblasts. PARP-1 activation by salidroside protects quiescent HSCs from oxidative stress-induced cycling in native animals and self-renewal defect in transplanted recipients, which was abrogated by genetic ablation or pharmacologic inhibition of PARP-1. Together, these findings suggest that activation of PARP-1 by salidroside could affect the homeostasis and function of HSCs and contribute to the antioxidant effects of salidroside.

  17. WHERE MULTIFUNCTIONAL DNA REPAIR PROTEINS MEET: MAPPING THE INTERACTION DOMAINS BETWEEN XPG AND WRN

    Energy Technology Data Exchange (ETDEWEB)

    Rangaraj, K.; Cooper, P.K.; Trego, K.S.

    2009-01-01

    The rapid recognition and repair of DNA damage is essential for the maintenance of genomic integrity and cellular survival. Multiple complex and interconnected DNA damage responses exist within cells to preserve the human genome, and these repair pathways are carried out by a specifi c interplay of protein-protein interactions. Thus a failure in the coordination of these processes, perhaps brought about by a breakdown in any one multifunctional repair protein, can lead to genomic instability, developmental and immunological abnormalities, cancer and premature aging. This study demonstrates a novel interaction between two such repair proteins, Xeroderma pigmentosum group G protein (XPG) and Werner syndrome helicase (WRN), that are both highly pleiotropic and associated with inherited genetic disorders when mutated. XPG is a structure-specifi c endonuclease required for the repair of UV-damaged DNA by nucleotide excision repair (NER), and mutations in XPG result in the diseases Xeroderma pigmentosum (XP) and Cockayne syndrome (CS). A loss of XPG incision activity results in XP, whereas a loss of non-enzymatic function(s) of XPG causes CS. WRN is a multifunctional protein involved in double-strand break repair (DSBR), and consists of 3’–5’ DNA-dependent helicase, 3’–5’ exonuclease, and single-strand DNA annealing activities. Nonfunctional WRN protein leads to Werner syndrome, a premature aging disorder with increased cancer incidence. Far Western analysis was used to map the interacting domains between XPG and WRN by denaturing gel electrophoresis, which separated purifi ed full length and recombinant XPG and WRN deletion constructs, based primarily upon the length of each polypeptide. Specifi c interacting domains were visualized when probed with the secondary protein of interest which was then detected by traditional Western analysis using the antibody of the secondary protein. The interaction between XPG and WRN was mapped to the C-terminal region of

  18. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in human keratinocytes and ex vivo skin.

    Science.gov (United States)

    Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2013-05-01

    Nicotinamide (vitamin B3) protects from ultraviolet (UV) radiation-induced carcinogenesis in mice and from UV-induced immunosuppression in mice and humans. Recent double-blinded randomized controlled Phase 2 studies in heavily sun-damaged individuals have shown that oral nicotinamide significantly reduces premalignant actinic keratoses, and may reduce new non-melanoma skin cancers. Nicotinamide is a precursor of nicotinamide adenine dinucleotide (NAD(+)), an essential coenzyme in adenosine triphosphate (ATP) production. Previously, we showed that nicotinamide prevents UV-induced ATP decline in HaCaT keratinocytes. Energy-dependent DNA repair is a key determinant of cellular survival after exposure to DNA-damaging agents such as UV radiation. Hence, in this study we investigated whether nicotinamide protection from cellular energy loss influences DNA repair. We treated HaCaT keratinocytes with nicotinamide and exposed them to low-dose solar-simulated UV (ssUV). Excision repair was quantified using an assay of unscheduled DNA synthesis. Nicotinamide increased both the proportion of cells undergoing excision repair and the repair rate in each cell. We then investigated ssUV-induced cyclobutane pyrimidine dimers (CPDs) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8oxoG) formation and repair by comet assay in keratinocytes and with immunohistochemistry in human skin. Nicotinamide reduced CPDs and 8oxoG in both models and the reduction appeared to be due to enhancement of DNA repair. These results show that nicotinamide enhances two different pathways for repair of UV-induced photolesions, supporting nicotinamide's potential as an inexpensive, convenient and non-toxic agent for skin cancer chemoprevention.

  19. Formation and repair of oxidative damage in the mitochondrial DNA.

    Science.gov (United States)

    Muftuoglu, Meltem; Mori, Mateus P; de Souza-Pinto, Nadja C

    2014-07-01

    The mitochondrial DNA (mtDNA) encodes for only 13 polypeptides, components of 4 of the 5 oxidative phosphorylation complexes. But despite this apparently small numeric contribution, all 13 subunits are essential for the proper functioning of the oxidative phosphorylation circuit. Thus, accumulation of lesions, mutations and deletions/insertions in the mtDNA could have severe functional consequences, including mitochondrial diseases, aging and age-related diseases. The DNA is a chemically unstable molecule, which can be easily oxidized, alkylated, deaminated and suffer other types of chemical modifications, throughout evolution the organisms that survived were those who developed efficient DNA repair processes. In the last two decades, it has become clear that mitochondria have DNA repair pathways, which operate, at least for some types of lesions, as efficiently as the nuclear DNA repair pathways. The mtDNA is localized in a particularly oxidizing environment, making it prone to accumulate oxidatively generated DNA modifications (ODMs). In this article, we: i) review the major types of ODMs formed in mtDNA and the known repair pathways that remove them; ii) discuss the possible involvement of other repair pathways, just recently characterized in mitochondria, in the repair of these modifications; and iii) address the role of DNA repair in mitochondrial function and a possible cross-talk with other pathways that may potentially participate in mitochondrial genomic stability, such as mitochondrial dynamics and nuclear-mitochondrial signaling. Oxidative stress and ODMs have been increasingly implicated in disease and aging, and thus we discuss how variations in DNA repair efficiency may contribute to the etiology of such conditions or even modulate their clinical outcomes. Copyright © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  20. The C-terminal Region and SUMOylation of Cockayne Syndrome Group B Protein Play Critical Roles in Transcription-coupled Nucleotide Excision Repair.

    Science.gov (United States)

    Sin, Yooksil; Tanaka, Kiyoji; Saijo, Masafumi

    2016-01-15

    Cockayne syndrome (CS) is a recessive disorder that results in deficiencies in transcription-coupled nucleotide excision repair (TC-NER), a subpathway of nucleotide excision repair, and cells from CS patients exhibit hypersensitivity to UV light. CS group B protein (CSB), which is the gene product of one of the genes responsible for CS, belongs to the SWI2/SNF2 DNA-dependent ATPase family and has an ATPase domain and an ubiquitin-binding domain (UBD) in the central region and the C-terminal region, respectively. The C-terminal region containing the UBD is essential for the functions of CSB. In this study, we generated several CSB deletion mutants and analyzed the functions of the C-terminal region of CSB in TC-NER. Not only the UBD but also the C-terminal 30-amino acid residues were required for UV light resistance and TC-NER. This region was needed for the interaction of CSB with RNA polymerase II, the translocation of CS group A protein to the nuclear matrix, and the association of CSB with chromatin after UV irradiation. CSB was modified by small ubiquitin-like modifier 2/3 in a UV light-dependent manner. This modification was abolished in a CSB mutant lacking the C-terminal 30 amino acid residues. However, the substitution of lysine residues in this region with arginine did not affect SUMOylation or TC-NER. By contrast, substitution of a lysine residue in the N-terminal region with arginine decreased SUMOylation and resulted in cells with defects in TC-NER. These results indicate that both the most C-terminal region and SUMOylation are important for the functions of CSB in TC-NER. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. The C-terminal Region and SUMOylation of Cockayne Syndrome Group B Protein Play Critical Roles in Transcription-coupled Nucleotide Excision Repair*

    Science.gov (United States)

    Sin, Yooksil; Tanaka, Kiyoji; Saijo, Masafumi

    2016-01-01

    Cockayne syndrome (CS) is a recessive disorder that results in deficiencies in transcription-coupled nucleotide excision repair (TC-NER), a subpathway of nucleotide excision repair, and cells from CS patients exhibit hypersensitivity to UV light. CS group B protein (CSB), which is the gene product of one of the genes responsible for CS, belongs to the SWI2/SNF2 DNA-dependent ATPase family and has an ATPase domain and an ubiquitin-binding domain (UBD) in the central region and the C-terminal region, respectively. The C-terminal region containing the UBD is essential for the functions of CSB. In this study, we generated several CSB deletion mutants and analyzed the functions of the C-terminal region of CSB in TC-NER. Not only the UBD but also the C-terminal 30-amino acid residues were required for UV light resistance and TC-NER. This region was needed for the interaction of CSB with RNA polymerase II, the translocation of CS group A protein to the nuclear matrix, and the association of CSB with chromatin after UV irradiation. CSB was modified by small ubiquitin-like modifier 2/3 in a UV light-dependent manner. This modification was abolished in a CSB mutant lacking the C-terminal 30 amino acid residues. However, the substitution of lysine residues in this region with arginine did not affect SUMOylation or TC-NER. By contrast, substitution of a lysine residue in the N-terminal region with arginine decreased SUMOylation and resulted in cells with defects in TC-NER. These results indicate that both the most C-terminal region and SUMOylation are important for the functions of CSB in TC-NER. PMID:26620705

  2. Stabilization of Ultraviolet (UV)-stimulated Scaffold Protein A by Interaction with Ubiquitin-specific Peptidase 7 Is Essential for Transcription-coupled Nucleotide Excision Repair.

