WorldWideScience

Sample records for evolutionary sequence conservation

  1. Evolutionary discrimination of mammalian conserved non-genic sequences (CNGs)

    NARCIS (Netherlands)

    Dermitzakis, ET; Reymond, A; Scamuffa, N; Ucla, C; Kirkness, E; Rossier, C; Antonarakis, SE

    2003-01-01

    Analysis of the human and mouse genomes identified an abundance of conserved non-genic sequences (CNGs). The significance and evolutionary depth of their conservation remain unanswered. We have quantified levels and patterns of conservation of 191 CNGs of human chromosome 21 in 14 mammalian species.

  2. Evolutionary placement of Xanthomonadales based on conserved protein signature sequences.

    Science.gov (United States)

    Cutiño-Jiménez, Ania M; Martins-Pinheiro, Marinalva; Lima, Wanessa C; Martín-Tornet, Alexander; Morales, Osleidys G; Menck, Carlos F M

    2010-02-01

    Xanthomonadales comprises one of the largest phytopathogenic bacterial groups, and is currently classified within the gamma-proteobacteria. However, the phylogenetic placement of this group is not clearly resolved, and the results of different studies contradict one another. In this work, the evolutionary position of Xanthomonadales was determined by analyzing the presence of shared insertions and deletions (INDELs) in highly conserved proteins. Several distinctive insertions found in most of the members of the gamma-proteobacteria are absent in Xanthomonadales and groups such as Legionelalles, Chromatiales, Methylococcales, Thiotrichales and Cardiobacteriales. These INDELs were most likely introduced after the branching of Xanthomonadales from most of the gamma-proteobacteria and provide evidence for the phylogenetic placement of the early gamma-proteobacteria. Moreover, other proteins contain insertions exclusive to the Xanthomonadales order, confirming that this is a monophyletic group and provide important specific genetic markers. Thus, the data presented clearly support the Xanthomonadales group as an independent subdivision, and constitute one of the deepest branching lineage within the gamma-proteobacteria clade. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  3. Evolutionary conservation of sequence and secondary structures inCRISPR repeats

    Energy Technology Data Exchange (ETDEWEB)

    Kunin, Victor; Sorek, Rotem; Hugenholtz, Philip

    2006-09-01

    Clustered Regularly Interspaced Palindromic Repeats (CRISPRs) are a novel class of direct repeats, separated by unique spacer sequences of similar length, that are present in {approx}40% of bacterial and all archaeal genomes analyzed to date. More than 40 gene families, called CRISPR-associated sequences (CAS), appear in conjunction with these repeats and are thought to be involved in the propagation and functioning of CRISPRs. It has been proposed that the CRISPR/CAS system samples, maintains a record of, and inactivates invasive DNA that the cell has encountered, and therefore constitutes a prokaryotic analog of an immune system. Here we analyze CRISPR repeats identified in 195 microbial genomes and show that they can be organized into multiple clusters based on sequence similarity. All individual repeats in any given cluster were inferred to form characteristic RNA secondary structure, ranging from non-existent to pronounced. Stable secondary structures included G:U base pairs and exhibited multiple compensatory base changes in the stem region, indicating evolutionary conservation and functional importance. We also show that the repeat-based classification corresponds to, and expands upon, a previously reported CAS gene-based classification including specific relationships between CRISPR and CAS subtypes.

  4. Proteome-Wide Discovery of Evolutionary Conserved Sequences in Disordered Regions

    Science.gov (United States)

    Nguyen Ba, Alex N.; Yeh, Brian J.; van Dyk, Dewald; Davidson, Alan R.; Andrews, Brenda J.; Weiss, Eric L.; Moses, Alan M.

    2016-01-01

    At least 30% of human proteins are thought to contain intrinsically disordered regions, which lack stable structural conformation. Despite lacking enzymatic functions and having few protein domains, disordered regions are functionally important for protein regulation and contain short linear motifs (short peptide sequences involved in protein-protein interactions), but in most disordered regions, the functional amino acid residues remain unknown. We searched for evolutionarily conserved sequences within disordered regions according to the hypothesis that conservation would indicate functional residues. Using a phylogenetic hidden Markov model (phylo-HMM), we made accurate, specific predictions of functional elements in disordered regions even when these elements are only two or three amino acids long. Among the conserved sequences that we identified were previously known and newly identified short linear motifs, and we experimentally verified key examples, including a motif that may mediate interaction between protein kinase Cbk1 and its substrates. We also observed that hub proteins, which interact with many partners in a protein interaction network, are highly enriched in these conserved sequences. Our analysis enabled the systematic identification of the functional residues in disordered regions and suggested that at least 5% of amino acids in disordered regions are important for function. PMID:22416277

  5. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Directory of Open Access Journals (Sweden)

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  6. Evolutionary conservation of protein backbone flexibility.

    Science.gov (United States)

    Maguid, Sandra; Fernández-Alberti, Sebastián; Parisi, Gustavo; Echave, Julián

    2006-10-01

    Internal protein dynamics is essential for biological function. During evolution, protein divergence is functionally constrained: properties more relevant for function vary more slowly than less important properties. Thus, if protein dynamics is relevant for function, it should be evolutionary conserved. In contrast with the well-studied evolution of protein structure, the evolutionary divergence of protein dynamics has not been addressed systematically before, apart from a few case studies. X-Ray diffraction analysis gives information not only on protein structure but also on B-factors, which characterize the flexibility that results from protein dynamics. Here we study the evolutionary divergence of protein backbone dynamics by comparing the C(alpha) flexibility (B-factor) profiles for a large dataset of homologous proteins classified into families and superfamilies. We show that C(alpha) flexibility profiles diverge slowly, so that they are conserved at family and superfamily levels, even for pairs of proteins with nonsignificant sequence similarity. We also analyze and discuss the correlations among the divergences of flexibility, sequence, and structure.

  7. cDNA sequence, genomic organization, and evolutionary conservation of a novel gene from the WAGR region

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, F.; Eisenman, R.; Knoll, J.; Bruns, G. [Children`s Hospital and Department of Pediatrics, Boston, MA (United States)

    1995-09-20

    A new gene (239FB) with predominant and differential expression in fetal brain has recently been isolated from a chromosome 11p13-p14 boundary area near FSHB. The corresponding mRNA has an open reading frame of 294 amino acids, a 3` untranslated region of 1247 nucleotides, and a highly GC-rich 5` untranslated region. The coding and 3` UT sequence is specified by 6 exons within nearly 87 kb of isolated genomic locus. The 5` end region of the transcript maps adjacent to the only genomically defined CpG island in a chromosomal subregion that may be associated with part of the mental retardation of some WAGR (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation) syndrome patients. In addition to nucleotide and amino acid similarity to an EST from a normalized infant brain cDNA library, the predicted protein has extensive similarity to Caenorhbditis elegans polypeptides of, as yet, unknown function. The 239FB locus is, therefore, likely part of a family of genes with two members expressed in human brain. The extensive conservation of the predicted protein suggests a fundamental function of the gene product and will enable evaluation of the role of the 239FB gene in neurogenesis in model organisms. 48 refs., 4 figs., 1 tab.

  8. Tracing the Evolutionary History of the CAP Superfamily of Proteins Using Amino Acid Sequence Homology and Conservation of Splice Sites.

    Science.gov (United States)

    Abraham, Anup; Chandler, Douglas E

    2017-10-01

    Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.

  9. Strategies for measuring evolutionary conservation of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Hofacker Ivo L

    2008-02-01

    Full Text Available Abstract Background Evolutionary conservation of RNA secondary structure is a typical feature of many functional non-coding RNAs. Since almost all of the available methods used for prediction and annotation of non-coding RNA genes rely on this evolutionary signature, accurate measures for structural conservation are essential. Results We systematically assessed the ability of various measures to detect conserved RNA structures in multiple sequence alignments. We tested three existing and eight novel strategies that are based on metrics of folding energies, metrics of single optimal structure predictions, and metrics of structure ensembles. We find that the folding energy based SCI score used in the RNAz program and a simple base-pair distance metric are by far the most accurate. The use of more complex metrics like for example tree editing does not improve performance. A variant of the SCI performed particularly well on highly conserved alignments and is thus a viable alternative when only little evolutionary information is available. Surprisingly, ensemble based methods that, in principle, could benefit from the additional information contained in sub-optimal structures, perform particularly poorly. As a general trend, we observed that methods that include a consensus structure prediction outperformed equivalent methods that only consider pairwise comparisons. Conclusion Structural conservation can be measured accurately with relatively simple and intuitive metrics. They have the potential to form the basis of future RNA gene finders, that face new challenges like finding lineage specific structures or detecting mis-aligned sequences.

  10. Evolutionary conservation of protein vibrational dynamics.

    Science.gov (United States)

    Maguid, Sandra; Fernandez-Alberti, Sebastian; Echave, Julian

    2008-10-01

    The aim of the present work is to study the evolutionary divergence of vibrational protein dynamics. To this end, we used the Gaussian Network Model to perform a systematic analysis of normal mode conservation on a large dataset of proteins classified into homologous sets of family pairs and superfamily pairs. We found that the lowest most collective normal modes are the most conserved ones. More precisely, there is, on average, a linear correlation between normal mode conservation and mode collectivity. These results imply that the previously observed conservation of backbone flexibility (B-factor) profiles is due to the conservation of the most collective modes, which contribute the most to such profiles. We discuss the possible roles of normal mode robustness and natural selection in the determination of the observed behavior. Finally, we draw some practical implications for dynamics-based protein alignment and classification and discuss possible caveats of the present approach.

  11. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  12. Does the evolutionary conservation of microsatellite loci imply function?

    Energy Technology Data Exchange (ETDEWEB)

    Shriver, M.D.; Deka, R.; Ferrell, R.E. [Univ. of Pittsburgh, PA (United States)] [and others

    1994-09-01

    Microsatellites are highly polymorphic tandem arrays of short (1-6 bp) sequence motifs which have been found widely distributed in the genomes of all eukaryotes. We have analyzed allele frequency data on 16 microsatellite loci typed in the great apes (human, chimp, orangutan, and gorilla). The majority of these loci (13) were isolated from human genomic libraries; three were cloned from chimpanzee genomic DNA. Most of these loci are not only present in all apes species, but are polymorphic with comparable levels of heterozygosity and have alleles which overlap in size. The extent of divergence of allele frequencies among these four species were studies using the stepwise-weighted genetic distance (Dsw), which was previously shown to conform to linearity with evolutionary time since divergence for loci where mutations exist in a stepwise fashion. The phylogenetic tree of the great apes constructed from this distance matrix was consistent with the expected topology, with a high bootstrap confidence (82%) for the human/chimp clade. However, the allele frequency distributions of these species are 10 times more similar to each other than expected when they were calibrated with a conservative estimate of the time since separation of humans and the apes. These results are in agreement with sequence-based surveys of microsatellites which have demonstrated that they are highly (90%) conserved over short periods of evolutionary time (< 10 million years) and moderately (30%) conserved over long periods of evolutionary time (> 60-80 million years). This evolutionary conservation has prompted some authors to speculate that there are functional constraints on microsatellite loci. In contrast, the presence of directional bias of mutations with constraints and/or selection against aberrant sized alleles can explain these results.

  13. Special Issue: Evolutionary perspectives on salmonid conservation and management

    OpenAIRE

    Waples, Robin S; Hendry, Andrew P

    2008-01-01

    This special issue of Evolutionary Applications comprises 15 papers that illustrate how evolutionary principles can inform the conservation and management of salmonid fishes. Several papers address the past evolutionary history of salmonids to gain insights into their likely plastic and genetic responses to future environmental change. The remaining papers consider potential evolutionary responses to climate warming, biological invasions, artificial propagation, habitat alteration, and harves...

  14. Genome sequence analysis of solanum lycopersicum showing the phylogenetic relationship based on multiple sequence alignment and conserved domain proteins.

    OpenAIRE

    Uma kumari; Ashok kumar choudhary

    2016-01-01

    Phylogenetics analysis has become essential in researching the evolutionary relationship between sequence alignment and conserved domain protein evolutionary relationship are identified from open reading frame rather than from complete sequences.A reading frame is a set of consecutive,nucleotide ,non overlapping triplets of three consecutive nucleotide .The national center for biotechnology information NCBI provide many tools for compairing database- stored nucleotide or protein sequence,i...

  15. EvoTol: a protein-sequence based evolutionary intolerance framework for disease-gene prioritization

    OpenAIRE

    Rackham, Owen?J.?L.; Shihab, Hashem A.; Johnson, Michael R.; Petretto, Enrico

    2014-01-01

    Methods to interpret personal genome sequences are increasingly required. Here, we report a novel framework (EvoTol) to identify disease-causing genes using patient sequence data from within protein coding-regions. EvoTol quantifies a gene's intolerance to mutation using evolutionary conservation of protein sequences and can incorporate tissue-specific gene expression data. We apply this framework to the analysis of whole-exome sequence data in epilepsy and congenital heart disease, and demon...

  16. Internal epitope tagging informed by relative lack of sequence conservation.

    Science.gov (United States)

    Burg, Leonard; Zhang, Karen; Bonawitz, Tristan; Grajevskaja, Viktorija; Bellipanni, Gianfranco; Waring, Richard; Balciunas, Darius

    2016-11-28

    Many experimental techniques rely on specific recognition and stringent binding of proteins by antibodies. This can readily be achieved by introducing an epitope tag. We employed an approach that uses a relative lack of evolutionary conservation to inform epitope tag site selection, followed by integration of the tag-coding sequence into the endogenous locus in zebrafish. We demonstrate that an internal epitope tag is accessible for antibody binding, and that tagged proteins retain wild type function.

  17. Internal epitope tagging informed by relative lack of sequence conservation

    OpenAIRE

    Leonard Burg; Karen Zhang; Tristan Bonawitz; Viktorija Grajevskaja; Gianfranco Bellipanni; Richard Waring; Darius Balciunas

    2016-01-01

    Many experimental techniques rely on specific recognition and stringent binding of proteins by antibodies. This can readily be achieved by introducing an epitope tag. We employed an approach that uses a relative lack of evolutionary conservation to inform epitope tag site selection, followed by integration of the tag-coding sequence into the endogenous locus in zebrafish. We demonstrate that an internal epitope tag is accessible for antibody binding, and that tagged proteins retain wild type ...

  18. Global distribution and conservation of evolutionary distinctness in birds.

    Science.gov (United States)

    Jetz, Walter; Thomas, Gavin H; Joy, Jeffrey B; Redding, David W; Hartmann, Klaas; Mooers, Arne O

    2014-05-05

    Integrated, efficient, and global prioritization approaches are necessary to manage the ongoing loss of species and their associated function. "Evolutionary distinctness" measures a species' contribution to the total evolutionary history of its clade and is expected to capture uniquely divergent genomes and functions. Here we demonstrate how such a metric identifies species and regions of particular value for safeguarding evolutionary diversity. Among the world's 9,993 recognized bird species, evolutionary distinctness is very heterogeneously distributed on the phylogenetic tree and varies little with range size or threat level. Species representing the most evolutionary history over the smallest area (those with greatest "evolutionary distinctness rarity") as well as some of the most imperiled distinct species are often concentrated outside the species-rich regions and countries, suggesting they may not be well captured by current conservation planning. We perform global cross-species and spatial analyses and generate minimum conservation sets to assess the benefits of the presented species-level metrics. We find that prioritizing imperiled species by their evolutionary distinctness and geographic rarity is a surprisingly effective and spatially economical way to maintain the total evolutionary information encompassing the world's birds. We identify potential conservation gaps in relation to the existing reserve network that in particular highlight islands as effective priority areas. The presented distinctness metrics are effective yet easily communicable and versatile tools to assist objective global conservation decision making. Given that most species will remain ecologically understudied, combining growing phylogenetic and spatial data may be an efficient way to retain vital aspects of biodiversity. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Evolutionary conservation and changes in insect TRP channels

    Directory of Open Access Journals (Sweden)

    Tominaga Makoto

    2009-09-01

    Full Text Available Abstract Background TRP (Transient Receptor Potential channels respond to diverse stimuli and thus function as the primary integrators of varied sensory information. They are also activated by various compounds and secondary messengers to mediate cell-cell interactions as well as to detect changes in the local environment. Their physiological roles have been primarily characterized only in mice and fruit flies, and evolutionary studies are limited. To understand the evolution of insect TRP channels and the mechanisms of integrating sensory inputs in insects, we have identified and compared TRP channel genes in Drosophila melanogaster, Bombyx mori, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, and Pediculus humanus genomes as part of genome sequencing efforts. Results All the insects examined have 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML subfamily members, demonstrating that these channels have the ancient origins in insects. The common pattern also suggests that the mechanisms for detecting mechanical and visual stimuli and maintaining lysosomal functions may be evolutionarily well conserved in insects. However, a TRPP channel, the most ancient TRP channel, is missing in B. mori, A. mellifera, and N. vitripennis. Although P. humanus and D. melanogaster contain 4 TRPA subfamily members, the other insects have 5 TRPA subfamily members. T. castaneum, A. mellifera, and N. vitripennis contain TRPA5 channels, which have been specifically retained or gained in Coleoptera and Hymenoptera. Furthermore, TRPA1, which functions for thermotaxis in Drosophila, is missing in A. mellifera and N. vitripennis; however, they have other Hymenoptera-specific TRPA channels (AmHsTRPA and NvHsTRPA. NvHsTRPA expressed in HEK293 cells is activated by temperature increase, demonstrating that HsTRPAs function as novel thermal sensors in Hymenoptera. Conclusion The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP

  20. Remarkable evolutionary conservation of SOX14 orthologues

    Indian Academy of Sciences (India)

    PCR based approach was used to identify Sox14 of goat, cow and rat, while nucleotide and amino acid sequence alignments and mapping were performed using information currently available in public database. Comparative sequence analysis revealed remarkable identity among Sox14 orthologues and helped us to ...

  1. The importance of an evolutionary perspective in conservation policy planning.

    Science.gov (United States)

    Moritz, Craig C; Potter, Sally

    2013-12-01

    Prioritization of taxa for conservation must rest on a foundation of correctly identified species boundaries, enhanced by an understanding of evolutionary history and phylogenetic relationships. Therefore, we can incorporate both evolutionary and ecological processes into efforts to sustain biodiversity. In this issue of Molecular Ecology, Malaney & Cook (2013) highlight the critical value of an evolutionary biogeographical approach, combining multilocus phylogeography with climatic niche modelling to infer phylogenetically weighted conservation priorities for evolutionary lineages of jumping mice across North America. Remarkably, they find that the Preble's meadow jumping mouse (Zapus hudsonius preblei), long debated as a threatened taxon, in fact represents the southern terminus of a relatively uniform lineage that expanded well into Alaska during the Holocene. By contrast, some other relictual and phylogenetically divergent taxa of jumping mice likely warrant greater conservation priority. This study highlights the value of integrative approaches that place current taxonomy in a broader evolutionary context to identify taxa for conservation assessment, but also highlights the challenges in maintaining potential for adaptive responses to environmental change. © 2013 John Wiley & Sons Ltd.

  2. Evolutionarily conserved sequences on human chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila

    2001-09-01

    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  3. The sequence, structure and evolutionary features of HOTAIR in mammals

    Science.gov (United States)

    2011-01-01

    Background An increasing number of long noncoding RNAs (lncRNAs) have been identified recently. Different from all the others that function in cis to regulate local gene expression, the newly identified HOTAIR is located between HoxC11 and HoxC12 in the human genome and regulates HoxD expression in multiple tissues. Like the well-characterised lncRNA Xist, HOTAIR binds to polycomb proteins to methylate histones at multiple HoxD loci, but unlike Xist, many details of its structure and function, as well as the trans regulation, remain unclear. Moreover, HOTAIR is involved in the aberrant regulation of gene expression in cancer. Results To identify conserved domains in HOTAIR and study the phylogenetic distribution of this lncRNA, we searched the genomes of 10 mammalian and 3 non-mammalian vertebrates for matches to its 6 exons and the two conserved domains within the 1800 bp exon6 using Infernal. There was just one high-scoring hit for each mammal, but many low-scoring hits were found in both mammals and non-mammalian vertebrates. These hits and their flanking genes in four placental mammals and platypus were examined to determine whether HOTAIR contained elements shared by other lncRNAs. Several of the hits were within unknown transcripts or ncRNAs, many were within introns of, or antisense to, protein-coding genes, and conservation of the flanking genes was observed only between human and chimpanzee. Phylogenetic analysis revealed discrete evolutionary dynamics for orthologous sequences of HOTAIR exons. Exon1 at the 5' end and a domain in exon6 near the 3' end, which contain domains that bind to multiple proteins, have evolved faster in primates than in other mammals. Structures were predicted for exon1, two domains of exon6 and the full HOTAIR sequence. The sequence and structure of two fragments, in exon1 and the domain B of exon6 respectively, were identified to robustly occur in predicted structures of exon1, domain B of exon6 and the full HOTAIR in mammals

  4. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  5. How conservative are evolutionary anthropologists?: a survey of political attitudes.

    Science.gov (United States)

    Lyle, Henry F; Smith, Eric A

    2012-09-01

    The application of evolutionary theory to human behavior has elicited a variety of critiques, some of which charge that this approach expresses or encourages conservative or reactionary political agendas. In a survey of graduate students in psychology, Tybur, Miller, and Gangestad (Human Nature, 18, 313-328, 2007) found that the political attitudes of those who use an evolutionary approach did not differ from those of other psychology grad students. Here, we present results from a directed online survey of a broad sample of graduate students in anthropology that assays political views. We found that evolutionary anthropology graduate students were very liberal in their political beliefs, overwhelmingly voted for a liberal U.S. presidential candidate in the 2008 election, and identified with liberal political parties; in this, they were almost indistinguishable from non-evolutionary anthropology students. Our results contradict the view that evolutionary anthropologists hold conservative or reactionary political views. We discuss some possible reasons for the persistence of this view in terms of the sociology of science.

  6. Evolutionary Relationships and Taxa-Specific Conserved Signature Indels Among Cellulases of Archaea, Bacteria, and Eukarya.

    Science.gov (United States)

    Thomas, Lebin; Ram, Hari; Singh, Ved Pal

    2017-10-01

    The cellulases from different cellulolytic organisms have evolutionary relationships, which range from single-celled prokaryotes to the complex eukaryotes of the living world. This in silico analysis revealed the presence of a conserved cellulase domain along with evolutionary relationships among cellulases from several species of Archaea, Bacteria, and Eukarya. The amino acid sequences of cellulases from Archaea and Bacteria showed closer identity with their domain or phylum members that provided insights into convergent and divergent evolution of cellulases from other enzymes with different substrate specificities. Evolutionary relatedness was also observed in phylogenetic trees among a number of cellulase sequences of diverse taxa. In cellulases, propensity for alanine, glycine, leucine, serine, and threonine was high, but low for cysteine, histidine, and methionine. Catalytic aspartic acid had a higher propensity than glutamic acid, and both were involved in regular expression patterns. Characteristic group and multigroup-specific conserved signature indels located in the catalytic domains of cellulases were observed that further clarified evolutionary relationships. These indels can be distinctive molecular tools for understanding phylogeny and identification of unknown cellulolytic species of common evolutionary descent in different environments.

  7. Sequence conservation on the Y chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, L.H.; Yang-Feng, L. [Yale Univ. School of Medicine, New Haven, CT (United States); Lau, C. [Univ. of California, San Francisco, CA (United States)

    1994-09-01

    The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid pools were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.

  8. Making evolutionary history count: biodiversity planning for coral reef fishes and the conservation of evolutionary processes

    Science.gov (United States)

    von der Heyden, Sophie

    2017-03-01

    Anthropogenic activities are having devastating impacts on marine systems with numerous knock-on effects on trophic functioning, species interactions and an accelerated loss of biodiversity. Establishing conservation areas can not only protect biodiversity, but also confer resilience against changes to coral reefs and their inhabitants. Planning for protection and conservation in marine systems is complex, but usually focuses on maintaining levels of biodiversity and protecting special and unique landscape features while avoiding negative impacts to socio-economic benefits. Conversely, the integration of evolutionary processes that have shaped extant species assemblages is rarely taken into account. However, it is as important to protect processes as it is to protect patterns for maintaining the evolutionary trajectories of populations and species. This review focuses on different approaches for integrating genetic analyses, such as phylogenetic diversity, phylogeography and the delineation of management units, temporal and spatial monitoring of genetic diversity and quantification of adaptive variation for protecting evolutionary resilience, into marine spatial planning, specifically for coral reef fishes. Many of these concepts are not yet readily applied to coral reef fish studies, but this synthesis highlights their potential and the importance of including historical processes into systematic biodiversity planning for conserving not only extant, but also future, biodiversity and its evolutionary potential.

  9. Evolutionary conservation of P-selectin glycoprotein ligand-1 primary structure and function

    Directory of Open Access Journals (Sweden)

    Schapira Marc

    2007-09-01

    Full Text Available Abstract Background P-selectin glycoprotein ligand-1 (PSGL-1 plays a critical role in recruiting leukocytes in inflammatory lesions by mediating leukocyte rolling on selectins. Core-2 O-glycosylation of a N-terminal threonine and sulfation of at least one tyrosine residue of PSGL-1 are required for L- and P-selectin binding. Little information is available on the intra- and inter-species evolution of PSGL-1 primary structure. In addition, the evolutionary conservation of selectin binding site on PSGL-1 has not been previously examined in detail. Therefore, we performed multiple sequence alignment of PSGL-1 amino acid sequences of 14 mammals (human, chimpanzee, rhesus monkey, bovine, pig, rat, tree-shrew, bushbaby, mouse, bat, horse, cat, sheep and dog and examined mammalian PSGL-1 interactions with human selectins. Results A signal peptide was predicted in each sequence and a propeptide cleavage site was found in 9/14 species. PSGL-1 N-terminus is poorly conserved. However, each species exhibits at least one tyrosine sulfation site and, except in horse and dog, a T [D/E]PP [D/E] motif associated to the core-2 O-glycosylation of a N-terminal threonine. A mucin-like domain of 250–280 amino acids long was disclosed in all studied species. It lies between the conserved N-terminal O-glycosylated threonine (Thr-57 in human and the transmembrane domain, and contains a central region exhibiting a variable number of decameric repeats (DR. Interspecies and intraspecies polymorphisms were observed. Transmembrane and cytoplasmic domain sequences are well conserved. The moesin binding residues that serve as adaptor between PSGL-1 and Syk, and are involved in regulating PSGL-1-dependent rolling on P-selectin are perfectly conserved in all analyzed mammalian sequences. Despite a poor conservation of PSGL-1 N-terminal sequence, CHO cells co-expressing human glycosyltransferases and human, bovine, pig or rat PSGL-1 efficiently rolled on human L- or P

  10. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Loots, G; Ovcharenko, I

    2006-08-08

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. We have created a database of evolutionary conserved regions (ECRs) in vertebrate genomes entitled ECRbase that is constructed from a collection of pairwise vertebrate genome alignments produced by the ECR Browser database. ECRbase features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a collection of promoters in all vertebrate genomes presented in the database. The database also contains a collection of annotated transcription factor binding sites (TFBS) in all ECRs and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and two pufferfish genomes. It is freely accessible at http://ECRbase.dcode.org.

  11. Masking residues using context-specific evolutionary conservation significantly improves short linear motif discovery.

    Science.gov (United States)

    Davey, Norman E; Shields, Denis C; Edwards, Richard J

    2009-02-15

    Short linear motifs (SLiMs) are important mediators of protein-protein interactions. Their short and degenerate nature presents a challenge for computational discovery. We sought to improve SLiM discovery by incorporating evolutionary information, since SLiMs are more conserved than surrounding residues. We have developed a new method that assesses the evolutionary signal of a residue in its sequence and structural context. Under-conserved residues are masked out prior to SLiM discovery, allowing incorporation into the existing statistical model employed by SLiMFinder. The method shows considerable robustness in terms of both the conservation score used for individual residues and the size of the sequence neighbourhood. Optimal parameters significantly improve return of known functional motifs from benchmarking data, raising the return of significant validated SLiMs from typical human interaction datasets from 20% to 60%, while retaining the high level of stringency needed for application to real biological data. The success of this regime indicates that it could be of general benefit to computational annotation and prediction of protein function at the sequence level. All data and tools in this article are available at http://bioware.ucd.ie/~slimdisc/slimfinder/conmasking/.

  12. Late replication domains are evolutionary conserved in the Drosophila genome.

    Directory of Open Access Journals (Sweden)

    Natalya G Andreyenkova

    Full Text Available Drosophila chromosomes are organized into distinct domains differing in their predominant chromatin composition, replication timing and evolutionary conservation. We show on a genome-wide level that genes whose order has remained unaltered across 9 Drosophila species display late replication timing and frequently map to the regions of repressive chromatin. This observation is consistent with the existence of extensive domains of repressive chromatin that replicate extremely late and have conserved gene order in the Drosophila genome. We suggest that such repressive chromatin domains correspond to a handful of regions that complete replication at the very end of S phase. We further demonstrate that the order of genes in these regions is rarely altered in evolution. Substantial proportion of such regions significantly coincide with large synteny blocks. This indicates that there are evolutionary mechanisms maintaining the integrity of these late-replicating chromatin domains. The synteny blocks corresponding to the extremely late-replicating regions in the D. melanogaster genome consistently display two-fold lower gene density across different Drosophila species.

  13. An evolutionary tree for invertebrate globin sequences.

    Science.gov (United States)

    Goodman, M; Pedwaydon, J; Czelusniak, J; Suzuki, T; Gotoh, T; Moens, L; Shishikura, F; Walz, D; Vinogradov, S

    1988-01-01

    A phylogenetic tree was constructed from 245 globin amino acid sequences. Of the six plant globins, five represented the Leguminosae and one the Ulmaceae. Among the invertebrate sequences, 7 represented the phylum Annelida, 13 represented Insecta and Crustacea of the phylum Arthropoda, and 6 represented the phylum Mollusca. Of the vertebrate globins, 4 represented the Agnatha and 209 represented the Gnathostomata. A common alignment was achieved for the 245 sequences using the parsimony principle, and a matrix of minimum mutational distances was constructed. The most parsimonious phylogenetic tree, i.e., the one having the lowest number of nucleotide substitutions that cause amino acid replacements, was obtained employing clustering and branch-swapping algorithms. Based on the available fossil record, the earliest split in the ancestral metazoan lineage was placed at 680 million years before present (Myr BP), the origin of vertebrates was placed at 510 Myr BP, and the separation of the Chondrichthyes and the Osteichthyes was placed at 425 Myr BP. Local "molecular clock" calculations were used to date the branch points on the descending branches of the various lineages within the plant and invertebrate portions of the tree. The tree divided the 245 sequences into five distinct clades that corresponded exactly to the five groups plants, annelids, arthropods, molluscs, and vertebrates. Furthermore, the maximum parsimony tree, in contrast to the unweighted pair group and distance Wagner trees, was consistent with the available fossil record and supported the hypotheses that the primitive hemoglobin of metazoans was monomeric and that the multisubunit extracellular hemoglobins found among the Annelida and the Arthropoda represent independently derived states.

  14. Identification of putative regulatory upstream ORFs in the yeast genome using heuristics and evolutionary conservation

    Directory of Open Access Journals (Sweden)

    Bilsland Elizabeth

    2007-08-01

    Full Text Available Abstract Background The translational efficiency of an mRNA can be modulated by upstream open reading frames (uORFs present in certain genes. A uORF can attenuate translation of the main ORF by interfering with translational reinitiation at the main start codon. uORFs also occur by chance in the genome, in which case they do not have a regulatory role. Since the sequence determinants for functional uORFs are not understood, it is difficult to discriminate functional from spurious uORFs by sequence analysis. Results We have used comparative genomics to identify novel uORFs in yeast with a high likelihood of having a translational regulatory role. We examined uORFs, previously shown to play a role in regulation of translation in Saccharomyces cerevisiae, for evolutionary conservation within seven Saccharomyces species. Inspection of the set of conserved uORFs yielded the following three characteristics useful for discrimination of functional from spurious uORFs: a length between 4 and 6 codons, a distance from the start of the main ORF between 50 and 150 nucleotides, and finally a lack of overlap with, and clear separation from, neighbouring uORFs. These derived rules are inherently associated with uORFs with properties similar to the GCN4 locus, and may not detect most uORFs of other types. uORFs with high scores based on these rules showed a much higher evolutionary conservation than randomly selected uORFs. In a genome-wide scan in S. cerevisiae, we found 34 conserved uORFs from 32 genes that we predict to be functional; subsequent analysis showed the majority of these to be located within transcripts. A total of 252 genes were found containing conserved uORFs with properties indicative of a functional role; all but 7 are novel. Functional content analysis of this set identified an overrepresentation of genes involved in transcriptional control and development. Conclusion Evolutionary conservation of uORFs in yeasts can be traced up to 100

  15. In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

    Energy Technology Data Exchange (ETDEWEB)

    Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.

    2006-02-01

    The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

  16. Tissue-specific DNA methylation is conserved across human, mouse, and rat, and driven by primary sequence conservation.

    Science.gov (United States)

    Zhou, Jia; Sears, Renee L; Xing, Xiaoyun; Zhang, Bo; Li, Daofeng; Rockweiler, Nicole B; Jang, Hyo Sik; Choudhary, Mayank N K; Lee, Hyung Joo; Lowdon, Rebecca F; Arand, Jason; Tabers, Brianne; Gu, C Charles; Cicero, Theodore J; Wang, Ting

    2017-09-12

    Uncovering mechanisms of epigenome evolution is an essential step towards understanding the evolution of different cellular phenotypes. While studies have confirmed DNA methylation as a conserved epigenetic mechanism in mammalian development, little is known about the conservation of tissue-specific genome-wide DNA methylation patterns. Using a comparative epigenomics approach, we identified and compared the tissue-specific DNA methylation patterns of rat against those of mouse and human across three shared tissue types. We confirmed that tissue-specific differentially methylated regions are strongly associated with tissue-specific regulatory elements. Comparisons between species revealed that at a minimum 11-37% of tissue-specific DNA methylation patterns are conserved, a phenomenon that we define as epigenetic conservation. Conserved DNA methylation is accompanied by conservation of other epigenetic marks including histone modifications. Although a significant amount of locus-specific methylation is epigenetically conserved, the majority of tissue-specific DNA methylation is not conserved across the species and tissue types that we investigated. Examination of the genetic underpinning of epigenetic conservation suggests that primary sequence conservation is a driving force behind epigenetic conservation. In contrast, evolutionary dynamics of tissue-specific DNA methylation are best explained by the maintenance or turnover of binding sites for important transcription factors. Our study extends the limited literature of comparative epigenomics and suggests a new paradigm for epigenetic conservation without genetic conservation through analysis of transcription factor binding sites.

  17. Cross-species genome-wide identification of evolutionary conserved microproteins

    DEFF Research Database (Denmark)

    Straub, Daniel; Wenkel, Stephan

    2017-01-01

    Protein concept beyond transcription factors to other protein families. Here, we reveal potential microProtein candidates in several plant and animal reference genomes. A large number of these microProteins are species-specific while others evolved early and are evolutionary highly conserved. Most known micro......MicroProteins are small single-domain proteins that act by engaging their targets into different, sometimes nonproductive protein complexes. In order to identify novel microProteins in any sequenced genome of interest, we have developed miPFinder, a program that identifies and classifies potential...

  18. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica

    Science.gov (United States)

    2011-01-01

    Background Angiosperm mitochondrial genomes are more complex than those of other organisms. Analyses of the mitochondrial genome sequences of at least 11 angiosperm species have showed several common properties; these cannot easily explain, however, how the diverse mitotypes evolved within each genus or species. We analyzed the evolutionary relationships of Brassica mitotypes by sequencing. Results We sequenced the mitotypes of cam (Brassica rapa), ole (B. oleracea), jun (B. juncea), and car (B. carinata) and analyzed them together with two previously sequenced mitotypes of B. napus (pol and nap). The sizes of whole single circular genomes of cam, jun, ole, and car are 219,747 bp, 219,766 bp, 360,271 bp, and 232,241 bp, respectively. The mitochondrial genome of ole is largest as a resulting of the duplication of a 141.8 kb segment. The jun mitotype is the result of an inherited cam mitotype, and pol is also derived from the cam mitotype with evolutionary modifications. Genes with known functions are conserved in all mitotypes, but clear variation in open reading frames (ORFs) with unknown functions among the six mitotypes was observed. Sequence relationship analysis showed that there has been genome compaction and inheritance in the course of Brassica mitotype evolution. Conclusions We have sequenced four Brassica mitotypes, compared six Brassica mitotypes and suggested a mechanism for mitochondrial genome formation in Brassica, including evolutionary events such as inheritance, duplication, rearrangement, genome compaction, and mutation. PMID:21988783

  19. Evolutionary rescue: linking theory for conservation and medicine.

    Science.gov (United States)

    Alexander, Helen K; Martin, Guillaume; Martin, Oliver Y; Bonhoeffer, Sebastian

    2014-12-01

    Evolutionary responses that rescue populations from extinction when drastic environmental changes occur can be friend or foe. The field of conservation biology is concerned with the survival of species in deteriorating global habitats. In medicine, in contrast, infected patients are treated with chemotherapeutic interventions, but drug resistance can compromise eradication of pathogens. These contrasting biological systems and goals have created two quite separate research communities, despite addressing the same central question of whether populations will decline to extinction or be rescued through evolution. We argue that closer integration of the two fields, especially of theoretical understanding, would yield new insights and accelerate progress on these applied problems. Here, we overview and link mathematical modelling approaches in these fields, suggest specific areas with potential for fruitful exchange, and discuss common ideas and issues for empirical testing and prediction.

  20. EvoTol: a protein-sequence based evolutionary intolerance framework for disease-gene prioritization.

    Science.gov (United States)

    Rackham, Owen J L; Shihab, Hashem A; Johnson, Michael R; Petretto, Enrico

    2015-03-11

    Methods to interpret personal genome sequences are increasingly required. Here, we report a novel framework (EvoTol) to identify disease-causing genes using patient sequence data from within protein coding-regions. EvoTol quantifies a gene's intolerance to mutation using evolutionary conservation of protein sequences and can incorporate tissue-specific gene expression data. We apply this framework to the analysis of whole-exome sequence data in epilepsy and congenital heart disease, and demonstrate EvoTol's ability to identify known disease-causing genes is unmatched by competing methods. Application of EvoTol to the human interactome revealed networks enriched for genes intolerant to protein sequence variation, informing novel polygenic contributions to human disease. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Evolutionary conservation of mammalian sperm proteins associates with overall, not tyrosine, phosphorylation in human spermatozoa.

    Science.gov (United States)

    Schumacher, Julia; Ramljak, Sanja; Asif, Abdul R; Schaffrath, Michael; Zischler, Hans; Herlyn, Holger

    2013-12-06

    We investigated possible associations between sequence evolution of mammalian sperm proteins and their phosphorylation status in humans. As a reference, spermatozoa from three normozoospermic men were analyzed combining two-dimensional gel electrophoresis, immunoblotting, and mass spectrometry. We identified 99 sperm proteins (thereof 42 newly described) and determined the phosphorylation status for most of them. Sequence evolution was studied across six mammalian species using nonsynonymous/synonymous rate ratios (dN/dS) and amino acid distances. Site-specific purifying selection was assessed employing average ratios of evolutionary rates at phosphorylated versus nonphosphorylated amino acids (α). According to our data, mammalian sperm proteins do not show statistically significant sequence conservation difference, no matter if the human ortholog is a phosphoprotein with or without tyrosine (Y) phosphorylation. In contrast, overall phosphorylation of human sperm proteins, i.e., phosphorylation at serine (S), threonine (T), and/or Y residues, associates with above-average conservation of sequences. Complementary investigations suggest that numerous protein-protein interactants constrain sequence evolution of sperm phosphoproteins. Although our findings reject a special relevance of Y phosphorylation for sperm functioning, they still indicate that overall phosphorylation substantially contributes to proper functioning of sperm proteins. Hence, phosphorylated sperm proteins might be considered as prime candidates for diagnosis and treatment of reduced male fertility.

  2. Protein 3D Structure Computed from Evolutionary Sequence Variation

    Science.gov (United States)

    Sheridan, Robert; Hopf, Thomas A.; Pagnani, Andrea; Zecchina, Riccardo; Sander, Chris

    2011-01-01

    The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing. In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy. We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues., including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7–4.8 Å Cα-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org). This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of protein

  3. Evolutionary conservation of essential and highly expressed genes in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Scharfe Maren

    2010-04-01

    Full Text Available Abstract Background The constant increase in development and spread of bacterial resistance to antibiotics poses a serious threat to human health. New sequencing technologies are now on the horizon that will yield massive increases in our capacity for DNA sequencing and will revolutionize the drug discovery process. Since essential genes are promising novel antibiotic targets, the prediction of gene essentiality based on genomic information has become a major focus. Results In this study we demonstrate that pooled sequencing is applicable for the analysis of sequence variations of strain collections with more than 10 individual isolates. Pooled sequencing of 36 clinical Pseudomonas aeruginosa isolates revealed that essential and highly expressed proteins evolve at lower rates, whereas extracellular proteins evolve at higher rates. We furthermore refined the list of experimentally essential P. aeruginosa genes, and identified 980 genes that show no sequence variation at all. Among the conserved nonessential genes we found several that are involved in regulation, motility and virulence, indicating that they represent factors of evolutionary importance for the lifestyle of a successful environmental bacterium and opportunistic pathogen. Conclusion The detailed analysis of a comprehensive set of P. aeruginosa genomes in this study clearly disclosed detailed information of the genomic makeup and revealed a large set of highly conserved genes that play an important role for the lifestyle of this microorganism. Sequencing strain collections enables for a detailed and extensive identification of sequence variations as potential bacterial adaptation processes, e.g., during the development of antibiotic resistance in the clinical setting and thus may be the basis to uncover putative targets for novel treatment strategies.

  4. Evolutionary Conservation of ABA Signaling for Stomatal Closure1[OPEN

    Science.gov (United States)

    Huang, Yuqing; Dai, Fei; Franks, Peter J.; Nevo, Eviatar; Soltis, Douglas E.; Soltis, Pamela S.; Xue, Dawei; Zhang, Guoping; Pogson, Barry J.

    2017-01-01

    Abscisic acid (ABA)-driven stomatal regulation reportedly evolved after the divergence of ferns, during the early evolution of seed plants approximately 360 million years ago. This hypothesis is based on the observation that the stomata of certain fern species are unresponsive to ABA, but exhibit passive hydraulic control. However, ABA-induced stomatal closure was detected in some mosses and lycophytes. Here, we observed that a number of ABA signaling and membrane transporter protein families diversified over the evolutionary history of land plants. The aquatic ferns Azolla filiculoides and Salvinia cucullata have representatives of 23 families of proteins orthologous to those of Arabidopsis (Arabidopsis thaliana) and all other land plant species studied. Phylogenetic analysis of the key ABA signaling proteins indicates an evolutionarily conserved stomatal response to ABA. Moreover, comparative transcriptomic analysis has identified a suite of ABA-responsive genes that differentially expressed in a terrestrial fern species, Polystichum proliferum. These genes encode proteins associated with ABA biosynthesis, transport, reception, transcription, signaling, and ion and sugar transport, which fit the general ABA signaling pathway constructed from Arabidopsis and Hordeum vulgare. The retention of these key ABA-responsive genes could have had a profound effect on the adaptation of ferns to dry conditions. Furthermore, stomatal assays have shown the primary evidence for ABA-induced closure of stomata in two terrestrial fern species P. proliferum and Nephrolepis exaltata. In summary, we report, to our knowledge, new molecular and physiological evidence for the presence of active stomatal control in ferns. PMID:28232585

  5. Genes with stable DNA methylation levels show higher evolutionary conservation than genes with fluctuant DNA methylation levels.

    Science.gov (United States)

    Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai

    2015-11-24

    Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.

  6. Historian: accurate reconstruction of ancestral sequences and evolutionary rates.

    Science.gov (United States)

    Holmes, Ian H

    2017-04-15

    Reconstruction of ancestral sequence histories, and estimation of parameters like indel rates, are improved by using explicit evolutionary models and summing over uncertain alignments. The previous best tool for this purpose (according to simulation benchmarks) was ProtPal, but this tool was too slow for practical use. Historian combines an efficient reimplementation of the ProtPal algorithm with performance-improving heuristics from other alignment tools. Simulation results on fidelity of rate estimation via ancestral reconstruction, along with evaluations on the structurally informed alignment dataset BAliBase 3.0, recommend Historian over other alignment tools for evolutionary applications. Historian is available at https://github.com/evoldoers/historian under the Creative Commons Attribution 3.0 US license. ihholmes+historian@gmail.com.

  7. Evolutionary Conservation in Genes Underlying Human Psychiatric Disorders

    Directory of Open Access Journals (Sweden)

    Lisa Michelle Ogawa

    2014-05-01

    Full Text Available Many psychiatric diseases observed in humans have tenuous or absent analogs in other species. Most notable among these are schizophrenia and autism. One hypothesis has posited that these diseases have arisen as a consequence of human brain evolution, for example, that the same processes that led to advances in cognition, language, and executive function also resulted in novel diseases in humans when dysfunctional. Here, the molecular evolution of genes associated with these and other psychiatric disorders are compared among species. Genes associated with psychiatric disorders are drawn from the literature and orthologous sequences are collected from eleven primate species (human, chimpanzee, bonobo, gorilla, orangutan, gibbon, macaque, baboon, marmoset, squirrel monkey, and galago and thirty one non-primate mammalian species. Evolutionary parameters, including dN/dS, are calculated for each gene and compared between disease classes and among species, focusing on humans and primates compared to other mammals and on large-brained taxa (cetaceans, rhinoceros, walrus, bear, and elephant compared to their small-brained sister species. Evidence of differential selection in primates supports the hypothesis that schizophrenia and autism are a cost of higher brain function. Through this work a better understanding of the molecular evolution of the human brain, the pathophysiology of disease, and the genetic basis of human psychiatric disease is gained.

  8. Investigating evolutionary conservation of dendritic cell subset identity and functions

    Directory of Open Access Journals (Sweden)

    Thien-Phong eVu Manh

    2015-06-01

    Full Text Available Dendritic cells (DC were initially defined as mononuclear phagocytes with a dendritic morphology and an exquisite efficiency for naïve T cell activation. DC encompass several subsets initially identified by their expression of specific cell surface molecules and later shown to excel in distinct functions and to develop under the instruction of different transcription factors or cytokines. Very few cell surface molecules are expressed in a specific manner on any immune cell type. Hence, to identify cell types, the sole use of a small number of cell surface markers in classical flow cytometry can be deceiving. Moreover, the markers currently used to define mononuclear phagocyte subsets vary depending on the tissue and animal species studied and even between laboratories. This has led to confusion in the definition of DC subset identity and in their attribution of specific functions. There is a strong need to identify a rigorous and consensus way to define mononuclear phagocyte subsets, with precise guidelines potentially applicable throughout tissues and species. We will discuss the advantages, drawbacks and complementarities of different methodologies: cell surface phenotyping, ontogeny, functional characterization and molecular profiling. We will advocate that gene expression profiling is a very rigorous, largely unbiased and accessible method to define the identity of mononuclear phagocyte subsets, which strengthens and refines surface phenotyping. It is uniquely powerful to yield new, experimentally testable, hypotheses on the ontogeny or functions of mononuclear phagocyte subsets, their molecular regulation and their evolutionary conservation. We propose defining cell populations based on a combination of cell surface phenotyping, expression analysis of hallmark genes and robust functional assays, in order to reach a consensus and integrate faster the huge but scattered knowledge accumulated by different laboratories on different cell types

  9. Evolutionary Conservation of ABA Signaling for Stomatal Closure.

    Science.gov (United States)

    Cai, Shengguan; Chen, Guang; Wang, Yuanyuan; Huang, Yuqing; Marchant, D Blaine; Wang, Yizhou; Yang, Qian; Dai, Fei; Hills, Adrian; Franks, Peter J; Nevo, Eviatar; Soltis, Douglas E; Soltis, Pamela S; Sessa, Emily; Wolf, Paul G; Xue, Dawei; Zhang, Guoping; Pogson, Barry J; Blatt, Michael R; Chen, Zhong-Hua

    2017-06-01

    Abscisic acid (ABA)-driven stomatal regulation reportedly evolved after the divergence of ferns, during the early evolution of seed plants approximately 360 million years ago. This hypothesis is based on the observation that the stomata of certain fern species are unresponsive to ABA, but exhibit passive hydraulic control. However, ABA-induced stomatal closure was detected in some mosses and lycophytes. Here, we observed that a number of ABA signaling and membrane transporter protein families diversified over the evolutionary history of land plants. The aquatic ferns Azolla filiculoides and Salvinia cucullata have representatives of 23 families of proteins orthologous to those of Arabidopsis (Arabidopsis thaliana) and all other land plant species studied. Phylogenetic analysis of the key ABA signaling proteins indicates an evolutionarily conserved stomatal response to ABA. Moreover, comparative transcriptomic analysis has identified a suite of ABA-responsive genes that differentially expressed in a terrestrial fern species, Polystichum proliferum These genes encode proteins associated with ABA biosynthesis, transport, reception, transcription, signaling, and ion and sugar transport, which fit the general ABA signaling pathway constructed from Arabidopsis and Hordeum vulgare The retention of these key ABA-responsive genes could have had a profound effect on the adaptation of ferns to dry conditions. Furthermore, stomatal assays have shown the primary evidence for ABA-induced closure of stomata in two terrestrial fern species Pproliferum and Nephrolepis exaltata In summary, we report, to our knowledge, new molecular and physiological evidence for the presence of active stomatal control in ferns. © 2017 American Society of Plant Biologists. All Rights Reserved.

  10. An evolutionary model for protein-coding regions with conserved RNA structure

    DEFF Research Database (Denmark)

    Pedersen, Jakob Skou; Forsberg, Roald; Meyer, Irmtraud Margret

    2004-01-01

    components of traditional phylogenetic models. We applied this to a data set of full-genome sequences from the hepatitis C virus where five RNA structures are mapped within the coding region. This allowed us to partition the effects of selection on different structural elements and to test various hypotheses...... concerning the relation of these effects. Of particular interest, we found evidence of a functional role of loop and bulge regions, as these were shown to evolve according to a different and more constrained selective regime than the nonpairing regions outside the RNA structures. Other potential applications......Here we present a model of nucleotide substitution in protein-coding regions that also encode the formation of conserved RNA structures. In such regions, apparent evolutionary context dependencies exist, both between nucleotides occupying the same codon and between nucleotides forming a base pair...

  11. Evolutionary biology in biodiversity science, conservation, and policy: a call to action.

    Science.gov (United States)

    Hendry, Andrew P; Lohmann, Lúcia G; Conti, Elena; Cracraft, Joel; Crandall, Keith A; Faith, Daniel P; Häuser, Christoph; Joly, Carlos A; Kogure, Kazuhiro; Larigauderie, Anne; Magallón, Susana; Moritz, Craig; Tillier, Simon; Zardoya, Rafael; Prieur-Richard, Anne-Hélène; Walther, Bruno A; Yahara, Tetsukazu; Donoghue, Michael J

    2010-05-01

    Evolutionary biologists have long endeavored to document how many species exist on Earth, to understand the processes by which biodiversity waxes and wanes, to document and interpret spatial patterns of biodiversity, and to infer evolutionary relationships. Despite the great potential of this knowledge to improve biodiversity science, conservation, and policy, evolutionary biologists have generally devoted limited attention to these broader implications. Likewise, many workers in biodiversity science have underappreciated the fundamental relevance of evolutionary biology. The aim of this article is to summarize and illustrate some ways in which evolutionary biology is directly relevant. We do so in the context of four broad areas: (1) discovering and documenting biodiversity, (2) understanding the causes of diversification, (3) evaluating evolutionary responses to human disturbances, and (4) implications for ecological communities, ecosystems, and humans. We also introduce bioGENESIS, a new project within DIVERSITAS launched to explore the potential practical contributions of evolutionary biology. In addition to fostering the integration of evolutionary thinking into biodiversity science, bioGENESIS provides practical recommendations to policy makers for incorporating evolutionary perspectives into biodiversity agendas and conservation. We solicit your involvement in developing innovative ways of using evolutionary biology to better comprehend and stem the loss of biodiversity.

  12. Episodic Statistics of Evolutionary Substitutions in DNA Sequences

    Science.gov (United States)

    West, Bruce J.

    1998-03-01

    The number of molecular substitutions occurring in a DNA sequence in a given time interval is described by a fractional-difference equation whose statistics are described by a truncated Levy distribution and which has an inverse power law correlation function. This is an empirically motivated stochastic model of molecular evolution and does not address the evolutionary mechanisms that lead to substitutions. The Levy stable process yields a Fano Factor, the ratio of the variance to the mean in the number of molecular substitutions, that increases as a power law in time. This prediction agrees with the observed statistics across 49 different genes in mammals. This model of molecular evolution is episodic and is consistent with the punctuated equilibrium model of macroevolution without making additional statistical assumptions.

  13. Weak correlation between sequence conservation in promoter regions and in protein-coding regions of human-mouse orthologous gene pairs

    Directory of Open Access Journals (Sweden)

    Nakai Kenta

    2008-04-01

    Full Text Available Abstract Background Interspecies sequence comparison is a powerful tool to extract functional or evolutionary information from the genomes of organisms. A number of studies have compared protein sequences or promoter sequences between mammals, which provided many insights into genomics. However, the correlation between protein conservation and promoter conservation remains controversial. Results We examined promoter conservation as well as protein conservation for 6,901 human and mouse orthologous genes, and observed a very weak correlation between them. We further investigated their relationship by decomposing it based on functional categories, and identified categories with significant tendencies. Remarkably, the 'ribosome' category showed significantly low promoter conservation, despite its high protein conservation, and the 'extracellular matrix' category showed significantly high promoter conservation, in spite of its low protein conservation. Conclusion Our results show the relation of gene function to protein conservation and promoter conservation, and revealed that there seem to be nonparallel components between protein and promoter sequence evolution.

  14. Next generation sequencing and analysis of a conserved transcriptome of New Zealand's kiwi.

    Science.gov (United States)

    Subramanian, Sankar; Huynen, Leon; Millar, Craig D; Lambert, David M

    2010-12-15

    Kiwi is a highly distinctive, flightless and endangered ratite bird endemic to New Zealand. To understand the patterns of molecular evolution of the nuclear protein-coding genes in brown kiwi (Apteryx australis mantelli) and to determine the timescale of avian history we sequenced a transcriptome obtained from a kiwi embryo using next generation sequencing methods. We then assembled the conserved protein-coding regions using the chicken proteome as a scaffold. Using 1,543 conserved protein coding genes we estimated the neutral evolutionary divergence between the kiwi and chicken to be ~45%, which is approximately equal to the divergence computed for the human-mouse pair using the same set of genes. A large fraction of genes was found to be under high selective constraint, as most of the expressed genes appeared to be involved in developmental gene regulation. Our study suggests a significant relationship between gene expression levels and protein evolution. Using sequences from over 700 nuclear genes we estimated the divergence between the two basal avian groups, Palaeognathae and Neognathae to be 132 million years, which is consistent with previous studies using mitochondrial genes. The results of this investigation revealed patterns of mutation and purifying selection in conserved protein coding regions in birds. Furthermore this study suggests a relatively cost-effective way of obtaining a glimpse into the fundamental molecular evolutionary attributes of a genome, particularly when no closely related genomic sequence is available.

  15. Predicting DNA-binding amino acid residues from electrostatic stabilization upon mutation to Asp/Glu and evolutionary conservation.

    Science.gov (United States)

    Chen, Yao Chi; Wu, Chih Yuan; Lim, Carmay

    2007-05-15

    Binding of polyanionic DNA depends on the cluster of electropositive atoms in the binding site of a DNA-binding protein. Such a cluster of electropositive protein atoms would be electrostatically unfavorable without stabilizing interactions from the respective electronegative DNA atoms and would likely be evolutionary conserved due to its critical biological role. Consequently, our strategy for predicting DNA-binding residues is based on detecting a cluster of evolutionary conserved surface residues that are electrostatically stabilized upon mutation to negatively charged Asp/Glu residues. The method requires as input the protein structure and sufficient sequence homologs to define each residue's relative conservation, and it yields as output experimentally testable residues that are predicted to bind DNA. By incorporating characteristic DNA-binding site features (i.e., electrostatic strain and amino acid conservation), the new method yields a prediction accuracy of 83%, which is much higher than methods based on only electrostatic strain (57%) or conservation alone (50%). It is also less sensitive to protein conformational changes upon DNA binding than methods that mainly depend on the 3D protein structure. 2007 Wiley-Liss, Inc.

  16. Conservation of the Keap1-Nrf2 System: An Evolutionary Journey through Stressful Space and Time

    Directory of Open Access Journals (Sweden)

    Yuji Fuse

    2017-03-01

    Full Text Available The Keap1-Nrf2 system is an evolutionarily conserved defense mechanism against oxidative and xenobiotic stress. Its regulatory mechanisms, e.g., stress-sensing mechanism, proteasome-based regulation of Nrf2 activity and selection of target genes, have been elucidated mainly in mammals. In addition, emerging model animals, such as zebrafish, fruit fly and Caenorhabditis elegans, have been shown to have similar anti-stress systems to mammals, suggesting that analogous defense systems are widely conserved throughout the animal kingdom. Experimental evidence in lower animals provides important information beyond mere laboratory-confined utility, such as regarding how these systems transformed during evolution, which may help characterize the mammalian system in greater detail. Recent advances in genome projects of both model and non-model animals have provided a great deal of useful information toward this end. We herein review the research on Keap1-Nrf2 and its analogous systems in both mammals and lower model animals. In addition, by comparing the amino acid sequences of Nrf2 and Keap1 proteins from various species, we can deduce the evolutionary history of the anti-stress system. This combinatorial approach using both experimental and genetic data will suggest perspectives of approach for researchers studying the stress response.

  17. Conservation of the Keap1-Nrf2 System: An Evolutionary Journey through Stressful Space and Time.

    Science.gov (United States)

    Fuse, Yuji; Kobayashi, Makoto

    2017-03-09

    The Keap1-Nrf2 system is an evolutionarily conserved defense mechanism against oxidative and xenobiotic stress. Its regulatory mechanisms, e.g., stress-sensing mechanism, proteasome-based regulation of Nrf2 activity and selection of target genes, have been elucidated mainly in mammals. In addition, emerging model animals, such as zebrafish, fruit fly and Caenorhabditis elegans , have been shown to have similar anti-stress systems to mammals, suggesting that analogous defense systems are widely conserved throughout the animal kingdom. Experimental evidence in lower animals provides important information beyond mere laboratory-confined utility, such as regarding how these systems transformed during evolution, which may help characterize the mammalian system in greater detail. Recent advances in genome projects of both model and non-model animals have provided a great deal of useful information toward this end. We herein review the research on Keap1-Nrf2 and its analogous systems in both mammals and lower model animals. In addition, by comparing the amino acid sequences of Nrf2 and Keap1 proteins from various species, we can deduce the evolutionary history of the anti-stress system. This combinatorial approach using both experimental and genetic data will suggest perspectives of approach for researchers studying the stress response.

  18. Mutational Studies on Resurrected Ancestral Proteins Reveal Conservation of Site-Specific Amino Acid Preferences throughout Evolutionary History

    Science.gov (United States)

    Risso, Valeria A.; Manssour-Triedo, Fadia; Delgado-Delgado, Asunción; Arco, Rocio; Barroso-delJesus, Alicia; Ingles-Prieto, Alvaro; Godoy-Ruiz, Raquel; Gavira, Jose A.; Gaucher, Eric A.; Ibarra-Molero, Beatriz; Sanchez-Ruiz, Jose M.

    2015-01-01

    Local protein interactions (“molecular context” effects) dictate amino acid replacements and can be described in terms of site-specific, energetic preferences for any different amino acid. It has been recently debated whether these preferences remain approximately constant during evolution or whether, due to coevolution of sites, they change strongly. Such research highlights an unresolved and fundamental issue with far-reaching implications for phylogenetic analysis and molecular evolution modeling. Here, we take advantage of the recent availability of phenotypically supported laboratory resurrections of Precambrian thioredoxins and β-lactamases to experimentally address the change of site-specific amino acid preferences over long geological timescales. Extensive mutational analyses support the notion that evolutionary adjustment to a new amino acid may occur, but to a large extent this is insufficient to erase the primitive preference for amino acid replacements. Generally, site-specific amino acid preferences appear to remain conserved throughout evolutionary history despite local sequence divergence. We show such preference conservation to be readily understandable in molecular terms and we provide crystallographic evidence for an intriguing structural-switch mechanism: Energetic preference for an ancestral amino acid in a modern protein can be linked to reorganization upon mutation to the ancestral local structure around the mutated site. Finally, we point out that site-specific preference conservation naturally leads to one plausible evolutionary explanation for the existence of intragenic global suppressor mutations. PMID:25392342

  19. Widespread evolutionary conservation of alternatively spliced exons in caenorhabditis

    DEFF Research Database (Denmark)

    Irimia, Manuel; Rukov, Jakob L; Penny, David

    2007-01-01

    Alternative splicing (AS) contributes to increased transcriptome and proteome diversity in various eukaryotic lineages. Previous studies showed low levels of conservation of alternatively spliced (cassette) exons within mammals and within dipterans. We report a strikingly different pattern...... in Caenorhabditis nematodes-more than 92% of cassette exons from Caenorhabditis elegans are conserved in Caenorhabditis briggsae and/or Caenorhabditis remanei. High levels of conservation extend to minor-form exons (present in a minority of transcripts) and are particularly pronounced for exons showing complex...... patterns of splicing. The functionality of the vast majority of cassette exons is underscored by various other features. We suggest that differences in conservation between lineages reflect differences in levels of functionality and further suggest that these differences are due to differences in intron...

  20. An Evolutionary Relationship Between Stearoyl-CoA Desaturase (SCD Protein Sequences Involved in Fatty Acid Metabolism

    Directory of Open Access Journals (Sweden)

    Mohammad Salmani Izadi

    2014-10-01

    Full Text Available Background: Stearoyl-CoA desaturase (SCD is a key enzyme that converts saturated fatty acids (SFAs to monounsaturated fatty acids (MUFAs in fat biosynthesis. Despite being crucial for interpreting SCDs’ roles across species, the evolutionary relationship of SCD proteins across species has yet to be elucidated. This study aims to present this evolutionary relationship based on amino acid sequences. Methods: Using Multiple Sequence Alignment (MSA and phylogenetic construction methods, a hypothetical evolutionary relationship was generated between the stearoyl-CoA desaturase (SCD protein sequences between 18 different species. Results: SCD protein sequences from Homo sapiens, Pan troglodytes (chimpanzee, and Pongo abelii (orangutan have the lowest genetic distances of 0.006 of the 18 species studied. Capra hircus (goat and Ovis aries (Sheep had the next lowest genetic distance of 0.023. These farm animals are 99.987% identical at the amino acid level. Conclusions: The SCD proteins are conserved in these 18 species, and their evolutionary relationships are similar.

  1. Evolution, homology conservation, and identification of unique sequence signatures in GH19 family chitinases.

    Science.gov (United States)

    Udaya Prakash, N A; Jayanthi, M; Sabarinathan, R; Kangueane, P; Mathew, Lazar; Sekar, K

    2010-05-01

    The discovery of GH (Glycoside Hydrolase) 19 chitinases in Streptomyces sp. raises the possibility of the presence of these proteins in other bacterial species, since they were initially thought to be confined to higher plants. The present study mainly concentrates on the phylogenetic distribution and homology conservation in GH19 family chitinases. Extensive database searches are performed to identify the presence of GH19 family chitinases in the three major super kingdoms of life. Multiple sequence alignment of all the identified GH19 chitinase family members resulted in the identification of globally conserved residues. We further identified conserved sequence motifs across the major sub groups within the family. Estimation of evolutionary distance between the various bacterial and plant chitinases are carried out to better understand the pattern of evolution. Our study also supports the horizontal gene transfer theory, which states that GH19 chitinase genes are transferred from higher plants to bacteria. Further, the present study sheds light on the phylogenetic distribution and identifies unique sequence signatures that define GH19 chitinase family of proteins. The identified motifs could be used as markers to delineate uncharacterized GH19 family chitinases. The estimation of evolutionary distance between chitinase identified in plants and bacteria shows that the flowering plants are more related to chitinase in actinobacteria than that of identified in purple bacteria. We propose a model to elucidate the natural history of GH19 family chitinases.

