WorldWideScience

Sample records for evolutionarily conserved sequences

  1. Evolutionarily conserved sequences on human chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila

    2001-09-01

    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  2. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences.

    LENUS (Irish Health Repository)

    Ivanov, Ivaylo P

    2011-05-01

    In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5\\' cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized--both for increased coding capacity and potentially also for novel regulatory mechanisms--remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5\\' untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data.

  3. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

    Directory of Open Access Journals (Sweden)

    Aaron Silva-Sanchez

    Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

  4. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Science.gov (United States)

    Capra, John A; Paeschke, Katrin; Singh, Mona; Zakian, Virginia A

    2010-07-22

    G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs) across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs). Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  5. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  6. Large-scale nucleotide sequence alignment and sequence variability assessment to identify the evolutionarily highly conserved regions for universal screening PCR assay design: an example of influenza A virus.

    Science.gov (United States)

    Nagy, Alexander; Jiřinec, Tomáš; Černíková, Lenka; Jiřincová, Helena; Havlíčková, Martina

    2015-01-01

    The development of a diagnostic polymerase chain reaction (PCR) or quantitative PCR (qPCR) assay for universal detection of highly variable viral genomes is always a difficult task. The purpose of this chapter is to provide a guideline on how to align, process, and evaluate a huge set of homologous nucleotide sequences in order to reveal the evolutionarily most conserved positions suitable for universal qPCR primer and hybridization probe design. Attention is paid to the quantification and clear graphical visualization of the sequence variability at each position of the alignment. In addition, specific problems related to the processing of the extremely large sequence pool are highlighted. All of these steps are performed using an ordinary desktop computer without the need for extensive mathematical or computational skills.

  7. Evolutionarily conserved herpesviral protein interaction networks.

    Directory of Open Access Journals (Sweden)

    Even Fossum

    2009-09-01

    Full Text Available Herpesviruses constitute a family of large DNA viruses widely spread in vertebrates and causing a variety of different diseases. They possess dsDNA genomes ranging from 120 to 240 kbp encoding between 70 to 170 open reading frames. We previously reported the protein interaction networks of two herpesviruses, varicella-zoster virus (VZV and Kaposi's sarcoma-associated herpesvirus (KSHV. In this study, we systematically tested three additional herpesvirus species, herpes simplex virus 1 (HSV-1, murine cytomegalovirus and Epstein-Barr virus, for protein interactions in order to be able to perform a comparative analysis of all three herpesvirus subfamilies. We identified 735 interactions by genome-wide yeast-two-hybrid screens (Y2H, and, together with the interactomes of VZV and KSHV, included a total of 1,007 intraviral protein interactions in the analysis. Whereas a large number of interactions have not been reported previously, we were able to identify a core set of highly conserved protein interactions, like the interaction between HSV-1 UL33 with the nuclear egress proteins UL31/UL34. Interactions were conserved between orthologous proteins despite generally low sequence similarity, suggesting that function may be more conserved than sequence. By combining interactomes of different species we were able to systematically address the low coverage of the Y2H system and to extract biologically relevant interactions which were not evident from single species.

  8. Evolutionarily conserved phenylpropanoid pattern on angiosperm pollen.

    Science.gov (United States)

    Fellenberg, Christin; Vogt, Thomas

    2015-04-01

    The male gametophyte of higher plants appears as a solid box containing the essentials to transmit genetic material to the next generation. These consist of haploid generative cells that are required for reproduction, and an invasive vegetative cell producing the pollen tube, both mechanically protected by a rigid polymer, the pollen wall, and surrounded by a hydrophobic pollen coat. This coat mediates the direct contact to the biotic and abiotic environments. It contains a mixture of compounds required not only for fertilization but also for protection against biotic and abiotic stressors. Among its metabolites, the structural characteristics of two types of phenylpropanoids, hydroxycinnamic acid amides and flavonol glycosides, are highly conserved in Angiosperm pollen. Structural and functional aspects of these compounds will be discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Aligning science and policy to achieve evolutionarily enlightened conservation.

    Science.gov (United States)

    Cook, Carly N; Sgrò, Carla M

    2017-06-01

    There is increasing recognition among conservation scientists that long-term conservation outcomes could be improved through better integration of evolutionary theory into management practices. Despite concerns that the importance of key concepts emerging from evolutionary theory (i.e., evolutionary principles and processes) are not being recognized by managers, there has been little effort to determine the level of integration of evolutionary theory into conservation policy and practice. We assessed conservation policy at 3 scales (international, national, and provincial) on 3 continents to quantify the degree to which key evolutionary concepts, such as genetic diversity and gene flow, are being incorporated into conservation practice. We also evaluated the availability of clear guidance within the applied evolutionary biology literature as to how managers can change their management practices to achieve better conservation outcomes. Despite widespread recognition of the importance of maintaining genetic diversity, conservation policies provide little guidance about how this can be achieved in practice and other relevant evolutionary concepts, such as inbreeding depression, are mentioned rarely. In some cases the poor integration of evolutionary concepts into management reflects a lack of decision-support tools in the literature. Where these tools are available, such as risk-assessment frameworks, they are not being adopted by conservation policy makers, suggesting that the availability of a strong evidence base is not the only barrier to evolutionarily enlightened management. We believe there is a clear need for more engagement by evolutionary biologists with policy makers to develop practical guidelines that will help managers make changes to conservation practice. There is also an urgent need for more research to better understand the barriers to and opportunities for incorporating evolutionary theory into conservation practice. © 2016 Society for Conservation

  10. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

    Science.gov (United States)

    Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

    2016-08-19

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Linkage disequilibrium of evolutionarily conserved regions in the human genome

    Directory of Open Access Journals (Sweden)

    Johnson Todd A

    2006-12-01

    Full Text Available Abstract Background The strong linkage disequilibrium (LD recently found in genic or exonic regions of the human genome demonstrated that LD can be increased by evolutionary mechanisms that select for functionally important loci. This suggests that LD might be stronger in regions conserved among species than in non-conserved regions, since regions exposed to natural selection tend to be conserved. To assess this hypothesis, we used genome-wide polymorphism data from the HapMap project and investigated LD within DNA sequences conserved between the human and mouse genomes. Results Unexpectedly, we observed that LD was significantly weaker in conserved regions than in non-conserved regions. To investigate why, we examined sequence features that may distort the relationship between LD and conserved regions. We found that interspersed repeats, and not other sequence features, were associated with the weak LD tendency in conserved regions. To appropriately understand the relationship between LD and conserved regions, we removed the effect of repetitive elements and found that the high degree of sequence conservation was strongly associated with strong LD in coding regions but not with that in non-coding regions. Conclusion Our work demonstrates that the degree of sequence conservation does not simply increase LD as predicted by the hypothesis. Rather, it implies that purifying selection changes the polymorphic patterns of coding sequences but has little influence on the patterns of functional units such as regulatory elements present in non-coding regions, since the former are generally restricted by the constraint of maintaining a functional protein product across multiple exons while the latter may exist more as individually isolated units.

  12. Localization of an evolutionarily conserved protein proton pyrophosphatase in evolutionarily distant plants oryza sativa and physcomitrella patens

    Science.gov (United States)

    Proton Pyrophosphatase (H+-PPase) is a highly evolutionarily conserved protein that is prevalent in the plant kingdom. One of the salient features of H+-PPase expression pattern, at least in vascular plants like Arabidopsis, is its conspicuous localization in both actively dividing cells and the phl...

  13. Evolutionarily conserved TRH neuropeptide pathway regulates growth in Caenorhabditis elegans.

    Science.gov (United States)

    Van Sinay, Elien; Mirabeau, Olivier; Depuydt, Geert; Van Hiel, Matthias Boris; Peymen, Katleen; Watteyne, Jan; Zels, Sven; Schoofs, Liliane; Beets, Isabel

    2017-05-16

    In vertebrates thyrotropin-releasing hormone (TRH) is a highly conserved neuropeptide that exerts the hormonal control of thyroid-stimulating hormone (TSH) levels as well as neuromodulatory functions. However, a functional equivalent in protostomian animals remains unknown, although TRH receptors are conserved in proto- and deuterostomians. Here we identify a TRH-like neuropeptide precursor in Caenorhabditis elegans that belongs to a bilaterian family of TRH precursors. Using CRISPR/Cas9 and RNAi reverse genetics, we show that TRH-like neuropeptides, through the activation of their receptor TRHR-1, promote growth in Celegans TRH-like peptides from pharyngeal motor neurons are required for normal body size, and knockdown of their receptor in pharyngeal muscle cells reduces growth. Mutants deficient for TRH signaling have no defects in pharyngeal pumping or isthmus peristalsis rates, but their growth defect depends on the bacterial diet. In addition to the decrease in growth, trh-1 mutants have a reduced number of offspring. Our study suggests that TRH is an evolutionarily ancient neuropeptide, having its origin before the divergence of protostomes and deuterostomes, and may ancestrally have been involved in the control of postembryonic growth and reproduction.

  14. An evolutionarily conserved sexual signature in the primate brain.

    Directory of Open Access Journals (Sweden)

    Björn Reinius

    2008-06-01

    Full Text Available The question of a potential biological sexual signature in the human brain is a heavily disputed subject. In order to provide further insight into this issue, we used an evolutionary approach to identify genes with sex differences in brain expression level among primates. We reasoned that expression patterns important to uphold key male and female characteristics may be conserved during evolution. We selected cortex for our studies because this specific brain region is responsible for many higher behavioral functions. We compared gene expression profiles in the occipital cortex of male and female humans (Homo sapiens, a great ape and cynomolgus macaques (Macaca fascicularis, an old world monkey, two catarrhine species that show abundant morphological sexual dimorphism, as well as in common marmosets (Callithrix Jacchus, a new world monkey which are relatively sexually monomorphic. We identified hundreds of genes with sex-biased expression patterns in humans and macaques, while fewer than ten were differentially expressed between the sexes in marmosets. In primates, a general rule is that many of the morphological and behavioral sexual dimorphisms seen in polygamous species, such as macaques, are typically less pronounced in monogamous species such as the marmosets. Our observations suggest that this correlation may also be reflected in the extent of sex-biased gene expression in the brain. We identified 85 genes with common sex-biased expression, in both human and macaque and 2 genes, X inactivation-specific transcript (XIST and Heat shock factor binding protein 1 (HSBP1, that were consistently sex-biased in the female direction in human, macaque, and marmoset. These observations imply a conserved signature of sexual gene expression dimorphism in cortex of primates. Further, we found that the coding region of female-biased genes is more evolutionarily constrained compared to the coding region of both male-biased and non sex-biased brain

  15. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges.

    Science.gov (United States)

    Lovci, Michael T; Ghanem, Dana; Marr, Henry; Arnold, Justin; Gee, Sherry; Parra, Marilyn; Liang, Tiffany Y; Stark, Thomas J; Gehman, Lauren T; Hoon, Shawn; Massirer, Katlin B; Pratt, Gabriel A; Black, Douglas L; Gray, Joe W; Conboy, John G; Yeo, Gene W

    2013-12-01

    Alternative splicing (AS) enables programmed diversity of gene expression across tissues and development. We show here that binding in distal intronic regions (>500 nucleotides (nt) from any exon) by Rbfox splicing factors important in development is extensive and is an active mode of splicing regulation. Similarly to exon-proximal sites, distal sites contain evolutionarily conserved GCATG sequences and are associated with AS activation and repression upon modulation of Rbfox abundance in human and mouse experimental systems. As a proof of principle, we validated the activity of two specific Rbfox enhancers in KIF21A and ENAH distal introns and showed that a conserved long-range RNA-RNA base-pairing interaction (an RNA bridge) is necessary for Rbfox-mediated exon inclusion in the ENAH gene. Thus we demonstrate a previously unknown RNA-mediated mechanism for AS control by distally bound RNA-binding proteins.

  16. Evolutionarily Conserved Repulsive Guidance Role of Slit in the Silkworm Bombyx mori

    Science.gov (United States)

    Liu, Chun; Cui, Wei-Zheng; Mu, Zhi-Mei; Zhao, Xiao; Liu, Qing-Xin

    2014-01-01

    Axon guidance molecule Slit is critical for the axon repulsion in neural tissues, which is evolutionarily conserved from planarians to humans. However, the function of Slit in the silkworm Bombyx mori was unknown. Here we showed that the structure of Bombyx mori Slit (BmSlit) was different from that in most other species in its C-terminal sequence. BmSlit was localized in the midline glial cell, the neuropil, the tendon cell, the muscle and the silk gland and colocalized with BmRobo1 in the neuropil, the muscle and the silk gland. Knock-down of Bmslit by RNA interference (RNAi) resulted in abnormal development of axons and muscles. Our results suggest that BmSlit has a repulsive role in axon guidance and muscle migration. Moreover, the localization of BmSlit in the silk gland argues for its important function in the development of the silk gland. PMID:25285792

  17. RNA editing in bacteria recodes multiple proteins and regulates an evolutionarily conserved toxin-antitoxin system.

    Science.gov (United States)

    Bar-Yaacov, Dan; Mordret, Ernest; Towers, Ruth; Biniashvili, Tammy; Soyris, Clara; Schwartz, Schraga; Dahan, Orna; Pilpel, Yitzhak

    2017-10-01

    Adenosine (A) to inosine (I) RNA editing is widespread in eukaryotes. In prokaryotes, however, A-to-I RNA editing was only reported to occur in tRNAs but not in protein-coding genes. By comparing DNA and RNA sequences of Escherichia coli, we show for the first time that A-to-I editing occurs also in prokaryotic mRNAs and has the potential to affect the translated proteins and cell physiology. We found 15 novel A-to-I editing events, of which 12 occurred within known protein-coding genes where they always recode a tyrosine (TAC) into a cysteine (TGC) codon. Furthermore, we identified the tRNA-specific adenosine deaminase (tadA) as the editing enzyme of all these editing sites, thus making it the first identified RNA editing enzyme that modifies both tRNAs and mRNAs. Interestingly, several of the editing targets are self-killing toxins that belong to evolutionarily conserved toxin-antitoxin pairs. We focused on hokB, a toxin that confers antibiotic tolerance by growth inhibition, as it demonstrated the highest level of such mRNA editing. We identified a correlated mutation pattern between the edited and a DNA hard-coded Cys residue positions in the toxin and demonstrated that RNA editing occurs in hokB in two additional bacterial species. Thus, not only the toxin is evolutionarily conserved but also the editing itself within the toxin is. Finally, we found that RNA editing in hokB increases as a function of cell density and enhances its toxicity. Our work thus demonstrates the occurrence, regulation, and functional consequences of RNA editing in bacteria. © 2017 Bar-Yaacov et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Specific expression of LATERAL SUPPRESSOR is controlled by an evolutionarily conserved 3' enhancer.

    Science.gov (United States)

    Raatz, Bodo; Eicker, Andrea; Schmitz, Gregor; Fuss, Elisabeth; Müller, Dörte; Rossmann, Susanne; Theres, Klaus

    2011-11-01

    Aerial plant architecture is largely based on the activity of axillary meristems (AMs), initiated in the axils of leaves. The Arabidopsis gene LATERAL SUPPRESSOR (LAS), which is expressed in well-defined domains at the adaxial boundary of leaf primordia, is a key regulator of AM formation. The precise definition of organ boundaries is an essential step for the formation of new organs in general and for meristem initiation; however, mechanisms leading to these specific patterns are not well understood. To increase understanding of how the highly specific transcript accumulation in organ boundary regions is established, we investigated the LAS promoter. Analysis of deletion constructs revealed that an essential enhancer necessary for complementation is situated about 3.2 kb downstream of the LAS open reading frame. This enhancer is sufficient to confer promoter specificity as upstream sequences in LAS could be replaced by non-specific promoters, such as the 35S minimal promoter. Further promoter swapping experiments using the PISTILLATA or the full 35S promoter demonstrated that the LAS 3' enhancer also has suppressor functions, largely overwriting the activity of different 5' promoters. Phylogenetic analyses suggest that LAS function and regulation are evolutionarily highly conserved. Homologous elements in downstream regulatory sequences were found in all LAS orthologs, including grasses. Transcomplementation experiments demonstrated the functional conservation of non-coding sequences between Solanum lycopersicum (tomato) and Arabidopsis. In summary, our results show that a highly conserved enhancer/suppressor element is the main regulatory module conferring the boundary-specific expression of LAS. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  19. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes

    DEFF Research Database (Denmark)

    Siepel, Adam; Bejerano, Gill; Pedersen, Jakob Skou

    2005-01-01

    We have conducted a comprehensive search for conserved elements in vertebrate genomes, using genome-wide multiple alignments of five vertebrate species (human, mouse, rat, chicken, and Fugu rubripes). Parallel searches have been performed with multiple alignments of four insect species (three spe...... for RNA secondary structure....

  20. Earthworms and Humans in Vitro: Characterizing Evolutionarily Conserved Stress and Immune Responses to Silver Nanoparticles

    DEFF Research Database (Denmark)

    Hayashi, Yuya; Engelmann, Péter; Foldbjerg, Rasmus

    2012-01-01

    on the conserved biological processes, and provide the first in vitro analysis of molecular and cellular toxicity mechanisms in the earthworm Eisenia fetida exposed to AgNPs (83 ± 22 nm). While we observed a clear difference in cytotoxicity of dissolved silver salt on earthworm coelomocytes and human cells (THP-1...... in the coelomocytes and THP-1 cells. Our findings provide mechanistic clues on cellular innate immunity toward AgNPs that is likely to be evolutionarily conserved across the animal kingdom....

  1. FGF signaling inhibitor, SPRY4, is evolutionarily conserved target of WNT signaling pathway in progenitor cells.

    Science.gov (United States)

    Katoh, Yuriko; Katoh, Masaru

    2006-03-01

    WNT, FGF and Hedgehog signaling pathways network together during embryogenesis, tissue regeneration, and carcinogenesis. FGF16, FGF18, and FGF20 genes are targets of WNT-mediated TCF/LEF-beta-catenin-BCL9/BCL9L-PYGO transcriptional complex. SPROUTY (SPRY) and SPRED family genes encode inhibitors for receptor tyrosine kinase signaling cascades, such as those of FGF receptor family members and EGF receptor family members. Here, transcriptional regulation of SPRY1, SPRY2, SPRY3, SPRY4, SPRED1, SPRED2, and SPRED3 genes by WNT/beta-catenin signaling cascade was investigated by using bioinformatics and human intelligence (humint). Because double TCF/LEF-binding sites were identified within the 5'-promoter region of human SPRY4 gene, comparative genomics analyses on SPRY4 orthologs were further performed. SPRY4-FGF1 locus at human chromosome 5q31.3 and FGF2-NUDT6-SPATA5-SPRY1 locus at human chromosome 4q27-q28.1 were paralogous regions within the human genome. Chimpanzee SPRY4 gene was identified within NW_107083.1 genome sequence. Human, chimpanzee, rat and mouse SPRY4 orthologs, consisting of three exons, were well conserved. SPRY4 gene was identified as the evolutionarily conserved target of WNT/beta-catenin signaling pathway based on the conservation of double TCF/LEF-binding sites within 5'-promoter region of mammalian SPRY4 orthologs. Human SPRY4 mRNA was expressed in embryonic stem (ES) cells, brain, pancreatic islet, colon cancer, head and neck tumor, melanoma, and pancreatic cancer. WNT signaling activation in progenitor cells leads to the growth regulation of progenitor cells themselves through SPRY4 induction, and also to the growth stimulation of proliferating cells through FGF secretion. Epigenetic silencing and loss-of-function mutations of SPRY4 gene in progenitor cells could lead to carcinogenesis. SPRY4 is the pharmacogenomics target in the fields of oncology and regenerative medicine.

  2. Sperm protein "DE" mediates gamete fusion through an evolutionarily conserved site of the CRISP family.

    Science.gov (United States)

    Ellerman, Diego A; Cohen, Débora J; Da Ros, Vanina G; Morgenfeld, Mauro M; Busso, Dolores; Cuasnicú, Patricia S

    2006-09-01

    The first member of the cysteine-rich secretory protein (CRISP) family was described by our laboratory in the rat epididymis, and it is known as DE or CRISP-1. Since then, numerous CRISPs exhibiting a high amino acid sequence similarity have been identified in animals, plants and fungi, although their functions remain largely unknown. CRISP-1 proteins are candidates to mediate gamete fusion in the rat, mouse and human through their binding to complementary sites on the egg surface. To elucidate the molecular mechanisms underlying CRISP-1 function, in the present work, deletion mutants of protein DE were generated and examined for their ability to bind to the rat egg and interfere with gamete fusion. Results revealed that the egg-binding ability of DE resides within a 45-amino acid N-terminal region containing the two motifs of the CRISP family named Signature 1 and Signature 2. Subsequent assays using synthetic peptides and other CRISPs support that the egg-binding site of DE falls in the 12-amino-acid region corresponding to Signature 2. The interesting finding that the binding site of DE resides in an evolutionarily conserved region of the molecule provides novel information on the molecular mechanisms underlying CRISP-1 function in gamete fusion with important implications on the structure-function relationship of other members of the widely distributed CRISP family.

  3. An evolutionarily conserved gene, FUWA, plays a role in determining panicle architecture, grain shape and grain weight in rice.

    Science.gov (United States)

    Chen, Jun; Gao, He; Zheng, Xiao-Ming; Jin, Mingna; Weng, Jian-Feng; Ma, Jin; Ren, Yulong; Zhou, Kunneng; Wang, Qi; Wang, Jie; Wang, Jiu-Lin; Zhang, Xin; Cheng, Zhijun; Wu, Chuanyin; Wang, Haiyang; Wan, Jian-Min

    2015-08-01

    Plant breeding relies on creation of novel allelic combinations for desired traits. Identification and utilization of beneficial alleles, rare alleles and evolutionarily conserved genes in the germplasm (referred to as 'hidden' genes) provide an effective approach to achieve this goal. Here we show that a chemically induced null mutation in an evolutionarily conserved gene, FUWA, alters multiple important agronomic traits in rice, including panicle architecture, grain shape and grain weight. FUWA encodes an NHL domain-containing protein, with preferential expression in the root meristem, shoot apical meristem and inflorescences, where it restricts excessive cell division. Sequence analysis revealed that FUWA has undergone a bottleneck effect, and become fixed in landraces and modern cultivars during domestication and breeding. We further confirm a highly conserved role of FUWA homologs in determining panicle architecture and grain development in rice, maize and sorghum through genetic transformation. Strikingly, knockdown of the FUWA transcription level by RNA interference results in an erect panicle and increased grain size in both indica and japonica genetic backgrounds. This study illustrates an approach to create new germplasm with improved agronomic traits for crop breeding by tapping into evolutionary conserved genes. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  4. Unique amino acid signatures that are evolutionarily conserved distinguish simple-type, epidermal and hair keratins

    Science.gov (United States)

    Strnad, Pavel; Usachov, Valentyn; Debes, Cedric; Gräter, Frauke; Parry, David A. D.; Omary, M. Bishr

    2011-01-01

    Keratins (Ks) consist of central α-helical rod domains that are flanked by non-α-helical head and tail domains. The cellular abundance of keratins, coupled with their selective cell expression patterns, suggests that they diversified to fulfill tissue-specific functions although the primary structure differences between them have not been comprehensively compared. We analyzed keratin sequences from many species: K1, K2, K5, K9, K10, K14 were studied as representatives of epidermal keratins, and compared with K7, K8, K18, K19, K20 and K31, K35, K81, K85, K86, which represent simple-type (single-layered or glandular) epithelial and hair keratins, respectively. We show that keratin domains have striking differences in their amino acids. There are many cysteines in hair keratins but only a small number in epidermal keratins and rare or none in simple-type keratins. The heads and/or tails of epidermal keratins are glycine and phenylalanine rich but alanine poor, whereas parallel domains of hair keratins are abundant in prolines, and those of simple-type epithelial keratins are enriched in acidic and/or basic residues. The observed differences between simple-type, epidermal and hair keratins are highly conserved throughout evolution. Cysteines and histidines, which are infrequent keratin amino acids, are involved in de novo mutations that are markedly overrepresented in keratins. Hence, keratins have evolutionarily conserved and domain-selectively enriched amino acids including glycine and phenylalanine (epidermal), cysteine and proline (hair), and basic and acidic (simple-type epithelial), which reflect unique functions related to structural flexibility, rigidity and solubility, respectively. Our findings also support the importance of human keratin ‘mutation hotspot’ residues and their wild-type counterparts. PMID:22215855

  5. [Amphioxus ortholog of ECSIT, an evolutionarily conserved adaptor in the Toll and BMP signaling pathways].

    Science.gov (United States)

    Lin, Y H; Zhang, W; Li, J W; Zhang, H W; Chen, D Y

    2017-01-01

    In vertebrates, evolutionarily conserved signaling intermediate in the Toll pathway (ECSIT) interacts with the TNF-receptor associated factor 6 (TRAF6) to regulate the processing of MEKK1, activate NF-κB, and also control BMP target genes. However, the role of ECSIT in invertebrates remains largely unexplored. We performed comparative investigations of the expression, gene structure, and phylogeny of ECSIT, Toll-like receptor (TLR), and Smad4 in the cephalochordate Branchiostoma belcheri. Phylogenetic analysis indicated that, in amphioxus, ECSIT, TLR, and Smad4 form independent clusters at the base of Chordate   clusters. Interestingly, overall gene structures were comparable to those in vertebrate orthologs. Transcripts of AmphiECSIT were detectable at the mid-neural stage, and continued to be expressed in the epithelium of the pharyngeal region at later stages. In adult animals, strong expression was observed in the nerve cord, endostyle, epithelial cells of the gut and wheel organ, genital membrane of the testis, and coelom and lymphoid cavities, what is highly similar to AmphiTLR and AmphiSmad4 expression patterns during development and in adult organisms. Our data suggests that ECSIT is evolutionarily conserved. Its amphioxus ortholog functions during embryonic development and as part of the innate immune system and may be involved in TLR/BMP signaling.

  6. Evolutionarily conserved coupling of adaptive and excitable networks mediates eukaryotic chemotaxis

    Science.gov (United States)

    Tang, Ming; Wang, Mingjie; Shi, Changji; Iglesias, Pablo A.; Devreotes, Peter N.; Huang, Chuan-Hsiang

    2014-10-01

    Numerous models explain how cells sense and migrate towards shallow chemoattractant gradients. Studies show that an excitable signal transduction network acts as a pacemaker that controls the cytoskeleton to drive motility. Here we show that this network is required to link stimuli to actin polymerization and chemotactic motility and we distinguish the various models of chemotaxis. First, signalling activity is suppressed towards the low side in a gradient or following removal of uniform chemoattractant. Second, signalling activities display a rapid shut off and a slower adaptation during which responsiveness to subsequent test stimuli decline. Simulations of various models indicate that these properties require coupled adaptive and excitable networks. Adaptation involves a G-protein-independent inhibitor, as stimulation of cells lacking G-protein function suppresses basal activities. The salient features of the coupled networks were observed for different chemoattractants in Dictyostelium and in human neutrophils, suggesting an evolutionarily conserved mechanism for eukaryotic chemotaxis.

  7. EAG2 potassium channel with evolutionarily conserved function as a brain tumor target

    Science.gov (United States)

    Huang, Xi; He, Ye; Dubuc, Adrian M.; Hashizume, Rintaro; Zhang, Wei; Reimand, Jüri; Yang, Huanghe; Wang, Tongfei A.; Stehbens, Samantha J.; Younger, Susan; Barshow, Suzanne; Zhu, Sijun; Cooper, Michael K.; Peacock, John; Ramaswamy, Vijay; Garzia, Livia; Wu, Xiaochong; Remke, Marc; Forester, Craig M.; Kim, Charles C.; Weiss, William A.; James, C. David; Shuman, Marc A.; Bader, Gary D.; Mueller, Sabine; Taylor, Michael D.; Jan, Yuh Nung; Jan, Lily Yeh

    2015-01-01

    Over 20% of the drugs for treating human diseases target ion channels, however, no cancer drug approved by the U.S. Food and Drug Administration (FDA) is intended to target an ion channel. Here, we demonstrate the evolutionarily conserved function of EAG2 potassium channel in promoting brain tumor growth and metastasis, delineate downstream pathways and uncover a mechanism for different potassium channels to functionally corporate and regulate mitotic cell volume and tumor progression. We show that EAG2 potassium channel is enriched at the trailing edge of migrating MB cells to regulate local cell volume dynamics, thereby facilitating cell motility. We identify the FDA-approved antipsychotic drug thioridazine as an EAG2 channel blocker that reduces xenografted MB growth and metastasis, and present a case report of repurposing thioridazine for treating a human patient. Our findings thus illustrate the potential of targeting ion channels in cancer treatment. PMID:26258683

  8. Ecological interactions are evolutionarily conserved across the entire tree of life.

    Science.gov (United States)

    Gómez, José M; Verdú, Miguel; Perfectti, Francisco

    2010-06-17

    Ecological interactions are crucial to understanding both the ecology and the evolution of organisms. Because the phenotypic traits regulating species interactions are largely a legacy of their ancestors, it is widely assumed that ecological interactions are phylogenetically conserved, with closely related species interacting with similar partners. However, the existing empirical evidence is inadequate to appropriately evaluate the hypothesis of phylogenetic conservatism in ecological interactions, because it is both ecologically and taxonomically biased. In fact, most studies on the evolution of ecological interactions have focused on specialized organisms, such as some parasites or insect herbivores, belonging to a limited subset of the overall tree of life. Here we study the evolution of host use in a large and diverse group of interactions comprising both specialist and generalist acellular, unicellular and multicellular organisms. We show that, as previously found for specialized interactions, generalized interactions can be evolutionarily conserved. Significant phylogenetic conservatism of interaction patterns was equally likely to occur in symbiotic and non-symbiotic interactions, as well as in mutualistic and antagonistic interactions. Host-use differentiation among species was higher in phylogenetically conserved clades, irrespective of their generalization degree and taxonomic position within the tree of life. Our findings strongly suggest a shared pattern in the organization of biological systems through evolutionary time, mediated by marked conservatism of ecological interactions among taxa.

  9. An evolutionarily conserved glycine-tyrosine motif forms a folding core in outer membrane proteins.

    Directory of Open Access Journals (Sweden)

    Marcin Michalik

    Full Text Available An intimate interaction between a pair of amino acids, a tyrosine and glycine on neighboring β-strands, has been previously reported to be important for the structural stability of autotransporters. Here, we show that the conservation of this interacting pair extends to nearly all major families of outer membrane β-barrel proteins, which are thought to have originated through duplication events involving an ancestral ββ hairpin. We analyzed the function of this motif using the prototypical outer membrane protein OmpX. Stopped-flow fluorescence shows that two folding processes occur in the millisecond time regime, the rates of which are reduced in the tyrosine mutant. Folding assays further demonstrate a reduction in the yield of folded protein for the mutant compared to the wild-type, as well as a reduction in thermal stability. Taken together, our data support the idea of an evolutionarily conserved 'folding core' that affects the folding, membrane insertion, and thermal stability of outer membrane protein β-barrels.

  10. The Populus ARBORKNOX1 homeodomain transcription factor regulates woody growth through binding to evolutionarily conserved target genes of diverse function.

    Science.gov (United States)

    Liu, Lijun; Zinkgraf, Matthew; Petzold, H Earl; Beers, Eric P; Filkov, Vladimir; Groover, Andrew

    2015-01-01

    The class I KNOX homeodomain transcription factor ARBORKNOX1 (ARK1) is a key regulator of vascular cambium maintenance and cell differentiation in Populus. Currently, basic information is lacking concerning the distribution, functional characteristics, and evolution of ARK1 binding in the Populus genome. Here, we used chromatin immunoprecipitation sequencing (ChIP-seq) technology to identify ARK1 binding loci genome-wide in Populus. Computational analyses evaluated the distribution of ARK1 binding loci, the function of genes associated with bound loci, the effect of ARK1 binding on transcript levels, and evolutionary conservation of ARK1 binding loci. ARK1 binds to thousands of loci which are highly enriched proximal to the transcriptional start sites of genes of diverse functions. ARK1 target genes are significantly enriched in paralogs derived from the whole-genome salicoid duplication event. Both ARK1 and a maize (Zea mays) homolog, KNOTTED1, preferentially target evolutionarily conserved genes. However, only a small portion of ARK1 target genes are significantly differentially expressed in an ARK1 over-expression mutant. This study describes the functional characteristics and evolution of DNA binding by a transcription factor in an undomesticated tree, revealing complexities similar to those shown for transcription factors in model animal species. No claim to original US Government works. New Phytologist © 2014 New Phytologist Trust.

  11. Evolutionarily divergent spliceosomal snRNAs and a conserved non-coding RNA processing motif in Giardia lamblia

    Science.gov (United States)

    Hudson, Andrew J.; Moore, Ashley N.; Elniski, David; Joseph, Joella; Yee, Janet; Russell, Anthony G.

    2012-01-01

    Non-coding RNAs (ncRNAs) have diverse essential biological functions in all organisms, and in eukaryotes, two such classes of ncRNAs are the small nucleolar (sno) and small nuclear (sn) RNAs. In this study, we have identified and characterized a collection of sno and snRNAs in Giardia lamblia, by exploiting our discovery of a conserved 12 nt RNA processing sequence motif found in the 3′ end regions of a large number of G. lamblia ncRNA genes. RNA end mapping and other experiments indicate the motif serves to mediate ncRNA 3′ end formation from mono- and di-cistronic RNA precursor transcripts. Remarkably, we find the motif is also utilized in the processing pathway of all four previously identified trans-spliced G. lamblia introns, revealing a common RNA processing pathway for ncRNAs and trans-spliced introns in this organism. Motif sequence conservation then allowed for the bioinformatic and experimental identification of additional G. lamblia ncRNAs, including new U1 and U6 spliceosomal snRNA candidates. The U6 snRNA candidate was then used as a tool to identity novel U2 and U4 snRNAs, based on predicted phylogenetically conserved snRNA–snRNA base-pairing interactions, from a set of previously identified G. lamblia ncRNAs without assigned function. The Giardia snRNAs retain the core features of spliceosomal snRNAs but are sufficiently evolutionarily divergent to explain the difficulties in their identification. Most intriguingly, all of these snRNAs show structural features diagnostic of U2-dependent/major and U12-dependent/minor spliceosomal snRNAs. PMID:23019220

  12. Identification of evolutionarily conserved exons as regulated targets for the splicing activator tra2β in development.

    Directory of Open Access Journals (Sweden)

    Sushma Grellscheid

    2011-12-01

    Full Text Available Alternative splicing amplifies the information content of the genome, creating multiple mRNA isoforms from single genes. The evolutionarily conserved splicing activator Tra2β (Sfrs10 is essential for mouse embryogenesis and implicated in spermatogenesis. Here we find that Tra2β is up-regulated as the mitotic stem cell containing population of male germ cells differentiate into meiotic and post-meiotic cells. Using CLIP coupled to deep sequencing, we found that Tra2β binds a high frequency of exons and identified specific G/A rich motifs as frequent targets. Significantly, for the first time we have analysed the splicing effect of Sfrs10 depletion in vivo by generating a conditional neuronal-specific Sfrs10 knock-out mouse (Sfrs10(fl/fl; Nestin-Cre(tg/+. This mouse has defects in brain development and allowed correlation of genuine physiologically Tra2β regulated exons. These belonged to a novel class which were longer than average size and importantly needed multiple cooperative Tra2β binding sites for efficient splicing activation, thus explaining the observed splicing defects in the knockout mice. Regulated exons included a cassette exon which produces a meiotic isoform of the Nasp histone chaperone that helps monitor DNA double-strand breaks. We also found a previously uncharacterised poison exon identifying a new pathway of feedback control between vertebrate Tra2 proteins. Both Nasp-T and the Tra2a poison exon are evolutionarily conserved, suggesting they might control fundamental developmental processes. Tra2β protein isoforms lacking the RRM were able to activate specific target exons indicating an additional functional role as a splicing co-activator. Significantly the N-terminal RS1 domain conserved between flies and humans was essential for the splicing activator function of Tra2β. Versions of Tra2β lacking this N-terminal RS1 domain potently repressed the same target exons activated by full-length Tra2β protein.

  13. Evolutionarily conserved prefrontal-amygdalar dysfunction in early-life anxiety.

    Science.gov (United States)

    Birn, R M; Shackman, A J; Oler, J A; Williams, L E; McFarlin, D R; Rogers, G M; Shelton, S E; Alexander, A L; Pine, D S; Slattery, M J; Davidson, R J; Fox, A S; Kalin, N H

    2014-08-01

    Some individuals are endowed with a biology that renders them more reactive to novelty and potential threat. When extreme, this anxious temperament (AT) confers elevated risk for the development of anxiety, depression and substance abuse. These disorders are highly prevalent, debilitating and can be challenging to treat. The high-risk AT phenotype is expressed similarly in children and young monkeys and mechanistic work demonstrates that the central (Ce) nucleus of the amygdala is an important substrate. Although it is widely believed that the flow of information across the structural network connecting the Ce nucleus to other brain regions underlies primates' capacity for flexibly regulating anxiety, the functional architecture of this network has remained poorly understood. Here we used functional magnetic resonance imaging (fMRI) in anesthetized young monkeys and quietly resting children with anxiety disorders to identify an evolutionarily conserved pattern of functional connectivity relevant to early-life anxiety. Across primate species and levels of awareness, reduced functional connectivity between the dorsolateral prefrontal cortex, a region thought to play a central role in the control of cognition and emotion, and the Ce nucleus was associated with increased anxiety assessed outside the scanner. Importantly, high-resolution 18-fluorodeoxyglucose positron emission tomography imaging provided evidence that elevated Ce nucleus metabolism statistically mediates the association between prefrontal-amygdalar connectivity and elevated anxiety. These results provide new clues about the brain network underlying extreme early-life anxiety and set the stage for mechanistic work aimed at developing improved interventions for pediatric anxiety.

  14. An Evolutionarily Conserved Pathway Essential for Orsay Virus Infection of Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Hongbing Jiang

    2017-09-01

    Full Text Available Many fundamental biological discoveries have been made in Caenorhabditis elegans. The discovery of Orsay virus has enabled studies of host-virus interactions in this model organism. To identify host factors critical for Orsay virus infection, we designed a forward genetic screen that utilizes a virally induced green fluorescent protein (GFP reporter. Following chemical mutagenesis, two Viro (virus induced reporter off mutants that failed to express GFP were mapped to sid-3, a nonreceptor tyrosine kinase, and B0280.13 (renamed viro-2, an ortholog of human Wiskott-Aldrich syndrome protein (WASP. Both mutants yielded Orsay virus RNA levels comparable to that of the residual input virus, suggesting that they are not permissive for Orsay virus replication. In addition, we demonstrated that both genes affect an early prereplication stage of Orsay virus infection. Furthermore, it is known that the human ortholog of SID-3, activated CDC42-associated kinase (ACK1/TNK2, is capable of phosphorylating human WASP, suggesting that VIRO-2 may be a substrate for SID-3 in C. elegans. A targeted RNA interference (RNAi knockdown screen further identified the C. elegans gene nck-1, which has a human ortholog that interacts with TNK2 and WASP, as required for Orsay virus infection. Thus, genetic screening in C. elegans identified critical roles in virus infection for evolutionarily conserved genes in a known human pathway.

  15. The evolutionarily conserved E3 ubiquitin ligase AtCHIP contributes to plant immunity

    Directory of Open Access Journals (Sweden)

    Xin eLi

    2016-03-01

    Full Text Available Plants possess a sophisticated immune system to recognize and respond to microbial threats in their environment. The level of immune signaling must be tightly regulated so that immune responses can be quickly activated in the presence of pathogens, while avoiding autoimmunity. HSP90s, along with their diverse array of co-chaperones, forms chaperone complexes that have been shown to play both positive and negative roles in regulating the accumulation of immune receptors and regulators. In this study, we examined the role of AtCHIP, an evolutionarily conserved E3 ligase that was known to interact with chaperones including HSP90s in multicellular organisms including fruit fly, C. elegans, plants and human. Atchip knockout mutants display enhanced disease susceptibility to a virulent oomycete pathogen, and overexpression of AtCHIP causes enhanced disease resistance at low temperature. Although CHIP was reported to target HSP90 for ubiquitination and degradation, accumulation of HSP90.3 was not affected in Atchip plants. In addition, protein accumulation of nucleotide-binding, leucine-rich repeat domain immune receptor (NLR SNC1 is not altered in Atchip mutant. Thus, while AtCHIP plays a role in immunity, it does not seem to regulate the turnover of HSP90 or SNC1. Further investigation is needed in order to determine the exact mechanism behind AtCHIP’s role in regulating plant immune responses.

  16. Unifying the genomics-based classes of cancer fusion gene partners: large cancer fusion genes are evolutionarily conserved.

    Science.gov (United States)

    Pava, Libia M; Morton, Daniel T; Chen, Ren; Blanck, George

    2012-11-01

    Genes that fuse to cause cancer have been studied to determine molecular bases for proliferation, to develop diagnostic tools, and as targets for drugs. To facilitate identification of additional, cancer fusion genes, following observation of a chromosomal translocation, we have characterized the genomic features of the fusion gene partners. Previous work indicated that cancer fusion gene partners, are either large or evolutionarily conserved in comparison to the neighboring genes in the region of a chromosomal translocation. These results raised the question of whether large cancer fusion gene partners were also evolutionarily conserved. We developed two methods for quantifying evolutionary conservation values, allowing the conclusion that both large and small cancer fusion gene partners are more evolutionarily conserved than their neighbors. Additionally, we determined that cancer fusion gene partners have more 3' untranslated region secondary structures than do their neighbors. Coupled with previous algorithms, with or without transcriptome approaches, we expect these results to assist in the rapid and efficient use of chromosomal translocations to identify cancer fusion genes. The above parameters for any gene of interest can be accessed at www.cancerfusiongenes.com.

  17. Common binding by redundant group B Sox proteins is evolutionarily conserved in Drosophila.

    Science.gov (United States)

    Carl, Sarah H; Russell, Steven

    2015-04-13

    Group B Sox proteins are a highly conserved group of transcription factors that act extensively to coordinate nervous system development in higher metazoans while showing both co-expression and functional redundancy across a broad group of taxa. In Drosophila melanogaster, the two group B Sox proteins Dichaete and SoxNeuro show widespread common binding across the genome. While some instances of functional compensation have been observed in Drosophila, the function of common binding and the extent of its evolutionary conservation is not known. We used DamID-seq to examine the genome-wide binding patterns of Dichaete and SoxNeuro in four species of Drosophila. Through a quantitative comparison of Dichaete binding, we evaluated the rate of binding site turnover across the genome as well as at specific functional sites. We also examined the presence of Sox motifs within binding intervals and the correlation between sequence conservation and binding conservation. To determine whether common binding between Dichaete and SoxNeuro is conserved, we performed a detailed analysis of the binding patterns of both factors in two species. We find that, while the regulatory networks driven by Dichaete and SoxNeuro are largely conserved across the drosophilids studied, binding site turnover is widespread and correlated with phylogenetic distance. Nonetheless, binding is preferentially conserved at known cis-regulatory modules and core, independently verified binding sites. We observed the strongest binding conservation at sites that are commonly bound by Dichaete and SoxNeuro, suggesting that these sites are functionally important. Our analysis provides insights into the evolution of group B Sox function, highlighting the specific conservation of shared binding sites and suggesting alternative sources of neofunctionalisation between paralogous family members.

  18. Damping capacity is evolutionarily conserved in the radial silk of orb-weaving spiders.

    Science.gov (United States)

    Kelly, Sean P; Sensenig, Andrew; Lorentz, Kimberly A; Blackledge, Todd A

    2011-09-01

    Orb-weaving spiders depend upon their two-dimensional silk traps to stop insects in mid flight. While the silks used to construct orb webs must be extremely tough to absorb the tremendous kinetic energy of insect prey, webs must also minimize the return of that energy to prey to prevent insects from bouncing out of oscillating webs. We therefore predict that the damping capacity of major ampullate spider silk, which forms the supporting frames and radial threads of orb webs, should be evolutionarily conserved among orb-weaving spiders. We test this prediction by comparing silk from six diverse species of orb spiders. Silk was taken directly from the radii of orb webs and a Nano Bionix test system was used either to sequentially extend the silk to 25% strain in 5% increments while relaxing it fully between each cycle, or to pull virgin silk samples to 15% strain. Damping capacity was then calculated as the percent difference in loading and unloading energies. Damping capacity increased after yield for all species and typically ranged from 40 to 50% within each cycle for sequentially pulled silk and from 50 to 70% for virgin samples. Lower damping at smaller strains may allow orb webs to withstand minor perturbations from wind and small prey while still retaining the ability to capture large insects. The similarity in damping capacity of silk from the radii spun by diverse spiders highlights the importance of energy absorption by silk for orb-weaving spiders. Copyright © 2011 Elsevier GmbH. All rights reserved.

  19. An evolutionarily conserved mutual interdependence between Aire and microRNAs in promiscuous gene expression.

    Science.gov (United States)

    Ucar, Olga; Tykocinski, Lars-Oliver; Dooley, James; Liston, Adrian; Kyewski, Bruno

    2013-07-01

    The establishment and maintenance of central tolerance depends to a large extent on the ability of medullary thymic epithelial cells to express a variety of tissue-restricted antigens, the so-called promiscuous gene expression (pGE). Autoimmune regulator (Aire) is to date the best characterised transcriptional regulator known to at least partially coordinate pGE. There is accruing evidence that the expression of Aire-dependent and -independent genes is modulated by higher order chromatin configuration, epigenetic modifications and post-transcriptional control. Given the involvement of microRNAs (miRNAs) as potent post-transcriptional modulators of gene expression, we investigated their role in the regulation of pGE in purified mouse and human thymic epithelial cells (TECs). Microarray profiling of TEC subpopulations revealed evolutionarily conserved cell type and differentiation-specific miRNA signatures with a subset of miRNAs being significantly upregulated during terminal medullary thymic epithelial cell differentiation. The differential regulation of this subset of miRNAs was correlated with Aire expression and some of these miRNAs were misexpressed in the Aire knockout thymus. In turn, the specific absence of miRNAs in TECs resulted in a progressive reduction of Aire expression and pGE, affecting both Aire-dependent and -independent genes. In contrast, the absence of miR-29a only affected the Aire-dependent gene pool. These findings reveal a mutual interdependence of miRNA and Aire. © 2013 The Authors. European Journal of Immunology published byWiley-VCH Verlag GmbH & Co. KGaA Weinheim.

  20. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs

    Directory of Open Access Journals (Sweden)

    Hutchison Clyde A

    2006-01-01

    Full Text Available Abstract Background Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs. We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. Results "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not are attractive targets when seeking errors of gene predicion. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency. We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Conclusion Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

  1. H3K23me1 is an evolutionarily conserved histone modification associated with CG DNA methylation in Arabidopsis.

    Science.gov (United States)

    Trejo-Arellano, Minerva S; Mahrez, Walid; Nakamura, Miyuki; Moreno-Romero, Jordi; Nanni, Paolo; Köhler, Claudia; Hennig, Lars

    2017-04-01

    Amino-terminal tails of histones are targets for diverse post-translational modifications whose combinatorial action may constitute a code that will be read and interpreted by cellular proteins to define particular transcriptional states. Here, we describe monomethylation of histone H3 lysine 23 (H3K23me1) as a histone modification not previously described in plants. H3K23me1 is an evolutionarily conserved mark in diverse species of flowering plants. Chromatin immunoprecipitation followed by high-throughput sequencing in Arabidopsis thaliana showed that H3K23me1 was highly enriched in pericentromeric regions and depleted from chromosome arms. In transposable elements it co-localized with CG, CHG and CHH DNA methylation as well as with the heterochromatic histone mark H3K9me2. Transposable elements are often rich in H3K23me1 but different families vary in their enrichment: LTR-Gypsy elements are most enriched and RC/Helitron elements are least enriched. The histone methyltransferase KRYPTONITE and normal DNA methylation were required for normal levels of H3K23me1 on transposable elements. Immunostaining experiments confirmed the pericentromeric localization and also showed mild enrichment in less condensed regions. Accordingly, gene bodies of protein-coding genes had intermediate H3K23me1 levels, which coexisted with CG DNA methylation. Enrichment of H3K23me1 along gene bodies did not correlate with transcription levels. Together, this work establishes H3K23me1 as a so far undescribed component of the plant histone code. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  2. Alternative promoter usage generates multiple evolutionarily conserved isoforms of Drosophila DOA kinase.

    Science.gov (United States)

    Kpebe, Arlette; Rabinow, Leonard

    2008-03-01

    The unique LAMMER (or Clk) protein kinase of Drosophila is encoded at the Doa locus. To better understand the pleiotropic effects of Doa mutations, we describe the structure and expression of the multiple RNA and protein products of the locus, as well as their evolutionary conservation among Drosophila. The gene produces at least six different protein isoforms, primarily through alternative promoter usage, generating kinases with virtually identical catalytic domains but variable N-terminal noncatalytic domains. The single known alternative splicing event generates a kinase with the insertion of six additional amino-acids in the catalytic domain. Two independent predicted genes nested within Doa introns actually encode additional alternative N-termini of the locus. An alternative polyadenylation site utilized exclusively during early embryogenesis generates a transcript with a short half-life, apparently to ensure a "burst" of kinase expression at the onset of development. Ecdysone induction of Doa transcripts affects all isoforms during pupariation. Finally, extensive conservation of amino-acid sequences of both the catalytic and N-terminal noncatalytic exons observed in alignments between D. melanogaster exons and the genome sequences of 11 other Drosophila species suggest that the multiple isoforms serve important and nonredundant functions. (c) 2008 Wiley-Liss, Inc.

  3. Positive selection drives rapid evolution of certain amino acid residues in an evolutionarily highly conserved interferon-inducible antiviral protein of fishes.

    Science.gov (United States)

    Padhi, Abinash

    2013-01-01

    Viperin, an evolutionarily highly conserved interferon-inducible multifunctional protein, has previously been reported to exhibit antiviral activity against a wide range of DNA and RNA viruses. Utilizing the complete nucleotide coding sequence data of fish viperin antiviral genes, and employing the maximum likelihood-based codon substitution models, the present study reports the pervasive role of positive selection in the evolution of viperin antiviral protein in fishes. The overall rate of nonsynonymous (dN) to synonymous (dS) substitutions (dN/dS) for the three functional domains of viperin (N-terminal, central domain and C-terminal) were 1.1, 0.12, and 0.24, respectively. Codon-by-codon substitution analyses have revealed that while most of the positively selected sites were located at the N-terminal amphipathic α-helix domain, few amino acid residues at the C-terminal domain were under positive selection. However, none of the sites in the central domain were under positive selection. These results indicate that, although viperin is evolutionarily highly conserved, the three functional domains experienced differential selection pressures. Taken together with the results of previous studies, the present study suggests that the persistent antagonistic nature of surrounding infectious viral pathogens might be the likely cause for such adaptive evolutionary changes of certain amino acids in fish viperin antiviral protein.