    Science.gov (United States)

    Higa, Mitsuru; Zhang, Xue; Tanaka, Kiyoji; Saijo, Masafumi

    2016-06-24

    UV-sensitive syndrome is an autosomal recessive disorder characterized by hypersensitivity to UV light and deficiency in transcription-coupled nucleotide excision repair (TC-NER), a subpathway of nucleotide excision repair that rapidly removes transcription-blocking DNA damage. UV-sensitive syndrome consists of three genetic complementation groups caused by mutations in the CSA, CSB, and UVSSA genes. UV-stimulated scaffold protein A (UVSSA), the product of UVSSA, which is required for stabilization of Cockayne syndrome group B (CSB) protein and reappearance of the hypophosphorylated form of RNA polymerase II after UV irradiation, forms a complex with ubiquitin-specific peptidase 7 (USP7). In this study, we demonstrated that the deubiquitination activity of USP7 is suppressed by its interaction with UVSSA. The interaction required the tumor necrosis factor receptor-associated factor domain of USP7 and the central region of UVSSA and was disrupted by an amino acid substitution in the tumor necrosis factor receptor-associated factor-binding motif of UVSSA. Cells expressing mutant UVSSA were highly sensitive to UV irradiation and defective in recovery of RNA synthesis after UV irradiation. These results indicate that the interaction between UVSSA and USP7 is important for TC-NER. Furthermore, the mutant UVSSA was rapidly degraded by the proteasome, and CSB was also degraded after UV irradiation as observed in UVSSA-deficient cells. Thus, stabilization of UVSSA by interaction with USP7 is essential for TC-NER. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Oxidatively damaged DNA repair defect in cockayne syndrome and its complementation by heterologous repair proteins.

    Science.gov (United States)

    Frosina, Guido

    2008-01-01

    Cockayne syndrome (complementation groups A and B) is a rare autosomal recessive DNA repair disorder characterized by photosensitive skin and severely impaired physical and intellectual development. The Cockayne syndrome A and B proteins intervene in the repair of DNA modifications that block the RNA polymerase in transcribed DNA sequences (transcription-coupled repair). Recent results suggest that they also have a more general role in the repair of oxidative DNA base modifications. Although the phenotypical consequences of defective repair of oxidatively damaged DNA in Cockayne syndrome are not determined, accumulation of oxidized lesions might contribute to delay the physical and intellectual development of these patients. To conceive new therapeutic strategies for this syndrome, we are investigating whether the oxidatively damaged DNA repair defect in Cockayne syndrome might be complemented by heterologous repair proteins, such as the Escherichia coli formamidopyrimidine-DNA glycosylase and endonuclease III. The complementation studies may shed light on the important lesions for the Cockayne syndrome phenotype and offer new tools for future therapies aimed at counteracting the consequences of oxidatively damaged DNA accumulation.

  4. When DNA repair goes wrong: BER-generated DNA-protein crosslinks to oxidative lesions.

    Science.gov (United States)

    Quiñones, Jason Luis; Demple, Bruce

    2016-08-01

    Free radicals generate an array of DNA lesions affecting all parts of the molecule. The damage to deoxyribose receives less attention than base damage, even though the former accounts for ∼20% of the total. Oxidative deoxyribose fragments (e.g., 3'-phosphoglycolate esters) are removed by the Ape1 AP endonuclease and other enzymes in mammalian cells to enable DNA repair synthesis. Oxidized abasic sites are initially incised by Ape1, thus recruiting these lesions into base excision repair (BER) pathways. Lesions such as 2-deoxypentos-4-ulose can be removed by conventional (single-nucleotide) BER, which proceeds through a covalent Schiff base intermediate with DNA polymerase β (Polβ) that is resolved by hydrolysis. In contrast, the lesion 2-deoxyribonolactone (dL) must be processed by multinucleotide ("long-patch") BER: attempted repair via the single-nucleotide pathway leads to a dead-end, covalent complex with Polβ cross- linked to the DNA by an amide bond. We recently detected these stable DNA-protein crosslinks (DPC) between Polβ and dL in intact cells. The features of the DPC formation in vivo are exactly in keeping with the mechanistic properties seen in vitro: Polβ-DPC are formed by oxidative agents in line with their ability to form the dL lesion; they are not formed by non-oxidative agents; DPC formation absolutely requires the active-site lysine-72 that attacks the 5'-deoxyribose; and DPC formation depends on Ape1 to incise the dL lesion first. The Polβ-DPC are rapidly processed in vivo, the signal disappearing with a half-life of 15-30min in both mouse and human cells. This removal is blocked by inhibiting the proteasome, which leads to the accumulation of ubiquitin associated with the Polβ-DPC. While other proteins (e.g., topoisomerases) also form DPC under these conditions, 60-70% of the trapped ubiquitin depends on Polβ. The mechanism of ubiquitin targeting to Polβ-DPC, the subsequent processing of the expected 5'-peptidyl-dL, and the

  5. Molecular biological mechanisms I. DNA repair; Molekularbiologische Mechanismen I. DNA-Reparatur

    Energy Technology Data Exchange (ETDEWEB)

    Friedl, A.A. [Muenchen Univ. (Germany). Strahlenbiologisches Inst.

    2000-07-01

    Cells of all living systems possess a variety of mechanisms that allow to repair spontaneous and exogeneously induced DNA damage. DNA repair deficiencies may invoke enhanced sensitivity towards DNA-damaging agents such as ionizing radiation. They may also enhance the risk of cancer development, both spontaneously or after induction. This article reviews several DNA repair mechanisms, especially those dealing with DNA double-strand breaks, and describes hereditary diseases associated with DNA repair defects. (orig.) [German] Zellen aller Organismen verfuegen ueber eine Vielzahl von Mechanismen zur Reparatur von spontanen und exogen induzierten DNA-Schaeden. Defizienzen in DNA-Reparatursystemen koennen zu einer erhoehten Sensitivitaet gegenueber DNA-schaedigenden Noxen wie ionisierender Strahlung fuehren und das Risiko fuer die Entstehung spontaner und induzierter maligner Neoplasien erhoehen. Der Artikel gibt einen Ueberblick ueber verschiedene DNA-Reparaturmechanismen unter besonderer Beruecksichtigung der bekannten Mechanismen zur Reparatur von DNA-Doppelstrangbruechen, sowie ueber Erbkrankheiten, die mit Reparaturdefekten assoziiert sind. (orig.)