  2. Conservation of tubulin-binding sequences in TRPV1 throughout evolution.

    Directory of Open Access Journals (Sweden)

    Puspendu Sardar

    Full Text Available Transient Receptor Potential Vanilloid sub type 1 (TRPV1, commonly known as capsaicin receptor can detect multiple stimuli ranging from noxious compounds, low pH, temperature as well as electromagnetic wave at different ranges. In addition, this receptor is involved in multiple physiological and sensory processes. Therefore, functions of TRPV1 have direct influences on adaptation and further evolution also. Availability of various eukaryotic genomic sequences in public domain facilitates us in studying the molecular evolution of TRPV1 protein and the respective conservation of certain domains, motifs and interacting regions that are functionally important.Using statistical and bioinformatics tools, our analysis reveals that TRPV1 has evolved about ∼420 million years ago (MYA. Our analysis reveals that specific regions, domains and motifs of TRPV1 has gone through different selection pressure and thus have different levels of conservation. We found that among all, TRP box is the most conserved and thus have functional significance. Our results also indicate that the tubulin binding sequences (TBS have evolutionary significance as these stretch sequences are more conserved than many other essential regions of TRPV1. The overall distribution of positively charged residues within the TBS motifs is conserved throughout evolution. In silico analysis reveals that the TBS-1 and TBS-2 of TRPV1 can form helical structures and may play important role in TRPV1 function.Our analysis identifies the regions of TRPV1, which are important for structure-function relationship. This analysis indicates that tubulin binding sequence-1 (TBS-1 near the TRP-box forms a potential helix and the tubulin interactions with TRPV1 via TBS-1 have evolutionary significance. This interaction may be required for the proper channel function and regulation and may also have significance in the context of Taxol®-induced neuropathy.

  3. The conservation of mitochondrial genome sequence in Leucadendron (Proteaceae

    Directory of Open Access Journals (Sweden)

    MADE PHARMAWATI

    2012-04-01

    Full Text Available Pharmawati M, Yan G, Finnegan PM. 2012. The conservation of mitochondrial genome sequence in Leucadendron (Proteaceae. Biodiversitas 13: 00-00. Mitochondrial DNA (mtDNA is useful for developing molecular markers and for studying plant phylogeny. However, its usefulness depends on the degree of detectable sequence variation. In seven species of the genus Leucadendron, PCR-RFLP failed to reveal any polymorphisms in seven separate regions of the mtDNA. Sixty-two primer pair - enzyme combinations were used to assay at least 248 restriction sites, resulting in the direct sampling of a minimum of 992 bp across 17,500 bp of mt DNA. The highly conserved nature of the mtDNA sequence in the genus Leucadendron was confirmed by the absence of sequence variation in the 1434 bp mtDNA nad1/B-C intron across these species. Mitochondrial DNA sequences are more highly conserved than the chloroplast DNA sequences in Leucadendron and the mtDNA sequences in many other plant genera. Phylogenetic analysis using this intron sequence was consistent with other phylogenetic analyses in regard to the position of Proteaceae.

  4. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  5. Sequence conservation of an avian centromeric repeated DNA component.

    Science.gov (United States)

    Madsen, C S; Brooks, J E; de Kloet, E; de Kloet, S R

    1994-06-01

    The approximately 190-bp centromeric repeat monomers of the spur-winged lapwing (Vanellus spinosus, Charadriidae), the Chilean flamingo (Phoenicopterus chilensis, Phoenicopteridae), the sarus crane (Grus antigone, Gruidae), parrots (Psittacidae), waterfowl (Anatidae), and the merlin (Falco columbarius, Falconidae) contain elements that are interspecifically highly variable, as well as elements (trinucleotides and higher order oligonucleotides) that are highly conserved in sequence and relative location within the repeat. Such conservation suggests that the centromeric repeats of these avian species have evolved from a common ancestral sequence that may date from very early stages of avian radiation.

  6. Teaching the Toolkit: A Laboratory Series to Demonstrate the Evolutionary Conservation of Metazoan Cell Signaling Pathways

    Science.gov (United States)

    LeClair, Elizabeth E.

    2008-01-01

    A major finding of comparative genomics and developmental genetics is that metazoans share certain conserved, embryonically deployed signaling pathways that instruct cells as to their ultimate fate. Because the DNA encoding these pathways predates the evolutionary split of most animal groups, it should in principle be possible to clone…

  7. Evolutionary conservation of Kv3.1 in the barn owl Tyto alba.

    Science.gov (United States)

    Kullmann, Lars; Schlüter, Tina; Wagner, Hermann; Nothwang, Hans Gerd

    2013-01-01

    For prey capture in the dark, the barn owl Tyto alba has evolved into an auditory specialist with an exquisite capability of sound localization. Adaptations include asymmetrical ears, enlarged auditory processing centers, the utilization of minute interaural time differences, and phase locking along the entire hearing range up to 10 kHz. Adaptations on the molecular level have not yet been investigated. Here, we tested the hypothesis that divergence in the amino acid sequence of the voltage-gated K(+) channel Kv3.1 contributes to the accuracy and high firing rates of auditory neurons in the barn owl. We therefore cloned both splice variants of Kcnc1, the gene encoding Kv3.1. Both splice variants, Kcnc1a and Kcnc1b, encode amino acids identical to those of the chicken, an auditory generalist. Expression analyses confirmed neural-restricted expression of the channel. In summary, our data reveal strong evolutionary conservation of Kcnc1 in the barn owl and point to other genes involved in auditory specializations of this animal. The data also demonstrate the feasibility to address neuroethological questions in organisms with no reference genome by molecular approaches. This will open new avenues for neuroethologists working in these organisms. Copyright © 2013 S. Karger AG, Basel.

  8. An evolutionary conserved role for anaplastic lymphoma kinase in behavioral responses to ethanol.

    Directory of Open Access Journals (Sweden)

    Amy W Lasek

    Full Text Available Anaplastic lymphoma kinase (Alk is a gene expressed in the nervous system that encodes a receptor tyrosine kinase commonly known for its oncogenic function in various human cancers. We have determined that Alk is associated with altered behavioral responses to ethanol in the fruit fly Drosophila melanogaster, in mice, and in humans. Mutant flies containing transposon insertions in dAlk demonstrate increased resistance to the sedating effect of ethanol. Database analyses revealed that Alk expression levels in the brains of recombinant inbred mice are negatively correlated with ethanol-induced ataxia and ethanol consumption. We therefore tested Alk gene knockout mice and found that they sedate longer in response to high doses of ethanol and consume more ethanol than wild-type mice. Finally, sequencing of human ALK led to the discovery of four polymorphisms associated with a low level of response to ethanol, an intermediate phenotype that is predictive of future alcohol use disorders (AUDs. These results suggest that Alk plays an evolutionary conserved role in ethanol-related behaviors. Moreover, ALK may be a novel candidate gene conferring risk for AUDs as well as a potential target for pharmacological intervention.

  9. Whole Genome Sequencing Allows Better Understanding of the Evolutionary History of Leptospira interrogans Serovar Hardjo.

    Directory of Open Access Journals (Sweden)

    Alejandro Llanes

    Full Text Available The genome of a laboratory-adapted strain of Leptospira interrogans serovar Hardjo was sequenced and analyzed. Comparison of the sequenced genome with that recently published for a field isolate of the same serovar revealed relatively high sequence conservation at the nucleotide level, despite the different biological background of both samples. Conversely, comparison of both serovar Hardjo genomes with those of L. borgpetersenii serovar Hardjo showed extensive differences between the corresponding chromosomes, except for the region occupied by their rfb loci. Additionally, comparison of the serovar Hardjo genomes with those of different L. interrogans serovars allowed us to detect several genomic features that may confer an adaptive advantage to L. interrogans serovar Hardjo, including a possible integrated plasmid and an additional copy of a cluster encoding a membrane transport system known to be involved in drug resistance. A phylogenomic strategy was used to better understand the evolutionary position of the Hardjo serovar among L. interrogans serovars and other Leptospira species. The proposed phylogeny supports the hypothesis that the presence of similar rfb loci in two different species may be the result of a lateral gene transfer event.

  10. Early evolution of conserved regulatory sequences associated with development in vertebrates.

    Directory of Open Access Journals (Sweden)

    Gayle K McEwen

    2009-12-01

    Full Text Available Comparisons between diverse vertebrate genomes have uncovered thousands of highly conserved non-coding sequences, an increasing number of which have been shown to function as enhancers during early development. Despite their extreme conservation over 500 million years from humans to cartilaginous fish, these elements appear to be largely absent in invertebrates, and, to date, there has been little understanding of their mode of action or the evolutionary processes that have modelled them. We have now exploited emerging genomic sequence data for the sea lamprey, Petromyzon marinus, to explore the depth of conservation of this type of element in the earliest diverging extant vertebrate lineage, the jawless fish (agnathans. We searched for conserved non-coding elements (CNEs at 13 human gene loci and identified lamprey elements associated with all but two of these gene regions. Although markedly shorter and less well conserved than within jawed vertebrates, identified lamprey CNEs are able to drive specific patterns of expression in zebrafish embryos, which are almost identical to those driven by the equivalent human elements. These CNEs are therefore a unique and defining characteristic of all vertebrates. Furthermore, alignment of lamprey and other vertebrate CNEs should permit the identification of persistent sequence signatures that are responsible for common patterns of expression and contribute to the elucidation of the regulatory language in CNEs. Identifying the core regulatory code for development, common to all vertebrates, provides a foundation upon which regulatory networks can be constructed and might also illuminate how large conserved regulatory sequence blocks evolve and become fixed in genomic DNA.

  11. Chromosomal instability in Afrotheria: fragile sites, evolutionary breakpoints and phylogenetic inference from genome sequence assemblies

    Directory of Open Access Journals (Sweden)

    Ruiz-Herrera Aurora

    2007-10-01

    Full Text Available Abstract Background Extant placental mammals are divided into four major clades (Laurasiatheria, Supraprimates, Xenarthra and Afrotheria. Given that Afrotheria is generally thought to root the eutherian tree in phylogenetic analysis of large nuclear gene data sets, the study of the organization of the genomes of afrotherian species provides new insights into the dynamics of mammalian chromosomal evolution. Here we test if there are chromosomal bands with a high tendency to break and reorganize in Afrotheria, and by analyzing the expression of aphidicolin-induced common fragile sites in three afrotherian species, whether these are coincidental with recognized evolutionary breakpoints. Results We described 29 fragile sites in the aardvark (OAF genome, 27 in the golden mole (CAS, and 35 in the elephant-shrew (EED genome. We show that fragile sites are conserved among afrotherian species and these are correlated with evolutionary breakpoints when compared to the human (HSA genome. Inddition, by computationally scanning the newly released opossum (Monodelphis domestica and chicken sequence assemblies for use as outgroups to Placentalia, we validate the HSA 3/21/5 chromosomal synteny as a rare genomic change that defines the monophyly of this ancient African clade of mammals. On the other hand, support for HSA 1/19p, which is also thought to underpin Afrotheria, is currently ambiguous. Conclusion We provide evidence that (i the evolutionary breakpoints that characterise human syntenies detected in the basal Afrotheria correspond at the chromosomal band level with fragile sites, (ii that HSA 3p/21 was in the amniote ancestor (i.e., common to turtles, lepidosaurs, crocodilians, birds and mammals and was subsequently disrupted in the lineage leading to marsupials. Its expansion to include HSA 5 in Afrotheria is unique and (iii that its fragmentation to HSA 3p/21 + HSA 5/21 in elephant and manatee was due to a fission within HSA 21 that is probably shared

  12. Evolutionary Conserved Protein Features From Analysis of Virus Shapes

    CERN Document Server

    Bozic, Anze Losdorfer; Podgornik, Rudolf

    2013-01-01

    From the shape and size analysis of approximately 130 small icosahedral viruses we conclude that there is a typical structural capsid protein, having a mean diameter of 5 nm and a mean thickness of 3 nm, with more than two thirds of the analyzed capsid proteins having thicknesses between 2 nm and 4 nm. To investigate whether, in addition to the conserved geometry, capsid proteins show similarities in the way they interact with one another, we examined the shapes of the capsids in detail. We classified them numerically according to their similarity to sphere and icosahedron and a set of shapes in between, all obtained from the theory of elasticity of shells. In order to make a unique and straightforward connection between an idealized, numerically calculated shape of an elastic shell and a capsid, we devised a special shape fitting procedure, the outcome of which is the idealized elastic shape fitting the capsid best. Using such a procedure we performed statistical analysis of a series of virus shapes and we f...

  13. Conservation of polymorphic simple sequence loci in cetacean species.

    Science.gov (United States)

    Schlötterer, C; Amos, B; Tautz, D

    1991-11-07

    Length polymorphisms within simple-sequence loci occur ubiquitously in non-coding eukaryotic DNA and can be highly informative in the analysis of natural populations. Simple-sequence length polymorphisms (SSLP) in the long-finned pilot whale Globicephala melas (Delphinidae) have provided useful information on the mating system as well as on the genetic structure of populations. We have therefore tested whether the polymerase chain reaction primers designed for Globicephala could also be used to uncover variability in other whale species. Homologous loci could indeed be amplified from a diverse range of whales, including all toothed (Odontoceti) and baleen whales (Mysticeti) tested. Cloning and sequencing these loci from 11 different species revealed an unusually high conservation of sequences flanking the simple-sequence stretches, averaging 3.2% difference over 35-40 Myr. This represents the lowest divergence rate for neutral nucleotide positions found for any species group so far and raises the possible need for a re-evaluation of the age of the modern whales. On the other hand, the high conservation of non-coding sequences in whales simplifies the application of SSLP DNA fingerprinting in cetacean species, as primers designed for one species will often uncover variability in other species.

  14. Sequencing and Comparative Analysis of a Conserved Syntenic Segment in the Solanaceae

    Science.gov (United States)

    Wang, Ying; Diehl, Adam; Wu, Feinan; Vrebalov, Julia; Giovannoni, James; Siepel, Adam; Tanksley, Steven D.

    2008-01-01

    Comparative genomics is a powerful tool for gaining insight into genomic function and evolution. However, in plants, sequence data that would enable detailed comparisons of both coding and noncoding regions have been limited in availability. Here we report the generation and analysis of sequences for an unduplicated conserved syntenic segment (CSS) in the genomes of five members of the agriculturally important plant family Solanaceae. This CSS includes a 105-kb region of tomato chromosome 2 and orthologous regions of the potato, eggplant, pepper, and petunia genomes. With a total neutral divergence of 0.73–0.78 substitutions/site, these sequences are similar enough that most noncoding regions can be aligned, yet divergent enough to be informative about evolutionary dynamics and selective pressures. The CSS contains 17 distinct genes with generally conserved order and orientation, but with numerous small-scale differences between species. Our analysis indicates that the last common ancestor of these species lived ∼27–36 million years ago, that more than one-third of short genomic segments (5–15 bp) are under selection, and that more than two-thirds of selected bases fall in noncoding regions. In addition, we identify genes under positive selection and analyze hundreds of conserved noncoding elements. This analysis provides a window into 30 million years of plant evolution in the absence of polyploidization. PMID:18723883

  15. Evolutionary insights from suffix array-based genome sequence ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    2007-08-06

    Aug 6, 2007 ... matching and searching algorithms. With recent advances in sequencing technology, several genomes have been sequenced in the last few years, leading to an unprecedented growth of the sequence databases. Availability of information of such large magnitude has given rise to a new tide in biology ...

  16. An Evolutionary Machine Learning Framework for Big Data Sequence Mining

    Science.gov (United States)

    Kamath, Uday Krishna

    2014-01-01

    Sequence classification is an important problem in many real-world applications. Unlike other machine learning data, there are no "explicit" features or signals in sequence data that can help traditional machine learning algorithms learn and predict from the data. Sequence data exhibits inter-relationships in the elements that are…

  17. Enterobacterial Small Mobile Sequences Carry Open Reading Frames and are Found Intragenically—Evolutionary Implications for Formation of New Peptides

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    2007-01-01

    Full Text Available Intergenic repeat units of 127-bp (RU-1 and 168-bp (RU-2, as well as a newly-found class of 103-bp (RU-3, represent small mobile sequences in enterobacterial genomes present in multiple intergenic regions. These repeat sequences display similarities to eukaryotic miniature inverted-repeat transposable elements (MITE. The RU mobile elements have not been reported to encode amino acid sequences. An in silico approach was used to scan genomes for location of repeat units. RU sequences are found to have open reading frames, which are present in annotated gene loci whereby the RU amino acid sequence is maintained. Gene loci that display repeat units include those that encode large proteins which are part of super families that carry conserved domains and those that carry predicted motifs such as signal peptide sequences and transmembrane domains. A putative exported protein in Y. pestis and a phylogenetically conserved putative inner membrane protein in Salmonella species represent some of the more interesting constructs. We hypothesize that a major outcome of RU open reading frame fusions is the evolutionary emergence of new proteins.

  18. Conservation of MHC class II DOA sequences among carnivores.

    Science.gov (United States)

    Soll, S J; Stewart, B S; Lehman, N

    2005-03-01

    We obtained the nucleotide sequence for most of the major histocompatibility complex (MHC) class II DOA locus for Weddell, leopard, northern elephant, and southern elephant seals and from the coyote and compared them to all known DOA data available to date. We found generally low levels of interspecific polymorphisms, providing further support for stabilizing selection acting on the DOA locus. This suggests that DO gene products play a substantial functional role in the regulation of antigen presentation. A seven-amino-acid motif of VWRLPEF was found to be conserved across all DOA sequences and may be a DO-specific recognition element.

  19. Rice pseudomolecule-anchored cross-species DNA sequence alignments indicate regional genomic variation in expressed sequence conservation

    Directory of Open Access Journals (Sweden)

    Thomas Howard

    2007-08-01

    Full Text Available Abstract Background Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences. Results A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Lolium perenne (ryegrass, Zea mays (maize, Hordeum vulgare (barley, Glycine max (soybean and Arabidopsis thaliana (thale cress was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'. Conclusion Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications.

  20. The Drosophila surface glia transcriptome: evolutionary conserved blood-brain barrier processes.

    Directory of Open Access Journals (Sweden)

    Michael K DeSalvo

    2014-11-01

    Full Text Available AbstractCentral nervous system (CNS function is dependent on the stringent regulation of metabolites, drugs, cells, and pathogens exposed to the CNS space. Cellular blood-brain barrier (BBB structures are highly specific checkpoints governing entry and exit of all small molecules to and from the brain interstitial space, but the precise mechanisms that regulate the BBB are not well understood. In addition, the BBB has long been a challenging obstacle to the pharmacologic treatment of CNS diseases; thus model systems that can parse the functions of the BBB are highly desirable. In this study, we sought to define the transcriptome of the adult Drosophila melanogaster BBB by isolating the BBB surface glia with FACS and profiling their gene expression with microarrays. By comparing the transcriptome of these surface glia to that of all brain glia, brain neurons, and whole brains, we present a catalog of transcripts that are selectively enriched at the Drosophila BBB. We found that the fly surface glia show high expression of many ABC and SLC transporters, cell adhesion molecules, metabolic enzymes, signaling molecules, and components of xenobiotic metabolism pathways. Using gene sequence-based alignments, we compare the Drosophila and Murine BBB transcriptomes and discover many shared chemoprotective and small molecule control pathways, thus affirming the relevance of invertebrate models for studying evolutionary conserved BBB properties. The Drosophila BBB transcriptome is valuable to vertebrate and insect biologists alike as a resource for studying proteins underlying diffusion barrier development and maintenance, glial biology, and regulation of drug transport at tissue barriers.

  1. The Drosophila surface glia transcriptome: evolutionary conserved blood-brain barrier processes.

    Science.gov (United States)

    DeSalvo, Michael K; Hindle, Samantha J; Rusan, Zeid M; Orng, Souvinh; Eddison, Mark; Halliwill, Kyle; Bainton, Roland J

    2014-01-01

    Central nervous system (CNS) function is dependent on the stringent regulation of metabolites, drugs, cells, and pathogens exposed to the CNS space. Cellular blood-brain barrier (BBB) structures are highly specific checkpoints governing entry and exit of all small molecules to and from the brain interstitial space, but the precise mechanisms that regulate the BBB are not well understood. In addition, the BBB has long been a challenging obstacle to the pharmacologic treatment of CNS diseases; thus model systems that can parse the functions of the BBB are highly desirable. In this study, we sought to define the transcriptome of the adult Drosophila melanogaster BBB by isolating the BBB surface glia with fluorescence activated cell sorting (FACS) and profiling their gene expression with microarrays. By comparing the transcriptome of these surface glia to that of all brain glia, brain neurons, and whole brains, we present a catalog of transcripts that are selectively enriched at the Drosophila BBB. We found that the fly surface glia show high expression of many ATP-binding cassette (ABC) and solute carrier (SLC) transporters, cell adhesion molecules, metabolic enzymes, signaling molecules, and components of xenobiotic metabolism pathways. Using gene sequence-based alignments, we compare the Drosophila and Murine BBB transcriptomes and discover many shared chemoprotective and small molecule control pathways, thus affirming the relevance of invertebrate models for studying evolutionary conserved BBB properties. The Drosophila BBB transcriptome is valuable to vertebrate and insect biologists alike as a resource for studying proteins underlying diffusion barrier development and maintenance, glial biology, and regulation of drug transport at tissue barriers.

  2. Polycomb repressive complex's evolutionary conserved function: the role of EZH2 status and cellular background.

    Science.gov (United States)

    Gall Trošelj, Koraljka; Novak Kujundzic, Renata; Ugarkovic, Djurdjica

    2016-01-01

    When assembled in multiprotein polycomb repressive complexes (PRCs), highly evolutionary conserved polycomb group (PcG) proteins epigenetically control gene activity. Although the composition of PRCs may vary considerably, it is well established that the embryonic ectoderm development (EED) 1, suppressor of zeste (SUZ) 12, and methyltransferase enhancer of zeste (EZH2)-containing complex, PRC2, which is abundant in highly proliferative cells (including cancer cells), establishes a repressive methylation mark on histone 3 (H3K27me3). From the perspective of molecular cancer pathogenesis, this effect, when directed towards a promoter of tumor suppressor genes, represents pro-tumorigenic effect. This mode of action was shown in several cancer models. However, EZH2 function extends beyond this scenario. The highly specific cellular background, related to the origin of cell and numerous external stimuli during a given time-window, may be the trigger for EZH2 interaction with other proteins, not necessarily histones. This is particularly relevant for cancer. This review provides a critical overview of the evolutional importance of PRC and discusses several important aspects of EZH2 functioning within PRC. The review also deals with mutational studies on EZH2. Due to the existence of several protein (and messenger RNA (mRNA)) isoforms, these mutations were stratified, using the protein sequence which is considered canonical. This approach showed that there is an urgent need for the uniformed positioning of currently known EZH2 mutations (somatic-in tumors, as well as germline mutations in the Weaver's syndrome). Finally, we discuss EZH2 function with respect to amount of trimethylated H3K27, in a specific cellular milieu, through presenting the most recent data related to EZH2-H3K27m3 relationship in cancer. All these points are significant in considering EZH2 as a therapeutic target.

  3. Whole-genome sequencing approaches for conservation biology: Advantages, limitations and practical recommendations.

    Science.gov (United States)

    Fuentes-Pardo, Angela P; Ruzzante, Daniel E

    2017-10-01

    Whole-genome resequencing (WGR) is a powerful method for addressing fundamental evolutionary biology questions that have not been fully resolved using traditional methods. WGR includes four approaches: the sequencing of individuals to a high depth of coverage with either unresolved or resolved haplotypes, the sequencing of population genomes to a high depth by mixing equimolar amounts of unlabelled-individual DNA (Pool-seq) and the sequencing of multiple individuals from a population to a low depth (lcWGR). These techniques require the availability of a reference genome. This, along with the still high cost of shotgun sequencing and the large demand for computing resources and storage, has limited their implementation in nonmodel species with scarce genomic resources and in fields such as conservation biology. Our goal here is to describe the various WGR methods, their pros and cons and potential applications in conservation biology. WGR offers an unprecedented marker density and surveys a wide diversity of genetic variations not limited to single nucleotide polymorphisms (e.g., structural variants and mutations in regulatory elements), increasing their power for the detection of signatures of selection and local adaptation as well as for the identification of the genetic basis of phenotypic traits and diseases. Currently, though, no single WGR approach fulfils all requirements of conservation genetics, and each method has its own limitations and sources of potential bias. We discuss proposed ways to minimize such biases. We envision a not distant future where the analysis of whole genomes becomes a routine task in many nonmodel species and fields including conservation biology. © 2017 John Wiley & Sons Ltd.

  4. Evolutionary optimization of biopolymers and sequence structure maps

    Energy Technology Data Exchange (ETDEWEB)

    Reidys, C.M.; Kopp, S.; Schuster, P. [Institut fuer Molekulare Biotechnologie, Jena (Germany)

    1996-06-01

    Searching for biopolymers having a predefined function is a core problem of biotechnology, biochemistry and pharmacy. On the level of RNA sequences and their corresponding secondary structures we show that this problem can be analyzed mathematically. The strategy will be to study the properties of the RNA sequence to secondary structure mapping that is essential for the understanding of the search process. We show that to each secondary structure s there exists a neutral network consisting of all sequences folding into s. This network can be modeled as a random graph and has the following generic properties: it is dense and has a giant component within the graph of compatible sequences. The neutral network percolates sequence space and any two neutral nets come close in terms of Hamming distance. We investigate the distribution of the orders of neutral nets and show that above a certain threshold the topology of neutral nets allows to find practically all frequent secondary structures.

  5. CREDO: a web-based tool for computational detection of conserved sequence motifs in noncoding sequences.

    Science.gov (United States)

    Hindemitt, Tobias; Mayer, Klaus F X

    2005-12-01

    CREDO is a user-friendly, web-based tool that integrates the analysis and results of different algorithms widely used for the computational detection of conserved sequence motifs in noncoding sequences. It enables easy comparison of the individual results. CREDO offers intuitive interfaces for easy and rapid configuration of the applied algorithms and convenient views on the results in graphical and tabular formats. http://mips.gsf.de/proj/regulomips/credo.htm.

  6. Spatial multiobjective optimization of agricultural conservation practices using a SWAT model and an evolutionary algorithm.

    Science.gov (United States)

    Rabotyagov, Sergey; Campbell, Todd; Valcu, Adriana; Gassman, Philip; Jha, Manoj; Schilling, Keith; Wolter, Calvin; Kling, Catherine

    2012-12-09

    Finding the cost-efficient (i.e., lowest-cost) ways of targeting conservation practice investments for the achievement of specific water quality goals across the landscape is of primary importance in watershed management. Traditional economics methods of finding the lowest-cost solution in the watershed context (e.g.,(5,12,20)) assume that off-site impacts can be accurately described as a proportion of on-site pollution generated. Such approaches are unlikely to be representative of the actual pollution process in a watershed, where the impacts of polluting sources are often determined by complex biophysical processes. The use of modern physically-based, spatially distributed hydrologic simulation models allows for a greater degree of realism in terms of process representation but requires a development of a simulation-optimization framework where the model becomes an integral part of optimization. Evolutionary algorithms appear to be a particularly useful optimization tool, able to deal with the combinatorial nature of a watershed simulation-optimization problem and allowing the use of the full water quality model. Evolutionary algorithms treat a particular spatial allocation of conservation practices in a watershed as a candidate solution and utilize sets (populations) of candidate solutions iteratively applying stochastic operators of selection, recombination, and mutation to find improvements with respect to the optimization objectives. The optimization objectives in this case are to minimize nonpoint-source pollution in the watershed, simultaneously minimizing the cost of conservation practices. A recent and expanding set of research is attempting to use similar methods and integrates water quality models with broadly defined evolutionary optimization methods(3,4,9,10,13-15,17-19,22,23,25). In this application, we demonstrate a program which follows Rabotyagov et al.'s approach and integrates a modern and commonly used SWAT water quality model(7) with a

  7. Wildlife conservation and animal temperament: causes and consequences of evolutionary change for captive, reintroduced, and wild populations

    NARCIS (Netherlands)

    McDougall, P.T.; Réale, D.; Sol, D.; Reader, S.M.

    2006-01-01

    We argue that animal temperament is an important concept for wildlife conservation science and review causes and consequences of evolutionary changes in temperament traits that may occur in captive-breeding programmes. An evolutionary perspective is valid because temperament traits are heritable,

  8. De novo transcriptome assembly of Zanthoxylum bungeanum using Illumina sequencing for evolutionary analysis and simple sequence repeat marker development

    OpenAIRE

    Feng, Shijing; Zhao, Lili; Liu, Zhenshan; Liu, Yulin; Yang, Tuxi; Wei, Anzhi

    2017-01-01

    Zanthoxylum, an ancient economic crop in Asia, has a satisfying aromatic taste and immense medicinal values. A lack of genomic information and genetic markers has limited the evolutionary analysis and genetic improvement of Zanthoxylum species and their close relatives. To better understand the evolution, domestication, and divergence of Zanthoxylum, we present a de novo transcriptome analysis of an elite cultivar of Z. bungeanum using Illumina sequencing; we then developed simple sequence re...

  9. Evolutionary insights from suffix array-based genome sequence ...

    Indian Academy of Sciences (India)

    2007-08-06

    grams; pattern matching; suffix arrays; suffix trees; short peptide ... Gene and protein sequence analyses, central components of studies in modern biology are easily amenable to string matching and pattern recognition algorithms.

  10. Disentangling evolutionary signals: conservation, specificity determining positions and coevolution. Implication for catalytic residue prediction

    DEFF Research Database (Denmark)

    Teppa, Elin; Wilkins, Angela D.; Nielsen, Morten

    2012-01-01

    predictive potential compared to others when it comes to, in particular, the identification of catalytic residues (CR) in proteins. Using a large set of enzymatic protein families and measures based on different evolutionary signals, we sought to break up the different components of the information content......Background: A large panel of methods exists that aim to identify residues with critical impact on protein function based on evolutionary signals, sequence and structure information. However, it is not clear to what extent these different methods overlap, and if any of the methods have higher...... within a multiple sequence alignment to investigate their predictive potential and degree of overlap. Results: Our results demonstrate that the different methods included in the benchmark in general can be divided into three groups with a limited mutual overlap. One group containing real...

  11. Evolutionary mirages: selection on binding site composition creates the illusion of conserved grammars in Drosophila enhancers.

    Directory of Open Access Journals (Sweden)

    Richard W Lusk

    2010-01-01

    Full Text Available The clustering of transcription factor binding sites in developmental enhancers and the apparent preferential conservation of clustered sites have been widely interpreted as proof that spatially constrained physical interactions between transcription factors are required for regulatory function. However, we show here that selection on the composition of enhancers alone, and not their internal structure, leads to the accumulation of clustered sites with evolutionary dynamics that suggest they are preferentially conserved. We simulated the evolution of idealized enhancers from Drosophila melanogaster constrained to contain only a minimum number of binding sites for one or more factors. Under this constraint, mutations that destroy an existing binding site are tolerated only if a compensating site has emerged elsewhere in the enhancer. Overlapping sites, such as those frequently observed for the activator Bicoid and repressor Krüppel, had significantly longer evolutionary half-lives than isolated sites for the same factors. This leads to a substantially higher density of overlapping sites than expected by chance and the appearance that such sites are preferentially conserved. Because D. melanogaster (like many other species has a bias for deletions over insertions, sites tended to become closer together over time, leading to an overall clustering of sites in the absence of any selection for clustered sites. Since this effect is strongest for the oldest sites, clustered sites also incorrectly appear to be preferentially conserved. Following speciation, sites tend to be closer together in all descendent species than in their common ancestors, violating the common assumption that shared features of species' genomes reflect their ancestral state. Finally, we show that selection on binding site composition alone recapitulates the observed number of overlapping and closely neighboring sites in real D. melanogaster enhancers. Thus, this study calls into

  12. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences.

    LENUS (Irish Health Repository)

    Ivanov, Ivaylo P

    2011-05-01

    In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5\\' cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized--both for increased coding capacity and potentially also for novel regulatory mechanisms--remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5\\' untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data.

  13. Discovery radiomics via evolutionary deep radiomic sequencer discovery for pathologically proven lung cancer detection.

    Science.gov (United States)

    Shafiee, Mohammad Javad; Chung, Audrey G; Khalvati, Farzad; Haider, Masoom A; Wong, Alexander

    2017-10-01

    While lung cancer is the second most diagnosed form of cancer in men and women, a sufficiently early diagnosis can be pivotal in patient survival rates. Imaging-based, or radiomics-driven, detection methods have been developed to aid diagnosticians, but largely rely on hand-crafted features that may not fully encapsulate the differences between cancerous and healthy tissue. Recently, the concept of discovery radiomics was introduced, where custom abstract features are discovered from readily available imaging data. We propose an evolutionary deep radiomic sequencer discovery approach based on evolutionary deep intelligence. Motivated by patient privacy concerns and the idea of operational artificial intelligence, the evolutionary deep radiomic sequencer discovery approach organically evolves increasingly more efficient deep radiomic sequencers that produce significantly more compact yet similarly descriptive radiomic sequences over multiple generations. As a result, this framework improves operational efficiency and enables diagnosis to be run locally at the radiologist's computer while maintaining detection accuracy. We evaluated the evolved deep radiomic sequencer (EDRS) discovered via the proposed evolutionary deep radiomic sequencer discovery framework against state-of-the-art radiomics-driven and discovery radiomics methods using clinical lung CT data with pathologically proven diagnostic data from the LIDC-IDRI dataset. The EDRS shows improved sensitivity (93.42%), specificity (82.39%), and diagnostic accuracy (88.78%) relative to previous radiomics approaches.

  14. Covariance of maximum likelihood evolutionary distances between sequences aligned pairwise

    Directory of Open Access Journals (Sweden)

    Dessimoz Christophe

    2008-06-01

    Full Text Available Abstract Background The estimation of a distance between two biological sequences is a fundamental process in molecular evolution. It is usually performed by maximum likelihood (ML on characters aligned either pairwise or jointly in a multiple sequence alignment (MSA. Estimators for the covariance of pairs from an MSA are known, but we are not aware of any solution for cases of pairs aligned independently. In large-scale analyses, it may be too costly to compute MSAs every time distances must be compared, and therefore a covariance estimator for distances estimated from pairs aligned independently is desirable. Knowledge of covariances improves any process that compares or combines distances, such as in generalized least-squares phylogenetic tree building, orthology inference, or lateral gene transfer detection. Results In this paper, we introduce an estimator for the covariance of distances from sequences aligned pairwise. Its performance is analyzed through extensive Monte Carlo simulations, and compared to the well-known variance estimator of ML distances. Our covariance estimator can be used together with the ML variance estimator to form covariance matrices. Conclusion The estimator performs similarly to the ML variance estimator. In particular, it shows no sign of bias when sequence divergence is below 150 PAM units (i.e. above ~29% expected sequence identity. Above that distance, the covariances tend to be underestimated, but then ML variances are also underestimated.

  15. Evolutionary conservation and network structure characterize genes of phenotypic relevance for mitosis in human.

    Directory of Open Access Journals (Sweden)

    Marek Ostaszewski

    Full Text Available The impact of gene silencing on cellular phenotypes is difficult to establish due to the complexity of interactions in the associated biological processes and pathways. A recent genome-wide RNA knock-down study both identified and phenotypically characterized a set of important genes for the cell cycle in HeLa cells. Here, we combine a molecular interaction network analysis, based on physical and functional protein interactions, in conjunction with evolutionary information, to elucidate the common biological and topological properties of these key genes. Our results show that these genes tend to be conserved with their corresponding protein interactions across several species and are key constituents of the evolutionary conserved molecular interaction network. Moreover, a group of bistable network motifs is found to be conserved within this network, which are likely to influence the network stability and therefore the robustness of cellular functioning. They form a cluster, which displays functional homogeneity and is significantly enriched in genes phenotypically relevant for mitosis. Additional results reveal a relationship between specific cellular processes and the phenotypic outcomes induced by gene silencing. This study introduces new ideas regarding the relationship between genotype and phenotype in the context of the cell cycle. We show that the analysis of molecular interaction networks can result in the identification of genes relevant to cellular processes, which is a promising avenue for future research.

  16. Assessing fluctuating evolutionary pressure in yeast and mammal evolutionary rate covariation using bioinformatics of meiotic protein genetic sequences

    Science.gov (United States)

    Dehipawala, Sunil; Nguyen, A.; Tremberger, G.; Cheung, E.; Holden, T.; Lieberman, D.; Cheung, T.

    2013-09-01

    The evolutionary rate co-variation in meiotic proteins has been reported for yeast and mammal using phylogenic branch lengths which assess retention, duplication and mutation. The bioinformatics of the corresponding DNA sequences could be classified as a diagram of fractal dimension and Shannon entropy. Results from biomedical gene research provide examples on the diagram methodology. The identification of adaptive selection using entropy marker and functional-structural diversity using fractal dimension would support a regression analysis where the coefficient of determination would serve as evolutionary pathway marker for DNA sequences and be an important component in the astrobiology community. Comparisons between biomedical genes such as EEF2 (elongation factor 2 human, mouse, etc), WDR85 in epigenetics, HAR1 in human specificity, clinical trial targeted cancer gene CD47, SIRT6 in spermatogenesis, and HLA-C in mosquito bite immunology demonstrate the diagram classification methodology. Comparisons to the SEPT4-XIAP pair in stem cell apoptosis, testesexpressed taste genes TAS1R3-GNAT3 pair, and amyloid beta APLP1-APLP2 pair with the yeast-mammal DNA sequences for meiotic proteins RAD50-MRE11 pair and NCAPD2-ICK pair have accounted for the observed fluctuating evolutionary pressure systematically. Regression with high R-sq values or a triangular-like cluster pattern for concordant pairs in co-variation among the studied species could serve as evidences for the possible location of common ancestors in the entropy-fractal dimension diagram, consistent with an example of the human-chimp common ancestor study using the FOXP2 regulated genes reported in human fetal brain study. The Deinococcus radiodurans R1 Rad-A could be viewed as an outlier in the RAD50 diagram and also in the free energy versus fractal dimension regression Cook's distance, consistent with a non-Earth source for this radiation resistant bacterium. Convergent and divergent fluctuating evolutionary

  17. Nucleotide sequence conservation in paramyxoviruses; the concept of codon constellation.

    Science.gov (United States)

    Rima, Bert K

    2015-05-01

    The stability and conservation of the sequences of RNA viruses in the field and the high error rates measured in vitro are paradoxical. The field stability indicates that there are very strong selective constraints on sequence diversity. The nature of these constraints is discussed. Apart from constraints on variation in cis-acting RNA and the amino acid sequences of viral proteins, there are other ones relating to the presence of specific dinucleotides such CpG and UpA as well as the importance of RNA secondary structures and RNA degradation rates. Recent other constraints identified in other RNA viruses, such as effects of secondary RNA structure on protein folding or modification of cellular tRNA complements, are also discussed. Using the family Paramyxoviridae, I show that the codon usage pattern (CUP) is (i) specific for each virus species and (ii) that it is markedly different from the host - it does not vary even in vaccine viruses that have been derived by passage in a number of inappropriate host cells. The CUP might thus be an additional constraint on variation, and I propose the concept of codon constellation to indicate the informational content of the sequences of RNA molecules relating not only to stability and structure but also to the efficiency of translation of a viral mRNA resulting from the CUP and the numbers and position of rare codons. © 2015 The Authors.

  18. Identification of the novel evolutionary conserved obstructor multigene family in invertebrates.

    Science.gov (United States)

    Behr, Matthias; Hoch, Michael

    2005-12-19

    Insects have evolved chitin-containing structures such as the cuticle or peritrophic membranes that serve to protect their bodies against the hostile environment. The specific mechanisms by which these structures are produced, are mostly unknown. We have identified a novel multigene family, the obstructor family, which encodes ten putatively secreted chitin-binding proteins that are characterized by a stereotype arrangement of a N-terminal signaling peptide and 3 chitin-binding-domains. Gene expression studies in Drosophila melanogaster embryos demonstrate that obstructor family members are expressed in cuticle forming tissues. Using computational and phylogenetic analysis, we show that obstructor genes represent an evolutionary conserved multigene family in invertebrates.

  19. Correlation between sequence conservation and structural thermodynamics of microRNA precursors from human, mouse, and chicken genomes

    Directory of Open Access Journals (Sweden)

    Wang Shengqi

    2010-10-01

    Full Text Available Abstract Background Previous studies have shown that microRNA precursors (pre-miRNAs have considerably more stable secondary structures than other native RNAs (tRNA, rRNA, and mRNA and artificial RNA sequences. However, pre-miRNAs with ultra stable secondary structures have not been investigated. It is not known if there is a tendency in pre-miRNA sequences towards or against ultra stable structures? Furthermore, the relationship between the structural thermodynamic stability of pre-miRNA and their evolution remains unclear. Results We investigated the correlation between pre-miRNA sequence conservation and structural stability as measured by adjusted minimum folding free energies in pre-miRNAs isolated from human, mouse, and chicken. The analysis revealed that conserved and non-conserved pre-miRNA sequences had structures with similar average stabilities. However, the relatively ultra stable and unstable pre-miRNAs were more likely to be non-conserved than pre-miRNAs with moderate stability. Non-conserved pre-miRNAs had more G+C than A+U nucleotides, while conserved pre-miRNAs contained more A+U nucleotides. Notably, the U content of conserved pre-miRNAs was especially higher than that of non-conserved pre-miRNAs. Further investigations showed that conserved and non-conserved pre-miRNAs exhibited different structural element features, even though they had comparable levels of stability. Conclusions We proposed that there is a correlation between structural thermodynamic stability and sequence conservation for pre-miRNAs from human, mouse, and chicken genomes. Our analyses suggested that pre-miRNAs with relatively ultra stable or unstable structures were less favoured by natural selection than those with moderately stable structures. Comparison of nucleotide compositions between non-conserved and conserved pre-miRNAs indicated the importance of U nucleotides in the pre-miRNA evolutionary process. Several characteristic structural elements were

  20. Phytophthora Genome Sequences Uncover Evolutionary Origins and Mechanisms of Pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tyler, Brett M.; Tripathy, Sucheta; Zhang, Xuemin; Dehal, Paramvir; Jiang, Rays H. Y.; Aerts, Andrea; Arredondo, Felipe D.; Baxter, Laura; Bensasson, Douda; Beynon, JIm L.; Chapman, Jarrod; Damasceno, Cynthia M. B.; Dorrance, Anne E.; Dou, Daolong; Dickerman, Allan W.; Dubchak, Inna L.; Garbelotto, Matteo; Gijzen, Mark; Gordon, Stuart G.; Govers, Francine; Grunwald, NIklaus J.; Huang, Wayne; Ivors, Kelly L.; Jones, Richard W.; Kamoun, Sophien; Krampis, Konstantinos; Lamour, Kurt H.; Lee, Mi-Kyung; McDonald, W. Hayes; Medina, Monica; Meijer, Harold J. G.; Nordberg, Erik K.; Maclean, Donald J.; Ospina-Giraldo, Manuel D.; Morris, Paul F.; Phuntumart, Vipaporn; Putnam, Nicholas J.; Rash, Sam; Rose, Jocelyn K. C.; Sakihama, Yasuko; Salamov, Asaf A.; Savidor, Alon; Scheuring, Chantel F.; Smith, Brian M.; Sobral, Bruno W. S.; Terry, Astrid; Torto-Alalibo, Trudy A.; Win, Joe; Xu, Zhanyou; Zhang, Hongbin; Grigoriev, Igor V.; Rokhsar, Daniel S.; Boore, Jeffrey L.

    2006-04-17

    Draft genome sequences have been determined for the soybean pathogen Phytophthora sojae and the sudden oak death pathogen Phytophthora ramorum. Oömycetes such as these Phytophthora species share the kingdom Stramenopila with photosynthetic algae such as diatoms, and the presence of many Phytophthora genes of probable phototroph origin supports a photosynthetic ancestry for the stramenopiles. Comparison of the two species' genomes reveals a rapid expansion and diversification of many protein families associated with plant infection such as hydrolases, ABC transporters, protein toxins, proteinase inhibitors, and, in particular, a superfamily of 700 proteins with similarity to known oömycete avirulence genes.

  1. Uncoupling evolutionary changes in DNA sequence, transcription factor occupancy and enhancer activity.

    Science.gov (United States)

    Khoueiry, Pierre; Girardot, Charles; Ciglar, Lucia; Peng, Pei-Chen; Gustafson, E Hilary; Sinha, Saurabh; Furlong, Eileen Em

    2017-08-09

    Sequence variation within enhancers plays a major role in both evolution and disease, yet its functional impact on transcription factor (TF) occupancy and enhancer activity remains poorly understood. Here, we assayed the binding of five essential TFs over multiple stages of embryogenesis in two distant Drosophila species (with 1.4 substitutions per neutral site), identifying thousands of orthologous enhancers with conserved or diverged combinatorial occupancy. We used these binding signatures to dissect two properties of developmental enhancers: (1) potential TF cooperativity, using signatures of co-associations and co-divergence in TF occupancy. This revealed conserved combinatorial binding despite sequence divergence, suggesting protein-protein interactions sustain conserved collective occupancy. (2) Enhancer in-vivo activity, revealing orthologous enhancers with conserved activity despite divergence in TF occupancy. Taken together, we identify enhancers with diverged motifs yet conserved occupancy and others with diverged occupancy yet conserved activity, emphasising the need to functionally measure the effect of divergence on enhancer activity.

  2. Evolutionary algorithms for scheduling a flowshop manufacturing cell with sequence dependent family setups

    NARCIS (Netherlands)

    Franca, PM; Gupta, JND; Mendes, AS; Moscato, P; Veltink, KJ

    This paper considers the problem of scheduling part families and jobs within each part family in a flowshop manufacturing cell with sequence dependent family setups times where it is desired to minimize the makespan while processing parts (jobs) in each family together. Two evolutionary algorithms-a

  3. Evolutionary conserved regulation of HIF-1β by NF-κB.

    Directory of Open Access Journals (Sweden)

    Patrick van Uden

    2011-01-01

    Full Text Available Hypoxia Inducible Factor-1 (HIF-1 is essential for mammalian development and is the principal transcription factor activated by low oxygen tensions. HIF-α subunit quantities and their associated activity are regulated in a post-translational manner, through the concerted action of a class of enzymes called Prolyl Hydroxylases (PHDs and Factor Inhibiting HIF (FIH respectively. However, alternative modes of HIF-α regulation such as translation or transcription are under-investigated, and their importance has not been firmly established. Here, we demonstrate that NF-κB regulates the HIF pathway in a significant and evolutionary conserved manner. We demonstrate that NF-κB directly regulates HIF-1β mRNA and protein. In addition, we found that NF-κB-mediated changes in HIF-1β result in modulation of HIF-2α protein. HIF-1β overexpression can rescue HIF-2α protein levels following NF-κB depletion. Significantly, NF-κB regulates HIF-1β (tango and HIF-α (sima levels and activity (Hph/fatiga, ImpL3/ldha in Drosophila, both in normoxia and hypoxia, indicating an evolutionary conserved mode of regulation. These results reveal a novel mechanism of HIF regulation, with impact in the development of novel therapeutic strategies for HIF-related pathologies including ageing, ischemia, and cancer.

  4. Evolutionary conserved regulation of HIF-1β by NF-κB.

    Science.gov (United States)

    van Uden, Patrick; Kenneth, Niall S; Webster, Ryan; Müller, H Arno; Mudie, Sharon; Rocha, Sonia

    2011-01-27

    Hypoxia Inducible Factor-1 (HIF-1) is essential for mammalian development and is the principal transcription factor activated by low oxygen tensions. HIF-α subunit quantities and their associated activity are regulated in a post-translational manner, through the concerted action of a class of enzymes called Prolyl Hydroxylases (PHDs) and Factor Inhibiting HIF (FIH) respectively. However, alternative modes of HIF-α regulation such as translation or transcription are under-investigated, and their importance has not been firmly established. Here, we demonstrate that NF-κB regulates the HIF pathway in a significant and evolutionary conserved manner. We demonstrate that NF-κB directly regulates HIF-1β mRNA and protein. In addition, we found that NF-κB-mediated changes in HIF-1β result in modulation of HIF-2α protein. HIF-1β overexpression can rescue HIF-2α protein levels following NF-κB depletion. Significantly, NF-κB regulates HIF-1β (tango) and HIF-α (sima) levels and activity (Hph/fatiga, ImpL3/ldha) in Drosophila, both in normoxia and hypoxia, indicating an evolutionary conserved mode of regulation. These results reveal a novel mechanism of HIF regulation, with impact in the development of novel therapeutic strategies for HIF-related pathologies including ageing, ischemia, and cancer.

  5. Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction

    Directory of Open Access Journals (Sweden)

    Elnaz Mehdizadeh Aghdam

    2014-05-01

    Full Text Available Purpose: Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA, raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Methods: Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting “A site” of 16S rRNA to riboswitches via docking method. Results: There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8 hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with “16S rRNA A site”. Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA “A site” suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. Conclusion: These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

  6. Evolutionary Diversifaction of Aminopeptidase N in Lepidoptera by Conserved Clade-specific Amino Acid Residues

    Science.gov (United States)

    Hughes, Austin L.

    2015-01-01

    Members of the aminopepidase N (APN) gene family of the insect order Lepidoptera (moths and butterflies) bind the naturally insecticidal Cry toxins produced by the bacterium Bacillus thuringiensis. Phylogenetic analysis of amino acid sequences of seven lepidopteran APN classes provided strong support for the hypothesis that lepidopteran APN2 class arose by gene duplication prior to the most recent common ancestor of Lepidoptera and Diptera. The Cry toxin-binding region (BR) of lepidopteran and dipteran APNs was subject to stronger purifying selection within APN classes than was the remainder of the molecule, reflecting conservation of catalytic site and adjoining residues within the BR. Of lepidopteran APN classes, APN2, APN6, and APN8 showed the strongest evidence of functional specialization, both in expression patterns and in the occurrence of conserved derived amino acid residues. The latter three APN classes also shared a convergently evolved conserved residue close to the catalytic site. APN8 showed a particularly strong tendency towards class-specific conserved residues, including one of the catalytic site residues in the BR and ten others in close vicinity to the catalytic site residues. The occurrence of class-specific sequences along with the conservation of enzymatic function is consistent with the hypothesis that the presence of Cry toxins in the environment has been a factor shaping the evolution of this multi-gene family. PMID:24675701

  7. Evolutionary diversification of aminopeptidase N in Lepidoptera by conserved clade-specific amino acid residues.

    Science.gov (United States)

    Hughes, Austin L

    2014-07-01

    Members of the aminopepidase N (APN) gene family of the insect order Lepidoptera (moths and butterflies) bind the naturally insecticidal Cry toxins produced by the bacterium Bacillus thuringiensis. Phylogenetic analysis of amino acid sequences of seven lepidopteran APN classes provided strong support for the hypothesis that lepidopteran APN2 class arose by gene duplication prior to the most recent common ancestor of Lepidoptera and Diptera. The Cry toxin-binding region (BR) of lepidopteran and dipteran APNs was subject to stronger purifying selection within APN classes than was the remainder of the molecule, reflecting conservation of catalytic site and adjoining residues within the BR. Of lepidopteran APN classes, APN2, APN6, and APN8 showed the strongest evidence of functional specialization, both in expression patterns and in the occurrence of conserved derived amino acid residues. The latter three APN classes also shared a convergently evolved conserved residue close to the catalytic site. APN8 showed a particularly strong tendency towards class-specific conserved residues, including one of the catalytic site residues in the BR and ten others in close vicinity to the catalytic site residues. The occurrence of class-specific sequences along with the conservation of enzymatic function is consistent with the hypothesis that the presence of Cry toxins in the environment has been a factor shaping the evolution of this multi-gene family. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Simple sequence repeats in zebra finch (Taeniopygia guttata) expressed sequence tags: a new resource for evolutionary genetic studies of passerines.

    Science.gov (United States)

    Slate, Jon; Hale, Matthew C; Birkhead, Timothy R

    2007-02-14

    Passerines (perching birds) are widely studied across many biological disciplines including ecology, population biology, neurobiology, behavioural ecology and evolutionary biology. However, understanding the molecular basis of relevant traits is hampered by the paucity of passerine genomics tools. Efforts to address this problem are underway, and the zebra finch (Taeniopygia guttata) will be the first passerine to have its genome sequenced. Here we describe a bioinformatic analysis of zebra finch expressed sequence tag (EST) Genbank entries. A total of 48,862 ESTs were downloaded from GenBank and assembled into contigs, representing an estimated 17,404 unique sequences. The unique sequence set contained 638 simple sequence repeats (SSRs) or microsatellites of length > or =20 bp and purity > or =90% and 144 simple sequence repeats of length > or =30 bp. A chromosomal location for the majority of SSRs was predicted by BLASTing against assembly 2.1 of the chicken genome sequence. The relative exonic location (5' untranslated region, coding region or 3' untranslated region) was predicted for 218 of the SSRs, by BLAST search against the ENSEMBL chicken peptide database. Ten loci were examined for polymorphism in two zebra finch populations and two populations of a distantly related passerine, the house sparrow Passer domesticus. Linkage was confirmed for four loci that were predicted to reside on the passerine homologue of chicken chromosome 7. We show that SSRs are abundant within zebra finch ESTs, and that their genomic location can be predicted from sequence similarity with the assembled chicken genome sequence. We demonstrate that a useful proportion of zebra finch EST-SSRs are likely to be polymorphic, and that they can be used to build a linkage map. Finally, we show that many zebra finch EST-SSRs are likely to be useful in evolutionary genetic studies of other passerines.

  9. Simple sequence repeats in zebra finch (Taeniopygia guttata expressed sequence tags: a new resource for evolutionary genetic studies of passerines

    Directory of Open Access Journals (Sweden)

    Birkhead Timothy R

    2007-02-01

    Full Text Available Abstract Background Passerines (perching birds are widely studied across many biological disciplines including ecology, population biology, neurobiology, behavioural ecology and evolutionary biology. However, understanding the molecular basis of relevant traits is hampered by the paucity of passerine genomics tools. Efforts to address this problem are underway, and the zebra finch (Taeniopygia guttata will be the first passerine to have its genome sequenced. Here we describe a bioinformatic analysis of zebra finch expressed sequence tag (EST Genbank entries. Results A total of 48,862 ESTs were downloaded from GenBank and assembled into contigs, representing an estimated 17,404 unique sequences. The unique sequence set contained 638 simple sequence repeats (SSRs or microsatellites of length ≥20 bp and purity ≥90% and 144 simple sequence repeats of length ≥30 bp. A chromosomal location for the majority of SSRs was predicted by BLASTing against assembly 2.1 of the chicken genome sequence. The relative exonic location (5' untranslated region, coding region or 3' untranslated region was predicted for 218 of the SSRs, by BLAST search against the ENSEMBL chicken peptide database. Ten loci were examined for polymorphism in two zebra finch populations and two populations of a distantly related passerine, the house sparrow Passer domesticus. Linkage was confirmed for four loci that were predicted to reside on the passerine homologue of chicken chromosome 7. Conclusion We show that SSRs are abundant within zebra finch ESTs, and that their genomic location can be predicted from sequence similarity with the assembled chicken genome sequence. We demonstrate that a useful proportion of zebra finch EST-SSRs are likely to be polymorphic, and that they can be used to build a linkage map. Finally, we show that many zebra finch EST-SSRs are likely to be useful in evolutionary genetic studies of other passerines.

  10. De novo transcriptome assembly of Zanthoxylum bungeanum using Illumina sequencing for evolutionary analysis and simple sequence repeat marker development.

    Science.gov (United States)

    Feng, Shijing; Zhao, Lili; Liu, Zhenshan; Liu, Yulin; Yang, Tuxi; Wei, Anzhi

    2017-12-01

    Zanthoxylum, an ancient economic crop in Asia, has a satisfying aromatic taste and immense medicinal values. A lack of genomic information and genetic markers has limited the evolutionary analysis and genetic improvement of Zanthoxylum species and their close relatives. To better understand the evolution, domestication, and divergence of Zanthoxylum, we present a de novo transcriptome analysis of an elite cultivar of Z. bungeanum using Illumina sequencing; we then developed simple sequence repeat markers for identification of Zanthoxylum. In total, we predicted 45,057 unigenes and 22,212 protein coding sequences, approximately 90% of which showed significant similarities to known proteins in databases. Phylogenetic analysis indicated that Zanthoxylum is relatively recent and estimated to have diverged from Citrus ca. 36.5-37.7 million years ago. We also detected a whole-genome duplication event in Zanthoxylum that occurred 14 million years ago. We found no protein coding sequences that were significantly under positive selection by Ka/Ks. Simple sequence repeat analysis divided 31 Zanthoxylum cultivars and landraces into three major groups. This Zanthoxylum reference transcriptome provides crucial information for the evolutionary study of the Zanthoxylum genus and the Rutaceae family, and facilitates the establishment of more effective Zanthoxylum breeding programs.

  11. A New Generation of Evolutionary Sequences for Novae

    Science.gov (United States)

    Starrfield, S.; Hauschildt, P.; Truran, J.; Sparks, W.; Wiescher, M.

    1995-12-01

    We report on the results of new calculations of Thermonuclear Runaways (TNR) on 1.25Msun and 1.35Msun oxygen-neon-magnesium white dwarfs using an updated version of NOVA. NOVA is a one-dimensional, fully implicit, hydrodynamic stellar evolution code that includes a large nuclear reaction network. The results of our previous studies can be found in Starrfield et al (1992, ApJ, 391, L71) and Politano et al (1995, ApJ, 448, 807). Since those calculations were done, we have updated both the nuclear reaction network and the nuclear reaction rates (see, for example, Van Wormer et al 1994, ApJ, 432, 326 and Herndl et al 1995, Phys. Rev. C, 52, 1078). We now use opacities from the OPAL carbon rich tables. When we are outside the range of validity of the OPAL tables, we continue to use the Iben fit. The new sequences also include boundary layer heating both from the accretion shock and the internal energy of the infalling material (Shaviv and Starrfield 1987, ApJ, 321, L51). Finally, in order to improve the agreement between our theoretical light curves and the observations, we use bolometric corrections obtained from the latest generation of spherical, expanding, Non-LTE, stellar atmospheres for novae (Hauschildt et al 1995a, ApJ, 447, 829; Hauschildt et al 1995b, ApJ, in press). Our first results show that the changes in the reaction rates and the opacities cause quantitative changes with respect to our published studies. For accretion onto the 1.25Msun white dwarf, for example, we find that less mass is ejected and a smaller amount of (26) Al is produced. In addition, the abundances of (31) P and (32) S increase by factors of more than two. The causes are that (1)the OPAL opacities are larger than those given by the Iben fit, which results in less mass being accreted on the white dwarf for the same initial conditions, and (2) the proton-capture reaction rates for some of the intermediate mass nuclei near (26) Al have increased so that the evolution to higher mass nuclei

  12. Sequencing of two sunflower chlorotic mottle virus isolates obtained from different natural hosts shed light on its evolutionary history.

    Science.gov (United States)

    Bejerman, N; Giolitti, F; de Breuil, S; Lenardon, S

    2013-02-01

    Sunflower chlorotic mottle virus (SuCMoV), the most prevalent virus of sunflower in Argentina, was reported naturally infecting not only sunflower but also weeds. To understand SuCMoV evolution and improve the knowledge on its variability, the complete genomic sequences of two SuCMoV isolates collected from Dipsacus fullonum (-dip) and Ibicella lutea (-ibi) were determined from three overlapping cDNA clones and subjected to phylogenetic and recombination analyses. SuCMoV-dip and -ibi genomes were 9,953-nucleotides (nt) long; their sequences contained an open reading frame of 9,561 nucleotides, which encoded a polyprotein of 3,187 amino acids flanked by a 5'-noncoding region (NCR) of 135 nt and a 3'-NCR of 257 nt. SuCMoV-dip and -ibi genome nucleotide sequences were 90.9 identical and displayed 90 and 94.6 % identity to that of SuCMoV-C, and 90.8 and 91.4 % identity to that of SuCMoV-CRS, respectively. P1 of SuCMoV-dip and -ibi was 3-nt longer than that of SuCMoV-CRS, but 12-nt shorter than that of SuCMoV-C. Two recombination events were detected in SuCMoV genome and the analysis of d(N)/d(S) ratio among SuCMoV complete sequences showed that the genomic regions are under different evolutionary constraints, suggesting that SuCMoV evolution would be conservative. Our findings provide evidence that mutation and recombination would have played important roles in the evolutionary history of SuCMoV.

  13. Deep Sequencing of Norovirus Genomes Defines Evolutionary Patterns in an Urban Tropical Setting

    Science.gov (United States)

    Cotten, Matthew; Petrova, Velislava; Phan, My V. T.; Rabaa, Maia A.; Watson, Simon J.; Ong, Swee Hoe; Baker, Stephen

    2014-01-01

    ABSTRACT Norovirus is a highly transmissible infectious agent that causes epidemic gastroenteritis in susceptible children and adults. Norovirus infections can be severe and can be initiated from an exceptionally small number of viral particles. Detailed genome sequence data are useful for tracking norovirus transmission and evolution. To address this need, we have developed a whole-genome deep-sequencing method that generates entire genome sequences from small amounts of clinical specimens. This novel approach employs an algorithm for reverse transcription and PCR amplification primer design using all of the publically available norovirus sequence data. Deep sequencing and de novo assembly were used to generate norovirus genomes from a large set of diarrheal patients attending three hospitals in Ho Chi Minh City, Vietnam, over a 2.5-year period. Positive-selection analysis and direct examination of protein changes in the virus over time identified codons in the regions encoding proteins VP1, p48 (NS1-2), and p22 (NS4) under positive selection and expands the known targets of norovirus evolutionary pressure. IMPORTANCE The high transmissibility and rapid evolutionary rate of norovirus, combined with a short-lived host immune responses, are thought to be the reasons why the virus causes the majority of pediatric viral diarrhea cases. The evolutionary patterns of this RNA virus have been described in detail for only a portion of the virus genome and never for a virus from a detailed urban tropical setting. We provide a detailed sequence description of the noroviruses circulating in three Ho Chi Minh City hospitals over a 2.5-year period. This study identified patterns of virus change in known sites of host immune response and identified three additional regions of the virus genome under selection that were not previously recognized. In addition, the method described here provides a robust full-genome sequencing platform for community-based virus surveillance. PMID

  14. Developmental evolutionary biology of the vertebrate ear: conserving mechanoelectric transduction and developmental pathways in diverging morphologies

    Science.gov (United States)

    Fritzsch, B.; Beisel, K. W.; Bermingham, N. A.

    2000-01-01

    This brief overview shows that a start has been made to molecularly dissect vertebrate ear development and its evolutionary conservation to the development of the insect hearing organ. However, neither the patterning process of the ear nor the patterning process of insect sensory organs is sufficiently known at the moment to provide more than a first glimpse. Moreover, hardly anything is known about otocyst development of the cephalopod molluscs, another triploblast lineage that evolved complex 'ears'. We hope that the apparent conserved functional and cellular components present in the ciliated sensory neurons/hair cells will also be found in the genes required for vertebrate ear and insect sensory organ morphogenesis (Fig. 3). Likewise, we expect that homologous pre-patterning genes will soon be identified for the non-sensory cell development, which is more than a blocking of neuronal development through the Delta/Notch signaling system. Generation of the apparently unique ear could thus represent a multiplication of non-sensory cells by asymmetric and symmetric divisions as well as modification of existing patterning process by implementing novel developmental modules. In the final analysis, the vertebrate ear may come about by increasing the level of gene interactions in an already existing and highly conserved interactive cascade of bHLH genes. Since this was apparently achieved in all three lineages of triploblasts independently (Fig. 3), we now need to understand how much of the morphogenetic cascades are equally conserved across phyla to generate complex ears. The existing mutations in humans and mice may be able to point the direction of future research to understand the development of specific cell types and morphologies in the formation of complex arthropod, cephalopod, and vertebrate 'ears'.

  15. Evolutionary plasticity of habenular asymmetry with a conserved efferent connectivity pattern.

    Directory of Open Access Journals (Sweden)

    Aldo Villalón

    Full Text Available The vertebrate habenulae (Hb is an evolutionary conserved dorsal diencephalic nuclear complex that relays information from limbic and striatal forebrain regions to the ventral midbrain. One key feature of this bilateral nucleus is the presence of left-right differences in size, cytoarchitecture, connectivity, neurochemistry and/or gene expression. In teleosts, habenular asymmetry has been associated with preferential innervation of left-right habenular efferents into dorso-ventral domains of the midbrain interpeduncular nucleus (IPN. However, the degree of conservation of this trait and its relation to the structural asymmetries of the Hb are currently unknown. To address these questions, we performed the first systematic comparative analysis of structural and connectional asymmetries of the Hb in teleosts. We found striking inter-species variability in the overall shape and cytoarchitecture of the Hb, and in the frequency, strength and to a lesser degree, laterality of habenular volume at the population level. Directional asymmetry of the Hb was either to the left in D. rerio, E. bicolor, O. latipes, P. reticulata, B. splendens, or to the right in F. gardneri females. In contrast, asymmetry was absent in P. scalare and F. gardneri males at the population level, although in these species the Hb displayed volumetric asymmetries at the individual level. Inter-species variability was more pronounced across orders than within a single order, and coexisted with an overall conserved laterotopic representation of left-right habenular efferents into dorso-ventral domains of the IPN. These results suggest that the circuit design involving the Hb of teleosts promotes structural flexibility depending on developmental, cognitive and/or behavioural pressures, without affecting the main midbrain connectivity output, thus unveiling a key conserved role of this connectivity trait in the function of the circuit. We propose that ontogenic plasticity in habenular

  16. Patterns of evolutionary conservation of essential genes correlate with their compensability.

    Directory of Open Access Journals (Sweden)

    Tobias Bergmiller

    2012-06-01

    Full Text Available Essential genes code for fundamental cellular functions required for the viability of an organism. For this reason, essential genes are often highly conserved across organisms. However, this is not always the case: orthologues of genes that are essential in one organism are sometimes not essential in other organisms or are absent from their genomes. This suggests that, in the course of evolution, essential genes can be rendered nonessential. How can a gene become non-essential? Here we used genetic manipulation to deplete the products of 26 different essential genes in Escherichia coli. This depletion results in a lethal phenotype, which could often be rescued by the overexpression of a non-homologous, non-essential gene, most likely through replacement of the essential function. We also show that, in a smaller number of cases, the essential genes can be fully deleted from the genome, suggesting that complete functional replacement is possible. Finally, we show that essential genes whose function can be replaced in the laboratory are more likely to be non-essential or not present in other taxa. These results are consistent with the notion that patterns of evolutionary conservation of essential genes are influenced by their compensability-that is, by how easily they can be functionally replaced, for example through increased expression of other genes.