  4. Evolutionarily conserved interaction between the phosphoproteins and X proteins of bornaviruses from different vertebrate species.

    Directory of Open Access Journals (Sweden)

    Kan Fujino

    Full Text Available Bornavirus, a non-segmented, negative-strand RNA viruses, is currently classified into several genetically distinct genotypes, such as Borna disease virus (BDV and avian bornaviruses (ABVs. Recent studies revealed that bornavirus genotypes show unique sequence variability in the putative 5' untranslated region (5' UTR of X/P mRNA, a bicistronic mRNA for the X protein and phosphoprotein (P. In this study, to understand the evolutionary relationship among the bornavirus genotypes, we investigated the functional interaction between the X and P proteins of four bornavirus genotypes, BDV, ABV genotype 4 and 5 and reptile bornavirus (RBV, the putative 5' UTRs of which exhibit variation in the length. Immunofluorescence and immunoprecipitation analyses using mammalian and avian cell lines revealed that the X proteins of bornaviruses conserve the ability to facilitate the export of P from the nucleus to the cytoplasm via interaction with P. Furthermore, we showed that inter-genotypic interactions may occur between X and P among the genotypes, except for X of RBV. In addition, a BDV minireplicon assay demonstrated that the X and P proteins of ABVs, but not RBV, can affect the polymerase activity of BDV. This study demonstrates that bornaviruses may have conserved the fundamental function of a regulatory protein during their evolution, whereas RBV has evolved distinctly from the other bornavirus genotypes.

  5. Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

    Science.gov (United States)

    Dale, Rodney M.; Topczewski, Jacek

    2011-01-01

    Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue

  6. An anomalous type IV secretion system in Rickettsia is evolutionarily conserved.

    Directory of Open Access Journals (Sweden)

    Joseph J Gillespie

    Full Text Available BACKGROUND: Bacterial type IV secretion systems (T4SSs comprise a diverse transporter family functioning in conjugation, competence, and effector molecule (DNA and/or protein translocation. Thirteen genome sequences from Rickettsia, obligate intracellular symbionts/pathogens of a wide range of eukaryotes, have revealed a reduced T4SS relative to the Agrobacterium tumefaciens archetype (vir. However, the Rickettsia T4SS has not been functionally characterized for its role in symbiosis/virulence, and none of its substrates are known. RESULTS: Superimposition of T4SS structural/functional information over previously identified Rickettsia components implicate a functional Rickettsia T4SS. virB4, virB8 and virB9 are duplicated, yet only one copy of each has the conserved features of similar genes in other T4SSs. An extraordinarily duplicated VirB6 gene encodes five hydrophobic proteins conserved only in a short region known to be involved in DNA transfer in A. tumefaciens. virB1, virB2 and virB7 are newly identified, revealing a Rickettsia T4SS lacking only virB5 relative to the vir archetype. Phylogeny estimation suggests vertical inheritance of all components, despite gene rearrangements into an archipelago of five islets. Similarities of Rickettsia VirB7/VirB9 to ComB7/ComB9 proteins of epsilon-proteobacteria, as well as phylogenetic affinities to the Legionella lvh T4SS, imply the Rickettsiales ancestor acquired a vir-like locus from distantly related bacteria, perhaps while residing in a protozoan host. Modern modifications of these systems likely reflect diversification with various eukaryotic host cells. CONCLUSION: We present the rvh (Rickettsiales vir homolog T4SS, an evolutionary conserved transporter with an unknown role in rickettsial biology. This work lays the foundation for future laboratory characterization of this system, and also identifies the Legionella lvh T4SS as a suitable genetic model.

  7. Reiterated WG/GW motifs form functionally and evolutionarily conserved ARGONAUTE-binding platforms in RNAi-related components

    Science.gov (United States)

    El-Shami, Mahmoud; Pontier, Dominique; Lahmy, Sylvie; Braun, Laurence; Picart, Claire; Vega, Danielle; Hakimi, Mohamed-Ali; Jacobsen, Steven E.; Cooke, Richard; Lagrange, Thierry

    2007-01-01

    Two forms of RNA Polymerase IV (PolIVa/PolIVb) have been implicated in RNA-directed DNA methylation (RdDM) in Arabidopsis. Prevailing models imply a distinct function for PolIVb by association of Argonaute4 (AGO4) with the C-terminal domain (CTD) of its largest subunit NRPD1b. Here we show that the extended CTD of NRPD1b-type proteins exhibits conserved Argonaute-binding capacity through a WG/GW-rich region that functionally distinguishes Pol IVb from Pol IVa, and that is essential for RdDM. Site-specific mutagenesis and domain-swapping experiments between AtNRPD1b and the human protein GW182 demonstrated that reiterated WG/GW motifs form evolutionarily and functionally conserved Argonaute-binding platforms in RNA interference (RNAi)-related components. PMID:17938239

  8. Post-transcriptional exon shuffling events in humans can be evolutionarily conserved and abundant.

    Science.gov (United States)

    Al-Balool, Haya H; Weber, David; Liu, Yilei; Wade, Mark; Guleria, Kamlesh; Nam, Pitsien Lang Ping; Clayton, Jake; Rowe, William; Coxhead, Jonathan; Irving, Julie; Elliott, David J; Hall, Andrew G; Santibanez-Koref, Mauro; Jackson, Michael S

    2011-11-01

    In silico analyses have established that transcripts from some genes can be processed into RNAs with rearranged exon order relative to genomic structure (post-transcriptional exon shuffling, or PTES). Although known to contribute to transcriptome diversity in some species, to date the structure, distribution, abundance, and functional significance of human PTES transcripts remains largely unknown. Here, using high-throughput transcriptome sequencing, we identify 205 putative human PTES products from 176 genes. We validate 72 out of 112 products analyzed using RT-PCR, and identify additional PTES products structurally related to 61% of validated targets. Sequencing of these additional products reveals GT-AG dinucleotides at >95% of the splice junctions, confirming that they are processed by the spliceosome. We show that most PTES transcripts are expressed in a wide variety of human tissues, that they can be polyadenylated, and that some are conserved in mouse. We also show that they can extend into 5' and 3' UTRs, consistent with formation via trans-splicing of independent pre-mRNA molecules. Finally, we use real-time PCR to compare the abundance of PTES exon junctions relative to canonical exon junctions within the transcripts from seven genes. PTES exon junctions are present at 90% of the levels of canonical junctions, with transcripts from MAN1A2, PHC3, TLE4, and CDK13 exhibiting the highest levels. This is the first systematic experimental analysis of PTES in human, and it suggests both that the phenomenon is much more widespread than previously thought and that some PTES transcripts could be functional.

  9. An Evolutionarily Young Polar Bear (Ursus maritimus) Endogenous Retrovirus Identified from Next Generation Sequence Data.

    Science.gov (United States)

    Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D

    2015-11-24

    Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.

  10. An Evolutionarily Young Polar Bear (Ursus maritimus Endogenous Retrovirus Identified from Next Generation Sequence Data

    Directory of Open Access Journals (Sweden)

    Kyriakos Tsangaras

    2015-11-01

    Full Text Available Transcriptome analysis of polar bear (Ursus maritimus tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV. Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos and black bear (Ursus americanus but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.

  11. An Evolutionarily Young Polar Bear (Ursus maritimus) Endogenous Retrovirus Identified from Next Generation Sequence Data

    Science.gov (United States)

    Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.

    2015-01-01

    Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552

  12. Evolutionarily conserved protein arginine methyltransferases in non-mammalian animal systems.

    Science.gov (United States)

    Wang, Yi-Chun; Li, Chuan

    2012-03-01

    Protein arginine methylation is catalyzed by members of the protein arginine methyltransferase (PRMT) family. In the present review, nine PRMTs identified in mammals (human) were used as templates to survey homologous PRMTs in 10 animal species with a completed sequence available in non-mammalian vertebrates, invertebrate chordates, echinoderms, arthropods, nematodes and cnidarians. We show the conservation of the most typical type I PRMT1 and type II PRMT5 in all of the species examined, the wide yet different distribution of PRMT3, 4 and 7 in non-mammalian animals, the vertebrate-restricted distribution of PRMT8 and the special reptile/avian-deficient distribution of PRMT2 and 6. We summarize the basic functions of each PRMT and focus on the current investigations of PRMTs in the non-mammalian animal models, including Xenopus, fish (zebrafish, flounder and medaka), Drosophila and Caenorhabditis elegans. Studies in the model systems not only complement the understanding of the functions of PRMTs in mammals, but also provide valuable information about their evolution, as well as their critical roles and interplays. © 2012 The Authors Journal compilation © 2012 FEBS.

  13. Computational Analysis of an Evolutionarily Conserved VertebrateMuscle Alternative Splicing Program

    Energy Technology Data Exchange (ETDEWEB)

    Das, Debopriya; Clark, Tyson A.; Schweitzer, Anthony; Marr,Henry; Yamamoto, Miki L.; Parra, Marilyn K.; Arribere, Josh; Minovitsky,Simon; Dubchak, Inna; Blume, John E.; Conboy, John G.

    2006-06-15

    A novel exon microarray format that probes gene expression with single exon resolution was employed to elucidate critical features of a vertebrate muscle alternative splicing program. A dataset of 56 microarray-defined, muscle-enriched exons and their flanking introns were examined computationally in order to investigate coordination of the muscle splicing program. Candidate intron regulatory motifs were required to meet several stringent criteria: significant over-representation near muscle-enriched exons, correlation with muscle expression, and phylogenetic conservation among genomes of several vertebrate orders. Three classes of regulatory motifs were identified in the proximal downstream intron, within 200nt of the target exons: UGCAUG, a specific binding site for Fox-1 related splicing factors; ACUAAC, a novel branchpoint-like element; and UG-/UGC-rich elements characteristic of binding sites for CELF splicing factors. UGCAUG was remarkably enriched, being present in nearly one-half of all cases. These studies suggest that Fox and CELF splicing factors play a major role in enforcing the muscle-specific alternative splicing program, facilitating expression of a set of unique isoforms of cytoskeletal proteins that are critical to muscle cell differentiation. Supplementary materials: There are four supplementary tables and one supplementary figure. The tables provide additional detailed information concerning the muscle-enriched datasets, and about over-represented oligonucleotide sequences in the flanking introns. The supplementary figure shows RT-PCR data confirming the muscle-enriched expression of exons predicted from the microarray analysis.

  14. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

    Directory of Open Access Journals (Sweden)

    Kristopher J. L. Irizarry

    2016-01-01

    Full Text Available Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1 that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons.

  15. Evolutionarily conserved transcription factor Apontic controls the G1/S progression by inducing cyclin e during eye development

    KAUST Repository

    Liu, Qingxin

    2014-06-16

    During Drosophila eye development, differentiation initiates in the posterior region of the eye disk and progresses anteriorly as a wave marked by the morphogenetic furrow (MF), which demarcates the boundary between anterior undifferentiated cells and posterior differentiated photoreceptors. However, the mechanism underlying the regulation of gene expression immediately before the onset of differentiation remains unclear. Here, we show that Apontic (Apt), which is an evolutionarily conserved transcription factor, is expressed in the differentiating cells posterior to the MF. Moreover, it directly induces the expression of cyclin E and is also required for the G1-to-S phase transition, which is known to be essential for the initiation of cell differentiation at the MF. These observations identify a pathway crucial for eye development, governed by a mechanism in which Cyclin E promotes the G1-to-S phase transition when regulated by Apt.

  16. Comparative analysis of evolutionarily conserved motifs of epidermal growth factor receptor 2 (HER2 predicts novel potential therapeutic epitopes.

    Directory of Open Access Journals (Sweden)

    Xiaohong Deng

    Full Text Available Overexpression of human epidermal growth factor receptor 2 (HER2 is associated with tumor aggressiveness and poor prognosis in breast cancer. With the availability of therapeutic antibodies against HER2, great strides have been made in the clinical management of HER2 overexpressing breast cancer. However, de novo and acquired resistance to these antibodies presents a serious limitation to successful HER2 targeting treatment. The identification of novel epitopes of HER2 that can be used for functional/region-specific blockade could represent a central step in the development of new clinically relevant anti-HER2 antibodies. In the present study, we present a novel computational approach as an auxiliary tool for identification of novel HER2 epitopes. We hypothesized that the structurally and linearly evolutionarily conserved motifs of the extracellular domain of HER2 (ECD HER2 contain potential druggable epitopes/targets. We employed the PROSITE Scan to detect structurally conserved motifs and PRINTS to search for linearly conserved motifs of ECD HER2. We found that the epitopes recognized by trastuzumab and pertuzumab are located in the predicted conserved motifs of ECD HER2, supporting our initial hypothesis. Considering that structurally and linearly conserved motifs can provide functional specific configurations, we propose that by comparing the two types of conserved motifs, additional druggable epitopes/targets in the ECD HER2 protein can be identified, which can be further modified for potential therapeutic application. Thus, this novel computational process for predicting or searching for potential epitopes or key target sites may contribute to epitope-based vaccine and function-selected drug design, especially when x-ray crystal structure protein data is not available.

  17. Comparative analysis of evolutionarily conserved motifs of epidermal growth factor receptor 2 (HER2) predicts novel potential therapeutic epitopes.

    Science.gov (United States)

    Deng, Xiaohong; Zheng, Xuxu; Yang, Huanming; Moreira, José Manuel Afonso; Brünner, Nils; Christensen, Henrik

    2014-01-01

    Overexpression of human epidermal growth factor receptor 2 (HER2) is associated with tumor aggressiveness and poor prognosis in breast cancer. With the availability of therapeutic antibodies against HER2, great strides have been made in the clinical management of HER2 overexpressing breast cancer. However, de novo and acquired resistance to these antibodies presents a serious limitation to successful HER2 targeting treatment. The identification of novel epitopes of HER2 that can be used for functional/region-specific blockade could represent a central step in the development of new clinically relevant anti-HER2 antibodies. In the present study, we present a novel computational approach as an auxiliary tool for identification of novel HER2 epitopes. We hypothesized that the structurally and linearly evolutionarily conserved motifs of the extracellular domain of HER2 (ECD HER2) contain potential druggable epitopes/targets. We employed the PROSITE Scan to detect structurally conserved motifs and PRINTS to search for linearly conserved motifs of ECD HER2. We found that the epitopes recognized by trastuzumab and pertuzumab are located in the predicted conserved motifs of ECD HER2, supporting our initial hypothesis. Considering that structurally and linearly conserved motifs can provide functional specific configurations, we propose that by comparing the two types of conserved motifs, additional druggable epitopes/targets in the ECD HER2 protein can be identified, which can be further modified for potential therapeutic application. Thus, this novel computational process for predicting or searching for potential epitopes or key target sites may contribute to epitope-based vaccine and function-selected drug design, especially when x-ray crystal structure protein data is not available.

  18. The evolutionarily conserved transcription factor PRDM12 controls sensory neuron development and pain perception.

    Science.gov (United States)

    Nagy, Vanja; Cole, Tiffany; Van Campenhout, Claude; Khoung, Thang M; Leung, Calvin; Vermeiren, Simon; Novatchkova, Maria; Wenzel, Daniel; Cikes, Domagoj; Polyansky, Anton A; Kozieradzki, Ivona; Meixner, Arabella; Bellefroid, Eric J; Neely, G Gregory; Penninger, Josef M

    2015-01-01

    PR homology domain-containing member 12 (PRDM12) belongs to a family of conserved transcription factors implicated in cell fate decisions. Here we show that PRDM12 is a key regulator of sensory neuronal specification in Xenopus. Modeling of human PRDM12 mutations that cause hereditary sensory and autonomic neuropathy (HSAN) revealed remarkable conservation of the mutated residues in evolution. Expression of wild-type human PRDM12 in Xenopus induced the expression of sensory neuronal markers, which was reduced using various human PRDM12 mutants. In Drosophila, we identified Hamlet as the functional PRDM12 homolog that controls nociceptive behavior in sensory neurons. Furthermore, expression analysis of human patient fibroblasts with PRDM12 mutations uncovered possible downstream target genes. Knockdown of several of these target genes including thyrotropin-releasing hormone degrading enzyme (TRHDE) in Drosophila sensory neurons resulted in altered cellular morphology and impaired nociception. These data show that PRDM12 and its functional fly homolog Hamlet are evolutionary conserved master regulators of sensory neuronal specification and play a critical role in pain perception. Our data also uncover novel pathways in multiple species that regulate evolutionary conserved nociception.

  19. Evolutionarily conserved mammalian adenine nucleotide translocase 4 is essential for spermatogenesis.

    Science.gov (United States)

    Brower, Jeffrey V; Rodic, Nemanja; Seki, Tsugio; Jorgensen, Marda; Fliess, Naime; Yachnis, Anthony T; McCarrey, John R; Oh, S Paul; Terada, Naohiro

    2007-10-05

    The adenine nucleotide translocases (Ant) facilitate the transport of ADP and ATP by an antiport mechanism across the inner mitochondrial membrane, thus playing an essential role in cellular energy metabolism. We recently identified a novel member of the Ant family in mouse, Ant4, of which gene configuration as well as amino acid homology is well conserved among mammals. The conservation of Ant4 in mammals, along with the absence of Ant4 in nonmammalian species, suggests a unique and indispensable role for this ADP/ATP carrier in mammalian development. Of interest, in contrast to its paralog Ant2, which is encoded by the X chromosome and ubiquitously expressed in somatic cells, Ant4 is encoded by an autosome and selectively expressed in testicular germ cells. Immunohistochemical examination as well as RNA expression analysis using separated spermatogenic cell types revealed that Ant4 expression was particularly high in spermatocytes. When we generated Ant4-deficient mice by targeted disruption, a significant reduction in testicular size was observed without any other distinguishable abnormalities in the mice. Histological examination as well as stage-specific gene expression analysis in adult and neonatal testes revealed a severe reduction of spermatocytes accompanied by increased apoptosis. Subsequently, the Ant4-deficient male mice were infertile. Taken together, these data elucidated the indispensable role of Ant4 in murine spermatogenesis. Considering the unique conservation and chromosomal location of the Ant family genes in mammals, the Ant4 gene may have arisen in mammalian ancestors and been conserved in mammals to serve as the sole and essential mitochondrial ADP/ATP carrier during spermatogenesis where the sex chromosome-linked Ant2 gene is inactivated.

  20. IAPs contain an evolutionarily conserved ubiquitin-binding domain that regulates NF-kappaB as well as cell survival and oncogenesis

    DEFF Research Database (Denmark)

    Gyrd-Hansen, Mads; Darding, Maurice; Miasari, Maria

    2008-01-01

    in cancer and their expression level is implicated in contributing to tumorigenesis, chemoresistance, disease progression and poor patient-survival. Here, we have identified an evolutionarily conserved ubiquitin-associated (UBA) domain in IAPs, which enables them to bind to Lys 63-linked polyubiquitin. We...

  1. An evolutionarily conserved intronic region controls the spatiotemporal expression of the transcription factor Sox10

    Directory of Open Access Journals (Sweden)

    Pavan William J

    2008-10-01

    Full Text Available Abstract Background A major challenge lies in understanding the complexities of gene regulation. Mutation of the transcription factor SOX10 is associated with several human diseases. The disease phenotypes reflect the function of SOX10 in diverse tissues including the neural crest, central nervous system and otic vesicle. As expected, the SOX10 expression pattern is complex and highly dynamic, but little is known of the underlying mechanisms regulating its spatiotemporal pattern. SOX10 expression is highly conserved between all vertebrates characterised. Results We have combined in vivo testing of DNA fragments in zebrafish and computational comparative genomics to identify the first regulatory regions of the zebrafish sox10 gene. Both approaches converged on the 3' end of the conserved 1st intron as being critical for spatial patterning of sox10 in the embryo. Importantly, we have defined a minimal region crucial for this function. We show that this region contains numerous binding sites for transcription factors known to be essential in early neural crest induction, including Tcf/Lef, Sox and FoxD3. We show that the identity and relative position of these binding sites are conserved between zebrafish and mammals. A further region, partially required for oligodendrocyte expression, lies in the 5' region of the same intron and contains a putative CSL binding site, consistent with a role for Notch signalling in sox10 regulation. Furthermore, we show that β-catenin, Notch signalling and Sox9 can induce ectopic sox10 expression in early embryos, consistent with regulatory roles predicted from our transgenic and computational results. Conclusion We have thus identified two major sites of sox10 regulation in vertebrates and provided evidence supporting a role for at least three factors in driving sox10 expression in neural crest, otic epithelium and oligodendrocyte domains.

  2. Evolutionarily conserved roles of the dicer helicase domain in regulating RNA interference processing.

    Science.gov (United States)

    Kidwell, Mary Anne; Chan, Jessica M; Doudna, Jennifer A

    2014-10-10

    The enzyme Dicer generates 21-25 nucleotide RNAs that target specific mRNAs for silencing during RNA interference and related pathways. Although their active sites and RNA binding regions are functionally conserved, the helicase domains have distinct activities in the context of different Dicer enzymes. To examine the evolutionary origins of Dicer helicase functions, we investigated two related Dicer enzymes from the thermophilic fungus Sporotrichum thermophile. RNA cleavage assays showed that S. thermophile Dicer-1 (StDicer-1) can process hairpin precursor microRNAs, whereas StDicer-2 can only cleave linear double-stranded RNAs. Furthermore, only StDicer-2 possesses robust ATP hydrolytic activity in the presence of double-stranded RNA. Deletion of the StDicer-2 helicase domain increases both StDicer-2 cleavage activity and affinity for hairpin RNA. Notably, both StDicer-1 and StDicer-2 could complement the distantly related yeast Schizosaccharomyces pombe lacking its endogenous Dicer gene but only in their full-length forms, underscoring the importance of the helicase domain. These results suggest an in vivo regulatory function for the helicase domain that may be conserved from fungi to humans. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Evolutionarily conserved role for SoxC genes in neural crest specification and neuronal differentiation.

    Science.gov (United States)

    Uy, Benjamin R; Simoes-Costa, Marcos; Koo, Daniel E S; Sauka-Spengler, Tatjana; Bronner, Marianne E

    2015-01-15

    Members of the Sox family of transcription factors play a variety of critical developmental roles in both vertebrates and invertebrates. Whereas SoxBs and SoxEs are involved in neural and neural crest development, respectively, far less is known about members of the SoxC subfamily. To address this from an evolutionary perspective, we compare expression and function of SoxC genes in neural crest cells and their derivatives in lamprey (Petromyzon marinus), a basal vertebrate, to frog (Xenopus laevis). Analysis of transcript distribution reveals conservation of lamprey and X. laevis SoxC expression in premigratory neural crest, branchial arches, and cranial ganglia. Moreover, morpholino-mediated loss-of-function of selected SoxC family members demonstrates essential roles in aspects of neural crest development in both organisms. The results suggest important and conserved functions of SoxC genes during vertebrate evolution and a particularly critical, previously unrecognized role in early neural crest specification. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Post-transcriptional exon shuffling events in humans can be evolutionarily conserved and abundant

    OpenAIRE

    Al-Balool, Haya H.; Weber, David; Liu, Yilei; Wade, Mark; Guleria, Kamlesh; Nam, Pitsien Lang Ping; Clayton, Jake; Rowe, William; Coxhead, Jonathan; Irving, Julie; Elliott, David J.; Hall, Andrew G.; Santibanez-Koref, Mauro; Jackson, Michael S.

    2011-01-01

    In silico analyses have established that transcripts from some genes can be processed into RNAs with rearranged exon order relative to genomic structure (post-transcriptional exon shuffling, or PTES). Although known to contribute to transcriptome diversity in some species, to date the structure, distribution, abundance, and functional significance of human PTES transcripts remains largely unknown. Here, using high-throughput transcriptome sequencing, we identify 205 putative human PTES produc...

  5. Genes that contribute to cancer fusion genes are large and evolutionarily conserved.

    Science.gov (United States)

    Narsing, Swetha; Jelsovsky, Zhihong; Mbah, Alfred; Blanck, George

    2009-06-01

    Numerous cancer fusion genes have been identified and studied, and in some cases, therapy or diagnostic techniques have been designed that are specific to the fusion protein encoded by the fusion gene. There has been little progress, however, in understanding the general features of cancer fusion genes in a way that could provide the foundation for an algorithm for predicting the occurrence of a fusion gene once the chromosomal translocation points have been identified by karyotype analyses. In this study, we used publicly available data sets to characterize 59 cancer fusion genes. The results indicate that all but 17% of the genes involved in fusion events are either relatively large, compared to neighboring genes, or are highly conserved in evolution. These results support a basis for designing algorithms that could have a high degree of predictive value in identifying fusion genes once conventional microscopic analyses have identified the chromosomal breakpoints.

  6. Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes

    Science.gov (United States)

    Dekel, Amir; Pitts, Ronald J.; Yakir, Esther; Bohbot, Jonathan D.

    2016-01-01

    Olfaction is a key insect adaptation to a wide range of habitats. In the last thirty years, the detection of octenol by blood-feeding insects has been primarily understood in the context of animal host-seeking. The recent discovery of a conserved octenol receptor gene in the strictly nectar-feeding elephant mosquito Toxorhynchites amboinensis (TaOr8) suggests a different biological role. Here, we show that TaOR8 is a functional ortholog of its counterparts in blood-feeding mosquitoes displaying selectivity towards the (R)-enantiomer of octenol and susceptibility to the insect repellent DEET. These findings suggest that while the function of OR8 has been maintained throughout mosquito evolution, the context in which this receptor is operating has diverged in blood and nectar-feeding mosquitoes. PMID:27849027

  7. An Abundant Evolutionarily Conserved CSB-PiggyBac Fusion Protein Expressed in Cockayne Syndrome

    Science.gov (United States)

    Newman, John C.; Bailey, Arnold D.; Fan, Hua-Ying; Pavelitz, Thomas; Weiner, Alan M.

    2008-01-01

    Cockayne syndrome (CS) is a devastating progeria most often caused by mutations in the CSB gene encoding a SWI/SNF family chromatin remodeling protein. Although all CSB mutations that cause CS are recessive, the complete absence of CSB protein does not cause CS. In addition, most CSB mutations are located beyond exon 5 and are thought to generate only C-terminally truncated protein fragments. We now show that a domesticated PiggyBac-like transposon PGBD3, residing within intron 5 of the CSB gene, functions as an alternative 3′ terminal exon. The alternatively spliced mRNA encodes a novel chimeric protein in which CSB exons 1–5 are joined in frame to the PiggyBac transposase. The resulting CSB-transposase fusion protein is as abundant as CSB protein itself in a variety of human cell lines, and continues to be expressed by primary CS cells in which functional CSB is lost due to mutations beyond exon 5. The CSB-transposase fusion protein has been highly conserved for at least 43 Myr since the divergence of humans and marmoset, and appears to be subject to selective pressure. The human genome contains over 600 nonautonomous PGBD3-related MER85 elements that were dispersed when the PGBD3 transposase was last active at least 37 Mya. Many of these MER85 elements are associated with genes which are involved in neuronal development, and are known to be regulated by CSB. We speculate that the CSB-transposase fusion protein has been conserved for host antitransposon defense, or to modulate gene regulation by MER85 elements, but may cause CS in the absence of functional CSB protein. PMID:18369450

  8. An abundant evolutionarily conserved CSB-PiggyBac fusion protein expressed in Cockayne syndrome.

    Directory of Open Access Journals (Sweden)

    John C Newman

    2008-03-01

    Full Text Available Cockayne syndrome (CS is a devastating progeria most often caused by mutations in the CSB gene encoding a SWI/SNF family chromatin remodeling protein. Although all CSB mutations that cause CS are recessive, the complete absence of CSB protein does not cause CS. In addition, most CSB mutations are located beyond exon 5 and are thought to generate only C-terminally truncated protein fragments. We now show that a domesticated PiggyBac-like transposon PGBD3, residing within intron 5 of the CSB gene, functions as an alternative 3' terminal exon. The alternatively spliced mRNA encodes a novel chimeric protein in which CSB exons 1-5 are joined in frame to the PiggyBac transposase. The resulting CSB-transposase fusion protein is as abundant as CSB protein itself in a variety of human cell lines, and continues to be expressed by primary CS cells in which functional CSB is lost due to mutations beyond exon 5. The CSB-transposase fusion protein has been highly conserved for at least 43 Myr since the divergence of humans and marmoset, and appears to be subject to selective pressure. The human genome contains over 600 nonautonomous PGBD3-related MER85 elements that were dispersed when the PGBD3 transposase was last active at least 37 Mya. Many of these MER85 elements are associated with genes which are involved in neuronal development, and are known to be regulated by CSB. We speculate that the CSB-transposase fusion protein has been conserved for host antitransposon defense, or to modulate gene regulation by MER85 elements, but may cause CS in the absence of functional CSB protein.

  9. Gene Regulatory Enhancers with Evolutionarily Conserved Activity Are More Pleiotropic than Those with Species-Specific Activity.

    Science.gov (United States)

    Fish, Alexandra; Chen, Ling; Capra, John A

    2017-10-01

    Studies of regulatory activity and gene expression have revealed an intriguing dichotomy: There is substantial turnover in the regulatory activity of orthologous sequences between species; however, the expression level of orthologous genes is largely conserved. Understanding how distal regulatory elements, for example, enhancers, evolve and function is critical, as alterations in gene expression levels can drive the development of both complex disease and functional divergence between species. In this study, we investigated determinants of the conservation of regulatory enhancer activity for orthologous sequences across mammalian evolution. Using liver enhancers identified from genome-wide histone modification profiles in ten diverse mammalian species, we compared orthologous sequences that exhibited regulatory activity in all species (conserved-activity enhancers) to shared sequences active only in a single species (species-specific-activity enhancers). Conserved-activity enhancers have greater regulatory potential than species-specific-activity enhancers, as quantified by both the density and diversity of transcription factor binding motifs. Consistent with their greater regulatory potential, conserved-activity enhancers have greater regulatory activity in humans than species-specific-activity enhancers: They are active across more cellular contexts, and they regulate more genes than species-specific-activity enhancers. Furthermore, the genes regulated by conserved-activity enhancers are expressed in more tissues and are less tolerant of loss-of-function mutations than those targeted by species-specific-activity enhancers. These consistent results across various stages of gene regulation demonstrate that conserved-activity enhancers are more pleiotropic than their species-specific-activity counterparts. This suggests that pleiotropy is associated with the conservation of regulatory across mammalian evolution. © The Author 2017. Published by Oxford University

  10. Dissecting the Gene Network of Dietary Restriction to Identify Evolutionarily Conserved Pathways and New Functional Genes

    Science.gov (United States)

    Wuttke, Daniel; Connor, Richard; Vora, Chintan; Craig, Thomas; Li, Yang; Wood, Shona; Vasieva, Olga; Shmookler Reis, Robert; Tang, Fusheng; de Magalhães, João Pedro

    2012-01-01

    Dietary restriction (DR), limiting nutrient intake from diet without causing malnutrition, delays the aging process and extends lifespan in multiple organisms. The conserved life-extending effect of DR suggests the involvement of fundamental mechanisms, although these remain a subject of debate. To help decipher the life-extending mechanisms of DR, we first compiled a list of genes that if genetically altered disrupt or prevent the life-extending effects of DR. We called these DR–essential genes and identified more than 100 in model organisms such as yeast, worms, flies, and mice. In order for other researchers to benefit from this first curated list of genes essential for DR, we established an online database called GenDR (http://genomics.senescence.info/diet/). To dissect the interactions of DR–essential genes and discover the underlying lifespan-extending mechanisms, we then used a variety of network and systems biology approaches to analyze the gene network of DR. We show that DR–essential genes are more conserved at the molecular level and have more molecular interactions than expected by chance. Furthermore, we employed a guilt-by-association method to predict novel DR–essential genes. In budding yeast, we predicted nine genes related to vacuolar functions; we show experimentally that mutations deleting eight of those genes prevent the life-extending effects of DR. Three of these mutants (OPT2, FRE6, and RCR2) had extended lifespan under ad libitum, indicating that the lack of further longevity under DR is not caused by a general compromise of fitness. These results demonstrate how network analyses of DR using GenDR can be used to make phenotypically relevant predictions. Moreover, gene-regulatory circuits reveal that the DR–induced transcriptional signature in yeast involves nutrient-sensing, stress responses and meiotic transcription factors. Finally, comparing the influence of gene expression changes during DR on the interactomes of multiple

  11. FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells

    Directory of Open Access Journals (Sweden)

    Cobos Everardo

    2005-01-01

    Full Text Available Abstract Background Hematopoiesis is a complex developmental process controlled by a large number of factors that regulate stem cell renewal, lineage commitment and differentiation. Secreted proteins, including the hematopoietic growth factors, play critical roles in these processes and have important biological and clinical significance. We have employed representational difference analysis to identify genes that are differentially expressed during experimentally induced myeloid differentiation in the murine EML hematopoietic stem cell line. Results One identified clone encoded a previously unidentified protein of 541 amino acids that contains an amino terminal signal sequence but no other characterized domains. This protein is a member of family of related proteins that has been named family with sequence similarity 20 (FAM20 with three members (FAM20A, FAM20B and FAM20C in mammals. Evolutionary comparisons revealed the existence of a single FAM20 gene in the simple vertebrate Ciona intestinalis and the invertebrate worm Caenorhabditis elegans and two genes in two insect species, Drosophila melanogaster and Anopheles gambiae. Six FAM20 family members were identified in the genome of the pufferfish, Fugu rubripes and five members in the zebrafish, Danio rerio. The mouse Fam20a protein was ectopically expressed in a mammalian cell line and found to be a bona fide secreted protein and efficient secretion was dependent on the integrity of the signal sequence. Expression analysis revealed that the Fam20a gene was indeed differentially expressed during hematopoietic differentiation and that the other two family members (Fam20b and Fam20c were also expressed during hematcpoiesis but that their mRNA levels did not vary significantly. Likewise FAM20A was expressed in more limited set of human tissues than the other two family members. Conclusions The FAM20 family represents a new family of secreted proteins with potential functions in regulating

  12. An evolutionarily conserved enhancer regulates Bmp4 expression in developing incisor and limb bud.

    Directory of Open Access Journals (Sweden)

    Dolrudee Jumlongras

    Full Text Available To elucidate the transcriptional regulation of Bmp4 expression during organogenesis, we used phylogenetic footprinting and transgenic reporter analyses to identify Bmp4 cis-regulatory modules (CRMs. These analyses identified a regulatory region located ∼46 kb upstream of the mouse Bmp4 transcription start site that had previously been shown to direct expression in lateral plate mesoderm. We refined this regulatory region to a 396-bp minimal enhancer, and show that it recapitulates features of endogenous Bmp4 expression in developing mandibular arch ectoderm and incisor epithelium during the initiation-stage of tooth development. In addition, this enhancer directs expression in the apical ectodermal ridge (AER of the developing limb and in anterior and posterior limb mesenchyme. Transcript profiling of E11.5 mouse incisor dental lamina, together with protein binding microarray (PBM analyses, allowed identification of a conserved DNA binding motif in the Bmp4 enhancer for Pitx homeoproteins, which are also expressed in the developing mandibular and incisor epithelium. In vitro electrophoretic mobility shift assays (EMSA and in vivo transgenic reporter mutational analyses revealed that this site supports Pitx binding and that the site is necessary to recapitulate aspects of endogenous Bmp4 expression in developing craniofacial and limb tissues. Finally, Pitx2 chromatin immunoprecipitation (ChIP demonstrated direct binding of Pitx2 to this Bmp4 enhancer site in a dental epithelial cell line. These results establish a direct molecular regulatory link between Pitx family members and Bmp4 gene expression in developing incisor epithelium.

  13. An Evolutionarily Conserved PLC-PKD-TFEB Pathway for Host Defense

    Directory of Open Access Journals (Sweden)

    Mehran Najibi

    2016-05-01

    Full Text Available The mechanisms that tightly control the transcription of host defense genes have not been fully elucidated. We previously identified TFEB as a transcription factor important for host defense, but the mechanisms that regulate TFEB during infection remained unknown. Here, we used C. elegans to discover a pathway that activates TFEB during infection. Gene dkf-1, which encodes a homolog of protein kinase D (PKD, was required for TFEB activation in nematodes infected with Staphylococcus aureus. Conversely, pharmacological activation of PKD was sufficient to activate TFEB. Furthermore, phospholipase C (PLC gene plc-1 was also required for TFEB activation, downstream of Gαq homolog egl-30 and upstream of dkf-1. Using reverse and chemical genetics, we discovered a similar PLC-PKD-TFEB axis in Salmonella-infected mouse macrophages. In addition, PKCα was required in macrophages. These observations reveal a previously unknown host defense signaling pathway, which has been conserved across one billion years of evolution.

  14. An Evolutionarily Conserved PLC-PKD-TFEB Pathway for Host Defense.

    Science.gov (United States)

    Najibi, Mehran; Labed, Sid Ahmed; Visvikis, Orane; Irazoqui, Javier Elbio

    2016-05-24

    The mechanisms that tightly control the transcription of host defense genes have not been fully elucidated. We previously identified TFEB as a transcription factor important for host defense, but the mechanisms that regulate TFEB during infection remained unknown. Here, we used C. elegans to discover a pathway that activates TFEB during infection. Gene dkf-1, which encodes a homolog of protein kinase D (PKD), was required for TFEB activation in nematodes infected with Staphylococcus aureus. Conversely, pharmacological activation of PKD was sufficient to activate TFEB. Furthermore, phospholipase C (PLC) gene plc-1 was also required for TFEB activation, downstream of Gαq homolog egl-30 and upstream of dkf-1. Using reverse and chemical genetics, we discovered a similar PLC-PKD-TFEB axis in Salmonella-infected mouse macrophages. In addition, PKCα was required in macrophages. These observations reveal a previously unknown host defense signaling pathway, which has been conserved across one billion years of evolution. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Evolutionarily conserved sites in yeast tropomyosin function in cell polarity, transport and contractile ring formation

    Directory of Open Access Journals (Sweden)

    Susanne Cranz-Mileva

    2015-08-01

    Full Text Available Tropomyosin is a coiled-coil protein that binds and regulates actin filaments. The tropomyosin gene in Schizosaccharomyces pombe, cdc8, is required for formation of actin cables, contractile rings, and polar localization of actin patches. The roles of conserved residues were investigated in gene replacement mutants. The work validates an evolution-based approach to identify tropomyosin functions in living cells and sites of potential interactions with other proteins. A cdc8 mutant with near-normal actin affinity affects patch polarization and vacuole fusion, possibly by affecting Myo52p, a class V myosin, function. The presence of labile residual cell attachments suggests a delay in completion of cell division and redistribution of cell patches following cytokinesis. Another mutant with a mild phenotype is synthetic negative with GFP-fimbrin, inferring involvement of the mutated tropomyosin sites in interaction between the two proteins. Proteins that assemble in the contractile ring region before actin do so in a mutant cdc8 strain that cannot assemble condensed actin rings, yet some cells can divide. Of general significance, LifeAct-GFP negatively affects the actin cytoskeleton, indicating caution in its use as a biomarker for actin filaments.

  16. Evolutionarily conserved Delta(25(27))-olefin ergosterol biosynthesis pathway in the alga Chlamydomonas reinhardtii.

    Science.gov (United States)

    Miller, Matthew B; Haubrich, Brad A; Wang, Qian; Snell, William J; Nes, W David

    2012-08-01

    Ergosterol is the predominant sterol of fungi and green algae. Although the biosynthetic pathway for sterol synthesis in fungi is well established and is known to use C24-methylation-C24 (28)-reduction (Δ(24(28))-olefin pathway) steps, little is known about the sterol pathway in green algae. Previous work has raised the possibility that these algae might use a novel pathway because the green alga Chlamydomonas reinhardtii was shown to possess a mevalonate-independent methylerythritol 4-phosphate not present in fungi. Here, we report that C. reinhardtii synthesizes the protosterol cycloartenol and converts it to ergosterol (C24β-methyl) and 7-dehydroporiferasterol (C24β-ethyl) through a highly conserved sterol C24- methylation-C25-reduction (Δ(25(27))-olefin) pathway that is distinct from the well-described acetate-mevalonate pathway to fungal lanosterol and its conversion to ergosterol by the Δ(24(28))-olefin pathway. We isolated and characterized 23 sterols by a combination of GC-MS and proton nuclear magnetic resonance spectroscopy analysis from a set of mutant, wild-type, and 25-thialanosterol-treated cells. The structure and stereochemistry of the final C24-alkyl sterol side chains possessed different combinations of 24β-methyl/ethyl groups and Δ(22(23))E and Δ(25(27))-double bond constructions. When incubated with [methyl-(2)H(3)]methionine, cells incorporated three (into ergosterol) or five (into 7-dehydroporiferasterol) deuterium atoms into the newly biosynthesized 24β-alkyl sterols, consistent only with a Δ(25(27))-olefin pathway. Thus, our findings demonstrate that two separate isoprenoid-24-alkyl sterol pathways evolved in fungi and green algae, both of which converge to yield a common membrane insert ergosterol.

  17. Drosophila KCNQ channel displays evolutionarily conserved electrophysiology and pharmacology with mammalian KCNQ channels.

    Directory of Open Access Journals (Sweden)

    Sonia Cavaliere

    Full Text Available Of the five human KCNQ (Kv7 channels, KCNQ1 with auxiliary subunit KCNE1 mediates the native cardiac I(Ks current with mutations causing short and long QT cardiac arrhythmias. KCNQ4 mutations cause deafness. KCNQ2/3 channels form the native M-current controlling excitability of most neurons, with mutations causing benign neonatal febrile convulsions. Drosophila contains a single KCNQ (dKCNQ that appears to serve alone the functions of all the duplicated mammalian neuronal and cardiac KCNQ channels sharing roughly 50-60% amino acid identity therefore offering a route to investigate these channels. Current information about the functional properties of dKCNQ is lacking therefore we have investigated these properties here. Using whole cell patch clamp electrophysiology we compare the biophysical and pharmacological properties of dKCNQ with the mammalian neuronal and cardiac KCNQ channels expressed in HEK cells. We show that Drosophila KCNQ (dKCNQ is a slowly activating and slowly-deactivating K(+ current open at sub-threshold potentials that has similar properties to neuronal KCNQ2/3 with some features of the cardiac KCNQ1/KCNE1 accompanied by conserved sensitivity to a number of clinically relevant KCNQ blockers (chromanol 293B, XE991, linopirdine and opener (zinc pyrithione. We also investigate the molecular basis of the differential selectivity of KCNQ channels to the opener retigabine and show a single amino acid substitution (M217W can confer sensitivity to dKCNQ. We show dKCNQ has similar electrophysiological and pharmacological properties as the mammalian KCNQ channels, allowing future study of physiological and pathological roles of KCNQ in Drosophila and whole organism screening for new modulators of KCNQ channelopathies.

  18. Evolutionarily conserved bias of amino-acid usage refines the definition of PDZ-binding motif

    Directory of Open Access Journals (Sweden)

    Launey Thomas

    2011-06-01

    Full Text Available Abstract Background The interactions between PDZ (PSD-95, Dlg, ZO-1 domains and PDZ-binding motifs play central roles in signal transductions within cells. Proteins with PDZ domains bind to PDZ-binding motifs almost exclusively when the motifs are located at the carboxyl (C- terminal ends of their binding partners. However, it remains little explored whether PDZ-binding motifs show any preferential location at the C-terminal ends of proteins, at genome-level. Results Here, we examined the distribution of the type-I (x-x-S/T-x-I/L/V or type-II (x-x-V-x-I/V PDZ-binding motifs in proteins encoded in the genomes of five different species (human, mouse, zebrafish, fruit fly and nematode. We first established that these PDZ-binding motifs are indeed preferentially present at their C-terminal ends. Moreover, we found specific amino acid (AA bias for the 'x' positions in the motifs at the C-terminal ends. In general, hydrophilic AAs were favored. Our genomics-based findings confirm and largely extend the results of previous interaction-based studies, allowing us to propose refined consensus sequences for all of the examined PDZ-binding motifs. An ontological analysis revealed that the refined motifs are functionally relevant since a large fraction of the proteins bearing the motif appear to be involved in signal transduction. Furthermore, co-precipitation experiments confirmed two new protein interactions predicted by our genomics-based approach. Finally, we show that influenza virus pathogenicity can be correlated with PDZ-binding motif, with high-virulence viral proteins bearing a refined PDZ-binding motif. Conclusions Our refined definition of PDZ-binding motifs should provide important clues for identifying functional PDZ-binding motifs and proteins involved in signal transduction.

  19. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress

    KAUST Repository

    Kinoshita, Natsuko

    2012-09-01

    The functions of microRNAs and their target mRNAs in Arabidopsis thaliana development have been widely documented; however, roles of stress-responsive microRNAs and their targets are not as well understood. Using small RNA deep sequencing and ATH1 microarrays to profile mRNAs, we identified IAA-Ala Resistant3 (IAR3) as a new target of miR167a. As expected, IAR3 mRNA was cleaved at the miR167a complementary site and under high osmotic stress miR167a levels decreased, whereas IAR3 mRNA levels increased. IAR3 hydrolyzes an inactive form of auxin (indole-3-acetic acid [IAA]-alanine) and releases bioactive auxin (IAA), a central phytohormone for root development. In contrast with the wild type, iar3 mutants accumulated reduced IAA levels and did not display high osmotic stress-induced root architecture changes. Transgenic plants expressing a cleavage-resistant form of IAR3 mRNA accumulated high levels of IAR3 mRNAs and showed increased lateral root development compared with transgenic plants expressing wild-type IAR3. Expression of an inducible noncoding RNA to sequester miR167a by target mimicry led to an increase in IAR3 mRNA levels, further confirming the inverse relationship between the two partners. Sequence comparison revealed the miR167 target site on IAR3 mRNA is conserved in evolutionarily distant plant species. Finally, we showed that IAR3 is required for drought tolerance. © 2012 American Society of Plant Biologists. All rights reserved.

  20. Deep sequencing of organ- and stage-specific microRNAs in the evolutionarily basal insect Blattella germanica (L. (Dictyoptera, Blattellidae.

    Directory of Open Access Journals (Sweden)

    Alexandre S Cristino

    Full Text Available BACKGROUND: microRNAs (miRNAs have been reported as key regulators at post-transcriptional level in eukaryotic cells. In insects, most of the studies have focused in holometabolans while only recently two hemimetabolans (Locusta migratoria and Acyrthosiphon pisum have had their miRNAs identified. Therefore, the study of the miRNAs of the evolutionarily basal hemimetabolan Blattella germanica may provide valuable insights on the structural and functional evolution of miRNAs. METHODOLOGY/PRINCIPAL FINDINGS: Small RNA libraries of the cockroach B. germanica were built from the whole body of the last instar nymph, and the adult ovaries. The high throughput Solexa sequencing resulted in approximately 11 and 8 million reads for the whole-body and ovaries, respectively. Bioinformatic analyses identified 38 known miRNAs as well as 11 known miRNA*s. We also found 70 miRNA candidates conserved in other insects and 170 candidates specific to B. germanica. The positive correlation between Solexa data and real-time quantitative PCR showed that number of reads can be used as a quantitative approach. Five novel miRNA precursors were identified and validated by PCR and sequencing. Known miRNAs and novel candidates were also validated by decreasing levels of their expression in dicer-1 RNAi knockdown individuals. The comparison of the two libraries indicates that whole-body nymph contain more known miRNAs than ovaries, whereas the adult ovaries are enriched with novel miRNA candidates. CONCLUSIONS/SIGNIFICANCE: Our study has identified many known miRNAs and novel miRNA candidates in the basal hemimetabolan insect B. germanica, and most of the specific sequences were found in ovaries. Deep sequencing data reflect miRNA abundance and dicer-1 RNAi assay is shown to be a reliable method for validation of novel miRNAs.

  1. On the relationship between residue structural environment and sequence conservation in proteins.

    Science.gov (United States)

    Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao

    2017-09-01

    Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.

  2. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    Science.gov (United States)

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

    2017-03-01

    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

  3. Sequence conservation on the Y chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, L.H.; Yang-Feng, L. [Yale Univ. School of Medicine, New Haven, CT (United States); Lau, C. [Univ. of California, San Francisco, CA (United States)

    1994-09-01

    The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid pools were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.

  4. Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

    Science.gov (United States)

    Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

    2017-03-27

    Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome

  5. Structural organization of essential iron-sulfur clusters in the evolutionarily highly conserved ATP-binding cassette protein ABCE1

    NARCIS (Netherlands)

    Barthelme, Dominik; Scheele, Urte; Dinkelaker, Stephanie; Janoschka, Adam; MacMillan, Fraser; Albers, Sonja-Verena; Driessen, Arnold J. M.; Stagni, Marco Salamone; Bill, Eckhard; Meyer-Klaucke, Wolfram; Schuenemann, Volker; Tampe, Robert; Schünemann, Volker

    2007-01-01

    The ABC protein ABCE1, formerly named RNase L inhibitor RLI1, is one of the most conserved proteins in evolution and is expressed in all organisms except eubacteria. Because of its fundamental role in translation initiation and/or ribosome biosynthesis, ABCE1 is essential for life. Its molecular

  6. Purifying Selection in Deeply Conserved Human Enhancers Is More Consistent than in Coding Sequences

    Science.gov (United States)

    De Silva, Dilrini R.; Nichols, Richard; Elgar, Greg

    2014-01-01

    Comparison of polymorphism at synonymous and non-synonymous sites in protein-coding DNA can provide evidence for selective constraint. Non-coding DNA that forms part of the regulatory landscape presents more of a challenge since there is not such a clear-cut distinction between sites under stronger and weaker selective constraint. Here, we consider putative regulatory elements termed Conserved Non-coding Elements (CNEs) defined by their high level of sequence identity across all vertebrates. Some mutations in these regions have been implicated in developmental disorders; we analyse CNE polymorphism data to investigate whether such deleterious effects are widespread in humans. Single nucleotide variants from the HapMap and 1000 Genomes Projects were mapped across nearly 2000 CNEs. In the 1000 Genomes data we find a significant excess of rare derived alleles in CNEs relative to coding sequences; this pattern is absent in HapMap data, apparently obscured by ascertainment bias. The distribution of polymorphism within CNEs is not uniform; we could identify two categories of sites by exploiting deep vertebrate alignments: stretches that are non-variant, and those that have at least one substitution. The conserved category has fewer polymorphic sites and a greater excess of rare derived alleles, which can be explained by a large proportion of sites under strong purifying selection within humans – higher than that for non-synonymous sites in most protein coding regions, and comparable to that at the strongly conserved trans-dev genes. Conversely, the more evolutionarily labile CNE sites have an allele frequency distribution not significantly different from non-synonymous sites. Future studies should exploit genome-wide re-sequencing to obtain better coverage in selected non-coding regions, given the likelihood that mutations in evolutionarily conserved enhancer sequences are deleterious. Discovery pipelines should validate non-coding variants to aid in identifying causal

  7. An Evolutionarily Conserved Sweet Clade is Involved in the Detection of Bitter and Sweet Tastants in Insects

    OpenAIRE

    Freeman, Erica

    2017-01-01

    The taste system is essential to determine the palatability of a potential food sources. Insects use gustatory receptors (Gr) to detect both appetitive and aversive compounds. In D. melanogaster, sweet neurons express eight Grs belonging to a highly conserved clade in insects. Currently, it is unknown how these receptors detect sweet tastants. A system that can functionally express single Grs to study ligand recognition is necessary to fill a critical gap in the field. Using the CO2-sensing ...