  6. Mechanisms of DNA repair and radio-induced mutagenesis in higher eukaryotes; Mecanismes de reparation et mutagenese radio-induite chez les eucaryotes superieurs

    Energy Technology Data Exchange (ETDEWEB)

    Averbeck, D. [Centre Universitaire d' Orsay, Institut Curie, Section de Recherche, Lab. Raymond-Latarjet, UMR 2027 CNRS, 91 (France)

    2000-10-01

    Cells of higher eukaryotes possess several very efficient systems for the repair of radiation-induced lesions in DNA. Different strategies have been adopted at the cellular level to remove or even tolerate various types of lesions in order to assure survival and limit the mutagenic consequences. In mammalian cells, the main DNA repair systems comprise direct reversion of damage, excision of damage and exchange mechanisms with intact DNA. Among these, the direct ligation of single strand breaks (SSB) by a DNA ligase and the multi-enzymatic repair systems of mismatch repair, base and nucleotide excision repair as well as the repair of double strand breaks (DSB) by homologous recombination or non homologous end-joining are the most important systems. Most of these processes are error-free except the non homologous end-joining pathway used for the repair of DSB. Moreover, certain lesions can be tolerated by more or less accurately acting polymerases capable of performing trans-lesion DNA syntheses. The DNA repair systems are intimately integrated in the network of cellular regulation. Some of their components are DNA damage inducible. Radiation-induced mutagenesis is largely due to unrepaired DNA damage but also involves error-prone repair processes like the repair of DSB by non-homologous end-joining. Generally, mammalian cells are well prepared to repair radiation-induced lesions. However, some questions remain to be asked about mechanistic details and efficiencies of the systems for removing certain types of radiation-damage and about their order and timing of action. The answers to these questions would be important for radioprotection as well as radiotherapy. (author)

  7. The Mutyh base excision repair gene influences the inflammatory response in a mouse model of ulcerative colitis.

    Directory of Open Access Journals (Sweden)

    Ida Casorelli

    Full Text Available BACKGROUND: The Mutyh DNA glycosylase is involved in the repair of oxidized DNA bases. Mutations in the human MUTYH gene are responsible for colorectal cancer in familial adenomatous polyposis. Since defective DNA repair genes might contribute to the increased cancer risk associated with inflammatory bowel diseases, we compared the inflammatory response of wild-type and Mutyh(-/- mice to oxidative stress. METHODOLOGY/PRINCIPAL FINDINGS: The severity of colitis, changes in expression of genes involved in DNA repair and inflammation, DNA 8-oxoguanine levels and microsatellite instability were analysed in colon of mice treated with dextran sulfate sodium (DSS. The Mutyh(-/- phenotype was associated with a significant accumulation of 8-oxoguanine in colon DNA of treated mice. A single DSS cycle induced severe acute ulcerative colitis in wild-type mice, whereas lesions were modest in Mutyh(-/- mice, and this was associated with moderate variations in the expression of several cytokines. Eight DSS cycles caused chronic colitis in both wild-type and Mutyh(-/- mice. Lymphoid hyperplasia and a significant reduction in Foxp3(+ regulatory T cells were observed only in Mutyh(-/- mice. CONCLUSIONS: The findings indicate that, in this model of ulcerative colitis, Mutyh plays a major role in maintaining intestinal integrity by affecting the inflammatory response.

  8. Resisting the Resistance in Cancer: Cheminformatics Studies on Short- Path Base Excision Repair Pathway Antagonists Using Supervised Learning Approaches.

    Science.gov (United States)

    Jain, Ritu; Jamal, Salma; Goyal, Sukriti; Wahi, Divya; Singh, Aditi; Grover, Abhinav

    2015-01-01

    Survival of cells and maintenance of genome depend on detection and repair of damaged DNA through intricate mechanisms. Cancer treatment relies on chemotherapy or radiation therapy that kills neoplastic cells by causing immense damage to the DNA. In many cases, escalated DNA repair mechanism leads to resistance against these therapies and therefore, there is a need to expand the interest in developing drugs that can sensitize the cells to such therapies by interfering with the DNA repair mechanism. Several studies have suggested a link between over expression of the primary mammalian enzyme, Apurinic/Apyrimidinic Endonuclease (APE1), responsible for abasic (or AP) site removal in the DNA and resistance of these cells to cancer therapy, whereas APE1 down-regulation sensitizes the cells to DNA damaging agents. Thus, the current treatment efficacy can be improved by aiding to selective sensitization of cancer cells and protection of normal cells. In the present study, we have used machine learning based approach by selecting assorted compounds with known activity for APE1 and constructed a range of in silico predictive classification models to discriminate between the inhibitors and non-inhibitors. These models can be applied to numerous other unscreened compounds to select the ones which are more likely to be the inhibitors for APE1. We have further found the common molecular substructures which were associated with the molecular activity of the compounds using a substructure search approach.

  9. DEK is required for homologous recombination repair of DNA breaks

    DEFF Research Database (Denmark)

    Smith, Eric A; Gole, Boris; Willis, Nicholas A

    2017-01-01

    DEK is a highly conserved chromatin-bound protein whose upregulation across cancer types correlates with genotoxic therapy resistance. Loss of DEK induces genome instability and sensitizes cells to DNA double strand breaks (DSBs), suggesting defects in DNA repair. While these DEK-deficiency pheno......DEK is a highly conserved chromatin-bound protein whose upregulation across cancer types correlates with genotoxic therapy resistance. Loss of DEK induces genome instability and sensitizes cells to DNA double strand breaks (DSBs), suggesting defects in DNA repair. While these DEK......-deficiency phenotypes were thought to arise from a moderate attenuation of non-homologous end joining (NHEJ) repair, the role of DEK in DNA repair remains incompletely understood. We present new evidence demonstrating the observed decrease in NHEJ is insufficient to impact immunoglobulin class switching in DEK knockout...

  10. Relationship between DNA Mismatch Repair Deficiency and Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Kenta Masuda

    2011-01-01

    Full Text Available Some cases of endometrial cancer are associated with a familial tumor and are referred to as hereditary nonpolyposis colorectal cancer (HNPCC or Lynch syndrome. Lynch syndrome is thought to be induced by germline mutation of the DNA mismatch repair (MMR gene. An aberration in the MMR gene prevents accurate repair of base mismatches produced during DNA replication. This phenomenon can lead to an increased frequency of errors in target genes involved in carcinogenesis, resulting in cancerization of the cell. On the other hand, aberrant DNA methylation is thought to play a key role in sporadic endometrial carcinogenesis. Hypermethylation of unmethylated CpG islands in the promoter regions of cancer-related genes associated with DNA repair leads to the cell becoming cancerous. Thus, both genetic and epigenetic changes are intricately involved in the process through which cells become cancerous. In this review, we introduce the latest findings on the DNA mismatch repair pathway in endometrial cancer.

  11. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  12. Direct detection and quantification of abasic sites for in vivo studies of DNA damage and repair

    Energy Technology Data Exchange (ETDEWEB)

    Wang Yanming [Division of Radiopharmaceutical Science, Case Center for Imaging Research, Department of Radiology, Case Western Reserve University, Cleveland, OH 44122 (United States)], E-mail: yanming.wang@case.edu; Liu Lili [Department of Hematology and Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, OH 44122 (United States); Wu Chunying [Division of Radiopharmaceutical Science, Case Center for Imaging Research, Department of Radiology, Case Western Reserve University, Cleveland, OH 44122 (United States); Bulgar, Alina [Department of Hematology and Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, OH 44122 (United States); Somoza, Eduardo; Zhu Wenxia [Division of Radiopharmaceutical Science, Case Center for Imaging Research, Department of Radiology, Case Western Reserve University, Cleveland, OH 44122 (United States); Gerson, Stanton L. [Department of Hematology and Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, OH 44122 (United States)

    2009-11-15

    Use of chemotherapeutic agents to induce cytotoxic DNA damage and programmed cell death is a key strategy in cancer treatments. However, the efficacy of DNA-targeted agents such as temozolomide is often compromised by intrinsic cellular responses such as DNA base excision repair (BER). Previous studies have shown that BER pathway resulted in formation of abasic or apurinic/apyrimidinic (AP) sites, and blockage of AP sites led to a significant enhancement of drug sensitivity due to reduction of DNA base excision repair. Since a number of chemotherapeutic agents also induce formation of AP sites, monitoring of these sites as a clinical correlate of drug effect will provide a useful tool in the development of DNA-targeted chemotherapies aimed at blocking abasic sites from repair. Here we report an imaging technique based on positron emission tomography (PET) that allows for direct quantification of AP sites in vivo. For this purpose, positron-emitting carbon-11 has been incorporated into methoxyamine ([{sup 11}C]MX) that binds covalently to AP sites with high specificity. The binding specificity of [{sup 11}C]MX for AP sites was demonstrated by in vivo blocking experiments. Using [{sup 11}C]MX as a radiotracer, animal PET studies have been conducted in melanoma and glioma xenografts for quantification of AP sites. Following induction of AP sites by temozolomide, both tumor models showed significant increase of [{sup 11}C]MX uptake in tumor regions in terms of radioactivity concentration as a function of time, which correlates well with conventional aldehyde reactive probe (ARP)-based bioassays for AP sites.