  17. Transcriptome sequencing reveals genome-wide variation in molecular evolutionary rate among ferns.

    Science.gov (United States)

    Grusz, Amanda L; Rothfels, Carl J; Schuettpelz, Eric

    2016-08-30

    Transcriptomics in non-model plant systems has recently reached a point where the examination of nuclear genome-wide patterns in understudied groups is an achievable reality. This progress is especially notable in evolutionary studies of ferns, for which molecular resources to date have been derived primarily from the plastid genome. Here, we utilize transcriptome data in the first genome-wide comparative study of molecular evolutionary rate in ferns. We focus on the ecologically diverse family Pteridaceae, which comprises about 10 % of fern diversity and includes the enigmatic vittarioid ferns-an epiphytic, tropical lineage known for dramatically reduced morphologies and radically elongated phylogenetic branch lengths. Using expressed sequence data for 2091 loci, we perform pairwise comparisons of molecular evolutionary rate among 12 species spanning the three largest clades in the family and ask whether previously documented heterogeneity in plastid substitution rates is reflected in their nuclear genomes. We then inquire whether variation in evolutionary rate is being shaped by genes belonging to specific functional categories and test for differential patterns of selection. We find significant, genome-wide differences in evolutionary rate for vittarioid ferns relative to all other lineages within the Pteridaceae, but we recover few significant correlations between faster/slower vittarioid loci and known functional gene categories. We demonstrate that the faster rates characteristic of the vittarioid ferns are likely not driven by positive selection, nor are they unique to any particular type of nucleotide substitution. Our results reinforce recently reviewed mechanisms hypothesized to shape molecular evolutionary rates in vittarioid ferns and provide novel insight into substitution rate variation both within and among fern nuclear genomes.

  18. Conservation genomics reveals multiple evolutionary units within Bell’s Vireo (Vireo bellii).

    Science.gov (United States)

    Klicka, Luke B.; Kus, Barbara E.; Title, Pascal O.; Burns, Kevin J.

    2016-01-01

    The Bell’s Vireo (Vireo bellii) is a widespread North American species of bird that has declined since the mid-1960s primarily due to habitat modification. Throughout its range, Bell’s Vireo populations are regulated under varying degrees of protection; however, the species has never been characterized genetically. Therefore, the current taxonomy used to guide management decisions may misrepresent the true evolutionary history for the species. We sequenced 86 individuals for ND2 and genotyped 48 individuals for genome-wide SNPs to identify distinct lineages within Bell’s Vireo. Phylogenetic analyses uncovered two distinct clades that are separated in the arid southwestern United States, near the border of the Chihuahuan and Sonoran Deserts. These clades diverged from each other approximately 1.11–2.04 mya. The timing of diversification, geographic location, and niche modeling of the east/west divergence suggest vicariance as a mode of diversification for these two lineages. Analyses of the SNP dataset provided additional resolution and indicated the Least Bell’s Vireo populations are a distinct evolutionary lineage. Our genetic evidence, together with information from morphology and behavior, suggests that the Bell’s Vireo complex involves two species, each containing two separate subspecies. This new information has implications for the federal, state and other listing status of Bell’s Vireo throughout its range.

  19. On the relationship between residue structural environment and sequence conservation in proteins.

    Science.gov (United States)

    Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao

    2017-09-01

    Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.

  20. Integrating Traditional and Evolutionary Knowledge in Biodiversity Conservation: a Population Level Case Study

    Directory of Open Access Journals (Sweden)

    Dylan J. Fraser

    2006-12-01

    Full Text Available Despite their dual importance in the assessment of endangered/threatened species, there have been few attempts to integrate traditional ecological knowledge (TEK and evolutionary biology knowledge (EBK at the population level. We contrasted long-term aboriginal TEK with previously obtained EBK in the context of seasonal migratory habits and population biology of a salmonid fish, brook charr, (Salvelinus fontinalis inhabiting a large, remote postglacial lake. Compilation of TEK spanning four decades involved analytical workshops, semidirective interviews, and collaborative fieldwork with local aboriginal informants and fishing guides. We found that TEK complemented EBK of brook charr by providing concordant and additional information about (1 population viability; (2 breeding areas and migration patterns of divergent populations; and (3 the behavioral ecology of populations within feeding areas; all of which may ultimately affect the maintenance of population diversity. Aboriginal concerns related to human pressures on this species, not revealed by EBK, also help to focus future conservation initiatives for divergent populations and to encourage restoration of traditional fishing practices. However, relative to EBK, the relevance of TEK to salmonid biodiversity conservation was evident mainly at a smaller spatial scale, for example, that of individual rivers occupied by populations or certain lake sectors. Nevertheless, EBK was only collected over a 4-yr period, so TEK provided an essential long-term temporal window to evaluate population differences and persistence. We concluded that, despite different conceptual underpinnings, spatially and temporally varying TEK and EBK both contribute to the knowledge base required to achieve sustainability and effective biodiversity conservation planning for a given species. Such integration may be particularly relevant in many isolated regions, where intraspecific diversity can go unrecognized due to sparse

  1. Comprehensive characterization of evolutionary conserved breakpoints in four New World Monkey karyotypes compared to Chlorocebus aethiops and Homo sapiens.

    Science.gov (United States)

    Fan, Xiaobo; Supiwong, Weerayuth; Weise, Anja; Mrasek, Kristin; Kosyakova, Nadezda; Tanomtong, Alongkoad; Pinthong, Krit; Trifonov, Vladimir A; Cioffi, Marcelo de Bello; Grothmann, Pierre; Liehr, Thomas; Oliveira, Edivaldo H C de

    2015-11-01

    Comparative cytogenetic analysis in New World Monkeys (NWMs) using human multicolor banding (MCB) probe sets were not previously done. Here we report on an MCB based FISH-banding study complemented with selected locus-specific and heterochromatin specific probes in four NWMs and one Old World Monkey (OWM) species, i.e. in Alouatta caraya (ACA), Callithrix jacchus (CJA), Cebus apella (CAP), Saimiri sciureus (SSC), and Chlorocebus aethiops (CAE), respectively. 107 individual evolutionary conserved breakpoints (ECBs) among those species were identified and compared with those of other species in previous reports. Especially for chromosomal regions being syntenic to human chromosomes 6, 8, 9, 10, 11, 12 and 16 previously cryptic rearrangements could be observed. 50.4% (54/107) NWM-ECBs were colocalized with those of OWMs, 62.6% (62/99) NWM-ECBs were related with those of Hylobates lar (HLA) and 66.3% (71/107) NWM-ECBs corresponded with those known from other mammalians. Furthermore, human fragile sites were aligned with the ECBs found in the five studied species and interestingly 66.3% ECBs colocalized with those fragile sites (FS). Overall, this study presents detailed chromosomal maps of one OWM and four NWM species. This data will be helpful to further investigation on chromosome evolution in NWM and hominoids in general and is prerequisite for correct interpretation of future sequencing based genomic studies in those species.

  2. Comprehensive characterization of evolutionary conserved breakpoints in four New World Monkey karyotypes compared to Chlorocebus aethiops and Homo sapiens

    Directory of Open Access Journals (Sweden)

    Xiaobo Fan

    2015-11-01

    Full Text Available Comparative cytogenetic analysis in New World Monkeys (NWMs using human multicolor banding (MCB probe sets were not previously done. Here we report on an MCB based FISH-banding study complemented with selected locus-specific and heterochromatin specific probes in four NWMs and one Old World Monkey (OWM species, i.e. in Alouatta caraya (ACA, Callithrix jacchus (CJA, Cebus apella (CAP, Saimiri sciureus (SSC, and Chlorocebus aethiops (CAE, respectively. 107 individual evolutionary conserved breakpoints (ECBs among those species were identified and compared with those of other species in previous reports. Especially for chromosomal regions being syntenic to human chromosomes 6, 8, 9, 10, 11, 12 and 16 previously cryptic rearrangements could be observed. 50.4% (54/107 NWM-ECBs were colocalized with those of OWMs, 62.6% (62/99 NWM-ECBs were related with those of Hylobates lar (HLA and 66.3% (71/107 NWM-ECBs corresponded with those known from other mammalians. Furthermore, human fragile sites were aligned with the ECBs found in the five studied species and interestingly 66.3% ECBs colocalized with those fragile sites (FS. Overall, this study presents detailed chromosomal maps of one OWM and four NWM species. This data will be helpful to further investigation on chromosome evolution in NWM and hominoids in general and is prerequisite for correct interpretation of future sequencing based genomic studies in those species.

  3. Spt-Ada-Gcn5-Acetyltransferase (SAGA Complex in Plants: Genome Wide Identification, Evolutionary Conservation and Functional Determination.

    Directory of Open Access Journals (Sweden)

    Rakesh Srivastava

    Full Text Available The recruitment of RNA polymerase II on a promoter is assisted by the assembly of basal transcriptional machinery in eukaryotes. The Spt-Ada-Gcn5-Acetyltransferase (SAGA complex plays an important role in transcription regulation in eukaryotes. However, even in the advent of genome sequencing of various plants, SAGA complex has been poorly defined for their components and roles in plant development and physiological functions. Computational analysis of Arabidopsis thaliana and Oryza sativa genomes for SAGA complex resulted in the identification of 17 to 18 potential candidates for SAGA subunits. We have further classified the SAGA complex based on the conserved domains. Phylogenetic analysis revealed that the SAGA complex proteins are evolutionary conserved between plants, yeast and mammals. Functional annotation showed that they participate not only in chromatin remodeling and gene regulation, but also in different biological processes, which could be indirect and possibly mediated via the regulation of gene expression. The in silico expression analysis of the SAGA components in Arabidopsis and O. sativa clearly indicates that its components have a distinct expression profile at different developmental stages. The co-expression analysis of the SAGA components suggests that many of these subunits co-express at different developmental stages, during hormonal interaction and in response to stress conditions. Quantitative real-time PCR analysis of SAGA component genes further confirmed their expression in different plant tissues and stresses. The expression of representative salt, heat and light inducible genes were affected in mutant lines of SAGA subunits in Arabidopsis. Altogether, the present study reveals expedient evidences of involvement of the SAGA complex in plant gene regulation and stress responses.

  4. Evolution of beta-amylase: patterns of variation and conservation in subfamily sequences in relation to parsimony mechanisms.

    Science.gov (United States)

    Pujadas, G; Ramírez, F M; Valero, R; Palau, J

    1996-08-01

    Soybean and sweet potato beta-amylases are structured as alpha/beta barrels and the same kind of folding may account for all known beta-amylases. We provide a comprehensive analysis of both protein and DNA (coding region) sequences of beta-amylases. The aim of the study is to contribute to the knowledge of the evolutionary molecular relationships among all known beta-amylases. Our approach combines the identification of the putative eightfold structural core formed by beta-strands with a complete multi-alignment analysis of all known sequences. Comparing putative beta-amylase (alpha/beta)8 cores from plants and microorganisms, two differentiated versions of residues at the packing sites, and a unique set of eight identical residues at the C-terminal catalytical site are observed, indicating early evolutionary divergence and absence of localized three-dimensional evolution, respectively. A new analytical approach has been developed in order to work out conserved motifs for beta-amylases, mostly related with the enzyme activity. This approach appears useful as a new routine to find sets of motifs (each set being known as a fingerprint) in protein families. We demonstrate that the evolutionary mechanism for beta-amylases is a combination of parsimonious divergence at three distinguishable rates in relation to the functional signatures, the barrel scaffold, and alpha-helix-containing loops.

  5. Sequence and Structural Analysis of the Chitinase Insertion Domain Reveals Two Conserved Motifs Involved in Chitin-Binding

    Science.gov (United States)

    Li, Hai; Greene, Lesley H.

    2010-01-01

    Background Chitinases are prevalent in life and are found in species including archaea, bacteria, fungi, plants, and animals. They break down chitin, which is the second most abundant carbohydrate in nature after cellulose. Hence, they are important for maintaining a balance between carbon and nitrogen trapped as insoluble chitin in biomass. Chitinases are classified into two families, 18 and 19 glycoside hydrolases. In addition to a catalytic domain, which is a triosephosphate isomerase barrel, many family 18 chitinases contain another module, i.e., chitinase insertion domain. While numerous studies focus on the biological role of the catalytic domain in chitinase activity, the function of the chitinase insertion domain is not completely understood. Bioinformatics offers an important avenue in which to facilitate understanding the role of residues within the chitinase insertion domain in chitinase function. Results Twenty-seven chitinase insertion domain sequences, which include four experimentally determined structures and span five kingdoms, were aligned and analyzed using a modified sequence entropy parameter. Thirty-two positions with conserved residues were identified. The role of these conserved residues was explored by conducting a structural analysis of a number of holo-enzymes. Hydrogen bonding and van der Waals calculations revealed a distinct subset of four conserved residues constituting two sequence motifs that interact with oligosaccharides. The other conserved residues may be key to the structure, folding, and stability of this domain. Conclusions Sequence and structural studies of the chitinase insertion domains conducted within the framework of evolution identified four conserved residues which clearly interact with the substrates. Furthermore, evolutionary studies propose a link between the appearance of the chitinase insertion domain and the function of family 18 chitinases in the subfamily A. PMID:20084296

  6. MultiSeq: unifying sequence and structure data for evolutionary analysis

    Directory of Open Access Journals (Sweden)

    Wright Dan

    2006-08-01

    Full Text Available Abstract Background Since the publication of the first draft of the human genome in 2000, bioinformatic data have been accumulating at an overwhelming pace. Currently, more than 3 million sequences and 35 thousand structures of proteins and nucleic acids are available in public databases. Finding correlations in and between these data to answer critical research questions is extremely challenging. This problem needs to be approached from several directions: information science to organize and search the data; information visualization to assist in recognizing correlations; mathematics to formulate statistical inferences; and biology to analyze chemical and physical properties in terms of sequence and structure changes. Results Here we present MultiSeq, a unified bioinformatics analysis environment that allows one to organize, display, align and analyze both sequence and structure data for proteins and nucleic acids. While special emphasis is placed on analyzing the data within the framework of evolutionary biology, the environment is also flexible enough to accommodate other usage patterns. The evolutionary approach is supported by the use of predefined metadata, adherence to standard ontological mappings, and the ability for the user to adjust these classifications using an electronic notebook. MultiSeq contains a new algorithm to generate complete evolutionary profiles that represent the topology of the molecular phylogenetic tree of a homologous group of distantly related proteins. The method, based on the multidimensional QR factorization of multiple sequence and structure alignments, removes redundancy from the alignments and orders the protein sequences by increasing linear dependence, resulting in the identification of a minimal basis set of sequences that spans the evolutionary space of the homologous group of proteins. Conclusion MultiSeq is a major extension of the Multiple Alignment tool that is provided as part of VMD, a structural

  7. Conserved sequence-specific lincRNA-steroid receptor interactions drive transcriptional repression and direct cell fate

    Energy Technology Data Exchange (ETDEWEB)

    Hudson, William H.; Pickard, Mark R.; de Vera, Ian Mitchelle S.; Kuiper, Emily G.; Mourtada-Maarabouni, Mirna; Conn, Graeme L.; Kojetin, Douglas J.; Williams, Gwyn T.; Ortlund, Eric A. [Emory-MED; (Keele); (Scripps)

    2014-12-23

    The majority of the eukaryotic genome is transcribed, generating a significant number of long intergenic noncoding RNAs (lincRNAs). Although lincRNAs represent the most poorly understood product of transcription, recent work has shown lincRNAs fulfill important cellular functions. In addition to low sequence conservation, poor understanding of structural mechanisms driving lincRNA biology hinders systematic prediction of their function. Here we report the molecular requirements for the recognition of steroid receptors (SRs) by the lincRNA growth arrest-specific 5 (Gas5), which regulates steroid-mediated transcriptional regulation, growth arrest and apoptosis. We identify the functional Gas5-SR interface and generate point mutations that ablate the SR-Gas5 lincRNA interaction, altering Gas5-driven apoptosis in cancer cell lines. Further, we find that the Gas5 SR-recognition sequence is conserved among haplorhines, with its evolutionary origin as a splice acceptor site. This study demonstrates that lincRNAs can recognize protein targets in a conserved, sequence-specific manner in order to affect critical cell functions.

  8. The interplay of sequence conservation and T cell immune recognition

    DEFF Research Database (Denmark)

    Bresciani, Anne Gøther; Sette, Alessandro; Greenbaum, Jason

    2014-01-01

    Predicting which peptides can elicit a T cell response (i.e. are immunogenic) is of great importance for many immunological studies. While it is clear that MHC binding is a necessary requirement for peptide immunogenicity, other variables exist that are incompletely understood. In this study we...... the Immune Epitope Database with their conservation in the human microbiome. Indeed, we did see a lower immunogenicity for conserved peptides conserved. While many aspects how this conservation comparison is done require further optimization, this is a first step towards a better understanding T cell...

  9. New Insights on Coffea miRNAs: Features and Evolutionary Conservation.

    Science.gov (United States)

    Chaves, S S; Fernandes-Brum, C N; Silva, G F F; Ferrara-Barbosa, B C; Paiva, L V; Nogueira, F T S; Cardoso, T C S; Amaral, L R; de Souza Gomes, M; Chalfun-Junior, A

    2015-10-01

    Small RNAs influence the gene expression at the post-transcriptional level by guiding messenger RNA (mRNA) cleavage, translational repression, and chromatin modifications. In addition to model plants, the microRNAs (miRNAs) have been identified in different crop species. In this work, we developed a specific pipeline to search for coffee miRNA homologs on expressed sequence tags (ESTs) and genome survey sequences (GSS) databases. As a result, 36 microRNAs were identified and a total of 616 and 362 potential targets for Coffea arabica and Coffea canephora, respectively. The evolutionary analyses of these molecules were performed by comparing the primary and secondary structures of precursors and mature miRNAs with their orthologs. Moreover, using a stem-loop RT-PCR assay, we evaluated the accumulation of mature miRNAs in genomes with different ploidy levels, detecting an increase in the miRNAs accumulation according to the ploidy raising. Finally, a 5' RACE (Rapid Amplification of cDNA Ends) assay was performed to verify the regulation of auxin responsive factor 8 (ARF8) by MIR167 in coffee plants. The great variety of target genes indicates the functional plasticity of these molecules and reinforces the importance of understanding the RNAi-dependent regulatory mechanisms. Our results expand the study of miRNAs and their target genes in this crop, providing new challenges to understand the biology of these species.

  10. The 18S ribosomal RNA sequence of the sea anemone Anemonia sulcata and its evolutionary position among other eukaryotes.

    Science.gov (United States)

    Hendriks, L; Van de Peer, Y; Van Herck, M; Neefs, J M; De Wachter, R

    1990-09-03

    Evolutionary trees based on partial small ribosomal subunit RNA sequences of 22 metazoa species have been published [(1988) Science 239, 748-753]. In these trees, cnidarians (Radiata) seemed to have evolved independently from the Bilateria, which is in contradiction with the general evolutionary view. In order to further investigate this problem, the complete srRNA sequence of the sea anemone Anemonia sulcata was determined and evolutionary trees were constructed using a matrix optimization method. In the tree thus obtained the sea anemone and Bilateria together form a monophyletic cluster, with the sea anemone forming the first line of the metazoan group.

  11. Systematic analysis of head-to-head gene organization: evolutionary conservation and potential biological relevance.

    Directory of Open Access Journals (Sweden)

    Yuan-Yuan Li

    2006-07-01

    Full Text Available Several "head-to-head" (or "bidirectional" gene pairs have been studied in individual experiments, but genome-wide analysis of this gene organization, especially in terms of transcriptional correlation and functional association, is still insufficient. We conducted a systematic investigation of head-to-head gene organization focusing on structural features, evolutionary conservation, expression correlation and functional association. Of the present 1,262, 1,071, and 491 head-to-head pairs identified in human, mouse, and rat genomes, respectively, pairs with 1- to 400-base pair distance between transcription start sites form the majority (62.36%, 64.15%, and 55.19% for human, mouse, and rat,respectively of each dataset, and the largest group is always the one with a transcription start site distance of 101 to 200 base pairs. The phylogenetic analysis among Fugu, chicken, and human indicates a negative selection on the separation of head-to-head genes across vertebrate evolution, and thus the ancestral existence of this gene organization. The expression analysis shows that most of the human head-to-head genes are significantly correlated,and the correlation could be positive, negative, or alternative depending on the experimental conditions. Finally, head to-head genes statistically tend to perform similar functions, and gene pairs associated with the significant cofunctions seem to have stronger expression correlations. The findings indicate that the head-to-head gene organization is ancient and conserved, which subjects functionally related genes to correlated transcriptional regulation and thus provides an exquisite mechanism of transcriptional regulation based on gene organization. These results have significantly expanded the knowledge about head-to-head gene organization. Supplementary materials for this study are available at http://www.scbit.org/h2h.

  12. Inferring the evolutionary histories of divergences in Hylobates and Nomascus gibbons through multilocus sequence data

    Science.gov (United States)

    2013-01-01

    Background Gibbons (Hylobatidae) are the most diverse group of living apes. They exist as geographically-contiguous species which diverged more rapidly than did their close relatives, the great apes (Hominidae). Of the four extant gibbon genera, the evolutionary histories of two polyspecific genera, Hylobates and Nomascus, have been the particular focus of research but the DNA sequence data used was largely derived from the maternally inherited mitochondrial DNA (mtDNA) locus. Results To investigate the evolutionary relationships and divergence processes of gibbon species, particularly those of the Hylobates genus, we produced and analyzed a total of 11.5 kb DNA of sequence at 14 biparentally inherited autosomal loci. We find that on average gibbon genera have a high average sequence diversity but a lower degree of genetic differentiation as compared to great ape genera. Our multilocus species tree features H. pileatus in a basal position and a grouping of the four Sundaic island species (H. agilis, H. klossii, H. moloch and H. muelleri). We conducted pairwise comparisons based on an isolation-with-migration (IM) model and detect signals of asymmetric gene flow between H. lar and H. moloch, between H. agilis and H. muelleri, and between N. leucogenys and N. siki. Conclusions Our multilocus analyses provide inferences of gibbon evolutionary histories complementary to those based on single gene data. The results of IM analyses suggest that the divergence processes of gibbons may be accompanied by gene flow. Future studies using analyses of multi-population model with samples of known provenance for Hylobates and Nomascus species would expand the understanding of histories of gene flow during divergences for these two gibbon genera. PMID:23586586

  13. Evolutionary conserved role of c-Jun-N-terminal kinase in CO2-induced epithelial dysfunction.

    Directory of Open Access Journals (Sweden)

    István Vadász

    Full Text Available Elevated CO(2 levels (hypercapnia occur in patients with respiratory diseases and impair alveolar epithelial integrity, in part, by inhibiting Na,K-ATPase function. Here, we examined the role of c-Jun N-terminal kinase (JNK in CO(2 signaling in mammalian alveolar epithelial cells as well as in diptera, nematodes and rodent lungs. In alveolar epithelial cells, elevated CO(2 levels rapidly induced activation of JNK leading to downregulation of Na,K-ATPase and alveolar epithelial dysfunction. Hypercapnia-induced activation of JNK required AMP-activated protein kinase (AMPK and protein kinase C-ζ leading to subsequent phosphorylation of JNK at Ser-129. Importantly, elevated CO(2 levels also caused a rapid and prominent activation of JNK in Drosophila S2 cells and in C. elegans. Paralleling the results with mammalian epithelial cells, RNAi against Drosophila JNK fully prevented CO(2-induced downregulation of Na,K-ATPase in Drosophila S2 cells. The importance and specificity of JNK CO(2 signaling was additionally demonstrated by the ability of mutations in the C. elegans JNK homologs, jnk-1 and kgb-2 to partially rescue the hypercapnia-induced fertility defects but not the pharyngeal pumping defects. Together, these data provide evidence that deleterious effects of hypercapnia are mediated by JNK which plays an evolutionary conserved, specific role in CO(2 signaling in mammals, diptera and nematodes.

  14. The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes.

    Science.gov (United States)

    Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques

    2011-02-01

    The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

  15. A new hypothesis of squamate evolutionary relationships from nuclear and mitochondrial DNA sequence data

    Energy Technology Data Exchange (ETDEWEB)

    Townsend, Ted M.; Larson, Allan; Louis, Edward; Macey, J. Robert

    2004-05-19

    Squamate reptiles serve as model systems for evolutionary studies of a variety of morphological and behavioral traits, and phylogeny is crucial to many generalizations derived from such studies. Specifically, the traditional dichotomy between Iguania and Scleroglossa has been correlated with major evolutionary shifts within Squamata. We present a molecular phylogenetic study of squamates using DNA sequence data from the nuclear genes RAG-1 and c-mos and the mitochondrial ND2 region, sampling all major clades and most major subclades. Monophyly of Iguania, Anguimorpha, and almost all currently recognized squamate families is strongly supported. However, monophyly is rejected for Scleroglossa, Varanoidea, and several other higher taxa, and Iguania is highly nested within Squamata. Limblessness evolved independently in snakes, dibamids, and amphisbaenians, suggesting widespread morphological convergence or parallelism in limbless, burrowing forms. Amphisbaenians are the sister group of lacertids, and snakes are grouped with iguanians and anguimorphs. Dibamids diverged early in squamate evolutionary history. Xantusiidae is the sister taxon of Cordylidae. Studies of functional tongue morphology and feeding mode have found significant differences between Scleroglossa and Iguania, and our finding of a nonmonophyletic Scleroglossa and a highly nested Iguania suggest that similar states evolved separately in Sphenodon and Iguania, and that jaw prehension is the ancestral feeding mode in squamates.

  16. Data on the evolutionary history of the V(DJ recombination-activating protein 1 – RAG1 coupled with sequence and variant analyses

    Directory of Open Access Journals (Sweden)

    Abhishek Kumar

    2016-09-01

    Full Text Available RAG1 protein is one of the key component of RAG complex regulating the V(DJ recombination. There are only few studies for RAG1 concerning evolutionary history, detailed sequence and mutational hotspots. Herein, we present out datasets used for the recent comprehensive study of RAG1 based on sequence, phylogenetic and genetic variant analyses (Kumar et al., 2015 [1]. Protein sequence alignment helped in characterizing the conserved domains and regions of RAG1. It also aided in unraveling ancestral RAG1 in the sea urchin. Human genetic variant analyses revealed 751 mutational hotspots, located both in the coding and the non-coding regions. For further analysis and discussion, see (Kumar et al., 2015 [1].

  17. An evolutionary conserved region (ECR in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex

    Directory of Open Access Journals (Sweden)

    Haddley Kate

    2011-05-01

    Full Text Available Abstract Background Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs, in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1 supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a a strong enhancer that functions in neurons and b a transcription factor that may modulate the function of that enhancer.

  18. Molecular cloning, sequencing and tissue expression of vasotocin and isotocin precursor genes from Ostariophysian catfishes: Phylogeny and evolutionary considerations in teleosts

    Directory of Open Access Journals (Sweden)

    Putul eBanerjee

    2015-05-01

    Full Text Available Basic and neutral neurohypophyseal (NH nonapeptides have evolved from vasotocin (VT by a gene duplication at the base of the gnathostome lineage. In teleosts, VT and IT are the basic and neutral peptides, respectively. In the present study, VT and IT precursor genes of Heteropneustes fossilis and Clarias batrachus (Siluriformes, Ostariophysi were cloned and sequenced. The channel catfish Icatalurus punctatus NH precursor sequences were obtained from EST database. The catfish NH sequences were used along with the available Acanthopterygii and other vertebrate NH precursor sequences to draw phylogenetic inference on the evolutionary history of the teleost NH peptides. Synteny analysis of the NH gene loci in various teleost species was done to complement the phylogenetic analysis. In H. fossilis, the NH transcripts were also sequenced from the ovary. The cloned genes and the deduced precursor proteins showed conserved characteristics of the NH nonapeptide precursors. The genes are expressed in brain and ovary (follicular envelope of H. fossilis with higher transcript abundance in the brain. The addition of the catfish sequences in the phylogenetic analysis revealed that the VT and IT precursors of the species-rich superorders of teleosts have a distinct phylogenetic history with the Acanthopterygii VT and IT precursors sharing a less evolutionary distance and the Ostariophysi VT and IT having a greater evolutionary distance. The genomic location of VT and IT precursors, and synteny analysis of the NH loci lend support to the phylogenetic inference and suggest a footprint of fish- specific whole genome duplication (3R and subsequent diploidization in the NH loci. The VT and IT precursor genes are most likely lineage-specific paralogs resulting from differential losses of the 3R NH paralogs in the two superorders. The independent yet consistent retention of VT and IT in the two superorders might be directed by a stringent ligand-receptor selectivity.

  19. Generalizing and learning protein-DNA binding sequence representations by an evolutionary algorithm

    KAUST Repository

    Wong, Ka Chun

    2011-02-05

    Protein-DNA bindings are essential activities. Understanding them forms the basis for further deciphering of biological and genetic systems. In particular, the protein-DNA bindings between transcription factors (TFs) and transcription factor binding sites (TFBSs) play a central role in gene transcription. Comprehensive TF-TFBS binding sequence pairs have been found in a recent study. However, they are in one-to-one mappings which cannot fully reflect the many-to-many mappings within the bindings. An evolutionary algorithm is proposed to learn generalized representations (many-to-many mappings) from the TF-TFBS binding sequence pairs (one-to-one mappings). The generalized pairs are shown to be more meaningful than the original TF-TFBS binding sequence pairs. Some representative examples have been analyzed in this study. In particular, it shows that the TF-TFBS binding sequence pairs are not presumably in one-to-one mappings. They can also exhibit many-to-many mappings. The proposed method can help us extract such many-to-many information from the one-to-one TF-TFBS binding sequence pairs found in the previous study, providing further knowledge in understanding the bindings between TFs and TFBSs. © 2011 Springer-Verlag.

  20. Amino Acid Sequence and Structural Comparison of BACE1 and BACE2 Using Evolutionary Trace Method

    Directory of Open Access Journals (Sweden)

    Hoda Mirsafian

    2014-01-01

    Full Text Available Beta-amyloid precursor protein cleavage enzyme 1 (BACE1 and beta-amyloid precursor protein cleavage enzyme 2 (BACE2, members of aspartyl protease family, are close homologues and have high similarity in their protein crystal structures. However, their enzymatic properties differ leading to disparate clinical consequences. In order to identify the residues that are responsible for such differences, we used evolutionary trace (ET method to compare the amino acid conservation patterns of BACE1 and BACE2 in several mammalian species. We found that, in BACE1 and BACE2 structures, most of the ligand binding sites are conserved which indicate their enzymatic property of aspartyl protease family members. The other conserved residues are more or less randomly localized in other parts of the structures. Four group-specific residues were identified at the ligand binding site of BACE1 and BACE2. We postulated that these residues would be essential for selectivity of BACE1 and BACE2 biological functions and could be sites of interest for the design of selective inhibitors targeting either BACE1 or BACE2.

  1. BEYOND THE MAIN SEQUENCE: TESTING THE ACCURACY OF STELLAR MASSES PREDICTED BY THE PARSEC EVOLUTIONARY TRACKS

    Energy Technology Data Exchange (ETDEWEB)

    Ghezzi, Luan; Johnson, John Asher, E-mail: lghezzi@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2015-10-20

    Characterizing the physical properties of exoplanets and understanding their formation and orbital evolution requires precise and accurate knowledge of their host stars. Accurately measuring stellar masses is particularly important because they likely influence planet occurrence and the architectures of planetary systems. Single main-sequence stars typically have masses estimated from evolutionary tracks, which generally provide accurate results due to their extensive empirical calibration. However, the validity of this method for subgiants and giants has been called into question by recent studies, with suggestions that the masses of these evolved stars could have been overestimated. We investigate these concerns using a sample of 59 benchmark evolved stars with model-independent masses (from binary systems or asteroseismology) obtained from the literature. We find very good agreement between these benchmark masses and the ones estimated using evolutionary tracks. The average fractional difference in the mass interval ∼0.7–4.5 M{sub ⊙} is consistent with zero (−1.30 ± 2.42%), with no significant trends in the residuals relative to the input parameters. A good agreement between model-dependent and -independent radii (−4.81 ± 1.32%) and surface gravities (0.71 ± 0.51%) is also found. The consistency between independently determined ages for members of binary systems adds further support for the accuracy of the method employed to derive the stellar masses. Taken together, our results indicate that determination of masses of evolved stars using grids of evolutionary tracks is not significantly affected by systematic errors, and is thus valid for estimating the masses of isolated stars beyond the main sequence.

  2. Simple sequence repeats in Neurospora crassa: distribution, polymorphism and evolutionary inference

    Directory of Open Access Journals (Sweden)

    Park Jongsun

    2008-01-01

    Full Text Available Abstract Background Simple sequence repeats (SSRs have been successfully used for various genetic and evolutionary studies in eukaryotic systems. The eukaryotic model organism Neurospora crassa is an excellent system to study evolution and biological function of SSRs. Results We identified and characterized 2749 SSRs of 963 SSR types in the genome of N. crassa. The distribution of tri-nucleotide (nt SSRs, the most common SSRs in N. crassa, was significantly biased in exons. We further characterized the distribution of 19 abundant SSR types (AST, which account for 71% of total SSRs in the N. crassa genome, using a Poisson log-linear model. We also characterized the size variation of SSRs among natural accessions using Polymorphic Index Content (PIC and ANOVA analyses and found that there are genome-wide, chromosome-dependent and local-specific variations. Using polymorphic SSRs, we have built linkage maps from three line-cross populations. Conclusion Taking our computational, statistical and experimental data together, we conclude that 1 the distributions of the SSRs in the sequenced N. crassa genome differ systematically between chromosomes as well as between SSR types, 2 the size variation of tri-nt SSRs in exons might be an important mechanism in generating functional variation of proteins in N. crassa, 3 there are different levels of evolutionary forces in variation of amino acid repeats, and 4 SSRs are stable molecular markers for genetic studies in N. crassa.

  3. BlockLogo: Visualization of peptide and sequence motif conservation

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian

    2013-01-01

    , selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes...

  4. Evolutionary refugia and ecological refuges: key concepts for conserving Australian arid zone freshwater biodiversity under climate change.

    Science.gov (United States)

    Davis, Jenny; Pavlova, Alexandra; Thompson, Ross; Sunnucks, Paul

    2013-07-01

    Refugia have been suggested as priority sites for conservation under climate change because of their ability to facilitate survival of biota under adverse conditions. Here, we review the likely role of refugial habitats in conserving freshwater biota in arid Australian aquatic systems where the major long-term climatic influence has been aridification. We introduce a conceptual model that characterizes evolutionary refugia and ecological refugees based on our review of the attributes of aquatic habitats and freshwater taxa (fishes and aquatic invertebrates) in arid Australia. We also identify methods of recognizing likely future refugia and approaches to assessing the vulnerability of arid-adapted freshwater biota to a warming and drying climate. Evolutionary refugia in arid areas are characterized as permanent, groundwater-dependent habitats (subterranean aquifers and springs) supporting vicariant relicts and short-range endemics. Ecological refugees can vary across space and time, depending on the dispersal abilities of aquatic taxa and the geographical proximity and hydrological connectivity of aquatic habitats. The most important are the perennial waterbodies (both groundwater and surface water fed) that support obligate aquatic organisms. These species will persist where suitable habitats are available and dispersal pathways are maintained. For very mobile species (invertebrates with an aerial dispersal phase) evolutionary refugia may also act as ecological refugees. Evolutionary refugia are likely future refugia because their water source (groundwater) is decoupled from local precipitation. However, their biota is extremely vulnerable to changes in local conditions because population extinction risks cannot be abated by the dispersal of individuals from other sites. Conservation planning must incorporate a high level of protection for aquifers that support refugial sites. Ecological refuges are vulnerable to changes in regional climate because they have

  5. Sequence conservation between porcine and human LRRK2

    DEFF Research Database (Denmark)

    Larsen, Knud; Madsen, Lone Bruhn

    2009-01-01

     Leucine-rich repeat kinase 2 (LRRK2) is a member of the ROCO protein superfamily (Ras of complex proteins (Roc) with a C-terminal Roc domain). Mutations in the LRRK2 gene lead to autosomal dominant Parkinsonism. We have cloned the porcine LRRK2 cDNA in an attempt to characterize conserved and th...... and expression patterns are conserved across species. The porcine LRRK2 gene was mapped to chromosome 5q25. The results obtained suggest that the LRRK2 gene might be of particular interest in our attempt to generate a transgenic porcine model for Parkinson's disease...

  6. Identifying human disease genes through cross-species gene mapping of evolutionary conserved processes.

    Directory of Open Access Journals (Sweden)

    Martin Poot

    2011-05-01

    Full Text Available Understanding complex networks that modulate development in humans is hampered by genetic and phenotypic heterogeneity within and between populations. Here we present a method that exploits natural variation in highly diverse mouse genetic reference panels in which genetic and environmental factors can be tightly controlled. The aim of our study is to test a cross-species genetic mapping strategy, which compares data of gene mapping in human patients with functional data obtained by QTL mapping in recombinant inbred mouse strains in order to prioritize human disease candidate genes.We exploit evolutionary conservation of developmental phenotypes to discover gene variants that influence brain development in humans. We studied corpus callosum volume in a recombinant inbred mouse panel (C57BL/6J×DBA/2J, BXD strains using high-field strength MRI technology. We aligned mouse mapping results for this neuro-anatomical phenotype with genetic data from patients with abnormal corpus callosum (ACC development.From the 61 syndromes which involve an ACC, 51 human candidate genes have been identified. Through interval mapping, we identified a single significant QTL on mouse chromosome 7 for corpus callosum volume with a QTL peak located between 25.5 and 26.7 Mb. Comparing the genes in this mouse QTL region with those associated with human syndromes (involving ACC and those covered by copy number variations (CNV yielded a single overlap, namely HNRPU in humans and Hnrpul1 in mice. Further analysis of corpus callosum volume in BXD strains revealed that the corpus callosum was significantly larger in BXD mice with a B genotype at the Hnrpul1 locus than in BXD mice with a D genotype at Hnrpul1 (F = 22.48, p<9.87*10(-5.This approach that exploits highly diverse mouse strains provides an efficient and effective translational bridge to study the etiology of human developmental disorders, such as autism and schizophrenia.

  7. Identification of (R)-selective ω-aminotransferases by exploring evolutionary sequence space.

    Science.gov (United States)

    Kim, Eun-Mi; Park, Joon Ho; Kim, Byung-Gee; Seo, Joo-Hyun

    2018-03-01

    Several (R)-selective ω-aminotransferases (R-ωATs) have been reported. The existence of additional R-ωATs having different sequence characteristics from previous ones is highly expected. In addition, it is generally accepted that R-ωATs are variants of aminotransferase group III. Based on these backgrounds, sequences in RefSeq database were scored using family profiles of branched-chain amino acid aminotransferase (BCAT) and d-alanine aminotransferase (DAT) to predict and identify putative R-ωATs. Sequences with two profile analysis scores were plotted on two-dimensional score space. Candidates with relatively similar scores in both BCAT and DAT profiles (i.e., profile analysis score using BCAT profile was similar to profile analysis score using DAT profile) were selected. Experimental results for selected candidates showed that putative R-ωATs from Saccharopolyspora erythraea (R-ωAT_Sery), Bacillus cellulosilyticus (R-ωAT_Bcel), and Bacillus thuringiensis (R-ωAT_Bthu) had R-ωAT activity. Additional experiments revealed that R-ωAT_Sery also possessed DAT activity while R-ωAT_Bcel and R-ωAT_Bthu had BCAT activity. Selecting putative R-ωATs from regions with similar profile analysis scores identified potential R-ωATs. Therefore, R-ωATs could be efficiently identified by using simple family profile analysis and exploring evolutionary sequence space. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Resolving Evolutionary Relationships in Closely Related Species with Whole-Genome Sequencing Data.

    Science.gov (United States)

    Nater, Alexander; Burri, Reto; Kawakami, Takeshi; Smeds, Linnéa; Ellegren, Hans

    2015-11-01

    Using genetic data to resolve the evolutionary relationships of species is of major interest in evolutionary and systematic biology. However, reconstructing the sequence of speciation events, the so-called species tree, in closely related and potentially hybridizing species is very challenging. Processes such as incomplete lineage sorting and interspecific gene flow result in local gene genealogies that differ in their topology from the species tree, and analyses of few loci with a single sequence per species are likely to produce conflicting or even misleading results. To study these phenomena on a full phylogenomic scale, we use whole-genome sequence data from 200 individuals of four black-and-white flycatcher species with so far unresolved phylogenetic relationships to infer gene tree topologies and visualize genome-wide patterns of gene tree incongruence. Using phylogenetic analysis in nonoverlapping 10-kb windows, we show that gene tree topologies are extremely diverse and change on a very small physical scale. Moreover, we find strong evidence for gene flow among flycatcher species, with distinct patterns of reduced introgression on the Z chromosome. To resolve species relationships on the background of widespread gene tree incongruence, we used four complementary coalescent-based methods for species tree reconstruction, including complex modeling approaches that incorporate post-divergence gene flow among species. This allowed us to infer the most likely species tree with high confidence. Based on this finding, we show that regions of reduced effective population size, which have been suggested as particularly useful for species tree inference, can produce positively misleading species tree topologies. Our findings disclose the pitfalls of using loci potentially under selection as phylogenetic markers and highlight the potential of modeling approaches to disentangle species relationships in systems with large effective population sizes and post

  9. Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

    Directory of Open Access Journals (Sweden)

    David Karlin

    Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

  10. Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

    Science.gov (United States)

    Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

    2017-03-27

    Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome

  11. Reconstructing Networks from Profit Sequences in Evolutionary Games via a Multiobjective Optimization Approach with Lasso Initialization

    Science.gov (United States)

    Wu, Kai; Liu, Jing; Wang, Shuai

    2016-11-01

    Evolutionary games (EG) model a common type of interactions in various complex, networked, natural and social systems. Given such a system with only profit sequences being available, reconstructing the interacting structure of EG networks is fundamental to understand and control its collective dynamics. Existing approaches used to handle this problem, such as the lasso, a convex optimization method, need a user-defined constant to control the tradeoff between the natural sparsity of networks and measurement error (the difference between observed data and simulated data). However, a shortcoming of these approaches is that it is not easy to determine these key parameters which can maximize the performance. In contrast to these approaches, we first model the EG network reconstruction problem as a multiobjective optimization problem (MOP), and then develop a framework which involves multiobjective evolutionary algorithm (MOEA), followed by solution selection based on knee regions, termed as MOEANet, to solve this MOP. We also design an effective initialization operator based on the lasso for MOEA. We apply the proposed method to reconstruct various types of synthetic and real-world networks, and the results show that our approach is effective to avoid the above parameter selecting problem and can reconstruct EG networks with high accuracy.

  12. Highly conserved D-loop-like nuclear mitochondrial sequences ...

    Indian Academy of Sciences (India)

    -1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses ...

  13. Comparative and Evolutionary Analyses of Meloidogyne spp. Based on Mitochondrial Genome Sequences

    Science.gov (United States)

    García, Laura Evangelina; Sánchez-Puerta, M. Virginia

    2015-01-01

    Molecular taxonomy and evolution of nematodes have been recently the focus of several studies. Mitochondrial sequences were proposed as an alternative for precise identification of Meloidogyne species, to study intraspecific variability and to follow maternal lineages. We characterized the mitochondrial genomes (mtDNAs) of the root knot nematodes M. floridensis, M. hapla and M. incognita. These were AT rich (81–83%) and highly compact, encoding 12 proteins, 2 rRNAs, and 22 tRNAs. Comparisons with published mtDNAs of M. chitwoodi, M. incognita (another strain) and M. graminicola revealed that they share protein and rRNA gene order but differ in the order of tRNAs. The mtDNAs of M. floridensis and M. incognita were strikingly similar (97–100% identity for all coding regions). In contrast, M. floridensis, M. chitwoodi, M. hapla and M. graminicola showed 65–84% nucleotide identity for coding regions. Variable mitochondrial sequences are potentially useful for evolutionary and taxonomic studies. We developed a molecular taxonomic marker by sequencing a highly-variable ~2 kb mitochondrial region, nad5-cox1, from 36 populations of root-knot nematodes to elucidate relationships within the genus Meloidogyne. Isolates of five species formed monophyletic groups and showed little intraspecific variability. We also present a thorough analysis of the mitochondrial region cox2-rrnS. Phylogenies based on either mitochondrial region had good discrimination power but could not discriminate between M. arenaria, M. incognita and M. floridensis. PMID:25799071

  14. From Binding-Induced Dynamic Effects in SH3 Structures to Evolutionary Conserved Sectors.

    Directory of Open Access Journals (Sweden)

    Ana Zafra Ruano

    2016-05-01

    Full Text Available Src Homology 3 domains are ubiquitous small interaction modules known to act as docking sites and regulatory elements in a wide range of proteins. Prior experimental NMR work on the SH3 domain of Src showed that ligand binding induces long-range dynamic changes consistent with an induced fit mechanism. The identification of the residues that participate in this mechanism produces a chart that allows for the exploration of the regulatory role of such domains in the activity of the encompassing protein. Here we show that a computational approach focusing on the changes in side chain dynamics through ligand binding identifies equivalent long-range effects in the Src SH3 domain. Mutation of a subset of the predicted residues elicits long-range effects on the binding energetics, emphasizing the relevance of these positions in the definition of intramolecular cooperative networks of signal transduction in this domain. We find further support for this mechanism through the analysis of seven other publically available SH3 domain structures of which the sequences represent diverse SH3 classes. By comparing the eight predictions, we find that, in addition to a dynamic pathway that is relatively conserved throughout all SH3 domains, there are dynamic aspects specific to each domain and homologous subgroups. Our work shows for the first time from a structural perspective, which transduction mechanisms are common between a subset of closely related and distal SH3 domains, while at the same time highlighting the differences in signal transduction that make each family member unique. These results resolve the missing link between structural predictions of dynamic changes and the domain sectors recently identified for SH3 domains through sequence analysis.

  15. Constructing a One-solar-mass Evolutionary Sequence Using Asteroseismic Data from Kepler

    DEFF Research Database (Denmark)

    Silva Aguirre, V.; Chaplin, W.J.; Ballot, J.

    2011-01-01

    readily extracted are the large frequency separation (Δν) and the frequency of maximum oscillation power (νmax). After the survey phase, these quantities are available for hundreds of solar-type stars. By scaling from solar values, we use these two asteroseismic observables to identify for the first time...... an evolutionary sequence of 1 M sun field stars, without the need for further information from stellar models. Comparison of our determinations with the few available spectroscopic results shows an excellent level of agreement. We discuss the potential of the method for differential analysis throughout the main......Asteroseismology of solar-type stars has entered a new era of large surveys with the success of the NASA Kepler mission, which is providing exquisite data on oscillations of stars across the Hertzsprung-Russell diagram. From the time-series photometry, the two seismic parameters that can be most...

  16. Voltage-Gated Sodium Channels: Evolutionary History and Distinctive Sequence Features.

    Science.gov (United States)

    Kasimova, M A; Granata, D; Carnevale, V

    2016-01-01

    Voltage-gated sodium channels (Nav) are responsible for the rising phase of the action potential. Their role in electrical signal transmission is so relevant that their emergence is believed to be one of the crucial factors enabling development of nervous system. The presence of voltage-gated sodium-selective channels in bacteria (BacNav) has raised questions concerning the evolutionary history of the ones in animals. Here we review some of the milestones in the field of Nav phylogenetic analysis and discuss some of the most important sequence features that distinguish these channels from voltage-gated potassium channels and transient receptor potential channels. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Fractional-difference stochastic model of evolutionary substitutions in DNA sequences

    Science.gov (United States)

    West, Bruce J.; Bickel, David R.

    1999-05-01

    The number of molecular substitutions occurring in a DNA sequence over a given time is described by a fractional-difference random walk model. This is an empirically motivated stochastic model of molecular evolution and does not address the detailed evolutionary mechanisms that lead to the substitution of nucleotides. This fractal stochastic process yields a Fano Factor, the ratio of the variance to the mean in the number of molecular substitutions, that increases as a power law in time. This prediction agrees with the observed statistics across 49 different genes in mammals. The fractional-difference model of molecular evolution is episodic and can be made consistent with the punctuated equilibrium model of macroevolution.

  18. [Morphologic variation of the parthenogenetic lizard Aspidoscelis rodecki (Squamata: Teiidae): evolutionary and conservation implications].

    Science.gov (United States)

    Elizalde-Rocha, Sandra P; Méndez-de la Cruz, Fausto R; Méndez-Sánchez, J Fernando; Granados-González, Gisela; Hernândez-Gallegos, Oswaldo

    2008-12-01

    Post-formational divergence has been used for the recognition of new parthenogenetic species. Currently, the parthenogenetic lizard Aspidoscelis rodecki McCoy and Maslin 1962 is recognized as a single taxon that was derived from a single, parthenogenetically capable, hybrid. This lizard had been derived via hybridization between individuals of two gonochoristic species, Aspidoscelis ungusticeps Cope 1878 and Aspidoscelis deppii Wiegmann 1834. The distribution of A. rodecki includes Isla Contoy and Isla Mujeres and the adjacent mainland of Quintana Roo, México. Previous studies have found post-formational divergence in genetic, chromatic and life-history characteristics among a continental population (Puerto Juárez) and an insular population (Isla Contoy). A meristic analysis was carried out to evaluate the morphological divergence among both populations of A. rodecki. We used 38 individuals from Puerto Juárez and 23 individuals from Isla Contoy. Nine meristic characters with discrimination value among species of the genus Aspidoscelis were used in both univariate (t-Student) and multivariate analyses (principal components and canonical variate analysis). According to both analyses, Puerto Juárez is meristically distinguishable from Isla Contoy. Both populations differ in five meristic characters and were a high correct classification in the canonical variate analysis: 97% of Puerto Juárez and 100% of Isla Contoy. A small sample from Isla Mujeres and a single specimen from Punta Sam (mainland) may represent different morphological groups. Due to the patterns of phenotypic variation, A. rodecki is considered as a single variable parthenogenetic species with high priority to conservation. The populations of A. rodecki have been extremely affected by the tourism developers. If the habitat of the parthenogenetic lizard (beach grasses) is allowed to stay, the expansion by the developers will not affect the survivorship of these populations. Nevertheless, the first

  19. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    Science.gov (United States)

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

    2017-03-01

    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

  20. Protein Phylogenies and Signature Sequences: A Reappraisal of Evolutionary Relationships among Archaebacteria, Eubacteria, and Eukaryotes

    Science.gov (United States)

    Gupta, Radhey S.

    1998-01-01

    The presence of shared conserved insertion or deletions (indels) in protein sequences is a special type of signature sequence that shows considerable promise for phylogenetic inference. An alternative model of microbial evolution based on the use of indels of conserved proteins and the morphological features of prokaryotic organisms is proposed. In this model, extant archaebacteria and gram-positive bacteria, which have a simple, single-layered cell wall structure, are termed monoderm prokaryotes. They are believed to be descended from the most primitive organisms. Evidence from indels supports the view that the archaebacteria probably evolved from gram-positive bacteria, and I suggest that this evolution occurred in response to antibiotic selection pressures. Evidence is presented that diderm prokaryotes (i.e., gram-negative bacteria), which have a bilayered cell wall, are derived from monoderm prokaryotes. Signature sequences in different proteins provide a means to define a number of different taxa within prokaryotes (namely, low G+C and high G+C gram-positive, Deinococcus-Thermus, cyanobacteria, chlamydia-cytophaga related, and two different groups of Proteobacteria) and to indicate how they evolved from a common ancestor. Based on phylogenetic information from indels in different protein sequences, it is hypothesized that all eukaryotes, including amitochondriate and aplastidic organisms, received major gene contributions from both an archaebacterium and a gram-negative eubacterium. In this model, the ancestral eukaryotic cell is a chimera that resulted from a unique fusion event between the two separate groups of prokaryotes followed by integration of their genomes. PMID:9841678

  1. Evolutionary patterning of hemagglutinin gene sequence of 2009 H1N1 pandemic.

    Science.gov (United States)

    Banerjee, Rachana; Roy, Ayan; Ahmad, Fayaz; Das, Santasabuj; Basak, Surajit

    2012-01-01

    The 2009 H1N1 swine flu is the first pandemic in decades. Infectivity of the influenza virus for human host depends largely on its ability to evade antibodies specific for viral protein called hemagglutinin (HA) that mediates attachment to the host. In the present study we analysed large number of HA gene sequences available in Flu Database maintained at NCBI. Our sequence based analysis clearly demonstrates that the amino acid usage pattern may dramatically change during the course of evolution, and there exists a clear link between a particular pattern of amino acid usage of HA genes and its potential to become infectious. Structural studies revealed how binding efficiency between the HA and sialic acid may alter the pandemic potential of infection. Our work highlights the evolutionary significance and biochemical basis of the selective advantage of certain amino acids of HA in 2009 and provides a link between the characteristics changes in HA protein and their potential to pronounce a global menace to public health.

  2. In situ conservation-harnessing natural and human-derived evolutionary forces to ensure future crop adaptation.

    Science.gov (United States)

    Bellon, Mauricio R; Dulloo, Ehsan; Sardos, Julie; Thormann, Imke; Burdon, Jeremy J

    2017-12-01

    Ensuring the availability of the broadest possible germplasm base for agriculture in the face of increasingly uncertain and variable patterns of biotic and abiotic change is fundamental for the world's future food supply. While ex situ conservation plays a major role in the conservation and availability of crop germplasm, it may be insufficient to ensure this. In situ conservation aims to maintain target species and the collective genotypes they represent under evolution. A major rationale for this view is based on the likelihood that continued exposure to changing selective forces will generate and favor new genetic variation and an increased likelihood that rare alleles that may be of value to future agriculture are maintained. However, the evidence that underpins this key rationale remains fragmented and has not been examined systematically, thereby decreasing the perceived value and support for in situ conservation for agriculture and food systems and limiting the conservation options available. This study reviews evidence regarding the likelihood and rate of evolutionary change in both biotic and abiotic traits for crops and their wild relatives, placing these processes in a realistic context in which smallholder farming operates and crop wild relatives continue to exist. It identifies areas of research that would contribute to a deeper understanding of these processes as the basis for making them more useful for future crop adaptation.

  3. Complex evolutionary history of the Aeromonas veronii group revealed by host interaction and DNA sequence data.

    Directory of Open Access Journals (Sweden)

    Adam C Silver

    Full Text Available Aeromonas veronii biovar sobria, Aeromonas veronii biovar veronii, and Aeromonas allosaccharophila are a closely related group of organisms, the Aeromonas veronii Group, that inhabit a wide range of host animals as a symbiont or pathogen. In this study, the ability of various strains to colonize the medicinal leech as a model for beneficial symbiosis and to kill wax worm larvae as a model for virulence was determined. Isolates cultured from the leech out-competed other strains in the leech model, while most strains were virulent in the wax worms. Three housekeeping genes, recA, dnaJ and gyrB, the gene encoding chitinase, chiA, and four loci associated with the type three secretion system, ascV, ascFG, aexT, and aexU were sequenced. The phylogenetic reconstruction failed to produce one consensus tree that was compatible with most of the individual genes. The Approximately Unbiased test and the Genetic Algorithm for Recombination Detection both provided further support for differing evolutionary histories among this group of genes. Two contrasting tests detected recombination within aexU, ascFG, ascV, dnaJ, and gyrB but not in aexT or chiA. Quartet decomposition analysis indicated a complex recent evolutionary history for these strains with a high frequency of horizontal gene transfer between several but not among all strains. In this study we demonstrate that at least for some strains, horizontal gene transfer occurs at a sufficient frequency to blur the signal from vertically inherited genes, despite strains being adapted to distinct niches. Simply increasing the number of genes included in the analysis is unlikely to overcome this challenge in organisms that occupy multiple niches and can exchange DNA between strains specialized to different niches. Instead, the detection of genes critical in the adaptation to specific niches may help to reveal the physiological specialization of these strains.

  4. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    Energy Technology Data Exchange (ETDEWEB)

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.

    2006-07-06

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  5. Detection of Weakly Conserved Ancestral Mammalian RegulatorySequences by Primate Comparisons

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qian-fei; Prabhakar, Shyam; Chanan, Sumita; Cheng,Jan-Fang; Rubin, Edward M.; Boffelli, Dario

    2006-06-01

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detectcryptic functional elements, which are too weakly conserved among mammalsto distinguish from nonfunctional DNA. To address this problem, weexplored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  6. Comparative Mitogenomics of the Genus Odontobutis (Perciformes: Gobioidei: Odontobutidae) Revealed Conserved Gene Rearrangement and High Sequence Variations.

    Science.gov (United States)

    Ma, Zhihong; Yang, Xuefen; Bercsenyi, Miklos; Wu, Junjie; Yu, Yongyao; Wei, Kaijian; Fan, Qixue; Yang, Ruibin

    2015-10-20

    To understand the molecular evolution of mitochondrial genomes (mitogenomes) in the genus Odontobutis, the mitogenome of Odontobutis yaluensis was sequenced and compared with those of another four Odontobutis species. Our results displayed similar mitogenome features among species in genome organization, base composition, codon usage, and gene rearrangement. The identical gene rearrangement of trnS-trnL-trnH tRNA cluster observed in mitogenomes of these five closely related freshwater sleepers suggests that this unique gene order is conserved within Odontobutis. Additionally, the present gene order and the positions of associated intergenic spacers of these Odontobutis mitogenomes indicate that this unusual gene rearrangement results from tandem duplication and random loss of large-scale gene regions. Moreover, these mitogenomes exhibit a high level of sequence variation, mainly due to the differences of corresponding intergenic sequences in gene rearrangement regions and the heterogeneity of tandem repeats in the control regions. Phylogenetic analyses support Odontobutis species with shared gene rearrangement forming a monophyletic group, and the interspecific phylogenetic relationships are associated with structural differences among their mitogenomes. The present study contributes to understanding the evolutionary patterns of Odontobutidae species.

  7. Evolutionary meta-analysis of solanaceous resistance gene and solanum resistance gene analog sequences and a practical framework for cross-species comparisons.

    Science.gov (United States)

    Quirin, Edmund A; Mann, Harpartap; Meyer, Rachel S; Traini, Alessandra; Chiusano, Maria Luisa; Litt, Amy; Bradeen, James M

    2012-05-01

    Cross-species comparative genomics approaches have been employed to map and clone many important disease resistance (R) genes from Solanum species-especially wild relatives of potato and tomato. These efforts will increase with the recent release of potato genome sequence and the impending release of tomato genome sequence. Most R genes belong to the prominent nucleotide binding site-leucine rich repeat (NBS-LRR) class and conserved NBS-LRR protein motifs enable survey of the R gene space of a plant genome by generation of resistance gene analogs (RGA), polymerase chain reaction fragments derived from R genes. We generated a collection of 97 RGA from the disease-resistant wild potato S. bulbocastanum, complementing smaller collections from other Solanum species. To further comparative genomics approaches, we combined all known Solanum RGA and cloned solanaceous NBS-LRR gene sequences, nearly 800 sequences in total, into a single meta-analysis. We defined R gene diversity bins that reflect both evolutionary relationships and DNA cross-hybridization results. The resulting framework is amendable and expandable, providing the research community with a common vocabulary for present and future study of R gene lineages. Through a series of sequence and hybridization experiments, we demonstrate that all tested R gene lineages are of ancient origin, are shared between Solanum species, and can be successfully accessed via comparative genomics approaches.

  8. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms.

    Science.gov (United States)

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M

    2014-08-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait

    Directory of Open Access Journals (Sweden)

    Shirai Leila T

    2012-02-01

    Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene

  10. The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

    Directory of Open Access Journals (Sweden)

    Roberts Richard J

    2008-05-01

    Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

  11. Conservation and evolutionary divergence in the activity of receptor-regulated smads

    Directory of Open Access Journals (Sweden)

    Sorrentino Gina M

    2012-10-01

    Full Text Available Abstract Background Activity of the Transforming growth factor-β (TGFβ pathway is essential to the establishment of body axes and tissue differentiation in bilaterians. Orthologs for core pathway members have been found in all metazoans, but uncertain homology of the body axes and tissues patterned by these signals raises questions about the activities of these molecules across the metazoan tree. We focus on the principal canonical transduction proteins (R-Smads of the TGFβ pathway, which instruct both axial patterning and tissue differentiation in the developing embryo. We compare the activity of R-Smads from a cnidarian (Nematostella vectensis, an arthropod (Drosophila melanogaster, and a vertebrate (Xenopus laevis in Xenopus embryonic assays. Results Overexpressing NvSmad1/5 ventralized Xenopus embryos when expressed in dorsal blastomeres, similar to the effects of Xenopus Smad1. However, NvSmad1/5 was less potent than XSmad1 in its ability to activate downstream target genes in Xenopus animal cap assays. NvSmad2/3 strongly induced general mesendodermal marker genes, but weakly induced ones involved in specifying the Spemann organizer. NvSmad2/3 was unable to induce a secondary trunk axis in Xenopus embryos, whereas the orthologs from Xenopus (XSmad2 and XSmad3 and Drosophila (dSmad2 were capable of doing so. Replacement of the NvSmad2/3 MH2 domain with the Xenopus XSmad2 MH2 slightly increased its inductive capability, but did not confer an ability to generate a secondary body axis. Conclusions Vertebrate and cnidarian Smad1/5 have similar axial patterning and induction activities, although NvSmad1/5 is less efficient than the vertebrate gene. We conclude that the activities of Smad1/5 orthologs have been largely conserved across Metazoa. NvSmad2/3 efficiently activates general mesendoderm markers, but is unable to induce vertebrate organizer-specific genes or to produce a secondary body axis in Xenopus. Orthologs dSmad2 and XSmad3

  12. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.

    Directory of Open Access Journals (Sweden)

    Kacy L Gordon

    2015-05-01

    Full Text Available Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2 from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  13. Advantages of a mechanistic codon substitution model for evolutionary analysis of protein-coding sequences.

    Directory of Open Access Journals (Sweden)

    Sanzo Miyazawa

    Full Text Available BACKGROUND: A mechanistic codon substitution model, in which each codon substitution rate is proportional to the product of a codon mutation rate and the average fixation probability depending on the type of amino acid replacement, has advantages over nucleotide, amino acid, and empirical codon substitution models in evolutionary analysis of protein-coding sequences. It can approximate a wide range of codon substitution processes. If no selection pressure on amino acids is taken into account, it will become equivalent to a nucleotide substitution model. If mutation rates are assumed not to depend on the codon type, then it will become essentially equivalent to an amino acid substitution model. Mutation at the nucleotide level and selection at the amino acid level can be separately evaluated. RESULTS: The present scheme for single nucleotide mutations is equivalent to the general time-reversible model, but multiple nucleotide changes in infinitesimal time are allowed. Selective constraints on the respective types of amino acid replacements are tailored to each gene in a linear function of a given estimate of selective constraints. Their good estimates are those calculated by maximizing the respective likelihoods of empirical amino acid or codon substitution frequency matrices. Akaike and Bayesian information criteria indicate that the present model performs far better than the other substitution models for all five phylogenetic trees of highly-divergent to highly-homologous sequences of chloroplast, mitochondrial, and nuclear genes. It is also shown that multiple nucleotide changes in infinitesimal time are significant in long branches, although they may be caused by compensatory substitutions or other mechanisms. The variation of selective constraint over sites fits the datasets significantly better than variable mutation rates, except for 10 slow-evolving nuclear genes of 10 mammals. An critical finding for phylogenetic analysis is that

  14. An alternative hybrid evolutionary technique focused on allocating machines and sequencing operations

    Directory of Open Access Journals (Sweden)

    Mariano Frutos

    2016-09-01

    Full Text Available We present here a hybrid algorithm for the Flexible Job-Shop Scheduling Problem (FJSSP. This problem involves the optimal use of resources in a flexible production environment in which each operation can be carried out by more than a single machine. Our algorithm allocates, in a first step, the machines to operations and in a second stage it sequences them by integrating a Multi-Objective Evolutionary Algorithm (MOEA and a path-dependent search algorithm (Multi-Objective Simulated Annealing, which is enacted at the genetic phase of the procedure. The joint interaction of those two components yields a very efficient procedure for solving the FJSSP. An important step in the development of the algorithm was the selection of the right MOEA. Candidates were tested on problems of low, medium and high complexity. Further analyses showed the relevance of the search algorithm in the hybrid structure. Finally, comparisons with other algorithms in the literature indicate that the performance of our alternative is good.

  15. Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

    Directory of Open Access Journals (Sweden)

    Kuzin Alexander

    2008-08-01

    Full Text Available Abstract Background The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. We describe the use of EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, to characterize highly conserved sequences that are shared among co-regulating enhancers. Results Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. We have used information gained from our comparative analysis to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. Conclusion The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function.