  8. Production of Bioactive Diterpenoids in the Euphorbiaceae Depends on Evolutionarily Conserved Gene Clusters[C][W][OPEN

    Science.gov (United States)

    King, Andrew J.; Brown, Geoffrey D.; Gilday, Alison D.; Larson, Tony R.; Graham, Ian A.

    2014-01-01

    The Euphorbiaceae produce a diverse range of diterpenoids, many of which have pharmacological activities. These diterpenoids include ingenol mebutate, which is licensed for the treatment of a precancerous skin condition (actinic keratosis), and phorbol derivatives such as resiniferatoxin and prostratin, which are undergoing investigation for the treatment of severe pain and HIV, respectively. Despite the interest in these diterpenoids, their biosynthesis is poorly understood at present, with the only characterized step being the conversion of geranylgeranyl pyrophosphate into casbene. Here, we report a physical cluster of diterpenoid biosynthetic genes from castor (Ricinus communis), including casbene synthases and cytochrome P450s from the CYP726A subfamily. CYP726A14, CYP726A17, and CYP726A18 were able to catalyze 5-oxidation of casbene, a conserved oxidation step in the biosynthesis of this family of medicinally important diterpenoids. CYP726A16 catalyzed 7,8-epoxidation of 5-keto-casbene and CYP726A15 catalyzed 5-oxidation of neocembrene. Evidence of similar gene clustering was also found in two other Euphorbiaceae, including Euphorbia peplus, the source organism of ingenol mebutate. These results demonstrate conservation of gene clusters at the higher taxonomic level of the plant family and that this phenomenon could prove useful in further elucidating diterpenoid biosynthetic pathways. PMID:25172144

  9. The evolutionarily conserved mediator subunit MDT-15/MED15 links protective innate immune responses and xenobiotic detoxification.

    Science.gov (United States)

    Pukkila-Worley, Read; Feinbaum, Rhonda L; McEwan, Deborah L; Conery, Annie L; Ausubel, Frederick M

    2014-05-01

    Metazoans protect themselves from environmental toxins and virulent pathogens through detoxification and immune responses. We previously identified a small molecule xenobiotic toxin that extends survival of Caenorhabditis elegans infected with human bacterial pathogens by activating the conserved p38 MAP kinase PMK-1 host defense pathway. Here we investigate the cellular mechanisms that couple activation of a detoxification response to innate immunity. From an RNAi screen of 1,420 genes expressed in the C. elegans intestine, we identified the conserved Mediator subunit MDT-15/MED15 and 28 other gene inactivations that abrogate the induction of PMK-1-dependent immune effectors by this small molecule. We demonstrate that MDT-15/MED15 is required for the xenobiotic-induced expression of p38 MAP kinase PMK-1-dependent immune genes and protection from Pseudomonas aeruginosa infection. We also show that MDT-15 controls the induction of detoxification genes and functions to protect the host from bacteria-derived phenazine toxins. These data define a central role for MDT-15/MED15 in the coordination of xenobiotic detoxification and innate immune responses.

  10. The evolutionarily conserved mediator subunit MDT-15/MED15 links protective innate immune responses and xenobiotic detoxification.

    Directory of Open Access Journals (Sweden)

    Read Pukkila-Worley

    2014-05-01

    Full Text Available Metazoans protect themselves from environmental toxins and virulent pathogens through detoxification and immune responses. We previously identified a small molecule xenobiotic toxin that extends survival of Caenorhabditis elegans infected with human bacterial pathogens by activating the conserved p38 MAP kinase PMK-1 host defense pathway. Here we investigate the cellular mechanisms that couple activation of a detoxification response to innate immunity. From an RNAi screen of 1,420 genes expressed in the C. elegans intestine, we identified the conserved Mediator subunit MDT-15/MED15 and 28 other gene inactivations that abrogate the induction of PMK-1-dependent immune effectors by this small molecule. We demonstrate that MDT-15/MED15 is required for the xenobiotic-induced expression of p38 MAP kinase PMK-1-dependent immune genes and protection from Pseudomonas aeruginosa infection. We also show that MDT-15 controls the induction of detoxification genes and functions to protect the host from bacteria-derived phenazine toxins. These data define a central role for MDT-15/MED15 in the coordination of xenobiotic detoxification and innate immune responses.

  11. A Functional Genomic Screen for Evolutionarily Conserved Genes Required for Lifespan and Immunity in Germline-Deficient C. elegans

    Science.gov (United States)

    Sinha, Amit; Rae, Robbie

    2014-01-01

    The reproductive system regulates lifespan in insects, nematodes and vertebrates. In Caenorhabditis elegans removal of germline increases lifespan by 60% which is dependent upon insulin signaling, nuclear hormone signaling, autophagy and fat metabolism and their microRNA-regulators. Germline-deficient C. elegans are also more resistant to various bacterial pathogens but the underlying molecular mechanisms are largely unknown. Firstly, we demonstrate that previously identified genes that regulate the extended lifespan of germline-deficient C. elegans (daf-2, daf-16, daf-12, tcer-1, mir-7.1 and nhr-80) are also essential for resistance to the pathogenic bacterium Xenorhabdus nematophila. We then use a novel unbiased approach combining laser cell ablation, whole genome microarrays, RNAi screening and exposure to X. nematophila to generate a comprehensive genome-wide catalog of genes potentially required for increased lifespan and innate immunity in germline-deficient C. elegans. We find 3,440 genes to be upregulated in C. elegans germline-deficient animals in a gonad dependent manner, which are significantly enriched for genes involved in insulin signaling, fatty acid desaturation, translation elongation and proteasome complex function. Using RNAi against a subset of 150 candidate genes selected from the microarray results, we show that the upregulated genes such as transcription factor DAF-16/FOXO, the PTEN homolog lipid phosphatase DAF-18 and several components of the proteasome complex (rpn-6.1, rpn-7, rpn-9, rpn-10, rpt-6, pbs-3 and pbs-6) are essential for both lifespan and immunity of germline deficient animals. We also identify a novel role for genes including par-5 and T12G3.6 in both lifespan-extension and increased survival on X. nematophila. From an evolutionary perspective, most of the genes differentially expressed in germline deficient C. elegans also show a conserved expression pattern in germline deficient Pristionchus pacificus, a nematode species

  12. Evolutionarily conserved cytogenetic changes in hematological malignancies of dogs and humans--man and his best friend share more than companionship.

    Science.gov (United States)

    Breen, Matthew; Modiano, Jaime F

    2008-01-01

    The pathophysiological similarities shared by many forms of human and canine disease, combined with the sophisticated genomic resources now available for the dog, have placed 'man's best friend' in a position of high visibility as a model system for a variety of biomedical concerns, including cancer. The importance of nonrandom cytogenetic abnormalities in human leukemia and lymphoma was recognized over 40 years ago, but the mechanisms of genome reorganization remain incompletely understood. The development of molecular cytogenetics, using fluorescence in situ hybridization (FISH) technology, has played a significant role in our understanding of cancer biology by providing a means for 'interrogating' tumor cells for a variety of gross genetic changes in the form of either numerical or structural chromosome aberrations. Here, we have identified cytogenetic abnormalities in naturally occurring canine hematopoietic tumors that are evolutionarily conserved compared with those that are considered characteristic of the corresponding human condition. These data suggest that humans and dogs share an ancestrally retained pathogenetic basis for cancer and that cytogenetic evaluation of canine tumors may provide greater insight into the biology of tumorigenesis.

  13. Proteome-Wide Discovery of Evolutionary Conserved Sequences in Disordered Regions

    Science.gov (United States)

    Nguyen Ba, Alex N.; Yeh, Brian J.; van Dyk, Dewald; Davidson, Alan R.; Andrews, Brenda J.; Weiss, Eric L.; Moses, Alan M.

    2016-01-01

    At least 30% of human proteins are thought to contain intrinsically disordered regions, which lack stable structural conformation. Despite lacking enzymatic functions and having few protein domains, disordered regions are functionally important for protein regulation and contain short linear motifs (short peptide sequences involved in protein-protein interactions), but in most disordered regions, the functional amino acid residues remain unknown. We searched for evolutionarily conserved sequences within disordered regions according to the hypothesis that conservation would indicate functional residues. Using a phylogenetic hidden Markov model (phylo-HMM), we made accurate, specific predictions of functional elements in disordered regions even when these elements are only two or three amino acids long. Among the conserved sequences that we identified were previously known and newly identified short linear motifs, and we experimentally verified key examples, including a motif that may mediate interaction between protein kinase Cbk1 and its substrates. We also observed that hub proteins, which interact with many partners in a protein interaction network, are highly enriched in these conserved sequences. Our analysis enabled the systematic identification of the functional residues in disordered regions and suggested that at least 5% of amino acids in disordered regions are important for function. PMID:22416277

  14. The BAT1 gene in the MHC encodes an evolutionarily conserved putative nuclear RNA helicase of the DEAD family

    Energy Technology Data Exchange (ETDEWEB)

    Peelman, L.J.; Van Zeveren, A.; Coppeiters, W. [State Univ. Ghent, Merelbeke (Belgium)] [and others

    1995-03-20

    The BAT1 gene has previously been identified about 30 kb upstream from the tumor necrosis factor (TNF) locus and close to a NF{sub kb}-related gene of the nuclear factor family in the major histocompatibility complex (MHC) of human, mouse, and pig. We now show that the BAT1 translation product is the homolog of the rat p47 nuclear protein, the WM6 Drosophila gene product, and probably also Ce08102 of Caenorhabditis elegans, all members of the DEAD protein family of ATP-dependent RNA helicases. This family has more than 40 members, including the eukaryotic translation initiation factor-4A (eIF-4A), the human nuclear protein p68, and the Drosophila oocyte polar granule component vasa. BAT1 spans about 10 kb, is split into 10 exons of varying length, and encodes a protein of 428 amino acids ({approximately}48 kDa). Human and pig BAT1 cDNAs display 95.6% identity in the coding region and 80% identity in the 5{prime} and 3{prime} noncoding regions. Several repeat sequences of different types were identified in introns of the porcine BAT1 gene. Three different mRNAs, 4.1,1.7, and 0.9 kb, respectively, were detected in all tissues analyzed upon hybridization with porcine BAT1 cDNA. Transfection and expression of human BAT1 cDNA after tagging with a heterologous antibody recognition epitope revealed a nuclear localization of the hybrid protein. An MspI RFLP was detected in an SLA class I typed family, confirming the localization of the BAT1 gene in the porcine MHC. BAT1 thus encodes a putative nuclear ATP-dependent RNA helicase and is likely to have an indispensable function. 35 refs., 6 figs., 1 tab.

  15. Expression analysis of an evolutionarily conserved alternative splicing factor, Sfrs10, in age-related macular degeneration.

    Directory of Open Access Journals (Sweden)

    Devi Krishna Priya Karunakaran

    Full Text Available Age-related macular degeneration (AMD is the most common cause of blindness in the elderly population. Hypoxic stress created in the micro-environment of the photoreceptors is thought to be the underlying cause that results in the pathophysiology of AMD. However, association of AMD with alternative splicing mediated gene regulation is not well explored. Alternative Splicing is one of the primary mechanisms in humans by which fewer protein coding genes are able to generate a vast proteome. Here, we investigated the expression of a known stress response gene and an alternative splicing factor called Serine-Arginine rich splicing factor 10 (Sfrs10. Sfrs10 is a member of the serine-arginine (SR rich protein family and is 100% identical at the amino acid level in most mammals. Immunoblot analysis on retinal extracts from mouse, rat, and chicken showed a single immunoreactive band. Further, immunohistochemistry on adult mouse, rat and chicken retinae showed pan-retinal expression. However, SFRS10 was not detected in normal human retina but was observed as distinct nuclear speckles in AMD retinae. This is in agreement with previous reports that show Sfrs10 to be a stress response gene, which is upregulated under hypoxia. The difference in the expression of Sfrs10 between humans and lower mammals and the upregulation of SFRS10 in AMD is further reflected in the divergence of the promoter sequence between these species. Finally, SFRS10+ speckles were independent of the SC35+ SR protein speckles or the HSF1+ stress granules. In all, our data suggests that SFRS10 is upregulated and forms distinct stress-induced speckles and might be involved in AS of stress response genes in AMD.

  16. An evolutionarily conserved arginine is essential for Tre1 G protein-coupled receptor function during germ cell migration in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Angela R Kamps

    Full Text Available BACKGROUND: G protein-coupled receptors (GPCRs play central roles in mediating cellular responses to environmental signals leading to changes in cell physiology and behaviors, including cell migration. Numerous clinical pathologies including metastasis, an invasive form of cell migration, have been linked to abnormal GPCR signaling. While the structures of some GPCRs have been defined, the in vivo roles of conserved amino acid residues and their relationships to receptor function are not fully understood. Trapped in endoderm 1 (Tre1 is an orphan receptor of the rhodopsin class that is necessary for primordial germ cell migration in Drosophila melanogaster embryos. In this study, we employ molecular genetic approaches to identify residues in Tre1 that are critical to its functions in germ cell migration. METHODOLOGY/PRINCIPAL FINDINGS: First, we show that the previously reported scattershot mutation is an allele of tre1. The scattershot allele results in an in-frame deletion of 8 amino acids at the junction of the third transmembrane domain and the second intracellular loop of Tre1 that dramatically impairs the function of this GPCR in germ cell migration. To further refine the molecular basis for this phenotype, we assayed the effects of single amino acid substitutions in transgenic animals and determined that the arginine within the evolutionarily conserved E/N/DRY motif is critical for receptor function in mediating germ cell migration within an intact developing embryo. CONCLUSIONS/SIGNIFICANCE: These structure-function studies of GPCR signaling in native contexts will inform future studies into the basic biology of this large and clinically important family of receptors.

  17. Subcellular targeting of an evolutionarily conserved plant defensin MtDef4.2 determines the outcome of plant-pathogen interaction in transgenic Arabidopsis.

    Science.gov (United States)

    Kaur, Jagdeep; Thokala, Mercy; Robert-Seilaniantz, Alexandre; Zhao, Patrick; Peyret, Hadrien; Berg, Howard; Pandey, Sona; Jones, Jonathan; Shah, Dilip

    2012-12-01

    The Medicago truncatula gene encoding an evolutionarily conserved antifungal defensin MtDef4.2 was cloned and characterized. In silico expression analysis indicated that MtDef4.2 is expressed in many tissues during the normal growth and development of M. truncatula. MtDef4.2 exhibits potent broad-spectrum antifungal activity against various Fusarium spp. Transgenic Arabidopsis thaliana lines in which MtDef4.2 was targeted to three different subcellular compartments were generated. These lines were tested for resistance to the obligate biotrophic oomycete Hyaloperonospora arabidopsidis Noco2 and the hemibiotrophic fungal pathogen Fusarium graminearum PH-1. MtDef4.2 directed to the extracellular space, but not to the vacuole or retained in the endoplasmic reticulum, conferred robust resistance to H. arabidopsidis. Siliques of transgenic Arabidopsis lines expressing either extracellularly or intracellularly targeted MtDef4.2 displayed low levels of resistance to F. graminearum, but accumulated substantially reduced levels of the mycotoxin deoxynivalenol. The data presented here suggest that extracellularly targeted MtDef4.2 is sufficient to provide strong resistance to the biotrophic oomycete, consistent with the extracellular lifestyle of this pathogen. However, the co-expression of extracellular and intracellular MtDef4.2 is probably required to achieve strong resistance to the hemibiotrophic pathogen F. graminearum which grows extracellularly and intracellularly. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

  18. CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3.

    Science.gov (United States)

    Evans, Timothy A

    2017-01-01

    Axon guidance receptors of the Roundabout (Robo) family regulate a number of axon guidance outcomes in bilaterian animals in addition to their canonical role in Slit-dependent midline repulsion. In the fruit fly Drosophila melanogaster, three Robo paralogs (Robo1, Robo2, and Robo3) each have specialized roles in regulating midline crossing and the formation of longitudinal axon pathways in the embryonic ventral nerve cord. The number of robo genes differs in other insects, and it is unknown whether the roles and/or signaling mechanisms of Drosophila Robos are shared in other insect species. To directly compare the axon guidance activities of Robo receptors in Drosophila and the flour beetle Tribolium castaneum, I have used a CRISPR/Cas9-based approach to replace Drosophila robo3 with Tribolium robo2/3. I show that when expressed from the robo3 locus in Drosophila embryos, Tribolium Robo2/3 (TcRobo2/3) protein is properly translated and localized to axons, where it reproduces the normal expression pattern of Drosophila Robo3. In embryos expressing TcRobo2/3 in place of robo3, two distinct subsets of longitudinal axons are guided properly to their normal positions in the intermediate neuropile, indicating that TcRobo2/3 can promote Robo3-dependent axon guidance decisions in developing Drosophila neurons. These observations suggest that the mechanism by which Drosophila Robo3 promotes longitudinal pathway formation is evolutionarily conserved in Tribolium, where it is performed by TcRobo2/3. The CRISPR/Cas9-based gene replacement approach described here can be applied to comparative evolutionary developmental studies of other Drosophila genes and their orthologs in other species.

  19. CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3

    Directory of Open Access Journals (Sweden)

    Timothy A. Evans

    2017-06-01

    Full Text Available Abstract Background Axon guidance receptors of the Roundabout (Robo family regulate a number of axon guidance outcomes in bilaterian animals in addition to their canonical role in Slit-dependent midline repulsion. In the fruit fly Drosophila melanogaster, three Robo paralogs (Robo1, Robo2, and Robo3 each have specialized roles in regulating midline crossing and the formation of longitudinal axon pathways in the embryonic ventral nerve cord. The number of robo genes differs in other insects, and it is unknown whether the roles and/or signaling mechanisms of Drosophila Robos are shared in other insect species. To directly compare the axon guidance activities of Robo receptors in Drosophila and the flour beetle Tribolium castaneum, I have used a CRISPR/Cas9-based approach to replace Drosophila robo3 with Tribolium robo2/3. Results I show that when expressed from the robo3 locus in Drosophila embryos, Tribolium Robo2/3 (TcRobo2/3 protein is properly translated and localized to axons, where it reproduces the normal expression pattern of Drosophila Robo3. In embryos expressing TcRobo2/3 in place of robo3, two distinct subsets of longitudinal axons are guided properly to their normal positions in the intermediate neuropile, indicating that TcRobo2/3 can promote Robo3-dependent axon guidance decisions in developing Drosophila neurons. Conclusions These observations suggest that the mechanism by which Drosophila Robo3 promotes longitudinal pathway formation is evolutionarily conserved in Tribolium, where it is performed by TcRobo2/3. The CRISPR/Cas9-based gene replacement approach described here can be applied to comparative evolutionary developmental studies of other Drosophila genes and their orthologs in other species.

  20. Peptides derived from evolutionarily conserved domains in Beclin-1 and Beclin-2 enhance the entry of lentiviral vectors into human cells.

    Science.gov (United States)

    Majdoul, Saliha; Cosette, Jeremie; Seye, Ababacar K; Bernard, Eric; Frin, Sophie; Holic, Nathalie; Chazal, Nathalie; Briant, Laurence; Espert, Lucile; Galy, Anne; Fenard, David

    2017-11-10

    Autophagy-related proteins such as Beclin-1 are involved in an array of complex processes, including antiviral responses, and may also modulate the efficiency of gene therapy viral vectors. The Tat-Beclin-1 (TB1) peptide has been reported as an autophagy-inducing factor inhibiting the replication of pathogens such as HIV, type 1 (HIV-1). However, autophagy-related proteins are also essential for the early steps of HIV-1 infection. Therefore, we examined the effects of the Beclin-1 evolutionarily conserved domain in TB1 on viral transduction and autophagy in single-round HIV infection or with nonreplicative HIV-1-derived lentiviral vectors. TB1 enhanced transduction with various pseudotypes but without inducing the autophagy process. TB1 augmented the transduction of human CD34+ hematopoietic stem/progenitor cells while maintaining their capacity to engraft in vivo into humanized mice. TB1 was as effective as other transduction additives and functioned by enhancing the adhesion and fusion of viral particles with target cells but not their aggregation. We also found that the N-terminal L1 loop was critical for TB1 transduction-enhancing activity. Interestingly, the Tat-Beclin-2 (TB2) peptide, derived from the human Beclin-2 protein, was even more potent than TB1 in promoting viral transduction and infection. Taken together, our findings suggest that the TB1 and TB2 peptides enhance the viral entry step. Tat-Beclin peptides therefore represent a new family of viral transduction enhancers for potential use in gene therapy. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Conservation of AtTZF1, AtTZF2 and AtTZF3 homolog gene regulation by salt stress in evolutionarily distant plant species

    Directory of Open Access Journals (Sweden)

    Fabio eD'Orso

    2015-06-01

    Full Text Available Arginine-rich tandem zinc-finger proteins (RR-TZF participate in a wide range of plant developmental processes and adaptive responses to abiotic stress, such as cold, salt and drought. This study investigates the conservation of the genes AtTZF1-5 at the level of their sequences and expression across plant species. The genomic sequences of the two RR-TZF genes TdTZF1-A and TdTZF1-B were isolated in durum wheat and assigned to chromosomes 3A and 3B, respectively. Sequence comparisons revealed that they encode proteins that are highly homologous to AtTZF1, AtTZF2 and AtTZF3. The expression profiles of these RR-TZF durum wheat and Arabidopsis proteins support a common function in the regulation of seed germination and responses to abiotic stress. In particular, analysis of plants with attenuated and overexpressed AtTZF3 indicate that AtTZF3 is a negative regulator of seed germination under conditions of salt stress. Finally, comparative sequence analyses establish that the RR-TZF genes are encoded by lower plants, including the bryophyte Physcomitrella patens and the alga Chlamydomonas reinhardtii. The regulation of the Physcomitrella AtTZF1-2-3-like genes by salt stress strongly suggests that a subgroup of the RR-TZF proteins has a function that has been conserved throughout evolution.

  2. Evolutionary discrimination of mammalian conserved non-genic sequences (CNGs)

    NARCIS (Netherlands)

    Dermitzakis, ET; Reymond, A; Scamuffa, N; Ucla, C; Kirkness, E; Rossier, C; Antonarakis, SE

    2003-01-01

    Analysis of the human and mouse genomes identified an abundance of conserved non-genic sequences (CNGs). The significance and evolutionary depth of their conservation remain unanswered. We have quantified levels and patterns of conservation of 191 CNGs of human chromosome 21 in 14 mammalian species.

  3. Phylogenetically Conserved Sequences Around Myelin P0 Stop Codon are Essential for Translational Readthrough to Produce L-MPZ.

    Science.gov (United States)

    Yamaguchi, Yoshihide; Baba, Hiroko

    2018-01-01

    Myelin protein zero (P0, MPZ) is the main cell adhesion molecule in peripheral myelin, the sequence of which is evolutionarily highly conserved. Large myelin protein zero (L-MPZ) is a novel translational readthrough molecule in mammals in a physiological status and is encoded by the P0 mRNA with an extra domain. The sequence similarities in the L-MPZ-specific region are found in humans and frogs but not in fish P0 cDNA. Actual synthesis of L-MPZ has been detected in rat and mouse sciatic nerve but not yet evaluated in frogs and humans. The production mechanism and physiological functions of L-MPZ remain unknown. Additionally, the sequence context around the canonical stop codon is significant for readthrough in viruses and yeast, but the correlation between the sequence around P0 stop codon and L-MPZ synthesis is unclear. Here, we focused on the phylogenetic pathways in L-MPZ synthesis. We have shown that L-MPZ is widely produced from frogs to humans using western blotting against L-MPZ. Mutation analysis of the sequence around the stop codon for L-MPZ synthesis using a mammalian in vitro transcription/translation system revealed that the evolutionarily conserved sequence around P0 stop codon is susceptible to readthrough and is similar to the consensus motif in viruses and yeast UAG stop codon type molecules. Our results demonstrate that the phylogenetically conserved sequence around the canonical P0 stop codon is essential for L-MPZ synthesis, suggesting that phylogenetic emergence of L-MPZ in amphibians may be related to particular distribution and/or function in the PNS myelin.

  4. Variation in conserved non-coding sequences on chromosome 5q and susceptibility to asthma and atopy

    Directory of Open Access Journals (Sweden)

    Dubchak Inna

    2005-12-01

    Full Text Available Abstract Background Evolutionarily conserved sequences likely have biological function. Methods To determine whether variation in conserved sequences in non-coding DNA contributes to risk for human disease, we studied six conserved non-coding elements in the Th2 cytokine cluster on human chromosome 5q31 in a large Hutterite pedigree and in samples of outbred European American and African American asthma cases and controls. Results Among six conserved non-coding elements (>100 bp, >70% identity; human-mouse comparison, we identified one single nucleotide polymorphism (SNP in each of two conserved elements and six SNPs in the flanking regions of three conserved elements. We genotyped our samples for four of these SNPs and an additional three SNPs each in the IL13 and IL4 genes. While there was only modest evidence for association with single SNPs in the Hutterite and European American samples (P IL4 gene (P IL13 gene was strongly associated with total IgE (P = 0.00022 and allergic sensitization to mold allergens (P = 0.00076 in the Hutterites, and more modestly associated with sensitization to molds in the European Americans and African Americans (P Conclusion These results indicate that there is overall little variation in the conserved non-coding elements on 5q31, but variation in IL4 and IL13, including possibly one SNP in a conserved element, influence asthma and atopic phenotypes in diverse populations.

  5. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    Energy Technology Data Exchange (ETDEWEB)

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole

    2005-09-10

    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  6. An evolutionarily conserved mitochondrial orf108 is associated with cytoplasmic male sterility in different alloplasmic lines of Brassica juncea and induces male sterility in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Kumar, Pankaj; Vasupalli, Naresh; Srinivasan, R; Bhat, Shripad R

    2012-05-01

    Nuclear-mitochondrial gene interactions governing cytoplasmic male sterility (CMS) in angiosperms have been found to be unique to each system. Fertility restoration of three diverse alloplasmic CMS lines of Brassica juncea by a line carrying the fertility-restorer gene introgressed from Moricandia arvensis prompted this investigation to examine the molecular basis of CMS in these lines. Since previous studies had found altered atpA transcription associated with CMS in these lines, the atpA genes and transcripts of CMS, fertility-restored, and euplasmic lines were cloned and compared. atpA coding and downstream sequences were conserved among CMS and euplasmic lines but major differences were found in the 5' flanking sequences of atpA. A unique open reading frame (ORF), orf108, co-transcribed with atpA, was found in male sterile flowers of CMS lines carrying mitochondrial genomes of Diplotaxis berthautii, D. catholica, or D. erucoides. In presence of the restorer gene, the bicistronic orf108-atpA transcript was cleaved within orf108 to yield a monocistronic atpA transcript. Transgenic expression of orf108 with anther-specific Atprx18 promoter in Arabidopsis thaliana gave 50% pollen sterility, indicating that Orf108 is lethal at the gametophytic stage. Further, lack of transmission of orf108 to the progeny showed for the first time that mitochondrial ORFs could also cause female sterility. orf108 was found to be widely distributed among wild relatives of Brassica, indicating its ancient origin. This is the first report that shows that CMS lines of different origin and morphology could share common molecular basis. The gametic lethality of Orf108 offers a novel opportunity for transgene containment.

  7. Sequencing and genomic annotation of the chicken (Gallus gallus) hox clusters and mapping of evolutionarily conserved regions

    NARCIS (Netherlands)

    Richardson, M.K.; Crooijmans, R.P.M.A.; Groenen, M.A.M.

    2007-01-01

    Hox genes encode transcription factors that are involved in the regulation of normal development and are mutated in some diseases and malformations. Chicken HOX genes have been extensively studied in the chick limb and other developmental models. To date while the chicken HOXA cluster has been

  8. Conserved hypothetical protein Rv1977 in Mycobacterium tuberculosis strains contains sequence polymorphisms and might be involved in ongoing immune evasion.

    Science.gov (United States)

    Jiang, Yi; Liu, Haican; Wang, Xuezhi; Li, Guilian; Qiu, Yan; Dou, Xiangfeng; Wan, Kanglin

    2015-01-01

    Host immune pressure and associated parasite immune evasion are key features of host-pathogen co-evolution. A previous study showed that human T cell epitopes of Mycobacterium tuberculosis are evolutionarily hyperconserved and thus it was deduced that M. tuberculosis lacks antigenic variation and immune evasion. Here, we selected 151 clinical Mycobacterium tuberculosis isolates from China, amplified gene encoding Rv1977 and compared the sequences. The results showed that Rv1977, a conserved hypothetical protein, is not conserved in M. tuberculosis strains and there are polymorphisms existed in the protein. Some mutations, especially one frameshift mutation, occurred in the antigen Rv1977, which is uncommon in M.tb strains and may lead to the protein function altering. Mutations and deletion in the gene all affect one of three T cell epitopes and the changed T cell epitope contained more than one variable position, which may suggest ongoing immune evasion.

  9. The conservation of mitochondrial genome sequence in Leucadendron (Proteaceae

    Directory of Open Access Journals (Sweden)

    MADE PHARMAWATI

    2012-04-01

    Full Text Available Pharmawati M, Yan G, Finnegan PM. 2012. The conservation of mitochondrial genome sequence in Leucadendron (Proteaceae. Biodiversitas 13: 00-00. Mitochondrial DNA (mtDNA is useful for developing molecular markers and for studying plant phylogeny. However, its usefulness depends on the degree of detectable sequence variation. In seven species of the genus Leucadendron, PCR-RFLP failed to reveal any polymorphisms in seven separate regions of the mtDNA. Sixty-two primer pair - enzyme combinations were used to assay at least 248 restriction sites, resulting in the direct sampling of a minimum of 992 bp across 17,500 bp of mt DNA. The highly conserved nature of the mtDNA sequence in the genus Leucadendron was confirmed by the absence of sequence variation in the 1434 bp mtDNA nad1/B-C intron across these species. Mitochondrial DNA sequences are more highly conserved than the chloroplast DNA sequences in Leucadendron and the mtDNA sequences in many other plant genera. Phylogenetic analysis using this intron sequence was consistent with other phylogenetic analyses in regard to the position of Proteaceae.

  10. Sequence conservation of an avian centromeric repeated DNA component.

    Science.gov (United States)

    Madsen, C S; Brooks, J E; de Kloet, E; de Kloet, S R

    1994-06-01

    The approximately 190-bp centromeric repeat monomers of the spur-winged lapwing (Vanellus spinosus, Charadriidae), the Chilean flamingo (Phoenicopterus chilensis, Phoenicopteridae), the sarus crane (Grus antigone, Gruidae), parrots (Psittacidae), waterfowl (Anatidae), and the merlin (Falco columbarius, Falconidae) contain elements that are interspecifically highly variable, as well as elements (trinucleotides and higher order oligonucleotides) that are highly conserved in sequence and relative location within the repeat. Such conservation suggests that the centromeric repeats of these avian species have evolved from a common ancestral sequence that may date from very early stages of avian radiation.

  11. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

    National Research Council Canada - National Science Library

    Kristopher J. L. Irizarry; Randall L. Bryden

    2016-01-01

    .... We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation...

  12. Conservation of polymorphic simple sequence loci in cetacean species.

    Science.gov (United States)

    Schlötterer, C; Amos, B; Tautz, D

    1991-11-07

    Length polymorphisms within simple-sequence loci occur ubiquitously in non-coding eukaryotic DNA and can be highly informative in the analysis of natural populations. Simple-sequence length polymorphisms (SSLP) in the long-finned pilot whale Globicephala melas (Delphinidae) have provided useful information on the mating system as well as on the genetic structure of populations. We have therefore tested whether the polymerase chain reaction primers designed for Globicephala could also be used to uncover variability in other whale species. Homologous loci could indeed be amplified from a diverse range of whales, including all toothed (Odontoceti) and baleen whales (Mysticeti) tested. Cloning and sequencing these loci from 11 different species revealed an unusually high conservation of sequences flanking the simple-sequence stretches, averaging 3.2% difference over 35-40 Myr. This represents the lowest divergence rate for neutral nucleotide positions found for any species group so far and raises the possible need for a re-evaluation of the age of the modern whales. On the other hand, the high conservation of non-coding sequences in whales simplifies the application of SSLP DNA fingerprinting in cetacean species, as primers designed for one species will often uncover variability in other species.

  13. Conservation of MHC class II DOA sequences among carnivores.

    Science.gov (United States)

    Soll, S J; Stewart, B S; Lehman, N

    2005-03-01

    We obtained the nucleotide sequence for most of the major histocompatibility complex (MHC) class II DOA locus for Weddell, leopard, northern elephant, and southern elephant seals and from the coyote and compared them to all known DOA data available to date. We found generally low levels of interspecific polymorphisms, providing further support for stabilizing selection acting on the DOA locus. This suggests that DO gene products play a substantial functional role in the regulation of antigen presentation. A seven-amino-acid motif of VWRLPEF was found to be conserved across all DOA sequences and may be a DO-specific recognition element.

  14. Internal epitope tagging informed by relative lack of sequence conservation.

    Science.gov (United States)

    Burg, Leonard; Zhang, Karen; Bonawitz, Tristan; Grajevskaja, Viktorija; Bellipanni, Gianfranco; Waring, Richard; Balciunas, Darius

    2016-11-28

    Many experimental techniques rely on specific recognition and stringent binding of proteins by antibodies. This can readily be achieved by introducing an epitope tag. We employed an approach that uses a relative lack of evolutionary conservation to inform epitope tag site selection, followed by integration of the tag-coding sequence into the endogenous locus in zebrafish. We demonstrate that an internal epitope tag is accessible for antibody binding, and that tagged proteins retain wild type function.

  15. Internal epitope tagging informed by relative lack of sequence conservation

    OpenAIRE

    Leonard Burg; Karen Zhang; Tristan Bonawitz; Viktorija Grajevskaja; Gianfranco Bellipanni; Richard Waring; Darius Balciunas

    2016-01-01

    Many experimental techniques rely on specific recognition and stringent binding of proteins by antibodies. This can readily be achieved by introducing an epitope tag. We employed an approach that uses a relative lack of evolutionary conservation to inform epitope tag site selection, followed by integration of the tag-coding sequence into the endogenous locus in zebrafish. We demonstrate that an internal epitope tag is accessible for antibody binding, and that tagged proteins retain wild type ...

  16. Identification, chromosomal arrangements and expression analyses of the evolutionarily conserved prmt1 gene in chicken in comparison with its vertebrate paralogue prmt8.

    Directory of Open Access Journals (Sweden)

    Yi-Chun Wang

    Full Text Available Nine protein arginine methyltransferases (PRMTs are conserved in mammals and fish. Among these, PRMT1 is the major type I PRMT for asymmetric dimethylarginine (ADMA formation and is the most conserved and widely distributed one. Two chicken prmt1 splicing variants were assembled and confirmed by RT-PCR experiments. However, only two scaffolds containing single separate prmt1 exon with high GC contents are present in the current chicken genome assembly. Besides, prmt1 exons are scattered in separate small scaffolds in most avian species. Complete prmt1 gene has only been predicted from two falcon species with few neighboring genes. Crocodilians are considered close to the common ancestor shared by crocodilians and birds. The gene arrangements around prmt1 in American alligator are different from that in birds but are largely conserved in human. Orthologues of genes in a large segment of human chromosomal 19 around PRMT1 are missing or not assigned to the current chicken chromosomes. In comparison, prmt8, the prmt1 paralogue, is on chicken chromosome 1 with the gene arrangements downstream of prmt8 highly conserved in birds, crocodilians, and human. However, the ones upstream vary greatly in birds. Biochemically, we found that though prmt1 transcripts were detected, limited or none PRMT1 protein was present in chicken tissues. Moreover, a much higher level of PRMT8 protein was detected in chicken brain than in mouse brain. While PRMT8 is brain specific in other vertebrate species studied, low level of PRMT8 was present in chicken but not mouse liver and muscle. We also showed that the ADMA level in chicken was similar to that in mouse. This study provides the critical information of chicken PRMT1 and PRMT8 for future analyses of the function of protein arginine methyltransferases in birds.

  17. Identification, chromosomal arrangements and expression analyses of the evolutionarily conserved prmt1 gene in chicken in comparison with its vertebrate paralogue prmt8.

    Science.gov (United States)

    Wang, Yi-Chun; Wang, Chien-Wen; Lin, Wen-Chang; Tsai, Yun-Jung; Chang, Chien-Ping; Lee, Yu-Jen; Lin, Min-Jon; Li, Chuan

    2017-01-01

    Nine protein arginine methyltransferases (PRMTs) are conserved in mammals and fish. Among these, PRMT1 is the major type I PRMT for asymmetric dimethylarginine (ADMA) formation and is the most conserved and widely distributed one. Two chicken prmt1 splicing variants were assembled and confirmed by RT-PCR experiments. However, only two scaffolds containing single separate prmt1 exon with high GC contents are present in the current chicken genome assembly. Besides, prmt1 exons are scattered in separate small scaffolds in most avian species. Complete prmt1 gene has only been predicted from two falcon species with few neighboring genes. Crocodilians are considered close to the common ancestor shared by crocodilians and birds. The gene arrangements around prmt1 in American alligator are different from that in birds but are largely conserved in human. Orthologues of genes in a large segment of human chromosomal 19 around PRMT1 are missing or not assigned to the current chicken chromosomes. In comparison, prmt8, the prmt1 paralogue, is on chicken chromosome 1 with the gene arrangements downstream of prmt8 highly conserved in birds, crocodilians, and human. However, the ones upstream vary greatly in birds. Biochemically, we found that though prmt1 transcripts were detected, limited or none PRMT1 protein was present in chicken tissues. Moreover, a much higher level of PRMT8 protein was detected in chicken brain than in mouse brain. While PRMT8 is brain specific in other vertebrate species studied, low level of PRMT8 was present in chicken but not mouse liver and muscle. We also showed that the ADMA level in chicken was similar to that in mouse. This study provides the critical information of chicken PRMT1 and PRMT8 for future analyses of the function of protein arginine methyltransferases in birds.

  18. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  19. CREDO: a web-based tool for computational detection of conserved sequence motifs in noncoding sequences.

    Science.gov (United States)

    Hindemitt, Tobias; Mayer, Klaus F X

    2005-12-01

    CREDO is a user-friendly, web-based tool that integrates the analysis and results of different algorithms widely used for the computational detection of conserved sequence motifs in noncoding sequences. It enables easy comparison of the individual results. CREDO offers intuitive interfaces for easy and rapid configuration of the applied algorithms and convenient views on the results in graphical and tabular formats. http://mips.gsf.de/proj/regulomips/credo.htm.

  20. In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

    Energy Technology Data Exchange (ETDEWEB)

    Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.

    2006-02-01

    The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

  1. Isolation and functional analysis of CONSTANS-LIKE genes suggests that a central role for CONSTANS in flowering time control is not evolutionarily conserved in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Albert eWong

    2014-09-01

    Full Text Available The zinc finger transcription factor CONSTANS has a well-established central role in the mechanism for photoperiod sensing in Arabidopsis, integrating light and circadian clock signals to upregulate the florigen gene FT under long-day but not short-day conditions. Although CONSTANS-like (COL genes in other species have also been shown to regulate flowering time, it is not clear how widely this central role in photoperiod sensing is conserved.Legumes are a major plant group and various legume species show significant natural variation for photoperiod responsive flowering. Orthologs of several Arabidopsis genes have been shown to participate in photoperiodic flowering in legumes, but the possible function of COL genes as integrators of the photoperiod response has not yet been examined in detail. Here we characterize the COL family in the temperate long-day legume Medicago truncatula, using expression analyses, reverse genetics, transient activation assays and Arabidopsis transformation. Our results provide several lines of evidence suggesting that COL genes are unlikely to have a central role in the photoperiod response mechanism in this species.

  2. Strigolactone biosynthesis is evolutionarily conserved, regulated by phosphate starvation and contributes to resistance against phytopathogenic fungi in a moss, Physcomitrella patens

    KAUST Repository

    Decker, Eva L.

    2017-03-06

    In seed plants, strigolactones (SLs) regulate architecture and induce mycorrhizal symbiosis in response to environmental cues. SLs are formed by combined activity of the carotenoid cleavage dioxygenases (CCDs) 7 and 8 from 9-cis-β-carotene, leading to carlactone that is converted by cytochromes P450 (clade 711; MAX1 in Arabidopsis) into various SLs. As Physcomitrella patens possesses CCD7 and CCD8 homologs but lacks MAX1, we investigated if PpCCD7 together with PpCCD8 form carlactone and how deletion of these enzymes influences growth and interactions with the environment. We investigated the enzymatic activity of PpCCD7 and PpCCD8 in vitro, identified the formed products by high performance liquid chromatography (HPLC) and LC-MS, and generated and analysed ΔCCD7 and ΔCCD8 mutants. We defined enzymatic activity of PpCCD7 as a stereospecific 9-cis-CCD and PpCCD8 as a carlactone synthase. ΔCCD7 and ΔCCD8 lines showed enhanced caulonema growth, which was revertible by adding the SL analogue GR24 or carlactone. Wild-type (WT) exudates induced seed germination in Orobanche ramosa. This activity was increased upon phosphate starvation and abolished in exudates of both mutants. Furthermore, both mutants showed increased susceptibility to phytopathogenic fungi. Our study reveals the deep evolutionary conservation of SL biosynthesis, SL function, and its regulation by biotic and abiotic cues.

  3. Strigolactone biosynthesis is evolutionarily conserved, regulated by phosphate starvation and contributes to resistance against phytopathogenic fungi in a moss, Physcomitrella patens.

    Science.gov (United States)

    Decker, Eva L; Alder, Adrian; Hunn, Stefan; Ferguson, Jenny; Lehtonen, Mikko T; Scheler, Bjoern; Kerres, Klaus L; Wiedemann, Gertrud; Safavi-Rizi, Vajiheh; Nordzieke, Steffen; Balakrishna, Aparna; Baz, Lina; Avalos, Javier; Valkonen, Jari P T; Reski, Ralf; Al-Babili, Salim

    2017-10-01

    In seed plants, strigolactones (SLs) regulate architecture and induce mycorrhizal symbiosis in response to environmental cues. SLs are formed by combined activity of the carotenoid cleavage dioxygenases (CCDs) 7 and 8 from 9-cis-β-carotene, leading to carlactone that is converted by cytochromes P450 (clade 711; MAX1 in Arabidopsis) into various SLs. As Physcomitrella patens possesses CCD7 and CCD8 homologs but lacks MAX1, we investigated if PpCCD7 together with PpCCD8 form carlactone and how deletion of these enzymes influences growth and interactions with the environment. We investigated the enzymatic activity of PpCCD7 and PpCCD8 in vitro, identified the formed products by high performance liquid chromatography (HPLC) and LC-MS, and generated and analysed ΔCCD7 and ΔCCD8 mutants. We defined enzymatic activity of PpCCD7 as a stereospecific 9-cis-CCD and PpCCD8 as a carlactone synthase. ΔCCD7 and ΔCCD8 lines showed enhanced caulonema growth, which was revertible by adding the SL analogue GR24 or carlactone. Wild-type (WT) exudates induced seed germination in Orobanche ramosa. This activity was increased upon phosphate starvation and abolished in exudates of both mutants. Furthermore, both mutants showed increased susceptibility to phytopathogenic fungi. Our study reveals the deep evolutionary conservation of SL biosynthesis, SL function, and its regulation by biotic and abiotic cues. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  4. The wheat Mla homologue TmMla1 exhibits an evolutionarily conserved function against powdery mildew in both wheat and barley.

    Science.gov (United States)

    Jordan, Tina; Seeholzer, Sabine; Schwizer, Simon; Töller, Armin; Somssich, Imre E; Keller, Beat

    2011-02-01

    The race-specific barley powdery mildew (Blumeria graminis f. sp. hordei) resistance gene Mla occurs as an allelic series and encodes CC-NB-LRR type resistance proteins. Inter-generic allele mining resulted in the isolation and characterisation of an Mla homologue from diploid wheat, designated TmMla1, which shares 78% identity with barley HvMLA1 at the protein level. TmMla1 was found to be a functional resistance gene against Blumeria graminis f. sp. tritici in wheat, hereby providing an example of R gene orthologs controlling the same disease in two different species. TmMLA1 exhibits race-specific resistance activity and its N-terminal coiled-coil domain interacts with the barley transcription factor HvWRKY1. Interestingly, TmMLA1 was not functional in barley transient assays. Replacement of the TmMLA1 LRR domain with that of HvMLA1 revealed that this fusion protein conferred resistance against B. graminis f. sp. hordei isolate K1 in barley. Thus, TmMLA1 not only confers resistance in wheat but possibly also in barley against an as yet unknown barley powdery mildew race. The conservation of functional R gene orthologs over at least 12 million years is surprising given the observed rapid breakdown of Mla-based resistance against barley mildew in agricultural ecosystems. This suggests a high stability of Mla resistance in the natural environment before domestication. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  5. C13C4.5/Spinster, an evolutionarily conserved protein that regulates fertility in C. elegans through a lysosome-mediated lipid metabolism process.

    Science.gov (United States)

    Han, Mei; Chang, Hao; Zhang, Peng; Chen, Tao; Zhao, Yanhua; Zhang, Yongdeng; Liu, Pingsheng; Xu, Tao; Xu, Pingyong

    2013-05-01

    Lipid droplets, which are conserved across almost all species, are cytoplasmic organelles used to store neutral lipids. Identification of lipid droplet regulators will be conducive to resolving obesity and other fat-associated diseases. In this paper, we selected 11 candidates that might be associated with lipid metabolism in Caenorhabditis elegans. Using a BODIPY 493/503-based flow cytometry screen, 6 negative and 3 positive regulators of fat content were identified. We selected one negative regulator of lipid content, C13C4.5, for future study. C13C4.5 was mainly expressed in the worm intestine. We found that this gene was important for maintaining the metabolism of lipid droplets. Biochemical results revealed that 50% of triacylglycerol (TAG) was lost in C13C4.5 knockout worms. Stimulated Raman scattering (SRS) signals in C13C4.5 mutants showed only 49.6% of the fat content in the proximal intestinal region and 86.3% in the distal intestinal region compared with wild type animals. The mean values of lipid droplet size and intensity in C13C4.5 knockout animals were found to be significantly decreased compared with those in wild type worms. The LMP-1-labeled membrane structures in worm intestines were also enlarged in C13C4.5 mutant animals. Finally, fertility defects were found in C13C4.5(ok2087) mutants. Taken together, these results indicate that C13C4.5 may regulate the fertility of C. elegans by changing the size and fat content of lipid droplets by interfering with lysosomal morphology and function.

  6. Nucleotide sequence conservation in paramyxoviruses; the concept of codon constellation.

    Science.gov (United States)

    Rima, Bert K

    2015-05-01

    The stability and conservation of the sequences of RNA viruses in the field and the high error rates measured in vitro are paradoxical. The field stability indicates that there are very strong selective constraints on sequence diversity. The nature of these constraints is discussed. Apart from constraints on variation in cis-acting RNA and the amino acid sequences of viral proteins, there are other ones relating to the presence of specific dinucleotides such CpG and UpA as well as the importance of RNA secondary structures and RNA degradation rates. Recent other constraints identified in other RNA viruses, such as effects of secondary RNA structure on protein folding or modification of cellular tRNA complements, are also discussed. Using the family Paramyxoviridae, I show that the codon usage pattern (CUP) is (i) specific for each virus species and (ii) that it is markedly different from the host - it does not vary even in vaccine viruses that have been derived by passage in a number of inappropriate host cells. The CUP might thus be an additional constraint on variation, and I propose the concept of codon constellation to indicate the informational content of the sequences of RNA molecules relating not only to stability and structure but also to the efficiency of translation of a viral mRNA resulting from the CUP and the numbers and position of rare codons. © 2015 The Authors.

  7. Tandem repeat sequences evolutionarily related to SVA-type retrotransposons are expanded in the centromere region of the western hoolock gibbon, a small ape.

    Science.gov (United States)

    Hara, Toru; Hirai, Yuriko; Jahan, Israt; Hirai, Hirohisa; Koga, Akihiko

    2012-12-01

    Hoolock hoolock (the western hoolock gibbon) is a species of the family Hylobatidae (small apes), which constitutes the superfamily Hominoidea (hominoids) together with Hominidae (great apes and human). Here, we report that centromeres or their vicinities in this gibbon species contain tandem repeat sequences that consist of 35-50-bp repeat units, and exhibit a sequence similarity with the variable number of tandem repeat (VNTR) region of the SVA, LAVA and PVA transposons. SVA is a composite retrotransposon thought to have been formed by fusion of three solo elements in the common ancestor of hominoids. LAVA and PVA are recently identified retrotransposons that have the same basic structure as SVA. Thus, the large-scale tandem repeats in the centromere region may have been derived from one or more of SVA-type transposons, including the three mentioned above and other yet unknown elements, or the repeat sequences could have served as a source for such elements. Amplification of VNTR-related sequences in another gibbon species, Hoolock leuconedys (eastern hoolock gibbon), has recently been reported, but it is yet to be examined whether the large-scale tandem repeats observed in the two species originated from a single event that occurred in their common ancestor. The repeat sequences in the western hoolock gibbon are mostly 40 kb or more in length, are present in 28 of the 38 chromosomes of the somatic cells, and are homozygous for chromosomal presence/absence.