  13. Transcription Restores DNA Repair to Heterochromatin, Determining Regional Mutation Rates in Cancer Genomes

    Directory of Open Access Journals (Sweden)

    Christina L. Zheng

    2014-11-01

    Full Text Available Somatic mutations in cancer are more frequent in heterochromatic and late-replicating regions of the genome. We report that regional disparities in mutation density are virtually abolished within transcriptionally silent genomic regions of cutaneous squamous cell carcinomas (cSCCs arising in an XPC−/− background. XPC−/− cells lack global genome nucleotide excision repair (GG-NER, thus establishing differential access of DNA repair machinery within chromatin-rich regions of the genome as the primary cause for the regional disparity. Strikingly, we find that increasing levels of transcription reduce mutation prevalence on both strands of gene bodies embedded within H3K9me3-dense regions, and only to those levels observed in H3K9me3-sparse regions, also in an XPC-dependent manner. Therefore, transcription appears to reduce mutation prevalence specifically by relieving the constraints imposed by chromatin structure on DNA repair. We model this relationship among transcription, chromatin state, and DNA repair, revealing a new, personalized determinant of cancer risk.

  14. A mutation in the XPB/ERCC3 DNA repair transcription gene, associated with trichothiodystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Weeda, G.; Donker, I.; Vermeulen, W. [Erasmus Univ., Rotterdam (Netherlands)] [and others

    1997-02-01

    Trichothiodystrophy (TTD) is a rare, autosomal recessive disorder characterized by sulfur-deficient brittle hair and nails, mental retardation, impaired sexual development, and ichthyosis. Photosensitivity has been reported in {approximately}50% of the cases, but no skin cancer is associated with TTD. Virtually all photosensitive TTD patients have a deficiency in the nucleotide excision repair (NER) of UV-induced DNA damage that is indistinguishable from that of xeroderma pigmentosum (XP) complementation group D (XP-D) patients. DNA repair defects in XP-D are associated with two additional, quite different diseases; XP, a sun-sensitive and cancer-prone repair disorder, and Cockayne syndrome (CS), a photosensitive condition characterized by physical and mental retardation and wizened facial appearance. One photosensitive TTD case constitutes a new repair-deficient complementation group, TTD-A. Remarkably, both TTD-A and XP-D defects are associated with subunits of TFIIH, a basal transcription factor with a second function in DNA repair. Thus, mutations in TFIIH components may, on top of a repair defect, also cause transcriptional insufficiency, which may explain part of the non-XP clinical features of TTD. To date, three patients with the remarkable conjunction of XP and CS but not TM have been assigned to XP complementation group B (XP-B). Here we present the characterization of the NER defect in two mild TTD patients (TTD6VI and TTD4VI) and confirm the assignment to X-PB. The causative mutation was found to be a single base substitution resulting in a missense mutation (T119P) in a region of the XPB protein. These findings define a third TTD complementation group, extend the clinical heterogeneity associated with XP-B, stress the exclusive relationship between TTD and mutations in subunits of repair/transcription factor TFIIH, and strongly support the concept of {open_quotes}transcription syndromes.{close_quotes} 46 refs., 6 figs., 2 tabs.

  15. Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

    Energy Technology Data Exchange (ETDEWEB)

    Dusinska, Maria, E-mail: Maria.DUSINSKA@nilu.no [CEE-Health Effects Group, NILU - Norwegian Institute for Air Research, Kjeller (Norway); Staruchova, Marta; Horska, Alexandra [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia); Smolkova, Bozena [Laboratory of Cancer Genetics, Cancer Research Institute of the Slovak Academy of Sciences, Bratislava (Slovakia); Collins, Andrew [Department of Nutrition, Faculty of Medicine, University of Oslo (Norway); Bonassi, Stefano [Unit of Clinical and Molecular Epidemiology, IRCCS San Raffaele Pisana, Rome (Italy); Volkovova, Katarina [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia)

    2012-08-01

    Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

  16. XRCC1 coordinates disparate responses and multiprotein repair complexes depending on the nature and context of the DNA damage

    DEFF Research Database (Denmark)

    Hanssen-Bauer, Audun; Solvang-Garten, Karin; Sundheim, Ottar

    2011-01-01

    short patch (SP) and long patch (LP) base excision repair (BER). We show that POLß and PNK colocalize with XRCC1 in replication foci and that POLß and PNK, but not PCNA, colocalize with constitutively present XRCC1-foci as well as damage-induced foci when low doses of a DNA-damaging agent are applied....... We demonstrate that the laser dose used for introducing DNA damage determines the repertoire of DNA repair proteins recruited. Furthermore, we demonstrate that recruitment of POLß and PNK to regions irradiated with low laser dose requires XRCC1 and that inhibition of PARylation by PARP......-inhibitors only slightly reduces the recruitment of XRCC1, PNK, or POLß to sites of DNA damage. Recruitment of PCNA and FEN-1 requires higher doses of irradiation and is enhanced by XRCC1, as well as by accumulation of PARP-1 at the site of DNA damage. These data improve our understanding of recruitment of BER...

  17. Role of Nicotinamide in DNA Damage, Mutagenesis, and DNA Repair

    Directory of Open Access Journals (Sweden)

    Devita Surjana

    2010-01-01

    Full Text Available Nicotinamide is a water-soluble amide form of niacin (nicotinic acid or vitamin B3. Both niacin and nicotinamide are widely available in plant and animal foods, and niacin can also be endogenously synthesized in the liver from dietary tryptophan. Nicotinamide is also commercially available in vitamin supplements and in a range of cosmetic, hair, and skin preparations. Nicotinamide is the primary precursor of nicotinamide adenine dinucleotide (NAD+, an essential coenzyme in ATP production and the sole substrate of the nuclear enzyme poly-ADP-ribose polymerase-1 (PARP-1. Numerous in vitro and in vivo studies have clearly shown that PARP-1 and NAD+ status influence cellular responses to genotoxicity which can lead to mutagenesis and cancer formation. This paper will examine the role of nicotinamide in the protection from carcinogenesis, DNA repair, and maintenance of genomic stability.

  18. Localized degradation of foreign DNA strands in cells: Only excising the first nucleotide of 5' region.

    Science.gov (United States)

    Li, Hui; Shen, Wei; Lam, Michael Hon-Wah; Liang, Haojun

    2017-09-15

    Intracellular delivery of foreign DNA probes sharply increases the efficiency of various biodetection protocols. Spherical nucleic acid (SNA) conjugate is a new type of probe that consists of a dense oligonucleotide shell attached typically to a gold nanoparticle core. They are widely used as novel labels for in vitro biodetection and intracellular assay. However, the degradation of foreign DNA still remains a challenge that can cause significant signal leakage (false positive signal). Hence, the site and behavior of intracellular degradation need to be investigated. Herein, we discover a localized degradation behavior that only excises the first nucleotide of 5' terminal from a DNA strand, whereas the residual portion of this strand is unbroken in MCF-7 cell. This novel degradation action totally differs from previous opinion that foreign DNA strand would be digested into tiny fragments or even individual nucleotides in cellular environment. On the basis of these findings, we propose a simple and effective way to avoid degradation-caused false positive that one can bypass the degradable site and choose a secure region to label fluorophore along the DNA stand, when using DNA probes for intracellular biodetection. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Laxity of the elbow after experimental excision of the radial head and division of the medial collateral ligament. Efficacy of ligament repair and radial head prosthetic replacement

    DEFF Research Database (Denmark)

    Jensen, Steen Lund; Deutch, Søren R; Olsen, Bo Sanderhoff

    2003-01-01

    We studied the stabilising effect of prosthetic replacement of the radial head and repair of the medial collateral ligament (MCL) after excision of the radial head and section of the MCL in five cadaver elbows. Division of the MCL increased valgus angulation (mean 3.9 +/- 1.5 degrees) and internal...... that the radial head is a constraint secondary to the MCL for both valgus displacement and internal rotation. Isolated repair of the ligament is superior to isolated prosthetic replacement and may be sufficient to restore valgus and internal rotatory stability after excision of the radial head in MCL...