  16. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  17. Quantifying the relationship between sequence and three-dimensional structure conservation in RNA

    Directory of Open Access Journals (Sweden)

    Capriotti Emidio

    2010-06-01

    Full Text Available Abstract Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii evolution tends to conserve more RNA structure than sequence, and (iii there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction.

  18. Using evolutionary conserved modules in gene networks as a strategy to leverage high throughput gene expression queries.

    Directory of Open Access Journals (Sweden)

    Jeanne M Serb

    Full Text Available BACKGROUND: Large-scale gene expression studies have not yielded the expected insight into genetic networks that control complex processes. These anticipated discoveries have been limited not by technology, but by a lack of effective strategies to investigate the data in a manageable and meaningful way. Previous work suggests that using a pre-determined seed-network of gene relationships to query large-scale expression datasets is an effective way to generate candidate genes for further study and network expansion or enrichment. Based on the evolutionary conservation of gene relationships, we test the hypothesis that a seed network derived from studies of retinal cell determination in the fly, Drosophila melanogaster, will be an effective way to identify novel candidate genes for their role in mouse retinal development. METHODOLOGY/PRINCIPAL FINDINGS: Our results demonstrate that a number of gene relationships regulating retinal cell differentiation in the fly are identifiable as pairwise correlations between genes from developing mouse retina. In addition, we demonstrate that our extracted seed-network of correlated mouse genes is an effective tool for querying datasets and provides a context to generate hypotheses. Our query identified 46 genes correlated with our extracted seed-network members. Approximately 54% of these candidates had been previously linked to the developing brain and 33% had been previously linked to the developing retina. Five of six candidate genes investigated further were validated by experiments examining spatial and temporal protein expression in the developing retina. CONCLUSIONS/SIGNIFICANCE: We present an effective strategy for pursuing a systems biology approach that utilizes an evolutionary comparative framework between two model organisms, fly and mouse. Future implementation of this strategy will be useful to determine the extent of network conservation, not just gene conservation, between species and will

  19. Asymmetrical distribution of non-conserved regulatory sequences at PHOX2B is reflected at the ENCODE loci and illuminates a possible genome-wide trend

    Directory of Open Access Journals (Sweden)

    McCallion Andrew S

    2009-01-01

    Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in

  20. Application of target capture sequencing of exons and conserved non-coding sequences to 20 inbred rat strains

    Directory of Open Access Journals (Sweden)

    Minako Yoshihara

    2016-12-01

    Full Text Available We report sequence data obtained by our recently devised target capture method TargetEC applied to 20 inbred rat strains. This method encompasses not only all annotated exons but also highly conserved non-coding sequences shared among vertebrates. The total length of the target regions covers 146.8 Mb. On an average, we obtained 31.7× depth of target coverage and identified 154,330 SNVs and 24,368 INDELs for each strain. This corresponds to 470,037 unique SNVs and 68,652 unique INDELs among the 20 strains. The sequence data can be accessed at DDBJ/EMBL/GenBank under accession number PRJDB4648, and the identified variants have been deposited at http://bioinfo.sls.kyushu-u.ac.jp/rat_target_capture/20_strains.vcf.gz.

  1. Phylogeography of Camellia taliensis (Theaceae) inferred from chloroplast and nuclear DNA: insights into evolutionary history and conservation.

    Science.gov (United States)

    Liu, Yang; Yang, Shi-xiong; Ji, Peng-zhang; Gao, Li-zhi

    2012-06-21

    As one of the most important but seriously endangered wild relatives of the cultivated tea, Camellia taliensis harbors valuable gene resources for tea tree improvement in the future. The knowledge of genetic variation and population structure may provide insights into evolutionary history and germplasm conservation of the species. Here, we sampled 21 natural populations from the species' range in China and performed the phylogeography of C. taliensis by using the nuclear PAL gene fragment and chloroplast rpl32-trnL intergenic spacer. Levels of haplotype diversity and nucleotide diversity detected at rpl32-trnL (h = 0.841; π = 0.00314) were almost as high as at PAL (h = 0.836; π = 0.00417). Significant chloroplast DNA population subdivision was detected (GST = 0.988; NST = 0.989), suggesting fairly high genetic differentiation and low levels of recurrent gene flow through seeds among populations. Nested clade phylogeographic analysis of chlorotypes suggests that population genetic structure in C. taliensis has been affected by habitat fragmentation in the past. However, the detection of a moderate nrDNA population subdivision (GST = 0.222; NST = 0.301) provided the evidence of efficient pollen-mediated gene flow among populations and significant phylogeographical structure (NST > GST; P conservation strategies for germplasm sampling and developing in situ conservation of natural populations.

  2. Mitochondrial DNA haplotype distribution patterns in Pinus ponderosa (Pinaceae): range-wide evolutionary history and implications for conservation.

    Science.gov (United States)

    Potter, Kevin M; Hipkins, Valerie D; Mahalovich, Mary F; Means, Robert E

    2013-08-01

    Ponderosa pine (Pinus ponderosa Douglas ex P. Lawson & C. Lawson) exhibits complicated patterns of morphological and genetic variation across its range in western North America. This study aims to clarify P. ponderosa evolutionary history and phylogeography using a highly polymorphic mitochondrial DNA marker, with results offering insights into how geographical and climatological processes drove the modern evolutionary structure of tree species in the region. We amplified the mtDNA nad1 second intron minisatellite region for 3,100 trees representing 104 populations, and sequenced all length variants. We estimated population-level haplotypic diversity and determined diversity partitioning among varieties, races and populations. After aligning sequences of minisatellite repeat motifs, we evaluated evolutionary relationships among haplotypes. The geographical structuring of the 10 haplotypes corresponded with division between Pacific and Rocky Mountain varieties. Pacific haplotypes clustered with high bootstrap support, and appear to have descended from Rocky Mountain haplotypes. A greater proportion of diversity was partitioned between Rocky Mountain races than between Pacific races. Areas of highest haplotypic diversity were the southern Sierra Nevada mountain range in California, northwestern California, and southern Nevada. Pinus ponderosa haplotype distribution patterns suggest a complex phylogeographic history not revealed by other genetic and morphological data, or by the sparse paleoecological record. The results appear consistent with long-term divergence between the Pacific and Rocky Mountain varieties, along with more recent divergences not well-associated with race. Pleistocene refugia may have existed in areas of high haplotypic diversity, as well as the Great Basin, Southwestern United States/northern Mexico, and the High Plains.

  3. Seminal-type ribonuclease genes in ruminants, sequence conservation without protein expression?

    Science.gov (United States)

    Kleineidam, R G; Jekel, P A; Beintema, J J; Situmorang, P

    1999-04-29

    Bovine seminal ribonuclease (BS-RNase) is an interesting enzyme both for functional and structural reasons. The enzyme is the product of a gene duplication that occurred in an ancestral ruminant. It is possible to demonstrate the presence of seminal-type genes in all other investigated ruminant species, but they are not expressed and show features of pseudogenes. In this paper we report the determination of two pancreatic and one seminal-type ribonuclease gene sequences of swamp-type water buffalo (Bubalus bubalis). The two pancreatic sequences encode proteins with identical amino acid sequences as previously determined for the enzymes isolated from swamp-type and river-type water buffalo, respectively. The seminal-type sequence has no pseudogene features and codes for an enzyme with no unusual features compared with the active bovine enzyme, except for the replacement of one of the cysteines which takes part in the two intersubunit disulfide bridges. However, Western blotting demonstrates the presence of only small amounts of the pancreatic enzymes in water buffalo semen, suggesting that also in this species the seminal-type sequence is not expressed. But it is still possible that the gene is expressed somewhere else in the body or during development. Reconstruction of seminal-type ribonuclease sequences in ancestors of Bovinae and Bovidae indicates no serious abnormalities in the encoded proteins and leads us to the hypothesis that the ruminant seminal-type ribonuclease gene has not come to expression during most of its evolutionary history, but did not exhibit a high evolutionary rate that is generally observed in pseudogenes.

  4. Classification, naming and evolutionary history of glycosyltransferases from sequenced green and red algal genomes.

    Directory of Open Access Journals (Sweden)

    Peter Ulvskov

    Full Text Available The Archaeplastida consists of three lineages, Rhodophyta, Virideplantae and Glaucophyta. The extracellular matrix of most members of the Rhodophyta and Viridiplantae consists of carbohydrate-based or a highly glycosylated protein-based cell wall while the Glaucophyte covering is poorly resolved. In order to elucidate possible evolutionary links between the three advanced lineages in Archaeplastida, a genomic analysis was initiated. Fully sequenced genomes from the Rhodophyta and Virideplantae and the well-defined CAZy database on glycosyltransferases were included in the analysis. The number of glycosyltransferases found in the Rhodophyta and Chlorophyta are generally much lower then in land plants (Embryophyta. Three specific features exhibited by land plants increase the number of glycosyltransferases in their genomes: (1 cell wall biosynthesis, the more complex land plant cell walls require a larger number of glycosyltransferases for biosynthesis, (2 a richer set of protein glycosylation, and (3 glycosylation of secondary metabolites, demonstrated by a large proportion of family GT1 being involved in secondary metabolite biosynthesis. In a comparative analysis of polysaccharide biosynthesis amongst the taxa of this study, clear distinctions or similarities were observed in (1 N-linked protein glycosylation, i.e., Chlorophyta has different mannosylation and glucosylation patterns, (2 GPI anchor biosynthesis, which is apparently missing in the Rhodophyta and truncated in the Chlorophyta, (3 cell wall biosynthesis, where the land plants have unique cell wall related polymers not found in green and red algae, and (4 O-linked glycosylation where comprehensive orthology was observed in glycosylation between the Chlorophyta and land plants but not between the target proteins.

  5. The repetitive component of the A genome of peanut (Arachis hypogaea) and its role in remodelling intergenic sequence space since its evolutionary divergence from the B genome

    Science.gov (United States)

    Bertioli, David J.; Vidigal, Bruna; Nielen, Stephan; Ratnaparkhe, Milind B.; Lee, Tae-Ho; Leal-Bertioli, Soraya C. M.; Kim, Changsoo; Guimarães, Patricia M.; Seijo, Guillermo; Schwarzacher, Trude; Paterson, Andrew H.; Heslop-Harrison, Pat; Araujo, Ana C. G.

    2013-01-01

    Background and Aims Peanut (Arachis hypogaea) is an allotetraploid (AABB-type genome) of recent origin, with a genome of about 2·8 Gb and a high repetitive content. This study reports an analysis of the repetitive component of the peanut A genome using bacterial artificial chromosome (BAC) clones from A. duranensis, the most probable A genome donor, and the probable consequences of the activity of these elements since the divergence of the peanut A and B genomes. Methods The repetitive content of the A genome was analysed by using A. duranensis BAC clones as probes for fluorescence in situ hybridization (BAC-FISH), and by sequencing and characterization of 12 genomic regions. For the analysis of the evolutionary dynamics, two A genome regions are compared with their B genome homeologues. Key Results BAC-FISH using 27 A. duranensis BAC clones as probes gave dispersed and repetitive DNA characteristic signals, predominantly in interstitial regions of the peanut A chromosomes. The sequences of 14 BAC clones showed complete and truncated copies of ten abundant long terminal repeat (LTR) retrotransposons, characterized here. Almost all dateable transposition events occurred genomes. The most abundant retrotransposon is Feral, apparently parasitic on the retrotransposon FIDEL, followed by Pipa, also non-autonomous and probably parasitic on a retrotransposon we named Pipoka. The comparison of the A and B genome homeologous regions showed conserved segments of high sequence identity, punctuated by predominantly indel regions without significant similarity. Conclusions A substantial proportion of the highly repetitive component of the peanut A genome appears to be accounted for by relatively few LTR retrotransposons and their truncated copies or solo LTRs. The most abundant of the retrotransposons are non-autonomous. The activity of these retrotransposons has been a very significant driver of genome evolution since the evolutionary divergence of the A and B genomes. PMID

  6. SNPs in Multi-Species Conserved Sequences (MCS as useful markers in association studies: a practical approach

    Directory of Open Access Journals (Sweden)

    Pericak-Vance Margaret A

    2007-08-01

    Full Text Available Abstract Background Although genes play a key role in many complex diseases, the specific genes involved in most complex diseases remain largely unidentified. Their discovery will hinge on the identification of key sequence variants that are conclusively associated with disease. While much attention has been focused on variants in protein-coding DNA, variants in noncoding regions may also play many important roles in complex disease by altering gene regulation. Since the vast majority of noncoding genomic sequence is of unknown function, this increases the challenge of identifying "functional" variants that cause disease. However, evolutionary conservation can be used as a guide to indicate regions of noncoding or coding DNA that are likely to have biological function, and thus may be more likely to harbor SNP variants with functional consequences. To help bias marker selection in favor of such variants, we devised a process that prioritizes annotated SNPs for genotyping studies based on their location within Multi-species Conserved Sequences (MCSs and used this process to select SNPs in a region of linkage to a complex disease. This allowed us to evaluate the utility of the chosen SNPs for further association studies. Previously, a region of chromosome 1q43 was linked to Multiple Sclerosis (MS in a genome-wide screen. We chose annotated SNPs in the region based on location within MCSs (termed MCS-SNPs. We then obtained genotypes for 478 MCS-SNPs in 989 individuals from MS families. Results Analysis of our MCS-SNP genotypes from the 1q43 region and comparison to HapMap data confirmed that annotated SNPs in MCS regions are frequently polymorphic and show subtle signatures of selective pressure, consistent with previous reports of genome-wide variation in conserved regions. We also present an online tool that allows MCS data to be directly exported to the UCSC genome browser so that MCS-SNPs can be easily identified within genomic regions of

  7. Structural proteomics of minimal organisms: conservation ofprotein fold usage and evolutionary implications

    Energy Technology Data Exchange (ETDEWEB)

    Chandonia, John-Marc; Kim, Sung-Hou

    2006-03-15

    Background: Determining the complete repertoire of proteinstructures for all soluble, globular proteins in a single organism hasbeen one of the major goals of several structural genomics projects inrecent years. Results: We report that this goal has nearly been reachedfor several "minimal organisms"--parasites or symbionts with reducedgenomes--for which over 95 percent of the soluble, globular proteins maynow be assigned folds, overall 3-D backbone structures. We analyze thestructures of these proteins as they relate to cellular functions, andcompare conservation off old usage between functional categories. We alsocompare patterns in the conservation off olds among minimal organisms andthose observed between minimal organisms and other bacteria. Conclusion:We find that proteins performing essential cellular functions closelyrelated to transcription and translation exhibit a higher degree ofconservation in fold usage than proteins in other functional categories.Folds related to transcription and translation functional categories werealso over represented in minimal organisms compared to otherbacteria.

  8. Evolutionary history and phylogenetic relationship between Auxis thazard and Auxis rochei inferred from COI sequences of mtDNA.

    Science.gov (United States)

    Kumar, Girish; Kunal, Swaraj Priyaranjan; Shyama, S K

    2013-01-01

    Tunas of the genus Auxis are cosmopolitan species and the smallest members of the tribe Thunnini, the true tunas. In the present study, COI sequences of mtDNA were employed to examine the evolutionary history and phylogenetic relationship between A. thazard and A. rochei. A total of 29 COI sequences were retrieved from NCBI. Historic demographic analyses of sequence data showed that A. thazard has undergone sudden population expansion in the past while population size of A. rochei has been remain constant for long period. Non-significant value of Tajimas's D (P = 0.22400) and Fu's FS (P = 0.21400) test fail to reject the null hypothesis of neutral evolution for A. rochei. Phylogenetic analyses of nucleotide sequences demonstrated separate clusters for both species and are strongly supported by 98% bootstrap value. The results of the present study suggest the recent founding of A. thazard in world ocean while A. rochei represents the ancestral species.

  9. T-cell recognition is shaped by epitope sequence conservation in the host proteome and microbiome

    DEFF Research Database (Denmark)

    Bresciani, Anne Gøther; Paul, Sinu; Schommer, Nina

    2016-01-01

    or allergen with the conservation of its sequence in the human proteome or the healthy human microbiome. Indeed, performing such comparisons on large sets of validated T-cell epitopes, we found that epitopes that are similar with self-antigens above a certain threshold showed lower immunogenicity, presumably...... as a result of negative selection of T cells capable of recognizing such peptides. Moreover, we also found a reduced level of immune recognition for epitopes conserved in the commensal microbiome, presumably as a result of peripheral tolerance. These findings indicate that the existence (and potentially...

  10. Purifying Selection in Deeply Conserved Human Enhancers Is More Consistent than in Coding Sequences

    Science.gov (United States)

    De Silva, Dilrini R.; Nichols, Richard; Elgar, Greg

    2014-01-01

    Comparison of polymorphism at synonymous and non-synonymous sites in protein-coding DNA can provide evidence for selective constraint. Non-coding DNA that forms part of the regulatory landscape presents more of a challenge since there is not such a clear-cut distinction between sites under stronger and weaker selective constraint. Here, we consider putative regulatory elements termed Conserved Non-coding Elements (CNEs) defined by their high level of sequence identity across all vertebrates. Some mutations in these regions have been implicated in developmental disorders; we analyse CNE polymorphism data to investigate whether such deleterious effects are widespread in humans. Single nucleotide variants from the HapMap and 1000 Genomes Projects were mapped across nearly 2000 CNEs. In the 1000 Genomes data we find a significant excess of rare derived alleles in CNEs relative to coding sequences; this pattern is absent in HapMap data, apparently obscured by ascertainment bias. The distribution of polymorphism within CNEs is not uniform; we could identify two categories of sites by exploiting deep vertebrate alignments: stretches that are non-variant, and those that have at least one substitution. The conserved category has fewer polymorphic sites and a greater excess of rare derived alleles, which can be explained by a large proportion of sites under strong purifying selection within humans – higher than that for non-synonymous sites in most protein coding regions, and comparable to that at the strongly conserved trans-dev genes. Conversely, the more evolutionarily labile CNE sites have an allele frequency distribution not significantly different from non-synonymous sites. Future studies should exploit genome-wide re-sequencing to obtain better coverage in selected non-coding regions, given the likelihood that mutations in evolutionarily conserved enhancer sequences are deleterious. Discovery pipelines should validate non-coding variants to aid in identifying causal

  11. Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata

    Directory of Open Access Journals (Sweden)

    Yu Huaping

    2010-07-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play a critical role in post-transcriptional gene regulation and have been shown to control many genes involved in various biological and metabolic processes. There have been extensive studies to discover miRNAs and analyze their functions in model plant species, such as Arabidopsis and rice. Deep sequencing technologies have facilitated identification of species-specific or lowly expressed as well as conserved or highly expressed miRNAs in plants. Results In this research, we used Solexa sequencing to discover new microRNAs in trifoliate orange (Citrus trifoliata which is an important rootstock of citrus. A total of 13,106,753 reads representing 4,876,395 distinct sequences were obtained from a short RNA library generated from small RNA extracted from C. trifoliata flower and fruit tissues. Based on sequence similarity and hairpin structure prediction, we found that 156,639 reads representing 63 sequences from 42 highly conserved miRNA families, have perfect matches to known miRNAs. We also identified 10 novel miRNA candidates whose precursors were all potentially generated from citrus ESTs. In addition, five miRNA* sequences were also sequenced. These sequences had not been earlier described in other plant species and accumulation of the 10 novel miRNAs were confirmed by qRT-PCR analysis. Potential target genes were predicted for most conserved and novel miRNAs. Moreover, four target genes including one encoding IRX12 copper ion binding/oxidoreductase and three genes encoding NB-LRR disease resistance protein have been experimentally verified by detection of the miRNA-mediated mRNA cleavage in C. trifoliata. Conclusion Deep sequencing of short RNAs from C. trifoliata flowers and fruits identified 10 new potential miRNAs and 42 highly conserved miRNA families, indicating that specific miRNAs exist in C. trifoliata. These results show that regulatory miRNAs exist in agronomically important trifoliate orange

  12. Evolutionary dynamics of microsatellite distribution in plants: insight from the comparison of sequenced brassica, Arabidopsis and other angiosperm species.

    Science.gov (United States)

    Shi, Jiaqin; Huang, Shunmou; Fu, Donghui; Yu, Jinyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

    2013-01-01

    Despite their ubiquity and functional importance, microsatellites have been largely ignored in comparative genomics, mostly due to the lack of genomic information. In the current study, microsatellite distribution was characterized and compared in the whole genomes and both the coding and non-coding DNA sequences of the sequenced Brassica, Arabidopsis and other angiosperm species to investigate their evolutionary dynamics in plants. The variation in the microsatellite frequencies of these angiosperm species was much smaller than those for their microsatellite numbers and genome sizes, suggesting that microsatellite frequency may be relatively stable in plants. The microsatellite frequencies of these angiosperm species were significantly negatively correlated with both their genome sizes and transposable elements contents. The pattern of microsatellite distribution may differ according to the different genomic regions (such as coding and non-coding sequences). The observed differences in many important microsatellite characteristics (especially the distribution with respect to motif length, type and repeat number) of these angiosperm species were generally accordant with their phylogenetic distance, which suggested that the evolutionary dynamics of microsatellite distribution may be generally consistent with plant divergence/evolution. Importantly, by comparing these microsatellite characteristics (especially the distribution with respect to motif type) the angiosperm species (aside from a few species) all clustered into two obviously different groups that were largely represented by monocots and dicots, suggesting a complex and generally dichotomous evolutionary pattern of microsatellite distribution in angiosperms. Polyploidy may lead to a slight increase in microsatellite frequency in the coding sequences and a significant decrease in microsatellite frequency in the whole genome/non-coding sequences, but have little effect on the microsatellite distribution with

  13. Evolutionary dynamics of microsatellite distribution in plants: insight from the comparison of sequenced brassica, Arabidopsis and other angiosperm species.

    Directory of Open Access Journals (Sweden)

    Jiaqin Shi

    Full Text Available Despite their ubiquity and functional importance, microsatellites have been largely ignored in comparative genomics, mostly due to the lack of genomic information. In the current study, microsatellite distribution was characterized and compared in the whole genomes and both the coding and non-coding DNA sequences of the sequenced Brassica, Arabidopsis and other angiosperm species to investigate their evolutionary dynamics in plants. The variation in the microsatellite frequencies of these angiosperm species was much smaller than those for their microsatellite numbers and genome sizes, suggesting that microsatellite frequency may be relatively stable in plants. The microsatellite frequencies of these angiosperm species were significantly negatively correlated with both their genome sizes and transposable elements contents. The pattern of microsatellite distribution may differ according to the different genomic regions (such as coding and non-coding sequences. The observed differences in many important microsatellite characteristics (especially the distribution with respect to motif length, type and repeat number of these angiosperm species were generally accordant with their phylogenetic distance, which suggested that the evolutionary dynamics of microsatellite distribution may be generally consistent with plant divergence/evolution. Importantly, by comparing these microsatellite characteristics (especially the distribution with respect to motif type the angiosperm species (aside from a few species all clustered into two obviously different groups that were largely represented by monocots and dicots, suggesting a complex and generally dichotomous evolutionary pattern of microsatellite distribution in angiosperms. Polyploidy may lead to a slight increase in microsatellite frequency in the coding sequences and a significant decrease in microsatellite frequency in the whole genome/non-coding sequences, but have little effect on the microsatellite

  14. Evolutionary Dynamics of Microsatellite Distribution in Plants: Insight from the Comparison of Sequenced Brassica, Arabidopsis and Other Angiosperm Species

    Science.gov (United States)

    Shi, Jiaqin; Huang, Shunmou; Fu, Donghui; Yu, Jinyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

    2013-01-01

    Despite their ubiquity and functional importance, microsatellites have been largely ignored in comparative genomics, mostly due to the lack of genomic information. In the current study, microsatellite distribution was characterized and compared in the whole genomes and both the coding and non-coding DNA sequences of the sequenced Brassica, Arabidopsis and other angiosperm species to investigate their evolutionary dynamics in plants. The variation in the microsatellite frequencies of these angiosperm species was much smaller than those for their microsatellite numbers and genome sizes, suggesting that microsatellite frequency may be relatively stable in plants. The microsatellite frequencies of these angiosperm species were significantly negatively correlated with both their genome sizes and transposable elements contents. The pattern of microsatellite distribution may differ according to the different genomic regions (such as coding and non-coding sequences). The observed differences in many important microsatellite characteristics (especially the distribution with respect to motif length, type and repeat number) of these angiosperm species were generally accordant with their phylogenetic distance, which suggested that the evolutionary dynamics of microsatellite distribution may be generally consistent with plant divergence/evolution. Importantly, by comparing these microsatellite characteristics (especially the distribution with respect to motif type) the angiosperm species (aside from a few species) all clustered into two obviously different groups that were largely represented by monocots and dicots, suggesting a complex and generally dichotomous evolutionary pattern of microsatellite distribution in angiosperms. Polyploidy may lead to a slight increase in microsatellite frequency in the coding sequences and a significant decrease in microsatellite frequency in the whole genome/non-coding sequences, but have little effect on the microsatellite distribution with

  15. Detecting evolutionary strata on the human x chromosome in the absence of gametologous y-linked sequences.

    Science.gov (United States)

    Pandey, Ravi Shanker; Wilson Sayres, Melissa A; Azad, Rajeev K

    2013-01-01

    Mammalian sex chromosomes arose from a pair of homologous autosomes that differentiated into the X and Y chromosomes following a series of recombination suppression events between the X and Y. The stepwise recombination suppressions from the distal long arm to the distal short arm of the chromosomes are reflected as regions with distinct X-Y divergence, referred to as evolutionary strata on the X. All current methods for stratum detection depend on X-Y comparisons but are severely limited by the paucity of X-Y gametologs. We have developed an integrative method that combines a top-down, recursive segmentation algorithm with a bottom-up, agglomerative clustering algorithm to decipher compositionally distinct regions on the X, which reflect regions of unique X-Y divergence. In application to human X chromosome, our method correctly classified a concatenated set of 35 previously assayed X-linked gene sequences by evolutionary strata. We then extended our analysis, applying this method to the entire sequence of the human X chromosome, in an effort to define stratum boundaries. The boundaries of more recently formed strata on X-added region, namely the fourth and fifth strata, have been defined by previous studies and are recapitulated with our method. The older strata, from the first up to the third stratum, have remained poorly resolved due to paucity of X-Y gametologs. By analyzing the entire X sequence, our method identified seven evolutionary strata in these ancient regions, where only three could previously be assayed, thus demonstrating the robustness of our method in detecting the evolutionary strata.

  16. Identification of conserved and novel microRNAs in the Pacific oyster Crassostrea gigas by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Fei Xu

    Full Text Available MicroRNAs (miRNAs play important roles in regulatory processes in various organisms. To date many studies have been performed in the investigation of miRNAs of numerous bilaterians, but limited numbers of miRNAs have been identified in the few species belonging to the clade Lophotrochozoa. In the current study, deep sequencing was conducted to identify the miRNAs of Crassostrea gigas (Lophotrochozoa at a genomic scale, using 21 libraries that included different developmental stages and adult organs. A total of 100 hairpin precursor loci were predicted to encode miRNAs. Of these, 19 precursors (pre-miRNA were novel in the oyster. As many as 53 (53% miRNAs were distributed in clusters and 49 (49% precursors were intragenic, which suggests two important biogenetic sources of miRNAs. Different developmental stages were characterized with specific miRNA expression patterns that highlighted regulatory variation along a temporal axis. Conserved miRNAs were expressed universally throughout different stages and organs, whereas novel miRNAs tended to be more specific and may be related to the determination of the novel body plan. Furthermore, we developed an index named the miRNA profile age index (miRPAI to integrate the evolutionary age and expression levels of miRNAs during a particular developmental stage. We found that the swimming stages were characterized by the youngest miRPAIs. Indeed, the large-scale expression of novel miRNAs indicated the importance of these stages during development, particularly from organogenetic and evolutionary perspectives. Some potentially important miRNAs were identified for further study through significant changes between expression patterns in different developmental events, such as metamorphosis. This study broadened the knowledge of miRNAs in animals and indicated the presence of sophisticated miRNA regulatory networks related to the biological processes in lophotrochozoans.

  17. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Science.gov (United States)

    Capra, John A; Paeschke, Katrin; Singh, Mona; Zakian, Virginia A

    2010-07-22

    G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs) across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs). Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  18. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  19. Evolutionary conserved mechanisms pervade structure and transcriptional modulation of allograft inflammatory factor-1 from sea anemone Anemonia viridis.

    Science.gov (United States)

    Cuttitta, Angela; Ragusa, Maria Antonietta; Costa, Salvatore; Bennici, Carmelo; Colombo, Paolo; Mazzola, Salvatore; Gianguzza, Fabrizio; Nicosia, Aldo

    2017-08-01

    Gene family encoding allograft inflammatory factor-1 (AIF-1) is well conserved among organisms; however, there is limited knowledge in lower organisms. In this study, the first AIF-1 homologue from cnidarians was identified and characterised in the sea anemone Anemonia viridis. The full-length cDNA of AvAIF-1 was of 913 bp with a 5' -untranslated region (UTR) of 148 bp, a 3'-UTR of 315 and an open reading frame (ORF) of 450 bp encoding a polypeptide with149 amino acid residues and predicted molecular weight of about 17 kDa. The predicted protein possesses evolutionary conserved EF hand Ca2+ binding motifs, post-transcriptional modification sites and a 3D structure which can be superimposed with human members of AIF-1 family. The AvAIF-1 transcript was constitutively expressed in all tested tissues of unchallenged sea anemone, suggesting that AvAIF-1 could serve as a general protective factor under normal physiological conditions. Moreover, we profiled the transcriptional activation of AvAIF-1 after challenges with different abiotic/biotic stresses showing induction by warming conditions, heavy metals exposure and immune stimulation. Thus, mechanisms associated to inflammation and immune challenges up-regulated AvAIF-1 mRNA levels. Our results suggest its involvement in the inflammatory processes and immune response of A. viridis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Position and sequence conservation in Amniota of polymorphic enhancer HS1.2 within the palindrome of IgH 3'Regulatory Region

    Directory of Open Access Journals (Sweden)

    Rocchi Mariano

    2011-03-01

    Full Text Available Abstract Background The Immunoglobulin heavy chain (IgH 3' Regulatory Region (3'RR, located at the 3' of the constant alpha gene, plays a crucial role in immunoglobulin production. In humans, there are 2 copies of the 3'RR, each composed of 4 main elements: 3 enhancers and a 20 bp tandem repeat. The single mouse 3'RR differs from the two human ones for the presence of 4 more regulative elements with the double copy of one enhancer at the border of a palindromic region. Results We compared the 3'RR organization in genomes of vertebrates to depict the evolutionary history of the region and highlight its shared features. We found that in the 8 species in which the whole region was included in a fully assembled contig (mouse, rat, dog, rabbit, panda, orangutan, chimpanzee, and human, the shared elements showed synteny and a highly conserved sequence, thus suggesting a strong evolutionary constraint. In these species, the wide 3'RR (~30 kb in human bears a large palindromic sequence, consisting in two ~3 kb complementary branches spaced by a ~3 kb sequence always including the HS1.2 enhancer. In mouse and rat, HS3 is involved by the palindrome so that one copy of the enhancer is present on each side. A second relevant feature of our present work concerns human polymorphism of the HS1.2 enhancer, associated to immune diseases in our species. We detected a similar polymorphism in all the studied Catarrhini (a primate parvorder. The polymorphism consists of multiple copies of a 40 bp element up to 12 in chimpanzees, 8 in baboons, 6 in macaque, 5 in gibbons, 4 in humans and orangutan, separated by stretches of Cytosine. We show specific binding of this element to nuclear factors. Conclusions The nucleotide sequence of the palindrome is not conserved among evolutionary distant species, suggesting pressures for the maintenance of two self-matching regions driving a three-dimensional structure despite of the inter-specific divergence at sequence level. The

  1. Position and sequence conservation in Amniota of polymorphic enhancer HS1.2 within the palindrome of IgH 3'Regulatory Region.

    Science.gov (United States)

    D'Addabbo, Pietro; Scascitelli, Moira; Giambra, Vincenzo; Rocchi, Mariano; Frezza, Domenico

    2011-03-15

    The Immunoglobulin heavy chain (IgH) 3' Regulatory Region (3'RR), located at the 3' of the constant alpha gene, plays a crucial role in immunoglobulin production. In humans, there are 2 copies of the 3'RR, each composed of 4 main elements: 3 enhancers and a 20 bp tandem repeat. The single mouse 3'RR differs from the two human ones for the presence of 4 more regulative elements with the double copy of one enhancer at the border of a palindromic region. We compared the 3'RR organization in genomes of vertebrates to depict the evolutionary history of the region and highlight its shared features. We found that in the 8 species in which the whole region was included in a fully assembled contig (mouse, rat, dog, rabbit, panda, orangutan, chimpanzee, and human), the shared elements showed synteny and a highly conserved sequence, thus suggesting a strong evolutionary constraint. In these species, the wide 3'RR (~30 kb in human) bears a large palindromic sequence, consisting in two ~3 kb complementary branches spaced by a ~3 kb sequence always including the HS1.2 enhancer. In mouse and rat, HS3 is involved by the palindrome so that one copy of the enhancer is present on each side. A second relevant feature of our present work concerns human polymorphism of the HS1.2 enhancer, associated to immune diseases in our species. We detected a similar polymorphism in all the studied Catarrhini (a primate parvorder). The polymorphism consists of multiple copies of a 40 bp element up to 12 in chimpanzees, 8 in baboons, 6 in macaque, 5 in gibbons, 4 in humans and orangutan, separated by stretches of Cytosine. We show specific binding of this element to nuclear factors. The nucleotide sequence of the palindrome is not conserved among evolutionary distant species, suggesting pressures for the maintenance of two self-matching regions driving a three-dimensional structure despite of the inter-specific divergence at sequence level. The information about the conservation of the palindromic

  2. Antibodies directed against monomorphic and evolutionary conserved self epitopes may be generated in 'knock-out' mice. Development of monoclonal antibodies directed against monomorphic MHC class I determinants

    DEFF Research Database (Denmark)

    Claesson, M H; Endel, B; Ulrik, J

    1994-01-01

    of culture. It is concluded that MoAbs reacting with monomorphic self epitopes may be generated using animals deleted of the gene of interest. The implications may be far reaching since such MoAbs potentially identify evolutionary conserved and physiologically important epitopes....

  3. Evolutionary Conservation and Diversification of the Translation Initiation Apparatus in Trypanosomatids

    Directory of Open Access Journals (Sweden)

    Alexandra Zinoviev

    2012-01-01

    Full Text Available Trypanosomatids are ancient eukaryotic parasites that migrate between insect vectors and mammalian hosts, causing a range of diseases in humans and domestic animals. Trypanosomatids feature a multitude of unusual molecular features, including polycistronic transcription and subsequent processing by trans-splicing and polyadenylation. Regulation of protein coding genes is posttranscriptional and thus, translation regulation is fundamental for activating the developmental program of gene expression. The spliced-leader RNA is attached to all mRNAs. It contains an unusual hypermethylated cap-4 structure in its 5 end. The cap-binding complex, eIF4F, has gone through evolutionary changes in accordance with the requirement to bind cap-4. The eIF4F components in trypanosomatids are highly diverged from their orthologs in higher eukaryotes, and their potential functions are discussed. The cap-binding activity in all eukaryotes is a target for regulation and plays a similar role in trypanosomatids. Recent studies revealed a novel eIF4E-interacting protein, involved in directing stage-specific and stress-induced translation pathways. Translation regulation during stress also follows unusual regulatory cues, as the increased translation of Hsp83 following heat stress is driven by a defined element in the 3 UTR, unlike higher eukaryotes. Overall, the environmental switches experienced by trypanosomatids during their life cycle seem to affect their translational machinery in unique ways.

  4. Phylogeography of Camellia taliensis (Theaceae inferred from chloroplast and nuclear DNA: insights into evolutionary history and conservation

    Directory of Open Access Journals (Sweden)

    Liu Yang

    2012-06-01

    Full Text Available Abstract Background As one of the most important but seriously endangered wild relatives of the cultivated tea, Camellia taliensis harbors valuable gene resources for tea tree improvement in the future. The knowledge of genetic variation and population structure may provide insights into evolutionary history and germplasm conservation of the species. Results Here, we sampled 21 natural populations from the species' range in China and performed the phylogeography of C. taliensis by using the nuclear PAL gene fragment and chloroplast rpl32-trnL intergenic spacer. Levels of haplotype diversity and nucleotide diversity detected at rpl32-trnL (h = 0.841; π = 0.00314 were almost as high as at PAL (h = 0.836; π = 0.00417. Significant chloroplast DNA population subdivision was detected (GST = 0.988; NST = 0.989, suggesting fairly high genetic differentiation and low levels of recurrent gene flow through seeds among populations. Nested clade phylogeographic analysis of chlorotypes suggests that population genetic structure in C. taliensis has been affected by habitat fragmentation in the past. However, the detection of a moderate nrDNA population subdivision (GST = 0.222; NST = 0.301 provided the evidence of efficient pollen-mediated gene flow among populations and significant phylogeographical structure (NST > GST; P PAL haplotypes indicates that phylogeographical pattern of nrDNA haplotypes might be caused by restricted gene flow with isolation by distance, which was also supported by Mantel’s test of nrDNA haplotypes (r = 0.234, P  Conclusions We found that C. taliensis showed fairly high genetic differentiation resulting from restricted gene flow and habitat fragmentation. This phylogeographical study gives us deep insights into population structure of the species and conservation strategies for germplasm sampling and developing in situ conservation of natural populations.

  5. Conservation and divergence of plant LHP1 protein sequences and expression patterns in angiosperms and gymnosperms.

    Science.gov (United States)

    Guan, Hexin; Zheng, Zhengui; Grey, Paris H; Li, Yuhua; Oppenheimer, David G

    2011-05-01

    Floral transition is a critical and strictly regulated developmental process in plants. Mutations in Arabidopsis LIKE HETEROCHROMATIN PROTEIN 1 (AtLHP1)/TERMINAL FLOWER 2 (TFL2) result in early and terminal flowers. Little is known about the gene expression, function and evolution of plant LHP1 homologs, except for Arabidopsis LHP1. In this study, the conservation and divergence of plant LHP1 protein sequences was analyzed by sequence alignments and phylogeny. LHP1 expression patterns were compared among taxa that occupy pivotal phylogenetic positions. Several relatively conserved new motifs/regions were identified among LHP1 homologs. Phylogeny of plant LHP1 proteins agreed with established angiosperm relationships. In situ hybridization unveiled conserved expression of plant LHP1 in the axillary bud/tiller, vascular bundles, developing stamens, and carpels. Unlike AtLHP1, cucumber CsLHP1-2, sugarcane SoLHP1 and maize ZmLHP1, rice OsLHP1 is not expressed in the shoot apical meristem (SAM) and the OsLHP1 transcript level is consistently low in shoots. "Unequal crossover" might have contributed to the divergence in the N-terminal and hinge region lengths of LHP1 homologs. We propose an "insertion-deletion" model for soybean (Glycine max L.) GmLHP1s evolution. Plant LHP1 homologs are more conserved than previously expected, and may favor vegetative meristem identity and primordia formation. OsLHP1 may not function in rice SAM during floral induction.

  6. Functional analysis of COP1 and SPA orthologs from Physcomitrella and rice during photomorphogenesis of transgenic Arabidopsis reveals distinct evolutionary conservation.

    Science.gov (United States)

    Ranjan, Aashish; Dickopf, Stephen; Ullrich, Kristian K; Rensing, Stefan A; Hoecker, Ute

    2014-07-01

    Plants have evolved light sensing mechanisms to optimally adapt their growth and development to the ambient light environment. The COP1/SPA complex is a key negative regulator of light signaling in the well-studied dicot Arabidopsis thaliana. COP1 and members of the four SPA proteins are part of an E3 ubiquitin ligase that acts in darkness to ubiquitinate several transcription factors involved in light responses, thereby targeting them for degradation by the proteasome. While COP1 is also found in humans, SPA proteins appear specific to plants. Here, we have functionally addressed evolutionary conservation of COP1 and SPA orthologs from the moss Physcomitrella, the monocot rice and the dicot Arabidopsis. To this end, we analyzed the activities of COP1- and SPA-like proteins from Physcomitrella patens and rice when expressed in Arabidopsis. Expression of rice COP1 and Physcomitrella COP1 protein sequences predominantly complemented all phenotypic aspects of the viable, hypomorphic cop1-4 mutant and the null, seedling-lethal cop1-5 mutant of Arabidopsis: rice COP1 fully rescued the constitutive-photomorphogenesis phenotype in darkness and the leaf expansion defect of cop1 mutants, while it partially restored normal photoperiodic flowering in cop1. Physcomitrella COP1 partially restored normal seedling growth and flowering time, while it fully restored normal leaf expansion in the cop1 mutants. In contrast, expression of a SPA ortholog from Physcomitrella (PpSPAb) in Arabidopsis spa mutants did not rescue any facet of the spa mutant phenotype, suggesting that the PpSPAb protein is not functionally conserved or that the Arabidopsis function evolved after the split of mosses and seed plants. The SPA1 ortholog from rice (OsSPA1) rescued the spa mutant phenotype in dark-grown seedlings, but did not complement any spa mutant phenotype in light-grown seedlings or in adult plants. Our results show that COP1 protein sequences from Physcomitrella, rice and Arabidopsis have

  7. Functional analysis of COP1 and SPA orthologs from Physcomitrella and rice during photomorphogenesis of transgenic Arabidopsis reveals distinct evolutionary conservation

    Science.gov (United States)

    2014-01-01

    Background Plants have evolved light sensing mechanisms to optimally adapt their growth and development to the ambient light environment. The COP1/SPA complex is a key negative regulator of light signaling in the well-studied dicot Arabidopsis thaliana. COP1 and members of the four SPA proteins are part of an E3 ubiquitin ligase that acts in darkness to ubiquitinate several transcription factors involved in light responses, thereby targeting them for degradation by the proteasome. While COP1 is also found in humans, SPA proteins appear specific to plants. Here, we have functionally addressed evolutionary conservation of COP1 and SPA orthologs from the moss Physcomitrella, the monocot rice and the dicot Arabidopsis. Results To this end, we analyzed the activities of COP1- and SPA-like proteins from Physcomitrella patens and rice when expressed in Arabidopsis. Expression of rice COP1 and Physcomitrella COP1 protein sequences predominantly complemented all phenotypic aspects of the viable, hypomorphic cop1-4 mutant and the null, seedling-lethal cop1-5 mutant of Arabidopsis: rice COP1 fully rescued the constitutive-photomorphogenesis phenotype in darkness and the leaf expansion defect of cop1 mutants, while it partially restored normal photoperiodic flowering in cop1. Physcomitrella COP1 partially restored normal seedling growth and flowering time, while it fully restored normal leaf expansion in the cop1 mutants. In contrast, expression of a SPA ortholog from Physcomitrella (PpSPAb) in Arabidopsis spa mutants did not rescue any facet of the spa mutant phenotype, suggesting that the PpSPAb protein is not functionally conserved or that the Arabidopsis function evolved after the split of mosses and seed plants. The SPA1 ortholog from rice (OsSPA1) rescued the spa mutant phenotype in dark-grown seedlings, but did not complement any spa mutant phenotype in light-grown seedlings or in adult plants. Conclusion Our results show that COP1 protein sequences from Physcomitrella

  8. Mitogenome sequencing reveals shallow evolutionary histories and recent divergence time between morphologically and ecologically distinct European whitefish (Coregonus spp.)

    DEFF Research Database (Denmark)

    Jacobsen, Magnus W.; Hansen, Michael Møller; Orlando, Ludovic

    2012-01-01

    an alternate use of such data to recover relationships and population history of closely related lineages with a shallow evolutionary history. Using a GS-FLX platform, we sequenced 106 mitogenomes from the Coregonus lavaretus (Europe) and Coregonus clupeaformis (North America) species complexes to investigate...... the evolutionary history of the endangered Danish North Sea houting (NSH) and other closely related Danish and Baltic European lake whitefish (ELW). Two well-supported clades were found within both ELW and NSH, probably reflecting historical introgression via Baltic migrants. Although ELW and NSH......-dependency effects. The estimate of c. 2700 bp was remarkably similar to results obtained using microsatellite markers. Within North American C. clupeaformis, the divergence time between the two lineages (Atlantic and Acadian) was estimated as between 20 000 and 60 000 bp. Under the assumption that NSH and ELW...

  9. Consistent levels of A-to-I RNA editing across individuals in coding sequences and non-conserved Alu repeats

    Directory of Open Access Journals (Sweden)

    Osenberg Sivan

    2010-10-01

    Full Text Available Abstract Background Adenosine to inosine (A-to-I RNA-editing is an essential post-transcriptional mechanism that occurs in numerous sites in the human transcriptome, mainly within Alu repeats. It has been shown to have consistent levels of editing across individuals in a few targets in the human brain and altered in several human pathologies. However, the variability across human individuals of editing levels in other tissues has not been studied so far. Results Here, we analyzed 32 skin samples, looking at A-to-I editing level in three genes within coding sequences and in the Alu repeats of six different genes. We observed highly consistent editing levels across different individuals as well as across tissues, not only in coding targets but, surprisingly, also in the non evolutionary conserved Alu repeats. Conclusions Our findings suggest that A-to-I RNA-editing of Alu elements is a tightly regulated process and, as such, might have been recruited in the course of primate evolution for post-transcriptional regulatory mechanisms.

  10. Conserved Units of Co-Expression in Bacterial Genomes: An Evolutionary Insight into Transcriptional Regulation

    Science.gov (United States)

    Junier, Ivan; Rivoire, Olivier

    2016-01-01

    Genome-wide measurements of transcriptional activity in bacteria indicate that the transcription of successive genes is strongly correlated beyond the scale of operons. Here, we analyze hundreds of bacterial genomes to identify supra-operonic segments of genes that are proximal in a large number of genomes. We show that these synteny segments correspond to genomic units of strong transcriptional co-expression. Structurally, the segments contain operons with specific relative orientations (co-directional or divergent) and nucleoid-associated proteins are found to bind at their boundaries. Functionally, operons inside a same segment are highly co-expressed even in the apparent absence of regulatory factors at their promoter regions. Remote operons along DNA can also be co-expressed if their corresponding segments share a transcriptional or sigma factor, without requiring these factors to bind directly to the promoters of the operons. As evidence that these results apply across the bacterial kingdom, we demonstrate them both in the Gram-negative bacterium Escherichia coli and in the Gram-positive bacterium Bacillus subtilis. The underlying process that we propose involves only RNA-polymerases and DNA: it implies that the transcription of an operon mechanically enhances the transcription of adjacent operons. In support of a primary role of this regulation by facilitated co-transcription, we show that the transcription en bloc of successive operons as a result of transcriptional read-through is strongly and specifically enhanced in synteny segments. Finally, our analysis indicates that facilitated co-transcription may be evolutionary primitive and may apply beyond bacteria. PMID:27195891

  11. An Evolutionary-Conserved Function of Mammalian Notch Family Members as Cell Adhesion Molecules

    Science.gov (United States)

    Murata, Akihiko; Yoshino, Miya; Hikosaka, Mari; Okuyama, Kazuki; Zhou, Lan; Sakano, Seiji; Yagita, Hideo; Hayashi, Shin-Ichi

    2014-01-01

    Notch family members were first identified as cell adhesion molecules by cell aggregation assays in Drosophila studies. However, they are generally recognized as signaling molecules, and it was unclear if their adhesion function was restricted to Drosophila. We previously demonstrated that a mouse Notch ligand, Delta-like 1 (Dll1) functioned as a cell adhesion molecule. We here investigated whether this adhesion function was conserved in the diversified mammalian Notch ligands consisted of two families, Delta-like (Dll1, Dll3 and Dll4) and Jagged (Jag1 and Jag2). The forced expression of mouse Dll1, Dll4, Jag1, and Jag2, but not Dll3, on stromal cells induced the rapid and enhanced adhesion of cultured mast cells (MCs). This was attributed to the binding of Notch1 and Notch2 on MCs to each Notch ligand on the stromal cells themselves, and not the activation of Notch signaling. Notch receptor-ligand binding strongly supported the tethering of MCs to stromal cells, the first step of cell adhesion. However, the Jag2-mediated adhesion of MCs was weaker and unlike other ligands appeared to require additional factor(s) in addition to the receptor-ligand binding. Taken together, these results demonstrated that the function of cell adhesion was conserved in mammalian as well as Drosophila Notch family members. Since Notch receptor-ligand interaction plays important roles in a broad spectrum of biological processes ranging from embryogenesis to disorders, our finding will provide a new perspective on these issues from the aspect of cell adhesion. PMID:25255288

  12. Improved Hidden Markov Model training for multiple sequence alignment by a particle swarm optimization-evolutionary algorithm hybrid.

    Science.gov (United States)

    Rasmussen, Thomas Kiel; Krink, Thiemo

    2003-11-01

    Multiple sequence alignment (MSA) is one of the basic problems in computational biology. Realistic problem instances of MSA are computationally intractable for exact algorithms. One way to tackle MSA is to use Hidden Markov Models (HMMs), which are known to be very powerful in the related problem domain of speech recognition. However, the training of HMMs is computationally hard and there is no known exact method that can guarantee optimal training within reasonable computing time. Perhaps the most powerful training method is the Baum-Welch algorithm, which is fast, but bears the problem of stagnation at local optima. In the study reported in this paper, we used a hybrid algorithm combining particle swarm optimization with evolutionary algorithms to train HMMs for the alignment of protein sequences. Our experiments show that our approach yields better alignments for a set of benchmark protein sequences than the most commonly applied HMM training methods, such as Baum-Welch and Simulated Annealing.

  13. Comparative analysis of function and interaction of transcription factors in nematodes: Extensive conservation of orthology coupled to rapid sequence evolution

    Directory of Open Access Journals (Sweden)

    Singh Rama S

    2008-08-01

    Full Text Available Abstract Background Much of the morphological diversity in eukaryotes results from differential regulation of gene expression in which transcription factors (TFs play a central role. The nematode Caenorhabditis elegans is an established model organism for the study of the roles of TFs in controlling the spatiotemporal pattern of gene expression. Using the fully sequenced genomes of three Caenorhabditid nematode species as well as genome information from additional more distantly related organisms (fruit fly, mouse, and human we sought to identify orthologous TFs and characterized their patterns of evolution. Results We identified 988 TF genes in C. elegans, and inferred corresponding sets in C. briggsae and C. remanei, containing 995 and 1093 TF genes, respectively. Analysis of the three gene sets revealed 652 3-way reciprocal 'best hit' orthologs (nematode TF set, approximately half of which are zinc finger (ZF-C2H2 and ZF-C4/NHR types and HOX family members. Examination of the TF genes in C. elegans and C. briggsae identified the presence of significant tandem clustering on chromosome V, the majority of which belong to ZF-C4/NHR family. We also found evidence for lineage-specific duplications and rapid evolution of many of the TF genes in the two species. A search of the TFs conserved among nematodes in Drosophila melanogaster, Mus musculus and Homo sapiens revealed 150 reciprocal orthologs, many of which are associated with important biological processes and human diseases. Finally, a comparison of the sequence, gene interactions and function indicates that nematode TFs conserved across phyla exhibit significantly more interactions and are enriched in genes with annotated mutant phenotypes compared to those that lack orthologs in other species. Conclusion Our study represents the first comprehensive genome-wide analysis of TFs across three nematode species and other organisms. The findings indicate substantial conservation of transcription

  14. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    Energy Technology Data Exchange (ETDEWEB)

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole

    2005-09-10

    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  15. Whole genome sequencing and evolutionary analysis of human respiratory syncytial virus A and B from Milwaukee, WI 1998-2010.

    Directory of Open Access Journals (Sweden)

    Cecilia Rebuffo-Scheer

    Full Text Available BACKGROUND: Respiratory Syncytial Virus (RSV is the leading cause of lower respiratory-tract infections in infants and young children worldwide. Despite this, only six complete genome sequences of original strains have been previously published, the most recent of which dates back 35 and 26 years for RSV group A and group B respectively. METHODOLOGY/PRINCIPAL FINDINGS: We present a semi-automated sequencing method allowing for the sequencing of four RSV whole genomes simultaneously. We were able to sequence the complete coding sequences of 13 RSV A and 4 RSV B strains from Milwaukee collected from 1998-2010. Another 12 RSV A and 5 RSV B strains sequenced in this study cover the majority of the genome. All RSV A and RSV B sequences were analyzed by neighbor-joining, maximum parsimony and Bayesian phylogeny methods. Genetic diversity was high among RSV A viruses in Milwaukee including the circulation of multiple genotypes (GA1, GA2, GA5, GA7 with GA2 persisting throughout the 13 years of the study. However, RSV B genomes showed little variation with all belonging to the BA genotype. For RSV A, the same evolutionary patterns and clades were seen consistently across the whole genome including all intergenic, coding, and non-coding regions sequences. CONCLUSIONS/SIGNIFICANCE: The sequencing strategy presented in this work allows for RSV A and B genomes to be sequenced simultaneously in two working days and with a low cost. We have significantly increased the amount of genomic data that is available for both RSV A and B, providing the basic molecular characteristics of RSV strains circulating in Milwaukee over the last 13 years. This information can be used for comparative analysis with strains circulating in other communities around the world which should also help with the development of new strategies for control of RSV, specifically vaccine development and improvement of RSV diagnostics.

  16. A Potential Tool for Swift Fox (Vulpes velox) Conservation: Individuality of Long-Range Barking Sequences

    DEFF Research Database (Denmark)

    Darden, Safi-Kirstine Klem; Dabelsteen, Torben; Pedersen, Simon Boel

    2003-01-01

    Vocal individuality has been found in a number canid species. This natural variation can have applications in several aspects of species conservation, from behavioral studies to estimating population density or abundance. The swift fox (Vulpes velox) is a North American canid listed as endangered...... context from 20 captive individuals (3 females and 17 males) housed in large, single-pair enclosures at a swift fox breeding facility. Using a discriminant function analysis with 7 temporal and spectral variables measured on barking sequences, we were able to correctly classify 99% of sequences...... to the correct individual. The most important discriminating variable was the mean spacing of barks in a barking sequence. Potential applications of such vocal individuality are discussed....

  17. In silico identification of conserved intercoding sequences in Leishmania genomes: unraveling putative cis-regulatory elements.

    Science.gov (United States)

    Vasconcelos, E J R; Terrão, M C; Ruiz, J C; Vêncio, R Z N; Cruz, A K

    2012-06-01

    In silico analyses of Leishmania spp. genome data are a powerful resource to improve the understanding of these pathogens' biology. Trypanosomatids such as Leishmania spp. have their protein-coding genes grouped in long polycistronic units of functionally unrelated genes. The control of gene expression happens by a variety of posttranscriptional mechanisms. The high degree of synteny among Leishmania species is accompanied by highly conserved coding sequences (CDS) and poorly conserved intercoding untranslated sequences. To identify the elements involved in the control of gene expression, we conducted an in silico investigation to find conserved intercoding sequences (CICS) in the genomes of L. major, L. infantum, and L. braziliensis. We used a combination of computational tools, such as Linux-Shell, PERL and R languages, BLAST, MSPcrunch, SSAKE, and Pred-A-Term algorithms to construct a pipeline which was able to: (i) search for conservation in target-regions, (ii) eliminate CICS redundancy and mask repeat elements, (iii) predict the mRNA's extremities, (iv) analyze the distribution of orthologous genes within the generated LeishCICS-clusters, (v) assign GO terms to the LeishCICS-clusters, and (vi) provide statistical support for the gene-enrichment annotation. We associated the LeishCICS-cluster data, generated at the end of the pipeline, with the expression profile of L. donovani genes during promastigote-amastigote differentiation, as previously evaluated by others (GEO accession: GSE21936). A Pearson's correlation coefficient greater than 0.5 was observed for 730 LeishCICS-clusters containing from 2 to 17 genes. The designed computational pipeline is a useful tool and its application identified potential regulatory cis elements and putative regulons in Leishmania. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Evolutionary analysis of two complement C4 genes: Ancient duplication and conservation during jawed vertebrate evolution.

    Science.gov (United States)

    Nonaka, Mayumi I; Terado, Tokio; Kimura, Hiroshi; Nonaka, Masaru

    2017-03-01

    The complement C4 is a thioester-containing protein, and a histidine (H) residue catalyzes the cleavage of the thioester to allow covalent binding to carbohydrates on target cells. Some mammalian and teleost species possess an additional isotype where the catalytic H is replaced by an aspartic acid (D), which binds preferentially to proteins. We found the two C4 isotypes in many other jawed vertebrates, including sharks and birds/reptiles. Phylogenetic analysis suggested that C4 gene duplication occurred in the early days of the jawed vertebrate evolution. The D-type C4 of bony fish except for mammals formed a cluster, termed D-lineage. The D-lineage genes were located in a syntenic region outside MHC, and evolved conservatively. Mammals lost the D-lineage before speciation, but D-type C4 was regenerated by recent gene duplication in some mammalian species or groups. Dual C4 molecules with different substrate specificities would have contributed to development of the antibody-dependent classical pathway. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Evolutionary conservation of a core root microbiome across plant phyla along a tropical soil chronosequence.

    Science.gov (United States)

    Yeoh, Yun Kit; Dennis, Paul G; Paungfoo-Lonhienne, Chanyarat; Weber, Lui; Brackin, Richard; Ragan, Mark A; Schmidt, Susanne; Hugenholtz, Philip

    2017-08-09

    Culture-independent molecular surveys of plant root microbiomes indicate that soil type generally has a stronger influence on microbial communities than host phylogeny. However, these studies have mostly focussed on model plants and crops. Here, we examine the root microbiomes of multiple plant phyla including lycopods, ferns, gymnosperms, and angiosperms across a soil chronosequence using 16S rRNA gene amplicon profiling. We confirm that soil type is the primary determinant of root-associated bacterial community composition, but also observe a significant correlation with plant phylogeny. A total of 47 bacterial genera are associated with roots relative to bulk soil microbial communities, including well-recognized plant-associated genera such as Bradyrhizobium, Rhizobium, and Burkholderia, and major uncharacterized lineages such as WPS-2, Ellin329, and FW68. We suggest that these taxa collectively constitute an evolutionarily conserved core root microbiome at this site. This lends support to the inference that a core root microbiome has evolved with terrestrial plants over their 400 million year history.Yeoh et al. study root microbiomes of different plant phyla across a tropical soil chronosequence. They confirm that soil type is the primary determinant of root-associated bacterial communities, but also observe a clear correlation with plant phylogeny and define a core root microbiome at this site.

  20. Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris).

    Science.gov (United States)

    Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong

    2006-08-01

    Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.

  1. Evolutionary Genomics and Conservation of the Endangered Przewalski’s Horse

    DEFF Research Database (Denmark)

    Der Sarkissian, Clio; Ermini, Luca; Schubert, Mikkel

    2015-01-01

    and short legs, they are phenotypically and behaviorally distinct from domesticated horses (DHs, Equus caballus). Here, we sequenced the complete genomes of 11 PHs, representing all founding lineages, and five historical specimens dated to 1878–1929 CE, including the Holotype. These were compared...... to the hitherto-most-extensive genome dataset characterized for horses, comprising 21 new genomes. We found that loci showing the most genetic differentiation with DHs were enriched in genes involved in metabolism, cardiac disorders, muscle contraction, reproduction, behavior, and signaling pathways. We also show...... that DH and PH populations split ∼45,000 years ago and have remained connected by gene-flow thereafter. Finally, we monitor the genomic impact of ∼110 years of captivity, revealing reduced heterozygosity, increased inbreeding, and variable introgression of domestic alleles, ranging from non...

  2. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus.

    Science.gov (United States)

    Scannell, Devin R; Zill, Oliver A; Rokas, Antonis; Payen, Celia; Dunham, Maitreya J; Eisen, Michael B; Rine, Jasper; Johnston, Mark; Hittinger, Chris Todd

    2011-06-01

    High-quality, well-annotated genome sequences and standardized laboratory strains fuel experimental and evolutionary research. We present improved genome sequences of three species of Saccharomyces sensu stricto yeasts: S. bayanus var. uvarum (CBS 7001), S. kudriavzevii (IFO 1802(T) and ZP 591), and S. mikatae (IFO 1815(T)), and describe their comparison to the genomes of S. cerevisiae and S. paradoxus. The new sequences, derived by assembling millions of short DNA sequence reads together with previously published Sanger shotgun reads, have vastly greater long-range continuity and far fewer gaps than the previously available genome sequences. New gene predictions defined a set of 5261 protein-coding orthologs across the five most commonly studied Saccharomyces yeasts, enabling a re-examination of the tempo and mode of yeast gene evolution and improved inferences of species-specific gains and losses. To facilitate experimental investigations, we generated genetically marked, stable haploid strains for all three of these Saccharomyces species. These nearly complete genome sequences and the collection of genetically marked strains provide a valuable toolset for comparative studies of gene function, metabolism, and evolution, and render Saccharomyces sensu stricto the most experimentally tractable model genus. These resources are freely available and accessible through www.SaccharomycesSensuStricto.org.

  3. Phylogeography of the endangered rosewood Dalbergia nigra (Fabaceae): insights into the evolutionary history and conservation of the Brazilian Atlantic Forest

    Science.gov (United States)

    Ribeiro, R A; Lemos-Filho, J P; Ramos, A C S; Lovato, M B

    2011-01-01

    The Brazilian rosewood (Dalbergia nigra) is an endangered tree endemic to the central Brazilian Atlantic Forest, one of the world's most threatened biomes. The population diversity, phylogeographic structure and demographic history of this species were investigated using the variation in the chloroplast DNA (cpDNA) sequences of 185 individuals from 19 populations along the geographical range of the species. Fifteen haplotypes were detected in the analysis of 1297 bp from two non-coding sequences, trnV-trnM and trnL. We identified a strong genetic structure (FST=0.62, Pclimatic changes in the central part of the Atlantic forest, with cycles of forest expansion and contraction, may have led to repeated vicariance events, resulting in the genetic differentiation of these groups. Based on comparisons among the populations of large reserves and small, disturbed fragments of the same phylogeographic group, we also found evidence of recent anthropogenic effects on genetic diversity. The results were also analysed with the aim of contributing to the conservation of D. nigra. We suggest that the three phylogeographic groups could be considered as three distinct management units. Based on the genetic diversity and uniqueness of the populations, we also indicate priority areas for conservation. PMID:20517347

  4. Evolutionary conservation of an atypical glucocorticoid-responsive element in the human tyrosine hydroxylase gene.

    Science.gov (United States)

    Sheela Rani, C S; Soto-Pina, Alexandra; Iacovitti, Lorraine; Strong, Randy

    2013-07-01

    The human tyrosine hydroxylase (hTH) gene has a 42 bp evolutionarily conserved region designated (CR) II at -7.24 kb, which bears 93% homology to the region we earlier identified as containing the glucocorticoid response element, a 7 bp activator protein-1 (AP-1)-like motif in the rat TH gene. We cloned this hTH-CRII region upstream of minimal basal hTH promoter in luciferase (Luc) reporter vector, and tested glucocorticoid responsiveness in human cell lines. Dexamethasone (Dex) stimulated Luc activity of hTH-CRII in HeLa cells, while mifepristone, a glucocorticoid receptor (GR) antagonist, prevented Dex stimulation. Deletion of the 7 bp 5'-TGACTAA at -7243 bp completely abolished the Dex-stimulated Luc activity of hTH-CRII construct. The AP-1 agonist, tetradeconoyl-12,13-phorbol acetate (TPA), also stimulated hTH promoter activity, and Dex and TPA together further accentuated this response. Chromatin immunoprecipitation assays revealed the presence of both GR and AP-1 proteins, especially Jun family members, at this hTH promoter site. Dex did not stimulate hTH promoter activity in a catecholaminergic cell line, which had low endogenous GR levels, but did activate the response when GR was expressed exogenously. Thus, our studies have clearly identified a glucocorticoid-responsive element in a 7 bp AP-1-like motif in the promoter region at -7.24 kb of the human TH gene. © 2013 International Society for Neurochemistry.

  5. Are Pharmaceuticals with Evolutionary Conserved Molecular Drug Targets More Potent to Cause Toxic Effects in Non-Target Organisms?