  8. Tissue-specific DNA methylation is conserved across human, mouse, and rat, and driven by primary sequence conservation.

    Science.gov (United States)

    Zhou, Jia; Sears, Renee L; Xing, Xiaoyun; Zhang, Bo; Li, Daofeng; Rockweiler, Nicole B; Jang, Hyo Sik; Choudhary, Mayank N K; Lee, Hyung Joo; Lowdon, Rebecca F; Arand, Jason; Tabers, Brianne; Gu, C Charles; Cicero, Theodore J; Wang, Ting

    2017-09-12

    Uncovering mechanisms of epigenome evolution is an essential step towards understanding the evolution of different cellular phenotypes. While studies have confirmed DNA methylation as a conserved epigenetic mechanism in mammalian development, little is known about the conservation of tissue-specific genome-wide DNA methylation patterns. Using a comparative epigenomics approach, we identified and compared the tissue-specific DNA methylation patterns of rat against those of mouse and human across three shared tissue types. We confirmed that tissue-specific differentially methylated regions are strongly associated with tissue-specific regulatory elements. Comparisons between species revealed that at a minimum 11-37% of tissue-specific DNA methylation patterns are conserved, a phenomenon that we define as epigenetic conservation. Conserved DNA methylation is accompanied by conservation of other epigenetic marks including histone modifications. Although a significant amount of locus-specific methylation is epigenetically conserved, the majority of tissue-specific DNA methylation is not conserved across the species and tissue types that we investigated. Examination of the genetic underpinning of epigenetic conservation suggests that primary sequence conservation is a driving force behind epigenetic conservation. In contrast, evolutionary dynamics of tissue-specific DNA methylation are best explained by the maintenance or turnover of binding sites for important transcription factors. Our study extends the limited literature of comparative epigenomics and suggests a new paradigm for epigenetic conservation without genetic conservation through analysis of transcription factor binding sites.

  9. An Evolutionarily Informed Education Science

    Science.gov (United States)

    Geary, David C.

    2008-01-01

    Schools are a central interface between evolution and culture. They are the contexts in which children learn the evolutionarily novel abilities and knowledge needed to function as adults in modern societies. Evolutionary educational psychology is the study of how an evolved bias in children's learning and motivational systems influences their…

  10. The interplay of sequence conservation and T cell immune recognition

    DEFF Research Database (Denmark)

    Bresciani, Anne Gøther; Sette, Alessandro; Greenbaum, Jason

    2014-01-01

    Predicting which peptides can elicit a T cell response (i.e. are immunogenic) is of great importance for many immunological studies. While it is clear that MHC binding is a necessary requirement for peptide immunogenicity, other variables exist that are incompletely understood. In this study we...... the Immune Epitope Database with their conservation in the human microbiome. Indeed, we did see a lower immunogenicity for conserved peptides conserved. While many aspects how this conservation comparison is done require further optimization, this is a first step towards a better understanding T cell...

  11. Genome sequence analysis of solanum lycopersicum showing the phylogenetic relationship based on multiple sequence alignment and conserved domain proteins.

    OpenAIRE

    Uma kumari; Ashok kumar choudhary

    2016-01-01

    Phylogenetics analysis has become essential in researching the evolutionary relationship between sequence alignment and conserved domain protein evolutionary relationship are identified from open reading frame rather than from complete sequences.A reading frame is a set of consecutive,nucleotide ,non overlapping triplets of three consecutive nucleotide .The national center for biotechnology information NCBI provide many tools for compairing database- stored nucleotide or protein sequence,i...

  12. BlockLogo: Visualization of peptide and sequence motif conservation

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian

    2013-01-01

    , selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes...

  13. Sequence conservation between porcine and human LRRK2

    DEFF Research Database (Denmark)

    Larsen, Knud; Madsen, Lone Bruhn

    2009-01-01

     Leucine-rich repeat kinase 2 (LRRK2) is a member of the ROCO protein superfamily (Ras of complex proteins (Roc) with a C-terminal Roc domain). Mutations in the LRRK2 gene lead to autosomal dominant Parkinsonism. We have cloned the porcine LRRK2 cDNA in an attempt to characterize conserved and th...... and expression patterns are conserved across species. The porcine LRRK2 gene was mapped to chromosome 5q25. The results obtained suggest that the LRRK2 gene might be of particular interest in our attempt to generate a transgenic porcine model for Parkinson's disease...

  14. Highly conserved D-loop-like nuclear mitochondrial sequences ...

    Indian Academy of Sciences (India)

    -1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses ...

  15. Expression of evolutionarily novel genes in tumors

    OpenAIRE

    A. P. Kozlov

    2016-01-01

    The evolutionarily novel genes originated through different molecular mechanisms are expressed in tumors. Sometimes the expression of evolutionarily novel genes in tumors is highly specific. Moreover positive selection of many human tumor-related genes in primate lineage suggests their involvement in the origin of new functions beneficial to organisms. It is suggested to consider the expression of evolutionarily young or novel genes in tumors as a new biological phenomenon, a phenomenon of TS...

  16. Evolutionary placement of Xanthomonadales based on conserved protein signature sequences.

    Science.gov (United States)

    Cutiño-Jiménez, Ania M; Martins-Pinheiro, Marinalva; Lima, Wanessa C; Martín-Tornet, Alexander; Morales, Osleidys G; Menck, Carlos F M

    2010-02-01

    Xanthomonadales comprises one of the largest phytopathogenic bacterial groups, and is currently classified within the gamma-proteobacteria. However, the phylogenetic placement of this group is not clearly resolved, and the results of different studies contradict one another. In this work, the evolutionary position of Xanthomonadales was determined by analyzing the presence of shared insertions and deletions (INDELs) in highly conserved proteins. Several distinctive insertions found in most of the members of the gamma-proteobacteria are absent in Xanthomonadales and groups such as Legionelalles, Chromatiales, Methylococcales, Thiotrichales and Cardiobacteriales. These INDELs were most likely introduced after the branching of Xanthomonadales from most of the gamma-proteobacteria and provide evidence for the phylogenetic placement of the early gamma-proteobacteria. Moreover, other proteins contain insertions exclusive to the Xanthomonadales order, confirming that this is a monophyletic group and provide important specific genetic markers. Thus, the data presented clearly support the Xanthomonadales group as an independent subdivision, and constitute one of the deepest branching lineage within the gamma-proteobacteria clade. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  17. Comparative analysis of P450 signature motifs EXXR and CXG in the large and diverse kingdom of fungi: identification of evolutionarily conserved amino acid patterns characteristic of P450 family.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Cytochrome P450 monooxygenases (P450s are heme-thiolate proteins distributed across the biological kingdoms. P450s are catalytically versatile and play key roles in organisms primary and secondary metabolism. Identification of P450s across the biological kingdoms depends largely on the identification of two P450 signature motifs, EXXR and CXG, in the protein sequence. Once a putative protein has been identified as P450, it will be assigned to a family and subfamily based on the criteria that P450s within a family share more than 40% homology and members of subfamilies share more than 55% homology. However, to date, no evidence has been presented that can distinguish members of a P450 family. Here, for the first time we report the identification of EXXR- and CXG-motifs-based amino acid patterns that are characteristic of the P450 family. Analysis of P450 signature motifs in the under-explored fungal P450s from four different phyla, ascomycota, basidiomycota, zygomycota and chytridiomycota, indicated that the EXXR motif is highly variable and the CXG motif is somewhat variable. The amino acids threonine and leucine are preferred as second and third amino acids in the EXXR motif and proline and glycine are preferred as second and third amino acids in the CXG motif in fungal P450s. Analysis of 67 P450 families from biological kingdoms such as plants, animals, bacteria and fungi showed conservation of a set of amino acid patterns characteristic of a particular P450 family in EXXR and CXG motifs. This suggests that during the divergence of P450 families from a common ancestor these amino acids patterns evolve and are retained in each P450 family as a signature of that family. The role of amino acid patterns characteristic of a P450 family in the structural and/or functional aspects of members of the P450 family is a topic for future research.

  18. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    Energy Technology Data Exchange (ETDEWEB)

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.

    2006-07-06

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  19. Detection of Weakly Conserved Ancestral Mammalian RegulatorySequences by Primate Comparisons

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qian-fei; Prabhakar, Shyam; Chanan, Sumita; Cheng,Jan-Fang; Rubin, Edward M.; Boffelli, Dario

    2006-06-01

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detectcryptic functional elements, which are too weakly conserved among mammalsto distinguish from nonfunctional DNA. To address this problem, weexplored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  20. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms.

    Science.gov (United States)

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M

    2014-08-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  2. The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

    Directory of Open Access Journals (Sweden)

    Roberts Richard J

    2008-05-01

    Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

  3. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.

    Directory of Open Access Journals (Sweden)

    Kacy L Gordon

    2015-05-01

    Full Text Available Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2 from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  4. Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

    Directory of Open Access Journals (Sweden)

    Kuzin Alexander

    2008-08-01

    Full Text Available Abstract Background The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. We describe the use of EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, to characterize highly conserved sequences that are shared among co-regulating enhancers. Results Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. We have used information gained from our comparative analysis to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. Conclusion The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function.

  5. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  6. Thioredoxins in evolutionarily primitive organisms

    Science.gov (United States)

    Buchanan, B. B.

    1986-01-01

    Thioredoxins are low molecular weight redox proteins, alternating between the S-S (oxidized) and SH (reduced) states, that function in a number of biochemical processes, including DNA synthesis, DNA replication, and enzyme regulation. Until recently, reduced ferredoxin was known to serve as the source of reducing power for the reduction of thioredoxins only in oxygenic photosynthetic cells. In all other organisms, the source of hydrogen (electrons) for thioredoxin reduction was considered to be NADPH. It was found that Clostridium pasteurianum, an anaerobic organism normally living in the soil unexposed to light, resembles photosynthetic cells in using ferredoxin for the reduction of thioredoxin. The results reveal the existence of a pathway in which ferredoxin, provides the reducing power for the reduction of thioredoxin via the flavoprotein enzyme, ferredoxinthioredoxin reductase. In related studies, it was found that Chromatium vinosum, an anaerobic photosynthetic purple sulfur bacterium, resembles evolutionarily more advanced micro-organisms in having an NADP-thioredoxin system composed of a single thioredoxin which is reduced by NADPH via NADP-thioredoxin reductase. The adoption of the NADP-thioredoxin system by Chromatium seems appropriate in view of evidence tha the organi sm utilizes ATP-driven reverse electron transport. Finally, results of research directed towards the identification of target enzymes of the ferredoxin/thioredoxin system in a cyanobacterium (Nostoc muscorum), show that thioredoxin-linked photosynthetic enzymes of cyanobateria are similar to those of chloroplasts. It now seems that the ferredoxin/thioredoxin system functions in regulating CO2 assimilation via the reductive pentose phosphate cycle in oxygenic but not anoxygenic photosynthetic cells.

  7. Quantifying the relationship between sequence and three-dimensional structure conservation in RNA

    Directory of Open Access Journals (Sweden)

    Capriotti Emidio

    2010-06-01

    Full Text Available Abstract Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii evolution tends to conserve more RNA structure than sequence, and (iii there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction.

  8. Application of target capture sequencing of exons and conserved non-coding sequences to 20 inbred rat strains

    Directory of Open Access Journals (Sweden)

    Minako Yoshihara

    2016-12-01

    Full Text Available We report sequence data obtained by our recently devised target capture method TargetEC applied to 20 inbred rat strains. This method encompasses not only all annotated exons but also highly conserved non-coding sequences shared among vertebrates. The total length of the target regions covers 146.8 Mb. On an average, we obtained 31.7× depth of target coverage and identified 154,330 SNVs and 24,368 INDELs for each strain. This corresponds to 470,037 unique SNVs and 68,652 unique INDELs among the 20 strains. The sequence data can be accessed at DDBJ/EMBL/GenBank under accession number PRJDB4648, and the identified variants have been deposited at http://bioinfo.sls.kyushu-u.ac.jp/rat_target_capture/20_strains.vcf.gz.

  9. Early evolution of conserved regulatory sequences associated with development in vertebrates.

    Directory of Open Access Journals (Sweden)

    Gayle K McEwen

    2009-12-01

    Full Text Available Comparisons between diverse vertebrate genomes have uncovered thousands of highly conserved non-coding sequences, an increasing number of which have been shown to function as enhancers during early development. Despite their extreme conservation over 500 million years from humans to cartilaginous fish, these elements appear to be largely absent in invertebrates, and, to date, there has been little understanding of their mode of action or the evolutionary processes that have modelled them. We have now exploited emerging genomic sequence data for the sea lamprey, Petromyzon marinus, to explore the depth of conservation of this type of element in the earliest diverging extant vertebrate lineage, the jawless fish (agnathans. We searched for conserved non-coding elements (CNEs at 13 human gene loci and identified lamprey elements associated with all but two of these gene regions. Although markedly shorter and less well conserved than within jawed vertebrates, identified lamprey CNEs are able to drive specific patterns of expression in zebrafish embryos, which are almost identical to those driven by the equivalent human elements. These CNEs are therefore a unique and defining characteristic of all vertebrates. Furthermore, alignment of lamprey and other vertebrate CNEs should permit the identification of persistent sequence signatures that are responsible for common patterns of expression and contribute to the elucidation of the regulatory language in CNEs. Identifying the core regulatory code for development, common to all vertebrates, provides a foundation upon which regulatory networks can be constructed and might also illuminate how large conserved regulatory sequence blocks evolve and become fixed in genomic DNA.

  10. Rice pseudomolecule-anchored cross-species DNA sequence alignments indicate regional genomic variation in expressed sequence conservation

    Directory of Open Access Journals (Sweden)

    Thomas Howard

    2007-08-01

    Full Text Available Abstract Background Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences. Results A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Lolium perenne (ryegrass, Zea mays (maize, Hordeum vulgare (barley, Glycine max (soybean and Arabidopsis thaliana (thale cress was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'. Conclusion Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications.

  11. Conservation of tubulin-binding sequences in TRPV1 throughout evolution.

    Directory of Open Access Journals (Sweden)

    Puspendu Sardar

    Full Text Available Transient Receptor Potential Vanilloid sub type 1 (TRPV1, commonly known as capsaicin receptor can detect multiple stimuli ranging from noxious compounds, low pH, temperature as well as electromagnetic wave at different ranges. In addition, this receptor is involved in multiple physiological and sensory processes. Therefore, functions of TRPV1 have direct influences on adaptation and further evolution also. Availability of various eukaryotic genomic sequences in public domain facilitates us in studying the molecular evolution of TRPV1 protein and the respective conservation of certain domains, motifs and interacting regions that are functionally important.Using statistical and bioinformatics tools, our analysis reveals that TRPV1 has evolved about ∼420 million years ago (MYA. Our analysis reveals that specific regions, domains and motifs of TRPV1 has gone through different selection pressure and thus have different levels of conservation. We found that among all, TRP box is the most conserved and thus have functional significance. Our results also indicate that the tubulin binding sequences (TBS have evolutionary significance as these stretch sequences are more conserved than many other essential regions of TRPV1. The overall distribution of positively charged residues within the TBS motifs is conserved throughout evolution. In silico analysis reveals that the TBS-1 and TBS-2 of TRPV1 can form helical structures and may play important role in TRPV1 function.Our analysis identifies the regions of TRPV1, which are important for structure-function relationship. This analysis indicates that tubulin binding sequence-1 (TBS-1 near the TRP-box forms a potential helix and the tubulin interactions with TRPV1 via TBS-1 have evolutionary significance. This interaction may be required for the proper channel function and regulation and may also have significance in the context of Taxol®-induced neuropathy.

  12. Next generation sequencing and analysis of a conserved transcriptome of New Zealand's kiwi.

    Science.gov (United States)

    Subramanian, Sankar; Huynen, Leon; Millar, Craig D; Lambert, David M

    2010-12-15

    Kiwi is a highly distinctive, flightless and endangered ratite bird endemic to New Zealand. To understand the patterns of molecular evolution of the nuclear protein-coding genes in brown kiwi (Apteryx australis mantelli) and to determine the timescale of avian history we sequenced a transcriptome obtained from a kiwi embryo using next generation sequencing methods. We then assembled the conserved protein-coding regions using the chicken proteome as a scaffold. Using 1,543 conserved protein coding genes we estimated the neutral evolutionary divergence between the kiwi and chicken to be ~45%, which is approximately equal to the divergence computed for the human-mouse pair using the same set of genes. A large fraction of genes was found to be under high selective constraint, as most of the expressed genes appeared to be involved in developmental gene regulation. Our study suggests a significant relationship between gene expression levels and protein evolution. Using sequences from over 700 nuclear genes we estimated the divergence between the two basal avian groups, Palaeognathae and Neognathae to be 132 million years, which is consistent with previous studies using mitochondrial genes. The results of this investigation revealed patterns of mutation and purifying selection in conserved protein coding regions in birds. Furthermore this study suggests a relatively cost-effective way of obtaining a glimpse into the fundamental molecular evolutionary attributes of a genome, particularly when no closely related genomic sequence is available.

  13. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Directory of Open Access Journals (Sweden)

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  14. T-cell recognition is shaped by epitope sequence conservation in the host proteome and microbiome

    DEFF Research Database (Denmark)

    Bresciani, Anne Gøther; Paul, Sinu; Schommer, Nina

    2016-01-01

    or allergen with the conservation of its sequence in the human proteome or the healthy human microbiome. Indeed, performing such comparisons on large sets of validated T-cell epitopes, we found that epitopes that are similar with self-antigens above a certain threshold showed lower immunogenicity, presumably...... as a result of negative selection of T cells capable of recognizing such peptides. Moreover, we also found a reduced level of immune recognition for epitopes conserved in the commensal microbiome, presumably as a result of peripheral tolerance. These findings indicate that the existence (and potentially...

  15. Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata

    Directory of Open Access Journals (Sweden)

    Yu Huaping

    2010-07-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play a critical role in post-transcriptional gene regulation and have been shown to control many genes involved in various biological and metabolic processes. There have been extensive studies to discover miRNAs and analyze their functions in model plant species, such as Arabidopsis and rice. Deep sequencing technologies have facilitated identification of species-specific or lowly expressed as well as conserved or highly expressed miRNAs in plants. Results In this research, we used Solexa sequencing to discover new microRNAs in trifoliate orange (Citrus trifoliata which is an important rootstock of citrus. A total of 13,106,753 reads representing 4,876,395 distinct sequences were obtained from a short RNA library generated from small RNA extracted from C. trifoliata flower and fruit tissues. Based on sequence similarity and hairpin structure prediction, we found that 156,639 reads representing 63 sequences from 42 highly conserved miRNA families, have perfect matches to known miRNAs. We also identified 10 novel miRNA candidates whose precursors were all potentially generated from citrus ESTs. In addition, five miRNA* sequences were also sequenced. These sequences had not been earlier described in other plant species and accumulation of the 10 novel miRNAs were confirmed by qRT-PCR analysis. Potential target genes were predicted for most conserved and novel miRNAs. Moreover, four target genes including one encoding IRX12 copper ion binding/oxidoreductase and three genes encoding NB-LRR disease resistance protein have been experimentally verified by detection of the miRNA-mediated mRNA cleavage in C. trifoliata. Conclusion Deep sequencing of short RNAs from C. trifoliata flowers and fruits identified 10 new potential miRNAs and 42 highly conserved miRNA families, indicating that specific miRNAs exist in C. trifoliata. These results show that regulatory miRNAs exist in agronomically important trifoliate orange

  16. Whole-genome sequencing approaches for conservation biology: Advantages, limitations and practical recommendations.

    Science.gov (United States)

    Fuentes-Pardo, Angela P; Ruzzante, Daniel E

    2017-10-01

    Whole-genome resequencing (WGR) is a powerful method for addressing fundamental evolutionary biology questions that have not been fully resolved using traditional methods. WGR includes four approaches: the sequencing of individuals to a high depth of coverage with either unresolved or resolved haplotypes, the sequencing of population genomes to a high depth by mixing equimolar amounts of unlabelled-individual DNA (Pool-seq) and the sequencing of multiple individuals from a population to a low depth (lcWGR). These techniques require the availability of a reference genome. This, along with the still high cost of shotgun sequencing and the large demand for computing resources and storage, has limited their implementation in nonmodel species with scarce genomic resources and in fields such as conservation biology. Our goal here is to describe the various WGR methods, their pros and cons and potential applications in conservation biology. WGR offers an unprecedented marker density and surveys a wide diversity of genetic variations not limited to single nucleotide polymorphisms (e.g., structural variants and mutations in regulatory elements), increasing their power for the detection of signatures of selection and local adaptation as well as for the identification of the genetic basis of phenotypic traits and diseases. Currently, though, no single WGR approach fulfils all requirements of conservation genetics, and each method has its own limitations and sources of potential bias. We discuss proposed ways to minimize such biases. We envision a not distant future where the analysis of whole genomes becomes a routine task in many nonmodel species and fields including conservation biology. © 2017 John Wiley & Sons Ltd.

  17. Conservation and divergence of plant LHP1 protein sequences and expression patterns in angiosperms and gymnosperms.

    Science.gov (United States)

    Guan, Hexin; Zheng, Zhengui; Grey, Paris H; Li, Yuhua; Oppenheimer, David G

    2011-05-01

    Floral transition is a critical and strictly regulated developmental process in plants. Mutations in Arabidopsis LIKE HETEROCHROMATIN PROTEIN 1 (AtLHP1)/TERMINAL FLOWER 2 (TFL2) result in early and terminal flowers. Little is known about the gene expression, function and evolution of plant LHP1 homologs, except for Arabidopsis LHP1. In this study, the conservation and divergence of plant LHP1 protein sequences was analyzed by sequence alignments and phylogeny. LHP1 expression patterns were compared among taxa that occupy pivotal phylogenetic positions. Several relatively conserved new motifs/regions were identified among LHP1 homologs. Phylogeny of plant LHP1 proteins agreed with established angiosperm relationships. In situ hybridization unveiled conserved expression of plant LHP1 in the axillary bud/tiller, vascular bundles, developing stamens, and carpels. Unlike AtLHP1, cucumber CsLHP1-2, sugarcane SoLHP1 and maize ZmLHP1, rice OsLHP1 is not expressed in the shoot apical meristem (SAM) and the OsLHP1 transcript level is consistently low in shoots. "Unequal crossover" might have contributed to the divergence in the N-terminal and hinge region lengths of LHP1 homologs. We propose an "insertion-deletion" model for soybean (Glycine max L.) GmLHP1s evolution. Plant LHP1 homologs are more conserved than previously expected, and may favor vegetative meristem identity and primordia formation. OsLHP1 may not function in rice SAM during floral induction.

  18. Sequencing and Comparative Analysis of a Conserved Syntenic Segment in the Solanaceae

    Science.gov (United States)

    Wang, Ying; Diehl, Adam; Wu, Feinan; Vrebalov, Julia; Giovannoni, James; Siepel, Adam; Tanksley, Steven D.

    2008-01-01

    Comparative genomics is a powerful tool for gaining insight into genomic function and evolution. However, in plants, sequence data that would enable detailed comparisons of both coding and noncoding regions have been limited in availability. Here we report the generation and analysis of sequences for an unduplicated conserved syntenic segment (CSS) in the genomes of five members of the agriculturally important plant family Solanaceae. This CSS includes a 105-kb region of tomato chromosome 2 and orthologous regions of the potato, eggplant, pepper, and petunia genomes. With a total neutral divergence of 0.73–0.78 substitutions/site, these sequences are similar enough that most noncoding regions can be aligned, yet divergent enough to be informative about evolutionary dynamics and selective pressures. The CSS contains 17 distinct genes with generally conserved order and orientation, but with numerous small-scale differences between species. Our analysis indicates that the last common ancestor of these species lived ∼27–36 million years ago, that more than one-third of short genomic segments (5–15 bp) are under selection, and that more than two-thirds of selected bases fall in noncoding regions. In addition, we identify genes under positive selection and analyze hundreds of conserved noncoding elements. This analysis provides a window into 30 million years of plant evolution in the absence of polyploidization. PMID:18723883

  19. Evolution, homology conservation, and identification of unique sequence signatures in GH19 family chitinases.

    Science.gov (United States)

    Udaya Prakash, N A; Jayanthi, M; Sabarinathan, R; Kangueane, P; Mathew, Lazar; Sekar, K

    2010-05-01

    The discovery of GH (Glycoside Hydrolase) 19 chitinases in Streptomyces sp. raises the possibility of the presence of these proteins in other bacterial species, since they were initially thought to be confined to higher plants. The present study mainly concentrates on the phylogenetic distribution and homology conservation in GH19 family chitinases. Extensive database searches are performed to identify the presence of GH19 family chitinases in the three major super kingdoms of life. Multiple sequence alignment of all the identified GH19 chitinase family members resulted in the identification of globally conserved residues. We further identified conserved sequence motifs across the major sub groups within the family. Estimation of evolutionary distance between the various bacterial and plant chitinases are carried out to better understand the pattern of evolution. Our study also supports the horizontal gene transfer theory, which states that GH19 chitinase genes are transferred from higher plants to bacteria. Further, the present study sheds light on the phylogenetic distribution and identifies unique sequence signatures that define GH19 chitinase family of proteins. The identified motifs could be used as markers to delineate uncharacterized GH19 family chitinases. The estimation of evolutionary distance between chitinase identified in plants and bacteria shows that the flowering plants are more related to chitinase in actinobacteria than that of identified in purple bacteria. We propose a model to elucidate the natural history of GH19 family chitinases.

  20. A Potential Tool for Swift Fox (Vulpes velox) Conservation: Individuality of Long-Range Barking Sequences

    DEFF Research Database (Denmark)

    Darden, Safi-Kirstine Klem; Dabelsteen, Torben; Pedersen, Simon Boel

    2003-01-01

    Vocal individuality has been found in a number canid species. This natural variation can have applications in several aspects of species conservation, from behavioral studies to estimating population density or abundance. The swift fox (Vulpes velox) is a North American canid listed as endangered...... context from 20 captive individuals (3 females and 17 males) housed in large, single-pair enclosures at a swift fox breeding facility. Using a discriminant function analysis with 7 temporal and spectral variables measured on barking sequences, we were able to correctly classify 99% of sequences...... to the correct individual. The most important discriminating variable was the mean spacing of barks in a barking sequence. Potential applications of such vocal individuality are discussed....

  1. In silico identification of conserved intercoding sequences in Leishmania genomes: unraveling putative cis-regulatory elements.

    Science.gov (United States)

    Vasconcelos, E J R; Terrão, M C; Ruiz, J C; Vêncio, R Z N; Cruz, A K

    2012-06-01

    In silico analyses of Leishmania spp. genome data are a powerful resource to improve the understanding of these pathogens' biology. Trypanosomatids such as Leishmania spp. have their protein-coding genes grouped in long polycistronic units of functionally unrelated genes. The control of gene expression happens by a variety of posttranscriptional mechanisms. The high degree of synteny among Leishmania species is accompanied by highly conserved coding sequences (CDS) and poorly conserved intercoding untranslated sequences. To identify the elements involved in the control of gene expression, we conducted an in silico investigation to find conserved intercoding sequences (CICS) in the genomes of L. major, L. infantum, and L. braziliensis. We used a combination of computational tools, such as Linux-Shell, PERL and R languages, BLAST, MSPcrunch, SSAKE, and Pred-A-Term algorithms to construct a pipeline which was able to: (i) search for conservation in target-regions, (ii) eliminate CICS redundancy and mask repeat elements, (iii) predict the mRNA's extremities, (iv) analyze the distribution of orthologous genes within the generated LeishCICS-clusters, (v) assign GO terms to the LeishCICS-clusters, and (vi) provide statistical support for the gene-enrichment annotation. We associated the LeishCICS-cluster data, generated at the end of the pipeline, with the expression profile of L. donovani genes during promastigote-amastigote differentiation, as previously evaluated by others (GEO accession: GSE21936). A Pearson's correlation coefficient greater than 0.5 was observed for 730 LeishCICS-clusters containing from 2 to 17 genes. The designed computational pipeline is a useful tool and its application identified potential regulatory cis elements and putative regulons in Leishmania. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris).

    Science.gov (United States)

    Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong

    2006-08-01

    Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.

  3. PETcofold: predicting conserved interactions and structures of two multiple alignments of RNA sequences.

    Science.gov (United States)

    Seemann, Stefan E; Richter, Andreas S; Gesell, Tanja; Backofen, Rolf; Gorodkin, Jan

    2011-01-15

    Predicting RNA-RNA interactions is essential for determining the function of putative non-coding RNAs. Existing methods for the prediction of interactions are all based on single sequences. Since comparative methods have already been useful in RNA structure determination, we assume that conserved RNA-RNA interactions also imply conserved function. Of these, we further assume that a non-negligible amount of the existing RNA-RNA interactions have also acquired compensating base changes throughout evolution. We implement a method, PETcofold, that can take covariance information in intra-molecular and inter-molecular base pairs into account to predict interactions and secondary structures of two multiple alignments of RNA sequences. PETcofold's ability to predict RNA-RNA interactions was evaluated on a carefully curated dataset of 32 bacterial small RNAs and their targets, which was manually extracted from the literature. For evaluation of both RNA-RNA interaction and structure prediction, we were able to extract only a few high-quality examples: one vertebrate small nucleolar RNA and four bacterial small RNAs. For these we show that the prediction can be improved by our comparative approach. Furthermore, PETcofold was evaluated on controlled data with phylogenetically simulated sequences enriched for covariance patterns at the interaction sites. We observed increased performance with increased amounts of covariance. The program PETcofold is available as source code and can be downloaded from http://rth.dk/resources/petcofold.

  4. Homology and conservation of amino acids in E-protein sequences of dengue serotypes

    Directory of Open Access Journals (Sweden)

    Ramesh Venkatachalam

    2014-09-01

    Full Text Available Objective: To identify the homology and phylogenetic relationship among the four dengue virus (DENV serotypes, and conservation of amino acid in E-proteins and to find out the phylogenetic relationship among the strains of four DENV serotypes. Methods: Clustal W analysis for homology and phylogram, European molecular biology open software suite for pairwise alignment of amino acid sequences and BLAST-P analysis for various strains of four DENV serotypes were carried out. Results: Homology of E-protein sequences of four DENV serotypes indicated a close relationship of DENV-1 with DENV-3. DENV-2 showed close relationship with DENV-1 and -3 forming a single cluster whereas DENV-4 alone formed group with a single serotype. In the multiple sequence alignment, 19 amino acid conserved groups were observed. BLAST-P analysis showed more number of 100% similarity among DENV-1 and -3 strains whereas only few strains showed 100% similarity in DENV-4. However, 100% similarity was absent among the DENV-3 strains. Conclusions: From the present study, phylogenetically all the four DENV serotypes were related but DENV-1, -2 and -3 were very closely related whereas DENV-4 was somewhat distant from the other three serotypes.

  5. Cytochrome Oxidase I (COI) sequence conservation and variation patterns in the yellowfin and longtail tunas.

    Science.gov (United States)

    Kunal, Swaraj Priyaranjan; Kumar, Girish

    2013-01-01

    Tunas are commercially important fishery worldwide. There are at least 13 species of tuna belonging to three genera, out of which genus Thunnus has maximum eight species. On the basis of their availability, they can be characterised as oceanic such as Thunnus albacares (yellowfin tuna) or coastal such as Thunnus tonggol (longtail tuna). Although these two are different species, morphological differentiation can only be seen in mature individuals, hence misidentification may result in erroneous data set, which ultimately affect conservation strategies. The mitochondrial DNA cytochrome oxidase c subunit 1 (COI) gene is one of the most popular markers for population genetic and phylogeographic studies across the animal kingdom. The present study aims to study the sequence conservation and variation in mitochondrial Cytochrome Oxidase I (COI) between these two species of tuna. COI sequence analysis of yellowfin and longtail revealed the close relationship between them in Thunnus genera. The present study is the first direct comparison of mitochondrial COI sequences of these two tuna species.

  6. Identification of conserved and novel microRNAs in Porphyridium purpureum via deep sequencing and bioinformatics.

    Science.gov (United States)

    Gao, Fan; Nan, Fangru; Feng, Jia; Lv, Junping; Liu, Qi; Xie, Shulian

    2016-08-11

    Porphyridium purpureum has been utilized in important industrial and pharmaceutical fields. The identification of microRNAs (miRNAs) in this unique species is of great importance: such identification can help fill gaps in the small RNA (sRNA) studies of this organism and help to elucidate essential biological processes and their regulation mechanisms in this special micro alga. In this study, 254 high-confidence miRNAs (203 conserved miRNAs and 51 novel miRNAs) were identified by sRNA deep sequencing (sRNA-seq) combined with bioinformatics. A total of 235 putative miRNA families were predicted, including 192 conserved families and 43 species-specific families. The conservation and diversity of predicted miRNA families were analysed in different plant species. Both the 100 % northern blot validation rate (VR) of four randomly selected miRNAs and the results of stem-loop quantitative real time RT-PCR (qRT-PCR) assays of 25 randomly selected miRNAs demonstrated that the majority of the miRNAs identified in this study are credible. A total of 14,958 and 2184 genes were predicted to be targeted by the 186 conserved and 41 novel miRNAs. Gene ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis indicated that some target genes likely provide valuable references for further understanding of vital functions in P. purpureum. In addition, a cytoscape network will provide some clues for research into the complex biological processes that occur in this unique alga. We first identified a large set of conserved and novel miRNAs in P. purpureum. The characteristic and validation analysis on miRNAs demonstrated authenticity of identification data. Functional annotation of target genes and metabolic pathways they involved in illuminated the direction for further utilization and development this micro alga based on its unique properties.

  7. PDL1 Signals through Conserved Sequence Motifs to Overcome Interferon-Mediated Cytotoxicity

    Directory of Open Access Journals (Sweden)

    Maria Gato-Cañas

    2017-08-01

    Full Text Available PDL1 blockade produces remarkable clinical responses, thought to occur by T cell reactivation through prevention of PDL1-PD1 T cell inhibitory interactions. Here, we find that PDL1 cell-intrinsic signaling protects cancer cells from interferon (IFN cytotoxicity and accelerates tumor progression. PDL1 inhibited IFN signal transduction through a conserved class of sequence motifs that mediate crosstalk with IFN signaling. Abrogation of PDL1 expression or antibody-mediated PDL1 blockade strongly sensitized cancer cells to IFN cytotoxicity through a STAT3/caspase-7-dependent pathway. Moreover, somatic mutations found in human carcinomas within these PDL1 sequence motifs disrupted motif regulation, resulting in PDL1 molecules with enhanced protective activities from type I and type II IFN cytotoxicity. Overall, our results reveal a mode of action of PDL1 in cancer cells as a first line of defense against IFN cytotoxicity.

  8. Sequence recombination and conservation of Varroa destructor virus-1 and deformed wing virus in field collected honey bees (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Hui Wang

    Full Text Available We sequenced small (s RNAs from field collected honeybees (Apis mellifera and bumblebees (Bombuspascuorum using the Illumina technology. The sRNA reads were assembled and resulting contigs were used to search for virus homologues in GenBank. Matches with Varroadestructor virus-1 (VDV1 and Deformed wing virus (DWV genomic sequences were obtained for A. mellifera but not B. pascuorum. Further analyses suggested that the prevalent virus population was composed of VDV-1 and a chimera of 5'-DWV-VDV1-DWV-3'. The recombination junctions in the chimera genomes were confirmed by using RT-PCR, cDNA cloning and Sanger sequencing. We then focused on conserved short fragments (CSF, size > 25 nt in the virus genomes by using GenBank sequences and the deep sequencing data obtained in this study. The majority of CSF sites confirmed conservation at both between-species (GenBank sequences and within-population (dataset of this study levels. However, conserved nucleotide positions in the GenBank sequences might be variable at the within-population level. High mutation rates (Pi>10% were observed at a number of sites using the deep sequencing data, suggesting that sequence conservation might not always be maintained at the population level. Virus-host interactions and strategies for developing RNAi treatments against VDV1/DWV infections are discussed.

  9. Sequence of Radiotherapy and Chemotherapy in Breast Cancer After Breast-Conserving Surgery

    Energy Technology Data Exchange (ETDEWEB)

    Jobsen, Jan J., E-mail: J.Jobsen@mst.nl [Department of Radiation Oncology, Medisch Spectrum Twente, Enschede (Netherlands); Palen, Job van der [Department of Epidemiology, Medisch Spectrum Twente, Enschede (Netherlands); Department of Research Methodology, Measurement and Data Analysis, Faculty of Behavioural Science, University of Twente (Netherlands); Brinkhuis, Marieel [Laboratory for Pathology Oost Nederland, Enschede (Netherlands); Ong, Francisca [Department of Radiation Oncology, Medisch Spectrum Twente, Enschede (Netherlands); Struikmans, Henk [Department of Radiation Oncology, Leiden University Medical Centre, Leiden (Netherlands); Radiotherapy Centre West, Medical Centre Haaglanden, the Hague (Netherlands)

    2012-04-01

    Purpose: The optimal sequence of radiotherapy and chemotherapy in breast-conserving therapy is unknown. Methods and Materials: From 1983 through 2007, a total of 641 patients with 653 instances of breast-conserving therapy (BCT), received both chemotherapy and radiotherapy and are the basis of this analysis. Patients were divided into three groups. Groups A and B comprised patients treated before 2005, Group A radiotherapy first and Group B chemotherapy first. Group C consisted of patients treated from 2005 onward, when we had a fixed sequence of radiotherapy first, followed by chemotherapy. Results: Local control did not show any differences among the three groups. For distant metastasis, no difference was shown between Groups A and B. Group C, when compared with Group A, showed, on univariate and multivariate analyses, a significantly better distant metastasis-free survival. The same was noted for disease-free survival. With respect to disease-specific survival, no differences were shown on multivariate analysis among the three groups. Conclusion: Radiotherapy, as an integral part of the primary treatment of BCT, should be administered first, followed by adjuvant chemotherapy.

  10. Chromosome conformation capture uncovers potential genome-wide interactions between human conserved non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Daniel Robyr

    Full Text Available Comparative analyses of various mammalian genomes have identified numerous conserved non-coding (CNC DNA elements that display striking conservation among species, suggesting that they have maintained specific functions throughout evolution. CNC function remains poorly understood, although recent studies have identified a role in gene regulation. We hypothesized that the identification of genomic loci that interact physically with CNCs would provide information on their functions. We have used circular chromosome conformation capture (4C to characterize interactions of 10 CNCs from human chromosome 21 in K562 cells. The data provide evidence that CNCs are capable of interacting with loci that are enriched for CNCs. The number of trans interactions varies among CNCs; some show interactions with many loci, while others interact with few. Some of the tested CNCs are capable of driving the expression of a reporter gene in the mouse embryo, and associate with the oligodendrocyte genes OLIG1 and OLIG2. Our results underscore the power of chromosome conformation capture for the identification of targets of functional DNA elements and raise the possibility that CNCs exert their functions by physical association with defined genomic regions enriched in CNCs. These CNC-CNC interactions may in part explain their stringent conservation as a group of regulatory sequences.

  11. An Evolutionarily Conserved Innate Immunity Protein Interaction Network*

    Science.gov (United States)

    De Arras, Lesly; Seng, Amara; Lackford, Brad; Keikhaee, Mohammad R.; Bowerman, Bruce; Freedman, Jonathan H.; Schwartz, David A.; Alper, Scott

    2013-01-01

    The innate immune response plays a critical role in fighting infection; however, innate immunity also can affect the pathogenesis of a variety of diseases, including sepsis, asthma, cancer, and atherosclerosis. To identify novel regulators of innate immunity, we performed comparative genomics RNA interference screens in the nematode Caenorhabditis elegans and mouse macrophages. These screens have uncovered many candidate regulators of the response to lipopolysaccharide (LPS), several of which interact physically in multiple species to form an innate immunity protein interaction network. This protein interaction network contains several proteins in the canonical LPS-responsive TLR4 pathway as well as many novel interacting proteins. Using RNAi and overexpression studies, we show that almost every gene in this network can modulate the innate immune response in mouse cell lines. We validate the importance of this network in innate immunity regulation in vivo using available mutants in C. elegans and mice. PMID:23209288

  12. Silencing Effect of Hominoid Highly Conserved Noncoding Sequences on Embryonic Brain Development

    Science.gov (United States)

    Mahmoudi Saber, Morteza

    2017-01-01

    Abstract Superfamily Hominoidea, which consists of Hominidae (humans and great apes) and Hylobatidae (gibbons), is well-known for sharing human-like characteristics, however, the genomic origins of these shared unique phenotypes have mainly remained elusive. To decipher the underlying genomic basis of Hominoidea-restricted phenotypes, we identified and characterized Hominoidea-restricted highly conserved noncoding sequences (HCNSs) that are a class of potential regulatory elements which may be involved in evolution of lineage-specific phenotypes. We discovered 679 such HCNSs from human, chimpanzee, gorilla, orangutan and gibbon genomes. These HCNSs were demonstrated to be under purifying selection but with lineage-restricted characteristics different from old CNSs. A significant proportion of their ancestral sequences had accelerated rates of nucleotide substitutions, insertions and deletions during the evolution of common ancestor of Hominoidea, suggesting the intervention of positive Darwinian selection for creating those HCNSs. In contrary to enhancer elements and similar to silencer sequences, these Hominoidea-restricted HCNSs are located in close proximity of transcription start sites. Their target genes are enriched in the nervous system, development and transcription, and they tend to be remotely located from the nearest coding gene. Chip-seq signals and gene expression patterns suggest that Hominoidea-restricted HCNSs are likely to be functional regulatory elements by imposing silencing effects on their target genes in a tissue-restricted manner during fetal brain development. These HCNSs, emerged through adaptive evolution and conserved through purifying selection, represent a set of promising targets for future functional studies of the evolution of Hominoidea-restricted phenotypes. PMID:28633494

  13. Weak correlation between sequence conservation in promoter regions and in protein-coding regions of human-mouse orthologous gene pairs

    Directory of Open Access Journals (Sweden)

    Nakai Kenta

    2008-04-01

    Full Text Available Abstract Background Interspecies sequence comparison is a powerful tool to extract functional or evolutionary information from the genomes of organisms. A number of studies have compared protein sequences or promoter sequences between mammals, which provided many insights into genomics. However, the correlation between protein conservation and promoter conservation remains controversial. Results We examined promoter conservation as well as protein conservation for 6,901 human and mouse orthologous genes, and observed a very weak correlation between them. We further investigated their relationship by decomposing it based on functional categories, and identified categories with significant tendencies. Remarkably, the 'ribosome' category showed significantly low promoter conservation, despite its high protein conservation, and the 'extracellular matrix' category showed significantly high promoter conservation, in spite of its low protein conservation. Conclusion Our results show the relation of gene function to protein conservation and promoter conservation, and revealed that there seem to be nonparallel components between protein and promoter sequence evolution.

  14. Correlation between sequence conservation and structural thermodynamics of microRNA precursors from human, mouse, and chicken genomes

    Directory of Open Access Journals (Sweden)

    Wang Shengqi

    2010-10-01

    Full Text Available Abstract Background Previous studies have shown that microRNA precursors (pre-miRNAs have considerably more stable secondary structures than other native RNAs (tRNA, rRNA, and mRNA and artificial RNA sequences. However, pre-miRNAs with ultra stable secondary structures have not been investigated. It is not known if there is a tendency in pre-miRNA sequences towards or against ultra stable structures? Furthermore, the relationship between the structural thermodynamic stability of pre-miRNA and their evolution remains unclear. Results We investigated the correlation between pre-miRNA sequence conservation and structural stability as measured by adjusted minimum folding free energies in pre-miRNAs isolated from human, mouse, and chicken. The analysis revealed that conserved and non-conserved pre-miRNA sequences had structures with similar average stabilities. However, the relatively ultra stable and unstable pre-miRNAs were more likely to be non-conserved than pre-miRNAs with moderate stability. Non-conserved pre-miRNAs had more G+C than A+U nucleotides, while conserved pre-miRNAs contained more A+U nucleotides. Notably, the U content of conserved pre-miRNAs was especially higher than that of non-conserved pre-miRNAs. Further investigations showed that conserved and non-conserved pre-miRNAs exhibited different structural element features, even though they had comparable levels of stability. Conclusions We proposed that there is a correlation between structural thermodynamic stability and sequence conservation for pre-miRNAs from human, mouse, and chicken genomes. Our analyses suggested that pre-miRNAs with relatively ultra stable or unstable structures were less favoured by natural selection than those with moderately stable structures. Comparison of nucleotide compositions between non-conserved and conserved pre-miRNAs indicated the importance of U nucleotides in the pre-miRNA evolutionary process. Several characteristic structural elements were

  15. Sequence conservation in avian CR1: an interspersed repetitive DNA family evolving under functional constraints.

    Science.gov (United States)

    Chen, Z Q; Ritzel, R G; Lin, C C; Hodgetts, R B

    1991-07-01

    CR1 is a short interspersed repetitive DNA element originally identified in the domestic chicken (Gallus gallus). However, unlike virtually all other such sequences described to date, CR1 is not confined to one or a few closely related species. It is probably a ubiquitous component of the avian genome, having been detected in representatives of nine orders encompassing a wide spectrum of the class Aves. This identification was made possible by using the polymerase chain reaction (PCR), which revealed interspecific similarities not detected by conventional Southern analysis. DNA sequence comparisons between a CR1 element isolated from a sarus crane (Grus antigone) and those isolated from an emu (Dromaius novaehollandiae) showed that two short highly conserved regions are present. These are included within two regions previously characterized in the CR1 units of domestic fowl. One of these behaves as a transcriptional silencer and the other is a binding site for a nuclear protein. Our observations suggest that CR1 has evolved under functional constraints and that interspersed repetitive sequences as a class may constitute a more significant component of the eukaryotic genome than is generally acknowledged.

  16. Evolutionary conservation of sequence and secondary structures inCRISPR repeats

    Energy Technology Data Exchange (ETDEWEB)

    Kunin, Victor; Sorek, Rotem; Hugenholtz, Philip

    2006-09-01

    Clustered Regularly Interspaced Palindromic Repeats (CRISPRs) are a novel class of direct repeats, separated by unique spacer sequences of similar length, that are present in {approx}40% of bacterial and all archaeal genomes analyzed to date. More than 40 gene families, called CRISPR-associated sequences (CAS), appear in conjunction with these repeats and are thought to be involved in the propagation and functioning of CRISPRs. It has been proposed that the CRISPR/CAS system samples, maintains a record of, and inactivates invasive DNA that the cell has encountered, and therefore constitutes a prokaryotic analog of an immune system. Here we analyze CRISPR repeats identified in 195 microbial genomes and show that they can be organized into multiple clusters based on sequence similarity. All individual repeats in any given cluster were inferred to form characteristic RNA secondary structure, ranging from non-existent to pronounced. Stable secondary structures included G:U base pairs and exhibited multiple compensatory base changes in the stem region, indicating evolutionary conservation and functional importance. We also show that the repeat-based classification corresponds to, and expands upon, a previously reported CAS gene-based classification including specific relationships between CRISPR and CAS subtypes.

  17. Sequence conservation and expression of the sex-lethal homologue in the fly Megaselia scalaris.

    Science.gov (United States)

    Sievert, V; Kuhn, S; Paululat, A; Traut, W

    2000-04-01

    Sex-lethal (Sxl) is Drosophila melanogaster's key regulating gene in the sex-determining cascade. Its homologue in Megaselia scalaris, the chromosome 3 gene Megsxl, codes for a protein with an overall similarity of 77% with the corresponding D. melanogaster sequence. Expression in M. scalaris, however, is very unlike that in D. melanogaster. Megsxl transcripts with a long ORF occur in both sexes. Differential splicing is conserved but not sex-specific. There are several splice variants, among them one is common to gonads and somatic tissues of all developmental stages investigated, one is specific for ovaries and embryos, and a third one is not found in ovaries. In the ovary, Megsxl is heavily transcribed in nurse cells and transported into eggs. These results suggest a non-sex-determining function during early embryogenesis; the presence of Megsxl RNA in testes and somatic tissues calls for other (or more) functions.

  18. FeatureMap3D - a tool to map protein features and sequence conservation onto homologous structures in the PDB

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Rapacki, Krzysztof; Stærfeldt, Hans Henrik

    2006-01-01

    FeatureMap3D is a web-based tool that maps protein features onto 3D structures. The user provides sequences annotated with any feature of interest, such as post-translational modifications, protease cleavage sites or exonic structure and FeatureMap3D will then search the Protein Data Bank (PDB......) for structures of homologous proteins. The results are displayed both as an annotated sequence alignment, where the user-provided annotations as well as the sequence conservation between the query and the target sequence are displayed, and also as a publication-quality image of the 3D protein structure...... with the selected features and sequence conservation enhanced. The results are also returned in a readily parsable text format as well as a PyMol (http://pymol.sourceforge.net/) script file, which allows the user to easily modify the protein structure image to suit a specific purpose. FeatureMap3D can also be used...

  19. Spatial clustering of binding motifs and charges reveals conserved functional features in disordered nucleoporin sequences

    Science.gov (United States)

    Ando, David; Colvin, Michael; Rexach, Michael; Gopinathan, Ajay

    2013-03-01

    The Nuclear Pore Complex (NPC) gates the only channel through which cells exchange material between the nucleus and cytoplasm. Traffic is regulated by transport receptors bound to cargo which interact with numerous of disordered phenylalanine glycine (FG) repeat containing proteins (FG nups) that line this channel. The precise physical mechanism of transport regulation has remained elusive primarily due to the difficulty in understanding the structure and dynamics of such a large assembly of interacting disordered proteins. Here we have performed a comprehensive bioinformatic analysis, specifically tailored towards disordered proteins, on thousands of nuclear pore proteins from a variety of species revealing a set of highly conserved features in the sequence structure among FG nups. Contrary to the general perception that these proteins are functionally equivalent to homogeneous polymers, we show that biophysically important features within individual nups like the separation, spatial localization and ordering along the chain of FG and charge domains are highly conserved. Our current understanding of NPC structure and function should therefore be revised to account for these common features that are functionally relevant for the underlying physical mechanism of NPC gating.

  20. A ChIP-Seq benchmark shows that sequence conservation mainly improves detection of strong transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Tony Håndstad

    Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.

  1. Whole-Genome de novo Sequencing Of Quail And Grey Partridge

    DEFF Research Database (Denmark)

    Holm, Lars-Erik; Panitz, Frank; Burt, Dave

    2011-01-01

    The development in sequencing methods has made it possible to perform whole genome de novo sequencing of species without large commercial interests. Within the EU-financed QUANTOMICS project (KBBE-2A-222664), we have performed de novo sequencing of quail (Coturnix coturnix) and grey partridge...... comparative studies towards the chicken genome and will aid in identifying evolutionarily conserved sequences within the Galliformes. The obtained sequences from quail and partridge represent a beginning of generating the whole genome sequence for these species. The continuation of establishing the genome...