  20. DNA Repair Gene Polymorphisms in Hereditary and Sporadic Breast Cancer

    National Research Council Canada - National Science Library

    Ricks-Santi, Luisel

    2006-01-01

    .... There is variable penetrance for breast cancer among women in families with known BRCA1 mutations, and we hypothesize that this might be due to genetic variants in wild-type BRCA1 or other DNA repair...

  1. D-ribose inhibits DNA repair synthesis in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  2. p53 in the DNA damage repair process

    Science.gov (United States)

    Williams, Ashley B.; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA damage response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA repair systems. It thus appears as if p53 is multitasking in protecting from cancer development by maintaining genome stability. PMID:27048304

  3. DNA repair, genome stability and cancer: a historical perspective.

    Science.gov (United States)

    Jeggo, Penny A; Pearl, Laurence H; Carr, Antony M

    2016-01-01

    The multistep process of cancer progresses over many years. The prevention of mutations by DNA repair pathways led to an early appreciation of a role for repair in cancer avoidance. However, the broader role of the DNA damage response (DDR) emerged more slowly. In this Timeline article, we reflect on how our understanding of the steps leading to cancer developed, focusing on the role of the DDR. We also consider how our current knowledge can be exploited for cancer therapy.

  4. Mutations in UVSSA cause UV-sensitive syndrome and impair RNA polymerase IIo processing in transcription-coupled nucleotide-excision repair.

    Science.gov (United States)

    Nakazawa, Yuka; Sasaki, Kensaku; Mitsutake, Norisato; Matsuse, Michiko; Shimada, Mayuko; Nardo, Tiziana; Takahashi, Yoshito; Ohyama, Kaname; Ito, Kosei; Mishima, Hiroyuki; Nomura, Masayo; Kinoshita, Akira; Ono, Shinji; Takenaka, Katsuya; Masuyama, Ritsuko; Kudo, Takashi; Slor, Hanoch; Utani, Atsushi; Tateishi, Satoshi; Yamashita, Shunichi; Stefanini, Miria; Lehmann, Alan R; Yoshiura, Koh-ichiro; Ogi, Tomoo

    2012-05-01

    UV-sensitive syndrome (UV(S)S) is a genodermatosis characterized by cutaneous photosensitivity without skin carcinoma. Despite mild clinical features, cells from individuals with UV(S)S, like Cockayne syndrome cells, are very UV sensitive and are deficient in transcription-coupled nucleotide-excision repair (TC-NER), which removes DNA damage in actively transcribed genes. Three of the seven known UV(S)S cases carry mutations in the Cockayne syndrome genes ERCC8 or ERCC6 (also known as CSA and CSB, respectively). The remaining four individuals with UVSS , one of whom is described for the first time here, formed a separate UV(S)S-A complementation group; however, the responsible gene was unknown. Using exome sequencing, we determine that mutations in the UVSSA gene (formerly known as KIAA1530) cause UV(S)S-A. The UVSSA protein interacts with TC-NER machinery and stabilizes the ERCC6 complex; it also facilitates ubiquitination of RNA polymerase IIo stalled at DNA damage sites. Our findings provide mechanistic insights into the processing of stalled RNA polymerase and explain the different clinical features across these TC-NER–deficient disorders.

  5. Laparoscopic Partial Cystectomy With Excision of Mesh Migration Into the Bladder Following Repair of Inguinal Hernia

    Directory of Open Access Journals (Sweden)

    Satoshi Funada

    2016-09-01

    Full Text Available Migration of hernia mesh into the bladder is a rare complication of inguinal hernioplasty. We present the case of an 85-year-old man who complained of hematuria and fever some 20 years after right hernioplasty. Cystoscopy and computed tomography revealed mesh migration into the right anterior wall of the bladder. Laparoscopic partial cystectomy with excision of the migrated mesh was performed successfully. To our knowledge, this is the first case of mesh migration into the bladder treated by laparoscopic partial cystectomy.

  6. DNA damage and repair in age-related macular degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Szaflik, Jacek P. [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Janik-Papis, Katarzyna; Synowiec, Ewelina; Ksiazek, Dominika [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Zaras, Magdalena [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Wozniak, Katarzyna [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Szaflik, Jerzy [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Blasiak, Janusz, E-mail: januszb@biol.uni.lodz.pl [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland)

    2009-10-02

    Age-related macular degeneration (AMD) is a retinal degenerative disease that is the main cause of vision loss in individuals over the age of 55 in the Western world. Clinically relevant AMD results from damage to the retinal pigment epithelial (RPE) cells thought to be mainly caused by oxidative stress. The stress also affects the DNA of RPE cells, which promotes genome instability in these cells. These effects may coincide with the decrease in the efficacy of DNA repair with age. Therefore individuals with DNA repair impaired more than average for a given age may be more susceptible to AMD if oxidative stress affects their RPE cells. This may be helpful in AMD risk assessment. In the present work we determined the level of basal (measured in the alkaline comet assay) endogenous and endogenous oxidative DNA damage, the susceptibility to exogenous mutagens and the efficacy of DNA repair in lymphocytes of 100 AMD patients and 110 age-matched individuals without visual disturbances. The cells taken from AMD patients displayed a higher extent of basal endogenous DNA damage without differences between patients of dry and wet forms of the disease. DNA double-strand breaks did not contribute to the observed DNA damage as checked by the neutral comet assay and pulsed field gel electrophoresis. The extent of oxidative modification to DNA bases was grater in AMD patients than in the controls, as probed by DNA repair enzymes NTH1 and Fpg. Lymphocytes from AMD patients displayed a higher sensitivity to hydrogen peroxide and UV radiation and repaired lesions induced by these factors less effectively than the cells from the control individuals. We postulate that the impaired efficacy of DNA repair may combine with enhanced sensitivity of RPE cells to blue and UV lights, contributing to the pathogenesis of AMD.

  7. The Challenges of Validating in Precision Medicine: The Case of Excision Repair Cross-Complement Group 1 Diagnostic Testing.

    Science.gov (United States)

    Barsanti-Innes, Brianna; Hey, Spencer Phillips; Kimmelman, Jonathan

    2017-01-01

    Personalized medicine relies upon the successful identification and translation of predictive biomarkers. Unfortunately, biomarker development has often fallen short of expectations. To better understand the obstacles to successful biomarker development, we systematically mapped research activities for a biomarker that has been in development for at least 12 years: excision repair cross-complement group 1 protein (ERCC1) as a biomarker for predicting clinical benefit with platinum-based chemotherapy in non-small cell lung cancer. We found that although research activities explored a wide range of approaches to ERCC1 testing, there was little replication or validation of techniques, and design and reporting of results were generally poor. Our analysis points to problems with coordinating and standardizing research in biomarker development. Clinically meaningful progress in personalized medicine will require concerted efforts to address these problems. In the interim, health care providers should be aware of the complexity involved in biomarker development, cautious about their near-term clinical value, and conscious of applying only validated diagnostics in the clinic. 2017;22:89-96 IMPLICATIONS FOR PRACTICE: : Many hospitals, policy makers, and scientists have made ambitious claims about the promise of personalizing cancer care. When one uses a case example of excision repair cross-complement group 1 protein-a biomarker that has a strong biological rationale and that has been researched for 12 years-the current research environment seems poorly suited for efficient development of biomarker tests. The findings provide grounds for tempering expectations about personalized cancer care-at least in the near term-and shed light on the current gap between the promise and practice of personalized medicine. © AlphaMed Press 2016.