    Science.gov (United States)

    Furuhagen, Sara; Fuchs, Anne; Lundström Belleza, Elin; Breitholtz, Magnus; Gorokhova, Elena

    2014-01-01

    The ubiquitous use of pharmaceuticals has resulted in a continuous discharge into wastewater and pharmaceuticals and their metabolites are found in the environment. Due to their design towards specific drug targets, pharmaceuticals may be therapeutically active already at low environmental concentrations. Several human drug targets are evolutionary conserved in aquatic organisms, raising concerns about effects of these pharmaceuticals in non-target organisms. In this study, we hypothesized that the toxicity of a pharmaceutical towards a non-target invertebrate depends on the presence of the human drug target orthologs in this species. This was tested by assessing toxicity of pharmaceuticals with (miconazole and promethazine) and without (levonorgestrel) identified drug target orthologs in the cladoceran Daphnia magna. The toxicity was evaluated using general toxicity endpoints at individual (immobility, reproduction and development), biochemical (RNA and DNA content) and molecular (gene expression) levels. The results provide evidence for higher toxicity of miconazole and promethazine, i.e. the drugs with identified drug target orthologs. At the individual level, miconazole had the lowest effect concentrations for immobility and reproduction (0.3 and 0.022 mg L−1, respectively) followed by promethazine (1.6 and 0.18 mg L−1, respectively). At the biochemical level, individual RNA content was affected by miconazole and promethazine already at 0.0023 and 0.059 mg L−1, respectively. At the molecular level, gene expression for cuticle protein was significantly suppressed by exposure to both miconazole and promethazine; moreover, daphnids exposed to miconazole had significantly lower vitellogenin expression. Levonorgestrel did not have any effects on any endpoints in the concentrations tested. These results highlight the importance of considering drug target conservation in environmental risk assessments of pharmaceuticals. PMID:25140792

  6. Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2

    Energy Technology Data Exchange (ETDEWEB)

    Dash, Paban Kumar, E-mail: pabandash@rediffmail.com; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana

    2013-07-05

    Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a

  7. Evolutionary conservation of candidate osmoregulation genes in plant phloem sap-feeding insects.

    Science.gov (United States)

    Jing, X; White, T A; Luan, J; Jiao, C; Fei, Z; Douglas, A E

    2016-06-01

    The high osmotic pressure generated by sugars in plant phloem sap is reduced in phloem-feeding aphids by sugar transformations and facilitated water flux in the gut. The genes mediating these osmoregulatory functions have been identified and validated empirically in the pea aphid Acyrthosiphon pisum: sucrase 1 (SUC1), a sucrase in glycoside hydrolase family 13 (GH13), and aquaporin 1 (AQP1), a member of the Drosophila integral protein (DRIP) family of aquaporins. Here, we describe molecular analysis of GH13 and AQP genes in phloem-feeding representatives of the four phloem-feeding groups: aphids (Myzus persicae), coccids (Planococcus citri), psyllids (Diaphorina citri, Bactericera cockerelli) and whiteflies (Bemisia tabaci MEAM1 and MED). A single candidate GH13-SUC gene and DRIP-AQP gene were identified in the genome/transcriptome of most insects tested by the criteria of sequence motif and gene expression in the gut. Exceptionally, the psyllid Ba. cockerelli transcriptome included a gut-expressed Pyrocoelia rufa integral protein (PRIP)-AQP, but has no DRIP-AQP transcripts, suggesting that PRIP-AQP is recruited for osmoregulatory function in this insect. This study indicates that phylogenetically related SUC and AQP genes may generally mediate osmoregulatory functions in these diverse phloem-feeding insects, and provides candidate genes for empirical validation and development as targets for osmotic disruption of pest species. © 2016 The Authors. Insect Molecular Biology published by John Wiley & Sons Ltd on behalf of The Royal Entomological Society.

  8. Evolutionary Conservation in Biogenesis of β-Barrel Proteins Allows Mitochondria to Assemble a Functional Bacterial Trimeric Autotransporter Protein*

    Science.gov (United States)

    Ulrich, Thomas; Oberhettinger, Philipp; Schütz, Monika; Holzer, Katharina; Ramms, Anne S.; Linke, Dirk; Autenrieth, Ingo B.; Rapaport, Doron

    2014-01-01

    Yersinia adhesin A (YadA) belongs to a class of bacterial adhesins that form trimeric structures. Their mature form contains a passenger domain and a C-terminal β-domain that anchors the protein in the outer membrane (OM). Little is known about how precursors of such proteins cross the periplasm and assemble into the OM. In the present study we took advantage of the evolutionary conservation in the biogenesis of β-barrel proteins between bacteria and mitochondria. We previously observed that upon expression in yeast cells, bacterial β-barrel proteins including the transmembrane domain of YadA assemble into the mitochondrial OM. In the current study we found that when expressed in yeast cells both the monomeric and trimeric forms of full-length YadA were detected in mitochondria but only the trimeric species was fully integrated into the OM. The oligomeric form was exposed on the surface of the organelle in its native conformation and maintained its capacity to adhere to host cells. The co-expression of YadA with a mitochondria-targeted form of the bacterial periplasmic chaperone Skp, but not with SurA or SecB, resulted in enhanced levels of both forms of YadA. Taken together, these results indicate that the proper assembly of trimeric autotransporter can occur also in a system lacking the lipoproteins of the BAM machinery and is specifically enhanced by the chaperone Skp. PMID:25190806

  9. Evolutionary Conservation and Emerging Functional Diversity of the Cytosolic Hsp70:J Protein Chaperone Network of Arabidopsis thaliana.

    Science.gov (United States)

    Verma, Amit K; Diwan, Danish; Raut, Sandeep; Dobriyal, Neha; Brown, Rebecca E; Gowda, Vinita; Hines, Justin K; Sahi, Chandan

    2017-06-07

    Heat shock proteins of 70 kDa (Hsp70s) partner with structurally diverse Hsp40s (J proteins), generating distinct chaperone networks in various cellular compartments that perform myriad housekeeping and stress-associated functions in all organisms. Plants, being sessile, need to constantly maintain their cellular proteostasis in response to external environmental cues. In these situations, the Hsp70:J protein machines may play an important role in fine-tuning cellular protein quality control. Although ubiquitous, the functional specificity and complexity of the plant Hsp70:J protein network has not been studied. Here, we analyzed the J protein network in the cytosol of Arabidopsis thaliana and, using yeast genetics, show that the functional specificities of most plant J proteins in fundamental chaperone functions are conserved across long evolutionary timescales. Detailed phylogenetic and functional analysis revealed that increased number, regulatory differences, and neofunctionalization in J proteins together contribute to the emerging functional diversity and complexity in the Hsp70:J protein network in higher plants. Based on the data presented, we propose that higher plants have orchestrated their "chaperome," especially their J protein complement, according to their specialized cellular and physiological stipulations. Copyright © 2017 Verma et al.

  10. Conservation genetics of evolutionary lineages of the endangered mountain yellow-legged frog, Rana muscosa (Amphibia: Ranidae), in southern California

    Science.gov (United States)

    Schoville, Sean D.; Tustall, Tate S.; Vredenburg, Vance T.; Backlin, Adam R.; Gallegos, Elizabeth; Wood, Dustin A.; Fisher, Robert N.

    2011-01-01

    Severe population declines led to the listing of southern California Rana muscosa (Ranidae) as endangered in 2002. Nine small populations inhabit watersheds in three isolated mountain ranges, the San Gabriel, San Bernardino and San Jacinto. One population from the Dark Canyon tributary in the San Jacinto Mountains has been used to establish a captive breeding population at the San Diego Zoo Institute for Conservation Research. Because these populations may still be declining, it is critical to gather information on how genetic variation is structured in these populations and what historical inter-population connectivity existed between populations. Additionally, it is not clear whether these populations are rapidly losing genetic diversity due to population bottlenecks. Using mitochondrial and microsatellite data, we examine patterns of genetic variation in southern California and one of the last remaining populations of R. muscosa in the southern Sierra Nevada. We find low levels of genetic variation within each population and evidence of genetic bottlenecks. Additionally, substantial population structure is evident, suggesting a high degree of historical isolation within and between mountain ranges. Based on estimates from a multi-population isolation with migration analysis, these populations diversified during glacial episodes of the Pleistocene, with little gene flow during population divergence. Our data demonstrate that unique evolutionary lineages of R. muscosa occupy each mountain range in southern California and should be managed separately. The captive breeding program at Dark Canyon is promising, although mitigating the loss of neutral genetic diversity relative to the natural population might require additional breeding frogs.

  11. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    Science.gov (United States)

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  12. PETcofold: predicting conserved interactions and structures of two multiple alignments of RNA sequences.

    Science.gov (United States)

    Seemann, Stefan E; Richter, Andreas S; Gesell, Tanja; Backofen, Rolf; Gorodkin, Jan

    2011-01-15

    Predicting RNA-RNA interactions is essential for determining the function of putative non-coding RNAs. Existing methods for the prediction of interactions are all based on single sequences. Since comparative methods have already been useful in RNA structure determination, we assume that conserved RNA-RNA interactions also imply conserved function. Of these, we further assume that a non-negligible amount of the existing RNA-RNA interactions have also acquired compensating base changes throughout evolution. We implement a method, PETcofold, that can take covariance information in intra-molecular and inter-molecular base pairs into account to predict interactions and secondary structures of two multiple alignments of RNA sequences. PETcofold's ability to predict RNA-RNA interactions was evaluated on a carefully curated dataset of 32 bacterial small RNAs and their targets, which was manually extracted from the literature. For evaluation of both RNA-RNA interaction and structure prediction, we were able to extract only a few high-quality examples: one vertebrate small nucleolar RNA and four bacterial small RNAs. For these we show that the prediction can be improved by our comparative approach. Furthermore, PETcofold was evaluated on controlled data with phylogenetically simulated sequences enriched for covariance patterns at the interaction sites. We observed increased performance with increased amounts of covariance. The program PETcofold is available as source code and can be downloaded from http://rth.dk/resources/petcofold.

  13. Homology and conservation of amino acids in E-protein sequences of dengue serotypes

    Directory of Open Access Journals (Sweden)

    Ramesh Venkatachalam

    2014-09-01

    Full Text Available Objective: To identify the homology and phylogenetic relationship among the four dengue virus (DENV serotypes, and conservation of amino acid in E-proteins and to find out the phylogenetic relationship among the strains of four DENV serotypes. Methods: Clustal W analysis for homology and phylogram, European molecular biology open software suite for pairwise alignment of amino acid sequences and BLAST-P analysis for various strains of four DENV serotypes were carried out. Results: Homology of E-protein sequences of four DENV serotypes indicated a close relationship of DENV-1 with DENV-3. DENV-2 showed close relationship with DENV-1 and -3 forming a single cluster whereas DENV-4 alone formed group with a single serotype. In the multiple sequence alignment, 19 amino acid conserved groups were observed. BLAST-P analysis showed more number of 100% similarity among DENV-1 and -3 strains whereas only few strains showed 100% similarity in DENV-4. However, 100% similarity was absent among the DENV-3 strains. Conclusions: From the present study, phylogenetically all the four DENV serotypes were related but DENV-1, -2 and -3 were very closely related whereas DENV-4 was somewhat distant from the other three serotypes.

  14. Cytochrome Oxidase I (COI) sequence conservation and variation patterns in the yellowfin and longtail tunas.

    Science.gov (United States)

    Kunal, Swaraj Priyaranjan; Kumar, Girish

    2013-01-01

    Tunas are commercially important fishery worldwide. There are at least 13 species of tuna belonging to three genera, out of which genus Thunnus has maximum eight species. On the basis of their availability, they can be characterised as oceanic such as Thunnus albacares (yellowfin tuna) or coastal such as Thunnus tonggol (longtail tuna). Although these two are different species, morphological differentiation can only be seen in mature individuals, hence misidentification may result in erroneous data set, which ultimately affect conservation strategies. The mitochondrial DNA cytochrome oxidase c subunit 1 (COI) gene is one of the most popular markers for population genetic and phylogeographic studies across the animal kingdom. The present study aims to study the sequence conservation and variation in mitochondrial Cytochrome Oxidase I (COI) between these two species of tuna. COI sequence analysis of yellowfin and longtail revealed the close relationship between them in Thunnus genera. The present study is the first direct comparison of mitochondrial COI sequences of these two tuna species.

  15. Phylogeography of Camellia taliensis (Theaceae) inferred from chloroplast and nuclear DNA: insights into evolutionary history and conservation

    Science.gov (United States)

    2012-01-01

    Background As one of the most important but seriously endangered wild relatives of the cultivated tea, Camellia taliensis harbors valuable gene resources for tea tree improvement in the future. The knowledge of genetic variation and population structure may provide insights into evolutionary history and germplasm conservation of the species. Results Here, we sampled 21 natural populations from the species' range in China and performed the phylogeography of C. taliensis by using the nuclear PAL gene fragment and chloroplast rpl32-trnL intergenic spacer. Levels of haplotype diversity and nucleotide diversity detected at rpl32-trnL (h = 0.841; π = 0.00314) were almost as high as at PAL (h = 0.836; π = 0.00417). Significant chloroplast DNA population subdivision was detected (GST = 0.988; NST = 0.989), suggesting fairly high genetic differentiation and low levels of recurrent gene flow through seeds among populations. Nested clade phylogeographic analysis of chlorotypes suggests that population genetic structure in C. taliensis has been affected by habitat fragmentation in the past. However, the detection of a moderate nrDNA population subdivision (GST = 0.222; NST = 0.301) provided the evidence of efficient pollen-mediated gene flow among populations and significant phylogeographical structure (NST > GST; P < 0.01). The analysis of PAL haplotypes indicates that phylogeographical pattern of nrDNA haplotypes might be caused by restricted gene flow with isolation by distance, which was also supported by Mantel’s test of nrDNA haplotypes (r = 0.234, P < 0.001). We found that chlorotype C1 was fixed in seven populations of Lancang River Region, implying that the Lancang River might have provided a corridor for the long-distance dispersal of the species. Conclusions We found that C. taliensis showed fairly high genetic differentiation resulting from restricted gene flow and habitat fragmentation. This phylogeographical

  16. Expression profiling of rainbow trout testis development identifies evolutionary conserved genes involved in spermatogenesis

    Directory of Open Access Journals (Sweden)

    Esquerré Diane

    2009-11-01

    Full Text Available Abstract Background Spermatogenesis is a late developmental process that involves a coordinated expression program in germ cells and a permanent communication between the testicular somatic cells and the germ-line. Current knowledge regarding molecular factors driving male germ cell proliferation and differentiation in vertebrates is still limited and mainly based on existing data from rodents and human. Fish with a marked reproductive cycle and a germ cell development in synchronous cysts have proven to be choice models to study precise stages of the spermatogenetic development and the germ cell-somatic cell communication network. In this study we used 9K cDNA microarrays to investigate the expression profiles underlying testis maturation during the male reproductive cycle of the trout, Oncorhynchus mykiss. Results Using total testis samples at various developmental stages and isolated spermatogonia, spermatocytes and spermatids, 3379 differentially expressed trout cDNAs were identified and their gene activation or repression patterns throughout the reproductive cycle were reported. We also performed a tissue-profiling analysis and highlighted many genes for which expression signals were restricted to the testes or gonads from both sexes. The search for orthologous genes in genome-sequenced fish species and the use of their mammalian orthologs allowed us to provide accurate annotations for trout cDNAs. The analysis of the GeneOntology terms therefore validated and broadened our interpretation of expression clusters by highlighting enriched functions that are consistent with known sequential events during male gametogenesis. Furthermore, we compared expression profiles of trout and mouse orthologs and identified a complement of genes for which expression during spermatogenesis was maintained throughout evolution. Conclusion A comprehensive study of gene expression and associated functions during testis maturation and germ cell differentiation in

  17. Do natural proteins differ from random sequences polypeptides? Natural vs. random proteins classification using an evolutionary neural network.

    Directory of Open Access Journals (Sweden)

    Davide De Lucrezia

    Full Text Available Are extant proteins the exquisite result of natural selection or are they random sequences slightly edited by evolution? This question has puzzled biochemists for long time and several groups have addressed this issue comparing natural protein sequences to completely random ones coming to contradicting conclusions. Previous works in literature focused on the analysis of primary structure in an attempt to identify possible signature of evolutionary editing. Conversely, in this work we compare a set of 762 natural proteins with an average length of 70 amino acids and an equal number of completely random ones of comparable length on the basis of their structural features. We use an ad hoc Evolutionary Neural Network Algorithm (ENNA in order to assess whether and to what extent natural proteins are edited from random polypeptides employing 11 different structure-related variables (i.e. net charge, volume, surface area, coil, alpha helix, beta sheet, percentage of coil, percentage of alpha helix, percentage of beta sheet, percentage of secondary structure and surface hydrophobicity. The ENNA algorithm is capable to correctly distinguish natural proteins from random ones with an accuracy of 94.36%. Furthermore, we study the structural features of 32 random polypeptides misclassified as natural ones to unveil any structural similarity to natural proteins. Results show that random proteins misclassified by the ENNA algorithm exhibit a significant fold similarity to portions or subdomains of extant proteins at atomic resolution. Altogether, our results suggest that natural proteins are significantly edited from random polypeptides and evolutionary editing can be readily detected analyzing structural features. Furthermore, we also show that the ENNA, employing simple structural descriptors, can predict whether a protein chain is natural or random.

  18. Identification of conserved and novel microRNAs in Porphyridium purpureum via deep sequencing and bioinformatics.

    Science.gov (United States)

    Gao, Fan; Nan, Fangru; Feng, Jia; Lv, Junping; Liu, Qi; Xie, Shulian

    2016-08-11

    Porphyridium purpureum has been utilized in important industrial and pharmaceutical fields. The identification of microRNAs (miRNAs) in this unique species is of great importance: such identification can help fill gaps in the small RNA (sRNA) studies of this organism and help to elucidate essential biological processes and their regulation mechanisms in this special micro alga. In this study, 254 high-confidence miRNAs (203 conserved miRNAs and 51 novel miRNAs) were identified by sRNA deep sequencing (sRNA-seq) combined with bioinformatics. A total of 235 putative miRNA families were predicted, including 192 conserved families and 43 species-specific families. The conservation and diversity of predicted miRNA families were analysed in different plant species. Both the 100 % northern blot validation rate (VR) of four randomly selected miRNAs and the results of stem-loop quantitative real time RT-PCR (qRT-PCR) assays of 25 randomly selected miRNAs demonstrated that the majority of the miRNAs identified in this study are credible. A total of 14,958 and 2184 genes were predicted to be targeted by the 186 conserved and 41 novel miRNAs. Gene ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis indicated that some target genes likely provide valuable references for further understanding of vital functions in P. purpureum. In addition, a cytoscape network will provide some clues for research into the complex biological processes that occur in this unique alga. We first identified a large set of conserved and novel miRNAs in P. purpureum. The characteristic and validation analysis on miRNAs demonstrated authenticity of identification data. Functional annotation of target genes and metabolic pathways they involved in illuminated the direction for further utilization and development this micro alga based on its unique properties.

  19. PDL1 Signals through Conserved Sequence Motifs to Overcome Interferon-Mediated Cytotoxicity

    Directory of Open Access Journals (Sweden)

    Maria Gato-Cañas

    2017-08-01

    Full Text Available PDL1 blockade produces remarkable clinical responses, thought to occur by T cell reactivation through prevention of PDL1-PD1 T cell inhibitory interactions. Here, we find that PDL1 cell-intrinsic signaling protects cancer cells from interferon (IFN cytotoxicity and accelerates tumor progression. PDL1 inhibited IFN signal transduction through a conserved class of sequence motifs that mediate crosstalk with IFN signaling. Abrogation of PDL1 expression or antibody-mediated PDL1 blockade strongly sensitized cancer cells to IFN cytotoxicity through a STAT3/caspase-7-dependent pathway. Moreover, somatic mutations found in human carcinomas within these PDL1 sequence motifs disrupted motif regulation, resulting in PDL1 molecules with enhanced protective activities from type I and type II IFN cytotoxicity. Overall, our results reveal a mode of action of PDL1 in cancer cells as a first line of defense against IFN cytotoxicity.

  20. Sequence recombination and conservation of Varroa destructor virus-1 and deformed wing virus in field collected honey bees (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Hui Wang

    Full Text Available We sequenced small (s RNAs from field collected honeybees (Apis mellifera and bumblebees (Bombuspascuorum using the Illumina technology. The sRNA reads were assembled and resulting contigs were used to search for virus homologues in GenBank. Matches with Varroadestructor virus-1 (VDV1 and Deformed wing virus (DWV genomic sequences were obtained for A. mellifera but not B. pascuorum. Further analyses suggested that the prevalent virus population was composed of VDV-1 and a chimera of 5'-DWV-VDV1-DWV-3'. The recombination junctions in the chimera genomes were confirmed by using RT-PCR, cDNA cloning and Sanger sequencing. We then focused on conserved short fragments (CSF, size > 25 nt in the virus genomes by using GenBank sequences and the deep sequencing data obtained in this study. The majority of CSF sites confirmed conservation at both between-species (GenBank sequences and within-population (dataset of this study levels. However, conserved nucleotide positions in the GenBank sequences might be variable at the within-population level. High mutation rates (Pi>10% were observed at a number of sites using the deep sequencing data, suggesting that sequence conservation might not always be maintained at the population level. Virus-host interactions and strategies for developing RNAi treatments against VDV1/DWV infections are discussed.

  1. Functional and evolutionary analysis of Korean bob-tailed native dog using whole-genome sequencing data.

    Science.gov (United States)

    Lee, Daehwan; Lim, Dajeong; Kwon, Daehong; Kim, Juyeon; Lee, Jongin; Sim, Mikang; Choi, Bong-Hwan; Choi, Seog-Gyu; Kim, Jaebum

    2017-12-11

    Rapid and cost effective production of large-scale genome data through next-generation sequencing has enabled population-level studies of various organisms to identify their genotypic differences and phenotypic consequences. This is also used to study indigenous animals with historical and economical values, although they are less studied than model organisms. The objective of this study was to perform functional and evolutionary analysis of Korean bob-tailed native dog Donggyeong with distinct tail and agility phenotype using whole-genome sequencing data by using population and comparative genomics approaches. Based on the uniqueness of non-synonymous single nucleotide polymorphisms obtained from next-generation sequencing data, Donggyeong dog-specific genes/proteins and their functions were identified by comparison with 12 other dog breeds and six other related species. These proteins were further divided into subpopulation-specific ones with different tail length and protein interaction-level signatures were investigated. Finally, the trajectory of shaping protein interactions of subpopulation-specific proteins during evolution was uncovered. This study expands our knowledge of Korean native dogs. Our results also provide a good example of using whole-genome sequencing data for population-level analysis in closely related species.

  2. Sequence of Radiotherapy and Chemotherapy in Breast Cancer After Breast-Conserving Surgery

    Energy Technology Data Exchange (ETDEWEB)

    Jobsen, Jan J., E-mail: J.Jobsen@mst.nl [Department of Radiation Oncology, Medisch Spectrum Twente, Enschede (Netherlands); Palen, Job van der [Department of Epidemiology, Medisch Spectrum Twente, Enschede (Netherlands); Department of Research Methodology, Measurement and Data Analysis, Faculty of Behavioural Science, University of Twente (Netherlands); Brinkhuis, Marieel [Laboratory for Pathology Oost Nederland, Enschede (Netherlands); Ong, Francisca [Department of Radiation Oncology, Medisch Spectrum Twente, Enschede (Netherlands); Struikmans, Henk [Department of Radiation Oncology, Leiden University Medical Centre, Leiden (Netherlands); Radiotherapy Centre West, Medical Centre Haaglanden, the Hague (Netherlands)

    2012-04-01

    Purpose: The optimal sequence of radiotherapy and chemotherapy in breast-conserving therapy is unknown. Methods and Materials: From 1983 through 2007, a total of 641 patients with 653 instances of breast-conserving therapy (BCT), received both chemotherapy and radiotherapy and are the basis of this analysis. Patients were divided into three groups. Groups A and B comprised patients treated before 2005, Group A radiotherapy first and Group B chemotherapy first. Group C consisted of patients treated from 2005 onward, when we had a fixed sequence of radiotherapy first, followed by chemotherapy. Results: Local control did not show any differences among the three groups. For distant metastasis, no difference was shown between Groups A and B. Group C, when compared with Group A, showed, on univariate and multivariate analyses, a significantly better distant metastasis-free survival. The same was noted for disease-free survival. With respect to disease-specific survival, no differences were shown on multivariate analysis among the three groups. Conclusion: Radiotherapy, as an integral part of the primary treatment of BCT, should be administered first, followed by adjuvant chemotherapy.

  3. Chromosome conformation capture uncovers potential genome-wide interactions between human conserved non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Daniel Robyr

    Full Text Available Comparative analyses of various mammalian genomes have identified numerous conserved non-coding (CNC DNA elements that display striking conservation among species, suggesting that they have maintained specific functions throughout evolution. CNC function remains poorly understood, although recent studies have identified a role in gene regulation. We hypothesized that the identification of genomic loci that interact physically with CNCs would provide information on their functions. We have used circular chromosome conformation capture (4C to characterize interactions of 10 CNCs from human chromosome 21 in K562 cells. The data provide evidence that CNCs are capable of interacting with loci that are enriched for CNCs. The number of trans interactions varies among CNCs; some show interactions with many loci, while others interact with few. Some of the tested CNCs are capable of driving the expression of a reporter gene in the mouse embryo, and associate with the oligodendrocyte genes OLIG1 and OLIG2. Our results underscore the power of chromosome conformation capture for the identification of targets of functional DNA elements and raise the possibility that CNCs exert their functions by physical association with defined genomic regions enriched in CNCs. These CNC-CNC interactions may in part explain their stringent conservation as a group of regulatory sequences.

  4. Combining evolutionary information extracted from frequency profiles with sequence-based kernels for protein remote homology detection.

    Science.gov (United States)

    Liu, Bin; Zhang, Deyuan; Xu, Ruifeng; Xu, Jinghao; Wang, Xiaolong; Chen, Qingcai; Dong, Qiwen; Chou, Kuo-Chen

    2014-02-15

    Owing to its importance in both basic research (such as molecular evolution and protein attribute prediction) and practical application (such as timely modeling the 3D structures of proteins targeted for drug development), protein remote homology detection has attracted a great deal of interest. It is intriguing to note that the profile-based approach is promising and holds high potential in this regard. To further improve protein remote homology detection, a key step is how to find an optimal means to extract the evolutionary information into the profiles. Here, we propose a novel approach, the so-called profile-based protein representation, to extract the evolutionary information via the frequency profiles. The latter can be calculated from the multiple sequence alignments generated by PSI-BLAST. Three top performing sequence-based kernels (SVM-Ngram, SVM-pairwise and SVM-LA) were combined with the profile-based protein representation. Various tests were conducted on a SCOP benchmark dataset that contains 54 families and 23 superfamilies. The results showed that the new approach is promising, and can obviously improve the performance of the three kernels. Furthermore, our approach can also provide useful insights for studying the features of proteins in various families. It has not escaped our notice that the current approach can be easily combined with the existing sequence-based methods so as to improve their performance as well. For users' convenience, the source code of generating the profile-based proteins and the multiple kernel learning was also provided at http://bioinformatics.hitsz.edu.cn/main/~binliu/remote/

  5. Evolutionary conservation in biogenesis of β-barrel proteins allows mitochondria to assemble a functional bacterial trimeric autotransporter protein.

    Science.gov (United States)

    Ulrich, Thomas; Oberhettinger, Philipp; Schütz, Monika; Holzer, Katharina; Ramms, Anne S; Linke, Dirk; Autenrieth, Ingo B; Rapaport, Doron

    2014-10-24

    Yersinia adhesin A (YadA) belongs to a class of bacterial adhesins that form trimeric structures. Their mature form contains a passenger domain and a C-terminal β-domain that anchors the protein in the outer membrane (OM). Little is known about how precursors of such proteins cross the periplasm and assemble into the OM. In the present study we took advantage of the evolutionary conservation in the biogenesis of β-barrel proteins between bacteria and mitochondria. We previously observed that upon expression in yeast cells, bacterial β-barrel proteins including the transmembrane domain of YadA assemble into the mitochondrial OM. In the current study we found that when expressed in yeast cells both the monomeric and trimeric forms of full-length YadA were detected in mitochondria but only the trimeric species was fully integrated into the OM. The oligomeric form was exposed on the surface of the organelle in its native conformation and maintained its capacity to adhere to host cells. The co-expression of YadA with a mitochondria-targeted form of the bacterial periplasmic chaperone Skp, but not with SurA or SecB, resulted in enhanced levels of both forms of YadA. Taken together, these results indicate that the proper assembly of trimeric autotransporter can occur also in a system lacking the lipoproteins of the BAM machinery and is specifically enhanced by the chaperone Skp. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Patterns of evolutionary conservation of ascorbic acid-related genes following whole-genome triplication in Brassica rapa.

    Science.gov (United States)

    Duan, Weike; Song, Xiaoming; Liu, Tongkun; Huang, Zhinan; Ren, Jun; Hou, Xilin; Du, Jianchang; Li, Ying

    2014-12-31

    Ascorbic acid (AsA) is an important antioxidant in plants and an essential vitamin for humans. Extending the study of AsA-related genes from Arabidopsis thaliana to Brassica rapa could shed light on the evolution of AsA in plants and inform crop breeding. In this study, we conducted whole-genome annotation, molecular-evolution and gene-expression analyses of all known AsA-related genes in B. rapa. The nucleobase-ascorbate transporter (NAT) gene family and AsA l-galactose pathway genes were also compared among plant species. Four important insights gained are that: 1) 102 AsA-related gene were identified in B. rapa and they mainly diverged 12-18 Ma accompanied by the Brassica-specific genome triplication event; 2) during their evolution, these AsA-related genes were preferentially retained, consistent with the gene dosage hypothesis; 3) the putative proteins were highly conserved, but their expression patterns varied; and 4) although the number of AsA-related genes is higher in B. rapa than in A. thaliana, the AsA contents and the numbers of expressed genes in leaves of both species are similar, the genes that are not generally expressed may serve as substitutes during emergencies. In summary, this study provides genome-wide insights into evolutionary history and mechanisms of AsA-related genes following whole-genome triplication in B. rapa. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Horse domestication and conservation genetics of Przewalski's horse inferred from sex chromosomal and autosomal sequences.

    Science.gov (United States)

    Lau, Allison N; Peng, Lei; Goto, Hiroki; Chemnick, Leona; Ryder, Oliver A; Makova, Kateryna D

    2009-01-01

    Despite their ability to interbreed and produce fertile offspring, there is continued disagreement about the genetic relationship of the domestic horse (Equus caballus) to its endangered wild relative, Przewalski's horse (Equus przewalskii). Analyses have differed as to whether or not Przewalski's horse is placed phylogenetically as a separate sister group to domestic horses. Because Przewalski's horse and domestic horse are so closely related, genetic data can also be used to infer domestication-specific differences between the two. To investigate the genetic relationship of Przewalski's horse to the domestic horse and to address whether evolution of the domestic horse is driven by males or females, five homologous introns (a total of approximately 3 kb) were sequenced on the X and Y chromosomes in two Przewalski's horses and three breeds of domestic horses: Arabian horse, Mongolian domestic horse, and Dartmoor pony. Five autosomal introns (a total of approximately 6 kb) were sequenced for these horses as well. The sequences of sex chromosomal and autosomal introns were used to determine nucleotide diversity and the forces driving evolution in these species. As a result, X chromosomal and autosomal data do not place Przewalski's horses in a separate clade within phylogenetic trees for horses, suggesting a close relationship between domestic and Przewalski's horses. It was also found that there was a lack of nucleotide diversity on the Y chromosome and higher nucleotide diversity than expected on the X chromosome in domestic horses as compared with the Y chromosome and autosomes. This supports the hypothesis that very few male horses along with numerous female horses founded the various domestic horse breeds. Patterns of nucleotide diversity among different types of chromosomes were distinct for Przewalski's in contrast to domestic horses, supporting unique evolutionary histories of the two species.

  8. A complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus: an evolutionary history of camelidae

    Directory of Open Access Journals (Sweden)

    Meng He

    2007-07-01

    Full Text Available Abstract Background The family Camelidae that evolved in North America during the Eocene survived with two distinct tribes, Camelini and Lamini. To investigate the evolutionary relationship between them and to further understand the evolutionary history of this family, we determined the complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus, the only wild survivor of the Old World camel. Results The mitochondrial genome sequence (16,680 bp from C. bactrianus ferus contains 13 protein-coding, two rRNA, and 22 tRNA genes as well as a typical control region; this basic structure is shared by all metazoan mitochondrial genomes. Its protein-coding region exhibits codon usage common to all mammals and possesses the three cryptic stop codons shared by all vertebrates. C. bactrianus ferus together with the rest of mammalian species do not share a triplet nucleotide insertion (GCC that encodes a proline residue found only in the nd1 gene of the New World camelid Lama pacos. This lineage-specific insertion in the L. pacos mtDNA occurred after the split between the Old and New World camelids suggests that it may have functional implication since a proline insertion in a protein backbone usually alters protein conformation significantly, and nd1 gene has not been seen as polymorphic as the rest of ND family genes among camelids. Our phylogenetic study based on complete mitochondrial genomes excluding the control region suggested that the divergence of the two tribes may occur in the early Miocene; it is much earlier than what was deduced from the fossil record (11 million years. An evolutionary history reconstructed for the family Camelidae based on cytb sequences suggested that the split of bactrian camel and dromedary may have occurred in North America before the tribe Camelini migrated from North America to Asia. Conclusion Molecular clock analysis of complete mitochondrial genomes from C. bactrianus ferus and L

  9. Silencing Effect of Hominoid Highly Conserved Noncoding Sequences on Embryonic Brain Development

    Science.gov (United States)

    Mahmoudi Saber, Morteza

    2017-01-01

    Abstract Superfamily Hominoidea, which consists of Hominidae (humans and great apes) and Hylobatidae (gibbons), is well-known for sharing human-like characteristics, however, the genomic origins of these shared unique phenotypes have mainly remained elusive. To decipher the underlying genomic basis of Hominoidea-restricted phenotypes, we identified and characterized Hominoidea-restricted highly conserved noncoding sequences (HCNSs) that are a class of potential regulatory elements which may be involved in evolution of lineage-specific phenotypes. We discovered 679 such HCNSs from human, chimpanzee, gorilla, orangutan and gibbon genomes. These HCNSs were demonstrated to be under purifying selection but with lineage-restricted characteristics different from old CNSs. A significant proportion of their ancestral sequences had accelerated rates of nucleotide substitutions, insertions and deletions during the evolution of common ancestor of Hominoidea, suggesting the intervention of positive Darwinian selection for creating those HCNSs. In contrary to enhancer elements and similar to silencer sequences, these Hominoidea-restricted HCNSs are located in close proximity of transcription start sites. Their target genes are enriched in the nervous system, development and transcription, and they tend to be remotely located from the nearest coding gene. Chip-seq signals and gene expression patterns suggest that Hominoidea-restricted HCNSs are likely to be functional regulatory elements by imposing silencing effects on their target genes in a tissue-restricted manner during fetal brain development. These HCNSs, emerged through adaptive evolution and conserved through purifying selection, represent a set of promising targets for future functional studies of the evolution of Hominoidea-restricted phenotypes. PMID:28633494

  10. Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles

    Science.gov (United States)

    Wang, Jianbin; Czech, Benjamin; Crunk, Amanda; Wallace, Adam; Mitreva, Makedonka; Hannon, Gregory J.; Davis, Richard E.

    2011-01-01

    Eukaryotic cells express several classes of small RNAs that regulate gene expression and ensure genome maintenance. Endogenous siRNAs (endo-siRNAs) and Piwi-interacting RNAs (piRNAs) mainly control gene and transposon expression in the germline, while microRNAs (miRNAs) generally function in post-transcriptional gene silencing in both somatic and germline cells. To provide an evolutionary and developmental perspective on small RNA pathways in nematodes, we identified and characterized known and novel small RNA classes through gametogenesis and embryo development in the parasitic nematode Ascaris suum and compared them with known small RNAs of Caenorhabditis elegans. piRNAs, Piwi-clade Argonautes, and other proteins associated with the piRNA pathway have been lost in Ascaris. miRNAs are synthesized immediately after fertilization in utero, before pronuclear fusion, and before the first cleavage of the zygote. This is the earliest expression of small RNAs ever described at a developmental stage long thought to be transcriptionally quiescent. A comparison of the two classes of Ascaris endo-siRNAs, 22G-RNAs and 26G-RNAs, to those in C. elegans, suggests great diversification and plasticity in the use of small RNA pathways during spermatogenesis in different nematodes. Our data reveal conserved characteristics of nematode small RNAs as well as features unique to Ascaris that illustrate significant flexibility in the use of small RNAs pathways, some of which are likely an adaptation to Ascaris' life cycle and parasitism. PMID:21685128

  11. Complete sequence determination of a novel reptile iridovirus isolated from soft-shelled turtle and evolutionary analysis of Iridoviridae

    Directory of Open Access Journals (Sweden)

    Wang Xiujie

    2009-05-01

    Full Text Available Abstract Background Soft-shelled turtle iridovirus (STIV is the causative agent of severe systemic diseases in cultured soft-shelled turtles (Trionyx sinensis. To our knowledge, the only molecular information available on STIV mainly concerns the highly conserved STIV major capsid protein. The complete sequence of the STIV genome is not yet available. Therefore, determining the genome sequence of STIV and providing a detailed bioinformatic analysis of its genome content and evolution status will facilitate further understanding of the taxonomic elements of STIV and the molecular mechanisms of reptile iridovirus pathogenesis. Results We determined the complete nucleotide sequence of the STIV genome using 454 Life Science sequencing technology. The STIV genome is 105 890 bp in length with a base composition of 55.1% G+C. Computer assisted analysis revealed that the STIV genome contains 105 potential open reading frames (ORFs, which encode polypeptides ranging from 40 to 1,294 amino acids and 20 microRNA candidates. Among the putative proteins, 20 share homology with the ancestral proteins of the nuclear and cytoplasmic large DNA viruses (NCLDVs. Comparative genomic analysis showed that STIV has the highest degree of sequence conservation and a colinear arrangement of genes with frog virus 3 (FV3, followed by Tiger frog virus (TFV, Ambystoma tigrinum virus (ATV, Singapore grouper iridovirus (SGIV, Grouper iridovirus (GIV and other iridovirus isolates. Phylogenetic analysis based on conserved core genes and complete genome sequence of STIV with other virus genomes was performed. Moreover, analysis of the gene gain-and-loss events in the family Iridoviridae suggested that the genes encoded by iridoviruses have evolved for favoring adaptation to different natural host species. Conclusion This study has provided the complete genome sequence of STIV. Phylogenetic analysis suggested that STIV and FV3 are strains of the same viral species belonging to the

  12. Sequence conservation in avian CR1: an interspersed repetitive DNA family evolving under functional constraints.

    Science.gov (United States)

    Chen, Z Q; Ritzel, R G; Lin, C C; Hodgetts, R B

    1991-07-01

    CR1 is a short interspersed repetitive DNA element originally identified in the domestic chicken (Gallus gallus). However, unlike virtually all other such sequences described to date, CR1 is not confined to one or a few closely related species. It is probably a ubiquitous component of the avian genome, having been detected in representatives of nine orders encompassing a wide spectrum of the class Aves. This identification was made possible by using the polymerase chain reaction (PCR), which revealed interspecific similarities not detected by conventional Southern analysis. DNA sequence comparisons between a CR1 element isolated from a sarus crane (Grus antigone) and those isolated from an emu (Dromaius novaehollandiae) showed that two short highly conserved regions are present. These are included within two regions previously characterized in the CR1 units of domestic fowl. One of these behaves as a transcriptional silencer and the other is a binding site for a nuclear protein. Our observations suggest that CR1 has evolved under functional constraints and that interspersed repetitive sequences as a class may constitute a more significant component of the eukaryotic genome than is generally acknowledged.

  13. Updating algal evolutionary relationships through plastid genome sequencing: did alveolate plastids emerge through endosymbiosis of an ochrophyte?

    Science.gov (United States)

    Ševčíková, Tereza; Horák, Aleš; Klimeš, Vladimír; Zbránková, Veronika; Demir-Hilton, Elif; Sudek, Sebastian; Jenkins, Jerry; Schmutz, Jeremy; Přibyl, Pavel; Fousek, Jan; Vlček, Čestmír; Lang, B Franz; Oborník, Miroslav; Worden, Alexandra Z; Eliáš, Marek

    2015-05-28

    Algae with secondary plastids of a red algal origin, such as ochrophytes (photosynthetic stramenopiles), are diverse and ecologically important, yet their evolutionary history remains controversial. We sequenced plastid genomes of two ochrophytes, Ochromonas sp. CCMP1393 (Chrysophyceae) and Trachydiscus minutus (Eustigmatophyceae). A shared split of the clpC gene as well as phylogenomic analyses of concatenated protein sequences demonstrated that chrysophytes and eustigmatophytes form a clade, the Limnista, exhibiting an unexpectedly elevated rate of plastid gene evolution. Our analyses also indicate that the root of the ochrophyte phylogeny falls between the recently redefined Khakista and Phaeista assemblages. Taking advantage of the expanded sampling of plastid genome sequences, we revisited the phylogenetic position of the plastid of Vitrella brassicaformis, a member of Alveolata with the least derived plastid genome known for the whole group. The results varied depending on the dataset and phylogenetic method employed, but suggested that the Vitrella plastids emerged from a deep ochrophyte lineage rather than being derived vertically from a hypothetical plastid-bearing common ancestor of alveolates and stramenopiles. Thus, we hypothesize that the plastid in Vitrella, and potentially in other alveolates, may have been acquired by an endosymbiosis of an early ochrophyte.

  14. The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

    Directory of Open Access Journals (Sweden)

    Olivier Arnaiz

    Full Text Available Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a

  15. Improving High-Throughput Sequencing Approaches for Reconstructing the Evolutionary Dynamics of Upper Paleolithic Human Groups

    DEFF Research Database (Denmark)

    Seguin-Orlando, Andaine

    the development and testing of innovative molecular approaches aiming at improving the amount of informative HTS data one can recover from ancient DNA extracts. We have characterized important ligation and amplification biases in the sequencing library building and enrichment steps, which can impede further...... been mainly driven by the development of High-Throughput DNA Sequencing (HTS) technologies but also by the implementation of novel molecular tools tailored to the manipulation of ultra short and damaged DNA molecules. Our ability to retrieve traces of genetic material has tremendously improved, pushing...

  16. Evolutionary history and adaptation from high-coverage whole-genome sequences of diverse African hunter-gatherers.

    Science.gov (United States)

    Lachance, Joseph; Vernot, Benjamin; Elbers, Clara C; Ferwerda, Bart; Froment, Alain; Bodo, Jean-Marie; Lema, Godfrey; Fu, Wenqing; Nyambo, Thomas B; Rebbeck, Timothy R; Zhang, Kun; Akey, Joshua M; Tishkoff, Sarah A

    2012-08-03

    To reconstruct modern human evolutionary history and identify loci that have shaped hunter-gatherer adaptation, we sequenced the whole genomes of five individuals in each of three different hunter-gatherer populations at > 60× coverage: Pygmies from Cameroon and Khoesan-speaking Hadza and Sandawe from Tanzania. We identify 13.4 million variants, substantially increasing the set of known human variation. We found evidence of archaic introgression in all three populations, and the distribution of time to most recent common ancestors from these regions is similar to that observed for introgressed regions in Europeans. Additionally, we identify numerous loci that harbor signatures of local adaptation, including genes involved in immunity, metabolism, olfactory and taste perception, reproduction, and wound healing. Within the Pygmy population, we identify multiple highly differentiated loci that play a role in growth and anterior pituitary function and are associated with height. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Recovering the evolutionary history of crowned pigeons (Columbidae: Goura): Implications for the biogeography and conservation of New Guinean lowland birds.

    Science.gov (United States)

    Bruxaux, Jade; Gabrielli, Maëva; Ashari, Hidayat; Prŷs-Jones, Robert; Joseph, Leo; Milá, Borja; Besnard, Guillaume; Thébaud, Christophe

    2017-12-01

    Assessing the relative contributions of immigration and diversification into the buildup of species diversity is key to understanding the role of historical processes in driving biogeographical and diversification patterns in species-rich regions. Here, we investigated how colonization, in situ speciation, and extinction history may have generated the present-day distribution and diversity of Goura crowned pigeons (Columbidae), a group of large forest-dwelling pigeons comprising four recognized species that are all endemic to New Guinea. We used a comprehensive geographical and taxonomic sampling based mostly on historical museum samples, and shallow shotgun sequencing, to generate complete mitogenomes, nuclear ribosomal clusters and independent nuclear conserved DNA elements. We used these datasets independently to reconstruct molecular phylogenies. Divergence time estimates were obtained using mitochondrial data only. All analyses revealed similar genetic divisions within the genus Goura and recovered as monophyletic groups the four species currently recognized, providing support for recent taxonomic changes based on differences in plumage characters. These four species are grouped into two pairs of strongly supported sister species, which were previously not recognized as close relatives: Goura sclaterii with Goura cristata, and Goura victoria with Goura scheepmakeri. While the geographical origin of the Goura lineage remains elusive, the crown age of 5.73 Ma is consistent with present-day species diversity being the result of a recent diversification within New Guinea. Although the orogeny of New Guinea's central cordillera must have played a role in driving diversification in Goura, cross-barrier dispersal seems more likely than vicariance to explain the speciation events having led to the four current species. Our results also have important conservation implications. Future assessments of the conservation status of Goura species should consider threat

  18. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  19. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

    2010-03-31

    Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B

  20. Sequence conservation and expression of the sex-lethal homologue in the fly Megaselia scalaris.

    Science.gov (United States)

    Sievert, V; Kuhn, S; Paululat, A; Traut, W

    2000-04-01

    Sex-lethal (Sxl) is Drosophila melanogaster's key regulating gene in the sex-determining cascade. Its homologue in Megaselia scalaris, the chromosome 3 gene Megsxl, codes for a protein with an overall similarity of 77% with the corresponding D. melanogaster sequence. Expression in M. scalaris, however, is very unlike that in D. melanogaster. Megsxl transcripts with a long ORF occur in both sexes. Differential splicing is conserved but not sex-specific. There are several splice variants, among them one is common to gonads and somatic tissues of all developmental stages investigated, one is specific for ovaries and embryos, and a third one is not found in ovaries. In the ovary, Megsxl is heavily transcribed in nurse cells and transported into eggs. These results suggest a non-sex-determining function during early embryogenesis; the presence of Megsxl RNA in testes and somatic tissues calls for other (or more) functions.

  1. Sequence-based antigenic change prediction by a sparse learning method incorporating co-evolutionary information.

    Directory of Open Access Journals (Sweden)

    Jialiang Yang

    Full Text Available Rapid identification of influenza antigenic variants will be critical in selecting optimal vaccine candidates and thus a key to developing an effective vaccination program. Recent studies suggest that multiple simultaneous mutations at antigenic sites accumulatively enhance antigenic drift of influenza A viruses. However, pre-existing methods on antigenic variant identification are based on analyses from individual sites. Because the impacts of these co-evolved sites on influenza antigenicity may not be additive, it will be critical to quantify the impact of not only those single mutations but also multiple simultaneous mutations or co-evolved sites. Here, we developed and applied a computational method, AntigenCO, to identify and quantify both single and co-evolutionary sites driving the historical antigenic drifts. AntigenCO achieved an accuracy of up to 90.05% for antigenic variant prediction, significantly outperforming methods based on single sites. AntigenCO can be useful in antigenic variant identification in influenza surveillance.

  2. FeatureMap3D - a tool to map protein features and sequence conservation onto homologous structures in the PDB

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Rapacki, Krzysztof; Stærfeldt, Hans Henrik

    2006-01-01

    FeatureMap3D is a web-based tool that maps protein features onto 3D structures. The user provides sequences annotated with any feature of interest, such as post-translational modifications, protease cleavage sites or exonic structure and FeatureMap3D will then search the Protein Data Bank (PDB......) for structures of homologous proteins. The results are displayed both as an annotated sequence alignment, where the user-provided annotations as well as the sequence conservation between the query and the target sequence are displayed, and also as a publication-quality image of the 3D protein structure...... with the selected features and sequence conservation enhanced. The results are also returned in a readily parsable text format as well as a PyMol (http://pymol.sourceforge.net/) script file, which allows the user to easily modify the protein structure image to suit a specific purpose. FeatureMap3D can also be used...

  3. Microcollinearity in an ethylene receptor coding gene region of the Coffea canephora genome is extensively conserved with Vitis vinifera and other distant dicotyledonous sequenced genomes.

    Science.gov (United States)

    Guyot, Romain; de la Mare, Marion; Viader, Véronique; Hamon, Perla; Coriton, Olivier; Bustamante-Porras, José; Poncet, Valérie; Campa, Claudine; Hamon, Serge; de Kochko, Alexandre

    2009-02-25

    conservation with other distant dicotyledonous reference genomes. Altogether, these results provide valuable information to identify candidate genes in C. canephora genome and serve as a foundation to establish strategies for whole genome sequencing. Future large-scale sequence comparison between C. canephora and reference sequenced genomes will help in understanding the evolutionary history of dicotyledonous plants.

  4. Workflow management systems for gene sequence analysis and evolutionary studies - A Review.

    Science.gov (United States)

    Sharma, Anu; Rai, Anil; Lal, Sb

    2013-01-01

    Post 'omic' era has resulted in the development of many primary, secondary and derived databases. Many analytical and visualization bioinformatics tools have been developed to manage and analyze the data available through large sequencing projects. Availability of heterogeneous databases and tools make it difficult for researchers to access information from varied sources and run different bioinformatics tools to get desired analysis done. Building integrated bioinformatics platforms is one of the most challenging tasks that bioinformatics community is facing. Integration of various databases, tools and algorithm is a challenging problem to deal with. This article describes the bioinformatics analysis workflow management systems that are developed in the area of gene sequence analysis and phylogeny. This article will be useful for biotechnologists, molecular biologists, computer scientists and statisticians engaged in computational biology and bioinformatics research.

  5. Spatial clustering of binding motifs and charges reveals conserved functional features in disordered nucleoporin sequences

    Science.gov (United States)

    Ando, David; Colvin, Michael; Rexach, Michael; Gopinathan, Ajay

    2013-03-01

    The Nuclear Pore Complex (NPC) gates the only channel through which cells exchange material between the nucleus and cytoplasm. Traffic is regulated by transport receptors bound to cargo which interact with numerous of disordered phenylalanine glycine (FG) repeat containing proteins (FG nups) that line this channel. The precise physical mechanism of transport regulation has remained elusive primarily due to the difficulty in understanding the structure and dynamics of such a large assembly of interacting disordered proteins. Here we have performed a comprehensive bioinformatic analysis, specifically tailored towards disordered proteins, on thousands of nuclear pore proteins from a variety of species revealing a set of highly conserved features in the sequence structure among FG nups. Contrary to the general perception that these proteins are functionally equivalent to homogeneous polymers, we show that biophysically important features within individual nups like the separation, spatial localization and ordering along the chain of FG and charge domains are highly conserved. Our current understanding of NPC structure and function should therefore be revised to account for these common features that are functionally relevant for the underlying physical mechanism of NPC gating.

  6. Workflow management systems for gene sequence analysis and evolutionary studies ? A Review

    OpenAIRE

    Sharma, Anu; Rai, Anil; Lal, SB

    2013-01-01

    Post ?omic? era has resulted in the development of many primary, secondary and derived databases. Many analytical and visualization bioinformatics tools have been developed to manage and analyze the data available through large sequencing projects. Availability of heterogeneous databases and tools make it difficult for researchers to access information from varied sources and run different bioinformatics tools to get desired analysis done. Building integrated bioinformatics platforms is one o...

  7. Variation in conserved non-coding sequences on chromosome 5q and susceptibility to asthma and atopy

    Directory of Open Access Journals (Sweden)

    Dubchak Inna

    2005-12-01

    Full Text Available Abstract Background Evolutionarily conserved sequences likely have biological function. Methods To determine whether variation in conserved sequences in non-coding DNA contributes to risk for human disease, we studied six conserved non-coding elements in the Th2 cytokine cluster on human chromosome 5q31 in a large Hutterite pedigree and in samples of outbred European American and African American asthma cases and controls. Results Among six conserved non-coding elements (>100 bp, >70% identity; human-mouse comparison, we identified one single nucleotide polymorphism (SNP in each of two conserved elements and six SNPs in the flanking regions of three conserved elements. We genotyped our samples for four of these SNPs and an additional three SNPs each in the IL13 and IL4 genes. While there was only modest evidence for association with single SNPs in the Hutterite and European American samples (P IL4 gene (P IL13 gene was strongly associated with total IgE (P = 0.00022 and allergic sensitization to mold allergens (P = 0.00076 in the Hutterites, and more modestly associated with sensitization to molds in the European Americans and African Americans (P Conclusion These results indicate that there is overall little variation in the conserved non-coding elements on 5q31, but variation in IL4 and IL13, including possibly one SNP in a conserved element, influence asthma and atopic phenotypes in diverse populations.

  8. Comparative genetic structure in pines: evolutionary and conservation consequences Estructura genética comparada en pinos: consecuencias evolutivas y para la conservación

    OpenAIRE

    PATRICIA DELGADO; ARGELIA CUENCA; Escalante, Ana E.; FRANCISCO MOLINA-FREANER; DANIEL PIÑERO

    2002-01-01

    Pines have been the focus of several studies that estimate population genetic parameters using both allozymes and chloroplast single sequence repeats (SSRs). Also, the genus has also been recently studied using molecular systematics so that we now have a more clear understanding of their evolutionary history. With this background we studied comparatively the genetic structure in pines. Expected heterozygosity is particularly constant with a 99 % confidence interval between 0.19 and 0.23 in sp...

  9. Targeted sequencing for high-resolution evolutionary analyses following genome duplication in salmonid fish: Proof of concept for key components of the insulin-like growth factor axis.

    Science.gov (United States)

    Lappin, Fiona M; Shaw, Rebecca L; Macqueen, Daniel J

    2016-12-01

    High-throughput sequencing has revolutionised comparative and evolutionary genome biology. It has now become relatively commonplace to generate multiple genomes and/or transcriptomes to characterize the evolution of large taxonomic groups of interest. Nevertheless, such efforts may be unsuited to some research questions or remain beyond the scope of some research groups. Here we show that targeted high-throughput sequencing offers a viable alternative to study genome evolution across a vertebrate family of great scientific interest. Specifically, we exploited sequence capture and Illumina sequencing to characterize the evolution of key components from the insulin-like growth (IGF) signalling axis of salmonid fish at unprecedented phylogenetic resolution. The IGF axis represents a central governor of vertebrate growth and its core components were expanded by whole genome duplication in the salmonid ancestor ~95Ma. Using RNA baits synthesised to genes encoding the complete family of IGF binding proteins (IGFBP) and an IGF hormone (IGF2), we captured, sequenced and assembled orthologous and paralogous exons from species representing all ten salmonid genera. This approach generated 299 novel sequences, most as complete or near-complete protein-coding sequences. Phylogenetic analyses confirmed congruent evolutionary histories for all nineteen recognized salmonid IGFBP family members and identified novel salmonid-specific IGF2 paralogues. Moreover, we reconstructed the evolution of duplicated IGF axis paralogues across a replete salmonid phylogeny, revealing complex historic selection regimes - both ancestral to salmonids and lineage-restricted - that frequently involved asymmetric paralogue divergence under positive and/or relaxed purifying selection. Our findings add to an emerging literature highlighting diverse applications for targeted sequencing in comparative-evolutionary genomics. We also set out a viable approach to obtain large sets of nuclear genes for any

  10. USING ECO-EVOLUTIONARY INDIVIDUAL-BASED MODELS TO INVESTIGATE SPATIALLY-DEPENDENT PROCESSES IN CONSERVATION GENETICS

    Science.gov (United States)

    Eco-evolutionary population simulation models are powerful new forecasting tools for exploring management strategies for climate change and other dynamic disturbance regimes. Additionally, eco-evo individual-based models (IBMs) are useful for investigating theoretical feedbacks ...

  11. Cancer systems biology in the genome sequencing era: part 2, evolutionary dynamics of tumor clonal networks and drug resistance.

    Science.gov (United States)

    Wang, Edwin; Zou, Jinfeng; Zaman, Naif; Beitel, Lenore K; Trifiro, Mark; Paliouras, Miltiadis

    2013-08-01

    A tumor often consists of multiple cell subpopulations (clones). Current chemo-treatments often target one clone of a tumor. Although the drug kills that clone, other clones overtake it and the tumor recurs. Genome sequencing and computational analysis allows to computational dissection of clones from tumors, while singe-cell genome sequencing including RNA-Seq allows profiling of these clones. This opens a new window for treating a tumor as a system in which clones are evolving. Future cancer systems biology studies should consider a tumor as an evolving system with multiple clones. Therefore, topics discussed in Part 2 of this review include evolutionary dynamics of clonal networks, early-warning signals (e.g., genome duplication events) for formation of fast-growing clones, dissecting tumor heterogeneity, and modeling of clone-clone-stroma interactions for drug resistance. The ultimate goal of the future systems biology analysis is to obtain a 'whole-system' understanding of a tumor and therefore provides a more efficient and personalized management strategies for cancer patients. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  12. Partial sequence analysis of an atypical Turkish isolate provides further information on the evolutionary history of Plum pox virus (PPV).

    Science.gov (United States)

    Glasa, Miroslav; Candresse, Thierry

    2005-03-01

    A variety of techniques, such as typing with subgroup-specific monoclonal antibodies, restriction length polymorphism (RFLP) analysis or subgroup-specific RT-PCR are available for the discrimination of Plum pox virus (PPV) isolates. However, the existence of PPV isolates showing abnormal typing properties has been observed in the past [Candresse, T., Cambra, M., Dallot, S., Lanneau, M., Asensio, M., Gorris, M.T., Revers, F., Macquaire, G., Olmos, A., Boscia, D., Quiot J.B., Dunez, J., 1998. Comparison of monoclonal antibodies and polymerase chain reaction assays for the typing of isolates belonging to the D and M serotypes of Plum pox potyvirus. Phytopathology 88, 198-204.]. In an effort to understand the molecular mechanisms underlying such anomalous serological and molecular typing characteristics, partial 3' (1449 nt) and 5' (3706 nt) sequences have been determined for an atypical Turkish PPV isolate (Abricotier Turquie or Ab-Tk). The results obtained indicate that its unusual typing behaviour is caused by point mutations affecting key restriction sites and epitopes and confirm that this isolate represents a divergent member of the PPV-M subgroup. In addition, analysis of the partial Ab-Tk genomic sequences demonstrated that the 5' region of the genome of this isolate has a mosaic structure resulting from recombination event(s), shedding new light on the evolutionary history of Plum pox virus.

  13. The methionine-rich low-molecular-weight chloroplast heat-shock protein: evolutionary conservation and accumulation in relation to thermotolerance.

    Science.gov (United States)

    Downs, C; Heckathorn, S; Bryan, J; Coleman, J

    1998-02-01

    The evolutionary conservation of the low-molecular-weight chloroplast-localized heat-shock protein (LMW chlpHsp) in vascular plants was examined using immunological methods. An antibody (Abmet) specific to the LMW chlpHsp was produced using a synthetic 28-residue peptide containing the most conserved elements of its unique "methionine-rich domain" as an antigen. This antibody detected a heat-inducible low-molecular-weight chloroplast protein in plants of six divergent Anthophyta species, including C3, C4, CAM, monocot, and dicot species. Abmet also detected a LMW chlpHsp in species from the Divisions Psilotophyta, Equisetophyta, Polypodiophyta, and Ginkgophyta. A preliminary examination of the relationship between accumulation of the LMW chlpHsp and habitat was also conducted. Seven Anthophyta species originating from both warm- and cool-temperature habitats were grown at 28C and then heat stressed at 40C. A positive qualitative relationship between the accumulation of the LMW chlpHsp and organismal thermotolerance in these species was observed; similar results were obtained separately with four nonAnthophyta species. The strong evolutionary conservation of this LMW Hsp and its localization to the chloroplast, and the correlation between production of this protein and plant thermotolerance, suggest that the LMW chlpHsp plays an important role in adaptation to heat stress.

  14. A ChIP-Seq benchmark shows that sequence conservation mainly improves detection of strong transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Tony Håndstad

    Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.

  15. A micromorphological study of pedogenic processes in an evolutionary soil sequence formed in late quaternary rhyolitic tephra deposits, North Island, New Zealand.

    NARCIS (Netherlands)

    Bakker, L.; Lowe, D.J.; Jongmans, A.G.

    1996-01-01

    The influence of time as a soil forming factor was studied on an evolutionary sequence of five soils (1850 radiocarbo years BP-ca. 120,000 BP) developed in rhyolitic tephra deposits in New Zealand. New micromorphological observations were combined with existing macromorphological, chemical,

  16. New insights into evolutionary relationships within the subfamily Lamioideae (Lamiaceae) based on pentatricopeptide repeat (PPR) nuclear DNA sequences.

    Science.gov (United States)

    Roy, Tilottama; Lindqvist, Charlotte

    2015-10-01

    Lamioideae, one of the most species-rich subfamilies within Lamiaceae, exhibits a remarkable diversity in morphology and habit and is found in many temperate to subtropical regions across the globe. Previous studies based on chloroplast DNA (cpDNA) sequence data produced a tribal classification of Lamioideae, but so far this has not been confirmed with nuclear DNA loci. We investigated sequence variation in a low-copy nuclear pentatricopeptide repeat (PPR) region and compared the phylogenetic results with previously published sequence data from a concatenated data set comprising four cpDNA loci. We incorporated representatives of all 10 lamioid tribes and some unclassified taxa, analyzed the data using phylogenetic inference, and estimated divergence times and ancestral areas for major nodes. Our results showed overall topological similarities between the cpDNA and PPR phylogenies with strong support for most tribes. However, we also observed incongruence in the circumscription of some tribes, including Gomphostemmateae and Pogostemoneae and in the relationships among tribes. Our results suggest an Oligocene-Miocene origin of the Lamioideae crown group. Asia and the Mediterranean region appear to have been centers of diversity and place of origin for many lamioid tribes. This study represents the first phylogeny of subfamily Lamioideae inferred from low-copy nuclear DNA data. We show that most lamioid tribes are corroborated, although the exact circumscription of two tribes is questioned. We have shed further light on the evolutionary relationships within Lamioideae, and this study demonstrates the utility of the PPR region for such subfamilial-level phylogenetic studies. © 2015 Botanical Society of America.

  17. Novel evolutionary lineages in Labeobarbus (Cypriniformes; Cyprinidae) based on phylogenetic analyses of mtDNA sequences.

    Science.gov (United States)

    Beshera, Kebede A; Harris, Phillip M; Mayden, Richard L

    2016-03-22

    Phylogenetic relationships within Labeobarbus, the large-sized hexaploid cyprinids, were examined using cytochrome b gene sequences from a broad range of geographic localities and multiple taxa. Maximum likelihood and Bayesian methods revealed novel lineages from previously unsampled drainages in central (Congo River), eastern (Genale River) and southeastern (Revue and Mussapa Grande rivers) Africa. Relationships of some species of Varicorhinus in Africa (excluding 'V.' maroccanus) render Labeobarbus as paraphyletic. 'Varicorhinus' beso, 'V.' jubae, 'V.' mariae, 'V.' nelspruitensis, and 'V.' steindachneri are transferred to Labeobarbus. Bayesian estimation of time to most recent common ancestor suggested that Labeobarbus originated in the Late Miocene while lineage diversification began during the Late Miocene-Early Pliocene and continued to the late Pleistocene. The relationships presented herein provide phylogenetic resolution within Labeobarbus and advances our knowledge of genetic diversity within the lineage as well as provides some interesting insight into the hydrographic and geologic history of Africa.

  18. Evolutionary History of Helicobacter pylori Sequences Reflect Past Human Migrations in Southeast Asia

    Science.gov (United States)

    Breurec, Sebastien; Guillard, Bertrand; Hem, Sopheak; Brisse, Sylvain; Dieye, Fatou Bintou; Huerre, Michel; Oung, Chakravuth; Raymond, Josette; Sreng Tan, Tek; Thiberge, Jean-Michel; Vong, Sirenda; Monchy, Didier; Linz, Bodo

    2011-01-01

    The human population history in Southeast Asia was shaped by numerous migrations and population expansions. Their reconstruction based on archaeological, linguistic or human genetic data is often hampered by the limited number of informative polymorphisms in classical human genetic markers, such as the hypervariable regions of the mitochondrial DNA. Here, we analyse housekeeping gene sequences of the human stomach bacterium Helicobacter pylori from various countries in Southeast Asia and we provide evidence that H. pylori accompanied at least three ancient human migrations into this area: i) a migration from India introducing hpEurope bacteria into Thailand, Cambodia and Malaysia; ii) a migration of the ancestors of Austro-Asiatic speaking people into Vietnam and Cambodia carrying hspEAsia bacteria; and iii) a migration of the ancestors of the Thai people from Southern China into Thailand carrying H. pylori of population hpAsia2. Moreover, the H. pylori sequences reflect iv) the migrations of Chinese to Thailand and Malaysia within the last 200 years spreading hspEasia strains, and v) migrations of Indians to Malaysia within the last 200 years distributing both hpAsia2 and hpEurope bacteria. The distribution of the bacterial populations seems to strongly influence the incidence of gastric cancer as countries with predominantly hspEAsia isolates exhibit a high incidence of gastric cancer while the incidence is low in countries with a high proportion of hpAsia2 or hpEurope strains. In the future, the host range expansion of hpEurope strains among Asian populations, combined with human motility, may have a significant impact on gastric cancer incidence in Asia. PMID:21818291

  19. Evolutionary history of Helicobacter pylori sequences reflect past human migrations in Southeast Asia.

    Directory of Open Access Journals (Sweden)

    Sebastien Breurec

    Full Text Available The human population history in Southeast Asia was shaped by numerous migrations and population expansions. Their reconstruction based on archaeological, linguistic or human genetic data is often hampered by the limited number of informative polymorphisms in classical human genetic markers, such as the hypervariable regions of the mitochondrial DNA. Here, we analyse housekeeping gene sequences of the human stomach bacterium Helicobacter pylori from various countries in Southeast Asia and we provide evidence that H. pylori accompanied at least three ancient human migrations into this area: i a migration from India introducing hpEurope bacteria into Thailand, Cambodia and Malaysia; ii a migration of the ancestors of Austro-Asiatic speaking people into Vietnam and Cambodia carrying hspEAsia bacteria; and iii a migration of the ancestors of the Thai people from Southern China into Thailand carrying H. pylori of population hpAsia2. Moreover, the H. pylori sequences reflect iv the migrations of Chinese to Thailand and Malaysia within the last 200 years spreading hspEasia strains, and v migrations of Indians to Malaysia within the last 200 years distributing both hpAsia2 and hpEurope bacteria. The distribution of the bacterial populations seems to strongly influence the incidence of gastric cancer as countries with predominantly hspEAsia isolates exhibit a high incidence of gastric cancer while the incidence is low in countries with a high proportion of hpAsia2 or hpEurope strains. In the future, the host range expansion of hpEurope strains among Asian populations, combined with human motility, may have a significant impact on gastric cancer incidence in Asia.