  2. Sequence Classification: 892234 [

    Lifescience Database Archive (English)

    Full Text Available tif necessary for cell viability but not for Prp19p association, evolutionarily conserved and homologous to S. pombe Cdc5p; Cef1p || http://www.ncbi.nlm.nih.gov/protein/6323869 ...

  3. A tree-based conservation scoring method for short linear motifs in multiple alignments of protein sequences

    Directory of Open Access Journals (Sweden)

    López Rodrigo

    2008-05-01

    Full Text Available Abstract Background The structure of many eukaryotic cell regulatory proteins is highly modular. They are assembled from globular domains, segments of natively disordered polypeptides and short linear motifs. The latter are involved in protein interactions and formation of regulatory complexes. The function of such proteins, which may be difficult to define, is the aggregate of the subfunctions of the modules. It is therefore desirable to efficiently predict linear motifs with some degree of accuracy, yet sequence database searches return results that are not significant. Results We have developed a method for scoring the conservation of linear motif instances. It requires only primary sequence-derived information (e.g. multiple alignment and sequence tree and takes into account the degenerate nature of linear motif patterns. On our benchmarking, the method accurately scores 86% of the known positive instances, while distinguishing them from random matches in 78% of the cases. The conservation score is implemented as a real time application designed to be integrated into other tools. It is currently accessible via a Web Service or through a graphical interface. Conclusion The conservation score improves the prediction of linear motifs, by discarding those matches that are unlikely to be functional because they have not been conserved during the evolution of the protein sequences. It is especially useful for instances in non-structured regions of the proteins, where a domain masking filtering strategy is not applicable.

  4. A belief-based evolutionarily stable strategy.

    Science.gov (United States)

    Deng, Xinyang; Wang, Zhen; Liu, Qi; Deng, Yong; Mahadevan, Sankaran

    2014-11-21

    As an equilibrium refinement of the Nash equilibrium, evolutionarily stable strategy (ESS) is a key concept in evolutionary game theory and has attracted growing interest. An ESS can be either a pure strategy or a mixed strategy. Even though the randomness is allowed in mixed strategy, the selection probability of pure strategy in a mixed strategy may fluctuate due to the impact of many factors. The fluctuation can lead to more uncertainty. In this paper, such uncertainty involved in mixed strategy has been further taken into consideration: a belief strategy is proposed in terms of Dempster-Shafer evidence theory. Furthermore, based on the proposed belief strategy, a belief-based ESS has been developed. The belief strategy and belief-based ESS can reduce to the mixed strategy and mixed ESS, which provide more realistic and powerful tools to describe interactions among agents. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Conserved noncoding sequences are associated with rates of mRNA decay in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jacob B Spangler

    2013-05-01

    Full Text Available Steady-state mRNA levels are tightly regulated through a combination of transcriptional and post-transcriptional control mechanisms. The discovery of cis-acting DNA elements that encode these control mechanisms is of high importance. We have investigated the influence of conserved non-coding sequences (CNSs, DNA patterns retained after an ancient whole genome duplication event, on the breadth of gene expression and the rates of mRNA decay in Arabidopsis thaliana. The absence of CNSs near α duplicate genes was associated with a decrease in breadth of gene expression and slower mRNA decay rates while the presence CNSs near α duplicates was associated with an increase in breadth of gene expression and faster mRNA decay rates. The observed difference in mRNA decay rate was fastest in genes with CNSs in both nontranscribed and transcribed regions, albeit through an unknown mechanism. This study supports the notion that some Arabidopsis CNSs regulate the steady-state mRNA levels through post-transcriptional control mechanisms and that CNSs also play a role in controlling the breadth of gene expression.

  6. DNA sequence conservation between the Bacillus anthracis pXO2 plasmid and genomic sequence from closely related bacteria

    Directory of Open Access Journals (Sweden)

    Sabin Robert

    2002-12-01

    Full Text Available Abstract Background Complete sequencing and annotation of the 96.2 kb Bacillus anthracis plasmid, pXO2, predicted 85 open reading frames (ORFs. Bacillus cereus and Bacillus thuringiensis isolates that ranged in genomic similarity to B. anthracis, as determined by amplified fragment length polymorphism (AFLP analysis, were examined by PCR for the presence of sequences similar to 47 pXO2 ORFs. Results The two most distantly related isolates examined, B. thuringiensis 33679 and B. thuringiensis AWO6, produced the greatest number of ORF sequences similar to pXO2; 10 detected in 33679 and 16 in AWO6. No more than two of the pXO2 ORFs were detected in any one of the remaining isolates. Dot-blot DNA hybridizations between pXO2 ORF fragments and total genomic DNA from AWO6 were consistent with the PCR assay results for this isolate and also revealed nine additional ORFs shared between these two bacteria. Sequences similar to the B. anthracis cap genes or their regulator, acpA, were not detected among any of the examined isolates. Conclusions The presence of pXO2 sequences in the other Bacillus isolates did not correlate with genomic relatedness established by AFLP analysis. The presence of pXO2 ORF sequences in other Bacillus species suggests the possibility that certain pXO2 plasmid gene functions may also be present in other closely related bacteria.

  7. Effects of using coding potential, sequence conservation and mRNA structure conservation for predicting pyrroly-sine containing genes

    DEFF Research Database (Denmark)

    Have, Christian Theil; Zambach, Sine; Christiansen, Henning

    2013-01-01

    Background Pyrrolysine (the 22nd amino acid) is in certain organisms and under certain circumstances encoded by the amber stop codon, UAG. The circumstances driving pyrrolysine translation are not well understood. The involvement of a predicted mRNA structure in the region downstream UAG has been...... these clusters according to several features that may influence pyrrolysine translation. The ranking effects of different features are assessed and we propose a weighted combination of these features which best explains the currently known pyrrolysine incorporating genes. We devote special attention...... for prediction of pyrrolysine incorporating genes in genomes of bacteria and archaea leading to insights about the factors driving pyrrolysine translation and identification of new gene candidates. The method predicts known conserved genes with high recall and predicts several other promising candidates...

  8. Sequence and Structural Analysis of the Chitinase Insertion Domain Reveals Two Conserved Motifs Involved in Chitin-Binding

    Science.gov (United States)

    Li, Hai; Greene, Lesley H.

    2010-01-01

    Background Chitinases are prevalent in life and are found in species including archaea, bacteria, fungi, plants, and animals. They break down chitin, which is the second most abundant carbohydrate in nature after cellulose. Hence, they are important for maintaining a balance between carbon and nitrogen trapped as insoluble chitin in biomass. Chitinases are classified into two families, 18 and 19 glycoside hydrolases. In addition to a catalytic domain, which is a triosephosphate isomerase barrel, many family 18 chitinases contain another module, i.e., chitinase insertion domain. While numerous studies focus on the biological role of the catalytic domain in chitinase activity, the function of the chitinase insertion domain is not completely understood. Bioinformatics offers an important avenue in which to facilitate understanding the role of residues within the chitinase insertion domain in chitinase function. Results Twenty-seven chitinase insertion domain sequences, which include four experimentally determined structures and span five kingdoms, were aligned and analyzed using a modified sequence entropy parameter. Thirty-two positions with conserved residues were identified. The role of these conserved residues was explored by conducting a structural analysis of a number of holo-enzymes. Hydrogen bonding and van der Waals calculations revealed a distinct subset of four conserved residues constituting two sequence motifs that interact with oligosaccharides. The other conserved residues may be key to the structure, folding, and stability of this domain. Conclusions Sequence and structural studies of the chitinase insertion domains conducted within the framework of evolution identified four conserved residues which clearly interact with the substrates. Furthermore, evolutionary studies propose a link between the appearance of the chitinase insertion domain and the function of family 18 chitinases in the subfamily A. PMID:20084296

  9. Dominant Sequences of Human Major Histocompatibility Complex Conserved Extended Haplotypes from HLA-DQA2 to DAXX

    Science.gov (United States)

    Larsen, Charles E.; Alford, Dennis R.; Trautwein, Michael R.; Jalloh, Yanoh K.; Tarnacki, Jennifer L.; Kunnenkeri, Sushruta K.; Fici, Dolores A.; Yunis, Edmond J.; Awdeh, Zuheir L.; Alper, Chester A.

    2014-01-01

    We resequenced and phased 27 kb of DNA within 580 kb of the MHC class II region in 158 population chromosomes, most of which were conserved extended haplotypes (CEHs) of European descent or contained their centromeric fragments. We determined the single nucleotide polymorphism and deletion-insertion polymorphism alleles of the dominant sequences from HLA-DQA2 to DAXX for these CEHs. Nine of 13 CEHs remained sufficiently intact to possess a dominant sequence extending at least to DAXX, 230 kb centromeric to HLA-DPB1. We identified the regions centromeric to HLA-DQB1 within which single instances of eight “common” European MHC haplotypes previously sequenced by the MHC Haplotype Project (MHP) were representative of those dominant CEH sequences. Only two MHP haplotypes had a dominant CEH sequence throughout the centromeric and extended class II region and one MHP haplotype did not represent a known European CEH anywhere in the region. We identified the centromeric recombination transition points of other MHP sequences from CEH representation to non-representation. Several CEH pairs or groups shared sequence identity in small blocks but had significantly different (although still conserved for each separate CEH) sequences in surrounding regions. These patterns partly explain strong calculated linkage disequilibrium over only short (tens to hundreds of kilobases) distances in the context of a finite number of observed megabase-length CEHs comprising half a population's haplotypes. Our results provide a clearer picture of European CEH class II allelic structure and population haplotype architecture, improved regional CEH markers, and raise questions concerning regional recombination hotspots. PMID:25299700

  10. Mitochondrial genome sequences illuminate maternal lineages of conservation concern in a rare carnivore

    Science.gov (United States)

    Brian J. Knaus; Richard Cronn; Aaron Liston; Kristine Pilgrim; Michael K. Schwartz

    2011-01-01

    Science-based wildlife management relies on genetic information to infer population connectivity and identify conservation units. The most commonly used genetic marker for characterizing animal biodiversity and identifying maternal lineages is the mitochondrial genome. Mitochondrial genotyping figures prominently in conservation and management plans, with much of the...

  11. Genome Sequence Conservation of Hendra Virus Isolates during Spillover to Horses, Australia

    Science.gov (United States)

    Todd, Shawn; Foord, Adam; Hansson, Eric; Davies, Kelly; Wright, Lynda; Morrissy, Chris; Halpin, Kim; Middleton, Deborah; Field, Hume E.; Daniels, Peter; Wang, Lin-Fa

    2010-01-01

    Bat-to-horse transmission of Hendra virus has occurred at least 14 times. Although clinical signs in horses have differed, genome sequencing has demonstrated little variation among the isolates. Our sequencing of 5 isolates from recent Hendra virus outbreaks in horses found no correlation between sequences and time or geographic location of outbreaks. PMID:21029540

  12. Parallel tagged next-generation sequencing on pooled samples - a new approach for population genetics in ecology and conservation.

    Science.gov (United States)

    Zavodna, Monika; Grueber, Catherine E; Gemmell, Neil J

    2013-01-01

    Next-generation sequencing (NGS) on pooled samples has already been broadly applied in human medical diagnostics and plant and animal breeding. However, thus far it has been only sparingly employed in ecology and conservation, where it may serve as a useful diagnostic tool for rapid assessment of species genetic diversity and structure at the population level. Here we undertake a comprehensive evaluation of the accuracy, practicality and limitations of parallel tagged amplicon NGS on pooled population samples for estimating species population diversity and structure. We obtained 16S and Cyt b data from 20 populations of Leiopelma hochstetteri, a frog species of conservation concern in New Zealand, using two approaches - parallel tagged NGS on pooled population samples and individual Sanger sequenced samples. Data from each approach were then used to estimate two standard population genetic parameters, nucleotide diversity (π) and population differentiation (FST), that enable population genetic inference in a species conservation context. We found a positive correlation between our two approaches for population genetic estimates, showing that the pooled population NGS approach is a reliable, rapid and appropriate method for population genetic inference in an ecological and conservation context. Our experimental design also allowed us to identify both the strengths and weaknesses of the pooled population NGS approach and outline some guidelines and suggestions that might be considered when planning future projects.

  13. Parallel tagged next-generation sequencing on pooled samples - a new approach for population genetics in ecology and conservation.

    Directory of Open Access Journals (Sweden)

    Monika Zavodna

    Full Text Available Next-generation sequencing (NGS on pooled samples has already been broadly applied in human medical diagnostics and plant and animal breeding. However, thus far it has been only sparingly employed in ecology and conservation, where it may serve as a useful diagnostic tool for rapid assessment of species genetic diversity and structure at the population level. Here we undertake a comprehensive evaluation of the accuracy, practicality and limitations of parallel tagged amplicon NGS on pooled population samples for estimating species population diversity and structure. We obtained 16S and Cyt b data from 20 populations of Leiopelma hochstetteri, a frog species of conservation concern in New Zealand, using two approaches - parallel tagged NGS on pooled population samples and individual Sanger sequenced samples. Data from each approach were then used to estimate two standard population genetic parameters, nucleotide diversity (π and population differentiation (FST, that enable population genetic inference in a species conservation context. We found a positive correlation between our two approaches for population genetic estimates, showing that the pooled population NGS approach is a reliable, rapid and appropriate method for population genetic inference in an ecological and conservation context. Our experimental design also allowed us to identify both the strengths and weaknesses of the pooled population NGS approach and outline some guidelines and suggestions that might be considered when planning future projects.

  14. Conserved sequence-specific lincRNA-steroid receptor interactions drive transcriptional repression and direct cell fate

    Energy Technology Data Exchange (ETDEWEB)

    Hudson, William H.; Pickard, Mark R.; de Vera, Ian Mitchelle S.; Kuiper, Emily G.; Mourtada-Maarabouni, Mirna; Conn, Graeme L.; Kojetin, Douglas J.; Williams, Gwyn T.; Ortlund, Eric A. [Emory-MED; (Keele); (Scripps)

    2014-12-23

    The majority of the eukaryotic genome is transcribed, generating a significant number of long intergenic noncoding RNAs (lincRNAs). Although lincRNAs represent the most poorly understood product of transcription, recent work has shown lincRNAs fulfill important cellular functions. In addition to low sequence conservation, poor understanding of structural mechanisms driving lincRNA biology hinders systematic prediction of their function. Here we report the molecular requirements for the recognition of steroid receptors (SRs) by the lincRNA growth arrest-specific 5 (Gas5), which regulates steroid-mediated transcriptional regulation, growth arrest and apoptosis. We identify the functional Gas5-SR interface and generate point mutations that ablate the SR-Gas5 lincRNA interaction, altering Gas5-driven apoptosis in cancer cell lines. Further, we find that the Gas5 SR-recognition sequence is conserved among haplorhines, with its evolutionary origin as a splice acceptor site. This study demonstrates that lincRNAs can recognize protein targets in a conserved, sequence-specific manner in order to affect critical cell functions.

  15. Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

    Science.gov (United States)

    Zhang, Qiang; Rahim, Mir Munir A; Allan, David S J; Tu, Megan M; Belanger, Simon; Abou-Samra, Elias; Ma, Jaehun; Sekhon, Harman S; Fairhead, Todd; Zein, Haggag S; Carlyle, James R; Anderson, Stephen K; Makrigiannis, Andrew P

    2012-01-01

    The Nkrp1 (Klrb1)-Clr (Clec2) genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b), Nkrp1c (Klrb1c), and Clr-c (Clec2f) genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d) and Clr-g (Clec2i) showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells), as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.

  16. Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    Full Text Available The Nkrp1 (Klrb1-Clr (Clec2 genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b, Nkrp1c (Klrb1c, and Clr-c (Clec2f genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d and Clr-g (Clec2i showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells, as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.

  17. Conservation and diversification of Msx protein in metazoan evolution.

    Science.gov (United States)

    Takahashi, Hirokazu; Kamiya, Akiko; Ishiguro, Akira; Suzuki, Atsushi C; Saitou, Naruya; Toyoda, Atsushi; Aruga, Jun

    2008-01-01

    Msx (/msh) family genes encode homeodomain (HD) proteins that control ontogeny in many animal species. We compared the structures of Msx genes from a wide range of Metazoa (Porifera, Cnidaria, Nematoda, Arthropoda, Tardigrada, Platyhelminthes, Mollusca, Brachiopoda, Annelida, Echiura, Echinodermata, Hemichordata, and Chordata) to gain an understanding of the role of these genes in phylogeny. Exon-intron boundary analysis suggested that the position of the intron located N-terminally to the HDs was widely conserved in all the genes examined, including those of cnidarians. Amino acid (aa) sequence comparison revealed 3 new evolutionarily conserved domains, as well as very strong conservation of the HDs. Two of the three domains were associated with Groucho-like protein binding in both a vertebrate and a cnidarian Msx homolog, suggesting that the interaction between Groucho-like proteins and Msx proteins was established in eumetazoan ancestors. Pairwise comparison among the collected HDs and their C-flanking aa sequences revealed that the degree of sequence conservation varied depending on the animal taxa from which the sequences were derived. Highly conserved Msx genes were identified in the Vertebrata, Cephalochordata, Hemichordata, Echinodermata, Mollusca, Brachiopoda, and Anthozoa. The wide distribution of the conserved sequences in the animal phylogenetic tree suggested that metazoan ancestors had already acquired a set of conserved domains of the current Msx family genes. Interestingly, although strongly conserved sequences were recovered from the Vertebrata, Cephalochordata, and Anthozoa, the sequences from the Urochordata and Hydrozoa showed weak conservation. Because the Vertebrata-Cephalochordata-Urochordata and Anthozoa-Hydrozoa represent sister groups in the Chordata and Cnidaria, respectively, Msx sequence diversification may have occurred differentially in the course of evolution. We speculate that selective loss of the conserved domains in Msx family

  18. Determination of 5 '-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs

    DEFF Research Database (Denmark)

    Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens

    1999-01-01

    We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...

  19. Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

    Directory of Open Access Journals (Sweden)

    David Karlin

    Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

  20. Advances in the sequencing of the genome of the adenophorean nematode Trichinella spiralis

    OpenAIRE

    Mitreva, M; Jasmer, D P

    2008-01-01

    The adenophorean nematodes are evolutionarily distant from other species in the phylum Nematoda. Interspecific comparisons of predicted proteins have supported such an ancient divergence. Accordingly, Trichinella spiralis represents a basal nematode representative for genome sequencing focused on gaining a deeper insight into the evolutionary biology of nematodes. In addition, molecular characteristics that are conserved across the phylum could be of great value for control strategies with br...

  1. An androgen receptor NH2-terminal conserved motif interacts with the COOH terminus of the Hsp70-interacting protein (CHIP).

    Science.gov (United States)

    He, Bin; Bai, Suxia; Hnat, Andrew T; Kalman, Rebecca I; Minges, John T; Patterson, Cam; Wilson, Elizabeth M

    2004-07-16

    The NH2-terminal sequence of steroid receptors is highly variable between different receptors and in the same receptor from different species. In this study, a primary sequence homology comparison identified a 14-amino acid NH2-terminal motif of the human androgen receptor (AR) that is common to AR from all species reported, including the lower vertebrates. The evolutionarily conserved motif is unique to AR, with the exception of a partial sequence in the glucocorticoid receptor of higher species. The presence of the conserved motif in AR and the glucocorticoid receptor and its absence in other steroid receptors suggests convergent evolution. The function of the AR NH2-terminal conserved motif was suggested from a yeast two-hybrid screen that identified the COOH terminus of the Hsp70-interacting protein (CHIP) as a binding partner. We found that CHIP functions as a negative regulator of AR transcriptional activity by promoting AR degradation. In support of this, two mutations in the AR NH2-terminal conserved motif previously identified in the transgenic adenocarcinoma of mouse prostate model reduced the interaction between CHIP and AR. Our results suggest that the AR NH2-terminal domain contains an evolutionarily conserved motif that functions to limit AR transcriptional activity. Moreover, we demonstrate that the combination of comparative sequence alignment and yeast two-hybrid screening using short conserved peptides as bait provides an effective strategy to probe the structure-function relationships of steroid receptor NH2-terminal domains and other intrinsically unstructured transcriptional regulatory proteins.

  2. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  3. Structure-Related Roles for the Conservation of the HIV-1 Fusion Peptide Sequence Revealed by Nuclear Magnetic Resonance.

    Science.gov (United States)

    Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles

    2017-10-17

    Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.

  4. Structure-sequence based analysis for identification of conserved regions in proteins

    Science.gov (United States)

    Zemla, Adam T; Zhou, Carol E; Lam, Marisa W; Smith, Jason R; Pardes, Elizabeth

    2013-05-28

    Disclosed are computational methods, and associated hardware and software products for scoring conservation in a protein structure based on a computationally identified family or cluster of protein structures. A method of computationally identifying a family or cluster of protein structures in also disclosed herein.

  5. Conservation of Shannon's redundancy for proteins. [information theory applied to amino acid sequences

    Science.gov (United States)

    Gatlin, L. L.

    1974-01-01

    Concepts of information theory are applied to examine various proteins in terms of their redundancy in natural originators such as animals and plants. The Monte Carlo method is used to derive information parameters for random protein sequences. Real protein sequence parameters are compared with the standard parameters of protein sequences having a specific length. The tendency of a chain to contain some amino acids more frequently than others and the tendency of a chain to contain certain amino acid pairs more frequently than other pairs are used as randomness measures of individual protein sequences. Non-periodic proteins are generally found to have random Shannon redundancies except in cases of constraints due to short chain length and genetic codes. Redundant characteristics of highly periodic proteins are discussed. A degree of periodicity parameter is derived.

  6. Identification and characterization of novel and conserved microRNAs in radish (Raphanus sativus L.) using high-throughput sequencing.

    Science.gov (United States)

    Xu, Liang; Wang, Yan; Xu, Yuanyuan; Wang, Liangju; Zhai, Lulu; Zhu, Xianwen; Gong, Yiqin; Ye, Shan; Liu, Liwang

    2013-03-01

    MicroRNAs (miRNAs) are endogenous, non-coding, small RNAs that play significant regulatory roles in plant growth, development, and biotic and abiotic stress responses. To date, a great number of conserved and species-specific miRNAs have been identified in many important plant species such as Arabidopsis, rice and poplar. However, little is known about identification of miRNAs and their target genes in radish (Raphanus sativus L.). In the present study, a small RNA library from radish root was constructed and sequenced using the high-throughput Solexa sequencing. Through sequence alignment and secondary structure prediction, a total of 545 conserved miRNA families as well as 15 novel (with their miRNA* strand) and 64 potentially novel miRNAs were identified. Quantitative real-time PCR (qRT-PCR) analysis confirmed that both conserved and novel miRNAs were expressed in radish, and some of them were preferentially expressed in certain tissues. A total of 196 potential target genes were predicted for 42 novel radish miRNAs. Gene ontology (GO) analysis showed that most of the targets were involved in plant growth, development, metabolism and stress responses. This study represents a first large-scale identification and characterization of radish miRNAs and their potential target genes. These results could lead to the further identification of radish miRNAs and enhance our understanding of radish miRNA regulatory mechanisms in diverse biological and metabolic processes. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  8. Seminal-type ribonuclease genes in ruminants, sequence conservation without protein expression?

    Science.gov (United States)

    Kleineidam, R G; Jekel, P A; Beintema, J J; Situmorang, P

    1999-04-29

    Bovine seminal ribonuclease (BS-RNase) is an interesting enzyme both for functional and structural reasons. The enzyme is the product of a gene duplication that occurred in an ancestral ruminant. It is possible to demonstrate the presence of seminal-type genes in all other investigated ruminant species, but they are not expressed and show features of pseudogenes. In this paper we report the determination of two pancreatic and one seminal-type ribonuclease gene sequences of swamp-type water buffalo (Bubalus bubalis). The two pancreatic sequences encode proteins with identical amino acid sequences as previously determined for the enzymes isolated from swamp-type and river-type water buffalo, respectively. The seminal-type sequence has no pseudogene features and codes for an enzyme with no unusual features compared with the active bovine enzyme, except for the replacement of one of the cysteines which takes part in the two intersubunit disulfide bridges. However, Western blotting demonstrates the presence of only small amounts of the pancreatic enzymes in water buffalo semen, suggesting that also in this species the seminal-type sequence is not expressed. But it is still possible that the gene is expressed somewhere else in the body or during development. Reconstruction of seminal-type ribonuclease sequences in ancestors of Bovinae and Bovidae indicates no serious abnormalities in the encoded proteins and leads us to the hypothesis that the ruminant seminal-type ribonuclease gene has not come to expression during most of its evolutionary history, but did not exhibit a high evolutionary rate that is generally observed in pseudogenes.

  9. Conservation of the C-type lectin fold for massive sequence variation in a Treponema diversity-generating retroelement

    Energy Technology Data Exchange (ETDEWEB)

    Le Coq, Johanne; Ghosh, Partho (UCSD)

    2012-06-19

    Anticipatory ligand binding through massive protein sequence variation is rare in biological systems, having been observed only in the vertebrate adaptive immune response and in a phage diversity-generating retroelement (DGR). Earlier work has demonstrated that the prototypical DGR variable protein, major tropism determinant (Mtd), meets the demands of anticipatory ligand binding by novel means through the C-type lectin (CLec) fold. However, because of the low sequence identity among DGR variable proteins, it has remained unclear whether the CLec fold is a general solution for DGRs. We have addressed this problem by determining the structure of a second DGR variable protein, TvpA, from the pathogenic oral spirochete Treponema denticola. Despite its weak sequence identity to Mtd ({approx}16%), TvpA was found to also have a CLec fold, with predicted variable residues exposed in a ligand-binding site. However, this site in TvpA was markedly more variable than the one in Mtd, reflecting the unprecedented approximate 10{sup 20} potential variability of TvpA. In addition, similarity between TvpA and Mtd with formylglycine-generating enzymes was detected. These results provide strong evidence for the conservation of the formylglycine-generating enzyme-type CLec fold among DGRs as a means of accommodating massive sequence variation.

  10. Expression of cassini, a murine gamma-satellite sequence conserved in evolution, is regulated in normal and malignant hematopoietic cells.

    Science.gov (United States)

    Arutyunyan, Anna; Stoddart, Sonia; Yi, Sun-ju; Fei, Fei; Lim, Min; Groffen, Paula; Feldhahn, Niklas; Groffen, John; Heisterkamp, Nora

    2012-08-23

    Acute lymphoblastic leukemia (ALL) cells treated with drugs can become drug-tolerant if co-cultured with protective stromal mouse embryonic fibroblasts (MEFs). We performed transcriptional profiling on these stromal fibroblasts to investigate if they were affected by the presence of drug-treated ALL cells. These mitotically inactivated MEFs showed few changes in gene expression, but a family of sequences of which transcription is significantly increased was identified. A sequence related to this family, which we named cassini, was selected for further characterization. We found that cassini was highly upregulated in drug-treated ALL cells. Analysis of RNAs from different normal mouse tissues showed that cassini expression is highest in spleen and thymus, and can be further enhanced in these organs by exposure of mice to bacterial endotoxin. Heat shock, but not other types of stress, significantly induced the transcription of this locus in ALL cells. Transient overexpression of cassini in human 293 embryonic kidney cells did not increase the cytotoxic or cytostatic effects of chemotherapeutic drugs but provided some protection. Database searches revealed that sequences highly homologous to cassini are present in rodents, apicomplexans, flatworms and primates, indicating that they are conserved in evolution. Moreover, CASSINI RNA was induced in human ALL cells treated with vincristine. Surprisingly, cassini belongs to the previously reported murine family of γ-satellite/major satellite DNA sequences, which were not known to be present in other species. Our results show that the transcription of at least one member of these sequences is regulated, suggesting that this has a function in normal and transformed immune cells. Expression of these sequences may protect cells when they are exposed to specific stress stimuli.

  11. Expression of cassini, a murine gamma-satellite sequence conserved in evolution, is regulated in normal and malignant hematopoietic cells

    Directory of Open Access Journals (Sweden)

    Arutyunyan Anna

    2012-08-01

    Full Text Available Abstract Background Acute lymphoblastic leukemia (ALL cells treated with drugs can become drug-tolerant if co-cultured with protective stromal mouse embryonic fibroblasts (MEFs. Results We performed transcriptional profiling on these stromal fibroblasts to investigate if they were affected by the presence of drug-treated ALL cells. These mitotically inactivated MEFs showed few changes in gene expression, but a family of sequences of which transcription is significantly increased was identified. A sequence related to this family, which we named cassini, was selected for further characterization. We found that cassini was highly upregulated in drug-treated ALL cells. Analysis of RNAs from different normal mouse tissues showed that cassini expression is highest in spleen and thymus, and can be further enhanced in these organs by exposure of mice to bacterial endotoxin. Heat shock, but not other types of stress, significantly induced the transcription of this locus in ALL cells. Transient overexpression of cassini in human 293 embryonic kidney cells did not increase the cytotoxic or cytostatic effects of chemotherapeutic drugs but provided some protection. Database searches revealed that sequences highly homologous to cassini are present in rodents, apicomplexans, flatworms and primates, indicating that they are conserved in evolution. Moreover, CASSINI RNA was induced in human ALL cells treated with vincristine. Surprisingly, cassini belongs to the previously reported murine family of γ-satellite/major satellite DNA sequences, which were not known to be present in other species. Conclusions Our results show that the transcription of at least one member of these sequences is regulated, suggesting that this has a function in normal and transformed immune cells. Expression of these sequences may protect cells when they are exposed to specific stress stimuli.

  12. A conserved unusual posttranscriptional processing mediated by short, direct repeated (SDR) sequences in plants.

    Science.gov (United States)

    Niu, Xiangli; Luo, Di; Gao, Shaopei; Ren, Guangjun; Chang, Lijuan; Zhou, Yuke; Luo, Xiaoli; Li, Yuxiang; Hou, Pei; Tang, Wei; Lu, Bao-Rong; Liu, Yongsheng

    2010-01-01

    In several stress responsive gene loci of monocot cereal crops, we have previously identified an unusual posttranscriptional processing mediated by paired presence of short direct repeated (SDR) sequences at 5' and 3' splicing junctions that are distinct from conventional (U2/U12-type) splicing boundaries. By using the known SDR-containing sequences as probes, 24 plant candidate genes involved in diverse functional pathways from both monocots and dicots that potentially possess SDR-mediated posttranscriptional processing were predicted in the GenBank database. The SDRs-mediated posttranscriptional processing events including cis- and trans-actions were experimentally detected in majority of the predicted candidates. Extensive sequence analysis demonstrates several types of SDR-associated splicing peculiarities including partial exon deletion, exon fragment repetition, exon fragment scrambling and trans-splicing that result in either loss of partial exon or unusual exonic sequence rearrangements within or between RNA molecules. In addition, we show that the paired presence of SDR is necessary but not sufficient in SDR-mediated splicing in transient expression and stable transformation systems. We also show prokaryote is incapable of SDR-mediated premRNA splicing. Copyright 2010 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  13. An atlas of over 90.000 conserved noncoding sequences provides insight into crucifer regulatory regions

    NARCIS (Netherlands)

    Haudry, A.; Platts, A.E.; Vello, E.; Hoen, D.R.; Leclerq, M.; Williamson, R.J.; Forczek, E.; Joly-Lopez, Z.; Steffen, J.G.; Hazzouri, K.M.; Dewar, K.; Stinchcombe, J.R.; Schoen, D.J.; Wang, X.; Schmutz, J.; Town, C.D.; Edger, P.P.; Pires, J.C.; Schumaker, K.S.; Jarvis, D.E.; Mandakova, T.; Lysak, M.; Bergh, van den E.; Schranz, M.E.; Harrison, P.M.

    2013-01-01

    Despite the central importance of noncoding DNA to gene regulation and evolution, understanding of the extent of selection on plant noncoding DNA remains limited compared to that of other organisms. Here we report sequencing of genomes from three Brassicaceae species (Leavenworthia alabamica,

  14. Sequence divergence and conservation in genomes of Helicobacter cetorum strains from a dolphin and a whale.

    Science.gov (United States)

    Kersulyte, Dangeruta; Rossi, Mirko; Berg, Douglas E

    2013-01-01

    Strains of Helicobacter cetorum have been cultured from several marine mammals and have been found to be closely related in 16 S rDNA sequence to the human gastric pathogen H. pylori, but their genomes were not characterized further. The genomes of H. cetorum strains from a dolphin and a whale were sequenced completely using 454 technology and PCR and capillary sequencing. These genomes are 1.8 and 1.95 mb in size, some 7-26% larger than H. pylori genomes, and differ markedly from one another in gene content, and sequences and arrangements of shared genes. However, each strain is more related overall to H. pylori and its descendant H. acinonychis than to other known species. These H. cetorum strains lack cag pathogenicity islands, but contain novel alleles of the virulence-associated vacuolating cytotoxin (vacA) gene. Of particular note are (i) an extra triplet of vacA genes with ≤50% protein-level identity to each other in the 5' two-thirds of the gene needed for host factor interaction; (ii) divergent sets of outer membrane protein genes; (iii) several metabolic genes distinct from those of H. pylori; (iv) genes for an iron-cofactored urease related to those of Helicobacter species from terrestrial carnivores, in addition to genes for a nickel co-factored urease; and (v) members of the slr multigene family, some of which modulate host responses to infection and improve Helicobacter growth with mammalian cells. Our genome sequence data provide a glimpse into the novelty and great genetic diversity of marine helicobacters. These data should aid further analyses of microbial genome diversity and evolution and infection and disease mechanisms in vast and often fragile ocean ecosystems.

  15. Sequence divergence and conservation in genomes of Helicobacter cetorum strains from a dolphin and a whale.

    Directory of Open Access Journals (Sweden)

    Dangeruta Kersulyte

    Full Text Available Strains of Helicobacter cetorum have been cultured from several marine mammals and have been found to be closely related in 16 S rDNA sequence to the human gastric pathogen H. pylori, but their genomes were not characterized further.The genomes of H. cetorum strains from a dolphin and a whale were sequenced completely using 454 technology and PCR and capillary sequencing.These genomes are 1.8 and 1.95 mb in size, some 7-26% larger than H. pylori genomes, and differ markedly from one another in gene content, and sequences and arrangements of shared genes. However, each strain is more related overall to H. pylori and its descendant H. acinonychis than to other known species. These H. cetorum strains lack cag pathogenicity islands, but contain novel alleles of the virulence-associated vacuolating cytotoxin (vacA gene. Of particular note are (i an extra triplet of vacA genes with ≤50% protein-level identity to each other in the 5' two-thirds of the gene needed for host factor interaction; (ii divergent sets of outer membrane protein genes; (iii several metabolic genes distinct from those of H. pylori; (iv genes for an iron-cofactored urease related to those of Helicobacter species from terrestrial carnivores, in addition to genes for a nickel co-factored urease; and (v members of the slr multigene family, some of which modulate host responses to infection and improve Helicobacter growth with mammalian cells.Our genome sequence data provide a glimpse into the novelty and great genetic diversity of marine helicobacters. These data should aid further analyses of microbial genome diversity and evolution and infection and disease mechanisms in vast and often fragile ocean ecosystems.

  16. Peptomics, identification of novel cationic Arabidopsis peptides with conserved sequence motifs

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Mundy, John; Skriver, Karen

    2002-01-01

    Few plant peptides involved in intercellular communication have been experimentally isolated. Sequence analysis of the Arabidopsis thaliana genome has revealed numerous transmembrane receptors predicted to bind proteinacious ligands, emphasizing the importance of identifying peptides with signaling...... initially performed a systematic analysis of short polypeptides encoded by annotated genes on two Arabidopsis chromosomes using SignalP to identify potentially secreted peptides. Subsequent homology searches with selected, putatively secreted peptides, led to the identification of a potential, large...... function. Annotation of the Arabidopsis genome sequence has made it possible to identify peptide-encoding genes. However, such annotational identification is impeded because small genes are poorly predicted by gene-prediction algorithms, thus prompting the alternative approaches described here. We...

  17. The First Myriapod Genome Sequence Reveals Conservative Arthropod Gene Content and Genome Organisation in the Centipede Strigamia maritima

    Science.gov (United States)

    Chipman, Ariel D.; Ferrier, David E. K.; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S. T.; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C.; Alonso, Claudio R.; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C. J.; Blankenburg, Kerstin P.; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K.; Du Pasquier, Louis; Duncan, Elizabeth J.; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D.; Extavour, Cassandra G.; Francisco, Liezl; Gabaldón, Toni; Gillis, William J.; Goodwin-Horn, Elizabeth A.; Green, Jack E.; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J. P.; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H. L.; Hunn, Julia P.; Hunnekuhl, Vera S.; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N.; Jiggins, Francis M.; Jones, Tamsin E.; Kaiser, Tobias S.; Kalra, Divya; Kenny, Nathan J.; Korchina, Viktoriya; Kovar, Christie L.; Kraus, F. Bernhard; Lapraz, François; Lee, Sandra L.; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N.; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J.; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H.; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C.; Robertson, Helen E.; Robertson, Hugh M.; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E.; Schurko, Andrew M.; Siggens, Kenneth W.; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J.; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M.; Willis, Judith H.; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M.; Worley, Kim C.; Gibbs, Richard A.; Akam, Michael; Richards, Stephen

    2014-01-01

    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations to its specific

  18. The first myriapod genome sequence reveals conservative arthropod gene content and genome organisation in the centipede Strigamia maritima.

    Directory of Open Access Journals (Sweden)

    Ariel D Chipman

    2014-11-01

    Full Text Available Myriapods (e.g., centipedes and millipedes display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations

  19. Polymorphic duplicate genes and persistent non-coding sequences reveal heterogeneous patterns of mitochondrial DNA loss in salamanders

    OpenAIRE

    Chong, Rebecca A.; Mueller, Rachel Lockridge

    2017-01-01

    Background Mitochondria are the site of the citric acid cycle and oxidative phosphorylation (OXPHOS). In metazoans, the mitochondrial genome is a small, circular molecule averaging 16.5 kb in length. Despite evolutionarily conserved gene content, metazoan mitochondrial genomes show a diversity of gene orders most commonly explained by the duplication-random loss (DRL) model. In the DRL model, (1) a sequence of genes is duplicated in tandem, (2) one paralog sustains a loss-of-function mutation...

  20. Comparative Mitogenomics of the Genus Odontobutis (Perciformes: Gobioidei: Odontobutidae) Revealed Conserved Gene Rearrangement and High Sequence Variations.

    Science.gov (United States)

    Ma, Zhihong; Yang, Xuefen; Bercsenyi, Miklos; Wu, Junjie; Yu, Yongyao; Wei, Kaijian; Fan, Qixue; Yang, Ruibin

    2015-10-20

    To understand the molecular evolution of mitochondrial genomes (mitogenomes) in the genus Odontobutis, the mitogenome of Odontobutis yaluensis was sequenced and compared with those of another four Odontobutis species. Our results displayed similar mitogenome features among species in genome organization, base composition, codon usage, and gene rearrangement. The identical gene rearrangement of trnS-trnL-trnH tRNA cluster observed in mitogenomes of these five closely related freshwater sleepers suggests that this unique gene order is conserved within Odontobutis. Additionally, the present gene order and the positions of associated intergenic spacers of these Odontobutis mitogenomes indicate that this unusual gene rearrangement results from tandem duplication and random loss of large-scale gene regions. Moreover, these mitogenomes exhibit a high level of sequence variation, mainly due to the differences of corresponding intergenic sequences in gene rearrangement regions and the heterogeneity of tandem repeats in the control regions. Phylogenetic analyses support Odontobutis species with shared gene rearrangement forming a monophyletic group, and the interspecific phylogenetic relationships are associated with structural differences among their mitogenomes. The present study contributes to understanding the evolutionary patterns of Odontobutidae species.

  1. Horse domestication and conservation genetics of Przewalski's horse inferred from sex chromosomal and autosomal sequences.

    Science.gov (United States)

    Lau, Allison N; Peng, Lei; Goto, Hiroki; Chemnick, Leona; Ryder, Oliver A; Makova, Kateryna D

    2009-01-01

    Despite their ability to interbreed and produce fertile offspring, there is continued disagreement about the genetic relationship of the domestic horse (Equus caballus) to its endangered wild relative, Przewalski's horse (Equus przewalskii). Analyses have differed as to whether or not Przewalski's horse is placed phylogenetically as a separate sister group to domestic horses. Because Przewalski's horse and domestic horse are so closely related, genetic data can also be used to infer domestication-specific differences between the two. To investigate the genetic relationship of Przewalski's horse to the domestic horse and to address whether evolution of the domestic horse is driven by males or females, five homologous introns (a total of approximately 3 kb) were sequenced on the X and Y chromosomes in two Przewalski's horses and three breeds of domestic horses: Arabian horse, Mongolian domestic horse, and Dartmoor pony. Five autosomal introns (a total of approximately 6 kb) were sequenced for these horses as well. The sequences of sex chromosomal and autosomal introns were used to determine nucleotide diversity and the forces driving evolution in these species. As a result, X chromosomal and autosomal data do not place Przewalski's horses in a separate clade within phylogenetic trees for horses, suggesting a close relationship between domestic and Przewalski's horses. It was also found that there was a lack of nucleotide diversity on the Y chromosome and higher nucleotide diversity than expected on the X chromosome in domestic horses as compared with the Y chromosome and autosomes. This supports the hypothesis that very few male horses along with numerous female horses founded the various domestic horse breeds. Patterns of nucleotide diversity among different types of chromosomes were distinct for Przewalski's in contrast to domestic horses, supporting unique evolutionary histories of the two species.

  2. [Prognostic value of sequencing of radiotherapy and chemotherapy following breast-conserving surgery for patients with breast cancer].

    Science.gov (United States)

    Zhong, Q Z; Wang, Z; Tang, Y; Rong, Q L; Wang, S L; Jin, J; Wang, W H; Liu, Y P; Song, Y W; Fang, H; Chen, B; Qi, S N; Li, N; Tang, Y; Zhang, J H; Li, Y X

    2017-04-23

    Objective: To evaluate the prognostic value of sequencing of adjuvant radiotherapy and chemotherapy following breast-conserving surgery for patients with breast cancer. Methods: A total of 1 154 patients withT1-2N0-3M0 breast cancer retrospectively reviewed. All patients received sequential radiotherapy and chemotherapy following breast-conserving surgery. Among them, 603 patients received radiotherapy first and 551 patients received chemotherapy first. Log-rank tests were used to determine significance of disease-free survival (DFS) and overall survival (OS) rates in the Kaplan-Meier curve. Results: The 5-year DFS and OS rates for all patients were 93.0% and 97.8%. The 5-year OS rate was 98.6% in the radiotherapy first group and 96.4% in the chemotherapy first group (P=0.191), and the corresponding DFS rate was 92.7% and 93.2% (P=0.430), respectively. Among the patients with Luminal A subtype, the 5-year OS rate was 99.6% in the radiotherapy first group and 97.8% in the chemotherapy first group (P=0.789). Among the patients with Luminal B subtype, the 5-year OS rate was 94.2% and 96.0%, respectively (P=0.680). Among the patients with triple negative breast cancer, the 5-year OS rate was 100% and 90.9%, respectively, with statistically significant differences (P=0.019). Among the patients with HER-2 positive breast cancer, The 5-year DFS rate was 80.1% and 100%, respectively (P=0.045). Conclusions: The OS and DFS rates in the chemotherapy first group are not significantly different from those of radiotherapy first group after breast-conserving surgery. Patients with HER-2 positive breast cancer in chemotherapy first group have a much higher DFS rate than that of radiotherapy first group, whereas patients with triple negative breast cancer in radiotherapy first group have a better OS rate than that of chemotherapy first group. Further research is warranted to investigate the benefit of different molecular types in different sequencing of radiotherapy and

  3. SNPs in Multi-Species Conserved Sequences (MCS as useful markers in association studies: a practical approach

    Directory of Open Access Journals (Sweden)

    Pericak-Vance Margaret A

    2007-08-01

    Full Text Available Abstract Background Although genes play a key role in many complex diseases, the specific genes involved in most complex diseases remain largely unidentified. Their discovery will hinge on the identification of key sequence variants that are conclusively associated with disease. While much attention has been focused on variants in protein-coding DNA, variants in noncoding regions may also play many important roles in complex disease by altering gene regulation. Since the vast majority of noncoding genomic sequence is of unknown function, this increases the challenge of identifying "functional" variants that cause disease. However, evolutionary conservation can be used as a guide to indicate regions of noncoding or coding DNA that are likely to have biological function, and thus may be more likely to harbor SNP variants with functional consequences. To help bias marker selection in favor of such variants, we devised a process that prioritizes annotated SNPs for genotyping studies based on their location within Multi-species Conserved Sequences (MCSs and used this process to select SNPs in a region of linkage to a complex disease. This allowed us to evaluate the utility of the chosen SNPs for further association studies. Previously, a region of chromosome 1q43 was linked to Multiple Sclerosis (MS in a genome-wide screen. We chose annotated SNPs in the region based on location within MCSs (termed MCS-SNPs. We then obtained genotypes for 478 MCS-SNPs in 989 individuals from MS families. Results Analysis of our MCS-SNP genotypes from the 1q43 region and comparison to HapMap data confirmed that annotated SNPs in MCS regions are frequently polymorphic and show subtle signatures of selective pressure, consistent with previous reports of genome-wide variation in conserved regions. We also present an online tool that allows MCS data to be directly exported to the UCSC genome browser so that MCS-SNPs can be easily identified within genomic regions of

  4. Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles

    Science.gov (United States)

    Wang, Jianbin; Czech, Benjamin; Crunk, Amanda; Wallace, Adam; Mitreva, Makedonka; Hannon, Gregory J.; Davis, Richard E.

    2011-01-01

    Eukaryotic cells express several classes of small RNAs that regulate gene expression and ensure genome maintenance. Endogenous siRNAs (endo-siRNAs) and Piwi-interacting RNAs (piRNAs) mainly control gene and transposon expression in the germline, while microRNAs (miRNAs) generally function in post-transcriptional gene silencing in both somatic and germline cells. To provide an evolutionary and developmental perspective on small RNA pathways in nematodes, we identified and characterized known and novel small RNA classes through gametogenesis and embryo development in the parasitic nematode Ascaris suum and compared them with known small RNAs of Caenorhabditis elegans. piRNAs, Piwi-clade Argonautes, and other proteins associated with the piRNA pathway have been lost in Ascaris. miRNAs are synthesized immediately after fertilization in utero, before pronuclear fusion, and before the first cleavage of the zygote. This is the earliest expression of small RNAs ever described at a developmental stage long thought to be transcriptionally quiescent. A comparison of the two classes of Ascaris endo-siRNAs, 22G-RNAs and 26G-RNAs, to those in C. elegans, suggests great diversification and plasticity in the use of small RNA pathways during spermatogenesis in different nematodes. Our data reveal conserved characteristics of nematode small RNAs as well as features unique to Ascaris that illustrate significant flexibility in the use of small RNAs pathways, some of which are likely an adaptation to Ascaris' life cycle and parasitism. PMID:21685128

  5. Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

    Directory of Open Access Journals (Sweden)

    Apurva Barve

    2013-01-01

    Full Text Available Xeroderma pigmentosum group A (XPA is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1 and replication protein A 70 kDa subunit (RPA70 proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  6. Structural and sequence similarities of hydra xeroderma pigmentosum A protein to human homolog suggest early evolution and conservation.

    Science.gov (United States)

    Barve, Apurva; Ghaskadbi, Saroj; Ghaskadbi, Surendra

    2013-01-01

    Xeroderma pigmentosum group A (XPA) is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER) pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1) and replication protein A 70 kDa subunit (RPA70) proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  7. Identification of specific gene sequences conserved in contemporary epidemic strains of Salmonella enterica.

    Science.gov (United States)

    Kang, Min-Su; Besser, Thomas E; Hancock, Dale D; Porwollik, Steffen; McClelland, Michael; Call, Douglas R

    2006-11-01

    Genetic elements specific to recent and contemporary epidemic strains of Salmonella enterica were identified using comparative genomic analysis. Two epidemic multidrug-resistant (MDR) strains, MDR Salmonella enterica serovar Typhimurium definitive phage type 104 (DT104) and cephalosporin-resistant MDR Salmonella enterica serovar Newport, and an epidemic pansusceptible strain, Salmonella serovar Typhimurium DT160, were subjected to Salmonella gene microarray and suppression subtractive hybridization analyses. Their genome contents were compared with those of coexisting sporadic strains matched by serotype, geographic and temporal distribution, and host species origin. These paired comparisons revealed that epidemic strains of S. enterica had specific genes and gene regions that were shared by isolates of the same subtype. Most of these gene sequences are related to mobile genetic elements, including phages, plasmids, and plasmid-like and transposable elements, and some genes may encode proteins conferring growth or survival advantages. The emergence of epidemic MDR strains may therefore be associated with the presence of fitness-associated genetic factors in addition to their antimicrobial resistance genes.

  8. Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development

    Directory of Open Access Journals (Sweden)

    Wang Yen-Yi

    2011-04-01

    Full Text Available Abstract Background Flower development in kiwifruit (Actinidia spp. is initiated in the first growing season, when undifferentiated primordia are established in latent shoot buds. These primordia can differentiate into flowers in the second growing season, after the winter dormancy period and upon accumulation of adequate winter chilling. Kiwifruit is an important horticultural crop, yet little is known about the molecular regulation of flower development. Results To study kiwifruit flower development, nine MADS-box genes were identified and functionally characterized. Protein sequence alignment, phenotypes obtained upon overexpression in Arabidopsis and expression patterns suggest that the identified genes are required for floral meristem and floral organ specification. Their role during budbreak and flower development was studied. A spontaneous kiwifruit mutant was utilized to correlate the extended expression domains of these flowering genes with abnormal floral development. Conclusions This study provides a description of flower development in kiwifruit at the molecular level. It has identified markers for flower development, and candidates for manipulation of kiwifruit growth, phase change and time of flowering. The expression in normal and aberrant flowers provided a model for kiwifruit flower development.

  9. Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development.