  8. Contributions of histone H3 nucleosome core surface mutations to chromatin structures, silencing and DNA repair.

    Directory of Open Access Journals (Sweden)

    Michel Fink

    Full Text Available Histone H3 mutations in residues that cluster in a discrete region on the nucleosome surface around lysine 79 of H3 affect H3-K79 methylation, impair transcriptional silencing in subtelomeric chromatin, and reveal distinct contributions of histone H3 to various DNA-damage response and repair pathways. These residues might act by recruitment of silencing and DNA-damage response factors. Alternatively, their location on the nucleosome surface suggests a possible involvement in nucleosome positioning, stability and nucleosome interactions. Here, we show that the yeast H3 mutants hht2-T80A, hht2-K79E, hht2-L70S, and hht2-E73D show normal nucleosome positioning and stability in minichromosomes. However, loss of silencing in a subtelomeric URA3 gene correlates with a shift of the promoter nucleosome, while nucleosome positions and stability in the coding region are maintained. Moreover, the H3 mutants show normal repair of UV lesions by photolyase and nucleotide excision repair in minichromosomes and slightly enhanced repair in the subtelomeric region. Thus, these results support a role of those residues in the recruitment of silencing proteins and argue against a general role in nucleosome organization.

  9. A polymorphism in the base excision repair gene PARP2 is associated with differential prognosis by chemotherapy among postmenopausal breast cancer patients.

    Science.gov (United States)

    Seibold, Petra; Schmezer, Peter; Behrens, Sabine; Michailidou, Kyriaki; Bolla, Manjeet K; Wang, Qin; Flesch-Janys, Dieter; Nevanlinna, Heli; Fagerholm, Rainer; Aittomäki, Kristiina; Blomqvist, Carl; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Lambrechts, Diether; Wildiers, Hans; Kristensen, Vessela; Alnæs, Grethe Grenaker; Nord, Silje; Borresen-Dale, Anne-Lise; Hooning, Maartje J; Hollestelle, Antoinette; Jager, Agnes; Seynaeve, Caroline; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Dunning, Alison M; Rhenius, Valerie; Shah, Mitul; Kabisch, Maria; Torres, Diana; Ulmer, Hans-Ulrich; Hamann, Ute; Schildkraut, Joellen M; Purrington, Kristen S; Couch, Fergus J; Hall, Per; Pharoah, Paul; Easton, Doug F; Schmidt, Marjanka K; Chang-Claude, Jenny; Popanda, Odilia

    2015-12-16

    Personalized therapy considering clinical and genetic patient characteristics will further improve breast cancer survival. Two widely used treatments, chemotherapy and radiotherapy, can induce oxidative DNA damage and, if not repaired, cell death. Since base excision repair (BER) activity is specific for oxidative DNA damage, we hypothesized that germline genetic variation in this pathway will affect breast cancer-specific survival depending on treatment. We assessed in 1,408 postmenopausal breast cancer patients from the German MARIE study whether cancer specific survival after adjuvant chemotherapy, anthracycline chemotherapy, and radiotherapy is modulated by 127 Single Nucleotide Polymorphisms (SNPs) in 21 BER genes. For SNPs with interaction terms showing p<0.1 (likelihood ratio test) using multivariable Cox proportional hazard analyses, replication in 6,392 patients from nine studies of the Breast Cancer Association Consortium (BCAC) was performed. rs878156 in PARP2 showed a differential effect by chemotherapy (p=0.093) and was replicated in BCAC studies (p=0.009; combined analysis p=0.002). Compared to non-carriers, carriers of the variant G allele (minor allele frequency=0.07) showed better survival after chemotherapy (combined allelic hazard ratio (HR)=0.75, 95% 0.53-1.07) and poorer survival when not treated with chemotherapy (HR=1.42, 95% 1.08-1.85). A similar effect modification by rs878156 was observed for anthracycline-based chemotherapy in both MARIE and BCAC, with improved survival in carriers (combined allelic HR=0.73, 95% CI 0.40-1.32). None of the SNPs showed significant differential effects by radiotherapy. Our data suggest for the first time that a SNP in PARP2, rs878156, may together with other genetic variants modulate cancer specific survival in breast cancer patients depending on chemotherapy. These germline SNPs could contribute towards the design of predictive tests for breast cancer patients.

  10. DNA repair mechanisms in dividing and non-dividing cells.

    Science.gov (United States)

    Iyama, Teruaki; Wilson, David M

    2013-08-01

    DNA damage created by endogenous or exogenous genotoxic agents can exist in multiple forms, and if allowed to persist, can promote genome instability and directly lead to various human diseases, particularly cancer, neurological abnormalities, immunodeficiency and premature aging. To avoid such deleterious outcomes, cells have evolved an array of DNA repair pathways, which carry out what is typically a multiple-step process to resolve specific DNA lesions and maintain genome integrity. To fully appreciate the biological contributions of the different DNA repair systems, one must keep in mind the cellular context within which they operate. For example, the human body is composed of non-dividing and dividing cell types, including, in the brain, neurons and glial cells. We describe herein the molecular mechanisms of the different DNA repair pathways, and review their roles in non-dividing and dividing cells, with an eye toward how these pathways may regulate the development of neurological disease. Published by Elsevier B.V.

  11. DNA Repair Gene Polymorphisms in Relation to Non-Small Cell Lung Cancer Survival

    Directory of Open Access Journals (Sweden)

    Yuliang Su

    2015-07-01

    Full Text Available Background: Single nucleotide polymorphisms (SNPs in the DNA repair genes are suspected to be related to the survival of lung cancer patients due to their possible influence on DNA repair capacity (DRC. However, the study results are inconsistent. Methods: A follow-up study of 610 non-small cell lung cancer (NSCLC patients was conducted to investigate genetic polymorphisms associated with the DNA repair genes in relation to NSCLC survival; 6 SNPs were genotyped, including XRCC1 (rs25487 G>A, hOGG1 (rs1052133 C>G, MUTYH (rs3219489 G>C, XPA (rs1800975 G>A, ERCC2 (rs1799793 G>A and XRCC3 (rs861539 C>T. Kaplan-Meier survival curve and Cox proportional hazards regression analyses were performed. SNP-SNP interaction was also examined using the survival tree analysis. Results: Advanced disease stage and older age at diagnosis were associated with poor prognosis of NSCLC. Patients with the variant ‘G' allele of hOGG1 rs1052133 had poor overall survival compared with those with the homozygous wild ‘CC' genotype, especially in female patients, adenocarcinoma histology, early stage, light smokers and without family history of cancer. For never smoking female lung cancer patients, individuals carrying homozygous variant ‘AA' genotype of XPA had shorter survival time compared to those with wild ‘G' alleles. Furthermore, females carrying homozygous variant XPA and hOGG1 genotypes simultaneously had 2.78-fold increased risk for death. Among all 6 polymorphisms, the homozygous variant ‘AA' of XPA carriers had poor prognosis compared to the carriers of wild ‘G' alleles of XPA together with other base excision repair (BER polymorphisms. Conclusions: Besides disease stage and age, the study found DNA repair gene polymorphisms were associated with lung cancer survival.

  12. Biochemical Characterization of Mycobacterium tuberculosis DNA Repair Enzymes – Nfo, XthA and Nei2

    Directory of Open Access Journals (Sweden)

    Sailau Abeldenov

    2014-01-01

    Full Text Available Introduction: Tuberculosis (TB is a human disease caused by Mycobacterium tuberculosis (Mtb. Treatment of TB requires long-term courses of multi-drug therapies to eliminate subpopulations of bacteria, which sometimes persist against antibiotics. Therefore, understanding of the mechanism of Mtb antibiotic-resistance is extremely important. During infection, Mtb overcomes a variety of body defense mechanisms, including treatment with the reactive species of oxygen and nitrogen. The bases in DNA molecule are susceptible to the damages caused by reactive forms of intermediate compounds of oxygen and nitrogen. Most of this damage is repaired by the base excision repair (BER pathway. In this study, we aimed to biochemically characterize three Mtb DNA repair enzymes of BER pathway. Methods: XthA, nfo, and nei genes were identified in mycobacteria by homology search of genomic sequences available in the GenBank database. We used standard methods of genetic engineering  to clone and sequence Mtb genes, which coded Nfo, XthA and Nei2 repair enzymes. The protein products of Mtb genes were expressed and purified in Escherichia coli using affinity tags. The enzymatic activity of purified Nfo, XthA, and Nei2 proteins were measured using radioactively labeled DNA substrates containing various modified residues. Results: The genes end (Rv0670, xthA (Rv0427c, and nei (Rv3297 were PCR amplified using genomic DNA of Mtb H37Rv with primers that contain specific restriction sites. The amplified products were inserted into pET28c(+ expression vector in such a way that the recombinant proteins contain C-terminal histidine tags. The plasmid constructs were verified by sequencing and then transformed into the Escherichia coli BL21 (DE3 strain. Purification of recombinant proteins was performed using Ni2+ ions immobilized affinity column, coupled with the fast performance liquid chromatography machine AKTA. Identification of the isolated proteins was performed by

  13. DNA Repair and the Accumulation of Oxidatively Damaged DNA Are Affected by Fruit Intake in Mice

    DEFF Research Database (Denmark)

    Croteau, Deborah L; de Souza-Pinto, Nadja C; Harboe, Charlotte

    2010-01-01

    Aging is associated with elevated oxidative stress and DNA damage. To achieve healthy aging, we must begin to understand how diet affects cellular processes. We postulated that fruit-enriched diets might initiate a program of enhanced DNA repair and thereby improve genome integrity. C57Bl/6 J mice...... were fed for 14 weeks a control diet or a diet with 8% peach or nectarine extract. The activities of DNA repair enzymes, the level of DNA damage, and gene expression changes were measured. Our study showed that repair of various oxidative DNA lesions was more efficient in liver extracts derived from...