  20. A tree-based conservation scoring method for short linear motifs in multiple alignments of protein sequences

    Directory of Open Access Journals (Sweden)

    López Rodrigo

    2008-05-01

    Full Text Available Abstract Background The structure of many eukaryotic cell regulatory proteins is highly modular. They are assembled from globular domains, segments of natively disordered polypeptides and short linear motifs. The latter are involved in protein interactions and formation of regulatory complexes. The function of such proteins, which may be difficult to define, is the aggregate of the subfunctions of the modules. It is therefore desirable to efficiently predict linear motifs with some degree of accuracy, yet sequence database searches return results that are not significant. Results We have developed a method for scoring the conservation of linear motif instances. It requires only primary sequence-derived information (e.g. multiple alignment and sequence tree and takes into account the degenerate nature of linear motif patterns. On our benchmarking, the method accurately scores 86% of the known positive instances, while distinguishing them from random matches in 78% of the cases. The conservation score is implemented as a real time application designed to be integrated into other tools. It is currently accessible via a Web Service or through a graphical interface. Conclusion The conservation score improves the prediction of linear motifs, by discarding those matches that are unlikely to be functional because they have not been conserved during the evolution of the protein sequences. It is especially useful for instances in non-structured regions of the proteins, where a domain masking filtering strategy is not applicable.

  1. Mitochondrial DNA haplotype distribution patterns in Pinus ponderosa (pinaceae): range-wide evolutionary history and implications for conservation

    Science.gov (United States)

    Kevin M. Potter; Valerie D. Hipkins; Mary F. Mahalovich; Robert E. Means

    2013-01-01

    Premise of the study: Ponderosa pine ( Pinus ponderosa Douglas ex P. Lawson & C. Lawson) exhibits complicated patterns of morphological and genetic variation across its range in western North America. This study aims to clarify P. ponderosa evolutionary history and phylogeography using a highly polymorphic...

  2. Conserved noncoding sequences are associated with rates of mRNA decay in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jacob B Spangler

    2013-05-01

    Full Text Available Steady-state mRNA levels are tightly regulated through a combination of transcriptional and post-transcriptional control mechanisms. The discovery of cis-acting DNA elements that encode these control mechanisms is of high importance. We have investigated the influence of conserved non-coding sequences (CNSs, DNA patterns retained after an ancient whole genome duplication event, on the breadth of gene expression and the rates of mRNA decay in Arabidopsis thaliana. The absence of CNSs near α duplicate genes was associated with a decrease in breadth of gene expression and slower mRNA decay rates while the presence CNSs near α duplicates was associated with an increase in breadth of gene expression and faster mRNA decay rates. The observed difference in mRNA decay rate was fastest in genes with CNSs in both nontranscribed and transcribed regions, albeit through an unknown mechanism. This study supports the notion that some Arabidopsis CNSs regulate the steady-state mRNA levels through post-transcriptional control mechanisms and that CNSs also play a role in controlling the breadth of gene expression.

  3. Evolutionary pathway to increased virulence and epidemic group A Streptococcus disease derived from 3,615 genome sequences

    Science.gov (United States)

    Nasser, Waleed; Beres, Stephen B.; Olsen, Randall J.; Dean, Melissa A.; Rice, Kelsey A.; Long, S. Wesley; Kristinsson, Karl G.; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A.; Steinbakk, Martin; Low, Donald E.; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A.; Hoffmann, Steen; Musser, James M.

    2014-01-01

    We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD+-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide. PMID:24733896

  4. Sequence co-evolutionary information is a natural partner to minimally-frustrated models of biomolecular dynamics.

    Science.gov (United States)

    Noel, Jeffrey K; Morcos, Faruck; Onuchic, Jose N

    2016-01-01

    Experimentally derived structural constraints have been crucial to the implementation of computational models of biomolecular dynamics. For example, not only does crystallography provide essential starting points for molecular simulations but also high-resolution structures permit for parameterization of simplified models. Since the energy landscapes for proteins and other biomolecules have been shown to be minimally frustrated and therefore funneled, these structure-based models have played a major role in understanding the mechanisms governing folding and many functions of these systems. Structural information, however, may be limited in many interesting cases. Recently, the statistical analysis of residue co-evolution in families of protein sequences has provided a complementary method of discovering residue-residue contact interactions involved in functional configurations. These functional configurations are often transient and difficult to capture experimentally. Thus, co-evolutionary information can be merged with that available for experimentally characterized low free-energy structures, in order to more fully capture the true underlying biomolecular energy landscape.

  5. The Complete Plastid Genome Sequence of the Secondarily Nonphotosynthetic Alga Cryptomonas paramecium: Reduction, Compaction, and Accelerated Evolutionary Rate

    Science.gov (United States)

    Donaher, Natalie; Tanifuji, Goro; Onodera, Naoko T.; Malfatti, Stephanie A.; Chain, Patrick S. G.; Hara, Yoshiaki

    2009-01-01

    The cryptomonads are a group of unicellular algae that acquired photosynthesis through the engulfment of a red algal cell, a process called secondary endosymbiosis. Here, we present the complete plastid genome sequence of the secondarily nonphotosynthetic species Cryptomonas paramecium CCAP977/2a. The ∼78 kilobase pair (Kbp) C. paramecium genome contains 82 predicted protein genes, 29 transfer RNA genes, and a single pseudogene (atpF). The C. paramecium plastid genome is approximately 50 Kbp smaller than those of the photosynthetic cryptomonads Guillardia theta and Rhodomonas salina; 71 genes present in the G. theta and/or R. salina plastid genomes are missing in C. paramecium. The pet, psa, and psb photosynthetic gene families are almost entirely absent. Interestingly, the ribosomal RNA operon, present as inverted repeats in most plastid genomes (including G. theta and R. salina), exists as a single copy in C. paramecium. The G + C content (38%) is higher in C. paramecium than in other cryptomonad plastid genomes, and C. paramecium plastid genes are characterized by significantly different codon usage patterns and increased evolutionary rates. The content and structure of the C. paramecium plastid genome provides insight into the changes associated with recent loss of photosynthesis in a predominantly photosynthetic group of algae and reveals features shared with the plastid genomes of other secondarily nonphotosynthetic eukaryotes. PMID:20333213

  6. LA CONSERVACIÓN BIOLÓGICA Y SU PERSPECTIVA EVOLUTIVA Biological Conservation and its Evolutionary Perspective

    Directory of Open Access Journals (Sweden)

    OLGA L MONTENEGRO

    Full Text Available Este artículo revisa tres de las principales causas de amenaza a la diversidad biológica, como son la fragmentación y pérdida del hábitat, así como la invasión de especies exóticas, principalmente en lo que compete a sus implicaciones evolutivas. Los efectos de la fragmentación y/o pérdida del hábitat pueden revisarse a la luz de la sinergia entre factores demográficos y genéticos que moldean cambios evolutivos o que llevan a las poblaciones al vórtice de la extinción. Las invasiones biológicas, aunque han generado pérdidas considerables en la diversidad biológica, ofrecen un escenario interesante para estudiar procesos evolutivos contemporáneos.This paper reviews three of the main threats to biological diversity, such as habitat fragmentation /habitat loss, and invasion of exotic species, mainly from their evolutionary implications. Effects of habitat fragmentation/habitat loss could be addressed by looking at the synergy between demographic and genetic factors that together shape evolutionary changes or otherwise bring populations to extinction vortex. Biological invasions, in spite of their strong negative effects on biological diversity, offer an interesting scenario to study contemporary evolutionary processes.

  7. DNA sequence conservation between the Bacillus anthracis pXO2 plasmid and genomic sequence from closely related bacteria

    Directory of Open Access Journals (Sweden)

    Sabin Robert

    2002-12-01

    Full Text Available Abstract Background Complete sequencing and annotation of the 96.2 kb Bacillus anthracis plasmid, pXO2, predicted 85 open reading frames (ORFs. Bacillus cereus and Bacillus thuringiensis isolates that ranged in genomic similarity to B. anthracis, as determined by amplified fragment length polymorphism (AFLP analysis, were examined by PCR for the presence of sequences similar to 47 pXO2 ORFs. Results The two most distantly related isolates examined, B. thuringiensis 33679 and B. thuringiensis AWO6, produced the greatest number of ORF sequences similar to pXO2; 10 detected in 33679 and 16 in AWO6. No more than two of the pXO2 ORFs were detected in any one of the remaining isolates. Dot-blot DNA hybridizations between pXO2 ORF fragments and total genomic DNA from AWO6 were consistent with the PCR assay results for this isolate and also revealed nine additional ORFs shared between these two bacteria. Sequences similar to the B. anthracis cap genes or their regulator, acpA, were not detected among any of the examined isolates. Conclusions The presence of pXO2 sequences in the other Bacillus isolates did not correlate with genomic relatedness established by AFLP analysis. The presence of pXO2 ORF sequences in other Bacillus species suggests the possibility that certain pXO2 plasmid gene functions may also be present in other closely related bacteria.

  8. Effects of using coding potential, sequence conservation and mRNA structure conservation for predicting pyrroly-sine containing genes

    DEFF Research Database (Denmark)

    Have, Christian Theil; Zambach, Sine; Christiansen, Henning

    2013-01-01

    Background Pyrrolysine (the 22nd amino acid) is in certain organisms and under certain circumstances encoded by the amber stop codon, UAG. The circumstances driving pyrrolysine translation are not well understood. The involvement of a predicted mRNA structure in the region downstream UAG has been...... these clusters according to several features that may influence pyrrolysine translation. The ranking effects of different features are assessed and we propose a weighted combination of these features which best explains the currently known pyrrolysine incorporating genes. We devote special attention...... for prediction of pyrrolysine incorporating genes in genomes of bacteria and archaea leading to insights about the factors driving pyrrolysine translation and identification of new gene candidates. The method predicts known conserved genes with high recall and predicts several other promising candidates...

  9. Phylogenetically Conserved Sequences Around Myelin P0 Stop Codon are Essential for Translational Readthrough to Produce L-MPZ.

    Science.gov (United States)

    Yamaguchi, Yoshihide; Baba, Hiroko

    2018-01-01

    Myelin protein zero (P0, MPZ) is the main cell adhesion molecule in peripheral myelin, the sequence of which is evolutionarily highly conserved. Large myelin protein zero (L-MPZ) is a novel translational readthrough molecule in mammals in a physiological status and is encoded by the P0 mRNA with an extra domain. The sequence similarities in the L-MPZ-specific region are found in humans and frogs but not in fish P0 cDNA. Actual synthesis of L-MPZ has been detected in rat and mouse sciatic nerve but not yet evaluated in frogs and humans. The production mechanism and physiological functions of L-MPZ remain unknown. Additionally, the sequence context around the canonical stop codon is significant for readthrough in viruses and yeast, but the correlation between the sequence around P0 stop codon and L-MPZ synthesis is unclear. Here, we focused on the phylogenetic pathways in L-MPZ synthesis. We have shown that L-MPZ is widely produced from frogs to humans using western blotting against L-MPZ. Mutation analysis of the sequence around the stop codon for L-MPZ synthesis using a mammalian in vitro transcription/translation system revealed that the evolutionarily conserved sequence around P0 stop codon is susceptible to readthrough and is similar to the consensus motif in viruses and yeast UAG stop codon type molecules. Our results demonstrate that the phylogenetically conserved sequence around the canonical P0 stop codon is essential for L-MPZ synthesis, suggesting that phylogenetic emergence of L-MPZ in amphibians may be related to particular distribution and/or function in the PNS myelin.

  10. Predict protein structural class for low-similarity sequences by evolutionary difference information into the general form of Chou's pseudo amino acid composition.

    Science.gov (United States)

    Zhang, Lichao; Zhao, Xiqiang; Kong, Liang

    2014-08-21

    Knowledge of protein structural class plays an important role in characterizing the overall folding type of a given protein. At present, it is still a challenge to extract sequence information solely using protein sequence for protein structural class prediction with low similarity sequence in the current computational biology. In this study, a novel sequence representation method is proposed based on position specific scoring matrix for protein structural class prediction. By defined evolutionary difference formula, varying length proteins are expressed as uniform dimensional vectors, which can represent evolutionary difference information between the adjacent residues of a given protein. To perform and evaluate the proposed method, support vector machine and jackknife tests are employed on three widely used datasets, 25PDB, 1189 and 640 datasets with sequence similarity lower than 25%, 40% and 25%, respectively. Comparison of our results with the previous methods shows that our method may provide a promising method to predict protein structural class especially for low-similarity sequences. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. The genome sequence of Brucella pinnipedialis B2/94 sheds light on the evolutionary history of the genus Brucella

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2011-07-01

    Full Text Available Abstract Background Since the discovery of the Malta fever agent, Brucella melitensis, in the 19th century, six terrestrial mammal-associated Brucella species were recognized over the next century. More recently the number of novel Brucella species has increased and among them, isolation of species B. pinnipedialis and B. ceti from marine mammals raised many questions about their origin as well as on the evolutionary history of the whole genus. Results We report here on the first complete genome sequence of a Brucella strain isolated from marine mammals, Brucella pinnipedialis strain B2/94. A whole gene-based phylogenetic analysis shows that five main groups of host-associated Brucella species rapidly diverged from a likely free-living ancestor close to the recently isolated B. microti. However, this tree lacks the resolution required to resolve the order of divergence of those groups. Comparative analyses focusing on a genome segments unshared between B. microti and B. pinnipedialis, b gene deletion/fusion events and c positions and numbers of Brucella specific IS711 elements in the available Brucella genomes provided enough information to propose a branching order for those five groups. Conclusions In this study, it appears that the closest relatives of marine mammal Brucella sp. are B. ovis and Brucella sp. NVSL 07-0026 isolated from a baboon, followed by B. melitensis and B. abortus strains, and finally the group consisting of B. suis strains, including B. canis and the group consisting of the single B. neotomae species. We were not able, however, to resolve the order of divergence of the two latter groups.

  12. The genome sequence of Brucella pinnipedialis B2/94 sheds light on the evolutionary history of the genus Brucella

    Science.gov (United States)

    2011-01-01

    Background Since the discovery of the Malta fever agent, Brucella melitensis, in the 19th century, six terrestrial mammal-associated Brucella species were recognized over the next century. More recently the number of novel Brucella species has increased and among them, isolation of species B. pinnipedialis and B. ceti from marine mammals raised many questions about their origin as well as on the evolutionary history of the whole genus. Results We report here on the first complete genome sequence of a Brucella strain isolated from marine mammals, Brucella pinnipedialis strain B2/94. A whole gene-based phylogenetic analysis shows that five main groups of host-associated Brucella species rapidly diverged from a likely free-living ancestor close to the recently isolated B. microti. However, this tree lacks the resolution required to resolve the order of divergence of those groups. Comparative analyses focusing on a) genome segments unshared between B. microti and B. pinnipedialis, b) gene deletion/fusion events and c) positions and numbers of Brucella specific IS711 elements in the available Brucella genomes provided enough information to propose a branching order for those five groups. Conclusions In this study, it appears that the closest relatives of marine mammal Brucella sp. are B. ovis and Brucella sp. NVSL 07-0026 isolated from a baboon, followed by B. melitensis and B. abortus strains, and finally the group consisting of B. suis strains, including B. canis and the group consisting of the single B. neotomae species. We were not able, however, to resolve the order of divergence of the two latter groups. PMID:21745361

  13. The genome sequence of the North-European cucumber (Cucumis sativus L. unravels evolutionary adaptation mechanisms in plants.

    Directory of Open Access Journals (Sweden)

    Rafał Wóycicki

    Full Text Available Cucumber (Cucumis sativus L., a widely cultivated crop, has originated from Eastern Himalayas and secondary domestication regions includes highly divergent climate conditions e.g. temperate and subtropical. We wanted to uncover adaptive genome differences between the cucumber cultivars and what sort of evolutionary molecular mechanisms regulate genetic adaptation of plants to different ecosystems and organism biodiversity. Here we present the draft genome sequence of the Cucumis sativus genome of the North-European Borszczagowski cultivar (line B10 and comparative genomics studies with the known genomes of: C. sativus (Chinese cultivar--Chinese Long (line 9930, Arabidopsis thaliana, Populus trichocarpa and Oryza sativa. Cucumber genomes show extensive chromosomal rearrangements, distinct differences in quantity of the particular genes (e.g. involved in photosynthesis, respiration, sugar metabolism, chlorophyll degradation, regulation of gene expression, photooxidative stress tolerance, higher non-optimal temperatures tolerance and ammonium ion assimilation as well as in distributions of abscisic acid-, dehydration- and ethylene-responsive cis-regulatory elements (CREs in promoters of orthologous group of genes, which lead to the specific adaptation features. Abscisic acid treatment of non-acclimated Arabidopsis and C. sativus seedlings induced moderate freezing tolerance in Arabidopsis but not in C. sativus. This experiment together with analysis of abscisic acid-specific CRE distributions give a clue why C. sativus is much more susceptible to moderate freezing stresses than A. thaliana. Comparative analysis of all the five genomes showed that, each species and/or cultivars has a specific profile of CRE content in promoters of orthologous genes. Our results constitute the substantial and original resource for the basic and applied research on environmental adaptations of plants, which could facilitate creation of new crops with improved growth

  14. Evolutionary History of Wild Barley (Hordeum vulgare subsp. spontaneum) Analyzed Using Multilocus Sequence Data and Paleodistribution Modeling

    Science.gov (United States)

    Jakob, Sabine S.; Rödder, Dennis; Engler, Jan O.; Shaaf, Salar; Özkan, Hakan; Blattner, Frank R.; Kilian, Benjamin

    2014-01-01

    Studies of Hordeum vulgare subsp. spontaneum, the wild progenitor of cultivated barley, have mostly relied on materials collected decades ago and maintained since then ex situ in germplasm repositories. We analyzed spatial genetic variation in wild barley populations collected rather recently, exploring sequence variations at seven single-copy nuclear loci, and inferred the relationships among these populations and toward the genepool of the crop. The wild barley collection covers the whole natural distribution area from the Mediterranean to Middle Asia. In contrast to earlier studies, Bayesian assignment analyses revealed three population clusters, in the Levant, Turkey, and east of Turkey, respectively. Genetic diversity was exceptionally high in the Levant, while eastern populations were depleted of private alleles. Species distribution modeling based on climate parameters and extant occurrence points of the taxon inferred suitable habitat conditions during the ice-age, particularly in the Levant and Turkey. Together with the ecologically wide range of habitats, they might contribute to structured but long-term stable populations in this region and their high genetic diversity. For recently collected individuals, Bayesian assignment to geographic clusters was generally unambiguous, but materials from genebanks often showed accessions that were not placed according to their assumed geographic origin or showed traces of introgression from cultivated barley. We assign this to gene flow among accessions during ex situ maintenance. Evolutionary studies based on such materials might therefore result in wrong conclusions regarding the history of the species or the origin and mode of domestication of the crop, depending on the accessions included. PMID:24586028

  15. Dominant Sequences of Human Major Histocompatibility Complex Conserved Extended Haplotypes from HLA-DQA2 to DAXX

    Science.gov (United States)

    Larsen, Charles E.; Alford, Dennis R.; Trautwein, Michael R.; Jalloh, Yanoh K.; Tarnacki, Jennifer L.; Kunnenkeri, Sushruta K.; Fici, Dolores A.; Yunis, Edmond J.; Awdeh, Zuheir L.; Alper, Chester A.

    2014-01-01

    We resequenced and phased 27 kb of DNA within 580 kb of the MHC class II region in 158 population chromosomes, most of which were conserved extended haplotypes (CEHs) of European descent or contained their centromeric fragments. We determined the single nucleotide polymorphism and deletion-insertion polymorphism alleles of the dominant sequences from HLA-DQA2 to DAXX for these CEHs. Nine of 13 CEHs remained sufficiently intact to possess a dominant sequence extending at least to DAXX, 230 kb centromeric to HLA-DPB1. We identified the regions centromeric to HLA-DQB1 within which single instances of eight “common” European MHC haplotypes previously sequenced by the MHC Haplotype Project (MHP) were representative of those dominant CEH sequences. Only two MHP haplotypes had a dominant CEH sequence throughout the centromeric and extended class II region and one MHP haplotype did not represent a known European CEH anywhere in the region. We identified the centromeric recombination transition points of other MHP sequences from CEH representation to non-representation. Several CEH pairs or groups shared sequence identity in small blocks but had significantly different (although still conserved for each separate CEH) sequences in surrounding regions. These patterns partly explain strong calculated linkage disequilibrium over only short (tens to hundreds of kilobases) distances in the context of a finite number of observed megabase-length CEHs comprising half a population's haplotypes. Our results provide a clearer picture of European CEH class II allelic structure and population haplotype architecture, improved regional CEH markers, and raise questions concerning regional recombination hotspots. PMID:25299700

  16. Mitochondrial genome sequences illuminate maternal lineages of conservation concern in a rare carnivore

    Science.gov (United States)

    Brian J. Knaus; Richard Cronn; Aaron Liston; Kristine Pilgrim; Michael K. Schwartz

    2011-01-01

    Science-based wildlife management relies on genetic information to infer population connectivity and identify conservation units. The most commonly used genetic marker for characterizing animal biodiversity and identifying maternal lineages is the mitochondrial genome. Mitochondrial genotyping figures prominently in conservation and management plans, with much of the...

  17. The evolutionary rates of HCV estimated with subtype 1a and 1b sequences over the ORF length and in different genomic regions.

    Directory of Open Access Journals (Sweden)

    Manqiong Yuan

    Full Text Available Considerable progress has been made in the HCV evolutionary analysis, since the software BEAST was released. However, prior information, especially the prior evolutionary rate, which plays a critical role in BEAST analysis, is always difficult to ascertain due to various uncertainties. Providing a proper prior HCV evolutionary rate is thus of great importance.176 full-length sequences of HCV subtype 1a and 144 of 1b were assembled by taking into consideration the balance of the sampling dates and the even dispersion in phylogenetic trees. According to the HCV genomic organization and biological functions, each dataset was partitioned into nine genomic regions and two routinely amplified regions. A uniform prior rate was applied to the BEAST analysis for each region and also the entire ORF. All the obtained posterior rates for 1a are of a magnitude of 10(-3 substitutions/site/year and in a bell-shaped distribution. Significantly lower rates were estimated for 1b and some of the rate distribution curves resulted in a one-sided truncation, particularly under the exponential model. This indicates that some of the rates for subtype 1b are less accurate, so they were adjusted by including more sequences to improve the temporal structure.Among the various HCV subtypes and genomic regions, the evolutionary patterns are dissimilar. Therefore, an applied estimation of the HCV epidemic history requires the proper selection of the rate priors, which should match the actual dataset so that they can fit for the subtype, the genomic region and even the length. By referencing the findings here, future evolutionary analysis of the HCV subtype 1a and 1b datasets may become more accurate and hence prove useful for tracing their patterns.

  18. Genome Sequence Conservation of Hendra Virus Isolates during Spillover to Horses, Australia

    Science.gov (United States)

    Todd, Shawn; Foord, Adam; Hansson, Eric; Davies, Kelly; Wright, Lynda; Morrissy, Chris; Halpin, Kim; Middleton, Deborah; Field, Hume E.; Daniels, Peter; Wang, Lin-Fa

    2010-01-01

    Bat-to-horse transmission of Hendra virus has occurred at least 14 times. Although clinical signs in horses have differed, genome sequencing has demonstrated little variation among the isolates. Our sequencing of 5 isolates from recent Hendra virus outbreaks in horses found no correlation between sequences and time or geographic location of outbreaks. PMID:21029540

  19. Parallel tagged next-generation sequencing on pooled samples - a new approach for population genetics in ecology and conservation.

    Science.gov (United States)

    Zavodna, Monika; Grueber, Catherine E; Gemmell, Neil J

    2013-01-01

    Next-generation sequencing (NGS) on pooled samples has already been broadly applied in human medical diagnostics and plant and animal breeding. However, thus far it has been only sparingly employed in ecology and conservation, where it may serve as a useful diagnostic tool for rapid assessment of species genetic diversity and structure at the population level. Here we undertake a comprehensive evaluation of the accuracy, practicality and limitations of parallel tagged amplicon NGS on pooled population samples for estimating species population diversity and structure. We obtained 16S and Cyt b data from 20 populations of Leiopelma hochstetteri, a frog species of conservation concern in New Zealand, using two approaches - parallel tagged NGS on pooled population samples and individual Sanger sequenced samples. Data from each approach were then used to estimate two standard population genetic parameters, nucleotide diversity (π) and population differentiation (FST), that enable population genetic inference in a species conservation context. We found a positive correlation between our two approaches for population genetic estimates, showing that the pooled population NGS approach is a reliable, rapid and appropriate method for population genetic inference in an ecological and conservation context. Our experimental design also allowed us to identify both the strengths and weaknesses of the pooled population NGS approach and outline some guidelines and suggestions that might be considered when planning future projects.

  20. Parallel tagged next-generation sequencing on pooled samples - a new approach for population genetics in ecology and conservation.

    Directory of Open Access Journals (Sweden)

    Monika Zavodna

    Full Text Available Next-generation sequencing (NGS on pooled samples has already been broadly applied in human medical diagnostics and plant and animal breeding. However, thus far it has been only sparingly employed in ecology and conservation, where it may serve as a useful diagnostic tool for rapid assessment of species genetic diversity and structure at the population level. Here we undertake a comprehensive evaluation of the accuracy, practicality and limitations of parallel tagged amplicon NGS on pooled population samples for estimating species population diversity and structure. We obtained 16S and Cyt b data from 20 populations of Leiopelma hochstetteri, a frog species of conservation concern in New Zealand, using two approaches - parallel tagged NGS on pooled population samples and individual Sanger sequenced samples. Data from each approach were then used to estimate two standard population genetic parameters, nucleotide diversity (π and population differentiation (FST, that enable population genetic inference in a species conservation context. We found a positive correlation between our two approaches for population genetic estimates, showing that the pooled population NGS approach is a reliable, rapid and appropriate method for population genetic inference in an ecological and conservation context. Our experimental design also allowed us to identify both the strengths and weaknesses of the pooled population NGS approach and outline some guidelines and suggestions that might be considered when planning future projects.

  1. Evolutionary analyses of KCNQ1 and HERG voltage-gated potassium channel sequences reveal location-specific susceptibility and augmented chemical severities of arrhythmogenic mutations

    Directory of Open Access Journals (Sweden)

    Accili Eric A

    2008-06-01

    Full Text Available Abstract Background Mutations in HERG and KCNQ1 potassium channels have been associated with Long QT syndrome and atrial fibrillation, and more recently with sudden infant death syndrome and sudden unexplained death. In other proteins, disease-associated amino acid mutations have been analyzed according to the chemical severity of the changes and the locations of the altered amino acids according to their conservation over metazoan evolution. Here, we present the first such analysis of arrhythmia-associated mutations (AAMs in the HERG and KCNQ1 potassium channels. Results Using evolutionary analyses, AAMs in HERG and KCNQ1 were preferentially found at evolutionarily conserved sites and unevenly distributed among functionally conserved domains. Non-synonymous single nucleotide polymorphisms (nsSNPs are under-represented at evolutionarily conserved sites in HERG, but distribute randomly in KCNQ1. AAMs are chemically more severe, according to Grantham's Scale, than changes observed in evolution and their severity correlates with the expected chemical severity of the involved codon. Expected chemical severity of a given amino acid also correlates with its relative contribution to arrhythmias. At evolutionarily variable sites, the chemical severity of the changes is also correlated with the expected chemical severity of the involved codon. Conclusion Unlike nsSNPs, AAMs preferentially locate to evolutionarily conserved, and functionally important, sites and regions within HERG and KCNQ1, and are chemically more severe than changes which occur in evolution. Expected chemical severity may contribute to the overrepresentation of certain residues in AAMs, as well as to evolutionary change.

  2. Aj-rel and Aj-p105, two evolutionary conserved NF-κB homologues in sea cucumber (Apostichopus japonicus) and their involvement in LPS induced immunity.

    Science.gov (United States)

    Wang, Tingting; Sun, Yongxin; Jin, Liji; Thacker, Philip; Li, Shuying; Xu, Yongping

    2013-01-01

    The nuclear factor κB (NF-κB) has been evolutionary conserved from insects to mammals and plays a major regulatory role in the initiation of physiological responses. In this study, we identified and characterized a primitive and functional NF-κB pathway active in the immune defence of the sea cucumber (Apostichopus japonicus). The ancient NF-κB homologues, Aj-rel and Aj-p105, share numerous signature motifs with their vertebrate orthologues, notably the Rel Homology Domain, Rel Protein Signature DNA Binding Motif, Nuclear Localization Signal and the Ankyrin Repeats for Aj-p105. Phylogenetic analyses indicate that these homologues belong to class I and II of NF-κB respectively. We examined the dimerization of Aj-rel and Aj-p105 and our results demonstrated that Aj-rel forms heterdimers with Aj-p105 and the degradation product of Aj-p105, namely Aj-p50. We further observed that LPS stimulation led to the degradation of Aj-p105 and the nuclear translocation of Aj-rel and Aj-p50. Taken together, our data indicate that the NF-κB signaling cascade is active in sea cucumber and plays a crucial role in regulating their immune defence. Our results increase the available information on sea cucumber immunity and provide new information for use in the study of the comparative and evolutionary aspects of immunity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Domain architecture conservation in orthologs.

    Science.gov (United States)

    Forslund, Kristoffer; Pekkari, Isabella; Sonnhammer, Erik L L

    2011-08-05

    As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence.To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation.The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the notion that orthologs are

  4. Domain architecture conservation in orthologs

    Science.gov (United States)

    2011-01-01

    Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the

  5. Mulan: multiple-sequence local alignment and visualization for studying function and evolution

    National Research Council Canada - National Science Library

    Ovcharenko, Ivan; Loots, Gabriela G; Giardine, Belinda M; Hou, Minmei; Ma, Jian; Hardison, Ross C; Stubbs, Lisa; Miller, Webb

    2005-01-01

    .... Here we introduce Mulan (http://mulan.dcode.org/), a novel method and a network server for comparing multiple draft and finished-quality sequences to identify functional elements conserved over evolutionary time...

  6. Large-scale sequence analysis of hemagglutinin of influenza A virus identifies conserved regions suitable for targeting an anti-viral response.

    Science.gov (United States)

    Sahini, Leepakshi; Tempczyk-Russell, Anna; Agarwal, Ritu

    2010-02-17

    Influenza A viral surface protein, hemagglutinin, is the major target of neutralizing antibody response and hence a main constituent of all vaccine formulations. But due to its marked evolutionary variability, vaccines have to be reformulated so as to include the hemagglutinin protein from the emerging new viral strain. With the constant fear of a pandemic, there is critical need for the development of anti-viral strategies that can provide wider protection against any Influenza A pathogen. An anti-viral approach that is directed against the conserved regions of the hemaggutinin protein has a potential to protect against any current and new Influenza A virus and provide a solution to this ever-present threat to public health. Influenza A human hemagglutinin protein sequences available in the NCBI database, corresponding to H1, H2, H3 and H5 subtypes, were used to identify highly invariable regions of the protein. Nine such regions were identified and analyzed for structural properties like surface exposure, hydrophilicity and residue type to evaluate their suitability for targeting an anti-peptide antibody/anti-viral response. This study has identified nine conserved regions in the hemagglutinin protein, five of which have the structural characteristics suitable for an anti-viral/anti-peptide response. This is a critical step in the design of efficient anti-peptide antibodies as novel anti-viral agents against any Influenza A pathogen. In addition, these anti-peptide antibodies will provide broadly cross-reactive immunological reagents and aid the rapid development of vaccines against new and emerging Influenza A strains.

  7. Pulsating low-mass white dwarfs in the frame of new evolutionary sequences. V. Asteroseismology of ELMV white dwarf stars

    Science.gov (United States)

    Calcaferro, Leila M.; Córsico, Alejandro H.; Althaus, Leandro G.

    2017-11-01

    Context. Many pulsating low-mass white dwarf stars have been detected in the past years in the field of our Galaxy. Some of them exhibit multiperiodic brightness variation, therefore it is possible to probe their interiors through asteroseismology. Aims: We present a detailed asteroseismological study of all the known low-mass variable white dwarf stars based on a complete set of fully evolutionary models that are representative of low-mass He-core white dwarf stars. Methods: We employed adiabatic radial and nonradial pulsation periods for low-mass white dwarf models with stellar masses ranging from 0.1554 to 0.4352 M⊙ that were derived by simulating the nonconservative evolution of a binary system consisting of an initially 1 M⊙ zero-age main-sequence (ZAMS) star and a 1.4 M⊙ neutron star companion. We estimated the mean period spacing for the stars under study (where this was possible), and then we constrained the stellar mass by comparing the observed period spacing with the average of the computed period spacings for our grid of models. We also employed the individual observed periods of every known pulsating low-mass white dwarf star to search for a representative seismological model. Results: We found that even though the stars under analysis exhibit few periods and the period fits show multiplicity of solutions, it is possible to find seismological models whose mass and effective temperature are in agreement with the values given by spectroscopy for most of the cases. Unfortunately, we were not able to constrain the stellar masses by employing the observed period spacing because, in general, only few periods are exhibited by these stars. In the two cases where we were able to extract the period spacing from the set of observed periods, this method led to stellar mass values that were substantially higher than expected for this type of stars. Conclusions: The results presented in this work show the need for further photometric searches, on the one hand

  8. Towards an evolutionary model of transcription networks.

    Directory of Open Access Journals (Sweden)

    Dan Xie

    2011-06-01

    Full Text Available DNA evolution models made invaluable contributions to comparative genomics, although it seemed formidable to include non-genomic features into these models. In order to build an evolutionary model of transcription networks (TNs, we had to forfeit the substitution model used in DNA evolution and to start from modeling the evolution of the regulatory relationships. We present a quantitative evolutionary model of TNs, subjecting the phylogenetic distance and the evolutionary changes of cis-regulatory sequence, gene expression and network structure to one probabilistic framework. Using the genome sequences and gene expression data from multiple species, this model can predict regulatory relationships between a transcription factor (TF and its target genes in all species, and thus identify TN re-wiring events. Applying this model to analyze the pre-implantation development of three mammalian species, we identified the conserved and re-wired components of the TNs downstream to a set of TFs including Oct4, Gata3/4/6, cMyc and nMyc. Evolutionary events on the DNA sequence that led to turnover of TF binding sites were identified, including a birth of an Oct4 binding site by a 2nt deletion. In contrast to recent reports of large interspecies differences of TF binding sites and gene expression patterns, the interspecies difference in TF-target relationship is much smaller. The data showed increasing conservation levels from genomic sequences to TF-DNA interaction, gene expression, TN, and finally to morphology, suggesting that evolutionary changes are larger at molecular levels and smaller at functional levels. The data also showed that evolutionarily older TFs are more likely to have conserved target genes, whereas younger TFs tend to have larger re-wiring rates.

  9. Determination of 5 '-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs

    DEFF Research Database (Denmark)

    Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens

    1999-01-01

    We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...

  10. Comparative Analysis of the Mitochondrial Genomes of Callitettixini Spittlebugs (Hemiptera: Cercopidae) Confirms the Overall High Evolutionary Speed of the AT-Rich Region but Reveals the Presence of Short Conservative Elements at the Tribal Level

    Science.gov (United States)

    Liu, Jie; Bu, Cuiping; Wipfler, Benjamin; Liang, Aiping

    2014-01-01

    The present study compares the mitochondrial genomes of five species of the spittlebug tribe Callitettixini (Hemiptera: Cercopoidea: Cercopidae) from eastern Asia. All genomes of the five species sequenced are circular double-stranded DNA molecules and range from 15,222 to 15,637 bp in length. They contain 22 tRNA genes, 13 protein coding genes (PCGs) and 2 rRNA genes and share the putative ancestral gene arrangement of insects. The PCGs show an extreme bias of nucleotide and amino acid composition. Significant differences of the substitution rates among the different genes as well as the different codon position of each PCG are revealed by the comparative evolutionary analyses. The substitution speeds of the first and second codon position of different PCGs are negatively correlated with their GC content. Among the five species, the AT-rich region features great differences in length and pattern and generally shows a 2–5 times higher substitution rate than the fastest PCG in the mitochondrial genome, atp8. Despite the significant variability in length, short conservative segments were identified in the AT-rich region within Callitettixini, although absent from the other groups of the spittlebug superfamily Cercopoidea. PMID:25285442

  11. Structure-Related Roles for the Conservation of the HIV-1 Fusion Peptide Sequence Revealed by Nuclear Magnetic Resonance.

    Science.gov (United States)

    Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles

    2017-10-17

    Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.

  12. Structure-sequence based analysis for identification of conserved regions in proteins

    Science.gov (United States)

    Zemla, Adam T; Zhou, Carol E; Lam, Marisa W; Smith, Jason R; Pardes, Elizabeth

    2013-05-28

    Disclosed are computational methods, and associated hardware and software products for scoring conservation in a protein structure based on a computationally identified family or cluster of protein structures. A method of computationally identifying a family or cluster of protein structures in also disclosed herein.

  13. Conserved hypothetical protein Rv1977 in Mycobacterium tuberculosis strains contains sequence polymorphisms and might be involved in ongoing immune evasion.

    Science.gov (United States)

    Jiang, Yi; Liu, Haican; Wang, Xuezhi; Li, Guilian; Qiu, Yan; Dou, Xiangfeng; Wan, Kanglin

    2015-01-01

    Host immune pressure and associated parasite immune evasion are key features of host-pathogen co-evolution. A previous study showed that human T cell epitopes of Mycobacterium tuberculosis are evolutionarily hyperconserved and thus it was deduced that M. tuberculosis lacks antigenic variation and immune evasion. Here, we selected 151 clinical Mycobacterium tuberculosis isolates from China, amplified gene encoding Rv1977 and compared the sequences. The results showed that Rv1977, a conserved hypothetical protein, is not conserved in M. tuberculosis strains and there are polymorphisms existed in the protein. Some mutations, especially one frameshift mutation, occurred in the antigen Rv1977, which is uncommon in M.tb strains and may lead to the protein function altering. Mutations and deletion in the gene all affect one of three T cell epitopes and the changed T cell epitope contained more than one variable position, which may suggest ongoing immune evasion.

  14. The endocrine system controlling sexual reproduction in animals: Part of the evolutionary ancient but well conserved immune system?

    Science.gov (United States)

    De Loof, Arnold; Schoofs, Liliane; Huybrechts, Roger

    2016-01-15

    Drastic changes in hormone titers, in particular of steroid hormones, are intuitively interpreted as necessary and beneficial for optimal functioning of animals. Peaks in progesterone- and estradiol titers that accompany the estrus cycle in female vertebrates as well as in ecdysteroids at each molt and during metamorphosis of holometabolous insects are prominent examples. A recent analysis of insect metamorphosis yielded the view that, in general, a sharp rise in sex steroid hormone titer signals that somewhere in the body some tissue(s) is undergoing programmed cell death/apoptosis. Increased steroid production is part of this process. Typical examples are ovarian follicle cells in female vertebrates and invertebrates and the prothoracic gland cells, the main production site of ecdysteroids in larval insects. A duality emerges: programmed cell death-apoptosis is deleterious at the cellular level, but it may yield beneficial effects at the organismal level. Reconciling both opposites requires reevaluating the probable evolutionary origin and role of peptidic brain hormones that direct steroid hormone synthesis. Do e.g. Luteinizing Hormone in vertebrates and Prothoracicotropic Hormone (PTTH: acting through the Torso receptor) in insects still retain an ancient role as toxins in the early immune system? Does the functional link of some neuropeptides with Ca(2+)-induced apoptosis make sense in endocrine archeology? The endocrine system as a remnant of the ancient immune system is undoubtedly counterintuitive. Yet, we will argue that such paradigm enables the logical framing of many aspects, the endocrine one inclusive of both male and female reproductive physiology. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Conservation of Shannon's redundancy for proteins. [information theory applied to amino acid sequences

    Science.gov (United States)

    Gatlin, L. L.

    1974-01-01

    Concepts of information theory are applied to examine various proteins in terms of their redundancy in natural originators such as animals and plants. The Monte Carlo method is used to derive information parameters for random protein sequences. Real protein sequence parameters are compared with the standard parameters of protein sequences having a specific length. The tendency of a chain to contain some amino acids more frequently than others and the tendency of a chain to contain certain amino acid pairs more frequently than other pairs are used as randomness measures of individual protein sequences. Non-periodic proteins are generally found to have random Shannon redundancies except in cases of constraints due to short chain length and genetic codes. Redundant characteristics of highly periodic proteins are discussed. A degree of periodicity parameter is derived.

  16. The evolutionary history of Xiphophorus fish and their sexually selected sword: a genome-wide approach using restriction site-associated DNA sequencing.

    Science.gov (United States)

    Jones, Julia C; Fan, Shaohua; Franchini, Paolo; Schartl, Manfred; Meyer, Axel

    2013-06-01

    Next-generation sequencing (NGS) techniques are now key tools in the detection of population genomic and gene expression differences in a large array of organisms. However, so far few studies have utilized such data for phylogenetic estimations. Here, we use NGS data obtained from genome-wide restriction site-associated DNA (RAD) (∼66000 SNPs) to estimate the phylogenetic relationships among all 26 species of swordtail and platyfish (genus Xiphophorus) from Central America. Past studies, both sequence and morphology-based, have differed in their inferences of the evolutionary relationships within this genus, particularly at the species-level and among monophyletic groupings. We show that using a large number of markers throughout the genome, we are able to infer the phylogenetic relationships with unparalleled resolution for this genus. The relationships among all three major clades and species within each of them are highly resolved and consistent under maximum likelihood, Bayesian inference and maximum parsimony. However, we also highlight the current cautions with this data type and analyses. This genus exhibits a particularly interesting evolutionary history where at least two species may have arisen through hybridization events. Here, we are able to infer the paternal lineages of these putative hybrid species. Using the RAD-marker-based tree we reconstruct the evolutionary history of the sexually selected sword trait and show that it may have been present in the common ancestor of the genus. Together our results highlight the outstanding capacity that RAD sequencing data has for resolving previously problematic phylogenetic relationships, particularly among relatively closely related species. © 2013 John Wiley & Sons Ltd.

  17. Unusual evolutionary conservation and frequent DNA segment exchange in class I genes of the major histocompatibility complex.

    OpenAIRE

    Hayashida, H; Miyata, T.

    1983-01-01

    From comparisons of homologous DNA sequences for many different genes, it was shown that the silent positions of protein-encoding regions and introns evolve at high and remarkably similar rates for different genes. In addition, both silent positions and introns behave like clocks; they accumulated base substitutions at approximately constant rates with respect to geological time. The rates of evolution were estimated to be 5.5 X 10(-9), 3.7 X 10(-9), and 5.3 X 10(-9) per site per year for sil...

  18. Identification and characterization of novel and conserved microRNAs in radish (Raphanus sativus L.) using high-throughput sequencing.

    Science.gov (United States)

    Xu, Liang; Wang, Yan; Xu, Yuanyuan; Wang, Liangju; Zhai, Lulu; Zhu, Xianwen; Gong, Yiqin; Ye, Shan; Liu, Liwang

    2013-03-01

    MicroRNAs (miRNAs) are endogenous, non-coding, small RNAs that play significant regulatory roles in plant growth, development, and biotic and abiotic stress responses. To date, a great number of conserved and species-specific miRNAs have been identified in many important plant species such as Arabidopsis, rice and poplar. However, little is known about identification of miRNAs and their target genes in radish (Raphanus sativus L.). In the present study, a small RNA library from radish root was constructed and sequenced using the high-throughput Solexa sequencing. Through sequence alignment and secondary structure prediction, a total of 545 conserved miRNA families as well as 15 novel (with their miRNA* strand) and 64 potentially novel miRNAs were identified. Quantitative real-time PCR (qRT-PCR) analysis confirmed that both conserved and novel miRNAs were expressed in radish, and some of them were preferentially expressed in certain tissues. A total of 196 potential target genes were predicted for 42 novel radish miRNAs. Gene ontology (GO) analysis showed that most of the targets were involved in plant growth, development, metabolism and stress responses. This study represents a first large-scale identification and characterization of radish miRNAs and their potential target genes. These results could lead to the further identification of radish miRNAs and enhance our understanding of radish miRNA regulatory mechanisms in diverse biological and metabolic processes. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  19. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  20. Evolutionary conservation of the signaling proteins upstream of cyclic AMP-dependent kinase and protein kinase C in gastropod mollusks.

    Science.gov (United States)

    Sossin, Wayne S; Abrams, Thomas W

    2009-01-01

    The protein kinase C (PKC) and the cAMP-dependent kinase (protein kinase A; PKA) pathways are known to play important roles in behavioral plasticity and learning in the nervous systems of a wide variety of species across phyla. We briefly review the members of the PKC and PKA family and focus on the evolution of the immediate upstream activators of PKC and PKA i.e., phospholipase C (PLC) and adenylyl cyclase (AC), and their conservation in gastropod mollusks, taking advantage of the recent assembly of the Aplysiacalifornica and Lottia gigantea genomes. The diversity of PLC and AC family members present in mollusks suggests a multitude of possible mechanisms to activate PKA and PKC; we briefly discuss the relevance of these pathways to the known physiological activation of these kinases in Aplysia neurons during plasticity and learning. These multiple mechanisms of activation provide the gastropod nervous system with tremendous flexibility for implementing neuromodulatory responses to both neuronal activity and extracellular signals. Copyright 2009 S. Karger AG, Basel.

  1. Structure of Fusarium poae virus 1 shows conserved and variable elements of partitivirus capsids and evolutionary relationships to picobirnavirus.

    Science.gov (United States)

    Tang, Jinghua; Ochoa, Wendy F; Li, Hua; Havens, Wendy M; Nibert, Max L; Ghabrial, Said A; Baker, Timothy S

    2010-12-01

    Filamentous fungus Fusarium poae is a worldwide cause of the economically important disease Fusarium head blight of cereal grains. The fungus is itself commonly infected with a bisegmented dsRNA virus from the family Partitiviridae. For this study, we determined the structure of partitivirus Fusarium poae virus 1 (FpV1) to a resolution of 5.6Å or better by electron cryomicroscopy and three-dimensional image reconstruction. The main structural features of FpV1 are consistent with those of two other fungal partitiviruses for which high-resolution structures have been recently reported. These shared features include a 120-subunit T=1 capsid comprising 60 quasisymmetrical capsid protein dimers with both shell and protruding domains. Distinguishing features are evident throughout the FpV1 capsid, however, consistent with its more massive subunits and its greater phylogenetic divergence relative to the other two structurally characterized partitiviruses. These results broaden our understanding of conserved and variable elements of fungal partitivirus structure, as well as that of vertebrate picobirnavirus, and support the suggestion that a phylogenetic subcluster of partitiviruses closely related to FpV1 should constitute a separate taxonomic genus. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. Nuclear rDNA pseudogenes in Chagas disease vectors: evolutionary implications of a new 5.8S+ITS-2 paralogous sequence marker in triatomines of North, Central and northern South America.

    Science.gov (United States)

    Bargues, M Dolores; Zuriaga, M Angeles; Mas-Coma, Santiago

    2014-01-01

    A pseudogene, paralogous to rDNA 5.8S and ITS-2, is described in Meccus dimidiata dimidiata, M. d. capitata, M. d. maculippenis, M. d. hegneri, M. sp. aff. dimidiata, M. p. phyllosoma, M. p. longipennis, M. p. pallidipennis, M. p. picturata, M. p. mazzottii, Triatoma mexicana, Triatoma nitida and Triatoma sanguisuga, covering North America, Central America and northern South America. Such a nuclear rDNA pseudogene is very rare. In the 5.8S gene, criteria for pseudogene identification included length variability, lower GC content, mutations regarding the functional uniform sequence, and relatively high base substitutions in evolutionary conserved sites. At ITS-2 level, criteria were the shorter sequence and large proportion of insertions and deletions (indels). Pseudogenic 5.8S and ITS-2 secondary structures were different from the functional foldings, different one another, showing less negative values for minimum free energy (mfe) and centroid predictions, and lower fit between mfe, partition function, and centroid structures. A complete characterization indicated a processed pseudogenic unit of the ghost type, escaping from rDNA concerted evolution and with functionality subject to constraints instead of evolving free by neutral drift. Despite a high indel number, low mutation number and an evolutionary rate similar to the functional ITS-2, that pseudogene distinguishes different taxa and furnishes coherent phylogenetic topologies with resolution similar to the functional ITS-2. The discovery of a pseudogene in many phylogenetically related species is unique in animals and allowed for an estimation of its palaeobiogeographical origin based on molecular clock data, inheritance pathways, evolutionary rate and pattern, and geographical spread. Additional to the technical risk to be considered henceforth, this relict pseudogene, designated as "ps(5.8S+ITS-2)", proves to be a valuable marker for specimen classification, phylogenetic analyses, and systematic

  3. Conservation of the C-type lectin fold for massive sequence variation in a Treponema diversity-generating retroelement

    Energy Technology Data Exchange (ETDEWEB)

    Le Coq, Johanne; Ghosh, Partho (UCSD)

    2012-06-19

    Anticipatory ligand binding through massive protein sequence variation is rare in biological systems, having been observed only in the vertebrate adaptive immune response and in a phage diversity-generating retroelement (DGR). Earlier work has demonstrated that the prototypical DGR variable protein, major tropism determinant (Mtd), meets the demands of anticipatory ligand binding by novel means through the C-type lectin (CLec) fold. However, because of the low sequence identity among DGR variable proteins, it has remained unclear whether the CLec fold is a general solution for DGRs. We have addressed this problem by determining the structure of a second DGR variable protein, TvpA, from the pathogenic oral spirochete Treponema denticola. Despite its weak sequence identity to Mtd ({approx}16%), TvpA was found to also have a CLec fold, with predicted variable residues exposed in a ligand-binding site. However, this site in TvpA was markedly more variable than the one in Mtd, reflecting the unprecedented approximate 10{sup 20} potential variability of TvpA. In addition, similarity between TvpA and Mtd with formylglycine-generating enzymes was detected. These results provide strong evidence for the conservation of the formylglycine-generating enzyme-type CLec fold among DGRs as a means of accommodating massive sequence variation.

  4. Expression of cassini, a murine gamma-satellite sequence conserved in evolution, is regulated in normal and malignant hematopoietic cells.

    Science.gov (United States)

    Arutyunyan, Anna; Stoddart, Sonia; Yi, Sun-ju; Fei, Fei; Lim, Min; Groffen, Paula; Feldhahn, Niklas; Groffen, John; Heisterkamp, Nora

    2012-08-23

    Acute lymphoblastic leukemia (ALL) cells treated with drugs can become drug-tolerant if co-cultured with protective stromal mouse embryonic fibroblasts (MEFs). We performed transcriptional profiling on these stromal fibroblasts to investigate if they were affected by the presence of drug-treated ALL cells. These mitotically inactivated MEFs showed few changes in gene expression, but a family of sequences of which transcription is significantly increased was identified. A sequence related to this family, which we named cassini, was selected for further characterization. We found that cassini was highly upregulated in drug-treated ALL cells. Analysis of RNAs from different normal mouse tissues showed that cassini expression is highest in spleen and thymus, and can be further enhanced in these organs by exposure of mice to bacterial endotoxin. Heat shock, but not other types of stress, significantly induced the transcription of this locus in ALL cells. Transient overexpression of cassini in human 293 embryonic kidney cells did not increase the cytotoxic or cytostatic effects of chemotherapeutic drugs but provided some protection. Database searches revealed that sequences highly homologous to cassini are present in rodents, apicomplexans, flatworms and primates, indicating that they are conserved in evolution. Moreover, CASSINI RNA was induced in human ALL cells treated with vincristine. Surprisingly, cassini belongs to the previously reported murine family of γ-satellite/major satellite DNA sequences, which were not known to be present in other species. Our results show that the transcription of at least one member of these sequences is regulated, suggesting that this has a function in normal and transformed immune cells. Expression of these sequences may protect cells when they are exposed to specific stress stimuli.

  5. Expression of cassini, a murine gamma-satellite sequence conserved in evolution, is regulated in normal and malignant hematopoietic cells

    Directory of Open Access Journals (Sweden)

    Arutyunyan Anna

    2012-08-01

    Full Text Available Abstract Background Acute lymphoblastic leukemia (ALL cells treated with drugs can become drug-tolerant if co-cultured with protective stromal mouse embryonic fibroblasts (MEFs. Results We performed transcriptional profiling on these stromal fibroblasts to investigate if they were affected by the presence of drug-treated ALL cells. These mitotically inactivated MEFs showed few changes in gene expression, but a family of sequences of which transcription is significantly increased was identified. A sequence related to this family, which we named cassini, was selected for further characterization. We found that cassini was highly upregulated in drug-treated ALL cells. Analysis of RNAs from different normal mouse tissues showed that cassini expression is highest in spleen and thymus, and can be further enhanced in these organs by exposure of mice to bacterial endotoxin. Heat shock, but not other types of stress, significantly induced the transcription of this locus in ALL cells. Transient overexpression of cassini in human 293 embryonic kidney cells did not increase the cytotoxic or cytostatic effects of chemotherapeutic drugs but provided some protection. Database searches revealed that sequences highly homologous to cassini are present in rodents, apicomplexans, flatworms and primates, indicating that they are conserved in evolution. Moreover, CASSINI RNA was induced in human ALL cells treated with vincristine. Surprisingly, cassini belongs to the previously reported murine family of γ-satellite/major satellite DNA sequences, which were not known to be present in other species. Conclusions Our results show that the transcription of at least one member of these sequences is regulated, suggesting that this has a function in normal and transformed immune cells. Expression of these sequences may protect cells when they are exposed to specific stress stimuli.

  6. Molecular Characterization and Expression Profiling of Brachypodium distachyon L. Cystatin Genes Reveal High Evolutionary Conservation and Functional Divergence in Response to Abiotic Stress

    Directory of Open Access Journals (Sweden)

    Saminathan Subburaj

    2017-05-01

    Full Text Available Cystatin is a class of proteins mainly involved in cysteine protease inhibition and plant growth and development, as well as tolerance under various abiotic stresses. In this study, we performed the first comprehensive analysis of the molecular characterization and expression profiling in response to various abiotic stresses of the cystatin gene family in Brachypodium distachyon, a novel model plant for Triticum species with huge genomes. Comprehensive searches of the Brachypodium genome database identified 25 B. distachyon cystatin (BdC genes that are distributed unevenly on chromosomes; of these, nine and two were involved in tandem and segmental duplication events, respectively. All BdC genes had similar exon/intron structural organization, with three conserved motifs similar to those from other plant species, indicating their high evolutionary conservation. Expression profiling of 10 typical BdC genes revealed ubiquitous expression in different organs at varying expression levels. BdC gene expression in seedling leaves was particularly highly induced by various abiotic stresses, including the plant hormone abscisic acid and various environmental cues (cold, H2O2, CdCl2, salt, and drought. Interestingly, most BdC genes were significantly upregulated under multiple abiotic stresses, including BdC15 under all stresses, BdC7-2 and BdC10 under five stresses, and BdC7-1, BdC2-1, BdC14, and BdC12 under four stresses. The putative metabolic pathways of cytastin genes in response to various abiotic stresses mainly involve the aberrant protein degradation pathway and reactive oxygen species (ROS-triggered programmed cell death signaling pathways. These observations provide a better understanding of the structural and functional characteristics of the plant cystatin gene family.

  7. A novel bioinformatics pipeline to discover genes related to arbuscular mycorrhizal symbiosis based on their evolutionary conservation pattern among higher plants.

    Science.gov (United States)

    Favre, Patrick; Bapaume, Laure; Bossolini, Eligio; Delorenzi, Mauro; Falquet, Laurent; Reinhardt, Didier

    2014-12-03

    Genes involved in arbuscular mycorrhizal (AM) symbiosis have been identified primarily by mutant screens, followed by identification of the mutated genes (forward genetics). In addition, a number of AM-related genes has been identified by their AM-related expression patterns, and their function has subsequently been elucidated by knock-down or knock-out approaches (reverse genetics). However, genes that are members of functionally redundant gene families, or genes that have a vital function and therefore result in lethal mutant phenotypes, are difficult to identify. If such genes are constitutively expressed and therefore escape differential expression analyses, they remain elusive. The goal of this study was to systematically search for AM-related genes with a bioinformatics strategy that is insensitive to these problems. The central element of our approach is based on the fact that many AM-related genes are conserved only among AM-competent species. Our approach involves genome-wide comparisons at the proteome level of AM-competent host species with non-mycorrhizal species. Using a clustering method we first established orthologous/paralogous relationships and subsequently identified protein clusters that contain members only of the AM-competent species. Proteins of these clusters were then analyzed in an extended set of 16 plant species and ranked based on their relatedness among AM-competent monocot and dicot species, relative to non-mycorrhizal species. In addition, we combined the information on the protein-coding sequence with gene expression data and with promoter analysis. As a result we present a list of yet uncharacterized proteins that show a strongly AM-related pattern of sequence conservation, indicating that the respective genes may have been under selection for a function in AM. Among the top candidates are three genes that encode a small family of similar receptor-like kinases that are related to the S-locus receptor kinases involved in sporophytic

  8. A conserved unusual posttranscriptional processing mediated by short, direct repeated (SDR) sequences in plants.

    Science.gov (United States)

    Niu, Xiangli; Luo, Di; Gao, Shaopei; Ren, Guangjun; Chang, Lijuan; Zhou, Yuke; Luo, Xiaoli; Li, Yuxiang; Hou, Pei; Tang, Wei; Lu, Bao-Rong; Liu, Yongsheng

    2010-01-01

    In several stress responsive gene loci of monocot cereal crops, we have previously identified an unusual posttranscriptional processing mediated by paired presence of short direct repeated (SDR) sequences at 5' and 3' splicing junctions that are distinct from conventional (U2/U12-type) splicing boundaries. By using the known SDR-containing sequences as probes, 24 plant candidate genes involved in diverse functional pathways from both monocots and dicots that potentially possess SDR-mediated posttranscriptional processing were predicted in the GenBank database. The SDRs-mediated posttranscriptional processing events including cis- and trans-actions were experimentally detected in majority of the predicted candidates. Extensive sequence analysis demonstrates several types of SDR-associated splicing peculiarities including partial exon deletion, exon fragment repetition, exon fragment scrambling and trans-splicing that result in either loss of partial exon or unusual exonic sequence rearrangements within or between RNA molecules. In addition, we show that the paired presence of SDR is necessary but not sufficient in SDR-mediated splicing in transient expression and stable transformation systems. We also show prokaryote is incapable of SDR-mediated premRNA splicing. Copyright 2010 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  9. An atlas of over 90.000 conserved noncoding sequences provides insight into crucifer regulatory regions

    NARCIS (Netherlands)

    Haudry, A.; Platts, A.E.; Vello, E.; Hoen, D.R.; Leclerq, M.; Williamson, R.J.; Forczek, E.; Joly-Lopez, Z.; Steffen, J.G.; Hazzouri, K.M.; Dewar, K.; Stinchcombe, J.R.; Schoen, D.J.; Wang, X.; Schmutz, J.; Town, C.D.; Edger, P.P.; Pires, J.C.; Schumaker, K.S.; Jarvis, D.E.; Mandakova, T.; Lysak, M.; Bergh, van den E.; Schranz, M.E.; Harrison, P.M.

    2013-01-01

    Despite the central importance of noncoding DNA to gene regulation and evolution, understanding of the extent of selection on plant noncoding DNA remains limited compared to that of other organisms. Here we report sequencing of genomes from three Brassicaceae species (Leavenworthia alabamica,

  10. Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

    Science.gov (United States)

    Zhang, Qiang; Rahim, Mir Munir A; Allan, David S J; Tu, Megan M; Belanger, Simon; Abou-Samra, Elias; Ma, Jaehun; Sekhon, Harman S; Fairhead, Todd; Zein, Haggag S; Carlyle, James R; Anderson, Stephen K; Makrigiannis, Andrew P

    2012-01-01

    The Nkrp1 (Klrb1)-Clr (Clec2) genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b), Nkrp1c (Klrb1c), and Clr-c (Clec2f) genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d) and Clr-g (Clec2i) showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells), as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.

  11. Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    Full Text Available The Nkrp1 (Klrb1-Clr (Clec2 genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b, Nkrp1c (Klrb1c, and Clr-c (Clec2f genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d and Clr-g (Clec2i showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells, as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.

  12. Sequence divergence and conservation in genomes of Helicobacter cetorum strains from a dolphin and a whale.

    Science.gov (United States)

    Kersulyte, Dangeruta; Rossi, Mirko; Berg, Douglas E

    2013-01-01

    Strains of Helicobacter cetorum have been cultured from several marine mammals and have been found to be closely related in 16 S rDNA sequence to the human gastric pathogen H. pylori, but their genomes were not characterized further. The genomes of H. cetorum strains from a dolphin and a whale were sequenced completely using 454 technology and PCR and capillary sequencing. These genomes are 1.8 and 1.95 mb in size, some 7-26% larger than H. pylori genomes, and differ markedly from one another in gene content, and sequences and arrangements of shared genes. However, each strain is more related overall to H. pylori and its descendant H. acinonychis than to other known species. These H. cetorum strains lack cag pathogenicity islands, but contain novel alleles of the virulence-associated vacuolating cytotoxin (vacA) gene. Of particular note are (i) an extra triplet of vacA genes with ≤50% protein-level identity to each other in the 5' two-thirds of the gene needed for host factor interaction; (ii) divergent sets of outer membrane protein genes; (iii) several metabolic genes distinct from those of H. pylori; (iv) genes for an iron-cofactored urease related to those of Helicobacter species from terrestrial carnivores, in addition to genes for a nickel co-factored urease; and (v) members of the slr multigene family, some of which modulate host responses to infection and improve Helicobacter growth with mammalian cells. Our genome sequence data provide a glimpse into the novelty and great genetic diversity of marine helicobacters. These data should aid further analyses of microbial genome diversity and evolution and infection and disease mechanisms in vast and often fragile ocean ecosystems.

  13. Sequence divergence and conservation in genomes of Helicobacter cetorum strains from a dolphin and a whale.

    Directory of Open Access Journals (Sweden)

    Dangeruta Kersulyte

    Full Text Available Strains of Helicobacter cetorum have been cultured from several marine mammals and have been found to be closely related in 16 S rDNA sequence to the human gastric pathogen H. pylori, but their genomes were not characterized further.The genomes of H. cetorum strains from a dolphin and a whale were sequenced completely using 454 technology and PCR and capillary sequencing.These genomes are 1.8 and 1.95 mb in size, some 7-26% larger than H. pylori genomes, and differ markedly from one another in gene content, and sequences and arrangements of shared genes. However, each strain is more related overall to H. pylori and its descendant H. acinonychis than to other known species. These H. cetorum strains lack cag pathogenicity islands, but contain novel alleles of the virulence-associated vacuolating cytotoxin (vacA gene. Of particular note are (i an extra triplet of vacA genes with ≤50% protein-level identity to each other in the 5' two-thirds of the gene needed for host factor interaction; (ii divergent sets of outer membrane protein genes; (iii several metabolic genes distinct from those of H. pylori; (iv genes for an iron-cofactored urease related to those of Helicobacter species from terrestrial carnivores, in addition to genes for a nickel co-factored urease; and (v members of the slr multigene family, some of which modulate host responses to infection and improve Helicobacter growth with mammalian cells.Our genome sequence data provide a glimpse into the novelty and great genetic diversity of marine helicobacters. These data should aid further analyses of microbial genome diversity and evolution and infection and disease mechanisms in vast and often fragile ocean ecosystems.