    Science.gov (United States)

    Varkonyi-Gasic, Erika; Moss, Sarah M; Voogd, Charlotte; Wu, Rongmei; Lough, Robyn H; Wang, Yen-Yi; Hellens, Roger P

    2011-04-27

    Flower development in kiwifruit (Actinidia spp.) is initiated in the first growing season, when undifferentiated primordia are established in latent shoot buds. These primordia can differentiate into flowers in the second growing season, after the winter dormancy period and upon accumulation of adequate winter chilling. Kiwifruit is an important horticultural crop, yet little is known about the molecular regulation of flower development. To study kiwifruit flower development, nine MADS-box genes were identified and functionally characterized. Protein sequence alignment, phenotypes obtained upon overexpression in Arabidopsis and expression patterns suggest that the identified genes are required for floral meristem and floral organ specification. Their role during budbreak and flower development was studied. A spontaneous kiwifruit mutant was utilized to correlate the extended expression domains of these flowering genes with abnormal floral development. This study provides a description of flower development in kiwifruit at the molecular level. It has identified markers for flower development, and candidates for manipulation of kiwifruit growth, phase change and time of flowering. The expression in normal and aberrant flowers provided a model for kiwifruit flower development.

  10. Comparative analysis of function and interaction of transcription factors in nematodes: Extensive conservation of orthology coupled to rapid sequence evolution

    Directory of Open Access Journals (Sweden)

    Singh Rama S

    2008-08-01

    Full Text Available Abstract Background Much of the morphological diversity in eukaryotes results from differential regulation of gene expression in which transcription factors (TFs play a central role. The nematode Caenorhabditis elegans is an established model organism for the study of the roles of TFs in controlling the spatiotemporal pattern of gene expression. Using the fully sequenced genomes of three Caenorhabditid nematode species as well as genome information from additional more distantly related organisms (fruit fly, mouse, and human we sought to identify orthologous TFs and characterized their patterns of evolution. Results We identified 988 TF genes in C. elegans, and inferred corresponding sets in C. briggsae and C. remanei, containing 995 and 1093 TF genes, respectively. Analysis of the three gene sets revealed 652 3-way reciprocal 'best hit' orthologs (nematode TF set, approximately half of which are zinc finger (ZF-C2H2 and ZF-C4/NHR types and HOX family members. Examination of the TF genes in C. elegans and C. briggsae identified the presence of significant tandem clustering on chromosome V, the majority of which belong to ZF-C4/NHR family. We also found evidence for lineage-specific duplications and rapid evolution of many of the TF genes in the two species. A search of the TFs conserved among nematodes in Drosophila melanogaster, Mus musculus and Homo sapiens revealed 150 reciprocal orthologs, many of which are associated with important biological processes and human diseases. Finally, a comparison of the sequence, gene interactions and function indicates that nematode TFs conserved across phyla exhibit significantly more interactions and are enriched in genes with annotated mutant phenotypes compared to those that lack orthologs in other species. Conclusion Our study represents the first comprehensive genome-wide analysis of TFs across three nematode species and other organisms. The findings indicate substantial conservation of transcription

  11. Evolution of beta-amylase: patterns of variation and conservation in subfamily sequences in relation to parsimony mechanisms.

    Science.gov (United States)

    Pujadas, G; Ramírez, F M; Valero, R; Palau, J

    1996-08-01

    Soybean and sweet potato beta-amylases are structured as alpha/beta barrels and the same kind of folding may account for all known beta-amylases. We provide a comprehensive analysis of both protein and DNA (coding region) sequences of beta-amylases. The aim of the study is to contribute to the knowledge of the evolutionary molecular relationships among all known beta-amylases. Our approach combines the identification of the putative eightfold structural core formed by beta-strands with a complete multi-alignment analysis of all known sequences. Comparing putative beta-amylase (alpha/beta)8 cores from plants and microorganisms, two differentiated versions of residues at the packing sites, and a unique set of eight identical residues at the C-terminal catalytical site are observed, indicating early evolutionary divergence and absence of localized three-dimensional evolution, respectively. A new analytical approach has been developed in order to work out conserved motifs for beta-amylases, mostly related with the enzyme activity. This approach appears useful as a new routine to find sets of motifs (each set being known as a fingerprint) in protein families. We demonstrate that the evolutionary mechanism for beta-amylases is a combination of parsimonious divergence at three distinguishable rates in relation to the functional signatures, the barrel scaffold, and alpha-helix-containing loops.

  12. The putative Leishmania telomerase RNA (LeishTER undergoes trans-splicing and contains a conserved template sequence.

    Directory of Open Access Journals (Sweden)

    Elton J R Vasconcelos

    Full Text Available Telomerase RNAs (TERs are highly divergent between species, varying in size and sequence composition. Here, we identify a candidate for the telomerase RNA component of Leishmania genus, which includes species that cause leishmaniasis, a neglected tropical disease. Merging a thorough computational screening combined with RNA-seq evidence, we mapped a non-coding RNA gene localized in a syntenic locus on chromosome 25 of five Leishmania species that shares partial synteny with both Trypanosoma brucei TER locus and a putative TER candidate-containing locus of Crithidia fasciculata. Using target-driven molecular biology approaches, we detected a ∼2,100 nt transcript (LeishTER that contains a 5' spliced leader (SL cap, a putative 3' polyA tail and a predicted C/D box snoRNA domain. LeishTER is expressed at similar levels in the logarithmic and stationary growth phases of promastigote forms. A 5'SL capped LeishTER co-immunoprecipitated and co-localized with the telomerase protein component (TERT in a cell cycle-dependent manner. Prediction of its secondary structure strongly suggests the existence of a bona fide single-stranded template sequence and a conserved C[U/C]GUCA motif-containing helix II, representing the template boundary element. This study paves the way for further investigations on the biogenesis of parasite TERT ribonucleoproteins (RNPs and its role in parasite telomere biology.

  13. Sex-biased gene expression and sequence conservation in Atlantic and Pacific salmon lice (Lepeophtheirus salmonis).

    Science.gov (United States)

    Poley, Jordan D; Sutherland, Ben J G; Jones, Simon R M; Koop, Ben F; Fast, Mark D

    2016-07-04

    Salmon lice, Lepeophtheirus salmonis (Copepoda: Caligidae), are highly important ectoparasites of farmed and wild salmonids, and cause multi-million dollar losses to the salmon aquaculture industry annually. Salmon lice display extensive sexual dimorphism in ontogeny, morphology, physiology, behavior, and more. Therefore, the identification of transcripts with differential expression between males and females (sex-biased transcripts) may help elucidate the relationship between sexual selection and sexually dimorphic characteristics. Sex-biased transcripts were identified from transcriptome analyses of three L. salmonis populations, including both Atlantic and Pacific subspecies. A total of 35-43 % of all quality-filtered transcripts were sex-biased in L. salmonis, with male-biased transcripts exhibiting higher fold change than female-biased transcripts. For Gene Ontology and functional analyses, a consensus-based approach was used to identify concordantly differentially expressed sex-biased transcripts across the three populations. A total of 127 male-specific transcripts (i.e. those without detectable expression in any female) were identified, and were enriched with reproductive functions (e.g. seminal fluid and male accessory gland proteins). Other sex-biased transcripts involved in morphogenesis, feeding, energy generation, and sensory and immune system development and function were also identified. Interestingly, as observed in model systems, male-biased L. salmonis transcripts were more frequently without annotation compared to female-biased or unbiased transcripts, suggesting higher rates of sequence divergence in male-biased transcripts. Transcriptome differences between male and female L. salmonis described here provide key insights into the molecular mechanisms controlling sexual dimorphism in L. salmonis. This analysis offers targets for parasite control and provides a foundation for further analyses exploring critical topics such as the interaction

  14. Inverse statistical physics of protein sequences: a key issues review

    Science.gov (United States)

    Cocco, Simona; Feinauer, Christoph; Figliuzzi, Matteo; Monasson, Rémi; Weigt, Martin

    2018-03-01

    In the course of evolution, proteins undergo important changes in their amino acid sequences, while their three-dimensional folded structure and their biological function remain remarkably conserved. Thanks to modern sequencing techniques, sequence data accumulate at unprecedented pace. This provides large sets of so-called homologous, i.e. evolutionarily related protein sequences, to which methods of inverse statistical physics can be applied. Using sequence data as the basis for the inference of Boltzmann distributions from samples of microscopic configurations or observables, it is possible to extract information about evolutionary constraints and thus protein function and structure. Here we give an overview over some biologically important questions, and how statistical-mechanics inspired modeling approaches can help to answer them. Finally, we discuss some open questions, which we expect to be addressed over the next years.

  15. Inverse Statistical Physics of Protein Sequences: A Key Issues Review.

    Science.gov (United States)

    Cocco, S; Feinauer, Christoph; Figliuzzi, Matteo; Monasson, Remi; Weigt, Martin

    2017-11-09

    In the course of evolution, proteins undergo important changes in their amino-acid sequences, while their three-dimensional folded structure and their biological function remain remarkably conserved. Thanks to modern sequencing techniques, sequence data accumulate at unprecedented pace. This provides large sets of so-called homologous, i.e.~evolutionarily related protein sequences, to which methods of inverse statistical physics can be applied. Using sequence data as the basis for the inference of Boltzmann distributions from samples of microscopic configurations or observables, it is possible to extract information about evolutionary constraints and thus protein function and structure. Here we give an overview over some biologically important questions, and how statistical-mechanics inspired modeling approaches can help to answer them. Finally, we discuss some open questions, which we expect to be addressed over the next years. © 2017 IOP Publishing Ltd.

  16. Solexa sequencing identification of conserved and novel microRNAs in backfat of Large White and Chinese Meishan pigs.

    Directory of Open Access Journals (Sweden)

    Chen Chen

    Full Text Available The domestic pig (Sus scrofa, an important species in animal production industry, is a right model for studying adipogenesis and fat deposition. In order to expand the repertoire of porcine miRNAs and further explore potential regulatory miRNAs which have influence on adipogenesis, high-throughput Solexa sequencing approach was adopted to identify miRNAs in backfat of Large White (lean type pig and Meishan pigs (Chinese indigenous fatty pig. We identified 215 unique miRNAs comprising 75 known pre-miRNAs, of which 49 miRNA*s were first identified in our study, 73 miRNAs were overlapped in both libraries, and 140 were novelly predicted miRNAs, and 215 unique miRNAs were collectively corresponding to 235 independent genomic loci. Furthermore, we analyzed the sequence variations, seed edits and phylogenetic development of the miRNAs. 17 miRNAs were widely conserved from vertebrates to invertebrates, suggesting that these miRNAs may serve as potential evolutional biomarkers. 9 conserved miRNAs with significantly differential expressions were determined. The expression of miR-215, miR-135, miR-224 and miR-146b was higher in Large White pigs, opposite to the patterns shown by miR-1a, miR-133a, miR-122, miR-204 and miR-183. Almost all novel miRNAs could be considered pig-specific except ssc-miR-1343, miR-2320, miR-2326, miR-2411 and miR-2483 which had homologs in Bos taurus, among which ssc-miR-1343, miR-2320, miR-2411 and miR-2483 were validated in backfat tissue by stem-loop qPCR. Our results displayed a high level of concordance between the qPCR and Solexa sequencing method in 9 of 10 miRNAs comparisons except for miR-1a. Moreover, we found 2 miRNAs, miR-135 and miR-183, may exert impacts on porcine backfat development through WNT signaling pathway. In conclusion, our research develops porcine miRNAs and should be beneficial to study the adipogenesis and fat deposition of different pig breeds based on miRNAs.

  17. HMMerThread: detecting remote, functional conserved domains in entire genomes by combining relaxed sequence-database searches with fold recognition.

    Directory of Open Access Journals (Sweden)

    Charles Richard Bradshaw

    Full Text Available Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10, a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in

  18. Asymmetrical distribution of non-conserved regulatory sequences at PHOX2B is reflected at the ENCODE loci and illuminates a possible genome-wide trend

    Directory of Open Access Journals (Sweden)

    McCallion Andrew S

    2009-01-01

    Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in

  19. Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

    Directory of Open Access Journals (Sweden)

    Santos Carlos A.F.

    2002-01-01

    Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

  20. Sequence conservation, HLA-E-Restricted peptide, and best-defined CTL/CD8+ epitopes in gag P24 (capsid) of HIV-1 subtype B

    Science.gov (United States)

    Prasetyo, Afiono Agung; Dharmawan, Ruben; Sari, Yulia; Sariyatun, Ratna

    2017-02-01

    Human immunodeficiency virus type 1 (HIV-1) remains a cause of global health problem. Continuous studies of HIV-1 genetic and immunological profiles are important to find strategies against the virus. This study aimed to conduct analysis of sequence conservation, HLA-E-restricted peptide, and best-defined CTL/CD8+ epitopes in p24 (capsid) of HIV-1 subtype B worldwide. The p24-coding sequences from 3,557 HIV subtype B isolates were aligned using MUSCLE and analysed. Some highly conserved regions (sequence conservation ≥95%) were observed. Two considerably long series of sequences with conservation of 100% was observed at base 349-356 and 550-557 of p24 (HXB2 numbering). The consensus from all aligned isolates was precisely the same as consensus B in the Los Alamos HIV Database. The HLA-E-restricted peptide in amino acid (aa) 14-22 of HIV-1 p24 (AISPRTLNA) was found in 55.9% (1,987/3,557) of HIV-1 subtype B worldwide. Forty-four best-defined CTL/CD8+ epitopes were observed, in which VKNWMTETL epitope (aa 181-189 of p24) restricted by B*4801 was the most frequent, as found in 94.9% of isolates. The results of this study would contribute information about HIV-1 subtype B and benefits for further works willing to develop diagnostic and therapeutic strategies against the virus.

  1. A conserved predicted pseudoknot in the NS2A-encoding sequence of West Nile and Japanese encephalitis flaviviruses suggests NS1' may derive from ribosomal frameshifting

    Directory of Open Access Journals (Sweden)

    Atkins John F

    2009-02-01

    Full Text Available Abstract Japanese encephalitis, West Nile, Usutu and Murray Valley encephalitis viruses form a tight subgroup within the larger Flavivirus genus. These viruses utilize a single-polyprotein expression strategy, resulting in ~10 mature proteins. Plotting the conservation at synonymous sites along the polyprotein coding sequence reveals strong conservation peaks at the very 5' end of the coding sequence, and also at the 5' end of the sequence encoding the NS2A protein. Such peaks are generally indicative of functionally important non-coding sequence elements. The second peak corresponds to a predicted stable pseudoknot structure whose biological importance is supported by compensatory mutations that preserve the structure. The pseudoknot is preceded by a conserved slippery heptanucleotide (Y CCU UUU, thus forming a classical stimulatory motif for -1 ribosomal frameshifting. We hypothesize, therefore, that the functional importance of the pseudoknot is to stimulate a portion of ribosomes to shift -1 nt into a short (45 codon, conserved, overlapping open reading frame, termed foo. Since cleavage at the NS1-NS2A boundary is known to require synthesis of NS2A in cis, the resulting transframe fusion protein is predicted to be NS1-NS2AN-term-FOO. We hypothesize that this may explain the origin of the previously identified NS1 'extension' protein in JEV-group flaviviruses, known as NS1'.

  2. Human T-cell recognition of synthetic peptides representing conserved and variant sequences from the merozoite surface protein 2 of Plasmodium falciparum

    DEFF Research Database (Denmark)

    Theander, T G; Hviid, L; Dodoo, D

    1997-01-01

    . The findings are encouraging for the development of a vaccine based on these T-epitope containing regions of MSP2, as the peptides were broadly recognized suggesting that they can bind to diverse HLA alleles and also because they include conserved MSP2 sequences. Immunisation with a vaccine construct...

  3. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation | Center for Cancer Research

    Science.gov (United States)

    Dubbed "Tom's T" by Dhruba Chattoraj, the unusually conserved thymine at position +7 in bacteriophage P1 plasmid RepA DNA binding sites rises above repressor and acceptor sequence logos. The T appears to represent base flipping prior to helix opening in this DNA replication initation protein.

  4. ELISA: Structure-Function Inferences based on statistically significant and evolutionarily inspired observations

    Directory of Open Access Journals (Sweden)

    DeLisi Charles

    2003-09-01

    Full Text Available Abstract The problem of functional annotation based on homology modeling is primary to current bioinformatics research. Researchers have noted regularities in sequence, structure and even chromosome organization that allow valid functional cross-annotation. However, these methods provide a lot of false negatives due to limited specificity inherent in the system. We want to create an evolutionarily inspired organization of data that would approach the issue of structure-function correlation from a new, probabilistic perspective. Such organization has possible applications in phylogeny, modeling of functional evolution and structural determination. ELISA (Evolutionary Lineage Inferred from Structural Analysis, http://romi.bu.edu/elisa is an online database that combines functional annotation with structure and sequence homology modeling to place proteins into sequence-structure-function "neighborhoods". The atomic unit of the database is a set of sequences and structural templates that those sequences encode. A graph that is built from the structural comparison of these templates is called PDUG (protein domain universe graph. We introduce a method of functional inference through a probabilistic calculation done on an arbitrary set of PDUG nodes. Further, all PDUG structures are mapped onto all fully sequenced proteomes allowing an easy interface for evolutionary analysis and research into comparative proteomics. ELISA is the first database with applicability to evolutionary structural genomics explicitly in mind. Availability: The database is available at http://romi.bu.edu/elisa.

  5. Consistent levels of A-to-I RNA editing across individuals in coding sequences and non-conserved Alu repeats

    Directory of Open Access Journals (Sweden)

    Osenberg Sivan

    2010-10-01

    Full Text Available Abstract Background Adenosine to inosine (A-to-I RNA-editing is an essential post-transcriptional mechanism that occurs in numerous sites in the human transcriptome, mainly within Alu repeats. It has been shown to have consistent levels of editing across individuals in a few targets in the human brain and altered in several human pathologies. However, the variability across human individuals of editing levels in other tissues has not been studied so far. Results Here, we analyzed 32 skin samples, looking at A-to-I editing level in three genes within coding sequences and in the Alu repeats of six different genes. We observed highly consistent editing levels across different individuals as well as across tissues, not only in coding targets but, surprisingly, also in the non evolutionary conserved Alu repeats. Conclusions Our findings suggest that A-to-I RNA-editing of Alu elements is a tightly regulated process and, as such, might have been recruited in the course of primate evolution for post-transcriptional regulatory mechanisms.

  6. cDNA sequence, genomic organization, and evolutionary conservation of a novel gene from the WAGR region

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, F.; Eisenman, R.; Knoll, J.; Bruns, G. [Children`s Hospital and Department of Pediatrics, Boston, MA (United States)

    1995-09-20

    A new gene (239FB) with predominant and differential expression in fetal brain has recently been isolated from a chromosome 11p13-p14 boundary area near FSHB. The corresponding mRNA has an open reading frame of 294 amino acids, a 3` untranslated region of 1247 nucleotides, and a highly GC-rich 5` untranslated region. The coding and 3` UT sequence is specified by 6 exons within nearly 87 kb of isolated genomic locus. The 5` end region of the transcript maps adjacent to the only genomically defined CpG island in a chromosomal subregion that may be associated with part of the mental retardation of some WAGR (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation) syndrome patients. In addition to nucleotide and amino acid similarity to an EST from a normalized infant brain cDNA library, the predicted protein has extensive similarity to Caenorhbditis elegans polypeptides of, as yet, unknown function. The 239FB locus is, therefore, likely part of a family of genes with two members expressed in human brain. The extensive conservation of the predicted protein suggests a fundamental function of the gene product and will enable evaluation of the role of the 239FB gene in neurogenesis in model organisms. 48 refs., 4 figs., 1 tab.

  7. Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns

    Directory of Open Access Journals (Sweden)

    Fraser Tresa S

    2010-11-01

    Full Text Available Abstract Background Dengue viruses (DENV are one of the most important viral diseases in the world with approximately 100 million infections and 200,000 deaths each year. The current lack of an approved tetravalent vaccine and ineffective insecticide control measures warrant a search for alternatives to effectively combat DENV. The trans-splicing variant of the Tetrahymena thermophila group I intron catalytic RNA, or ribozyme, is a powerful tool for post-transcriptional RNA modification. The nature of the ribozyme and the predictability with which it can be directed makes it a powerful tool for modifying RNA in nearly any cell type without the need for genome-altering gene therapy techniques or dependence on native cofactors. Results Several anti-DENV Group I trans-splicing introns (αDENV-GrpIs were designed and tested for their ability to target DENV-2 NGC genomes in situ. We have successfully targeted two different uracil bases on the positive sense genomic strand within the highly conserved 5'-3' cyclization sequence (CS region common to all serotypes of DENV with our αDENV-GrpIs. Our ribozymes have demonstrated ability to specifically trans-splice a new RNA sequence downstream of the targeted site in vitro and in transfected insect cells as analyzed by firefly luciferase and RT-PCR assays. The effectiveness of these αDENV-GrpIs to target infecting DENV genomes is also validated in transfected or transformed Aedes mosquito cell lines upon infection with unattenuated DENV-2 NGC. Conclusions Analysis shows that our αDENV-GrpIs have the ability to effectively trans-splice the DENV genome in situ. Notably, these results show that the αDENV-GrpI 9v1, designed to be active against all forms of Dengue virus, effectively targeted the DENV-2 NGC genome in a sequence specific manner. These novel αDENV-GrpI introns provide a striking alternative to other RNA based approaches for the transgenic suppression of DENV in transformed mosquito cells and

  8. NemaFootPrinter: a web based software for the identification of conserved non-coding genome sequence regions between C. elegans and C. briggsae

    Directory of Open Access Journals (Sweden)

    Morandi Paolo

    2005-12-01

    Full Text Available Abstract Background NemaFootPrinter (Nematode Transcription Factor Scan Through Philogenetic Footprinting is a web-based software for interactive identification of conserved, non-exonic DNA segments in the genomes of C. elegans and C. briggsae. It has been implemented according to the following project specifications: a Automated identification of orthologous gene pairs. b Interactive selection of the boundaries of the genes to be compared. c Pairwise sequence comparison with a range of different methods. d Identification of putative transcription factor binding sites on conserved, non-exonic DNA segments. Results Starting from a C. elegans or C. briggsae gene name or identifier, the software identifies the putative ortholog (if any, based on information derived from public nematode genome annotation databases. The investigator can then retrieve the genome DNA sequences of the two orthologous genes; visualize graphically the genes' intron/exon structure and the surrounding DNA regions; select, through an interactive graphical user interface, subsequences of the two gene regions. Using a bioinformatics toolbox (Blast2seq, Dotmatcher, Ssearch and connection to the rVista database the investigator is able at the end of the procedure to identify and analyze significant sequences similarities, detecting the presence of transcription factor binding sites corresponding to the conserved segments. The software automatically masks exons. Discussion This software is intended as a practical and intuitive tool for the researchers interested in the identification of non-exonic conserved sequence segments between C. elegans and C. briggsae. These sequences may contain regulatory transcriptional elements since they are conserved between two related, but rapidly evolving genomes. This software also highlights the power of genome annotation databases when they are conceived as an open resource and the possibilities offered by seamless integration of different web

  9. Comparative Sequence and Structure Analysis Reveals the Conservation and Diversity of Nucleotide Positions and Their Associated Tertiary Interactions in the Riboswitches

    Science.gov (United States)

    Appasamy, Sri D.; Ramlan, Effirul Ikhwan; Firdaus-Raih, Mohd

    2013-01-01

    The tertiary motifs in complex RNA molecules play vital roles to either stabilize the formation of RNA 3D structure or to provide important biological functionality to the molecule. In order to better understand the roles of these tertiary motifs in riboswitches, we examined 11 representative riboswitch PDB structures for potential agreement of both motif occurrences and conservations. A total of 61 unique tertiary interactions were found in the reference structures. In addition to the expected common A-minor motifs and base-triples mainly involved in linking distant regions the riboswitch structures three highly conserved variants of A-minor interactions called G-minors were found in the SAM-I and FMN riboswitches where they appear to be involved in the recognition of the respective ligand’s functional groups. From our structural survey as well as corresponding structure and sequence alignments, the agreement between motif occurrences and conservations are very prominent across the representative riboswitches. Our analysis provide evidence that some of these tertiary interactions are essential components to form the structure where their sequence positions are conserved despite a high degree of diversity in other parts of the respective riboswitches sequences. This is indicative of a vital role for these tertiary interactions in determining the specific biological function of riboswitch. PMID:24040136

  10. Identification of conserved and novel microRNAs in the Pacific oyster Crassostrea gigas by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Fei Xu

    Full Text Available MicroRNAs (miRNAs play important roles in regulatory processes in various organisms. To date many studies have been performed in the investigation of miRNAs of numerous bilaterians, but limited numbers of miRNAs have been identified in the few species belonging to the clade Lophotrochozoa. In the current study, deep sequencing was conducted to identify the miRNAs of Crassostrea gigas (Lophotrochozoa at a genomic scale, using 21 libraries that included different developmental stages and adult organs. A total of 100 hairpin precursor loci were predicted to encode miRNAs. Of these, 19 precursors (pre-miRNA were novel in the oyster. As many as 53 (53% miRNAs were distributed in clusters and 49 (49% precursors were intragenic, which suggests two important biogenetic sources of miRNAs. Different developmental stages were characterized with specific miRNA expression patterns that highlighted regulatory variation along a temporal axis. Conserved miRNAs were expressed universally throughout different stages and organs, whereas novel miRNAs tended to be more specific and may be related to the determination of the novel body plan. Furthermore, we developed an index named the miRNA profile age index (miRPAI to integrate the evolutionary age and expression levels of miRNAs during a particular developmental stage. We found that the swimming stages were characterized by the youngest miRPAIs. Indeed, the large-scale expression of novel miRNAs indicated the importance of these stages during development, particularly from organogenetic and evolutionary perspectives. Some potentially important miRNAs were identified for further study through significant changes between expression patterns in different developmental events, such as metamorphosis. This study broadened the knowledge of miRNAs in animals and indicated the presence of sophisticated miRNA regulatory networks related to the biological processes in lophotrochozoans.

  11. Molecular characterization of flavanone 3 beta-hydroxylases. Consensus sequence, comparison with related enzymes and the role of conserved histidine residues.

    Science.gov (United States)

    Britsch, L; Dedio, J; Saedler, H; Forkmann, G

    1993-10-15

    A heterologous cDNA probe from Petunia hybrida was used to isolate flavanone-3 beta-hydroxylase-encoding cDNA clones from carnation (Dianthus caryophyllus), china aster (Callistephus chinensis) and stock (Matthiola incana). The deduced protein sequences together with the known sequences of the enzyme from P. hybrida, barley (Hordeum vulgare) and snapdragon (Antirrhinum majus) enabled the determination of a consensus sequence which revealed an overall 84% similarity (53% identity) of flavanone 3 beta-hydroxylases from the different sources. Alignment with the sequences of other known enzymes of the same class and to related non-heme iron-(II) enzymes demonstrated the strict genetic conservation of 14 amino acids, in particular, of three histidines and an aspartic acid. The conservation of the histidine motifs provides strong support for the possible conservation of structurally similar iron-binding sites in these enzymes. The putative role of histidines as chelators of ferrous ions in the active site of flavanone 3 beta-hydroxylases was corroborated by diethyl-pyrocarbonate modification of the partially purified recombinant Petunia enzyme.

  12. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  13. A highly conserved N-terminal sequence for teleost vitellogenin with potential value to the biochemistry, molecular biology and pathology of vitellogenesis

    Science.gov (United States)

    Folmar, L.D.; Denslow, N.D.; Wallace, R.A.; LaFleur, G.; Gross, T.S.; Bonomelli, S.; Sullivan, C.V.

    1995-01-01

    N-terminal amino acid sequences for vitellogenin (Vtg) from six species of teleost fish (striped bass, mummichog, pinfish, brown bullhead, medaka, yellow perch and the sturgeon) are compared with published N-terminal Vtg sequences for the lamprey, clawed frog and domestic chicken. Striped bass and mummichog had 100% identical amino acids between positions 7 and 21, while pinfish, brown bullhead, sturgeon, lamprey, Xenopus and chicken had 87%, 93%, 60%, 47%, 47-60%) for four transcripts and had 40% identical, respectively, with striped bass for the same positions. Partial sequences obtained for medaka and yellow perch were 100% identical between positions 5 to 10. The potential utility of this conserved sequence for studies on the biochemistry, molecular biology and pathology of vitellogenesis is discussed.

  14. Optimizing multiple sequence alignments using a genetic algorithm based on three objectives: structural information, non-gaps percentage and totally conserved columns.

    Science.gov (United States)

    Ortuño, Francisco M; Valenzuela, Olga; Rojas, Fernando; Pomares, Hector; Florido, Javier P; Urquiza, Jose M; Rojas, Ignacio

    2013-09-01

    Multiple sequence alignments (MSAs) are widely used approaches in bioinformatics to carry out other tasks such as structure predictions, biological function analyses or phylogenetic modeling. However, current tools usually provide partially optimal alignments, as each one is focused on specific biological features. Thus, the same set of sequences can produce different alignments, above all when sequences are less similar. Consequently, researchers and biologists do not agree about which is the most suitable way to evaluate MSAs. Recent evaluations tend to use more complex scores including further biological features. Among them, 3D structures are increasingly being used to evaluate alignments. Because structures are more conserved in proteins than sequences, scores with structural information are better suited to evaluate more distant relationships between sequences. The proposed multiobjective algorithm, based on the non-dominated sorting genetic algorithm, aims to jointly optimize three objectives: STRIKE score, non-gaps percentage and totally conserved columns. It was significantly assessed on the BAliBASE benchmark according to the Kruskal-Wallis test (P 0.05) with the advantage of being able to use less structures. Structural information is included within the objective function to evaluate more accurately the obtained alignments. The source code is available at http://www.ugr.es/~fortuno/MOSAStrE/MO-SAStrE.zip.

  15. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  16. Measuring the Evolutionarily Important Goals of Situations: Situational Affordances for Adaptive Problems

    National Research Council Canada - National Science Library

    Brown, Nicolas A; Neel, Rebecca; Sherman, Ryne A

    2015-01-01

    .... This article introduces the Situational Affordances for Adaptive Problems (SAAP), a measure of situation characteristics that promotes or prevents the achievement of these evolutionarily important goals...

  17. Evolutionarily advanced ant farmers rear polyploid fungal crops

    DEFF Research Database (Denmark)

    Kooij, Pepijn Wilhelmus; Aanen, D.K.; Schiøtt, Morten

    2015-01-01

    Innovative evolutionary developments are often related to gene or genome duplications. The crop fungi of attine fungus-growing ants are suspected to have enhanced genetic variation reminiscent of polyploidy, but this has never been quantified with cytological data and genetic markers. We estimated...... the number of nuclei per fungal cell for 42 symbionts reared by 14 species of Panamanian fungus-growing ants. This showed that domesticated symbionts of higher attine ants are polykaryotic with 7-17 nuclei per cell, whereas nonspecialized crops of lower attines are dikaryotic similar to most free...... of the basal higher attine genera Trachymyrmex and Sericomyrmex was only slightly enhanced, but the evolutionarily derived crop fungi of Atta and Acromyrmex leaf-cutting ants had much higher genetic variation. Our opposite ploidy models indicated that the symbionts of Trachymyrmex and Sericomyrmex are likely...

  18. Dengue virus type 2 in Cuba, 1997: conservation of E gene sequence in isolates obtained at different times during the epidemic.

    Science.gov (United States)

    Rodriguez-Roche, R; Alvarez, M; Gritsun, T; Rosario, D; Halstead, S; Kouri, G; Gould, E A; Guzman, M G

    2005-03-01

    It was recently reported that disease severity increased during the 1997 Cuban dengue 2 virus epidemic and it was suggested that this might be explained by the appearance of neutralization resistant escape mutants. We investigated these observations and ideas by sequencing 20 dengue 2 virus isolates obtained during the early (low case fatality rate) and the late (high case fatality rate) phases of the outbreak. Our results showed total conservation of the E gene sequence for these isolates suggesting that the selection of envelope gene escape mutants was not the determinant of increased disease severity. Alignment of these sequences with those available in GenBank, followed by Maximum likelihood phylogenetic analysis generated a tree, which indicated that our isolates are closely related to the virus that circulated in Venezuela in 1997/98 and subsequently in Martinique in 1998. This "American/Asian" genotype has therefore gradually dispersed across the Caribbean region during the past 5 years.

  19. Hospital and community ampicillin-resistant Enterococcus faecium are evolutionarily closely linked but have diversified through niche adaptation.

    Directory of Open Access Journals (Sweden)

    Marieke J A de Regt

    Full Text Available BACKGROUND: Ampicillin-resistant Enterococcus faecium (ARE has emerged as a nosocomial pathogen. Here, we quantified ARE carriage in different community sources and determined genetic relatedness with hospital ARE. METHODS AND RESULTS: ARE was recovered from rectal swabs of 24 of 79 (30% dogs, 11 of 85 (13% cats and 0 of 42 horses and from 3 of 40 (8% faecal samples of non-hospitalized humans receiving amoxicillin. Multi-locus Sequence Typing revealed 21 sequence types (STs, including 5 STs frequently associated with hospital-acquired infections. Genes previously found to be enriched in hospital ARE, such as IS16, orf903, orf905, orf907, were highly prevalent in community ARE (≥79%, while genes with a proposed role in pathogenesis, such as esp, hyl and ecbA, were found rarely (≤5% in community isolates. Comparative genome analysis of 2 representative dog isolates revealed that the dog strain of ST192 was evolutionarily closely linked to two previously sequenced hospital ARE, but had, based on gene content, more genes in common with the other, evolutionarily more distantly related, dog strain (ST266. CONCLUSION: ARE were detected in dogs, cats and sporadically in healthy humans, with evolutionary linkage to hospital ARE. Yet, their accessory genome has diversified, probably as a result of niche adaptation.

  20. Conserved secondary structures in Aspergillus.

    Directory of Open Access Journals (Sweden)

    Abigail Manson McGuire

    2008-07-01

    Full Text Available Recent evidence suggests that the number and variety of functional RNAs (ncRNAs as well as cis-acting RNA elements within mRNAs is much higher than previously thought; thus, the ability to computationally predict and analyze RNAs has taken on new importance. We have computationally studied the secondary structures in an alignment of six Aspergillus genomes. Little is known about the RNAs present in this set of fungi, and this diverse set of genomes has an optimal level of sequence conservation for observing the correlated evolution of base-pairs seen in RNAs.We report the results of a whole-genome search for evolutionarily conserved secondary structures, as well as the results of clustering these predicted secondary structures by structural similarity. We find a total of 7450 predicted secondary structures, including a new predicted approximately 60 bp long hairpin motif found primarily inside introns. We find no evidence for microRNAs. Different types of genomic regions are over-represented in different classes of predicted secondary structures. Exons contain the longest motifs (primarily long, branched hairpins, 5' UTRs primarily contain groupings of short hairpins located near the start codon, and 3' UTRs contain very little secondary structure compared to other regions. There is a large concentration of short hairpins just inside the boundaries of exons. The density of predicted intronic RNAs increases with the length of introns, and the density of predicted secondary structures within mRNA coding regions increases with the number of introns in a gene.There are many conserved, high-confidence RNAs of unknown function in these Aspergillus genomes, as well as interesting spatial distributions of predicted secondary structures. This study increases our knowledge of secondary structure in these aspergillus organisms.

  1. Sequence Diversity of pfmdr1 and Sequence Conserve of pldh in Plasmodium falciparum from Indonesia: Its implications on Designing a Novel Antimalarial Drug with Less Prone to Resistance.

    Directory of Open Access Journals (Sweden)

    Muhamad Ali

    2013-12-01

    Full Text Available pfmdr1 and its variants are molecular marker which are responsible for antibiotics resistance in Plasmodium falciparum, a parasitic carrier for malaria disease. A novel strategy to treat malaria disease is by disrupting parasite lactate dehydrogenase (pLDH, a crucial enzyme for Plasmodium survival during their erythrocytic stages. This research was aimed to investigate and characterize the pfmdr1 and pldh genes of P. falciparum isolated from Nusa Tenggara Indonesia.Genomic DNA of P.falciparum was isolated from malaria patients in Nusa Tenggara Indonesia. pfmdr1 was amplified using nested PCR and genotyped using Restriction Fragment Length Polymorphism (RFLP. pldh was amplified, sequenced, and analyzed using NCBI public domain databases and alignment using Clustal W ver. 1.83.Genotyping of the pfmdr1 revealed that sequence diversity was extremely high among isolates. However, a sequence analysis of pldh indicated that open reading frame of 316 amino acids of the gene showing 100% homology to the P. falciparum 3D7 reference pldh (GeneBank: XM_001349953.1.This is the first report which confirms the heterologous of pfmdr1 and the homologous sequences of P.falciparum pldh isolated from Nusa Tenggara Islands of Indonesia, indicating that the chloroquine could not be used effectively as antimalarial target in the region and the pLDH-targeted antimalarial compound would have higher chance to be successful than using chloroquine for curbing malaria worldwide.

  2. A Cluster of Vitellogenin Genes in the Mediterranean Fruit Fly Ceratitis Capitata: Sequence and Structural Conservation in Dipteran Yolk Proteins and Their Genes

    Science.gov (United States)

    Rina, M.; Savakis, C.

    1991-01-01

    Four genes encoding the major egg yolk polypeptides of the Mediterranean fruit fly Ceratitis capitata, vitellogenins 1 and 2 (VG1 and VG2), were cloned, characterized and partially sequenced. The genes are located on the same region of chromosome 5 and are organized in pairs, each encoding the two polypeptides on opposite DNA strands. Restriction and nucleotide sequence analysis indicate that the gene pairs have arisen from an ancestral pair by a relatively recent duplication event. The transcribed part is very similar to that of the Drosophila melanogaster yolk protein genes Yp1, Yp2 and Yp3. The Vg1 genes have two introns at the same positions as those in D. melanogaster Yp3; the Vg2 genes have only one of the introns, as do D. melanogaster Yp1 and Yp2. Comparison of the five polypeptide sequences shows extensive homology, with 27% of the residues being invariable. The sequence similarity of the processed proteins extends in two regions separated by a nonconserved region of varying size. Secondary structure predictions suggest a highly conserved secondary structure pattern in the two regions, which probably correspond to structural and functional domains. The carboxy-end domain of the C. capitata proteins shows the same sequence similarities with triacylglycerol lipases that have been reported previously for the D. melanogaster yolk proteins. Analysis of codon usage shows significant differences between D. melanogaster and C. capitata vitellogenins with the latter exhibiting a less biased representation of synonymous codons. PMID:1903120

  3. Microcollinearity in an ethylene receptor coding gene region of the Coffea canephora genome is extensively conserved with Vitis vinifera and other distant dicotyledonous sequenced genomes.

    Science.gov (United States)

    Guyot, Romain; de la Mare, Marion; Viader, Véronique; Hamon, Perla; Coriton, Olivier; Bustamante-Porras, José; Poncet, Valérie; Campa, Claudine; Hamon, Serge; de Kochko, Alexandre

    2009-02-25

    Coffea canephora, also called Robusta, belongs to the Rubiaceae, the fourth largest angiosperm family. This diploid species (2x = 2n = 22) has a fairly small genome size of approximately 690 Mb and despite its extreme economic importance, particularly for developing countries, knowledge on the genome composition, structure and evolution remain very limited. Here, we report the 160 kb of the first C. canephora Bacterial Artificial Chromosome (BAC) clone ever sequenced and its fine analysis. This clone contains the CcEIN4 gene, encoding an ethylene receptor, and twenty other predicted genes showing a high gene density of one gene per 7.8 kb. Most of them display perfect matches with C. canephora expressed sequence tags or show transcriptional activities through PCR amplifications on cDNA libraries. Twenty-three transposable elements, mainly Class II transposon derivatives, were identified at this locus. Most of these Class II elements are Miniature Inverted-repeat Transposable Elements (MITE) known to be closely associated with plant genes. This BAC composition gives a pattern similar to those found in gene rich regions of Solanum lycopersicum and Medicago truncatula genomes indicating that the CcEIN4 regions may belong to a gene rich region in the C. canephora genome. Comparative sequence analysis indicated an extensive conservation between C. canephora and most of the reference dicotyledonous genomes studied in this work, such as tomato (S. lycopersicum), grapevine (V. vinifera), barrel medic M. truncatula, black cottonwood (Populus trichocarpa) and Arabidopsis thaliana. The higher degree of microcollinearity was found between C. canephora and V. vinifera, which belong respectively to the Asterids and Rosids, two clades that diverged more than 114 million years ago. This study provides a first glimpse of C. canephora genome composition and evolution. Our data revealed a remarkable conservation of the microcollinearity between C. canephora and V. vinifera and a high

  4. Intrinsically disordered proteins drive enamel formation via an evolutionarily conserved self-assembly motif

    Czech Academy of Sciences Publication Activity Database

    Wald, Tomáš; Špoutil, František; Osičková, Adriana; Procházková, Michaela; Benada, Oldřich; Kašpárek, Petr; Bumba, Ladislav; Klein, O. D.; Sedláček, Radislav; Šebo, Peter; Procházka, Jan; Osička, Radim

    2017-01-01

    Roč. 114, č. 9 (2017), s. 1641-1650 ISSN 0027-8424 R&D Projects: GA MŠk(CZ) LM2015064; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2011032; GA MŠk(CZ) LM2015040; GA MŠk(CZ) LO1509; GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk ED2.1.00/19.0395 Grant - others:Ministerstvo pro místní rozvoj(CZ) CZ2.16/3.1.00/24023 Institutional support: RVO:61388971 ; RVO:68378050 Keywords : ameloblastin * amelogenin * biomineralization Subject RIV: EE - Microbiology, Virology; EB - Genetics ; Molecular Biology (UMG-J) Impact factor: 9.661, year: 2016

  5. An Evolutionarily Conserved Role for Polydom/Svep1 during Lymphatic Vessel Formation

    NARCIS (Netherlands)

    Karpanen, Terhi; Padberg, Yvonne; Van De Pavert, Serge A.; Dierkes, Cathrin; Morooka, Nanami; Peterson-Maduro, Josi; Van De Hoek, Glenn; Adrian, Max; Mochizuki, Naoki; Sekiguchi, Kiyotoshi; Kiefer, Friedemann; Schulte, Dörte; Schulte-Merker, Stefan

    2017-01-01

    Rationale: Lymphatic vessel formation and function constitutes a physiologically and pathophysiologically important process, but its genetic control is not well understood. Objective: Here, we identify the secreted Polydom/Svep1 protein as essential for the formation of the lymphatic vasculature. We

  6. Evolutionarily conserved Δ25(27)-olefin ergosterol biosynthesis pathway in the alga Chlamydomonas reinhardtii

    OpenAIRE

    Miller, Matthew B.; Haubrich, Brad A; Wang, Qian; Snell, William J.; Nes, W. David

    2012-01-01

    Ergosterol is the predominant sterol of fungi and green algae. Although the biosynthetic pathway for sterol synthesis in fungi is well established and is known to use C24-methylation-C24 (28)-reduction (Δ24(28)-olefin pathway) steps, little is known about the sterol pathway in green algae. Previous work has raised the possibility that these algae might use a novel pathway because the green alga Chlamydomonas reinhardtii was shown to possess a mevalonate-independent methylerythritol 4-phosphat...

  7. Evolutionarily Conserved Roles for Blood-Brain Barrier Xenobiotic Transporters in Endogenous Steroid Partitioning and Behavior.

    Science.gov (United States)

    Hindle, Samantha J; Munji, Roeben N; Dolghih, Elena; Gaskins, Garrett; Orng, Souvinh; Ishimoto, Hiroshi; Soung, Allison; DeSalvo, Michael; Kitamoto, Toshihiro; Keiser, Michael J; Jacobson, Matthew P; Daneman, Richard; Bainton, Roland J

    2017-10-31

    Central nervous system (CNS) chemical protection depends upon discrete control of small-molecule access by the blood-brain barrier (BBB). Curiously, some drugs cause CNS side-effects despite negligible transit past the BBB. To investigate this phenomenon, we asked whether the highly BBB-enriched drug efflux transporter MDR1 has dual functions in controlling drug and endogenous molecule CNS homeostasis. If this is true, then brain-impermeable drugs could induce behavioral changes by affecting brain levels of endogenous molecules. Using computational, genetic, and pharmacologic approaches across diverse organisms, we demonstrate that BBB-localized efflux transporters are critical for regulating brain levels of endogenous steroids and steroid-regulated behaviors (sleep in Drosophila and anxiety in mice). Furthermore, we show that MDR1-interacting drugs are associated with anxiety-related behaviors in humans. We propose a general mechanism for common behavioral side effects of prescription drugs: pharmacologically challenging BBB efflux transporters disrupts brain levels of endogenous substrates and implicates the BBB in behavioral regulation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Tryptophan as an evolutionarily conserved signal to brain serotonin : Molecular evidence and psychiatric implications

    NARCIS (Netherlands)

    Russo, Sascha; Kema, Ido P.; Bosker, Fokko; Haavik, Jan; Korf, Jakob

    2009-01-01

    The role of serotonin (5-HT) in psychopathology has been investigated for decades. Among others, symptoms of depression, panic, aggression and suicidality have been associated with serotonergic dysfunction. Here we summarize the evidence that low brain 5-HT signals a metabolic imbalance that is

  9. An Evolutionarily Conserved Mechanism for Activity-Dependent Visual Circuit Development

    Science.gov (United States)

    Pratt, Kara G.; Hiramoto, Masaki; Cline, Hollis T.

    2016-01-01

    Neural circuit development is an activity-dependent process. This activity can be spontaneous, such as the retinal waves that course across the mammalian embryonic retina, or it can be sensory-driven, such as the activation of retinal ganglion cells (RGCs) by visual stimuli. Whichever the source, neural activity provides essential instruction to the developing circuit. Indeed, experimentally altering activity has been shown to impact circuit development and function in many different ways and in many different model systems. In this review, we contemplate the idea that retinal waves in amniotes, the animals that develop either in ovo or utero (namely reptiles, birds and mammals) could be an evolutionary adaptation to life on land, and that the anamniotes, animals whose development is entirely external (namely the aquatic amphibians and fish), do not display retinal waves, most likely because they simply don’t need them. We then review what is known about the function of both retinal waves and visual stimuli on their respective downstream targets, and predict that the experience-dependent development of the tadpole visual system is a blueprint of what will be found in future studies of the effects of spontaneous retinal waves on instructing development of retinorecipient targets such as the superior colliculus (SC) and the lateral geniculate nucleus. PMID:27818623

  10. An Evolutionarily Conserved Mechanism for Activity-dependent Visual Circuit Development

    Directory of Open Access Journals (Sweden)

    Kara Geo Pratt

    2016-10-01

    Full Text Available Neural circuit development is an activity-dependent process. This activity can be spontaneous, such as the retinal waves that course across the mammalian embryonic retina, or it can be sensory-driven, such as the activation of retinal ganglion cells by visual stimuli. Whichever the source, neural activity provides essential instruction to the developing circuit. Indeed, experimentally altering activity has been shown to impact circuit development and function in many different ways and in many different model systems. In this review we contemplate the idea that retinal waves in amniotes, the animals that develop either in ovo or utero (namely reptiles, birds, mammals could be an evolutionary adaptation to life on land, and that the anamniotes, animals whose development is entirely external (namely the aquatic amphibians and fish, do not display retinal waves, most likely because they simply don’t need them. We then review what is known about the function of both retinal waves and visual stimuli on their respective downstream targets, and predict that the experience-dependent development of the tadpole visual system is a blueprint of what will be found in future studies of the effects of spontaneous retinal waves on instructing development of retinorecipient targets such as the superior colliculus and the lateral geniculate nucleus.

  11. An Evolutionarily Conserved PLC-PKD-TFEB Pathway for Host Defense

    OpenAIRE

    Najibi, Mehran; Labed, Sid Ahmed; Visvikis, Orane; Irazoqui, Javier Elbio

    2016-01-01

    The mechanisms that tightly control the transcription of host defense genes have not been fully elucidated. We previously identified TFEB as a transcription factor important for host defense, but the mechanisms that regulate TFEB during infection remained unknown. We used C. elegans to discover a pathway that activates TFEB during infection. Gene dkf-1, which encodes a homolog of protein kinase D (PKD), was required for TFEB activation in nematodes infected with Staphylococcus aureus. Convers...

  12. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila.

    Science.gov (United States)

    Sitnik, Jessica L; Francis, Carmen; Hens, Korneel; Huybrechts, Roger; Wolfner, Mariana F; Callaerts, Patrick

    2014-03-01

    Members of the M13 class of metalloproteases have been implicated in diseases and in reproductive fitness. Nevertheless, their physiological role remains poorly understood. To obtain a tractable model with which to analyze this protein family's function, we characterized the gene family in Drosophila melanogaster and focused on reproductive phenotypes. The D. melanogaster genome contains 24 M13 class protease homologs, some of which are orthologs of human proteases, including neprilysin. Many are expressed in the reproductive tracts of either sex. Using RNAi we individually targeted the five Nep genes most closely related to vertebrate neprilysin, Nep1-5, to investigate their roles in reproduction. A reduction in Nep1, Nep2, or Nep4 expression in females reduced egg laying. Nep1 and Nep2 are required in the CNS and the spermathecae for wild-type fecundity. Females that are null for Nep2 also show defects as hosts of sperm competition as well as an increased rate of depletion for stored sperm. Furthermore, eggs laid by Nep2 mutant females are fertilized normally, but arrest early in embryonic development. In the male, only Nep1 was required to induce normal patterns of female egg laying. Reduction in the expression of Nep2-5 in the male did not cause any dramatic effects on reproductive fitness, which suggests that these genes are either nonessential for male fertility or perform redundant functions. Our results suggest that, consistent with the functions of neprilysins in mammals, these proteins are also required for reproduction in Drosophila, opening up this model system for further functional analysis of this protein class and their substrates.

  13. Latency transition of plasminogen activator inhibitor type 1 is evolutionarily conserved

    DEFF Research Database (Denmark)

    Jendroszek, Agnieszka; Sønnichsen, Malene; Chana Munoz, Andres

    2017-01-01

    latency transition must have been a specific selection criterion for the evolution of PAI-1. It appears that all PAI-1 molecules must harbour latency transition to fulfil their physiological function, stressing the importance to further pursue a complete understanding of this molecular phenomenon......Plasminogen activator inhibitor type 1 (PAI-1) is a central regulator of fibrinolysis and tissue remodelling. PAI-1 belongs to the serpin superfamily and unlike other inhibitory serpins undergoes a spontaneous inactivation process under physiological conditions, termed latency transition. During...... latency transition the solvent exposed reactive centre loop is inserted into the central β-sheet A of the molecule, and is no longer accessible to reaction with the protease. More than three decades of research on mammalian PAI-1 has not been able to clarify the evolutionary advantage and physiological...