  14. End-joining repair of double-strand breaks in Drosophila melanogaster is largely DNA ligase IV independent.

    Science.gov (United States)

    McVey, Mitch; Radut, Dora; Sekelsky, Jeff J

    2004-12-01

    Repair of DNA double-strand breaks can occur by either nonhomologous end joining or homologous recombination. Most nonhomologous end joining requires a specialized ligase, DNA ligase IV (Lig4). In Drosophila melanogaster, double-strand breaks created by excision of a P element are usually repaired by a homologous recombination pathway called synthesis-dependent strand annealing (SDSA). SDSA requires strand invasion mediated by DmRad51, the product of the spn-A gene. In spn-A mutants, repair proceeds through a nonconservative pathway involving the annealing of microhomologies found within the 17-nt overhangs produced by P excision. We report here that end joining of P-element breaks in the absence of DmRad51 does not require Drosophila LIG4. In wild-type flies, SDSA is sometimes incomplete, and repair is finished by an end-joining pathway that also appears to be independent of LIG4. Loss of LIG4 does not increase sensitivity to ionizing radiation in late-stage larvae, but lig4 spn-A double mutants do show heightened sensitivity relative to spn-A single mutants. Together, our results suggest that a LIG4-independent end-joining pathway is responsible for the majority of double-strand break repair in the absence of homologous recombination in flies.

  15. Mechanisms and biological impact of DNA repair pathways for UV and {gamma}-ray-induced damage

    Energy Technology Data Exchange (ETDEWEB)

    Hoeijmakers, J.H.J. [MGC, Department of Cell Biology et Genetics, Erasmus Universtiy, Rotterdam (Netherlands)

    1997-03-01

    Nature has equipped all living systems with an intricate network of DNA repair pathways, to cope with damage induced by genotoxic agents (such as UV light, {gamma}-rays and numerous chemicals). These pathways ensure genome stability and prevent carcinogenesis. Examples of multi-step damage repair processes are: nucleotide excision repair (NER, for removal of a wide variety of lesions, including UV) and recombination repair (for elimination of the very genotoxic radiation-induced double strand breaks). The NER pathway is understood in great detail and is associated with three human syndromes characterized by marked sun sensitivity: xeroderma pigmentosum (XP), cockayne syndrome (CS) and tricho-thio-dystrophy (TTD), XP patients show an over 1000 x increased risk of skin cancer, in contrast to CS and TTD. At least 25 proteins re involved some are also implicated in other cellular processes, explaining puzzling features associated with defects in these genes. NER-deficient mouse mutants have been generated, that permit evaluation of the biological impact of this process. Recombination repair is much less understood. However, recently a number of genes has been cloned based on sequence homology with yeast genes and mouse mutants are being generated. These will be invaluable to investigate e.g. radioresistance and radiation-induced tumorigenesis and for radiotherapy. (author)

  16. Hippocampal Adult Neurogenesis Is Maintained by Neil3-Dependent Repair of Oxidative DNA Lesions in Neural Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Christine Elisabeth Regnell

    2012-09-01

    Full Text Available Accumulation of oxidative DNA damage has been proposed as a potential cause of age-related cognitive decline. The major pathway for removal of oxidative DNA base lesions is base excision repair, which is initiated by DNA glycosylases. In mice, Neil3 is the main DNA glycosylase for repair of hydantoin lesions in single-stranded DNA of neural stem/progenitor cells, promoting neurogenesis. Adult neurogenesis is crucial for maintenance of hippocampus-dependent functions involved in behavior. Herein, behavioral studies reveal learning and memory deficits and reduced anxiety-like behavior in Neil3−/− mice. Neural stem/progenitor cells from aged Neil3−/− mice show impaired proliferative capacity and reduced DNA repair activity. Furthermore, hippocampal neurons in Neil3−/− mice display synaptic irregularities. It appears that Neil3-dependent repair of oxidative DNA damage in neural stem/progenitor cells is required for maintenance of adult neurogenesis to counteract the age-associated deterioration of cognitive performance.

  17. [Polymorphism of genes encoding proteins of DNA repair vs. occupational and environmental exposure to lead, arsenic and pesticides].

    Science.gov (United States)

    Bukowski, Karol; Woźniak, Katarzyna

    2017-10-12

    Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(1). This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  18. DNA Repair and Cancer Therapy: Targeting APE1/Ref-1 Using Dietary Agents

    Directory of Open Access Journals (Sweden)

    Julian J. Raffoul

    2012-01-01

    Full Text Available Epidemiological studies have demonstrated the cancer protective effects of dietary agents and other natural compounds isolated from fruits, soybeans, and vegetables on neoplasia. Studies have also revealed the potential for these natural products to be combined with chemotherapy or radiotherapy for the more effective treatment of cancer. In this paper we discuss the potential for targeting the DNA base excision repair enzyme APE1/Ref-1 using dietary agents such as soy isoflavones, resveratrol, curcumin, and the vitamins ascorbate and α-tocopherol. We also discuss the potential role of soy isoflavones in sensitizing cancer cells to the effects of radiotherapy. A comprehensive review of the dual nature of APE1/Ref-1 in DNA repair and redox activation of cellular transcription factors, NF-κB and HIF-1α, is also discussed. Further research efforts dedicated to delineating the role of APE1/Ref-1 DNA repair versus redox activity in sensitizing cancer cells to conventional treatment are warranted.

  19. Chromatin Dynamics in Genome Stability: Roles in Suppressing Endogenous DNA Damage and Facilitating DNA Repair

    Directory of Open Access Journals (Sweden)

    Nidhi Nair

    2017-07-01

    Full Text Available Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage.

  20. Assembly of checkpoint and repair machineries at DNA damage sites

    Science.gov (United States)

    Huen, Michael S.Y.; Chen, Junjie

    2009-01-01

    The remarkably coordinated nature of the DNA damage response pathway relies on numerous mechanisms that facilitate the assembly of checkpoint and repair factors at DNA breaks. Post-translational modifications on and around chromatin play critical roles in allowing the timely and sequential assembly of DNA damage responsive elements at the vicinity of DNA breaks. Notably, recent advances in forward genetics and proteomics-based approaches have enabled the identification of novel components within the DNA damage response pathway, providing a more comprehensive picture of the molecular network that assists in the detection and propagation of DNA damage signals. PMID:19875294

  1. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    was seen in HC, but with overall smaller effects and without the induction after acute stress. Nuclear DNA damage from oxidation as measured by the comet assay was unaffected by stress in both regions. We conclude that psychological stress have a dynamic influence on brain DNA repair gene expression...

  2. Role of DNA repair in Bacillus subtilis spore resistance.

    OpenAIRE

    Setlow, B; Setlow, P

    1996-01-01

    Wet-heat or hydrogen peroxide treatment of wild-type Bacillus subtilis spores did not result in induction of lacZ fusions to three DNA repair-related genes (dinR, recA, and uvrC) during spore outgrowth. However, these genes were induced during outgrowth of wild-type spores treated with dry heat or UV. Wet-heat, desiccation, dry-heat, or UV treatment of spores lacking major DNA-binding proteins (termed alpha-beta- spores) also resulted in induction of the three DNA repair genes during spore ou...