  14. Evolutionary Conserved Function of Barley and Arabidopsis 3-KETOACYL-CoA SYNTHASES in Providing Wax Signals for Germination of Powdery Mildew Fungi1[C][W

    Science.gov (United States)

    Weidenbach, Denise; Jansen, Marcus; Franke, Rochus B.; Hensel, Goetz; Weissgerber, Wiebke; Ulferts, Sylvia; Jansen, Irina; Schreiber, Lukas; Korzun, Viktor; Pontzen, Rolf; Kumlehn, Jochen; Pillen, Klaus; Schaffrath, Ulrich

    2014-01-01

    For plant pathogenic fungi, such as powdery mildews, that survive only on a limited number of host plant species, it is a matter of vital importance that their spores sense that they landed on the right spot to initiate germination as quickly as possible. We investigated a barley (Hordeum vulgare) mutant with reduced epicuticular leaf waxes on which spores of adapted and nonadapted powdery mildew fungi showed reduced germination. The barley gene responsible for the mutant wax phenotype was cloned in a forward genetic screen and identified to encode a 3-KETOACYL-CoA SYNTHASE (HvKCS6), a protein participating in fatty acid elongation and required for synthesis of epicuticular waxes. Gas chromatography-mass spectrometry analysis revealed that the mutant has significantly fewer aliphatic wax constituents with a chain length above C-24. Complementation of the mutant restored wild-type wax and overcame germination penalty, indicating that wax constituents less present on the mutant are a crucial clue for spore germination. Investigation of Arabidopsis (Arabidopsis thaliana) transgenic plants with sense silencing of Arabidopsis REQUIRED FOR CUTICULAR WAX PRODUCTION1, the HvKCS6 ortholog, revealed the same germination phenotype against adapted and nonadapted powdery mildew fungi. Our findings hint to an evolutionary conserved mechanism for sensing of plant surfaces among distantly related powdery mildews that is based on KCS6-derived wax components. Perception of such a signal must have been evolved before the monocot-dicot split took place approximately 150 million years ago. PMID:25201879

  15. RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more

    Science.gov (United States)

    Salgado, Heladia; Peralta-Gil, Martin; Gama-Castro, Socorro; Santos-Zavaleta, Alberto; Muñiz-Rascado, Luis; García-Sotelo, Jair S.; Weiss, Verena; Solano-Lira, Hilda; Martínez-Flores, Irma; Medina-Rivera, Alejandra; Salgado-Osorio, Gerardo; Alquicira-Hernández, Shirley; Alquicira-Hernández, Kevin; López-Fuentes, Alejandra; Porrón-Sotelo, Liliana; Huerta, Araceli M.; Bonavides-Martínez, César; Balderas-Martínez, Yalbi I.; Pannier, Lucia; Olvera, Maricela; Labastida, Aurora; Jiménez-Jacinto, Verónica; Vega-Alvarado, Leticia; del Moral-Chávez, Victor; Hernández-Alvarez, Alfredo; Morett, Enrique; Collado-Vides, Julio

    2013-01-01

    This article summarizes our progress with RegulonDB (http://regulondb.ccg.unam.mx/) during the past 2 years. We have kept up-to-date the knowledge from the published literature regarding transcriptional regulation in Escherichia coli K-12. We have maintained and expanded our curation efforts to improve the breadth and quality of the encoded experimental knowledge, and we have implemented criteria for the quality of our computational predictions. Regulatory phrases now provide high-level descriptions of regulatory regions. We expanded the assignment of quality to various sources of evidence, particularly for knowledge generated through high-throughput (HT) technology. Based on our analysis of most relevant methods, we defined rules for determining the quality of evidence when multiple independent sources support an entry. With this latest release of RegulonDB, we present a new highly reliable larger collection of transcription start sites, a result of our experimental HT genome-wide efforts. These improvements, together with several novel enhancements (the tracks display, uploading format and curational guidelines), address the challenges of incorporating HT-generated knowledge into RegulonDB. Information on the evolutionary conservation of regulatory elements is also available now. Altogether, RegulonDB version 8.0 is a much better home for integrating knowledge on gene regulation from the sources of information currently available. PMID:23203884

  16. Peptomics, identification of novel cationic Arabidopsis peptides with conserved sequence motifs

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Mundy, John; Skriver, Karen

    2002-01-01

    Few plant peptides involved in intercellular communication have been experimentally isolated. Sequence analysis of the Arabidopsis thaliana genome has revealed numerous transmembrane receptors predicted to bind proteinacious ligands, emphasizing the importance of identifying peptides with signaling...... initially performed a systematic analysis of short polypeptides encoded by annotated genes on two Arabidopsis chromosomes using SignalP to identify potentially secreted peptides. Subsequent homology searches with selected, putatively secreted peptides, led to the identification of a potential, large...... function. Annotation of the Arabidopsis genome sequence has made it possible to identify peptide-encoding genes. However, such annotational identification is impeded because small genes are poorly predicted by gene-prediction algorithms, thus prompting the alternative approaches described here. We...

  17. The First Myriapod Genome Sequence Reveals Conservative Arthropod Gene Content and Genome Organisation in the Centipede Strigamia maritima

    Science.gov (United States)

    Chipman, Ariel D.; Ferrier, David E. K.; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S. T.; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C.; Alonso, Claudio R.; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C. J.; Blankenburg, Kerstin P.; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K.; Du Pasquier, Louis; Duncan, Elizabeth J.; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D.; Extavour, Cassandra G.; Francisco, Liezl; Gabaldón, Toni; Gillis, William J.; Goodwin-Horn, Elizabeth A.; Green, Jack E.; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J. P.; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H. L.; Hunn, Julia P.; Hunnekuhl, Vera S.; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N.; Jiggins, Francis M.; Jones, Tamsin E.; Kaiser, Tobias S.; Kalra, Divya; Kenny, Nathan J.; Korchina, Viktoriya; Kovar, Christie L.; Kraus, F. Bernhard; Lapraz, François; Lee, Sandra L.; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N.; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J.; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H.; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C.; Robertson, Helen E.; Robertson, Hugh M.; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E.; Schurko, Andrew M.; Siggens, Kenneth W.; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J.; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M.; Willis, Judith H.; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M.; Worley, Kim C.; Gibbs, Richard A.; Akam, Michael; Richards, Stephen

    2014-01-01

    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations to its specific

  18. The first myriapod genome sequence reveals conservative arthropod gene content and genome organisation in the centipede Strigamia maritima.

    Directory of Open Access Journals (Sweden)

    Ariel D Chipman

    2014-11-01

    Full Text Available Myriapods (e.g., centipedes and millipedes display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations

  19. [Prognostic value of sequencing of radiotherapy and chemotherapy following breast-conserving surgery for patients with breast cancer].

    Science.gov (United States)

    Zhong, Q Z; Wang, Z; Tang, Y; Rong, Q L; Wang, S L; Jin, J; Wang, W H; Liu, Y P; Song, Y W; Fang, H; Chen, B; Qi, S N; Li, N; Tang, Y; Zhang, J H; Li, Y X

    2017-04-23

    Objective: To evaluate the prognostic value of sequencing of adjuvant radiotherapy and chemotherapy following breast-conserving surgery for patients with breast cancer. Methods: A total of 1 154 patients withT1-2N0-3M0 breast cancer retrospectively reviewed. All patients received sequential radiotherapy and chemotherapy following breast-conserving surgery. Among them, 603 patients received radiotherapy first and 551 patients received chemotherapy first. Log-rank tests were used to determine significance of disease-free survival (DFS) and overall survival (OS) rates in the Kaplan-Meier curve. Results: The 5-year DFS and OS rates for all patients were 93.0% and 97.8%. The 5-year OS rate was 98.6% in the radiotherapy first group and 96.4% in the chemotherapy first group (P=0.191), and the corresponding DFS rate was 92.7% and 93.2% (P=0.430), respectively. Among the patients with Luminal A subtype, the 5-year OS rate was 99.6% in the radiotherapy first group and 97.8% in the chemotherapy first group (P=0.789). Among the patients with Luminal B subtype, the 5-year OS rate was 94.2% and 96.0%, respectively (P=0.680). Among the patients with triple negative breast cancer, the 5-year OS rate was 100% and 90.9%, respectively, with statistically significant differences (P=0.019). Among the patients with HER-2 positive breast cancer, The 5-year DFS rate was 80.1% and 100%, respectively (P=0.045). Conclusions: The OS and DFS rates in the chemotherapy first group are not significantly different from those of radiotherapy first group after breast-conserving surgery. Patients with HER-2 positive breast cancer in chemotherapy first group have a much higher DFS rate than that of radiotherapy first group, whereas patients with triple negative breast cancer in radiotherapy first group have a better OS rate than that of chemotherapy first group. Further research is warranted to investigate the benefit of different molecular types in different sequencing of radiotherapy and

  20. Bridging the physical scales in evolutionary biology: from protein sequence space to fitness of organisms and populations.

    Science.gov (United States)

    Bershtein, Shimon; Serohijos, Adrian Wr; Shakhnovich, Eugene I

    2017-02-01

    Bridging the gap between the molecular properties of proteins and organismal/population fitness is essential for understanding evolutionary processes. This task requires the integration of the several physical scales of biological organization, each defined by a distinct set of mechanisms and constraints, into a single unifying model. The molecular scale is dominated by the constraints imposed by the physico-chemical properties of proteins and their substrates, which give rise to trade-offs and epistatic (non-additive) effects of mutations. At the systems scale, biological networks modulate protein expression and can either buffer or enhance the fitness effects of mutations. The population scale is influenced by the mutational input, selection regimes, and stochastic changes affecting the size and structure of populations, which eventually determine the evolutionary fate of mutations. Here, we summarize the recent advances in theory, computer simulations, and experiments that advance our understanding of the links between various physical scales in biology. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. A model of the statistical power of comparative genome sequence analysis.

    Directory of Open Access Journals (Sweden)

    Sean R Eddy

    2005-01-01

    Full Text Available Comparative genome sequence analysis is powerful, but sequencing genomes is expensive. It is desirable to be able to predict how many genomes are needed for comparative genomics, and at what evolutionary distances. Here I describe a simple mathematical model for the common problem of identifying conserved sequences. The model leads to some useful rules of thumb. For a given evolutionary distance, the number of comparative genomes needed for a constant level of statistical stringency in identifying conserved regions scales inversely with the size of the conserved feature to be detected. At short evolutionary distances, the number of comparative genomes required also scales inversely with distance. These scaling behaviors provide some intuition for future comparative genome sequencing needs, such as the proposed use of "phylogenetic shadowing" methods using closely related comparative genomes, and the feasibility of high-resolution detection of small conserved features.

  2. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  3. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    OpenAIRE

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

    2010-01-01

    Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB...

  4. Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

    Directory of Open Access Journals (Sweden)

    Apurva Barve

    2013-01-01

    Full Text Available Xeroderma pigmentosum group A (XPA is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1 and replication protein A 70 kDa subunit (RPA70 proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  5. Structural and sequence similarities of hydra xeroderma pigmentosum A protein to human homolog suggest early evolution and conservation.

    Science.gov (United States)

    Barve, Apurva; Ghaskadbi, Saroj; Ghaskadbi, Surendra

    2013-01-01

    Xeroderma pigmentosum group A (XPA) is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER) pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1) and replication protein A 70 kDa subunit (RPA70) proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  6. The evolutionary fate of the chloroplast and nuclear rps16 genes as revealed through the sequencing and comparative analyses of four novel legume chloroplast genomes from Lupinus.

    Science.gov (United States)

    Keller, J; Rousseau-Gueutin, M; Martin, G E; Morice, J; Boutte, J; Coissac, E; Ourari, M; Aïnouche, M; Salmon, A; Cabello-Hurtado, F; Aïnouche, A

    2017-08-01

    The Fabaceae family is considered as a model system for understanding chloroplast genome evolution due to the presence of extensive structural rearrangements, gene losses and localized hypermutable regions. Here, we provide sequences of four chloroplast genomes from the Lupinus genus, belonging to the underinvestigated Genistoid clade. Notably, we found in Lupinus species the functional loss of the essential rps16 gene, which was most likely replaced by the nuclear rps16 gene that encodes chloroplast and mitochondrion targeted RPS16 proteins. To study the evolutionary fate of the rps16 gene, we explored all available plant chloroplast, mitochondrial and nuclear genomes. Whereas no plant mitochondrial genomes carry an rps16 gene, many plants still have a functional nuclear and chloroplast rps16 gene. Ka/Ks ratios revealed that both chloroplast and nuclear rps16 copies were under purifying selection. However, due to the dual targeting of the nuclear rps16 gene product and the absence of a mitochondrial copy, the chloroplast gene may be lost. We also performed comparative analyses of lupine plastomes (SNPs, indels and repeat elements), identified the most variable regions and examined their phylogenetic utility. The markers identified here will help to reveal the evolutionary history of lupines, Genistoids and closely related clades. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  7. Multi-Objective Analysis Applied to Mixed-Model Assembly Line Sequencing Problem through Elite Induced Evolutionary Method

    Science.gov (United States)

    Shimizu, Yoshiaki; Sakaguchi, Tatsuhiko; Pralomkarn, Theerayoth

    To meet higher customer satisfaction and shorter production lead time, assembly lines are shifting to mixed-model assembly lines. Accordingly, sequencing is becoming an increasingly important operation scheduling that directly affects on efficiency of the entire process. In this study, such sequencing problem at the mixed-model assembly line has been formulated as a bi-objective integer programming problem so that decision making through trade-off analysis can bring about significant production improvements. Then we have developed a multi-objective analysis method by hybridizing conventional and recent meta-heuristic methods. After showing its generic idea, the car mixed-model assembly line sequencing problem is concerned as a case study. Certain measures are also introduced to quantitatively evaluate the performances of the method through comparison.

  8. Transcriptome sequencing of the blind subterranean mole rat, Spalax galili: utility and potential for the discovery of novel evolutionary patterns.

    Science.gov (United States)

    Malik, Assaf; Korol, Abraham; Hübner, Sariel; Hernandez, Alvaro G; Thimmapuram, Jyothi; Ali, Shahjahan; Glaser, Fabian; Paz, Arnon; Avivi, Aaron; Band, Mark

    2011-01-01

    The blind subterranean mole rat (Spalax ehrenbergi superspecies) is a model animal for survival under extreme environments due to its ability to live in underground habitats under severe hypoxic stress and darkness. Here we report the transcriptome sequencing of Spalax galili, a chromosomal type of S. ehrenbergi. cDNA pools from muscle and brain tissues isolated from animals exposed to hypoxic and normoxic conditions were sequenced using Sanger, GS FLX, and GS FLX Titanium technologies. Assembly of the sequences yielded over 51,000 isotigs with homology to ∼12,000 mouse, rat or human genes. Based on these results, it was possible to detect large numbers of splice variants, SNPs, and novel transcribed regions. In addition, multiple differential expression patterns were detected between tissues and treatments. The results presented here will serve as a valuable resource for future studies aimed at identifying genes and gene regions evolved during the adaptive radiation associated with underground life of the blind mole rat.

  9. The complete chloroplast genome sequence of Podocarpus lambertii: genome structure, evolutionary aspects, gene content and SSR detection.

    Directory of Open Access Journals (Sweden)

    Leila do Nascimento Vieira

    Full Text Available BACKGROUND: Podocarpus lambertii (Podocarpaceae is a native conifer from the Brazilian Atlantic Forest Biome, which is considered one of the 25 biodiversity hotspots in the world. The advancement of next-generation sequencing technologies has enabled the rapid acquisition of whole chloroplast (cp genome sequences at low cost. Several studies have proven the potential of cp genomes as tools to understand enigmatic and basal phylogenetic relationships at different taxonomic levels, as well as further probe the structural and functional evolution of plants. In this work, we present the complete cp genome sequence of P. lambertii. METHODOLOGY/PRINCIPAL FINDINGS: The P. lambertii cp genome is 133,734 bp in length, and similar to other sequenced cupressophytes, it lacks one of the large inverted repeat regions (IR. It contains 118 unique genes and one duplicated tRNA (trnN-GUU, which occurs as an inverted repeat sequence. The rps16 gene was not found, which was previously reported for the plastid genome of another Podocarpaceae (Nageia nagi and Araucariaceae (Agathis dammara. Structurally, P. lambertii shows 4 inversions of a large DNA fragment ∼20,000 bp compared to the Podocarpus totara cp genome. These unexpected characteristics may be attributed to geographical distance and different adaptive needs. The P. lambertii cp genome presents a total of 28 tandem repeats and 156 SSRs, with homo- and dipolymers being the most common and tri-, tetra-, penta-, and hexapolymers occurring with less frequency. CONCLUSION: The complete cp genome sequence of P. lambertii revealed significant structural changes, even in species from the same genus. These results reinforce the apparently loss of rps16 gene in Podocarpaceae cp genome. In addition, several SSRs in the P. lambertii cp genome are likely intraspecific polymorphism sites, which may allow highly sensitive phylogeographic and population structure studies, as well as phylogenetic studies of species of

  10. Evolutionary inferences based on ITS rDNA and actin sequences reveal extensive diversity of the common lichen alga Asterochloris (Trebouxiophyceae, Chlorophyta).

    Science.gov (United States)

    Skaloud, Pavel; Peksa, Ondrej

    2010-01-01

    The genus Asterochloris is one of the most common lichen photobionts. We present a molecular investigation of 41 cultured strains, for which nuclear-encoded ITS rDNA and partial actin I sequences were determined. The loci studied revealed considerable differences in their evolutionary dynamics as well as sequence variation. As compared to ITS data, the actin sequences show much greater variation, and the phylogenies yield strong resolution and support of many internal branches. The partitioning of ITS dataset into several regions yielded better node resolution. We recognized 16 well-supported monophyletic lineages, of which one represents the type species of the genus (Asterochloris phycobiontica), and six correspond to species previously classified to the genus Trebouxia (T. erici, T. excentrica, T. glomerata, T. irregularis, T. italiana and T. magna). Only 15% of isolated photobionts considered in our study could be assigned with certainty to previously described species, emphasizing amazing cryptic variability in Asterochloris. Concurrently with the formal delimitation of the genus Asterochloris, we propose new combinations for the former Trebouxia species; furthermore, T. pyriformis is reduced to a synonym of A. glomerata. The present knowledge of global diversity of Asterochloris algae is discussed.

  11. Identification of specific gene sequences conserved in contemporary epidemic strains of Salmonella enterica.

    Science.gov (United States)

    Kang, Min-Su; Besser, Thomas E; Hancock, Dale D; Porwollik, Steffen; McClelland, Michael; Call, Douglas R

    2006-11-01

    Genetic elements specific to recent and contemporary epidemic strains of Salmonella enterica were identified using comparative genomic analysis. Two epidemic multidrug-resistant (MDR) strains, MDR Salmonella enterica serovar Typhimurium definitive phage type 104 (DT104) and cephalosporin-resistant MDR Salmonella enterica serovar Newport, and an epidemic pansusceptible strain, Salmonella serovar Typhimurium DT160, were subjected to Salmonella gene microarray and suppression subtractive hybridization analyses. Their genome contents were compared with those of coexisting sporadic strains matched by serotype, geographic and temporal distribution, and host species origin. These paired comparisons revealed that epidemic strains of S. enterica had specific genes and gene regions that were shared by isolates of the same subtype. Most of these gene sequences are related to mobile genetic elements, including phages, plasmids, and plasmid-like and transposable elements, and some genes may encode proteins conferring growth or survival advantages. The emergence of epidemic MDR strains may therefore be associated with the presence of fitness-associated genetic factors in addition to their antimicrobial resistance genes.

  12. Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development

    Directory of Open Access Journals (Sweden)

    Wang Yen-Yi

    2011-04-01

    Full Text Available Abstract Background Flower development in kiwifruit (Actinidia spp. is initiated in the first growing season, when undifferentiated primordia are established in latent shoot buds. These primordia can differentiate into flowers in the second growing season, after the winter dormancy period and upon accumulation of adequate winter chilling. Kiwifruit is an important horticultural crop, yet little is known about the molecular regulation of flower development. Results To study kiwifruit flower development, nine MADS-box genes were identified and functionally characterized. Protein sequence alignment, phenotypes obtained upon overexpression in Arabidopsis and expression patterns suggest that the identified genes are required for floral meristem and floral organ specification. Their role during budbreak and flower development was studied. A spontaneous kiwifruit mutant was utilized to correlate the extended expression domains of these flowering genes with abnormal floral development. Conclusions This study provides a description of flower development in kiwifruit at the molecular level. It has identified markers for flower development, and candidates for manipulation of kiwifruit growth, phase change and time of flowering. The expression in normal and aberrant flowers provided a model for kiwifruit flower development.

  13. Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development.

    Science.gov (United States)

    Varkonyi-Gasic, Erika; Moss, Sarah M; Voogd, Charlotte; Wu, Rongmei; Lough, Robyn H; Wang, Yen-Yi; Hellens, Roger P

    2011-04-27

    Flower development in kiwifruit (Actinidia spp.) is initiated in the first growing season, when undifferentiated primordia are established in latent shoot buds. These primordia can differentiate into flowers in the second growing season, after the winter dormancy period and upon accumulation of adequate winter chilling. Kiwifruit is an important horticultural crop, yet little is known about the molecular regulation of flower development. To study kiwifruit flower development, nine MADS-box genes were identified and functionally characterized. Protein sequence alignment, phenotypes obtained upon overexpression in Arabidopsis and expression patterns suggest that the identified genes are required for floral meristem and floral organ specification. Their role during budbreak and flower development was studied. A spontaneous kiwifruit mutant was utilized to correlate the extended expression domains of these flowering genes with abnormal floral development. This study provides a description of flower development in kiwifruit at the molecular level. It has identified markers for flower development, and candidates for manipulation of kiwifruit growth, phase change and time of flowering. The expression in normal and aberrant flowers provided a model for kiwifruit flower development.

  14. The putative Leishmania telomerase RNA (LeishTER undergoes trans-splicing and contains a conserved template sequence.

    Directory of Open Access Journals (Sweden)

    Elton J R Vasconcelos

    Full Text Available Telomerase RNAs (TERs are highly divergent between species, varying in size and sequence composition. Here, we identify a candidate for the telomerase RNA component of Leishmania genus, which includes species that cause leishmaniasis, a neglected tropical disease. Merging a thorough computational screening combined with RNA-seq evidence, we mapped a non-coding RNA gene localized in a syntenic locus on chromosome 25 of five Leishmania species that shares partial synteny with both Trypanosoma brucei TER locus and a putative TER candidate-containing locus of Crithidia fasciculata. Using target-driven molecular biology approaches, we detected a ∼2,100 nt transcript (LeishTER that contains a 5' spliced leader (SL cap, a putative 3' polyA tail and a predicted C/D box snoRNA domain. LeishTER is expressed at similar levels in the logarithmic and stationary growth phases of promastigote forms. A 5'SL capped LeishTER co-immunoprecipitated and co-localized with the telomerase protein component (TERT in a cell cycle-dependent manner. Prediction of its secondary structure strongly suggests the existence of a bona fide single-stranded template sequence and a conserved C[U/C]GUCA motif-containing helix II, representing the template boundary element. This study paves the way for further investigations on the biogenesis of parasite TERT ribonucleoproteins (RNPs and its role in parasite telomere biology.

  15. The complete mitochondrial DNA sequences of Nephroselmis olivacea and Pedinomonas minor. Two radically different evolutionary patterns within green algae.

    Science.gov (United States)

    Turmel, M; Lemieux, C; Burger, G; Lang, B F; Otis, C; Plante, I; Gray, M W

    1999-09-01

    Green plants appear to comprise two sister lineages, Chlorophyta (classes Chlorophyceae, Ulvophyceae, Trebouxiophyceae, and Prasinophyceae) and Streptophyta (Charophyceae and Embryophyta, or land plants). To gain insight into the nature of the ancestral green plant mitochondrial genome, we have sequenced the mitochondrial DNAs (mtDNAs) of Nephroselmis olivacea and Pedinomonas minor. These two green algae are presumptive members of the Prasinophyceae. This class is thought to include descendants of the earliest diverging green algae. We find that Nephroselmis and Pedinomonas mtDNAs differ markedly in size, gene content, and gene organization. Of the green algal mtDNAs sequenced so far, that of Nephroselmis (45,223 bp) is the most ancestral (minimally diverged) and occupies the phylogenetically most basal position within the Chlorophyta. Its repertoire of 69 genes closely resembles that in the mtDNA of Prototheca wickerhamii, a later diverging trebouxiophycean green alga. Three of the Nephroselmis genes (nad10, rpl14, and rnpB) have not been identified in previously sequenced mtDNAs of green algae and land plants. In contrast, the 25,137-bp Pedinomonas mtDNA contains only 22 genes and retains few recognizably ancestral features. In several respects, including gene content and rate of sequence divergence, Pedinomonas mtDNA resembles the reduced mtDNAs of chlamydomonad algae, with which it is robustly affiliated in phylogenetic analyses. Our results confirm the existence of two radically different patterns of mitochondrial genome evolution within the green algae.

  16. Sex-biased gene expression and sequence conservation in Atlantic and Pacific salmon lice (Lepeophtheirus salmonis).

    Science.gov (United States)

    Poley, Jordan D; Sutherland, Ben J G; Jones, Simon R M; Koop, Ben F; Fast, Mark D

    2016-07-04

    Salmon lice, Lepeophtheirus salmonis (Copepoda: Caligidae), are highly important ectoparasites of farmed and wild salmonids, and cause multi-million dollar losses to the salmon aquaculture industry annually. Salmon lice display extensive sexual dimorphism in ontogeny, morphology, physiology, behavior, and more. Therefore, the identification of transcripts with differential expression between males and females (sex-biased transcripts) may help elucidate the relationship between sexual selection and sexually dimorphic characteristics. Sex-biased transcripts were identified from transcriptome analyses of three L. salmonis populations, including both Atlantic and Pacific subspecies. A total of 35-43 % of all quality-filtered transcripts were sex-biased in L. salmonis, with male-biased transcripts exhibiting higher fold change than female-biased transcripts. For Gene Ontology and functional analyses, a consensus-based approach was used to identify concordantly differentially expressed sex-biased transcripts across the three populations. A total of 127 male-specific transcripts (i.e. those without detectable expression in any female) were identified, and were enriched with reproductive functions (e.g. seminal fluid and male accessory gland proteins). Other sex-biased transcripts involved in morphogenesis, feeding, energy generation, and sensory and immune system development and function were also identified. Interestingly, as observed in model systems, male-biased L. salmonis transcripts were more frequently without annotation compared to female-biased or unbiased transcripts, suggesting higher rates of sequence divergence in male-biased transcripts. Transcriptome differences between male and female L. salmonis described here provide key insights into the molecular mechanisms controlling sexual dimorphism in L. salmonis. This analysis offers targets for parasite control and provides a foundation for further analyses exploring critical topics such as the interaction

  17. Solexa sequencing identification of conserved and novel microRNAs in backfat of Large White and Chinese Meishan pigs.

    Directory of Open Access Journals (Sweden)

    Chen Chen

    Full Text Available The domestic pig (Sus scrofa, an important species in animal production industry, is a right model for studying adipogenesis and fat deposition. In order to expand the repertoire of porcine miRNAs and further explore potential regulatory miRNAs which have influence on adipogenesis, high-throughput Solexa sequencing approach was adopted to identify miRNAs in backfat of Large White (lean type pig and Meishan pigs (Chinese indigenous fatty pig. We identified 215 unique miRNAs comprising 75 known pre-miRNAs, of which 49 miRNA*s were first identified in our study, 73 miRNAs were overlapped in both libraries, and 140 were novelly predicted miRNAs, and 215 unique miRNAs were collectively corresponding to 235 independent genomic loci. Furthermore, we analyzed the sequence variations, seed edits and phylogenetic development of the miRNAs. 17 miRNAs were widely conserved from vertebrates to invertebrates, suggesting that these miRNAs may serve as potential evolutional biomarkers. 9 conserved miRNAs with significantly differential expressions were determined. The expression of miR-215, miR-135, miR-224 and miR-146b was higher in Large White pigs, opposite to the patterns shown by miR-1a, miR-133a, miR-122, miR-204 and miR-183. Almost all novel miRNAs could be considered pig-specific except ssc-miR-1343, miR-2320, miR-2326, miR-2411 and miR-2483 which had homologs in Bos taurus, among which ssc-miR-1343, miR-2320, miR-2411 and miR-2483 were validated in backfat tissue by stem-loop qPCR. Our results displayed a high level of concordance between the qPCR and Solexa sequencing method in 9 of 10 miRNAs comparisons except for miR-1a. Moreover, we found 2 miRNAs, miR-135 and miR-183, may exert impacts on porcine backfat development through WNT signaling pathway. In conclusion, our research develops porcine miRNAs and should be beneficial to study the adipogenesis and fat deposition of different pig breeds based on miRNAs.

  18. Transcriptome sequence-based phylogeny of chalcidoid wasps (Hymenoptera: Chalcidoidea) reveals a history of rapid radiations, convergence, and evolutionary success.

    Science.gov (United States)

    Peters, Ralph S; Niehuis, Oliver; Gunkel, Simon; Bläser, Marcel; Mayer, Christoph; Podsiadlowski, Lars; Kozlov, Alexey; Donath, Alexander; van Noort, Simon; Liu, Shanlin; Zhou, Xin; Misof, Bernhard; Heraty, John; Krogmann, Lars

    2017-12-13

    Chalcidoidea are a megadiverse group of mostly parasitoid wasps of major ecological and economical importance that are omnipresent in almost all extant terrestrial habitats. The timing and pattern of chalcidoid diversification is so far poorly understood and has left many important questions on the evolutionary history of Chalcidoidea unanswered. In this study, we infer the early divergence events within Chalcidoidea and address the question of whether or not ancestral chalcidoids were small egg parasitoids. We also trace the evolution of some key traits: jumping ability, development of enlarged hind femora, and associations with figs. Our phylogenetic inference is based on the analysis of 3,239 single-copy genes across 48 chalcidoid wasps and outgroups representatives. We applied an innovative a posteriori evaluation approach to molecular clock-dating based on nine carefully validated fossils, resulting in the first molecular clock-based estimation of deep Chalcidoidea divergence times. Our results suggest a late Jurassic origin of Chalcidoidea, with a first divergence of morphologically and biologically distinct groups in the early to mid Cretaceous, between 129 and 81 million years ago (mya). Diversification of most extant lineages happened rapidly after the Cretaceous in the early Paleogene, between 75 and 53 mya. The inferred Chalcidoidea tree suggests a transition from ancestral minute egg parasitoids to larger-bodied parasitoids of other host stages during the early history of chalcidoid evolution. The ability to jump evolved independently at least three times, namely in Eupelmidae, Encyrtidae, and Tanaostigmatidae. Furthermore, the large-bodied strongly sclerotized species with enlarged hind femora in Chalcididae and Leucospidae are not closely related. Finally, the close association of some chalcidoid wasps with figs, either as pollinators, or as inquilines/gallers or as parasitoids, likely evolved at least twice independently: in the Eocene, giving rise

  19. Plastid genome sequence of a wild woody oil species, Prinsepia utilis, provides insights into evolutionary and mutational patterns of Rosaceae chloroplast genomes.

    Science.gov (United States)

    Wang, Shuo; Shi, Chao; Gao, Li-Zhi

    2013-01-01

    Prinsepiautilis Royle is a wild woody oil species of Rosaceae that yields edible oil which has been proved to possess particular benefits for human health and medical therapy. However, the lack of bred varieties has largely impeded exploiting immense potentials for high quality of its seed oil. It is urgently needed to enlarge the knowledge of genetic basis of the species and develop genetic markers to enhance modern breeding programs. Here we reported the complete chloroplast (cp) genome of 156,328 bp. Comparative cp sequence analyses of P. utilis along with other four Rosaceae species resulted in similar genome structures, gene orders, and gene contents. Contraction/expansion of inverted repeat regions (IRs) explained part of the length variation in the Rosaceae cp genomes. Genome sequence alignments revealed that nucleotide diversity was associated with AT content, and large single copy regions (LSC) and small single copy regions (SSC) harbored higher sequence variations in both coding and non-coding regions than IRs. Simple sequence repeats (SSRs) were detected in the P. utilis and compared with those of the other four Rosaceae cp genomes. Almost all the SSR loci were composed of A or T, therefore it might contribute to the A-T richness of cp genomes and be associated with AT biased sequence variation. Among all the protein-coding genes, ycf1 showed the highest sequence divergence, indicating that it could accomplish the discrimination of species within Rosaceae as well as within angiosperms better than other genes. With the addition of this new sequenced cp genome, high nucleotide substitution rate and abundant deletions/insertions were observed, suggesting a greater genomic dynamics than previously explored in Rosaceae. The availability of the complete cp genome of P. utilis will provide chloroplast markers and genetic information to better enhance the conservation and utilization of this woody oil plant.

  20. Plastid genome sequence of a wild woody oil species, Prinsepia utilis, provides insights into evolutionary and mutational patterns of Rosaceae chloroplast genomes.

    Directory of Open Access Journals (Sweden)

    Shuo Wang

    Full Text Available BACKGROUND: Prinsepiautilis Royle is a wild woody oil species of Rosaceae that yields edible oil which has been proved to possess particular benefits for human health and medical therapy. However, the lack of bred varieties has largely impeded exploiting immense potentials for high quality of its seed oil. It is urgently needed to enlarge the knowledge of genetic basis of the species and develop genetic markers to enhance modern breeding programs. RESULTS: Here we reported the complete chloroplast (cp genome of 156,328 bp. Comparative cp sequence analyses of P. utilis along with other four Rosaceae species resulted in similar genome structures, gene orders, and gene contents. Contraction/expansion of inverted repeat regions (IRs explained part of the length variation in the Rosaceae cp genomes. Genome sequence alignments revealed that nucleotide diversity was associated with AT content, and large single copy regions (LSC and small single copy regions (SSC harbored higher sequence variations in both coding and non-coding regions than IRs. Simple sequence repeats (SSRs were detected in the P. utilis and compared with those of the other four Rosaceae cp genomes. Almost all the SSR loci were composed of A or T, therefore it might contribute to the A-T richness of cp genomes and be associated with AT biased sequence variation. Among all the protein-coding genes, ycf1 showed the highest sequence divergence, indicating that it could accomplish the discrimination of species within Rosaceae as well as within angiosperms better than other genes. CONCLUSIONS: With the addition of this new sequenced cp genome, high nucleotide substitution rate and abundant deletions/insertions were observed, suggesting a greater genomic dynamics than previously explored in Rosaceae. The availability of the complete cp genome of P. utilis will provide chloroplast markers and genetic information to better enhance the conservation and utilization of this woody oil plant.

  1. Evolutionary analysis of whole-genome sequences confirms inter-farm transmission of Aleutian mink disease virus

    DEFF Research Database (Denmark)

    Hagberg, Emma Elisabeth; Pedersen, Anders Gorm; Larsen, Lars E

    2017-01-01

    direction of spread. It was however impossible to infer transmission pathways from the partial NS1 gene tree, since all samples from the case farms branched out from a single internal node. A sliding window analysis showed that there were no shorter genomic regions providing the same phylogenetic resolution......Aleutian mink disease virus (AMDV) is a frequently encountered pathogen associated with mink farming. Previous phylogenetic analyses of AMDV have been based on shorter and more conserved parts of the genome, e.g. the partial NS1 gene. Such fragments are suitable for detection but are less useful...

  2. Simultaneous reconstruction of evolutionary history and epidemiological dynamics from viral sequences with the birth-death SIR model.

    Science.gov (United States)

    Kühnert, Denise; Stadler, Tanja; Vaughan, Timothy G; Drummond, Alexei J

    2014-05-06

    The evolution of RNA viruses, such as human immunodeficiency virus (HIV), hepatitis C virus and influenza virus, occurs so rapidly that the viruses' genomes contain information on past ecological dynamics. Hence, we develop a phylodynamic method that enables the joint estimation of epidemiological parameters and phylogenetic history. Based on a compartmental susceptible-infected-removed (SIR) model, this method provides separate information on incidence and prevalence of infections. Detailed information on the interaction of host population dynamics and evolutionary history can inform decisions on how to contain or entirely avoid disease outbreaks. We apply our birth-death SIR method to two viral datasets. First, five HIV type 1 clusters sampled in the UK between 1999 and 2003 are analysed. The estimated basic reproduction ratios range from 1.9 to 3.2 among the clusters. All clusters show a decline in the growth rate of the local epidemic in the middle or end of the 1990s. The analysis of a hepatitis C virus genotype 2c dataset shows that the local epidemic in the Córdoban city Cruz del Eje originated around 1906 (median), coinciding with an immigration wave from Europe to central Argentina that dates from 1880 to 1920. The estimated time of epidemic peak is around 1970.

  3. Simultaneous reconstruction of evolutionary history and epidemiological dynamics from viral sequences with the birth–death SIR model

    Science.gov (United States)

    Kühnert, Denise; Stadler, Tanja; Vaughan, Timothy G.; Drummond, Alexei J.

    2014-01-01

    The evolution of RNA viruses, such as human immunodeficiency virus (HIV), hepatitis C virus and influenza virus, occurs so rapidly that the viruses' genomes contain information on past ecological dynamics. Hence, we develop a phylodynamic method that enables the joint estimation of epidemiological parameters and phylogenetic history. Based on a compartmental susceptible–infected–removed (SIR) model, this method provides separate information on incidence and prevalence of infections. Detailed information on the interaction of host population dynamics and evolutionary history can inform decisions on how to contain or entirely avoid disease outbreaks. We apply our birth–death SIR method to two viral datasets. First, five HIV type 1 clusters sampled in the UK between 1999 and 2003 are analysed. The estimated basic reproduction ratios range from 1.9 to 3.2 among the clusters. All clusters show a decline in the growth rate of the local epidemic in the middle or end of the 1990s. The analysis of a hepatitis C virus genotype 2c dataset shows that the local epidemic in the Córdoban city Cruz del Eje originated around 1906 (median), coinciding with an immigration wave from Europe to central Argentina that dates from 1880 to 1920. The estimated time of epidemic peak is around 1970. PMID:24573331

  4. Investigating Evolutionary Dynamics of RHA1 Operons.

    Science.gov (United States)

    Chen, Yong; Geng, Dandan; Ehrhardt, Kristina; Zhang, Shaoqiang

    2016-01-01

    Grouping genes as operons is an important genomic feature of prokaryotic organisms. The comprehensive understanding of the operon organizations would be helpful to decipher transcriptional mechanisms, cellular pathways, and the evolutionary landscape of prokaryotic genomes. Although thousands of prokaryotes have been sequenced, genome-wide investigation of the evolutionary dynamics (division and recombination) of operons among these genomes remains unexplored. Here, we systematically analyzed the operon dynamics of Rhodococcus jostii RHA1 (RHA1), an oleaginous bacterium with high potential applications in biofuel, by comparing 340 prokaryotic genomes that were carefully selected from different genera. Interestingly, 99% of RHA1 operons were observed to exhibit evolutionary events of division and recombination among the 340 compared genomes. An operon that encodes all enzymes related to histidine biosynthesis in RHA1 (His-operon) was found to be segmented into smaller gene groups (sub-operons) in diverse genomes. These sub-operons were further reorganized with different functional genes as novel operons that are related to different biochemical processes. Comparatively, the operons involved in the functional categories of lipid transport and metabolism are relatively conserved among the 340 compared genomes. At the pathway level, RHA1 operons found to be significantly conserved were involved in ribosome synthesis, oxidative phosphorylation, and fatty acid synthesis. These analyses provide evolutionary insights of operon organization and the dynamic associations of various biochemical pathways in different prokaryotes.

  5. Transcriptome sequencing of the blind subterranean mole rat, Spalax galili: Utility and potential for the discovery of novel evolutionary patterns

    KAUST Repository

    Malik, Assaf

    2011-08-12

    The blind subterranean mole rat (Spalax ehrenbergi superspecies) is a model animal for survival under extreme environments due to its ability to live in underground habitats under severe hypoxic stress and darkness. Here we report the transcriptome sequencing of Spalax galili, a chromosomal type of S. ehrenbergi. cDNA pools from muscle and brain tissues isolated from animals exposed to hypoxic and normoxic conditions were sequenced using Sanger, GS FLX, and GS FLX Titanium technologies. Assembly of the sequences yielded over 51,000 isotigs with homology to ~12,000 mouse, rat or human genes. Based on these results, it was possible to detect large numbers of splice variants, SNPs, and novel transcribed regions. In addition, multiple differential expression patterns were detected between tissues and treatments. The results presented here will serve as a valuable resource for future studies aimed at identifying genes and gene regions evolved during the adaptive radiation associated with underground life of the blind mole rat. 2011 Malik et al.

  6. Transcriptome sequencing of the blind subterranean mole rat, Spalax galili: utility and potential for the discovery of novel evolutionary patterns.

    Directory of Open Access Journals (Sweden)

    Assaf Malik

    Full Text Available The blind subterranean mole rat (Spalax ehrenbergi superspecies is a model animal for survival under extreme environments due to its ability to live in underground habitats under severe hypoxic stress and darkness. Here we report the transcriptome sequencing of Spalax galili, a chromosomal type of S. ehrenbergi. cDNA pools from muscle and brain tissues isolated from animals exposed to hypoxic and normoxic conditions were sequenced using Sanger, GS FLX, and GS FLX Titanium technologies. Assembly of the sequences yielded over 51,000 isotigs with homology to ∼12,000 mouse, rat or human genes. Based on these results, it was possible to detect large numbers of splice variants, SNPs, and novel transcribed regions. In addition, multiple differential expression patterns were detected between tissues and treatments. The results presented here will serve as a valuable resource for future studies aimed at identifying genes and gene regions evolved during the adaptive radiation associated with underground life of the blind mole rat.

  7. Sequence analysis of 96 genomic regions identifies distinct evolutionary lineages within CC156, the largest Streptococcus pneumoniae clonal complex in the MLST database.

    Directory of Open Access Journals (Sweden)

    Monica Moschioni

    Full Text Available Multi-Locus Sequence Typing (MLST of Streptococcus pneumoniae is based on the sequence of seven housekeeping gene fragments. The analysis of MLST allelic profiles by eBURST allows the grouping of genetically related strains into Clonal Complexes (CCs including those genotypes with a common descent from a predicted ancestor. However, the increasing use of MLST to characterize S. pneumoniae strains has led to the identification of a large number of new Sequence Types (STs causing the merger of formerly distinct lineages into larger CCs. An example of this is the CC156, displaying a high level of complexity and including strains with allelic profiles differing in all seven of the MLST loci, capsular type and the presence of the Pilus Islet-1 (PI-1. Detailed analysis of the CC156 indicates that the identification of new STs, such as ST4945, induced the merging of formerly distinct clonal complexes. In order to discriminate the strain diversity within CC156, a recently developed typing schema, 96-MLST, was used to analyse 66 strains representative of 41 different STs. Analysis of allelic profiles by hierarchical clustering and a minimum spanning tree identified ten genetically distinct evolutionary lineages. Similar results were obtained by phylogenetic analysis on the concatenated sequences with different methods. The identified lineages are homogenous in capsular type and PI-1 presence. ST4945 strains were unequivocally assigned to one of the lineages. In conclusion, the identification of new STs through an exhaustive analysis of pneumococcal strains from various laboratories has highlighted that potentially unrelated subgroups can be grouped into a single CC by eBURST. The analysis of additional loci, such as those included in the 96-MLST schema, will be necessary to accurately discriminate the clonal evolution of the pneumococcal population.

  8. Remembering the evolutionary Freud.

    Science.gov (United States)

    Young, Allan

    2006-03-01

    Throughout his career as a writer, Sigmund Freud maintained an interest in the evolutionary origins of the human mind and its neurotic and psychotic disorders. In common with many writers then and now, he believed that the evolutionary past is conserved in the mind and the brain. Today the "evolutionary Freud" is nearly forgotten. Even among Freudians, he is regarded to be a red herring, relevant only to the extent that he diverts attention from the enduring achievements of the authentic Freud. There are three ways to explain these attitudes. First, the evolutionary Freud's key work is the "Overview of the Transference Neurosis" (1915). But it was published at an inopportune moment, forty years after the author's death, during the so-called "Freud wars." Second, Freud eventually lost interest in the "Overview" and the prospect of a comprehensive evolutionary theory of psychopathology. The publication of The Ego and the Id (1923), introducing Freud's structural theory of the psyche, marked the point of no return. Finally, Freud's evolutionary theory is simply not credible. It is based on just-so stories and a thoroughly discredited evolutionary mechanism, Lamarckian use-inheritance. Explanations one and two are probably correct but also uninteresting. Explanation number three assumes that there is a fundamental difference between Freud's evolutionary narratives (not credible) and the evolutionary accounts of psychopathology that currently circulate in psychiatry and mainstream journals (credible). The assumption is mistaken but worth investigating.

  9. Comparative cytogenetics of tree frogs of the Dendropsophus marmoratus (Laurenti, 1768) group: conserved karyotypes and interstitial telomeric sequences.

    Science.gov (United States)

    Teixeira, Lívia S R; Seger, Karin Regina; Targueta, Cíntia Pelegrineti; Orrico, Victor G Dill; Lourenço, Luciana Bolsoni

    2016-01-01

    The diploid number 2n = 30 is a presumed synapomorphy of Dendropsophus Fitzinger, 1843, although a noticeable variation in the number of biarmed/telocentric chromosomes is observed in this genus. Such a variation suggests that several chromosomal rearrangements took place after the evolutionary origin of the hypothetical ancestral 30-chromosome karyotype; however, the inferred rearrangements remain unknown. Distinct numbers of telocentric chromosomes are found in the two most cytogenetically studied species groups of Dendropsophus. In contrast, all three species of the Dendropsophus marmoratus (Laurenti, 1768) group that are already karyotyped presented five pairs of telocentric chromosomes. In this study, we analyzed cytogenetically three additional species of this group to investigate if the number of telocentric chromosomes in this group is not as variable as in other Dendropsophus groups. We described the karyotypes of Dendropsophus seniculus (Cope, 1868), Dendropsophus soaresi (Caramaschi & Jim, 1983) and Dendropsophus novaisi (Bokermann, 1968) based on Giemsa staining, C-banding, silver impregnation and in situ hybridization with telomeric probes. Dendropsophus seniculus, Dendropsophus soaresi and Dendropsophus novaisi presented five pairs of telocentric chromosomes, as did the remaining species of the group previously karyotyped. Though the species of this group show a high degree of karyotypic similarity, Dendropsophus soaresi was unique in presenting large blocks of het-ITSs (heterochromatic internal telomeric sequences) in the majority of the centromeres. Although the ITSs have been interpreted as evidence of ancestral chromosomal fusions and inversions, the het-ITSs detected in the karyotype of Dendropsophus soaresi could not be explained as direct remnants of ancestral chromosomal rearrangements because no evidence of chromosomal changes emerged from the comparison of the karyotypes of all of the species of the Dendropsophus marmoratus group.

  10. HMMerThread: detecting remote, functional conserved domains in entire genomes by combining relaxed sequence-database searches with fold recognition.

    Directory of Open Access Journals (Sweden)

    Charles Richard Bradshaw

    Full Text Available Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10, a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in

  11. Genetic divergence and evolutionary relationship in Fejervarya cancrivora from Indonesia and other Asian countries inferred from allozyme and MtDNA sequence analyses.

    Science.gov (United States)

    Kurniawan, Nia; Islam, Mohammed Mafizul; Djong, Tjong Hon; Igawa, Takeshi; Daicus, M Belabut; Yong, Hoi Sen; Wanichanon, Ratanasate; Khan, Md Mukhlesur Rahman; Iskandar, Djoko T; Nishioka, Midori; Sumida, Masayuki

    2010-03-01

    To elucidate genetic divergence and evolutionary relationship in Fejervarya cancrivora from Indonesia and other Asian countries, allozyme and molecular analyses were carried out using 131 frogs collected from 24 populations in Indonesia, Thailand, Bangladesh, Malaysia, and the Philippines. In the allozymic survey, seventeen enzymatic loci were examined for 92 frogs from eight representative localities. The results showed that F. cancrivora is subdivided into two main groups, the mangrove type and the large- plus Pelabuhan ratu types. The average Nel's genetic distance between the two groups was 0.535. Molecular phylogenetic trees based on nucleotide sequences of the 16S rRNA and Cyt b genes and constructed with the ML, MP, NJ, and BI methods also showed that the individuals of F. cancrivora analyzed comprised two clades, the mangrove type and the large plus Pelabuhan ratu / Sulawesi types, the latter further split into two subclades, the large type and the Pelabuhan ratu / Sulawesi type. The geographical distribution of individuals of the three F. cancrivora types was examined. Ten Individuals from Bangladesh, Thailand, and the Philippines represented the mangrove type; 34 Individuals from Malaysia and Indonesia represented the large type; and 11 individuals from Indonesia represented the Pelabuhan ratu / Sulawesi type. Average sequence divergences among the three types were 5.78-10.22% for the 16S and 12.88-16.38% for Cyt b. Our results suggest that each of the three types can be regarded as a distinct species.

  12. Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

    Directory of Open Access Journals (Sweden)

    Santos Carlos A.F.

    2002-01-01

    Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

  13. Enhanced identification of β-lactamases and its classes using sequence, physicochemical and evolutionary information with sequence feature characterization of the classes.

    Science.gov (United States)

    Nath, Abhigyan; Karthikeyan, S

    2017-06-01

    β-lactamases provides one of the most successful means of evading the therapeutic effects of β lactam class of antibiotics by many gram positive and gram negative bacteria. On the basis of sequence identity, β-lactamases have been identified into four distinct classes- A, B, C and D. The classes A, C and D are the serine β-lactamases and class B is the metallo-lactamse. In the present study, we developed a two stage cascade classification system. The first-stage performs the classification of β-lactamases from non-β-lactamases and the second-stage performs the further classification of β-lactamases into four different β-lactamase classes. In the first-stage binary classification, we obtained an accuracy of 97.3% with a sensitivity of 89.1% and specificity of 98.0% and for the second stage multi-class classification, we obtained an accuracy of 87.3% for the class A, 91.0% for the class B, 96.3% for the class C and 96.4% for class D. A systematic statistical analysis is carried out on the sieved-out, correctly-predicted instances from the second stage classifier, which revealed some interesting patterns. We analyzed different classes of β-lactamases on the basis of sequence and physicochemical property differences between them. Among amino acid composition, H, W, Y and V showed significant differences between the different β-lactamases classes. Differences in average physicochemical properties are observed for isoelectric point, volume, flexibility, hydrophobicity, bulkiness and charge in one or more β-lactamase classes. The key differences in physicochemical property groups can be observed in small and aromatic groups. Among amino acid property group n-grams except charged n-grams, all other property group n-grams are significant in one or more classes. Statistically significant differences in dipeptide counts among different β-lactamase classes are also reported. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Sequence conservation, HLA-E-Restricted peptide, and best-defined CTL/CD8+ epitopes in gag P24 (capsid) of HIV-1 subtype B

    Science.gov (United States)

    Prasetyo, Afiono Agung; Dharmawan, Ruben; Sari, Yulia; Sariyatun, Ratna

    2017-02-01

    Human immunodeficiency virus type 1 (HIV-1) remains a cause of global health problem. Continuous studies of HIV-1 genetic and immunological profiles are important to find strategies against the virus. This study aimed to conduct analysis of sequence conservation, HLA-E-restricted peptide, and best-defined CTL/CD8+ epitopes in p24 (capsid) of HIV-1 subtype B worldwide. The p24-coding sequences from 3,557 HIV subtype B isolates were aligned using MUSCLE and analysed. Some highly conserved regions (sequence conservation ≥95%) were observed. Two considerably long series of sequences with conservation of 100% was observed at base 349-356 and 550-557 of p24 (HXB2 numbering). The consensus from all aligned isolates was precisely the same as consensus B in the Los Alamos HIV Database. The HLA-E-restricted peptide in amino acid (aa) 14-22 of HIV-1 p24 (AISPRTLNA) was found in 55.9% (1,987/3,557) of HIV-1 subtype B worldwide. Forty-four best-defined CTL/CD8+ epitopes were observed, in which VKNWMTETL epitope (aa 181-189 of p24) restricted by B*4801 was the most frequent, as found in 94.9% of isolates. The results of this study would contribute information about HIV-1 subtype B and benefits for further works willing to develop diagnostic and therapeutic strategies against the virus.

  15. A conserved predicted pseudoknot in the NS2A-encoding sequence of West Nile and Japanese encephalitis flaviviruses suggests NS1' may derive from ribosomal frameshifting

    Directory of Open Access Journals (Sweden)

    Atkins John F

    2009-02-01

    Full Text Available Abstract Japanese encephalitis, West Nile, Usutu and Murray Valley encephalitis viruses form a tight subgroup within the larger Flavivirus genus. These viruses utilize a single-polyprotein expression strategy, resulting in ~10 mature proteins. Plotting the conservation at synonymous sites along the polyprotein coding sequence reveals strong conservation peaks at the very 5' end of the coding sequence, and also at the 5' end of the sequence encoding the NS2A protein. Such peaks are generally indicative of functionally important non-coding sequence elements. The second peak corresponds to a predicted stable pseudoknot structure whose biological importance is supported by compensatory mutations that preserve the structure. The pseudoknot is preceded by a conserved slippery heptanucleotide (Y CCU UUU, thus forming a classical stimulatory motif for -1 ribosomal frameshifting. We hypothesize, therefore, that the functional importance of the pseudoknot is to stimulate a portion of ribosomes to shift -1 nt into a short (45 codon, conserved, overlapping open reading frame, termed foo. Since cleavage at the NS1-NS2A boundary is known to require synthesis of NS2A in cis, the resulting transframe fusion protein is predicted to be NS1-NS2AN-term-FOO. We hypothesize that this may explain the origin of the previously identified NS1 'extension' protein in JEV-group flaviviruses, known as NS1'.

  16. Human T-cell recognition of synthetic peptides representing conserved and variant sequences from the merozoite surface protein 2 of Plasmodium falciparum

    DEFF Research Database (Denmark)

    Theander, T G; Hviid, L; Dodoo, D

    1997-01-01

    . The findings are encouraging for the development of a vaccine based on these T-epitope containing regions of MSP2, as the peptides were broadly recognized suggesting that they can bind to diverse HLA alleles and also because they include conserved MSP2 sequences. Immunisation with a vaccine construct...

  17. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation | Center for Cancer Research

    Science.gov (United States)

    Dubbed "Tom's T" by Dhruba Chattoraj, the unusually conserved thymine at position +7 in bacteriophage P1 plasmid RepA DNA binding sites rises above repressor and acceptor sequence logos. The T appears to represent base flipping prior to helix opening in this DNA replication initation protein.

  18. Integrating restriction site-associated DNA sequencing (RAD-seq) with morphological cladistic analysis clarifies evolutionary relationships among major species groups of bee orchids.

    Science.gov (United States)

    Bateman, Richard M; Sramkó, Gábor; Paun, Ovidiu

    2018-01-25

    Bee orchids (Ophrys) have become the most popular model system for studying reproduction via insect-mediated pseudo-copulation and for exploring the consequent, putatively adaptive, evolutionary radiations. However, despite intensive past research, both the phylogenetic structure and species diversity within the genus remain highly contentious. Here, we integrate next-generation sequencing and morphological cladistic techniques to clarify the phylogeny of the genus. At least two accessions of each of the ten species groups previously circumscribed from large-scale cloned nuclear ribosomal internal transcibed spacer (nrITS) sequencing were subjected to restriction site-associated sequencing (RAD-seq). The resulting matrix of 4159 single nucleotide polymorphisms (SNPs) for 34 accessions was used to construct an unrooted network and a rooted maximum likelihood phylogeny. A parallel morphological cladistic matrix of 43 characters generated both polymorphic and non-polymorphic sets of parsimony trees before being mapped across the RAD-seq topology. RAD-seq data strongly support the monophyly of nine out of ten groups previously circumscribed using nrITS and resolve three major clades; in contrast, supposed microspecies are barely distinguishable. Strong incongruence separated the RAD-seq trees from both the morphological trees and traditional classifications; mapping of the morphological characters across the RAD-seq topology rendered them far more homoplastic. The comparatively high level of morphological homoplasy reflects extensive convergence, whereas the derived placement of the fusca group is attributed to paedomorphic simplification. The phenotype of the most recent common ancestor of the extant lineages is inferred, but it post-dates the majority of the character-state changes that typify the genus. RAD-seq may represent the high-water mark of the contribution of molecular phylogenetics to understanding evolution within Ophrys; further progress will require

  19. Multilocus Sequence Typing Reveals Relevant Genetic Variation and Different Evolutionary Dynamics among Strains of Xanthomonas arboricola pv. juglandis

    Directory of Open Access Journals (Sweden)

    Marco Scortichini

    2010-11-01

    Full Text Available Forty-five Xanthomonas arboricola pv. juglandis (Xaj strains originating from Juglans regia cultivation in different countries were molecularly typed by means of MultiLocus Sequence Typing (MLST, using acnB, gapA, gyrB and rpoD gene fragments. A total of 2.5 kilobases was used to infer the phylogenetic relationship among the strains and possible recombination events. Haplotype diversity, linkage disequilibrium analysis, selection tests, gene flow estimates and codon adaptation index were also assessed. The dendrograms built by maximum likelihood with concatenated nucleotide and amino acid sequences revealed two major and two minor phylotypes. The same haplotype was found in strains originating from different continents, and different haplotypes were found in strains isolated in the same year from the same location. A recombination breakpoint was detected within the rpoD gene fragment. At the pathovar level, the Xaj populations studied here are clonal and under neutral selection. However, four Xaj strains isolated from walnut fruits with apical necrosis are under diversifying selection, suggesting a possible new adaptation. Gene flow estimates do not support the hypothesis of geographic isolation of the strains, even though the genetic diversity between the strains increases as the geographic distance between them increases. A triplet deletion, causing the absence of valine, was found in the rpoD fragment of all 45 Xaj strains when compared with X. axonopodis pv. citri strain 306. The codon adaptation index was high in all four genes studied, indicating a relevant metabolic activity.

  20. K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features.

    Science.gov (United States)

    Sievers, Aaron; Bosiek, Katharina; Bisch, Marc; Dreessen, Chris; Riedel, Jascha; Froß, Patrick; Hausmann, Michael; Hildenbrand, Georg

    2017-04-19

    In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers) was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4) on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B) of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs), which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST) and the high pace of

  1. Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns

    Directory of Open Access Journals (Sweden)

    Fraser Tresa S

    2010-11-01

    Full Text Available Abstract Background Dengue viruses (DENV are one of the most important viral diseases in the world with approximately 100 million infections and 200,000 deaths each year. The current lack of an approved tetravalent vaccine and ineffective insecticide control measures warrant a search for alternatives to effectively combat DENV. The trans-splicing variant of the Tetrahymena thermophila group I intron catalytic RNA, or ribozyme, is a powerful tool for post-transcriptional RNA modification. The nature of the ribozyme and the predictability with which it can be directed makes it a powerful tool for modifying RNA in nearly any cell type without the need for genome-altering gene therapy techniques or dependence on native cofactors. Results Several anti-DENV Group I trans-splicing introns (αDENV-GrpIs were designed and tested for their ability to target DENV-2 NGC genomes in situ. We have successfully targeted two different uracil bases on the positive sense genomic strand within the highly conserved 5'-3' cyclization sequence (CS region common to all serotypes of DENV with our αDENV-GrpIs. Our ribozymes have demonstrated ability to specifically trans-splice a new RNA sequence downstream of the targeted site in vitro and in transfected insect cells as analyzed by firefly luciferase and RT-PCR assays. The effectiveness of these αDENV-GrpIs to target infecting DENV genomes is also validated in transfected or transformed Aedes mosquito cell lines upon infection with unattenuated DENV-2 NGC. Conclusions Analysis shows that our αDENV-GrpIs have the ability to effectively trans-splice the DENV genome in situ. Notably, these results show that the αDENV-GrpI 9v1, designed to be active against all forms of Dengue virus, effectively targeted the DENV-2 NGC genome in a sequence specific manner. These novel αDENV-GrpI introns provide a striking alternative to other RNA based approaches for the transgenic suppression of DENV in transformed mosquito cells and

  2. NemaFootPrinter: a web based software for the identification of conserved non-coding genome sequence regions between C. elegans and C. briggsae

    Directory of Open Access Journals (Sweden)

    Morandi Paolo

    2005-12-01

    Full Text Available Abstract Background NemaFootPrinter (Nematode Transcription Factor Scan Through Philogenetic Footprinting is a web-based software for interactive identification of conserved, non-exonic DNA segments in the genomes of C. elegans and C. briggsae. It has been implemented according to the following project specifications: a Automated identification of orthologous gene pairs. b Interactive selection of the boundaries of the genes to be compared. c Pairwise sequence comparison with a range of different methods. d Identification of putative transcription factor binding sites on conserved, non-exonic DNA segments. Results Starting from a C. elegans or C. briggsae gene name or identifier, the software identifies the putative ortholog (if any, based on information derived from public nematode genome annotation databases. The investigator can then retrieve the genome DNA sequences of the two orthologous genes; visualize graphically the genes' intron/exon structure and the surrounding DNA regions; select, through an interactive graphical user interface, subsequences of the two gene regions. Using a bioinformatics toolbox (Blast2seq, Dotmatcher, Ssearch and connection to the rVista database the investigator is able at the end of the procedure to identify and analyze significant sequences similarities, detecting the presence of transcription factor binding sites corresponding to the conserved segments. The software automatically masks exons. Discussion This software is intended as a practical and intuitive tool for the researchers interested in the identification of non-exonic conserved sequence segments between C. elegans and C. briggsae. These sequences may contain regulatory transcriptional elements since they are conserved between two related, but rapidly evolving genomes. This software also highlights the power of genome annotation databases when they are conceived as an open resource and the possibilities offered by seamless integration of different web

  3. Identification of residues in ABCG2 affecting protein trafficking and drug transport, using co-evolutionary analysis of ABCG sequences.

    Science.gov (United States)

    Haider, Ameena J; Cox, Megan H; Jones, Natalie; Goode, Alice J; Bridge, Katherine S; Wong, Kelvin; Briggs, Deborah; Kerr, Ian D

    2015-07-17

    ABCG2 is an ABC (ATP-binding cassette) transporter with a physiological role in urate transport in the kidney and is also implicated in multi-drug efflux from a number of organs in the body. The trafficking of the protein and the mechanism by which it recognizes and transports diverse drugs are important areas of research. In the current study, we have made a series of single amino acid mutations in ABCG2 on the basis of sequence analysis. Mutant isoforms were characterized for cell surface expression and function. One mutant (I573A) showed disrupted glycosylation and reduced trafficking kinetics. In contrast with many ABC transporter folding mutations which appear to be 'rescued' by chemical chaperones or low temperature incubation, the I573A mutation was not enriched at the cell surface by either treatment, with the majority of the protein being retained in the endoplasmic reticulum (ER). Two other mutations (P485A and M549A) showed distinct effects on transport of ABCG2 substrates reinforcing the role of TM helix 3 in drug recognition and transport and indicating the presence of intracellular coupling regions in ABCG2. © 2015 Authors.

  4. Reconstruction of the evolutionary history of Saccharomyces cerevisiae x S. kudriavzevii hybrids based on multilocus sequence analysis.

    Directory of Open Access Journals (Sweden)

    David Peris

    Full Text Available In recent years, interspecific hybridization and introgression are increasingly recognized as significant events in the evolution of Saccharomyces yeasts. These mechanisms have probably been involved in the origin of novel yeast genotypes and phenotypes, which in due course were to colonize and predominate in the new fermentative environments created by human manipulation. The particular conditions in which hybrids arose are still unknown, as well as the number of possible hybridization events that generated the whole set of natural hybrids described in the literature during recent years. In this study, we could infer at least six different hybridization events that originated a set of 26 S. cerevisiae x S. kudriavzevii hybrids isolated from both fermentative and non-fermentative environments. Different wine S. cerevisiae strains and European S. kudriavzevii strains were probably involved in the hybridization events according to gene sequence information, as well as from previous data on their genome composition and ploidy. Finally, we postulate that these hybrids may have originated after the introduction of vine growing and winemaking practices by the Romans to the present Northern vine-growing limits and spread during the expansion of improved viticulture and enology practices that occurred during the Late Middle Ages.

  5. Reconstruction of the evolutionary history of Saccharomyces cerevisiae x S. kudriavzevii hybrids based on multilocus sequence analysis.

    Science.gov (United States)

    Peris, David; Lopes, Christian A; Arias, Armando; Barrio, Eladio

    2012-01-01

    In recent years, interspecific hybridization and introgression are increasingly recognized as significant events in the evolution of Saccharomyces yeasts. These mechanisms have probably been involved in the origin of novel yeast genotypes and phenotypes, which in due course were to colonize and predominate in the new fermentative environments created by human manipulation. The particular conditions in which hybrids arose are still unknown, as well as the number of possible hybridization events that generated the whole set of natural hybrids described in the literature during recent years. In this study, we could infer at least six different hybridization events that originated a set of 26 S. cerevisiae x S. kudriavzevii hybrids isolated from both fermentative and non-fermentative environments. Different wine S. cerevisiae strains and European S. kudriavzevii strains were probably involved in the hybridization events according to gene sequence information, as well as from previous data on their genome composition and ploidy. Finally, we postulate that these hybrids may have originated after the introduction of vine growing and winemaking practices by the Romans to the present Northern vine-growing limits and spread during the expansion of improved viticulture and enology practices that occurred during the Late Middle Ages.