  14. Drosophila Ncd reveals an evolutionarily conserved powerstroke mechanism for homodimeric and heterodimeric kinesin-14s.

    Science.gov (United States)

    Zhang, Pengwei; Dai, Wei; Hahn, Juergen; Gilbert, Susan P

    2015-05-19

    Drosophila melanogaster kinesin-14 Ncd cross-links parallel microtubules at the spindle poles and antiparallel microtubules within the spindle midzone to play roles in bipolar spindle assembly and proper chromosome distribution. As observed for Saccharomyces cerevisiae kinesin-14 Kar3Vik1 and Kar3Cik1, Ncd binds adjacent microtubule protofilaments in a novel microtubule binding configuration and uses an ATP-promoted powerstroke mechanism. The hypothesis tested here is that Kar3Vik1 and Kar3Cik1, as well as Ncd, use a common ATPase mechanism for force generation even though the microtubule interactions for both Ncd heads are modulated by nucleotide state. The presteady-state kinetics and computational modeling establish an ATPase mechanism for a powerstroke model of Ncd that is very similar to those determined for Kar3Vik1 and Kar3Cik1, although these heterodimers have one Kar3 catalytic motor domain and a Vik1/Cik1 partner motor homology domain whose interactions with microtubules are not modulated by nucleotide state but by strain. The results indicate that both Ncd motor heads bind the microtubule lattice; two ATP binding and hydrolysis events are required for each powerstroke; and a slow step occurs after microtubule collision and before the ATP-promoted powerstroke. Note that unlike conventional myosin-II or other processive molecular motors, Ncd requires two ATP turnovers rather than one for a single powerstroke-driven displacement or step. These results are significant because all metazoan kinesin-14s are homodimers, and the results presented show that despite their structural and functional differences, the heterodimeric and homodimeric kinesin-14s share a common evolutionary structural and mechanochemical mechanism for force generation.

  15. Evolutionarily distinct bacteriophage endolysins featuring conserved peptidoglycan cleavage sites protect mice from MRSA infection

    Science.gov (United States)

    Staphylococcus aureus is a Gram-positive pathogen relevant for both human and animal health. With multi-drug resistant S. aureus strains becoming increasingly prevalent, alternative therapeutics are urgently needed. Bacteriophage endolysins (peptidoglycan hydrolases, PGH) are capable of killing Gra...

  16. Assembly of an Evolutionarily Conserved Alternative Proteasome Isoform in Human Cells

    Directory of Open Access Journals (Sweden)

    Achuth Padmanabhan

    2016-03-01

    Full Text Available Targeted intracellular protein degradation in eukaryotes is largely mediated by the proteasome. Here, we report the formation of an alternative proteasome isoform in human cells, previously found only in budding yeast, that bears an altered subunit arrangement in the outer ring of the proteasome core particle. These proteasomes result from incorporation of an additional α4 (PSMA7 subunit in the position normally occupied by α3 (PSMA4. Assembly of “α4-α4” proteasomes depends on the relative cellular levels of α4 and α3 and on the proteasome assembly chaperone PAC3. The oncogenic tyrosine kinases ABL and ARG and the tumor suppressor BRCA1 regulate cellular α4 levels and formation of α4-α4 proteasomes. Cells primed to assemble α4-α4 proteasomes exhibit enhanced resistance to toxic metal ions. Taken together, our results establish the existence of an alternative mammalian proteasome isoform and suggest a potential role in enabling cells to adapt to environmental stresses.

  17. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins

    National Research Council Canada - National Science Library

    Michishita, Eriko; Park, Jean Y; Burneskis, Jenna M; Barrett, J Carl; Horikawa, Izumi

    2005-01-01

    .... This study examines seven human proteins homologous to Sir2 (SIRT1 through SIRT7) for cellular localization, expression profiles, protein deacetylation activity, and effects on human cell lifespan. We found that: 1...

  18. An evolutionarily conserved mutual interdependence between Aire and microRNAs in promiscuous gene expression

    OpenAIRE

    Ucar, Olga; Tykocinski, Lars-Oliver; Dooley, James; Liston, Adrian; Kyewski, Bruno

    2013-01-01

    The establishment and maintenance of central tolerance depends to a large extent on the ability of medullary thymic epithelial cells to express a variety of tissue-restricted antigens, the so-called promiscuous gene expression (pGE). Autoimmune regulator (Aire) is to date the best characterised transcriptional regulator known to at least partially coordinate pGE. There is accruing evidence that the expression of Aire-dependent and -independent genes is modulated by higher order chromatin conf...

  19. WASP and SCAR are evolutionarily conserved in actin-filled pseudopod-based motility

    OpenAIRE

    Fritz-Laylin, Lillian K.; Lord, Samuel J.; Mullins, R Dyche

    2017-01-01

    Diverse eukaryotic cells crawl through complex environments using distinct modes of migration. To understand the underlying mechanisms and their evolutionary relationships, we must define each mode and identify its phenotypic and molecular markers. In this study, we focus on a widely dispersed migration mode characterized by dynamic actin-filled pseudopods that we call ??-motility.? Mining genomic data reveals a clear trend: only organisms with both WASP and SCAR/WAVE?activators of branched a...

  20. WASP and SCAR are evolutionarily conserved in actin-filled pseudopod-based motility.

    Science.gov (United States)

    Fritz-Laylin, Lillian K; Lord, Samuel J; Mullins, R Dyche

    2017-06-05

    Diverse eukaryotic cells crawl through complex environments using distinct modes of migration. To understand the underlying mechanisms and their evolutionary relationships, we must define each mode and identify its phenotypic and molecular markers. In this study, we focus on a widely dispersed migration mode characterized by dynamic actin-filled pseudopods that we call "α-motility." Mining genomic data reveals a clear trend: only organisms with both WASP and SCAR/WAVE-activators of branched actin assembly-make actin-filled pseudopods. Although SCAR has been shown to drive pseudopod formation, WASP's role in this process is controversial. We hypothesize that these genes collectively represent a genetic signature of α-motility because both are used for pseudopod formation. WASP depletion from human neutrophils confirms that both proteins are involved in explosive actin polymerization, pseudopod formation, and cell migration. WASP and WAVE also colocalize to dynamic signaling structures. Moreover, retention of WASP together with SCAR correctly predicts α-motility in disease-causing chytrid fungi, which we show crawl at >30 µm/min with actin-filled pseudopods. By focusing on one migration mode in many eukaryotes, we identify a genetic marker of pseudopod formation, the morphological feature of α-motility, providing evidence for a widely distributed mode of cell crawling with a single evolutionary origin. © 2017 Fritz-Laylin et al.

  1. Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed.

    Directory of Open Access Journals (Sweden)

    Xuezhong Cai

    2006-03-01

    Full Text Available The pathogenic lymphocryptovirus Epstein-Barr virus (EBV is shown to express at least 17 distinct microRNAs (miRNAs in latently infected cells. These are arranged in two clusters: 14 miRNAs are located in the introns of the viral BART gene while three are located adjacent to BHRF1. The BART miRNAs are expressed at high levels in latently infected epithelial cells and at lower, albeit detectable, levels in B cells. In contrast to the tissue-specific expression pattern of the BART miRNAs, the BHRF1 miRNAs are found at high levels in B cells undergoing stage III latency but are essentially undetectable in B cells or epithelial cells undergoing stage I or II latency. Induction of lytic EBV replication was found to enhance the expression of many, but not all, of these viral miRNAs. Rhesus lymphocryptovirus, which is separated from EBV by > or =13 million years of evolution, expresses at least 16 distinct miRNAs, seven of which are closely related to EBV miRNAs. Thus, lymphocryptovirus miRNAs are under positive selection and are likely to play important roles in the viral life cycle. Moreover, the differential regulation of EBV miRNA expression implies distinct roles during infection of different human tissues.

  2. Genome-wide identification of conserved and novel microRNAs in one bud and two tender leaves of tea plant (Camellia sinensis) by small RNA sequencing, microarray-based hybridization and genome survey scaffold sequences.

    Science.gov (United States)

    Jeyaraj, Anburaj; Zhang, Xiao; Hou, Yan; Shangguan, Mingzhu; Gajjeraman, Prabu; Li, Yeyun; Wei, Chaoling

    2017-11-21

    MicroRNAs (miRNAs) are important for plant growth and responses to environmental stresses via post-transcriptional regulation of gene expression. Tea, which is primarily produced from one bud and two tender leaves of the tea plant (Camellia sinensis), is one of the most popular non-alcoholic beverages worldwide owing to its abundance of secondary metabolites. A large number of miRNAs have been identified in various plants, including non-model species. However, due to the lack of reference genome sequences and/or information of tea plant genome survey scaffold sequences, discovery of miRNAs has been limited in C. sinensis. Using small RNA sequencing, combined with our recently obtained genome survey data, we have identified and analyzed 175 conserved and 83 novel miRNAs mainly in one bud and two tender leaves of the tea plant. Among these, 93 conserved and 18 novel miRNAs were validated using miRNA microarray hybridization. In addition, the expression pattern of 11 conserved and 8 novel miRNAs were validated by stem-loop-qRT-PCR. A total of 716 potential target genes of identified miRNAs were predicted. Further, Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that most of the target genes were primarily involved in stress response and enzymes related to phenylpropanoid biosynthesis. The predicted targets of 4 conserved miRNAs were further validated by 5'RLM-RACE. A negative correlation between expression profiles of 3 out of 4 conserved miRNAs (csn-miR160a-5p, csn-miR164a, csn-miR828 and csn-miR858a) and their targets (ARF17, NAC100, WER and MYB12 transcription factor) were observed. In summary, the present study is one of few such studies on miRNA detection and identification in the tea plant. The predicted target genes of majority of miRNAs encoded enzymes, transcription factors, and functional proteins. The miRNA-target transcription factor gene interactions may provide important clues about the regulatory

  3. Position and sequence conservation in Amniota of polymorphic enhancer HS1.2 within the palindrome of IgH 3'Regulatory Region

    Directory of Open Access Journals (Sweden)

    Rocchi Mariano

    2011-03-01

    Full Text Available Abstract Background The Immunoglobulin heavy chain (IgH 3' Regulatory Region (3'RR, located at the 3' of the constant alpha gene, plays a crucial role in immunoglobulin production. In humans, there are 2 copies of the 3'RR, each composed of 4 main elements: 3 enhancers and a 20 bp tandem repeat. The single mouse 3'RR differs from the two human ones for the presence of 4 more regulative elements with the double copy of one enhancer at the border of a palindromic region. Results We compared the 3'RR organization in genomes of vertebrates to depict the evolutionary history of the region and highlight its shared features. We found that in the 8 species in which the whole region was included in a fully assembled contig (mouse, rat, dog, rabbit, panda, orangutan, chimpanzee, and human, the shared elements showed synteny and a highly conserved sequence, thus suggesting a strong evolutionary constraint. In these species, the wide 3'RR (~30 kb in human bears a large palindromic sequence, consisting in two ~3 kb complementary branches spaced by a ~3 kb sequence always including the HS1.2 enhancer. In mouse and rat, HS3 is involved by the palindrome so that one copy of the enhancer is present on each side. A second relevant feature of our present work concerns human polymorphism of the HS1.2 enhancer, associated to immune diseases in our species. We detected a similar polymorphism in all the studied Catarrhini (a primate parvorder. The polymorphism consists of multiple copies of a 40 bp element up to 12 in chimpanzees, 8 in baboons, 6 in macaque, 5 in gibbons, 4 in humans and orangutan, separated by stretches of Cytosine. We show specific binding of this element to nuclear factors. Conclusions The nucleotide sequence of the palindrome is not conserved among evolutionary distant species, suggesting pressures for the maintenance of two self-matching regions driving a three-dimensional structure despite of the inter-specific divergence at sequence level. The

  4. Position and sequence conservation in Amniota of polymorphic enhancer HS1.2 within the palindrome of IgH 3'Regulatory Region.

    Science.gov (United States)

    D'Addabbo, Pietro; Scascitelli, Moira; Giambra, Vincenzo; Rocchi, Mariano; Frezza, Domenico

    2011-03-15

    The Immunoglobulin heavy chain (IgH) 3' Regulatory Region (3'RR), located at the 3' of the constant alpha gene, plays a crucial role in immunoglobulin production. In humans, there are 2 copies of the 3'RR, each composed of 4 main elements: 3 enhancers and a 20 bp tandem repeat. The single mouse 3'RR differs from the two human ones for the presence of 4 more regulative elements with the double copy of one enhancer at the border of a palindromic region. We compared the 3'RR organization in genomes of vertebrates to depict the evolutionary history of the region and highlight its shared features. We found that in the 8 species in which the whole region was included in a fully assembled contig (mouse, rat, dog, rabbit, panda, orangutan, chimpanzee, and human), the shared elements showed synteny and a highly conserved sequence, thus suggesting a strong evolutionary constraint. In these species, the wide 3'RR (~30 kb in human) bears a large palindromic sequence, consisting in two ~3 kb complementary branches spaced by a ~3 kb sequence always including the HS1.2 enhancer. In mouse and rat, HS3 is involved by the palindrome so that one copy of the enhancer is present on each side. A second relevant feature of our present work concerns human polymorphism of the HS1.2 enhancer, associated to immune diseases in our species. We detected a similar polymorphism in all the studied Catarrhini (a primate parvorder). The polymorphism consists of multiple copies of a 40 bp element up to 12 in chimpanzees, 8 in baboons, 6 in macaque, 5 in gibbons, 4 in humans and orangutan, separated by stretches of Cytosine. We show specific binding of this element to nuclear factors. The nucleotide sequence of the palindrome is not conserved among evolutionary distant species, suggesting pressures for the maintenance of two self-matching regions driving a three-dimensional structure despite of the inter-specific divergence at sequence level. The information about the conservation of the palindromic

  5. Sequence conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in human and mouse.

    NARCIS (Netherlands)

    M.J. McKay (Michael); C. Troelstra (Christine); P.J. van der Spek (Peter); R. Kanaar (Roland); B. Smit (Bep); A. Hagemeijer (Anne); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1996-01-01

    textabstractThe rad21 gene of Schizosaccharomyces pombe is involved in the repair of ionizing radiation-induced DNA double-strand breaks. The isolation of mouse and human putative homologs of rad21 is reported here. Alignment of the predicted amino acid sequence of Rad21 with the mammalian proteins

  6. The first myriapod genome sequence reveals conservative arthropod gene content and genome organisation in the centipede Strigamia maritima

    NARCIS (Netherlands)

    Chipman, Ariel D; Ferrier, David E K; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S T; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C; Alonso, Claudio R; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C J; Blankenburg, Kerstin P; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K; Du Pasquier, Louis; Duncan, Elizabeth J; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D; Extavour, Cassandra G; Francisco, Liezl; Gabaldón, Toni; Gillis, William J; Goodwin-Horn, Elizabeth A; Green, Jack E; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J P; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H L; Hunn, Julia P; Hunnekuhl, Vera S; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N; Jiggins, Francis M; Jones, Tamsin E; Kaiser, Tobias S; Kalra, Divya; Kenny, Nathan J; Korchina, Viktoriya; Kovar, Christie L; Kraus, F Bernhard; Lapraz, François; Lee, Sandra L; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C; Robertson, Helen E; Robertson, Hugh M; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E; Schurko, Andrew M; Siggens, Kenneth W; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M; Willis, Judith H; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M; Worley, Kim C; Gibbs, Richard A; Akam, Michael; Richards, Stephen

    2014-01-01

    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present

  7. Assessment of genetic diversity among four orchids based on ddRAD sequencing data for conservation purposes.

    Science.gov (United States)

    Roy, Subhas Chandra; Moitra, Kaushik; De Sarker, Dilip

    2017-01-01

    Genetic diversity was assessed in the four orchid species using NGS based ddRAD sequencing data. The assembled nucleotide sequences (fastq) were deposited in the SRA archive of NCBI Database with accession number (SRP063543 for Dendrobium , SRP065790 for Geodorum, SRP072201 for Cymbidium and SRP072378 for Rhynchostylis ). Total base pair read was 1.1 Mbp in case of Dendrobium sp., 553.3 Kbp for Geodorum sp., 1.6 Gbp for Cymbidium , and 1.4 Gbp for Rhynchostylis . Average GC% was 43.9 in Geodorum , 43.7% in Dendrobium , 41.2% in Cymbidium and 42.3% in Rhynchostylis . Four partial gene sequences were used in DnaSP5 program for nucleotide diversity and phylogenetic relationship determination ( Ycf2 gene of Dendrobium, matK gene of Geodorum , psbD gene of Cymbidium and Ycf2 gene of Ryhnchostylis ). Nucleotide diversity (per site) Pi (π) was 0.10560 in Dendrobium, 0.03586 in Geodorum, 0.01364 in Cymbidium and 0.011344 in Rhynchostylis . Neutrality test statistics showed the negative value in all the four orchid species (Tajima's D value -2.17959 in Dendrobium , -2.01655 in Geodorum, -2.12362 in Rhynchostylis and -1.54222 in Cymbidium ) indicating the purifying selection. Result for these gene sequences ( mat K and Ycf 2 and psb D) indicate that they were not evolved neutrally, but signifying that selection might have played a role in evolution of these genes in these four groups of orchids. Phylogenetic relationship was analyzed by reconstructing dendrogram based on the matK, psbD and Ycf2 gene sequences using maximum likelihood method in MEGA6 program.

  8. Identification of conserved and novel microRNAs in Catharanthus roseus by deep sequencing and computational prediction of their potential targets.

    Science.gov (United States)

    Prakash, Pravin; Ghosliya, Dolly; Gupta, Vikrant

    2015-01-10

    MicroRNAs are small endogenous non-coding RNAs of ~19-24 nucleotides and perform regulatory roles in many plant processes. To identify miRNAs involved in regulatory networks controlling diverse biological processes including secondary metabolism in Catharanthus roseus, an important medicinal plant, we employed deep sequencing of small RNA from leaf tissue. A total of 88 potential miRNAs comprising of 81 conserved miRNAs belonging to 35 families and seven novel miRNAs were identified. Precursors for 16 conserved and seven novel cro-miRNAs were identified, and their stem-loop hairpin structures were predicted. Selected cro-miRNAs were analyzed by stem-loop qRT-PCR and differential expression patterns were observed in different vegetative tissues of C. roseus. Targets were predicted for conserved and novel cro-miRNAs, which were found to be involved in diverse biological role(s) including secondary metabolism. Our study enriches available resources and information regarding miRNAs and their potential targets for better understanding of miRNA-mediated gene regulation in plants. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Functional conservation between rodents and chicken of regulatory sequences driving skeletal muscle gene expression in transgenic chickens

    Directory of Open Access Journals (Sweden)

    Taylor Lorna

    2010-02-01

    Full Text Available Abstract Background Regulatory elements that control expression of specific genes during development have been shown in many cases to contain functionally-conserved modules that can be transferred between species and direct gene expression in a comparable developmental pattern. An example of such a module has been identified at the rat myosin light chain (MLC 1/3 locus, which has been well characterised in transgenic mouse studies. This locus contains two promoters encoding two alternatively spliced isoforms of alkali myosin light chain. These promoters are differentially regulated during development through the activity of two enhancer elements. The MLC3 promoter alone has been shown to confer expression of a reporter gene in skeletal and cardiac muscle in transgenic mice and the addition of the downstream MLC enhancer increased expression levels in skeletal muscle. We asked whether this regulatory module, sufficient for striated muscle gene expression in the mouse, would drive expression in similar domains in the chicken. Results We have observed that a conserved downstream MLC enhancer is present in the chicken MLC locus. We found that the rat MLC1/3 regulatory elements were transcriptionally active in chick skeletal muscle primary cultures. We observed that a single copy lentiviral insert containing this regulatory cassette was able to drive expression of a lacZ reporter gene in the fast-fibres of skeletal muscle in chicken in three independent transgenic chicken lines in a pattern similar to the endogenous MLC locus. Reporter gene expression in cardiac muscle tissues was not observed for any of these lines. Conclusions From these results we conclude that skeletal expression from this regulatory module is conserved in a genomic context between rodents and chickens. This transgenic module will be useful in future investigations of muscle development in avian species.

  10. Prediction of enzyme function based on 3D templates of evolutionarily important amino acids

    Directory of Open Access Journals (Sweden)

    Chen Brian Y

    2008-01-01

    Full Text Available Abstract Background Structural genomics projects such as the Protein Structure Initiative (PSI yield many new structures, but often these have no known molecular functions. One approach to recover this information is to use 3D templates – structure-function motifs that consist of a few functionally critical amino acids and may suggest functional similarity when geometrically matched to other structures. Since experimentally determined functional sites are not common enough to define 3D templates on a large scale, this work tests a computational strategy to select relevant residues for 3D templates. Results Based on evolutionary information and heuristics, an Evolutionary Trace Annotation (ETA pipeline built templates for 98 enzymes, half taken from the PSI, and sought matches in a non-redundant structure database. On average each template matched 2.7 distinct proteins, of which 2.0 share the first three Enzyme Commission digits as the template's enzyme of origin. In many cases (61% a single most likely function could be predicted as the annotation with the most matches, and in these cases such a plurality vote identified the correct function with 87% accuracy. ETA was also found to be complementary to sequence homology-based annotations. When matches are required to both geometrically match the 3D template and to be sequence homologs found by BLAST or PSI-BLAST, the annotation accuracy is greater than either method alone, especially in the region of lower sequence identity where homology-based annotations are least reliable. Conclusion These data suggest that knowledge of evolutionarily important residues improves functional annotation among distant enzyme homologs. Since, unlike other 3D template approaches, the ETA method bypasses the need for experimental knowledge of the catalytic mechanism, it should prove a useful, large scale, and general adjunct to combine with other methods to decipher protein function in the structural proteome.

  11. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available BACKGROUND: The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. METHODOLOGY/PRINCIPAL FINDINGS: Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. CONCLUSION/SIGNIFICANCE: We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  12. Channel catfish BAC-end sequences for marker development and assessment of syntenic conservation with other fish species.

    Science.gov (United States)

    Xu, P; Wang, S; Liu, L; Peatman, E; Somridhivej, B; Thimmapuram, J; Gong, G; Liu, Z

    2006-08-01

    In the present study, 25 195 BAC ends for channel catfish (Ictalurus punctatus) were sequenced, generating 20 366 clean BAC-end sequences (BES), with an average read length of 557 bp after trimming. A total of 11 414 601 bp were generated, representing approximately 1.2% of the catfish genome. Based on this survey, the catfish genome was found to be highly AT-rich, with 60.7% A+T and 39.3% G+C. Approximately 12% of the catfish genome consisted of dispersed repetitive elements, with the Tc1/mariner transposons making up the largest percentage by base pair (4.57%). Microsatellites were detected in 17.5% of BES. Catfish BACs were anchored to the zebrafish and Tetraodon genome sequences by BLASTN, generating 16% and 8.2% significant hits (E < e(-5)) respectively. A total of 1074 and 773 significant hits were unique to the zebrafish and Tetraodon genomes, respectively, of which 417 and 406, respectively, were identified as known genes in other species, providing a major genome resource for comparative genomic mapping.

  13. Inhibition of Hepatitis C Virus in Mice by a Small Interfering RNA Targeting a Highly Conserved Sequence in Viral IRES Pseudoknot.

    Directory of Open Access Journals (Sweden)

    Jae-Su Moon

    Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.

  14. Hepatitis B virus depicts a high degree of conservation during the immune-tolerant phase in familiarly transmitted chronic hepatitis B infection: deep-sequencing and phylogenetic analysis.

    Science.gov (United States)

    Sede, M; Lopez-Ledesma, M; Frider, B; Pozzati, M; Campos, R H; Flichman, D; Quarleri, J

    2014-01-01

    When intrafamilial transmission of hepatitis B virus (HBV) occurs, a virus with the same characteristics interacts with diverse hosts' immune systems and may thus result in different mutations to escape immune pressure. In this study, the HBV genomic characterization was assessed longitudinally after intrafamilial transmission using nucleotide sequence data of phylogenetic and mutational analyses, including those obtained by deep-sequencing for the first time. Furthermore, HBeAg-anti-HBe profile and variability of HBV core-derived epitopes were also evaluated. Strong evidence was obtained from intrafamilial transmission of HBV genotype D1 by phylogenetic inferences. HBV isolates exhibited high degree (~99%) of genomic conservation for almost 20 years, when patients were persistently HBeAg positive with normal amino transferase levels. This identity remained high among immune-tolerant siblings. In contrast, it diminished significantly (P = 0.02) when the mother cleared HBeAg (immune clearance phase). By deep-sequencing, the quantitative analysis of the dynamics of basal core promoter (BCP) (A1762T, G1764A; A1766C; T1773C; 8-bp deletion; and other) and precore (G1896A) variants among HBV isolates from family members exhibited differences during the follow-up. However, only those from the mother showed amino acid variations at core protein that would impair their MHC-II binding. Hence, when intrafamilial transmission occurs, HBV was highly conserved under the immune-tolerant phase, but it exhibited mutations more frequently during the immune clearance phase. The analysis of the HBV BCP and precore mutants after intrafamilial HBV transmission contributes to a better understanding of how they evolve over time. © 2013 John Wiley & Sons Ltd.

  15. The disequilibrium of nucleosomes distribution along chromosomes plays a functional and evolutionarily role in regulating gene expression

    KAUST Repository

    Cui, Peng

    2011-08-19

    To further understand the relationship between nucleosome-space occupancy (NO) and global transcriptional activity in mammals, we acquired a set of genome-wide nucleosome distribution and transcriptome data from the mouse cerebrum and testis based on ChIP (H3)-seq and RNA-seq, respectively. We identified a nearly consistent NO patterns among three mouse tissues-cerebrum, testis, and ESCs-and found, through clustering analysis for transcriptional activation, that the NO variations among chromosomes are closely associated with distinct expression levels between house-keeping (HK) genes and tissue-specific (TS) genes. Both TS and HK genes form clusters albeit the obvious majority. This feature implies that NO patterns, i.e. nucleosome binding and clustering, are coupled with gene clustering that may be functionally and evolutionarily conserved in regulating gene expression among different cell types. © 2011 Cui et al.

  16. The disequilibrium of nucleosomes distribution along chromosomes plays a functional and evolutionarily role in regulating gene expression.

    Directory of Open Access Journals (Sweden)

    Peng Cui

    Full Text Available To further understand the relationship between nucleosome-space occupancy (NO and global transcriptional activity in mammals, we acquired a set of genome-wide nucleosome distribution and transcriptome data from the mouse cerebrum and testis based on ChIP (H3-seq and RNA-seq, respectively. We identified a nearly consistent NO patterns among three mouse tissues--cerebrum, testis, and ESCs--and found, through clustering analysis for transcriptional activation, that the NO variations among chromosomes are closely associated with distinct expression levels between house-keeping (HK genes and tissue-specific (TS genes. Both TS and HK genes form clusters albeit the obvious majority. This feature implies that NO patterns, i.e. nucleosome binding and clustering, are coupled with gene clustering that may be functionally and evolutionarily conserved in regulating gene expression among different cell types.

  17. The Phylogeographical Pattern and Conservation of the Chinese Cobra (Naja atra) across Its Range Based on Mitochondrial Control Region Sequences

    Science.gov (United States)

    Lin, Long-Hui; Hua, Lei; Qu, Yan-Fu; Gao, Jian-Fang; Ji, Xiang

    2014-01-01

    The vulnerable Chinese cobra (Naja atra) ranges from southeastern China south of the Yangtze River to northern Vietnam and Laos. Large mountain ranges and water bodies may influence the pattern of genetic diversity of this species. We sequenced the mitochondrial DNA control region (1029 bp) using 285 individuals collected from 23 localities across the species' range and obtained 18 sequences unique to Taiwan from GenBank for phylogenetic and population analysis. Two distinct clades were identified, one including haplotypes from the two westernmost localities (Hekou and Miyi) and the other including haplotypes from all sampling sites except Miyi. A strong population structure was found (Φst = 0.76, P<0.0001) with high haplotype diversity (h = 1.00) and low nucleotide diversity (π = 0.0049). The Luoxiao and Nanling Mountains act as historical geographical barriers limiting gene exchange. In the haplotype network there were two “star” clusters. Haplotypes from populations east of the Luoxiao Mountains were represented within one cluster and haplotypes from populations west of the mountain range within the other, with haplotypes from populations south of the Nanling Mountains in between. Lineage sorting between mainland and island populations is incomplete. It remains unknown as to how much adaptive differentiation there is between population groups or within each group. We caution against long-distance transfers within any group, especially when environmental differences are apparent. PMID:25184236

  18. The phylogeographical pattern and conservation of the Chinese cobra (Naja atra) across its range based on mitochondrial control region sequences.

    Science.gov (United States)

    Lin, Long-Hui; Hua, Lei; Qu, Yan-Fu; Gao, Jian-Fang; Ji, Xiang

    2014-01-01

    The vulnerable Chinese cobra (Naja atra) ranges from southeastern China south of the Yangtze River to northern Vietnam and Laos. Large mountain ranges and water bodies may influence the pattern of genetic diversity of this species. We sequenced the mitochondrial DNA control region (1029 bp) using 285 individuals collected from 23 localities across the species' range and obtained 18 sequences unique to Taiwan from GenBank for phylogenetic and population analysis. Two distinct clades were identified, one including haplotypes from the two westernmost localities (Hekou and Miyi) and the other including haplotypes from all sampling sites except Miyi. A strong population structure was found (Φst = 0.76, P<0.0001) with high haplotype diversity (h = 1.00) and low nucleotide diversity (π = 0.0049). The Luoxiao and Nanling Mountains act as historical geographical barriers limiting gene exchange. In the haplotype network there were two "star" clusters. Haplotypes from populations east of the Luoxiao Mountains were represented within one cluster and haplotypes from populations west of the mountain range within the other, with haplotypes from populations south of the Nanling Mountains in between. Lineage sorting between mainland and island populations is incomplete. It remains unknown as to how much adaptive differentiation there is between population groups or within each group. We caution against long-distance transfers within any group, especially when environmental differences are apparent.

  19. The first complete mitochondrial genome sequences of Amblypygi (Chelicerata: Arachnida) reveal conservation of the ancestral arthropod gene order.

    Science.gov (United States)

    Fahrein, Kathrin; Masta, Susan E; Podsiadlowski, Lars

    2009-05-01

    Amblypygi (whip spiders) are terrestrial chelicerates inhabiting the subtropics and tropics. In morphological and rRNA-based phylogenetic analyses, Amblypygi cluster with Uropygi (whip scorpions) and Araneae (spiders) to form the taxon Tetrapulmonata, but there is controversy regarding the interrelationship of these three taxa. Mitochondrial genomes provide an additional large data set of phylogenetic information (sequences, gene order, RNA secondary structure), but in arachnids, mitochondrial genome data are missing for some of the major orders. In the course of an ongoing project concerning arachnid mitochondrial genomics, we present the first two complete mitochondrial genomes from Amblypygi. Both genomes were found to be typical circular duplex DNA molecules with all 37 genes usually present in bilaterian mitochondrial genomes. In both species, gene order is identical to that of Limulus polyphemus (Xiphosura), which is assumed to reflect the putative arthropod ground pattern. All tRNA gene sequences have the potential to fold into structures that are typical of metazoan mitochondrial tRNAs, except for tRNA-Ala, which lacks the D arm in both amblypygids, suggesting the loss of this feature early in amblypygid evolution. Phylogenetic analysis resulted in weak support for Uropygi being the sister group of Amblypygi.

  20. p23 and HSP20/alpha-crystallin proteins define a conserved sequence domain present in other eukaryotic protein families.

    Science.gov (United States)

    Garcia-Ranea, J A; Mirey, Gladys; Camonis, Jacques; Valencia, Alfonso

    2002-10-09

    We identified families of proteins characterized by the presence of a domain similar to human p23 protein, which include proteins such as Sgt1, involved in the yeast kinetochore assembly; melusin, involved in specific interactions with the cytoplasmic integrin beta1 domain; Rar1, related to pathogenic resistance in plants, and to development in animals; B5+B5R flavo-hemo cytochrome NAD(P)H oxidoreductase type B in humans and mice; and NudC, involved in nucleus migration during mitosis. We also found that p23 and the HSP20/alpha-crystallin family of heat shock proteins, which share the same three-dimensional folding, show a pattern of conserved residues that points to a common origin in the evolution of both protein domains. The p23 and HSP20/alpha-crystallin phylogenetic relationship and their similar role in chaperone activity suggest a common function, probably involving protein-protein interaction, for those proteins containing p23-like domains.

  1. Mutational analysis of the vacuolar sorting signal of procarboxypeptidase Y in yeast shows a low requirement for sequence conservation

    DEFF Research Database (Denmark)

    van Voorst, F; Kielland-Brandt, Morten; Winther, Jakob R.

    1996-01-01

    The core of the vacuolar targeting signal of yeast carboxypeptidase Y (CPY) is recognized by the receptor Vps10p and consists of four contiguous amino acid residues, Gln24-Arg-Pro-Leu27, near the amino terminus of the propeptide (Valls, L.A., Winther, J. R., and Stevens, T. H. (1990) J. Cell Biol....... 111, 361-368; Marcusson, E. G., Horazdovsky, B. F., Cereghino, J. L., Gharakhanian, E., and Emr, S. D. (1994) Cell 77, 579-586). In order to determine the sequence specificity of the interaction with the sorting receptor, substitutions were introduced into this part of the propeptide by semirandom...... site-directed mutagenesis. The efficiency of vacuolar sorting by the mutants was determined by immunoprecipitation of CPY from pulse-labeled cells. It was found that amino acid residues Gln24 and Leu27 were the most important ones. While it appears that Gln24 is essential for proper function, Leu27 can...

  2. Identification of evolutionarily invariant sequences in the protein C gene promoter

    NARCIS (Netherlands)

    Spek, C. A.; Bertina, R. M.; Reitsma, P. H.

    1998-01-01

    Recent studies on human protein C gene expression have revealed the presence of three transcription factor binding sites in close proximity to the transcription start site. Binding sites for the liver-enriched hepatocyte nuclear factors 1 and 3 (HNF-1 and HNF-3, respectively) are located immediately

  3. Tracing the Evolutionary History of the CAP Superfamily of Proteins Using Amino Acid Sequence Homology and Conservation of Splice Sites.

    Science.gov (United States)

    Abraham, Anup; Chandler, Douglas E

    2017-10-01

    Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.

  4. Computational identification of conserved microRNAs and their targets from expression sequence tags of blueberry (Vaccinium corybosum).

    Science.gov (United States)

    Li, Xuyan; Hou, Yanming; Zhang, Li; Zhang, Wenhao; Quan, Chen; Cui, Yuhai; Bian, Shaomin

    2014-01-01

    MicroRNAs (miRNAs) are a class of endogenous, approximately 21nt in length, non-coding RNA, which mediate the expression of target genes primarily at post-transcriptional levels. miRNAs play critical roles in almost all plant cellular and metabolic processes. Although numerous miRNAs have been identified in the plant kingdom, the miRNAs in blueberry, which is an economically important small fruit crop, still remain totally unknown. In this study, we reported a computational identification of miRNAs and their targets in blueberry. By conducting an EST-based comparative genomics approach, 9 potential vco-miRNAs were discovered from 22,402 blueberry ESTs according to a series of filtering criteria, designated as vco-miR156-5p, vco-miR156-3p, vco-miR1436, vco-miR1522, vco-miR4495, vco-miR5120, vco-miR5658, vco-miR5783, and vco-miR5986. Based on sequence complementarity between miRNA and its target transcript, 34 target ESTs from blueberry and 70 targets from other species were identified for the vco-miRNAs. The targets were found to be involved in transcription, RNA splicing and binding, DNA duplication, signal transduction, transport and trafficking, stress response, as well as synthesis and metabolic process. These findings will greatly contribute to future research in regard to functions and regulatory mechanisms of blueberry miRNAs.

  5. Comparative cytogenetics of tree frogs of the Dendropsophus marmoratus (Laurenti, 1768) group: conserved karyotypes and interstitial telomeric sequences.

    Science.gov (United States)

    Teixeira, Lívia S R; Seger, Karin Regina; Targueta, Cíntia Pelegrineti; Orrico, Victor G Dill; Lourenço, Luciana Bolsoni

    2016-01-01

    The diploid number 2n = 30 is a presumed synapomorphy of Dendropsophus Fitzinger, 1843, although a noticeable variation in the number of biarmed/telocentric chromosomes is observed in this genus. Such a variation suggests that several chromosomal rearrangements took place after the evolutionary origin of the hypothetical ancestral 30-chromosome karyotype; however, the inferred rearrangements remain unknown. Distinct numbers of telocentric chromosomes are found in the two most cytogenetically studied species groups of Dendropsophus. In contrast, all three species of the Dendropsophus marmoratus (Laurenti, 1768) group that are already karyotyped presented five pairs of telocentric chromosomes. In this study, we analyzed cytogenetically three additional species of this group to investigate if the number of telocentric chromosomes in this group is not as variable as in other Dendropsophus groups. We described the karyotypes of Dendropsophus seniculus (Cope, 1868), Dendropsophus soaresi (Caramaschi & Jim, 1983) and Dendropsophus novaisi (Bokermann, 1968) based on Giemsa staining, C-banding, silver impregnation and in situ hybridization with telomeric probes. Dendropsophus seniculus, Dendropsophus soaresi and Dendropsophus novaisi presented five pairs of telocentric chromosomes, as did the remaining species of the group previously karyotyped. Though the species of this group show a high degree of karyotypic similarity, Dendropsophus soaresi was unique in presenting large blocks of het-ITSs (heterochromatic internal telomeric sequences) in the majority of the centromeres. Although the ITSs have been interpreted as evidence of ancestral chromosomal fusions and inversions, the het-ITSs detected in the karyotype of Dendropsophus soaresi could not be explained as direct remnants of ancestral chromosomal rearrangements because no evidence of chromosomal changes emerged from the comparison of the karyotypes of all of the species of the Dendropsophus marmoratus group.

  6. Identification of novel and conserved microRNAs related to drought stress in potato by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available MicroRNAs (miRNAs are a group of small, non-coding RNAs that play important roles in plant growth, development and stress response. There have been an increasing number of investigations aimed at discovering miRNAs and analyzing their functions in model plants (such as Arabidopsis thaliana and rice. In this research, we constructed small RNA libraries from both polyethylene glycol (PEG 6,000 treated and control potato samples, and a large number of known and novel miRNAs were identified. Differential expression analysis showed that 100 of the known miRNAs were down-regulated and 99 were up-regulated as a result of PEG stress, while 119 of the novel miRNAs were up-regulated and 151 were down-regulated. Based on target prediction, annotation and expression analysis of the miRNAs and their putative target genes, 4 miRNAs were identified as regulating drought-related genes (miR811, miR814, miR835, miR4398. Their target genes were MYB transcription factor (CV431094, hydroxyproline-rich glycoprotein (TC225721, quaporin (TC223412 and WRKY transcription factor (TC199112, respectively. Relative expression trends of those miRNAs were the same as that predicted by Solexa sequencing and they showed a negative correlation with the expression of the target genes. The results provide molecular evidence for the possible involvement of miRNAs in the process of drought response and/or tolerance in the potato plant.

  7. Whole-genome sequences of Odocoileus hemionus deer adenovirus isolates from deer, moose and elk are highly conserved and support a new species in the genus Atadenovirus.

    Science.gov (United States)

    Miller, Myrna M; Cornish, Todd E; Creekmore, Terry E; Fox, Karen; Laegreid, Will; McKenna, Jennifer; Vasquez, Marce; Woods, Leslie W

    2017-09-01

    We present the first complete genome sequence of Odocoileus hemionus deer adenovirus 1 (OdAdV-1). This virus can cause sporadic haemorrhagic disease in cervids, although epizootics with high mortality have occurred in California. OdAdV-1 has been placed in the genus Atadenovirus, based on partial hexon, pVIII and fibre genes. Ten field isolates recovered from naturally infected mule deer (Odocoileus hemionus), white-tailed deer (Odocoileus virginiana) and moose (Alces alces) from Wyoming, black-tailed deer (Odocoileus hemionus columbianus) from California, and Rocky Mountain elk (Cervus elaphus nelsoni) from Colorado and Washington state were sequenced. The genome lengths ranged from 30 620 to 30 699 bp, contained the predicted proteins and gene organization typical of members of genus Atadenovirus, and had a high percentage of A/T nucleotides (66.7 %). Phylogenic analysis found that the closest ancestry was with ruminant atadenoviruses, while a divergence of the hexon, polymerase and penton base proteins of more than 15 % supports classification as a new species. Genetic global comparison between the 10 isolates found an overall 99 % identity, but greater divergence was found between those recovered from moose and elk as compared to deer, and a single variable region contained most of these differences. Our findings demonstrate that OdAdV-1 is highly conserved between 10 isolates recovered from multiple related cervid species, but genotypic differences, largely localized to a variable region, define two strains. We propose that the virus type name be changed to cervid adenovirus 1, with the species name Cervid atadenovirus A. Sequence data were used to develop molecular assays for improved detection and genotyping.

  8. RNA expression in a cartilaginous fish cell line reveals ancient 3' noncoding regions highly conserved in vertebrates.

    Science.gov (United States)

    Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J; Barnes, David W

    2007-01-23

    We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3' UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3' mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology.

  9. Large-scale sequence analysis of hemagglutinin of influenza A virus identifies conserved regions suitable for targeting an anti-viral response.

    Science.gov (United States)

    Sahini, Leepakshi; Tempczyk-Russell, Anna; Agarwal, Ritu

    2010-02-17

    Influenza A viral surface protein, hemagglutinin, is the major target of neutralizing antibody response and hence a main constituent of all vaccine formulations. But due to its marked evolutionary variability, vaccines have to be reformulated so as to include the hemagglutinin protein from the emerging new viral strain. With the constant fear of a pandemic, there is critical need for the development of anti-viral strategies that can provide wider protection against any Influenza A pathogen. An anti-viral approach that is directed against the conserved regions of the hemaggutinin protein has a potential to protect against any current and new Influenza A virus and provide a solution to this ever-present threat to public health. Influenza A human hemagglutinin protein sequences available in the NCBI database, corresponding to H1, H2, H3 and H5 subtypes, were used to identify highly invariable regions of the protein. Nine such regions were identified and analyzed for structural properties like surface exposure, hydrophilicity and residue type to evaluate their suitability for targeting an anti-peptide antibody/anti-viral response. This study has identified nine conserved regions in the hemagglutinin protein, five of which have the structural characteristics suitable for an anti-viral/anti-peptide response. This is a critical step in the design of efficient anti-peptide antibodies as novel anti-viral agents against any Influenza A pathogen. In addition, these anti-peptide antibodies will provide broadly cross-reactive immunological reagents and aid the rapid development of vaccines against new and emerging Influenza A strains.

  10. The wing-patterning network in the wingless castes of Myrmicine and Formicine ant species is a mix of evolutionarily labile and non-labile genes.

    Science.gov (United States)

    Shbailat, Seba Jamal; Abouheif, Ehab

    2013-03-01

    Wing polyphenism in ants is the ability of a single genome to produce winged or wingless castes in a colony in response to environmental cues. Although wing polyphenism is a universal and homologous feature of ants, the gene network underlying wing polyphenism is conserved in the winged castes, but is labile in the wingless castes, that is, the network is interrupted at different points in the wingless castes of different ant species. Because the expression of all genes sampled so far in this network in the wingless castes is evolutionarily labile across species, an important question is whether all "interruption points" in the network are evolutionarily labile or are there interruption points that are evolutionarily non-labile. Here we show that in the wingless castes, the expression of the gene brinker (brk), which mediates growth, patterning, and apoptosis in the Drosophila wing disc, is non-labile; it is absent in vestigial wing discs of four ants species. In contrast, the expression of engrailed (en), a gene upstream of brk is labile; it is present in some species but absent in others. In the winged castes, both brk and en expression are conserved relative to their expression in Drosophila wing discs. The differential lability of genes in the network in wingless castes may be a general feature of networks underlying polyphenic traits. This raises the possibility that some genes, like brk, may be under stabilizing selection while most others, like en, may be evolving via directional selection or neutral drift. Copyright © 2012 Wiley Periodicals, Inc.

  11. Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria : research communication

    Directory of Open Access Journals (Sweden)

    D.O. Oluwayelu

    2008-09-01

    Full Text Available This work reports the first molecular analysis study of chicken anaemia virus (CAV in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6 % and 4 % nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2 % amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/Cl-8 and NGR/Cl-9 were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

  12. A nuclear DNA perspective on delineating evolutionarily significant lineages in polyploids: the case of the endangered shortnose sturgeon (Acipenser brevirostrum)

    Science.gov (United States)

    King, Timothy L.; Henderson, Anne P.; Kynard, Boyd E.; Kieffer, Micah C.; Peterson, Douglas L.; Aunins, Aaron W.; Brown, Bonnie L.

    2014-01-01

    The shortnose sturgeon, Acipenser brevirostrum, oft considered a phylogenetic relic, is listed as an “endangered species threatened with extinction” in the US and “Vulnerable” on the IUCN Red List. Effective conservation of A. brevirostrum depends on understanding its diversity and evolutionary processes, yet challenges associated with the polyploid nature of its nuclear genome have heretofore limited population genetic analysis to maternally inherited haploid characters. We developed a suite of polysomic microsatellite DNA markers and characterized a sample of 561 shortnose sturgeon collected from major extant populations along the North American Atlantic coast. The 181 alleles observed at 11 loci were scored as binary loci and the data were subjected to multivariate ordination, Bayesian clustering, hierarchical partitioning of variance, and among-population distance metric tests. The methods uncovered moderately high levels of gene diversity suggesting population structuring across and within three metapopulations (Northeast, Mid-Atlantic, and Southeast) that encompass seven demographically discrete and evolutionarily distinct lineages. The predicted groups are consistent with previously described behavioral patterns, especially dispersal and migration, supporting the interpretation that A. brevirostrum exhibit adaptive differences based on watershed. Combined with results of prior genetic (mitochondrial DNA) and behavioral studies, the current work suggests that dispersal is an important factor in maintaining genetic diversity in A. brevirostrum and that the basic unit for conservation management is arguably the local population.

  13. Most m6A RNA modifications in protein-coding regions are evolutionarily unconserved and likely nonfunctional.

    Science.gov (United States)

    Liu, Zhen; Zhang, Jianzhi

    2017-12-08

    Methylation of the adenosine base at the nitrogen-6 position (m6A) is the most prevalent internal posttranscriptional modification of mRNAs in many eukaryotes. Despite the rapid progress in the transcriptome-wide mapping of m6As, identification of proteins responsible for writing, reading, and erasing m6As, and elucidation of m6A functions in splicing, RNA stability, translation, and other processes, it is unknown whether most observed m6A modifications are functional. To address this question, we respectively analyze the evolutionary conservation of yeast and human m6As in protein-coding regions. Relative to comparable unmethylated As, m6As are overall no more conserved in yeasts and only slightly more conserved in mammals. Furthermore, yeast m6As and comparable unmethylated As have no significant difference in single nucleotide polymorphism (SNP) density or SNP site frequency spectrum. The same is true in human. The methylation status of a gene, not necessarily the specific sites methylated in the gene, is subject to purifying selection for no more than ∼20% of m6A-modified genes. These observations suggest that most m6A modifications in protein-coding regions are nonfunctional and nonadaptive, probably resulting from off-target activities of m6A methyltransferases. In addition, our reanalysis invalidates the recent claim of positive selection for newly acquired m6A modifications in human evolution. Regarding the small number of evolutionarily conserved m6As, evidence suggests that a large proportion of them are likely functional; they should be prioritized in future functional characterizations of m6As. Together, these findings have important implications for understanding the biological significance of m6A and other posttranscriptional modifications. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Mulan: Multiple-Sequence Local Alignment and Visualization for Studying Function and Evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ovcharenko, I; Loots, G; Giardine, B; Hou, M; Ma, J; Hardison, R; Stubbs, L; Miller, W

    2004-07-14

    Multiple sequence alignment analysis is a powerful approach for understanding phylogenetic relationships, annotating genes and detecting functional regulatory elements. With a growing number of partly or fully sequenced vertebrate genomes, effective tools for performing multiple comparisons are required to accurately and efficiently assist biological discoveries. Here we introduce Mulan (http://mulan.dcode.org/), a novel method and a network server for comparing multiple draft and finished-quality sequences to identify functional elements conserved over evolutionary time. Mulan brings together several novel algorithms: the tba multi-aligner program for rapid identification of local sequence conservation and the multiTF program for detecting evolutionarily conserved transcription factor binding sites in multiple alignments. In addition, Mulan supports two-way communication with the GALA database; alignments of multiple species dynamically generated in GALA can be viewed in Mulan, and conserved transcription factor binding sites identified with Mulan/multiTF can be integrated and overlaid with extensive genome annotation data using GALA. Local multiple alignments computed by Mulan ensure reliable representation of short-and large-scale genomic rearrangements in distant organisms. Mulan allows for interactive modification of critical conservation parameters to differentially predict conserved regions in comparisons of both closely and distantly related species. We illustrate the uses and applications of the Mulan tool through multi-species comparisons of the GATA3 gene locus and the identification of elements that are conserved differently in avians than in other genomes allowing speculation on the evolution of birds. Source code for the aligners and the aligner-evaluation software can be freely downloaded from http://bio.cse.psu.edu/.

  15. Conserved epitopes on HIV-1, FIV and SIV p24 proteins are recognized by HIV-1 infected subjects.

    Science.gov (United States)

    Roff, Shannon R; Sanou, Missa P; Rathore, Mobeen H; Levy, Jay A; Yamamoto, Janet K

    2015-01-01

    Cross-reactive peptides on HIV-1 and FIV p24 protein sequences were studied using peripheral blood mononuclear cells (PBMC) from untreated HIV-1-infected long-term survivors (LTS; >10 y of infection without antiretroviral therapy, ART), short-term HIV-1 infected subjects not on ART, and ART-treated HIV-1 infected subjects. IFNγ-ELISpot and CFSE-proliferation analyses were performed with PBMC using overlapping HIV-1 and FIV p24 peptides. Over half of the HIV-1 infected subjects tested (22/31 or 71%) responded to one or more FIV p24 peptide pools by either IFNγ or T-cell proliferation analysis. PBMC and T cells from infected subjects in all 3 HIV(+) groups predominantly recognized one FIV p24 peptide pool (Fp14) by IFNγ production and one additional FIV p24 peptide pool (Fp9) by T-cell proliferation analysis. Furthermore, evaluation of overlapping SIV p24 peptide sequences identified conserved epitope(s) on the Fp14/Hp15-counterpart of SIV, Sp14, but none on Fp9-counterpart of SIV, Sp9. The responses to these FIV peptide pools were highly reproducible and persisted throughout 2-4 y of monitoring. Intracellular staining analysis for cytotoxins and phenotyping for CD107a determined that peptide epitopes from Fp9 and Fp14 pools induced cytotoxic T lymphocyte-associated molecules including perforin, granzyme B, granzyme A, and/or expression of CD107a. Selected FIV and corresponding SIV epitopes recognized by HIV-1 infected patients indicate that these protein sequences are evolutionarily conserved on both SIV and HIV-1 (e.g., Hp15:Fp14:Sp14). These studies demonstrate that comparative immunogenicity analysis of HIV-1, FIV, and SIV can identify evolutionarily-conserved T cell-associated lentiviral epitopes, which could be used as a vaccine for prophylaxis or immunotherapy.