  3. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis.

    Science.gov (United States)

    Dong, Hui; Shi, Qiong; Song, Xiufang; Fu, Juanli; Hu, Lihua; Xu, Demei; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang

    2015-07-01

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2'-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Characterization of DNA repair phenotypes of Xeroderma pigmentosum cell lines by a paralleled in vitro test; Phenotypage de la reparation de l'ADN de lignees Xeroderma pigmentosum, par un test in vitro multiparametrique

    Energy Technology Data Exchange (ETDEWEB)

    Raffin, A.L.

    2009-06-15

    DNA is constantly damaged modifying the genetic information for which it encodes. Several cellular mechanisms as the Base Excision Repair (BER) and the Nucleotide Excision Repair (NER) allow recovering the right DNA sequence. The Xeroderma pigmentosum is a disease characterised by a deficiency in the NER pathway. The aim of this study was to propose an efficient and fast test for the diagnosis of this disease as an alternative to the currently available UDS test. DNA repair activities of XP cell lines were quantified using in vitro miniaturized and paralleled tests in order to establish DNA repair phenotypes of XPA and XPC deficient cells. The main advantage of the tests used in this study is the simultaneous measurement of excision or excision synthesis (ES) of several lesions by only one cellular extract. We showed on one hand that the relative ES of the different lesions depend strongly on the protein concentration of the nuclear extract tested. Working at high protein concentration allowed discriminating the XP phenotype versus the control one, whereas it was impossible under a certain concentration's threshold. On the other hand, while the UVB irradiation of control cells stimulated their repair activities, this effect was not observed in XP cells. This study brings new information on the XPA and XPC protein roles during BER and NER and underlines the complexity of the regulations of DNA repair processes. (author)

  5. Dynamics and mechanisms of DNA repair by photolyase

    Science.gov (United States)

    Liu, Zheyun; Wang, Lijuan; Zhong, Dongping

    2015-01-01

    Photolyase, a class of flavoproteins, uses blue light to repair two types of ultraviolet-induced DNA damage, cyclobutane pyrimidine dimer (CPD) and pyrimidine-pyrimidone (6–4) photoproduct (6–4PP). In this perspective, we review the recent progress on the repair dynamics and mechanisms of both types of DNA restoration by photolyases. We first report the spectroscopic characterization of flavin in various redox states and the active-site solvation dynamics in photolyases. We then systematically summarize the detailed repair dynamics of damaged DNA by photolyases and a biomimetic system through resolving all elementary steps on the ultrafast timescales, including multiple intermolecular electron- and proton-transfer reactions and bond-breaking and -making processes. We determined the unique electron tunneling pathways, identified the key functional residues and revealed the molecular origin of high repair efficiency, and thus elucidate the molecular mechanisms and repair photocycles at the most fundamental level. We finally conclude that the active sites of photolyases, unlike aqueous solution for the biomimetic system, provide a unique electrostatic environment and local flexibility and thus a dedicated synergy for all elementary dynamics to maximize the repair efficiency. This repair photomachine is the first enzyme that the entire functional evolution is completely mapped out in real time. PMID:25870862

  6. Organisms posses enzymes that function in the repair of DNA damaged by radiations, chemicals and metabolic events

    Energy Technology Data Exchange (ETDEWEB)

    Mizuma, Nagayo [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst.

    1998-01-01

    This report briefly describes the studies on the mechanism of in vivo DNA repairing by the author in Research Reactor Institute, Kyoto Univ. for the past 30 years. First, the ability of UV radiation to induce transformation was investigated with viral DNA. The formation of thymine-thymine dimer was found harmful to organisms and such dimers were removable by UV-radiation at a low frequency. The mutability was determined in three different E.coli strains with mutator gene, mutT, mutS or mutL. The ability to excise 8-oxoguanin developed in primer DNA was deficient in mutT and miss-pairing left after DNA replication could not be recovered in mutL and mutS strains. Further, DNA repairing mechanism was investigated in other microorganisms; single-strand cleavage caused by exposure to BNCB radiation (boron-neutron-captured beam) could not be repaired in E. coli. Whereas for Deinococcus radiodurans, of which survival rate was not decreased by {gamma}-ray radiation at 5 kGy or less, it was found that its single-strand DNA was damaged by {gamma}-radiation to smaller molecules, but it was mended to the similar size to that in the non-irradiated cells during incubation. In addition, the transformation frequency was also recovered in the actinomycetes. Thus, it was demonstrated that de novo protein synthesis is necessary for the repairing system of recombination. (M.N.)

  7. Damage and repair of ancient DNA

    DEFF Research Database (Denmark)

    Mitchell, David; Willerslev, Eske; Hansen, Anders

    2005-01-01

    of early native Americans. Hence, ancient DNA contains information pertinent to numerous fields of study including evolution, population genetics, ecology, climatology, medicine, archeology, and behavior. The major obstacles to the study of aDNA are its extremely low yield, contamination with modern DNA......Under certain conditions small amounts of DNA can survive for long periods of time and can be used as polymerase chain reaction (PCR) substrates for the study of phylogenetic relationships and population genetics of extinct plants and animals, including hominids. Because of extensive DNA...... degradation, these studies are limited to species that lived within the past 10(4)-10(5) years (Late Pleistocene), although DNA sequences from 10(6) years have been reported. Ancient DNA (aDNA) has been used to study phylogenetic relationships of protists, fungi, algae, plants, and higher eukaryotes...

  8. Induction of base excision repair enzymes NTH1 and APE1 in rat spleen following aniline exposure.

    Science.gov (United States)

    Ma, Huaxian; Wang, Jianling; Abdel-Rahman, Sherif Z; Boor, Paul J; Khan, M Firoze

    2013-03-15

    Mechanisms by which aniline exposure elicits splenotoxicity, especially a tumorigenic response, are not well-understood. Earlier, we have shown that aniline exposure leads to oxidative DNA damage and up-regulation of OGG1 and NEIL1/2 DNA glycosylases in rat spleen. However, the contribution of endonuclease III homolog 1 (NTH1) and apurinic/apyrimidinic endonuclease 1 (APE1) in the repair of aniline-induced oxidative DNA damage in the spleen is not known. This study was, therefore, focused on examining whether NTH1 and APE1 contribute to the repair of oxidative DNA lesions in the spleen, in an experimental condition preceding tumorigenesis. To achieve this, male SD rats were subchronically exposed to aniline (0.5 mmol/kg/day via drinking water for 30 days), while controls received drinking water only. By quantitating the cleavage products, the activities of NTH1 and APE1 were assayed using substrates containing thymine glycol (Tg) and tetrahydrofuran, respectively. Aniline treatment led to significant increases in NTH1- and APE1-mediated BER activity in the nuclear extracts of spleen of aniline-treated rats compared to the controls. NTH1 and APE1 mRNA expression in the spleen showed 2.9- and 3.2-fold increases, respectively, in aniline-treated rats compared to the controls. Likewise, Western blot analysis showed that protein expression of NTH1 and APE1 in the nuclear extracts of spleen from aniline-treated rats was 1.9- and 2.7-fold higher than the controls, respectively. Immunohistochemistry indicated that aniline treatment also led to stronger immunoreactivity for both NTH1 and APE1 in the spleens, confined to the red pulp areas. These results, thus, show that aniline exposure is associated with induction of NTH1 and APE1 in the spleen. The increased repair activity of NTH1 and APE1 could be an important mechanism for the removal of oxidative DNA lesions. These findings thus identify a novel mechanism through which NTH1 and APE1 may regulate the repair of

  9. Chromatid damage after G2 phase x-irradiation of cells from cancer-prone individuals implicates deficiency in DNA repair.

    Science.gov (United States)

    Parshad, R; Sanford, K K; Jones, G M

    1983-09-01

    Ten lines of skin fibroblasts from individuals with genetic disorders predisposing to a high risk of cancer were compared with nine lines from normal adult donors with respect to chromatid damage after x-irradiation [25, 50, and 100 rad (0.25, 0.50, and 1 gray)] during G2 phase. The 10 cell lines represented five ge