  6. Reconstruction of the Evolutionary History of Saccharomyces cerevisiae x S. kudriavzevii Hybrids Based on Multilocus Sequence Analysis

    Science.gov (United States)

    Peris, David; Lopes, Christian A.; Arias, Armando; Barrio, Eladio

    2012-01-01

    In recent years, interspecific hybridization and introgression are increasingly recognized as significant events in the evolution of Saccharomyces yeasts. These mechanisms have probably been involved in the origin of novel yeast genotypes and phenotypes, which in due course were to colonize and predominate in the new fermentative environments created by human manipulation. The particular conditions in which hybrids arose are still unknown, as well as the number of possible hybridization events that generated the whole set of natural hybrids described in the literature during recent years. In this study, we could infer at least six different hybridization events that originated a set of 26 S. cerevisiae x S. kudriavzevii hybrids isolated from both fermentative and non-fermentative environments. Different wine S. cerevisiae strains and European S. kudriavzevii strains were probably involved in the hybridization events according to gene sequence information, as well as from previous data on their genome composition and ploidy. Finally, we postulate that these hybrids may have originated after the introduction of vine growing and winemaking practices by the Romans to the present Northern vine-growing limits and spread during the expansion of improved viticulture and enology practices that occurred during the Late Middle Ages. PMID:23049811

  7. SNP detection from de novo transcriptome sequencing in the bivalve Macoma balthica: marker development for evolutionary studies.

    Directory of Open Access Journals (Sweden)

    Eric Pante

    Full Text Available Hybrid zones are noteworthy systems for the study of environmental adaptation to fast-changing environments, as they constitute reservoirs of polymorphism and are key to the maintenance of biodiversity. They can move in relation to climate fluctuations, as temperature can affect both selection and migration, or remain trapped by environmental and physical barriers. There is therefore a very strong incentive to study the dynamics of hybrid zones subjected to climate variations. The infaunal bivalve Macoma balthica emerges as a noteworthy model species, as divergent lineages hybridize, and its native NE Atlantic range is currently contracting to the North. To investigate the dynamics and functioning of hybrid zones in M. balthica, we developed new molecular markers by sequencing the collective transcriptome of 30 individuals. Ten individuals were pooled for each of the three populations sampled at the margins of two hybrid zones. A single 454 run generated 277 Mb from which 17K SNPs were detected. SNP density averaged 1 polymorphic site every 14 to 19 bases, for mitochondrial and nuclear loci, respectively. An [Formula: see text] scan detected high genetic divergence among several hundred SNPs, some of them involved in energetic metabolism, cellular respiration and physiological stress. The high population differentiation, recorded for nuclear-encoded ATP synthase and NADH dehydrogenase as well as most mitochondrial loci, suggests cytonuclear genetic incompatibilities. Results from this study will help pave the way to a high-resolution study of hybrid zone dynamics in M. balthica, and the relative importance of endogenous and exogenous barriers to gene flow in this system.

  8. NetTurnP--neural network prediction of beta-turns by use of evolutionary information and predicted protein sequence features.

    Directory of Open Access Journals (Sweden)

    Bent Petersen

    Full Text Available UNLABELLED: β-turns are the most common type of non-repetitive structures, and constitute on average 25% of the amino acids in proteins. The formation of β-turns plays an important role in protein folding, protein stability and molecular recognition processes. In this work we present the neural network method NetTurnP, for prediction of two-class β-turns and prediction of the individual β-turn types, by use of evolutionary information and predicted protein sequence features. It has been evaluated against a commonly used dataset BT426, and achieves a Matthews correlation coefficient of 0.50, which is the highest reported performance on a two-class prediction of β-turn and not-β-turn. Furthermore NetTurnP shows improved performance on some of the specific β-turn types. In the present work, neural network methods have been trained to predict β-turn or not and individual β-turn types from the primary amino acid sequence. The individual β-turn types I, I', II, II', VIII, VIa1, VIa2, VIba and IV have been predicted based on classifications by PROMOTIF, and the two-class prediction of β-turn or not is a superset comprised of all β-turn types. The performance is evaluated using a golden set of non-homologous sequences known as BT426. Our two-class prediction method achieves a performance of: MCC=0.50, Qtotal=82.1%, sensitivity=75.6%, PPV=68.8% and AUC=0.864. We have compared our performance to eleven other prediction methods that obtain Matthews correlation coefficients in the range of 0.17-0.47. For the type specific β-turn predictions, only type I and II can be predicted with reasonable Matthews correlation coefficients, where we obtain performance values of 0.36 and 0.31, respectively. CONCLUSION: The NetTurnP method has been implemented as a webserver, which is freely available at http://www.cbs.dtu.dk/services/NetTurnP/. NetTurnP is the only available webserver that allows submission of multiple sequences.

  9. Comparative Sequence and Structure Analysis Reveals the Conservation and Diversity of Nucleotide Positions and Their Associated Tertiary Interactions in the Riboswitches

    Science.gov (United States)

    Appasamy, Sri D.; Ramlan, Effirul Ikhwan; Firdaus-Raih, Mohd

    2013-01-01

    The tertiary motifs in complex RNA molecules play vital roles to either stabilize the formation of RNA 3D structure or to provide important biological functionality to the molecule. In order to better understand the roles of these tertiary motifs in riboswitches, we examined 11 representative riboswitch PDB structures for potential agreement of both motif occurrences and conservations. A total of 61 unique tertiary interactions were found in the reference structures. In addition to the expected common A-minor motifs and base-triples mainly involved in linking distant regions the riboswitch structures three highly conserved variants of A-minor interactions called G-minors were found in the SAM-I and FMN riboswitches where they appear to be involved in the recognition of the respective ligand’s functional groups. From our structural survey as well as corresponding structure and sequence alignments, the agreement between motif occurrences and conservations are very prominent across the representative riboswitches. Our analysis provide evidence that some of these tertiary interactions are essential components to form the structure where their sequence positions are conserved despite a high degree of diversity in other parts of the respective riboswitches sequences. This is indicative of a vital role for these tertiary interactions in determining the specific biological function of riboswitch. PMID:24040136

  10. Molecular phylogeny and evolutionary relationships among mosquitoes (Diptera: Culicidae) from the northeastern United States based on small subunit ribosomal DNA (18S rDNA) sequences.

    Science.gov (United States)

    Shepard, John J; Andreadis, Theodore G; Vossbrinck, Charles R

    2006-05-01

    The phylogenetic relationships of Culicidae native to the northeastern United States were investigated by analyzing small subunit ribosomal DNA (18S rDNA) sequences obtained from 39 species representing nine genera. Molecular phylogenies were consistent with traditional classifications based on morphological characters except for the placements of Psorophora Robineau-Desvoidy and Uranotaenia Lynch Arribalzaga. In our analyses, 1) Anopheles Meigen was strongly supported as the sister taxon to the remaining Culicidae; 2) Toxorhynchites Theobald was represented as a distinct monophyletic sister group to the Culicinae; 3) Psorophora formed a basal clade to Culiseta Felt, Coquillettidia Dyar, and Culex L. but also was shown as a sister taxon to Aedes Meigen and Ochlerotatus Lynch Arribalzaga; 4) Coquillettidia perturbans (Walker) seems to be a sister group to Culiseta; 5) placement of Uranotaenia was inconclusive and seemed to be either a sister group to the Aedes and Ochlerotatus or a basal taxon to all other culicines; and 6) Aedes and Ochlerotatus formed two separate and distinct clades, providing phylogenetic data consistent with the recent elevation of Ochlerotatus to the generic level as proposed by Reinert (2000). The utility of 18S rDNA for evaluating phylogenetic and evolutionary relationships among mosquito taxa was demonstrated at the genus and species levels. To our knowledge, this study represents the first molecular-based phylogenetic study of mosquito species occurring within this geographic region of North America and contains the largest number of species that have been examined among the genera Aedes and Ochlerotatus.

  11. NetTurnP – Neural Network Prediction of Beta-turns by Use of Evolutionary Information and Predicted Protein Sequence Features

    DEFF Research Database (Denmark)

    Petersen, Bent; Lundegaard, Claus; Petersen, Thomas Nordahl

    2010-01-01

    is the highest reported performance on a two-class prediction of β-turn and not-β-turn. Furthermore NetTurnP shows improved performance on some of the specific β-turn types. In the present work, neural network methods have been trained to predict β-turn or not and individual β-turn types from the primary amino......β-turns are the most common type of non-repetitive structures, and constitute on average 25% of the amino acids in proteins. The formation of β-turns plays an important role in protein folding, protein stability and molecular recognition processes. In this work we present the neural network method...... NetTurnP, for prediction of two-class β-turns and prediction of the individual β-turn types, by use of evolutionary information and predicted protein sequence features. It has been evaluated against a commonly used dataset BT426, and achieves a Matthews correlation coefficient of 0.50, which...

  12. Molecular characterization of flavanone 3 beta-hydroxylases. Consensus sequence, comparison with related enzymes and the role of conserved histidine residues.

    Science.gov (United States)

    Britsch, L; Dedio, J; Saedler, H; Forkmann, G

    1993-10-15

    A heterologous cDNA probe from Petunia hybrida was used to isolate flavanone-3 beta-hydroxylase-encoding cDNA clones from carnation (Dianthus caryophyllus), china aster (Callistephus chinensis) and stock (Matthiola incana). The deduced protein sequences together with the known sequences of the enzyme from P. hybrida, barley (Hordeum vulgare) and snapdragon (Antirrhinum majus) enabled the determination of a consensus sequence which revealed an overall 84% similarity (53% identity) of flavanone 3 beta-hydroxylases from the different sources. Alignment with the sequences of other known enzymes of the same class and to related non-heme iron-(II) enzymes demonstrated the strict genetic conservation of 14 amino acids, in particular, of three histidines and an aspartic acid. The conservation of the histidine motifs provides strong support for the possible conservation of structurally similar iron-binding sites in these enzymes. The putative role of histidines as chelators of ferrous ions in the active site of flavanone 3 beta-hydroxylases was corroborated by diethyl-pyrocarbonate modification of the partially purified recombinant Petunia enzyme.

  13. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  14. A highly conserved N-terminal sequence for teleost vitellogenin with potential value to the biochemistry, molecular biology and pathology of vitellogenesis

    Science.gov (United States)

    Folmar, L.D.; Denslow, N.D.; Wallace, R.A.; LaFleur, G.; Gross, T.S.; Bonomelli, S.; Sullivan, C.V.

    1995-01-01

    N-terminal amino acid sequences for vitellogenin (Vtg) from six species of teleost fish (striped bass, mummichog, pinfish, brown bullhead, medaka, yellow perch and the sturgeon) are compared with published N-terminal Vtg sequences for the lamprey, clawed frog and domestic chicken. Striped bass and mummichog had 100% identical amino acids between positions 7 and 21, while pinfish, brown bullhead, sturgeon, lamprey, Xenopus and chicken had 87%, 93%, 60%, 47%, 47-60%) for four transcripts and had 40% identical, respectively, with striped bass for the same positions. Partial sequences obtained for medaka and yellow perch were 100% identical between positions 5 to 10. The potential utility of this conserved sequence for studies on the biochemistry, molecular biology and pathology of vitellogenesis is discussed.

  15. Identification of evolutionary hotspots based on genetic data from multiple terrestrial and aquatic taxa and gap analysis of hotspots in protected lands encompassed by the South Atlantic Landscape Conservation Cooperative.

    Science.gov (United States)

    Robinson, J.; Snider, M.; Duke, J.; Moyer, G.R.

    2014-01-01

     The southeastern United States is a recognized hotspot of biodiversity for a variety of aquatic taxa, including fish, amphibians, and mollusks. Unfortunately, the great diversity of the area is accompanied by a large proportion of species at risk of extinction . Gap analysis was employed to assess the representation of evolutionary hotspots in protected lands w h ere an evolutionary hotspot was defined as an area with high evolutionary potential and measured by atypical patterns of genetic divergence, genetic diversity, and to a lesser extent genetic similarity across multiple terrestrial or aquatic taxa. A survey of the primary literature produced 16 terrestrial and 14 aquatic genetic datasets for estimation of genetic divergence and diversity. Relative genetic diversity and divergence values for each terrestrial and aquatic dataset were used for interpolation of multispecies genetic surfaces and subsequent visualization using ArcGIS. The multispecies surfaces interpolated from relative divergences and diversity data identified numerous evolutionary hotspots for both terrestrial and aquatic taxa , many of which were afforded some current protection. For instance, 14% of the cells identified as hotspots of aquatic diversity were encompassed by currently protected areas. Additionally, 25% of the highest 1% of terrestrial diversity cells were afforded some level of protection. In contrast, areas of high and low divergence among species, and areas of high variance in diversity were poorly represented in the protected lands. Of particular interest were two areas that were consistently identified by several different measures as important from a conservation perspective. These included an area encompassing the panhandle of Florida and southern Georgia near the Apalachicola National Forest (displaying varying levels of genetic divergence and greater than average levels of genetic diversity) and a large portion of the coastal regions of North and South Carolina

  16. Optimizing multiple sequence alignments using a genetic algorithm based on three objectives: structural information, non-gaps percentage and totally conserved columns.

    Science.gov (United States)

    Ortuño, Francisco M; Valenzuela, Olga; Rojas, Fernando; Pomares, Hector; Florido, Javier P; Urquiza, Jose M; Rojas, Ignacio

    2013-09-01

    Multiple sequence alignments (MSAs) are widely used approaches in bioinformatics to carry out other tasks such as structure predictions, biological function analyses or phylogenetic modeling. However, current tools usually provide partially optimal alignments, as each one is focused on specific biological features. Thus, the same set of sequences can produce different alignments, above all when sequences are less similar. Consequently, researchers and biologists do not agree about which is the most suitable way to evaluate MSAs. Recent evaluations tend to use more complex scores including further biological features. Among them, 3D structures are increasingly being used to evaluate alignments. Because structures are more conserved in proteins than sequences, scores with structural information are better suited to evaluate more distant relationships between sequences. The proposed multiobjective algorithm, based on the non-dominated sorting genetic algorithm, aims to jointly optimize three objectives: STRIKE score, non-gaps percentage and totally conserved columns. It was significantly assessed on the BAliBASE benchmark according to the Kruskal-Wallis test (P 0.05) with the advantage of being able to use less structures. Structural information is included within the objective function to evaluate more accurately the obtained alignments. The source code is available at http://www.ugr.es/~fortuno/MOSAStrE/MO-SAStrE.zip.

  17. Evolutionary divergence of chloroplast FAD synthetase proteins

    Directory of Open Access Journals (Sweden)

    Arilla-Luna Sonia

    2010-10-01

    Full Text Available Abstract Background Flavin adenine dinucleotide synthetases (FADSs - a group of bifunctional enzymes that carry out the dual functions of riboflavin phosphorylation to produce flavin mononucleotide (FMN and its subsequent adenylation to generate FAD in most prokaryotes - were studied in plants in terms of sequence, structure and evolutionary history. Results Using a variety of bioinformatics methods we have found that FADS enzymes localized to the chloroplasts, which we term as plant-like FADS proteins, are distributed across a variety of green plant lineages and constitute a divergent protein family clearly of cyanobacterial origin. The C-terminal module of these enzymes does not contain the typical riboflavin kinase active site sequence, while the N-terminal module is broadly conserved. These results agree with a previous work reported by Sandoval et al. in 2008. Furthermore, our observations and preliminary experimental results indicate that the C-terminus of plant-like FADS proteins may contain a catalytic activity, but different to that of their prokaryotic counterparts. In fact, homology models predict that plant-specific conserved residues constitute a distinct active site in the C-terminus. Conclusions A structure-based sequence alignment and an in-depth evolutionary survey of FADS proteins, thought to be crucial in plant metabolism, are reported, which will be essential for the correct annotation of plant genomes and further structural and functional studies. This work is a contribution to our understanding of the evolutionary history of plant-like FADS enzymes, which constitute a new family of FADS proteins whose C-terminal module might be involved in a distinct catalytic activity.

  18. Evolutionary divergence of chloroplast FAD synthetase proteins

    Science.gov (United States)

    2010-01-01

    Background Flavin adenine dinucleotide synthetases (FADSs) - a group of bifunctional enzymes that carry out the dual functions of riboflavin phosphorylation to produce flavin mononucleotide (FMN) and its subsequent adenylation to generate FAD in most prokaryotes - were studied in plants in terms of sequence, structure and evolutionary history. Results Using a variety of bioinformatics methods we have found that FADS enzymes localized to the chloroplasts, which we term as plant-like FADS proteins, are distributed across a variety of green plant lineages and constitute a divergent protein family clearly of cyanobacterial origin. The C-terminal module of these enzymes does not contain the typical riboflavin kinase active site sequence, while the N-terminal module is broadly conserved. These results agree with a previous work reported by Sandoval et al. in 2008. Furthermore, our observations and preliminary experimental results indicate that the C-terminus of plant-like FADS proteins may contain a catalytic activity, but different to that of their prokaryotic counterparts. In fact, homology models predict that plant-specific conserved residues constitute a distinct active site in the C-terminus. Conclusions A structure-based sequence alignment and an in-depth evolutionary survey of FADS proteins, thought to be crucial in plant metabolism, are reported, which will be essential for the correct annotation of plant genomes and further structural and functional studies. This work is a contribution to our understanding of the evolutionary history of plant-like FADS enzymes, which constitute a new family of FADS proteins whose C-terminal module might be involved in a distinct catalytic activity. PMID:20955574

  19. Distinct retroelement classes define evolutionary breakpoints demarcating sites of evolutionary novelty

    Directory of Open Access Journals (Sweden)

    Green Eric D

    2009-07-01

    Full Text Available Abstract Background Large-scale genome rearrangements brought about by chromosome breaks underlie numerous inherited diseases, initiate or promote many cancers and are also associated with karyotype diversification during species evolution. Recent research has shown that these breakpoints are nonrandomly distributed throughout the mammalian genome and many, termed "evolutionary breakpoints" (EB, are specific genomic locations that are "reused" during karyotypic evolution. When the phylogenetic trajectory of orthologous chromosome segments is considered, many of these EB are coincident with ancient centromere activity as well as new centromere formation. While EB have been characterized as repeat-rich regions, it has not been determined whether specific sequences have been retained during evolution that would indicate previous centromere activity or a propensity for new centromere formation. Likewise, the conservation of specific sequence motifs or classes at EBs among divergent mammalian taxa has not been determined. Results To define conserved sequence features of EBs associated with centromere evolution, we performed comparative sequence analysis of more than 4.8 Mb within the tammar wallaby, Macropus eugenii, derived from centromeric regions (CEN, euchromatic regions (EU, and an evolutionary breakpoint (EB that has undergone convergent breakpoint reuse and past centromere activity in marsupials. We found a dramatic enrichment for long interspersed nucleotide elements (LINE1s and endogenous retroviruses (ERVs and a depletion of short interspersed nucleotide elements (SINEs shared between CEN and EBs. We analyzed the orthologous human EB (14q32.33, known to be associated with translocations in many cancers including multiple myelomas and plasma cell leukemias, and found a conserved distribution of similar repetitive elements. Conclusion Our data indicate that EBs tracked within the class Mammalia harbor sequence features retained since the

  20. Comparative genomics and evolutionary biology.

    Science.gov (United States)

    Kondrashov, A S

    1999-12-01

    Data of large-scale DNA sequencing are relevant to some of the most fundamental issues in evolutionary biology: suboptimality, homology, hierarchy, ancestry, novelties, the role of natural selection, and the relative importance of directional versus stabilizing selection. Already, these data provided the best available evidence for some evolutionary phenomena, and in several cases led to refinement of old concepts. Still, the Darwinian evolutionary paradigm will successfully accommodate comparative genomics.

  1. Dengue virus type 2 in Cuba, 1997: conservation of E gene sequence in isolates obtained at different times during the epidemic.

    Science.gov (United States)

    Rodriguez-Roche, R; Alvarez, M; Gritsun, T; Rosario, D; Halstead, S; Kouri, G; Gould, E A; Guzman, M G

    2005-03-01

    It was recently reported that disease severity increased during the 1997 Cuban dengue 2 virus epidemic and it was suggested that this might be explained by the appearance of neutralization resistant escape mutants. We investigated these observations and ideas by sequencing 20 dengue 2 virus isolates obtained during the early (low case fatality rate) and the late (high case fatality rate) phases of the outbreak. Our results showed total conservation of the E gene sequence for these isolates suggesting that the selection of envelope gene escape mutants was not the determinant of increased disease severity. Alignment of these sequences with those available in GenBank, followed by Maximum likelihood phylogenetic analysis generated a tree, which indicated that our isolates are closely related to the virus that circulated in Venezuela in 1997/98 and subsequently in Martinique in 1998. This "American/Asian" genotype has therefore gradually dispersed across the Caribbean region during the past 5 years.

  2. Large-scale nucleotide sequence alignment and sequence variability assessment to identify the evolutionarily highly conserved regions for universal screening PCR assay design: an example of influenza A virus.

    Science.gov (United States)

    Nagy, Alexander; Jiřinec, Tomáš; Černíková, Lenka; Jiřincová, Helena; Havlíčková, Martina

    2015-01-01

    The development of a diagnostic polymerase chain reaction (PCR) or quantitative PCR (qPCR) assay for universal detection of highly variable viral genomes is always a difficult task. The purpose of this chapter is to provide a guideline on how to align, process, and evaluate a huge set of homologous nucleotide sequences in order to reveal the evolutionarily most conserved positions suitable for universal qPCR primer and hybridization probe design. Attention is paid to the quantification and clear graphical visualization of the sequence variability at each position of the alignment. In addition, specific problems related to the processing of the extremely large sequence pool are highlighted. All of these steps are performed using an ordinary desktop computer without the need for extensive mathematical or computational skills.

  3. Linkage disequilibrium of evolutionarily conserved regions in the human genome

    Directory of Open Access Journals (Sweden)

    Johnson Todd A

    2006-12-01

    Full Text Available Abstract Background The strong linkage disequilibrium (LD recently found in genic or exonic regions of the human genome demonstrated that LD can be increased by evolutionary mechanisms that select for functionally important loci. This suggests that LD might be stronger in regions conserved among species than in non-conserved regions, since regions exposed to natural selection tend to be conserved. To assess this hypothesis, we used genome-wide polymorphism data from the HapMap project and investigated LD within DNA sequences conserved between the human and mouse genomes. Results Unexpectedly, we observed that LD was significantly weaker in conserved regions than in non-conserved regions. To investigate why, we examined sequence features that may distort the relationship between LD and conserved regions. We found that interspersed repeats, and not other sequence features, were associated with the weak LD tendency in conserved regions. To appropriately understand the relationship between LD and conserved regions, we removed the effect of repetitive elements and found that the high degree of sequence conservation was strongly associated with strong LD in coding regions but not with that in non-coding regions. Conclusion Our work demonstrates that the degree of sequence conservation does not simply increase LD as predicted by the hypothesis. Rather, it implies that purifying selection changes the polymorphic patterns of coding sequences but has little influence on the patterns of functional units such as regulatory elements present in non-coding regions, since the former are generally restricted by the constraint of maintaining a functional protein product across multiple exons while the latter may exist more as individually isolated units.

  4. Evolutionary Nephrology.

    Science.gov (United States)

    Chevalier, Robert L

    2017-05-01

    Progressive kidney disease follows nephron loss, hyperfiltration, and incomplete repair, a process described as "maladaptive." In the past 20 years, a new discipline has emerged that expands research horizons: evolutionary medicine. In contrast to physiologic (homeostatic) adaptation, evolutionary adaptation is the result of reproductive success that reflects natural selection. Evolutionary explanations for physiologically maladaptive responses can emerge from mismatch of the phenotype with environment or evolutionary tradeoffs. Evolutionary adaptation to a terrestrial environment resulted in a vulnerable energy-consuming renal tubule and a hypoxic, hyperosmolar microenvironment. Natural selection favors successful energy investment strategy: energy is allocated to maintenance of nephron integrity through reproductive years, but this declines with increasing senescence after ~40 years of age. Risk factors for chronic kidney disease include restricted fetal growth or preterm birth (life history tradeoff resulting in fewer nephrons), evolutionary selection for APOL1 mutations (that provide resistance to trypanosome infection, a tradeoff), and modern life experience (Western diet mismatch leading to diabetes and hypertension). Current advances in genomics, epigenetics, and developmental biology have revealed proximate causes of kidney disease, but attempts to slow kidney disease remain elusive. Evolutionary medicine provides a complementary approach by addressing ultimate causes of kidney disease. Marked variation in nephron number at birth, nephron heterogeneity, and changing susceptibility to kidney injury throughout life history are the result of evolutionary processes. Combined application of molecular genetics, evolutionary developmental biology (evo-devo), developmental programming and life history theory may yield new strategies for prevention and treatment of chronic kidney disease.

  5. Sequence Diversity of pfmdr1 and Sequence Conserve of pldh in Plasmodium falciparum from Indonesia: Its implications on Designing a Novel Antimalarial Drug with Less Prone to Resistance.

    Directory of Open Access Journals (Sweden)

    Muhamad Ali

    2013-12-01

    Full Text Available pfmdr1 and its variants are molecular marker which are responsible for antibiotics resistance in Plasmodium falciparum, a parasitic carrier for malaria disease. A novel strategy to treat malaria disease is by disrupting parasite lactate dehydrogenase (pLDH, a crucial enzyme for Plasmodium survival during their erythrocytic stages. This research was aimed to investigate and characterize the pfmdr1 and pldh genes of P. falciparum isolated from Nusa Tenggara Indonesia.Genomic DNA of P.falciparum was isolated from malaria patients in Nusa Tenggara Indonesia. pfmdr1 was amplified using nested PCR and genotyped using Restriction Fragment Length Polymorphism (RFLP. pldh was amplified, sequenced, and analyzed using NCBI public domain databases and alignment using Clustal W ver. 1.83.Genotyping of the pfmdr1 revealed that sequence diversity was extremely high among isolates. However, a sequence analysis of pldh indicated that open reading frame of 316 amino acids of the gene showing 100% homology to the P. falciparum 3D7 reference pldh (GeneBank: XM_001349953.1.This is the first report which confirms the heterologous of pfmdr1 and the homologous sequences of P.falciparum pldh isolated from Nusa Tenggara Islands of Indonesia, indicating that the chloroquine could not be used effectively as antimalarial target in the region and the pLDH-targeted antimalarial compound would have higher chance to be successful than using chloroquine for curbing malaria worldwide.

  6. On the evolutionary conservation of hydrogen bonds made by buried polar amino acids: the hidden joists, braces and trusses of protein architecture.

    Science.gov (United States)

    Worth, Catherine L; Blundell, Tom L

    2010-05-31

    The hydrogen bond patterns between mainchain atoms in protein structures not only give rise to regular secondary structures but also satisfy mainchain hydrogen bond potential. However, not all mainchain atoms can be satisfied through hydrogen bond interactions that arise in regular secondary structures; in some locations sidechain-to-mainchain hydrogen bonds are required to provide polar group satisfaction. Buried polar residues that are hydrogen-bonded to mainchain amide atoms tend to be highly conserved within protein families, confirming that mainchain architecture is a critical restraint on the evolution of proteins. We have investigated the stabilizing roles of buried polar sidechains on the backbones of protein structures by performing an analysis of solvent inaccessible residues that are entirely conserved within protein families and superfamilies and hydrogen bonded to an equivalent mainchain atom in each family member. We show that polar and sometimes charged sidechains form hydrogen bonds to mainchain atoms in the cores of proteins in a manner that has been conserved in evolution. Although particular motifs have previously been identified where buried polar residues have conserved roles in stabilizing protein structure, for example in helix capping, we demonstrate that such interactions occur in a range of architectures and highlight those polar amino acid types that fulfil these roles. We show that these buried polar residues often span elements of secondary structure and provide stabilizing interactions of the overall protein architecture. Conservation of buried polar residues and the hydrogen-bond interactions that they form implies an important role for maintaining protein structure, contributing strong restraints on amino acid substitutions during divergent protein evolution. Our analysis sheds light on the important stabilizing roles of these residues in protein architecture and provides further insight into factors influencing the evolution of

  7. On the evolutionary conservation of hydrogen bonds made by buried polar amino acids: the hidden joists, braces and trusses of protein architecture

    Directory of Open Access Journals (Sweden)

    Worth Catherine L

    2010-05-01

    Full Text Available Abstract Background The hydrogen bond patterns between mainchain atoms in protein structures not only give rise to regular secondary structures but also satisfy mainchain hydrogen bond potential. However, not all mainchain atoms can be satisfied through hydrogen bond interactions that arise in regular secondary structures; in some locations sidechain-to-mainchain hydrogen bonds are required to provide polar group satisfaction. Buried polar residues that are hydrogen-bonded to mainchain amide atoms tend to be highly conserved within protein families, confirming that mainchain architecture is a critical restraint on the evolution of proteins. We have investigated the stabilizing roles of buried polar sidechains on the backbones of protein structures by performing an analysis of solvent inaccessible residues that are entirely conserved within protein families and superfamilies and hydrogen bonded to an equivalent mainchain atom in each family member. Results We show that polar and sometimes charged sidechains form hydrogen bonds to mainchain atoms in the cores of proteins in a manner that has been conserved in evolution. Although particular motifs have previously been identified where buried polar residues have conserved roles in stabilizing protein structure, for example in helix capping, we demonstrate that such interactions occur in a range of architectures and highlight those polar amino acid types that fulfil these roles. We show that these buried polar residues often span elements of secondary structure and provide stabilizing interactions of the overall protein architecture. Conclusions Conservation of buried polar residues and the hydrogen-bond interactions that they form implies an important role for maintaining protein structure, contributing strong restraints on amino acid substitutions during divergent protein evolution. Our analysis sheds light on the important stabilizing roles of these residues in protein architecture and provides

  8. A Cluster of Vitellogenin Genes in the Mediterranean Fruit Fly Ceratitis Capitata: Sequence and Structural Conservation in Dipteran Yolk Proteins and Their Genes

    Science.gov (United States)

    Rina, M.; Savakis, C.

    1991-01-01

    Four genes encoding the major egg yolk polypeptides of the Mediterranean fruit fly Ceratitis capitata, vitellogenins 1 and 2 (VG1 and VG2), were cloned, characterized and partially sequenced. The genes are located on the same region of chromosome 5 and are organized in pairs, each encoding the two polypeptides on opposite DNA strands. Restriction and nucleotide sequence analysis indicate that the gene pairs have arisen from an ancestral pair by a relatively recent duplication event. The transcribed part is very similar to that of the Drosophila melanogaster yolk protein genes Yp1, Yp2 and Yp3. The Vg1 genes have two introns at the same positions as those in D. melanogaster Yp3; the Vg2 genes have only one of the introns, as do D. melanogaster Yp1 and Yp2. Comparison of the five polypeptide sequences shows extensive homology, with 27% of the residues being invariable. The sequence similarity of the processed proteins extends in two regions separated by a nonconserved region of varying size. Secondary structure predictions suggest a highly conserved secondary structure pattern in the two regions, which probably correspond to structural and functional domains. The carboxy-end domain of the C. capitata proteins shows the same sequence similarities with triacylglycerol lipases that have been reported previously for the D. melanogaster yolk proteins. Analysis of codon usage shows significant differences between D. melanogaster and C. capitata vitellogenins with the latter exhibiting a less biased representation of synonymous codons. PMID:1903120

  9. Evolutionary process of a tetranucleotide microsatellite locus in Acipenseriformes.

    Science.gov (United States)

    Shao, Zhao Jun; Rivals, Eric; Zhao, Na; Lek, Sovan; Chang, Jianbo; Berrebi, Patrick

    2011-08-01

    The evolutionary dynamics of the tetra-nucleotide microsatellite locus Spl-106 were investigated at the repeat and flanking sequences in 137 individuals of 15 Acipenseriform species, giving 93 homologous sequences, which were detected in 11 out of 15 species. Twenty-three haplotypes of flanking sequences and three distinct types of repeats, type I, type II and type III, were found within these 93 sequences. The MS-Align hylogenetic method, newly applied to microsatellite sequences, permitted us to understand the repeat and flanking sequence evolution of Spl-106 locus. The flanking region of locus Spl-106 was highly conserved among the species of genera Acipenser, Huso and Scaphirhynchus, which diverged about 150 million years ago (Mya). The rate of flanking sequence divergence at the microsatellite locus Spl-106 in sturgeons is between 0.011% and 0.079% with an average at 0.028% per million years. Sequence alignment and phylogenetic trees produced by MS-Align showed that both the flanking and repeat regions can cluster the alleles of different species into Pacific and Atlantic lineages. Our results show a synchronous evolutionary pattern between the flanking and repeat regions. Moreover, the coexistence of different repeat types in the same species, even in the same individual, is probably due to two duplication events encompassing the locus Spl-106 that occurred during the divergence of Pacific lineage. The first occured before the diversification of Pacific species (121-96 Mya) and led to repeat types I and II. The second occurred more recently, just before the speciation of A. sinensis and A. dabryanus (69-10 Mya), and led to repeat type III. Sequences in the same species with different repeat types probably corresponds to paralogous loci. This study sheds a new light on the evolutionary mechanisms that shape the complex microsatellite loci involving different repeat types.

  10. Gcn4 misregulation reveals a direct role for the evolutionary conserved EKC/KEOPS in the t6A modification of tRNAs

    OpenAIRE

    Daugeron, Marie-Claire; Lenstra, Tineke L.; Frizzarin, Martina; El Yacoubi, Basma; Liu, Xipeng; Baudin-Baillieu, Agnès; Lijnzaad, Philip; Decourty, Laurence; Saveanu, Cosmin; Jacquier, Alain; Frank C P Holstege; de Crécy-Lagard, Valérie; van Tilbeurgh, Herman; Libri, Domenico

    2011-01-01

    International audience; The EKC/KEOPS complex is universally conserved in Archaea and Eukarya and has been implicated in several cellular processes, including transcription, telomere homeostasis and genomic instability. However, the molecular function of the complex has remained elusive so far. We analyzed the transcriptome of EKC/KEOPS mutants and observed a specific profile that is highly enriched in targets of the Gcn4p transcriptional activator. GCN4 expression was found to be activated a...

  11. In Vivo Characterization of a Vertebrate Ultra-conserved Enhancer

    Energy Technology Data Exchange (ETDEWEB)

    Poulin, Francis; Nobrega, Marcelo A.; Plajzer-Frick, Ingrid; Holt, Amy; Afzal, Veena; Rubin, Edward M.; Pennacchio, Len

    2004-10-01

    Genomic sequence comparisons between human, mouse and pufferfish (Takifugu rubripes (Fugu))have revealed a set of extremely conserved noncoding sequences. While this high degree of sequence conservation suggests severe evolutionary constraint and predicts a lack of tolerance to change in order to retain in vivo functionality, such elements have been minimally explored experimentally. In this study, we describe the in-depth characterization of an ancient conserved enhancer, Dc2 located near the dachshund gene, which displays a human-Fugu identity of 84 percent over 424 basepairs (bp). In addition to this large overall conservation, we find that Dc2 is characterized by the presence of a large block of sequence (144 bp) that is completely identical between human, mouse, chicken, zebrafish and Fugu. Through the testing of reporter vector constructs in transgenic mice, we observed that the 424 bp Dc2 conserved element is necessary and sufficient for brain tissue enhancer activity. In vivo analyses also revealed that the 144 bp 100 percent conserved sequence is necessary, but not sufficient, to replicate Dc2 enhancer function. However, the introduction of two separate 16 bp insertions into the highly conserved enhancer core did not cause any detectable modification of its in vivo activity. Our observations indicate that the 144 bp 100 percent conserved element is tolerant of change at least at the resolution of this transgenic mouse assay and suggest that purifying selection on Dc2 sequence might not be as strong as we predicted or that some unknown property also constrains this highly conserved enhancer sequence.

  12. Genome-wide identification of conserved and novel microRNAs in one bud and two tender leaves of tea plant (Camellia sinensis) by small RNA sequencing, microarray-based hybridization and genome survey scaffold sequences.

    Science.gov (United States)

    Jeyaraj, Anburaj; Zhang, Xiao; Hou, Yan; Shangguan, Mingzhu; Gajjeraman, Prabu; Li, Yeyun; Wei, Chaoling

    2017-11-21

    MicroRNAs (miRNAs) are important for plant growth and responses to environmental stresses via post-transcriptional regulation of gene expression. Tea, which is primarily produced from one bud and two tender leaves of the tea plant (Camellia sinensis), is one of the most popular non-alcoholic beverages worldwide owing to its abundance of secondary metabolites. A large number of miRNAs have been identified in various plants, including non-model species. However, due to the lack of reference genome sequences and/or information of tea plant genome survey scaffold sequences, discovery of miRNAs has been limited in C. sinensis. Using small RNA sequencing, combined with our recently obtained genome survey data, we have identified and analyzed 175 conserved and 83 novel miRNAs mainly in one bud and two tender leaves of the tea plant. Among these, 93 conserved and 18 novel miRNAs were validated using miRNA microarray hybridization. In addition, the expression pattern of 11 conserved and 8 novel miRNAs were validated by stem-loop-qRT-PCR. A total of 716 potential target genes of identified miRNAs were predicted. Further, Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that most of the target genes were primarily involved in stress response and enzymes related to phenylpropanoid biosynthesis. The predicted targets of 4 conserved miRNAs were further validated by 5'RLM-RACE. A negative correlation between expression profiles of 3 out of 4 conserved miRNAs (csn-miR160a-5p, csn-miR164a, csn-miR828 and csn-miR858a) and their targets (ARF17, NAC100, WER and MYB12 transcription factor) were observed. In summary, the present study is one of few such studies on miRNA detection and identification in the tea plant. The predicted target genes of majority of miRNAs encoded enzymes, transcription factors, and functional proteins. The miRNA-target transcription factor gene interactions may provide important clues about the regulatory

  13. ChIP-seq Identification of Weakly Conserved Heart Enhancers

    Energy Technology Data Exchange (ETDEWEB)

    Blow, Matthew J.; McCulley, David J.; Li, Zirong; Zhang, Tao; Akiyama, Jennifer A.; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Wright, Crystal; Chen, Feng; Afzal, Veena; Bristow, James; Ren, Bing; Black, Brian L.; Rubin, Edward M.; Visel, Axel; Pennacchio, Len A.

    2010-07-01

    Accurate control of tissue-specific gene expression plays a pivotal role in heart development, but few cardiac transcriptional enhancers have thus far been identified. Extreme non-coding sequence conservation successfully predicts enhancers active in many tissues, but fails to identify substantial numbers of heart enhancers. Here we used ChIP-seq with the enhancer-associated protein p300 from mouse embryonic day 11.5 heart tissue to identify over three thousand candidate heart enhancers genome-wide. Compared to other tissues studied at this time-point, most candidate heart enhancers are less deeply conserved in vertebrate evolution. Nevertheless, the testing of 130 candidate regions in a transgenic mouse assay revealed that most of them reproducibly function as enhancers active in the heart, irrespective of their degree of evolutionary constraint. These results provide evidence for a large population of poorly conserved heart enhancers and suggest that the evolutionary constraint of embryonic enhancers can vary depending on tissue type.

  14. The Jumonji gene family in Crassostrea gigas suggests evolutionary conservation of Jmj-C histone demethylases orthologues in the oyster gametogenesis and development.

    Science.gov (United States)

    Fellous, Alexandre; Favrel, Pascal; Guo, Ximing; Riviere, Guillaume

    2014-03-15

    Jumonji (Jmj) proteins are histone demethylases, which control the identity of stem cells. Jmj genes were characterized from plants to mammals where they have been implicated in the epigenetic regulation of development. Despite the Pacific oyster Crassostrea gigas representing one of the most important aquaculture resources worldwide, the molecular mechanisms governing the embryogenesis and reproduction of this lophotrochozoan species remain poorly understood. However, annotations in the C. gigas EST library suggested the presence of putative Jumonji genes, raising the question of the conservation of this family of histone demethylases in the oyster. Using Primer walking, 5'-RACE PCR and in silico analyses, we characterized nine Jumonji orthologues in the oyster, called Cg-Jmj, bearing conserved domains critical for putative histone demethylase activity. Phylogenic analyses revealed that oyster Jumonji cluster into two distinct groups: 'single-domain Jmj' and 'multi-domain Jmj', and define 8 subgroups corresponding to each cognate orthologues in metazoans. RT-qPCR investigations showed specific regulations of Cg-Jmj mRNAs during the early development and along the reproduction cycle. Furthermore, in situ and in toto hybridizations indicate that oyster Jumonji genes are transcribed mostly within the gonad in adult oysters whereas they display a ubiquitous expression during embryonic and larval development. Our study demonstrates the presence of nine Jumonji orthologues in the oyster C. gigas. Their domain conservation and their expression profile suggest an implication during reproduction and development, questioning about the epigenetic regulation by histone methylation in lophotrochozoans. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Evolutionary Nephrology

    Directory of Open Access Journals (Sweden)

    Robert L. Chevalier

    2017-05-01

    Full Text Available Progressive kidney disease follows nephron loss, hyperfiltration, and incomplete repair, a process described as “maladaptive.” In the past 20 years, a new discipline has emerged that expands research horizons: evolutionary medicine. In contrast to physiologic (homeostatic adaptation, evolutionary adaptation is the result of reproductive success that reflects natural selection. Evolutionary explanations for physiologically maladaptive responses can emerge from mismatch of the phenotype with environment or from evolutionary tradeoffs. Evolutionary adaptation to a terrestrial environment resulted in a vulnerable energy-consuming renal tubule and a hypoxic, hyperosmolar microenvironment. Natural selection favors successful energy investment strategy: energy is allocated to maintenance of nephron integrity through reproductive years, but this declines with increasing senescence after ∼40 years of age. Risk factors for chronic kidney disease include restricted fetal growth or preterm birth (life history tradeoff resulting in fewer nephrons, evolutionary selection for APOL1 mutations (which provide resistance to trypanosome infection, a tradeoff, and modern life experience (Western diet mismatch leading to diabetes and hypertension. Current advances in genomics, epigenetics, and developmental biology have revealed proximate causes of kidney disease, but attempts to slow kidney disease remain elusive. Evolutionary medicine provides a complementary approach by addressing ultimate causes of kidney disease. Marked variation in nephron number at birth, nephron heterogeneity, and changing susceptibility to kidney injury throughout the life history are the result of evolutionary processes. Combined application of molecular genetics, evolutionary developmental biology (evo-devo, developmental programming, and life history theory may yield new strategies for prevention and treatment of chronic kidney disease.

  16. Liberal-Conservative Synthesis: the Experience of Creating the Concept of Evolutionary Modernization of Russia in the Second half of the 19th Century

    Directory of Open Access Journals (Sweden)

    Maxim N. Krot

    2015-06-01

    Full Text Available The article is devoted to consideration of the liberal-conservative conception of Russia formed in the second half of the 19th century by a number of Russian public figures and statesmen, the most prominent of which were B.N. Chicherin, K.D. Cavelin and A.D. Gradovsky. The author reveals the main stages of modernization of the social and political system in Russia suggested by the liberals. The author deals with the concrete projects of changes and reforms, characterizes the methods of achieving these aims. The article reveals the essence of the liberal-conservative "anticonstitutionalism" of the 60s and the first half of the 70s of the 19th century, identifies the main arguments, used by the representatives of this social thought trend for proving their opinion. One issue is considered separately: the draft of the administrative reform by K.D. Kavelin, having offered a wide reorganization of the supreme bodies of state administration and the nature of their formation in order to prepare the basis for establishing of representative government in Russia in the future. The article characterizes the situation in Russia at the turn of 1870 - 1880s, under the circumstances of which there is a gradual transition of liberal conservatives to the idea of immediate creation of representative bodies in Russia. The author analyzes in detail the following: the main arguments and motivations, having induced them to introducing the requirements as well as the projects themselves, devoted to the establishment of elected representative bodies that were supposed to be integrated into the existing government management, complementing and improving it. In the article special attention is drawn to the harmonious combination of liberal - reformational and conservative-preserving principles that, according to its authors, on the one hand, must have promoted the evolution of social and political relations in the country, have avoided their stagnation and degradation

  17. Detecting conserved regulatory elements with the model genome of the Japanese puffer fish, Fugu rubripes.

    Science.gov (United States)

    Aparicio, S; Morrison, A; Gould, A; Gilthorpe, J; Chaudhuri, C; Rigby, P; Krumlauf, R; Brenner, S

    1995-01-01

    Comparative vertebrate genome sequencing offers a powerful method for detecting conserved regulatory sequences. We propose that the compact genome of the teleost Fugu rubripes is well suited for this purpose. The evolutionary distance of teleosts from other vertebrates offers the maximum stringency for such evolutionary comparisons. To illustrate the comparative genome approach for F. rubripes, we use sequence comparisons between mouse and Fugu Hoxb-4 noncoding regions to identify conserved sequence blocks. We have used two approaches to test the function of these conserved blocks. In the first, homologous sequences were deleted from a mouse enhancer, resulting in a tissue-specific loss of activity when assayed in transgenic mice. In the second approach, Fugu DNA sequences showing homology to mouse sequences were tested for enhancer activity in transgenic mice. This strategy identified a neural element that mediates a subset of Hoxb-4 expression that is conserved between mammals and teleosts. The comparison of noncoding vertebrate sequences with those of Fugu, coupled to a transgenic bioassay, represents a general approach suitable for many genome projects. Images Fig. 2 Fig. 3 Fig. 4 PMID:7878040

  18. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

    Directory of Open Access Journals (Sweden)

    Aaron Silva-Sanchez

    Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

  19. Evolutionary relationships between Fusarium oxysporum f. sp. lycopersici and F. oxysporum f. sp. radicis-lycopersici isolates inferred from mating type, elongation factor-1α and exopolygalacturonase sequences

    NARCIS (Netherlands)

    Lievens, B.; van Baarlen, P.; Verreth, C.; Van Kerckhove, S.; Rep, M.; Thomma, B.P.H.J.

    2009-01-01

    Fusarium oxysporum is a ubiquitous species complex of soilborne plant pathogens that comprises many different formae speciales, each characterized by a high degree of host specificity. In this study, the evolutionary relationships between different isolates of the F. oxysporum species complex have

  20. Evolutionary relationships between Fusarium oxysporum f. sp. lycopersici and F. oxysporum f. sp. radicis-lycopersici isolates inferred from mating type, elongation factor-1a exopolygalacturonase sequences

    NARCIS (Netherlands)

    Lievens, B.; Baarlen, van P.; Verreth, C.; Kerckhove, van S.; Rep, M.; Thomma, B.P.H.J.

    2009-01-01

    Fusarium oxysporum is a ubiquitous species complex of soilborne plant pathogens that comprises many different formae speciales, each characterized by a high degree of host specificity. In this study, the evolutionary relationships between different isolates of the F. oxysporum species complex have

  1. Sequence conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in human and mouse.

    NARCIS (Netherlands)

    M.J. McKay (Michael); C. Troelstra (Christine); P.J. van der Spek (Peter); R. Kanaar (Roland); B. Smit (Bep); A. Hagemeijer (Anne); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1996-01-01

    textabstractThe rad21 gene of Schizosaccharomyces pombe is involved in the repair of ionizing radiation-induced DNA double-strand breaks. The isolation of mouse and human putative homologs of rad21 is reported here. Alignment of the predicted amino acid sequence of Rad21 with the mammalian proteins

  2. The first myriapod genome sequence reveals conservative arthropod gene content and genome organisation in the centipede Strigamia maritima

    NARCIS (Netherlands)

    Chipman, Ariel D; Ferrier, David E K; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S T; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C; Alonso, Claudio R; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C J; Blankenburg, Kerstin P; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K; Du Pasquier, Louis; Duncan, Elizabeth J; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D; Extavour, Cassandra G; Francisco, Liezl; Gabaldón, Toni; Gillis, William J; Goodwin-Horn, Elizabeth A; Green, Jack E; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J P; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H L; Hunn, Julia P; Hunnekuhl, Vera S; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N; Jiggins, Francis M; Jones, Tamsin E; Kaiser, Tobias S; Kalra, Divya; Kenny, Nathan J; Korchina, Viktoriya; Kovar, Christie L; Kraus, F Bernhard; Lapraz, François; Lee, Sandra L; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C; Robertson, Helen E; Robertson, Hugh M; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E; Schurko, Andrew M; Siggens, Kenneth W; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M; Willis, Judith H; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M; Worley, Kim C; Gibbs, Richard A; Akam, Michael; Richards, Stephen

    2014-01-01

    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present

  3. Molecular cloning and nucleotide sequence of the human growth hormone structural gene.

    Science.gov (United States)

    Roskam, W G; Rougeon, F

    1979-01-01

    An almost complete cDNA copy of human growth hormone has been cloned and sequenced. The nucleotide sequence confirms the known protein sequence and predicts the sequence of a precursor region of 26 amino acids. We have compared the nucleotide sequence to that for the homolgous proteins, rat growth hormone and human chorionic somatomammotropin (Seeburg et al. and Shine et al., Nature 270, 486 (1977)). There appears to be evolutionary conservation of mRNA sequence features not related to protein structure. Images PMID:386281

  4. Assessment of genetic diversity among four orchids based on ddRAD sequencing data for conservation purposes.

    Science.gov (United States)

    Roy, Subhas Chandra; Moitra, Kaushik; De Sarker, Dilip

    2017-01-01

    Genetic diversity was assessed in the four orchid species using NGS based ddRAD sequencing data. The assembled nucleotide sequences (fastq) were deposited in the SRA archive of NCBI Database with accession number (SRP063543 for Dendrobium , SRP065790 for Geodorum, SRP072201 for Cymbidium and SRP072378 for Rhynchostylis ). Total base pair read was 1.1 Mbp in case of Dendrobium sp., 553.3 Kbp for Geodorum sp., 1.6 Gbp for Cymbidium , and 1.4 Gbp for Rhynchostylis . Average GC% was 43.9 in Geodorum , 43.7% in Dendrobium , 41.2% in Cymbidium and 42.3% in Rhynchostylis . Four partial gene sequences were used in DnaSP5 program for nucleotide diversity and phylogenetic relationship determination ( Ycf2 gene of Dendrobium, matK gene of Geodorum , psbD gene of Cymbidium and Ycf2 gene of Ryhnchostylis ). Nucleotide diversity (per site) Pi (π) was 0.10560 in Dendrobium, 0.03586 in Geodorum, 0.01364 in Cymbidium and 0.011344 in Rhynchostylis . Neutrality test statistics showed the negative value in all the four orchid species (Tajima's D value -2.17959 in Dendrobium , -2.01655 in Geodorum, -2.12362 in Rhynchostylis and -1.54222 in Cymbidium ) indicating the purifying selection. Result for these gene sequences ( mat K and Ycf 2 and psb D) indicate that they were not evolved neutrally, but signifying that selection might have played a role in evolution of these genes in these four groups of orchids. Phylogenetic relationship was analyzed by reconstructing dendrogram based on the matK, psbD and Ycf2 gene sequences using maximum likelihood method in MEGA6 program.

  5. Archaeogenetics in evolutionary medicine.

    Science.gov (United States)

    Bouwman, Abigail; Rühli, Frank

    2016-09-01

    Archaeogenetics is the study of exploration of ancient DNA (aDNA) of more than 70 years old. It is an important part of the wider studies of many different areas of our past, including animal, plant and pathogen evolution and domestication events. Hereby, we address specifically the impact of research in archaeogenetics in the broader field of evolutionary medicine. Studies on ancient hominid genomes help to understand even modern health patterns. Human genetic microevolution, e.g. related to abilities of post-weaning milk consumption, and specifically genetic adaptation in disease susceptibility, e.g. towards malaria and other infectious diseases, are of the upmost importance in contributions of archeogenetics on the evolutionary understanding of human health and disease. With the increase in both the understanding of modern medical genetics and the ability to deep sequence ancient genetic information, the field of archaeogenetic evolutionary medicine is blossoming.

  6. Identification of conserved and novel microRNAs in Catharanthus roseus by deep sequencing and computational prediction of their potential targets.

    Science.gov (United States)

    Prakash, Pravin; Ghosliya, Dolly; Gupta, Vikrant

    2015-01-10

    MicroRNAs are small endogenous non-coding RNAs of ~19-24 nucleotides and perform regulatory roles in many plant processes. To identify miRNAs involved in regulatory networks controlling diverse biological processes including secondary metabolism in Catharanthus roseus, an important medicinal plant, we employed deep sequencing of small RNA from leaf tissue. A total of 88 potential miRNAs comprising of 81 conserved miRNAs belonging to 35 families and seven novel miRNAs were identified. Precursors for 16 conserved and seven novel cro-miRNAs were identified, and their stem-loop hairpin structures were predicted. Selected cro-miRNAs were analyzed by stem-loop qRT-PCR and differential expression patterns were observed in different vegetative tissues of C. roseus. Targets were predicted for conserved and novel cro-miRNAs, which were found to be involved in diverse biological role(s) including secondary metabolism. Our study enriches available resources and information regarding miRNAs and their potential targets for better understanding of miRNA-mediated gene regulation in plants. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Functional conservation between rodents and chicken of regulatory sequences driving skeletal muscle gene expression in transgenic chickens

    Directory of Open Access Journals (Sweden)

    Taylor Lorna

    2010-02-01

    Full Text Available Abstract Background Regulatory elements that control expression of specific genes during development have been shown in many cases to contain functionally-conserved modules that can be transferred between species and direct gene expression in a comparable developmental pattern. An example of such a module has been identified at the rat myosin light chain (MLC 1/3 locus, which has been well characterised in transgenic mouse studies. This locus contains two promoters encoding two alternatively spliced isoforms of alkali myosin light chain. These promoters are differentially regulated during development through the activity of two enhancer elements. The MLC3 promoter alone has been shown to confer expression of a reporter gene in skeletal and cardiac muscle in transgenic mice and the addition of the downstream MLC enhancer increased expression levels in skeletal muscle. We asked whether this regulatory module, sufficient for striated muscle gene expression in the mouse, would drive expression in similar domains in the chicken. Results We have observed that a conserved downstream MLC enhancer is present in the chicken MLC locus. We found that the rat MLC1/3 regulatory elements were transcriptionally active in chick skeletal muscle primary cultures. We observed that a single copy lentiviral insert containing this regulatory cassette was able to drive expression of a lacZ reporter gene in the fast-fibres of skeletal muscle in chicken in three independent transgenic chicken lines in a pattern similar to the endogenous MLC locus. Reporter gene expression in cardiac muscle tissues was not observed for any of these lines. Conclusions From these results we conclude that skeletal expression from this regulatory module is conserved in a genomic context between rodents and chickens. This transgenic module will be useful in future investigations of muscle development in avian species.

  8. Genomic sequencing of Pleistocene cave bears

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, James P.; Hofreiter, Michael; Smith, Doug; Priest, JamesR.; Rohland, Nadin; Rabeder, Gernot; Krause, Johannes; Detter, J. Chris; Paabo, Svante; Rubin, Edward M.

    2005-04-01

    Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome, the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.

  9. Multiple Identified Neurons and Peripheral Nerves Innervating the Prothoracic Defense Glands in Stick Insects Reveal Evolutionary Conserved and Novel Elements of a Chemical Defense System

    Directory of Open Access Journals (Sweden)

    Johannes Strauß

    2017-11-01

    Full Text Available The defense glands in the dorsal prothorax are an important autapomorphic trait of stick insects (Phasmatodea. Here, we study the functional anatomy and neuronal innervation of the defense glands in Anisomorpha paromalus (Westwood, 1859 (Pseudophasmatinae, a species which sprays its defense secretions when disturbed or attacked. We use a neuroanatomical approach to identify the nerves innervating the gland muscles and the motoneurons with axons in the different nerves. The defense gland is innervated by nerves originating from two segments, the subesophageal ganglion (SOG, and the prothoracic ganglion. Axonal tracing confirms the gland innervation via the anterior subesophageal nerve, and two intersegmental nerves, the posterior subesophageal nerve, and the anterior prothoracic nerve. Axonal tracing of individual nerves reveals eight identified neuron types in the subesophageal or prothoracic ganglion. The strongest innervating nerve of the gland is the anterior subesophageal nerve, which also supplies dorsal longitudinal thorax muscles (neck muscles by separate nerve branches. Tracing of individual nerve branches reveals different sets of motoneurons innervating the defense gland (one ipsilateral and one contralateral subesophageal neuron or the neck muscle (ventral median neurons. The ipsilateral and contralateral subesophageal neurons have no homologs in related taxa like locusts and crickets, and thus evolved within stick insects with the differentiation of the defense glands. The overall innervation pattern suggests that the longitudinal gland muscles derived from dorsal longitudinal neck muscles. In sum, the innervating nerves for dorsal longitudinal muscles are conserved in stick insects, while the neuronal control system was specialized with conserved motoneurons for the persisting neck muscles, and evolutionarily novel subesophageal and prothoracic motoneurons innervating the defense gland.

  10. Channel catfish BAC-end sequences for marker development and assessment of syntenic conservation with other fish species.

    Science.gov (United States)

    Xu, P; Wang, S; Liu, L; Peatman, E; Somridhivej, B; Thimmapuram, J; Gong, G; Liu, Z

    2006-08-01

    In the present study, 25 195 BAC ends for channel catfish (Ictalurus punctatus) were sequenced, generating 20 366 clean BAC-end sequences (BES), with an average read length of 557 bp after trimming. A total of 11 414 601 bp were generated, representing approximately 1.2% of the catfish genome. Based on this survey, the catfish genome was found to be highly AT-rich, with 60.7% A+T and 39.3% G+C. Approximately 12% of the catfish genome consisted of dispersed repetitive elements, with the Tc1/mariner transposons making up the largest percentage by base pair (4.57%). Microsatellites were detected in 17.5% of BES. Catfish BACs were anchored to the zebrafish and Tetraodon genome sequences by BLASTN, generating 16% and 8.2% significant hits (E < e(-5)) respectively. A total of 1074 and 773 significant hits were unique to the zebrafish and Tetraodon genomes, respectively, of which 417 and 406, respectively, were identified as known genes in other species, providing a major genome resource for comparative genomic mapping.

  11. Inhibition of Hepatitis C Virus in Mice by a Small Interfering RNA Targeting a Highly Conserved Sequence in Viral IRES Pseudoknot.

    Directory of Open Access Journals (Sweden)

    Jae-Su Moon

    Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.

  12. Hepatitis B virus depicts a high degree of conservation during the immune-tolerant phase in familiarly transmitted chronic hepatitis B infection: deep-sequencing and phylogenetic analysis.

    Science.gov (United States)

    Sede, M; Lopez-Ledesma, M; Frider, B; Pozzati, M; Campos, R H; Flichman, D; Quarleri, J

    2014-01-01

    When intrafamilial transmission of hepatitis B virus (HBV) occurs, a virus with the same characteristics interacts with diverse hosts' immune systems and may thus result in different mutations to escape immune pressure. In this study, the HBV genomic characterization was assessed longitudinally after intrafamilial transmission using nucleotide sequence data of phylogenetic and mutational analyses, including those obtained by deep-sequencing for the first time. Furthermore, HBeAg-anti-HBe profile and variability of HBV core-derived epitopes were also evaluated. Strong evidence was obtained from intrafamilial transmission of HBV genotype D1 by phylogenetic inferences. HBV isolates exhibited high degree (~99%) of genomic conservation for almost 20 years, when patients were persistently HBeAg positive with normal amino transferase levels. This identity remained high among immune-tolerant siblings. In contrast, it diminished significantly (P = 0.02) when the mother cleared HBeAg (immune clearance phase). By deep-sequencing, the quantitative analysis of the dynamics of basal core promoter (BCP) (A1762T, G1764A; A1766C; T1773C; 8-bp deletion; and other) and precore (G1896A) variants among HBV isolates from family members exhibited differences during the follow-up. However, only those from the mother showed amino acid variations at core protein that would impair their MHC-II binding. Hence, when intrafamilial transmission occurs, HBV was highly conserved under the immune-tolerant phase, but it exhibited mutations more frequently during the immune clearance phase. The analysis of the HBV BCP and precore mutants after intrafamilial HBV transmission contributes to a better understanding of how they evolve over time. © 2013 John Wiley & Sons Ltd.

  13. Understanding missense mutations in the BRCA1 gene: An evolutionary approach

    OpenAIRE

    Fleming, Melissa A.; Potter, John D.; Ramirez, Christina J.; Ostrander, Gary K.; Ostrander, Elaine A.

    2003-01-01

    The role of missense changes in BRCA1 in breast cancer susceptibility has been difficult to establish. We used comparative evolutionary methods to identify potential functionally important amino acid sites in exon 11 and missense changes likely to disrupt gene function, aligning sequences from 57 eutherian mammals and categorizing amino acid sites by degree of conservation. We used Bayesian phylogenetic analyses to determine relationships among orthologs and identify codons evolving under pos...

  14. Detailed phylogenetic analysis of primate T-lymphotropic virus type 1 (PTLV-1) sequences from orangutans (Pongo pygmaeus) reveals new insights into the evolutionary history of PTLV-1 in Asia.

    Science.gov (United States)

    Reid, Michael J C; Switzer, William M; Schillaci, Michael A; Ragonnet-Cronin, Manon; Joanisse, Isabelle; Caminiti, Kyna; Lowenberger, Carl A; Galdikas, Birute Mary F; Sandstrom, Paul A; Brooks, James I

    2016-09-01

    While human T-lymphotropic virus type 1 (HTLV-1) originates from ancient cross-species transmission of simian T-lymphotropic virus type 1 (STLV-1) from infected nonhuman primates, much debate exists on whether the first HTLV-1 occurred in Africa, or in Asia during early human evolution and migration. This topic is complicated by a lack of representative Asian STLV-1 to infer PTLV-1 evolutionary histories. In this study we obtained new STLV-1 LTR and tax sequences from a wild-born Bornean orangutan (Pongo pygmaeus) and performed detailed phylogenetic analyses using both maximum likelihood and Bayesian inference of available Asian PTLV-1 and African STLV-1 sequences. Phylogenies, divergence dates and nucleotide substitution rates were co-inferred and compared using six different molecular clock calibrations in a Bayesian framework, including both archaeological and/or nucleotide substitution rate calibrations. We then combined our molecular results with paleobiogeographical and ecological data to infer the most likely evolutionary history of PTLV-1. Based on the preferred models our analyses robustly inferred an Asian source for PTLV-1 with cross-species transmission of STLV-1 likely from a macaque (Macaca sp.) to an orangutan about 37.9-48.9kya, and to humans between 20.3-25.5kya. An orangutan diversification of STLV-1 commenced approximately 6.4-7.3kya. Our analyses also inferred that HTLV-1 was first introduced into Australia ~3.1-3.7kya, corresponding to both genetic and archaeological changes occurring in Australia at that time. Finally, HTLV-1 appears in Melanesia at ~2.3-2.7kya corresponding to the migration of the Lapita peoples into the region. Our results also provide an important future reference for calibrating information essential for PTLV evolutionary timescale inference. Longer sequence data, or full genomes from a greater representation of Asian primates, including gibbons, leaf monkeys, and Sumatran orangutans are needed to fully elucidate these

  15. In silico analysis of evolutionary patterns in restriction endonucleases.

    Science.gov (United States)

    Singh, Tiratha Raj; Pardasani, Kamal Raj

    2009-01-01

    Restriction endonucleases represent one of the best studied examples of DNA binding proteins. Type II restriction endonucleases recognize short sequences of foreign DNA and cleave the target on both strands with remarkable sequence specificity. Type II restriction endonucleases are part of restriction modification systems. Restriction modification systems occur ubiquitously among bacteria and archaea. Restriction endonucleases are indispensable tools in molecular biology and biotechnology. They are important model system for specific protein-nucleic acid interactions and also serve as good example for investigating structural, functional and evolutionary relationships among various biomolecules. The interaction between restriction endonucleases and their recognition sequences plays a crucial role in biochemical activities like catalytic site/metal binding, DNA repair and recombination etc. We study various patterns in restriction endonucleases type II and analyzed their structural, functional and evolutionary role. Our studies support X-ray crystallographic studies, arguing for divergence and molecular evolution. Conservation patterns of the nuclease superfamily have also been analyzed by estimating site-specific evolutionary rates for the analyzed structures related to respective chains in this study.

  16. Expression analysis of Egr-1 ortholog in metamorphic brain of honeybee (Apis mellifera L.): Possible evolutionary conservation of roles of Egr in eye development in vertebrates and insects.

    Science.gov (United States)

    Ugajin, Atsushi; Watanabe, Takayuki; Uchiyama, Hironobu; Sasaki, Tetsuhiko; Yajima, Shunsuke; Ono, Masato

    2016-09-16

    Specific genes quickly transcribed after extracellular stimuli without de novo protein synthesis are known as immediate early genes (IEGs) and are thought to contribute to learning and memory processes in the mature nervous system of vertebrates. A recent study revealed that the homolog of Early growth response protein-1 (Egr-1), which is one of the best-characterized vertebrate IEGs, shared similar properties as a neural activity-dependent gene in the adult brain of insects. With regard to the roles of vertebrate Egr-1 in neural development, the contribution to the development and growth of visual systems has been reported. However, in insects, the expression dynamics of the Egr-1 homologous gene during neural development remains poorly understood. Our expression analysis demonstrated that AmEgr, a honeybee homolog of Egr-1, was transiently upregulated in the developing brain during the early to mid pupal stages. In situ hybridization and 5-bromo-2'-deoxyuridine (BrdU) immunohistochemistry revealed that AmEgr was mainly expressed in post-mitotic cells in optic lobes, the primary visual center of the insect brain. These findings suggest the evolutionarily conserved role of Egr homologs in the development of visual systems in vertebrates and insects. Copyright © 2016 Elsevier Inc. All rights reserved.