  16. Use of genotyping by sequencing data to develop a high-throughput and multifunctional SNP panel for conservation applications in Pacific lamprey.

    Science.gov (United States)

    Hess, Jon E; Campbell, Nathan R; Docker, Margaret F; Baker, Cyndi; Jackson, Aaron; Lampman, Ralph; McIlraith, Brian; Moser, Mary L; Statler, David P; Young, William P; Wildbill, Andrew J; Narum, Shawn R

    2015-01-01

    Next-generation sequencing data can be mined for highly informative single nucleotide polymorphisms (SNPs) to develop high-throughput genomic assays for nonmodel organisms. However, choosing a set of SNPs to address a variety of objectives can be difficult because SNPs are often not equally informative. We developed an optimal combination of 96 high-throughput SNP assays from a total of 4439 SNPs identified in a previous study of Pacific lamprey (Entosphenus tridentatus) and used them to address four disparate objectives: parentage analysis, species identification and characterization of neutral and adaptive variation. Nine of these SNPs are FST outliers, and five of these outliers are localized within genes and significantly associated with geography, run-timing and dwarf life history. Two of the 96 SNPs were diagnostic for two other lamprey species that were morphologically indistinguishable at early larval stages and were sympatric in the Pacific Northwest. The majority (85) of SNPs in the panel were highly informative for parentage analysis, that is, putatively neutral with high minor allele frequency across the species' range. Results from three case studies are presented to demonstrate the broad utility of this panel of SNP markers in this species. As Pacific lamprey populations are undergoing rapid decline, these SNPs provide an important resource to address critical uncertainties associated with the conservation and recovery of this imperiled species. © 2014 John Wiley & Sons Ltd.

  17. Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans

    Science.gov (United States)

    Fraune, Johanna; Alsheimer, Manfred; Volff, Jean-Nicolas; Busch, Karoline; Fraune, Sebastian; Bosch, Thomas C. G.; Benavente, Ricardo

    2012-01-01

    The synaptonemal complex (SC) is a key structure of meiosis, mediating the stable pairing (synapsis) of homologous chromosomes during prophase I. Its remarkable tripartite structure is evolutionarily well conserved and can be found in almost all sexually reproducing organisms. However, comparison of the different SC protein components in the common meiosis model organisms Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus revealed no sequence homology. This discrepancy challenged the hypothesis that the SC arose only once in evolution. To pursue this matter we focused on the evolution of SYCP1 and SYCP3, the two major structural SC proteins of mammals. Remarkably, our comparative bioinformatic and expression studies revealed that SYCP1 and SYCP3 are also components of the SC in the basal metazoan Hydra. In contrast to previous assumptions, we therefore conclude that SYCP1 and SYCP3 form monophyletic groups of orthologous proteins across metazoans. PMID:23012415

  18. Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis

    Science.gov (United States)

    2014-01-01

    Background microRNAs (miRNAs) are endogenous, noncoding, small RNAs that have essential regulatory functions in plant growth, development, and stress response processes. However, limited information is available about their functions in sexual reproduction of flowering plants. Pollen development is an important process in the life cycle of a flowering plant and is a major factor that affects the yield and quality of crop seeds. Results This study aims to identify miRNAs involved in pollen development. Two independent small RNA libraries were constructed from the flower buds of the male sterile line (Bcajh97-01A) and male fertile line (Bcajh97-01B) of Brassica campestris ssp. chinensis. The libraries were subjected to high-throughput sequencing by using the Illumina Solexa system. Eight novel miRNAs on the other arm of known pre-miRNAs, 54 new conserved miRNAs, and 8 novel miRNA members were identified. Twenty-five pairs of novel miRNA/miRNA* were found. Among all the identified miRNAs, 18 differentially expressed miRNAs with over two-fold change between flower buds of male sterile line (Bcajh97-01A) and male fertile line (Bcajh97-01B) were identified. qRT-PCR analysis revealed that most of the differentially expressed miRNAs were preferentially expressed in flower buds of the male fertile line (Bcajh97-01B). Degradome analysis showed that a total of 15 genes were predicted to be the targets of seven miRNAs. Conclusions Our findings provide an overview of potential miRNAs involved in pollen development and interactions between miRNAs and their corresponding targets, which may provide important clues on the function of miRNAs in pollen development. PMID:24559317

  19. Auditory and visual sequence learning in humans and monkeys using an artificial grammar learning paradigm.

    Science.gov (United States)

    Milne, Alice E; Petkov, Christopher I; Wilson, Benjamin

    2017-07-05

    Language flexibly supports the human ability to communicate using different sensory modalities, such as writing and reading in the visual modality and speaking and listening in the auditory domain. Although it has been argued that nonhuman primate communication abilities are inherently multisensory, direct behavioural comparisons between human and nonhuman primates are scant. Artificial grammar learning (AGL) tasks and statistical learning experiments can be used to emulate ordering relationships between words in a sentence. However, previous comparative work using such paradigms has primarily investigated sequence learning within a single sensory modality. We used an AGL paradigm to evaluate how humans and macaque monkeys learn and respond to identically structured sequences of either auditory or visual stimuli. In the auditory and visual experiments, we found that both species were sensitive to the ordering relationships between elements in the sequences. Moreover, the humans and monkeys produced largely similar response patterns to the visual and auditory sequences, indicating that the sequences are processed in comparable ways across the sensory modalities. These results provide evidence that human sequence processing abilities stem from an evolutionarily conserved capacity that appears to operate comparably across the sensory modalities in both human and nonhuman primates. The findings set the stage for future neurobiological studies to investigate the multisensory nature of these sequencing operations in nonhuman primates and how they compare to related processes in humans. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  20. Sequence motifs associated with paternal transmission of mitochondrial DNA in the horse mussel, Modiolus modiolus (Bivalvia: Mytilidae).

    Science.gov (United States)

    Robicheau, Brent M; Breton, Sophie; Stewart, Donald T

    2017-03-20

    In the majority of metazoans paternal mitochondria represent evolutionary dead-ends. In many bivalves, however, this paradigm does not hold true; both maternal and paternal mitochondria are inherited. Herein, we characterize maternal and paternal mitochondrial control regions of the horse mussel, Modiolus modiolus (Bivalvia: Mytilidae). The maternal control region is 808bp long, while the paternal control region is longer at 2.3kb. We hypothesize that the size difference is due to a combination of repeated duplications within the control region of the paternal mtDNA genome, as well as an evolutionarily ancient recombination event between two sex-associated mtDNA genomes that led to the insertion of a second control region sequence in the genome that is now transmitted via males. In a comparison to other mytilid male control regions, we identified two evolutionarily Conserved Motifs, CMA and CMB, associated with paternal transmission of mitochondrial DNA. CMA is characterized by a conserved purine/pyrimidine pattern, while CMB exhibits a specific 13bp nucleotide string within a stem and loop structure. The identification of motifs CMA and CMB in M. modiolus extends our understanding of Sperm Transmission Elements (STEs) that have recently been identified as being associated with the paternal transmission of mitochondria in marine bivalves. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Identification and sequence analysis of six new members of the NIMA-related kinase family in Chlamydomonas.

    Science.gov (United States)

    Bradley, Brian A; Wagner, James J D; Quarmby, Lynne M

    2004-01-01

    The NIMA kinases are an evolutionarily conserved protein family with enigmatic roles in the regulation of mitosis. We report six new members of this family in Chlamydomonas, in addition to the previously identified NIMA-related kinase, Fa2p. Chlamydomonas NIMA-related kinases (CNKs) 1-6 were sequenced from subclones generated by RT-PCR using information from EST libraries and the recently sequenced Chlamydomonas genome. Phylogenetic and bioinformatic approaches were used to determine the relationships of the six new members with known members of the NIMA-related kinase family. Although humans express at least eleven NIMA-related kinases, the eukaryotic microbes that have been studied to date express only one or two members of the family. Thus, the discovery that Chlamydomonas expresses a total of at least seven NIMA-related kinases is intriguing. Our analyses suggest that members of this family may play roles in the assembly and function of cilia.

  2. Synaptotagmin gene content of the sequenced genomes

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2004-07-01

    Full Text Available Abstract Background Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. Results I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. Conclusions I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their

  3. Intraspecific phylogeography of Lasmigona subviridis (Bivalvia: Unionidae): Conservation implications of range discontinuity

    Science.gov (United States)

    King, T.L.; Eackles, M.S.; Gjetvaj, B.; Hoeh, W.R.

    1999-01-01

    A nucleotide sequence analysis of the first internal transcribed spacer region (ITS-1) between the 5.8S and 18S ribosomal DNA genes (640 bp) and cytochrome c oxidase subunit I (COI) of mitochondrial DNA (mtDNA) (576 bp) was conducted for the freshwater bivalve Lasmigona subviridis and three congeners to determine the utility of these regions in identifying phylogeographic and phylogenetic structure. Sequence analysis of the ITS-1 region indicated a zone of discontinuity in the genetic population structure between a group of L. subviridis populations inhabiting the Susquehanna and Potomac Rivers and more southern populations. Moreover, haplotype patterns resulting from variation in the COI region suggested an absence of gene exchange between tributaries within two different river drainages, as well as between adjacent rivers systems. The authors recommend that the northern and southern populations, which are reproductively isolated and constitute evolutionarily significant lineages, be managed as separate conservation units. Results from the COI region suggest that, in some cases, unionid relocations should be avoided between tributaries of the same drainage because these populations may have been reproductively isolated for thousands of generations. Therefore, unionid bivalves distributed among discontinuous habitats (e.g. Atlantic slope drainages) potentially should be considered evolutionarily distinct. The DNA sequence divergences observed in the nuclear and mtDNA regions among the Lasmigona species were congruent, although the level of divergence in the COI region was up to three times greater. The genus Lasmigona, as represented by the four species surveyed in this study, may not be monophyletic.

  4. On Nash Equilibrium and Evolutionarily Stable States That Are Not Characterised by the Folk Theorem.

    Directory of Open Access Journals (Sweden)

    Jiawei Li

    Full Text Available In evolutionary game theory, evolutionarily stable states are characterised by the folk theorem because exact solutions to the replicator equation are difficult to obtain. It is generally assumed that the folk theorem, which is the fundamental theory for non-cooperative games, defines all Nash equilibria in infinitely repeated games. Here, we prove that Nash equilibria that are not characterised by the folk theorem do exist. By adopting specific reactive strategies, a group of players can be better off by coordinating their actions in repeated games. We call it a type-k equilibrium when a group of k players coordinate their actions and they have no incentive to deviate from their strategies simultaneously. The existence and stability of the type-k equilibrium in general games is discussed. This study shows that the sets of Nash equilibria and evolutionarily stable states have greater cardinality than classic game theory has predicted in many repeated games.

  5. On Nash Equilibrium and Evolutionarily Stable States That Are Not Characterised by the Folk Theorem

    Science.gov (United States)

    Li, Jiawei; Kendall, Graham

    2015-01-01

    In evolutionary game theory, evolutionarily stable states are characterised by the folk theorem because exact solutions to the replicator equation are difficult to obtain. It is generally assumed that the folk theorem, which is the fundamental theory for non-cooperative games, defines all Nash equilibria in infinitely repeated games. Here, we prove that Nash equilibria that are not characterised by the folk theorem do exist. By adopting specific reactive strategies, a group of players can be better off by coordinating their actions in repeated games. We call it a type-k equilibrium when a group of k players coordinate their actions and they have no incentive to deviate from their strategies simultaneously. The existence and stability of the type-k equilibrium in general games is discussed. This study shows that the sets of Nash equilibria and evolutionarily stable states have greater cardinality than classic game theory has predicted in many repeated games. PMID:26288088

  6. Advances in the sequencing of the genome of the adenophorean nematode Trichinella spiralis.

    Science.gov (United States)

    Mitreva, M; Jasmer, D P

    2008-07-01

    The adenophorean nematodes are evolutionarily distant from other species in the phylum Nematoda. Interspecific comparisons of predicted proteins have supported such an ancient divergence. Accordingly, Trichinella spiralis represents a basal nematode representative for genome sequencing focused on gaining a deeper insight into the evolutionary biology of nematodes. In addition, molecular characteristics that are conserved across the phylum could be of great value for control strategies with broad application. In this review, we describe and summarize progress that has been made on the sequencing and analysis of the T. spiralis genome. The genome sequence was used in preliminary analyses for the investigation of specific questions relating to the biology of T. spiralis and, more generally, to parasitic nematodes. For instance, we evaluated an unusually large DNase II-like protein family, predicted proteins of prospective interest in the parasite-host muscle cell interaction, anthelmintic targets and prospective intestinal genes, the encoded proteins (potentially) linked to immunological control against other nematodes. The results are discussed in relation to characteristics that are broadly conserved among evolutionary distant nematodes. The results lead to expectations that this genome sequence will contribute to advances in research on T. spiralis and other parasitic nematodes.

  7. Comparative molecular analysis of evolutionarily distant glyceraldehyde-3-phosphate dehydrogenase from Sardina pilchardus and Octopus vulgaris.

    Science.gov (United States)

    Baibai, Tarik; Oukhattar, Laila; Mountassif, Driss; Assobhei, Omar; Serrano, Aurelio; Soukri, Abdelaziz

    2010-12-01

    The NAD(+)-dependent cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12), which is recognized as a key to central carbon metabolism in glycolysis and gluconeogenesis and as an important allozymic polymorphic biomarker, was purified from muscles of two marine species: the skeletal muscle of Sardina pilchardus Walbaum (Teleost, Clupeida) and the incompressible arm muscle of Octopus vulgaris (Mollusca, Cephalopoda). Comparative biochemical studies have revealed that they differ in their subunit molecular masses and in pI values. Partial cDNA sequences corresponding to an internal region of the GapC genes from Sardina and Octopus were obtained by polymerase chain reaction using degenerate primers designed from highly conserved protein motifs. Alignments of the deduced amino acid sequences were used to establish the 3D structures of the active site of two enzymes as well as the phylogenetic relationships of the sardine and octopus enzymes. These two enzymes are the first two GAPDHs characterized so far from teleost fish and cephalopod, respectively. Interestingly, phylogenetic analyses indicated that the sardina GAPDH is in a cluster with the archetypical enzymes from other vertebrates, while the octopus GAPDH comes together with other molluscan sequences in a distant basal assembly closer to bacterial and fungal orthologs, thus suggesting their different evolutionary scenarios.

  8. Evolutionarily stable learning schedules and cumulative culture in discrete generation models.

    Science.gov (United States)

    Aoki, Kenichi; Wakano, Joe Yuichiro; Lehmann, Laurent

    2012-06-01

    Individual learning (e.g., trial-and-error) and social learning (e.g., imitation) are alternative ways of acquiring and expressing the appropriate phenotype in an environment. The optimal choice between using individual learning and/or social learning may be dictated by the life-stage or age of an organism. Of special interest is a learning schedule in which social learning precedes individual learning, because such a schedule is apparently a necessary condition for cumulative culture. Assuming two obligatory learning stages per discrete generation, we obtain the evolutionarily stable learning schedules for the three situations where the environment is constant, fluctuates between generations, or fluctuates within generations. During each learning stage, we assume that an organism may target the optimal phenotype in the current environment by individual learning, and/or the mature phenotype of the previous generation by oblique social learning. In the absence of exogenous costs to learning, the evolutionarily stable learning schedules are predicted to be either pure social learning followed by pure individual learning ("bang-bang" control) or pure individual learning at both stages ("flat" control). Moreover, we find for each situation that the evolutionarily stable learning schedule is also the one that optimizes the learned phenotype at equilibrium. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Locations and contexts of sequences that hybridize to poly(dG-dT) x (dC-dA) in mammalian ribosomal DNAs and two X-linked genes

    Energy Technology Data Exchange (ETDEWEB)

    Braaten, D.C.; Thomas, J.R.; Little, R.D.; Dickson, K.R.; Goldberg, I.; Schlessinger, D.; Ciccodicola, A.; D' Urso, M.

    1988-02-11

    Sequences located several kilobases both 5' and 3' of the stably transcribed portion of several genes hybridize to radio-labeled pure fragments of the alternating sequence poly (dG-dT) (dC-dA) (''poly(GT)''). The genes include the ribosomal DNA of mouse, rat, and human, and also human glucose-6-phosphate dehydrogenase (G6PD) and mouse hypoxanthine-quanine phosphoribosyl transferase (HPRT). HPRT has additional hybridizing sequences in introns. Fragments that include the hybridizing sequences and up to 300 bp of adjoining DNA show perfect runs of poly(GT) (>30bp) in all but the human 5' region of rDNA, which shows a somewhat different alternating purine:pyrimidine sequence, poly(GTAT) (36bp). Within 150 bp of these sequences in various instances are found a number of other sequences reported to affect DNA conformation in model systems. Most marked is an enhancement of sequences matching at least 67% to the consensus binding sequence for topoisomerase II. Two to ten-fold less of such sequences were found in other sequenced portions of the nontranscribed spacer or in the transcribed portion of rDNA. The conservation of the locations of tracts of alternating purine:pyrimidine between evolutionarily diverse species is consistent with a possible functional role for these sequences.

  10. Conservation genetics in transition to conservation genomics

    DEFF Research Database (Denmark)

    Ouborg, N. Joop; Pertoldi, Cino; Loeschcke, Volker

    2010-01-01

    in conservation biology. This has allowed assessment of the impact of genetic drift on genetic variation, of the level of inbreeding within populations, and of the amount of gene flow between or within populations. Recent developments in genomic techniques, including next generation sequencing, whole genome scans...... and gene-expression pattern analysis, have made it possible to step up from a limited number of neutral markers to genome-wide estimates of functional genetic variation. Here, we focus on how the transition of conservation genetics to conservation genomics leads to insights into the dynamics of selectively...

  11. The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

    Science.gov (United States)

    Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

    2017-01-01

    Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

  12. Selaginella moellendoffii telomeres: conserved and unique features in an ancient land plant lineage

    Directory of Open Access Journals (Sweden)

    Eugene V Shakirov

    2012-07-01

    Full Text Available Telomeres, the essential terminal regions of linear eukaryotic chromosomes, consist of G-rich DNA repeats bound by a plethora of associated proteins. While the general pathways of telomere maintenance are evolutionarily conserved, individual telomere complex components show remarkable variation between eukaryotic lineages and even within closely related species. The recent genome sequencing of the lycophyte Selaginella moellendoffii and the availability of an ever-increasing number of flowering plant genomes provides a unique opportunity to evaluate the molecular and functional evolution of telomere components from the early evolving non-seed plants to the more developmentally advanced angiosperms. Here we analyzed telomere sequence in S. moellendorffii and found it to consist of TTTAGGG repeats, typical of most plants. Telomere tracts in S. moellendorffii range from 1-5.5 kb, closely resembling Arabidopsis thaliana. We identified several S. moellendorffii genes encoding sequence homologues of proteins involved in telomere maintenance in other organisms, including CST complex components and the telomere-binding proteins POT1 and TRFL. Notable sequence similarities and differences were uncovered among the telomere-related genes in some of the plant lineages. Taken together, the data indicate that comparative analysis of the telomere complex in early diverging land plants such as S. moellendorffii and green algae will yield important insights into the evolution of telomeres and their protein constituents.

  13. Data from "Crossing to safety: Dispersal, colonization and mate choice in evolutionarily distinct populations of Steller sea lions, Eumetopias jubatus."

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data sets used to support analysis published by O'Corry-Crowe et al (2014) Crossing to safety: Dispersal, colonization and mate choice in evolutionarily distinct...

  14. Synteny between Arabidopsis thaliana and rice at the genome level: a tool to identify conservation in the ongoing rice genome sequencing project

    OpenAIRE

    Salse, Jerome; Piégu, Benoît; Cooke, Richard; Delseny, Michel

    2002-01-01

    BLASTX alignment between 189.5 Mb of rice genomic sequence and translated Arabidopsis thaliana annotated coding sequences (CDS) identified 60 syntenic regions involving 4-22 rice orthologs covering < or =3.2 cM (centiMorgan). Most regions are

  15. Evolutionarily divergent, unstable filamentous actin is essential for gliding motility in apicomplexan parasites.

    Science.gov (United States)

    Skillman, Kristen M; Diraviyam, Karthikeyan; Khan, Asis; Tang, Keliang; Sept, David; Sibley, L David

    2011-10-01

    Apicomplexan parasites rely on a novel form of actin-based motility called gliding, which depends on parasite actin polymerization, to migrate through their hosts and invade cells. However, parasite actins are divergent both in sequence and function and only form short, unstable filaments in contrast to the stability of conventional actin filaments. The molecular basis for parasite actin filament instability and its relationship to gliding motility remain unresolved. We demonstrate that recombinant Toxoplasma (TgACTI) and Plasmodium (PfACTI and PfACTII) actins polymerized into very short filaments in vitro but were induced to form long, stable filaments by addition of equimolar levels of phalloidin. Parasite actins contain a conserved phalloidin-binding site as determined by molecular modeling and computational docking, yet vary in several residues that are predicted to impact filament stability. In particular, two residues were identified that form intermolecular contacts between different protomers in conventional actin filaments and these residues showed non-conservative differences in apicomplexan parasites. Substitution of divergent residues found in TgACTI with those from mammalian actin resulted in formation of longer, more stable filaments in vitro. Expression of these stabilized actins in T. gondii increased sensitivity to the actin-stabilizing compound jasplakinolide and disrupted normal gliding motility in the absence of treatment. These results identify the molecular basis for short, dynamic filaments in apicomplexan parasites and demonstrate that inherent instability of parasite actin filaments is a critical adaptation for gliding motility.

  16. Evolutionarily divergent, unstable filamentous actin is essential for gliding motility in apicomplexan parasites.

    Directory of Open Access Journals (Sweden)

    Kristen M Skillman

    2011-10-01

    Full Text Available Apicomplexan parasites rely on a novel form of actin-based motility called gliding, which depends on parasite actin polymerization, to migrate through their hosts and invade cells. However, parasite actins are divergent both in sequence and function and only form short, unstable filaments in contrast to the stability of conventional actin filaments. The molecular basis for parasite actin filament instability and its relationship to gliding motility remain unresolved. We demonstrate that recombinant Toxoplasma (TgACTI and Plasmodium (PfACTI and PfACTII actins polymerized into very short filaments in vitro but were induced to form long, stable filaments by addition of equimolar levels of phalloidin. Parasite actins contain a conserved phalloidin-binding site as determined by molecular modeling and computational docking, yet vary in several residues that are predicted to impact filament stability. In particular, two residues were identified that form intermolecular contacts between different protomers in conventional actin filaments and these residues showed non-conservative differences in apicomplexan parasites. Substitution of divergent residues found in TgACTI with those from mammalian actin resulted in formation of longer, more stable filaments in vitro. Expression of these stabilized actins in T. gondii increased sensitivity to the actin-stabilizing compound jasplakinolide and disrupted normal gliding motility in the absence of treatment. These results identify the molecular basis for short, dynamic filaments in apicomplexan parasites and demonstrate that inherent instability of parasite actin filaments is a critical adaptation for gliding motility.

  17. Sequence conservation in the C-terminal region of spider silk proteins (Spidroin) from Nephila clavipes (Tetragnathidae) and Araneus bicentenarius (Araneidae).

    Science.gov (United States)

    Beckwitt, R; Arcidiacono, S

    1994-03-04

    The polymerase chain reaction (PCR) has been used to amplify the portion of the Spidroin 1 gene that codes for the C-terminal part of the silk protein of the spider Nephila clavipes. Along with some substitution mutations of minor consequence, the PCR-derived sequence reveals an additional base missing from the previously published Nephila Spidroin 1 sequence. Comparison of the PCR-derived sequence with the equivalent region of Spidroin 2 indicates that the insertion of this single base results in greatly increased similarity in the resulting amino acid sequences of Spidroin 1 and Spidroin 2 (75% over 97 amino acids). The same PCR primers also amplified a fragment of the same length from Araneus bicentenarius. This sequence is also very similar to Spidroin 1 of Nephila (71% over 238 bases excluding the PCR primers, which translates into 76% over 79 amino acids).

  18. Genes with stable DNA methylation levels show higher evolutionary conservation than genes with fluctuant DNA methylation levels.

    Science.gov (United States)

    Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai

    2015-11-24

    Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.

  19. Mitogen-activated protein kinase signaling in plant-interacting fungi: distinct messages from conserved messengers.

    Science.gov (United States)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Duplessis, Sébastien; Ellis, Brian E

    2012-04-01

    Mitogen-activated protein kinases (MAPKs) are evolutionarily conserved proteins that function as key signal transduction components in fungi, plants, and mammals. During interaction between phytopathogenic fungi and plants, fungal MAPKs help to promote mechanical and/or enzymatic penetration of host tissues, while plant MAPKs are required for activation of plant immunity. However, new insights suggest that MAPK cascades in both organisms do not operate independently but that they mutually contribute to a highly interconnected molecular dialogue between the plant and the fungus. As a result, some pathogenesis-related processes controlled by fungal MAPKs lead to the activation of plant signaling, including the recruitment of plant MAPK cascades. Conversely, plant MAPKs promote defense mechanisms that threaten the survival of fungal cells, leading to a stress response mediated in part by fungal MAPK cascades. In this review, we make use of the genomic data available following completion of whole-genome sequencing projects to analyze the structure of MAPK protein families in 24 fungal taxa, including both plant pathogens and mycorrhizal symbionts. Based on conserved patterns of sequence diversification, we also propose the adoption of a unified fungal MAPK nomenclature derived from that established for the model species Saccharomyces cerevisiae. Finally, we summarize current knowledge of the functions of MAPK cascades in phytopathogenic fungi and highlight the central role played by MAPK signaling during the molecular dialogue between plants and invading fungal pathogens.

  20. Comparative analysis of evolutionarily conserved motifs of epidermal growth factor receptor 2 (HER2) predicts novel potential therapeutic epitopes

    DEFF Research Database (Denmark)

    Deng, Xiaohong; Zheng, Xuxu; Yang, Huanming

    2014-01-01

    for potential therapeutic application. Thus, this novel computational process for predicting or searching for potential epitopes or key target sites may contribute to epitope-based vaccine and function-selected drug design, especially when x-ray crystal structure protein data is not available....

  1. Impaired mitotic progression and preimplantation lethality in mice lacking OMCG1, a new evolutionarily conserved nuclear protein

    DEFF Research Database (Denmark)

    Artus, Jérôme; Vandormael-Pournin, Sandrine; Frödin, Morten

    2005-01-01

    -type-specific function, indicating that many aspects of cell cycle regulation during mammalian embryo development remain to be elucidated. Here, we report on the characterization of a new gene, Omcg1, which codes for a nuclear zinc finger protein. Embryos lacking Omcg1 die by the end of preimplantation development....... In vitro cultured Omcg1-null blastocysts exhibit a dramatic reduction in the total cell number, a high mitotic index, and the presence of abnormal mitotic figures. Importantly, we found that Omcg1 disruption results in the lengthening of M phase rather than in a mitotic block. We show that the mitotic...... delay in Omcg1-/- embryos is associated with neither a dysfunction of the spindle checkpoint nor abnormal global histone modifications. Taken together, these results suggest that Omcg1 is an important regulator of the cell cycle in the preimplantation embryo....

  2. An Evolutionarily Conserved Network Mediates Development of the zona limitans intrathalamica, a Sonic Hedgehog-Secreting Caudal Forebrain Signaling Center

    Directory of Open Access Journals (Sweden)

    Elena Sena

    2016-10-01

    Full Text Available Recent studies revealed new insights into the development of a unique caudal forebrain-signaling center: the zona limitans intrathalamica (zli. The zli is the last brain signaling center to form and the first forebrain compartment to be established. It is the only part of the dorsal neural tube expressing the morphogen Sonic Hedgehog (Shh whose activity participates in the survival, growth and patterning of neuronal progenitor subpopulations within the thalamic complex. Here, we review the gene regulatory network of transcription factors and cis-regulatory elements that underlies formation of a shh-expressing delimitated domain in the anterior brain. We discuss evidence that this network predates the origin of chordates. We highlight the contribution of Shh, Wnt and Notch signaling to zli development and discuss implications for the fact that the morphogen Shh relies on primary cilia for signal transduction. The network that underlies zli development also contributes to thalamus induction, and to its patterning once the zli has been set up. We present an overview of the brain malformations possibly associated with developmental defects in this gene regulatory network (GRN.

  3. The Populus ARBORKNOX1 homeodomain transcription factor regulates woody growth through binding to evolutionarily conserved target genes of diverse function

    Science.gov (United States)

    Lijun Liu; Matthew S. Zinkgraf; H. Earl Petzold; Eric P. Beers; Vladimir Filkov; Andrew Groover

    2014-01-01

    The class I KNOX homeodomain transcription factor ARBORKNOX1 (ARK1) is a key regulator of vascular cambium maintenance and cell differentiation in Populus. Currently, basic information is lacking concerning the distribution, functional characteristics, and evolution of ARK1 binding in the Populus genome.

  4. Structure-Based Sequence Alignment of the Transmembrane Domains of All Human GPCRs: Phylogenetic, Structural and Functional Implications

    Science.gov (United States)

    Cvicek, Vaclav; Goddard, William A.; Abrol, Ravinder

    2016-01-01

    The understanding of G-protein coupled receptors (GPCRs) is undergoing a revolution due to increased information about their signaling and the experimental determination of structures for more than 25 receptors. The availability of at least one receptor structure for each of the GPCR classes, well separated in sequence space, enables an integrated superfamily-wide analysis to identify signatures involving the role of conserved residues, conserved contacts, and downstream signaling in the context of receptor structures. In this study, we align the transmembrane (TM) domains of all experimental GPCR structures to maximize the conserved inter-helical contacts. The resulting superfamily-wide GpcR Sequence-Structure (GRoSS) alignment of the TM domains for all human GPCR sequences is sufficient to generate a phylogenetic tree that correctly distinguishes all different GPCR classes, suggesting that the class-level differences in the GPCR superfamily are encoded at least partly in the TM domains. The inter-helical contacts conserved across all GPCR classes describe the evolutionarily conserved GPCR structural fold. The corresponding structural alignment of the inactive and active conformations, available for a few GPCRs, identifies activation hot-spot residues in the TM domains that get rewired upon activation. Many GPCR mutations, known to alter receptor signaling and cause disease, are located at these conserved contact and activation hot-spot residue positions. The GRoSS alignment places the chemosensory receptor subfamilies for bitter taste (TAS2R) and pheromones (Vomeronasal, VN1R) in the rhodopsin family, known to contain the chemosensory olfactory receptor subfamily. The GRoSS alignment also enables the quantification of the structural variability in the TM regions of experimental structures, useful for homology modeling and structure prediction of receptors. Furthermore, this alignment identifies structurally and functionally important residues in all human GPCRs

  5. A novel nucleolar G-protein conserved in eukaryotes.

    Science.gov (United States)

    Park, J H; Jensen, B C; Kifer, C T; Parsons, M

    2001-01-01

    We describe here a novel, evolutionarily conserved set of predicted G-proteins. The founding member of this family, TbNOG1, was identified in a two-hybrid screen as a protein that interacts with NOPP44/46, a nucleolar phosphoprotein of Trypanosoma brucei. The biological relevance of the interaction was verified by co-localization and co-immunoprecipitation. TbNOG1 localized to the trypanosome nucleolus and interacted with domains of NOPP44/46 that are found in several other nucleolar proteins. Genes encoding proteins highly related to TbNOG1 are present in yeast and metazoa, and related G domains are found in bacteria. We show that NOG1 proteins in humans and Saccharomyces cerevisae are also nucleolar. The S. cerevisae NOG1 gene is essential for cell viability, and mutations in the predicted G motifs abrogate function. Together these data suggest that NOG1 may play an important role in nucleolar functions. The GTP-binding region of TbNOG1 is similar to those of Obg and DRG proteins, which, together with NOG, form a newly recognized family of G-proteins, herein named ODN. The ODN family differs significantly from other G-protein families, and shows several diagnostic sequence characteristics. All organisms appear to possess an ODN gene, pointing to the biological significance of this family of G-proteins.

  6. Model-Free RNA Sequence and Structure Alignment Informed by SHAPE Probing Reveals a Conserved Alternate Secondary Structure for 16S rRNA.

    Science.gov (United States)

    Lavender, Christopher A; Lorenz, Ronny; Zhang, Ge; Tamayo, Rita; Hofacker, Ivo L; Weeks, Kevin M

    2015-05-01

    Discovery and characterization of functional RNA structures remains challenging due to deficiencies in de novo secondary structure modeling. Here we describe a dynamic programming approach for model-free sequence comparison that incorporates high-throughput chemical probing data. Based on SHAPE probing data alone, ribosomal RNAs (rRNAs) from three diverse organisms--the eubacteria E. coli and C. difficile and the archeon H. volcanii--could be aligned with accuracies comparable to alignments based on actual sequence identity. When both base sequence identity and chemical probing reactivities were considered together, accuracies improved further. Derived sequence alignments and chemical probing data from protein-free RNAs were then used as pseudo-free energy constraints to model consensus secondary structures for the 16S and 23S rRNAs. There are critical differences between these experimentally-informed models and currently accepted models, including in the functionally important neck and decoding regions of the 16S rRNA. We infer that the 16S rRNA has evolved to undergo large-scale changes in base pairing as part of ribosome function. As high-quality RNA probing data become widely available, structurally-informed sequence alignment will become broadly useful for de novo motif and function discovery.

  7. Model-Free RNA Sequence and Structure Alignment Informed by SHAPE Probing Reveals a Conserved Alternate Secondary Structure for 16S rRNA.

    Directory of Open Access Journals (Sweden)

    Christopher A Lavender

    2015-05-01

    Full Text Available Discovery and characterization of functional RNA structures remains challenging due to deficiencies in de novo secondary structure modeling. Here we describe a dynamic programming approach for model-free sequence comparison that incorporates high-throughput chemical probing data. Based on SHAPE probing data alone, ribosomal RNAs (rRNAs from three diverse organisms--the eubacteria E. coli and C. difficile and the archeon H. volcanii--could be aligned with accuracies comparable to alignments based on actual sequence identity. When both base sequence identity and chemical probing reactivities were considered together, accuracies improved further. Derived sequence alignments and chemical probing data from protein-free RNAs were then used as pseudo-free energy constraints to model consensus secondary structures for the 16S and 23S rRNAs. There are critical differences between these experimentally-informed models and currently accepted models, including in the functionally important neck and decoding regions of the 16S rRNA. We infer that the 16S rRNA has evolved to undergo large-scale changes in base pairing as part of ribosome function. As high-quality RNA probing data become widely available, structurally-informed sequence alignment will become broadly useful for de novo motif and function discovery.

  8. Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission

    Directory of Open Access Journals (Sweden)

    Ahmad Nafees

    2005-05-01

    Full Text Available Abstract Background The reverse transcriptase (RT enzyme of human immunodeficiency virus type 1 (HIV-1 plays a crucial role in the life cycle of the virus by converting the single stranded RNA genome into double stranded DNA that integrates into the host chromosome. In addition, RT is also responsible for the generation of mutations throughout the viral genome, including in its own sequences and is thus responsible for the generation of quasi-species in HIV-1-infected individuals. We therefore characterized the molecular properties of RT, including the conservation of functional motifs, degree of genetic diversity, and evolutionary dynamics from five mother-infant pairs following vertical transmission. Results The RT open reading frame was maintained with a frequency of 87.2% in five mother-infant pairs' sequences following vertical transmission. There was a low degree of viral heterogeneity and estimates of genetic diversity in mother-infant pairs' sequences. Both mothers and infants RT sequences were under positive selection pressure, as determined by the ratios of non-synonymous to synonymous substitutions. Phylogenetic analysis of 132 mother-infant RT sequences revealed distinct clusters for each mother-infant pair, suggesting that the epidemiologically linked mother-infant pairs were evolutionarily closer to each other as compared with epidemiologically unlinked mother-infant pairs. The functional domains of RT which are responsible for reverse transcription, DNA polymerization and RNase H activity were mostly conserved in the RT sequences analyzed in this study. Specifically, the active sites and domains required for primer binding, template binding, primer and template positioning and nucleotide recruitment were conserved in all mother-infant pairs' sequences. Conclusion The maintenance of an intact RT open reading frame, conservation of functional domains for RT activity, preservation of several amino acid motifs in epidemiologically

  9. The telocentric tandem repeat at the p-arm is not conserved in Mus musculus subspecies.

    Science.gov (United States)

    Sasaki, Nobuya; Yamauchi, Hideto; Tomohiro, Nishino; Agui, Takashi

    2013-01-15

    Mouse chromosomes, with the exception of the Y chromosome, are telocentric. The telomere at the p-arm is separated from the centromere by the tL1 sequence and TLC tandem repeats. A previous report showed that the TLC array was also conserved in other strains of the subgenus Mus. These results suggest that the TLC arrays promote the stable evolutionary maintenance of a telocentric karyotype in the subgenus Mus. In this study, we investigated the degree of conservation of TLC arrays among a variety of wild-derived inbred strains, all of which are descendants of wild mice captured in several areas of the world. Genomic PCR analysis indicates that the sequential order of telomere-tL1 is highly conserved in all strains, whereas tL1-TLC is not. Next, Southern blot analysis of DNAs isolated from a panel of mouse subspecies showed both Mus musculus domesticus and Mus musculus castaneus subspecies possess TLC arrays. Unexpectedly, this repeat appears to be lost in almost all Mus musculus musculus and Mus musculus molossinus subspecies, which show a clear geographic divide. These results indicate that either other unknown sequences were replaced by the TLC repeat or almost all M. m. musculus and M. m. molossinus subspecies do not have any sequence between the telomere and minor satellites. Our observation suggests that the TLC array might be evolutionarily unstable and not essential for murine chromosomal conformation. This is the first example of the subspecies-specific large genome alterations in mice. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Characterization of chicken octamer-binding proteins demonstrates that POU domain-containing homeobox transcription factors have been highly conserved during vertebrate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Petryniak, B.; Postema, C.E.; McCormack, W.T.; Thompson, C.B. (Univ. of Michigan Medical Center, Ann Arbor (USA)); Staudt, L.M. (National Cancer Institute, Bethesda, MD (USA))

    1990-02-01

    The DNA sequence motif ATTTGCAT (octamer) or its inverse complement has been identified as an evolutionarily conserved element in the promoter region of immunoglobulin genes. Two major DNA-binding proteins that bind in a sequence-specific manner to the octamer DNA sequence have been identified in mammalian species--a ubiquitously expressed protein (Oct-1) and a lymphoid-specific protein (Oct-2). During characterization of the promoter region of the chicken immunoglobulin light chain gene, the authors identified two homologous octamer-binding proteins in chicken B cells. when the cloning of the human gene for Oct-2 revealed it to be a member of a distinct family of homeobox genes, they sought to determine if the human Oct-2 cDNA could be used to identify homologous chicken homeobox genes. Using a human Oct-2 homeobox-specific DNA probe, they were able to identify 6-10 homeobox-containing genes in the chicken genome, demonstrating that the Oct-2-related subfamily of homeobox genes exists in avian species. DNA sequence analysis revealed it to be the chicken homologue of the human Oct-1 gene. Together, the data show that the POU-containing subfamily of homeobox genes have been highly conserved during vertebrate evolution, apparently as a result of selection for their DNA-binding and transcriptional regulatory properties.

  11. Evolutionary stability of mutualism: interspecific population regulation as an evolutionarily stable strategy

    Science.gov (United States)

    Holland, J. Nathaniel; DeAngelis, Donald L.; Schultz, Stewart T.

    2004-01-01

    Interspecific mutualisms are often vulnerable to instability because low benefit : cost ratios can rapidly lead to extinction or to the conversion of mutualism to parasite–host or predator–prey interactions. We hypothesize that the evolutionary stability of mutualism can depend on how benefits and costs to one mutualist vary with the population density of its partner, and that stability can be maintained if a mutualist can influence demographic rates and regulate the population density of its partner. We test this hypothesis in a model of mutualism with key features of senita cactus (Pachycereus schottii) – senita moth (Upiga virescens) interactions, in which benefits of pollination and costs of larval seed consumption to plant fitness depend on pollinator density. We show that plants can maximize their fitness by allocating resources to the production of excess flowers at the expense of fruit. Fruit abortion resulting from excess flower production reduces pre–adult survival of the pollinating seed–consumer, and maintains its density beneath a threshold that would destabilize the mutualism. Such a strategy of excess flower production and fruit abortion is convergent and evolutionarily stable against invasion by cheater plants that produce few flowers and abort few to no fruit. This novel mechanism of achieving evolutionarily stable mutualism, namely interspecific population regulation, is qualitatively different from other mechanisms invoking partner choice or selective rewards, and may be a general process that helps to preserve mutualistic interactions in nature.

  12. The lateral line confers evolutionarily derived sleep loss in the Mexican cavefish.

    Science.gov (United States)

    Jaggard, James; Robinson, Beatriz G; Stahl, Bethany A; Oh, Ian; Masek, Pavel; Yoshizawa, Masato; Keene, Alex C

    2017-01-15

    Sleep is an essential behavior exhibited by nearly all animals, and disruption of this process is associated with an array of physiological and behavioral deficits. Sleep is defined by changes in sensory gating that reduce sensory input to the brain, but little is known about the neural basis for interactions between sleep and sensory processing. Blind Mexican cavefish comprise an extant surface dwelling form and 29 cave morphs that have independently evolved increased numbers of mechanoreceptive lateral line neuromasts and convergent evolution of sleep loss. Ablation of the lateral line enhanced sleep in the Pachón cavefish population, suggesting that heightened sensory input underlies evolutionarily derived sleep loss. Targeted lateral line ablation and behavioral analysis localized the wake-promoting neuromasts in Pachón cavefish to superficial neuromasts of the trunk and cranial regions. Strikingly, lateral line ablation did not affect sleep in four other cavefish populations, suggesting that distinct neural mechanisms regulate the evolution of sleep loss in independently derived cavefish populations. Cavefish are subject to seasonal changes in food availability, raising the possibility that sensory modulation of sleep is influenced by metabolic state. We found that starvation promotes sleep in Pachón cavefish, and is not enhanced by lateral line ablation, suggesting that functional interactions occur between sensory and metabolic regulation of sleep. Taken together, these findings support a model where sensory processing contributes to evolutionarily derived changes in sleep that are modulated in accordance with food availability. © 2017. Published by The Company of Biologists Ltd.

  13. The first myriapod genome sequence reveals conservative arthropod gene content and genome organisation in the centipede Strigamia maritima

    DEFF Research Database (Denmark)

    Chipman, Ariel D.; Ferrier, David E.K.; Brena, Carlo

    2014-01-01

    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We pres...

  14. Sequence imputation of HPV16 genomes for genetic association studies.

    Directory of Open Access Journals (Sweden)

    Benjamin Smith

    Full Text Available Human Papillomavirus type 16 (HPV16 causes over half of all cervical cancer and some HPV16 variants are more oncogenic than others. The genetic basis for the extraordinary oncogenic properties of HPV16 compared to other HPVs is unknown. In addition, we neither know which nucleotides vary across and within HPV types and lineages, nor which of the single nucleotide polymorphisms (SNPs determine oncogenicity.A reference set of 62 HPV16 complete genome sequences was established and used to examine patterns of evolutionary relatedness amongst variants using a pairwise identity heatmap and HPV16 phylogeny. A BLAST-based algorithm was developed to impute complete genome data from partial sequence information using the reference database. To interrogate the oncogenic risk of determined and imputed HPV16 SNPs, odds-ratios for each SNP were calculated in a case-control viral genome-wide association study (VWAS using biopsy confirmed high-grade cervix neoplasia and self-limited HPV16 infections from Guanacaste, Costa Rica.HPV16 variants display evolutionarily stable lineages that contain conserved diagnostic SNPs. The imputation algorithm indicated that an average of 97.5±1.03% of SNPs could be accurately imputed. The VWAS revealed specific HPV16 viral SNPs associated with variant lineages and elevated odds ratios; however, individual causal SNPs could not be distinguished with certainty due to the nature of HPV evolution.Conserved and lineage-specific SNPs can be imputed with a high degree of accuracy from limited viral polymorphic data due to the lack of recombination and the stochastic mechanism of variation accumulation in the HPV genome. However, to determine the role of novel variants or non-lineage-specific SNPs by VWAS will require direct sequence analysis. The investigation of patterns of genetic variation and the identification of diagnostic SNPs for lineages of HPV16 variants provides a valuable resource for future studies of HPV16

  15. Syntrophs dominate sequences associated with the mercury methylation-related gene hgcA in the water conservation areas of the Florida Everglades.

    Science.gov (United States)

    Bae, Hee-Sung; Dierberg, Forrest E; Ogram, Andrew

    2014-10-01

    The mechanisms and rates of mercury methylation in the Florida Everglades are of great concern because of potential adverse impacts on human and wildlife health through mercury accumulation in aquatic food webs. We developed a new PCR primer set targeting hgcA, a gene encoding a corrinoid protein essential for Hg methylation across broad phylogenetic boundaries, and used this primer set to study the distribution of hgcA sequences in soils collected from three sites along a gradient in sulfate and nutrient concentrations in the northern Everglades. The sequences obtained were distributed in diverse phyla, including Proteobacteria, Chloroflexi, Firmicutes, and Methanomicrobia; however, hgcA clone libraries from all sites were dominated by sequences clustering within the order Syntrophobacterales of the Deltaproteobacteria (49 to 65% of total sequences). dsrB mRNA sequences, representing active sulfate-reducing prokaryotes at the time of sampling, obtained from these sites were also dominated by Syntrophobacterales (75 to 89%). Laboratory incubations with soils taken from the site low in sulfate concentrations also suggested that Hg methylation activities were primarily mediated by members of the order Syntrophobacterales, with some contribution by methanogens, Chloroflexi, iron-reducing Geobacter, and non-sulfate-reducing Firmicutes inhabiting the sites. This suggests that prokaryotes distributed within clades defined by syntrophs are the predominant group controlling methylation of Hg in low-sulfate areas of the Everglades. Any strategy for managing mercury methylation in the Everglades should consider that net mercury methylation is not limited to the action of sulfate reduction. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    , supported by histone marks and ChIP-seq data, that specifically have features of an enhancer and a promoter, respectively. We also identified a putative long non-coding RNA from the characteristically long first intron of the Cd247 gene. The long non-coding RNA annotation is supported by manual annotations...... from the GENCODE project in human and our expression quantification analysis performed in NOD and B6 mice using qRT-PCR. Furthermore, 17 of the 23 SNPs already known to be implicated with T1D were observed within the long non-coding RNA region in mouse. The spatially conserved regulatory elements...

  17. Fourier Analysis of Conservation Patterns in Protein Secondary Structure.

    Science.gov (United States)

    Palaniappan, Ashok; Jakobsson, Eric

    2017-01-01

    Residue conservation is a common observation in alignments of protein families, underscoring positions important in protein structure and function. Though many methods measure the level of conservation of particular residue positions, currently we do not have a way to study spatial oscillations occurring in protein conservation patterns. It is known that hydrophobicity shows spatial oscillations in proteins, which is characterized by computing the hydrophobic moment of the protein domains. Here, we advance the study of moments of conservation of protein families to know whether there might exist spatial asymmetry in the conservation patterns of regular secondary structures. Analogous to the hydrophobic moment, the conservation moment is defined as the modulus of the Fourier transform of the conservation function of an alignment of related protein, where the conservation function is the vector of conservation values at each column of the alignment. The profile of the conservation moment is useful in ascertaining any periodicity of conservation, which might correlate with the period of the secondary structure. To demonstrate the concept, conservation in the family of potassium ion channel proteins was analyzed using moments. It was shown that the pore helix of the potassium channel showed oscillations in the moment of conservation matching the period of the α-helix. This implied that one side of the pore helix was evolutionarily conserved in contrast to its opposite side. In addition, the method of conservation moments correctly identified the disposition of the voltage sensor of voltage-gated potassium channels to form a 310 helix in the membrane.

  18. The Autosomal Chorion Locus of the Medfly Ceratitis Capitata. I. Conserved Synteny, Amplification and Tissue Specificity but Sequence Divergence and Altered Temporal Regulation

    Science.gov (United States)

    Vlachou, D.; Konsolaki, M.; Tolias, P. P.; Kafatos, F. C.; Komitopoulou, K.

    1997-01-01

    We report the isolation, full sequence characterization, amplification and expression properties of medfly chorion genes corresponding to the autosomal chorion locus of Drosophila. These genes are found adjacent to the paramyosin gene and are organized in the same order and tandem orientation as their Drosophila homologues, although they are spaced further apart. They show substantial sequence divergence from their Drosophila homologues, including novel peptide repeats and a new spacing of the tyrosines, which are known to be cross-linked in Dipteran chorion. The genes are amplified and expressed during oogenesis, as in Drosophila. Three of them are expressed in the same relative temporal order as in Drosophila but the fourth gene, the homologue of s15, shows a clear shift to an earlier expression period. This is the first known instance of changed temporal regulation in dipteran chorion genes. PMID:9409839

  19. A set of primers conserved in genus Parnassius (Lepidoptera, Papilionidae) for amplification and sequencing of 1016 bp fragment of cytochrome oxidase subunit I from museum specimens.

    Science.gov (United States)

    Konopinski, Maciej K

    2008-05-01

    Four short, overlapping amplicons covering a 1016 bp fragment of mitochondrial cytochrome oxidase subunit I were developed. All four fragments were successfully amplified and sequenced in eight species of butterflies belonging to the genus Parnassius including over 100-year-old DNA from pinned museum specimens. The fragment contains sufficient variation for both inter- and intraspecific analyses. A total of 105 sites were polymorphic within 52 haplotypes found in 186 samples from Parnassius mnemosyne. © 2007 The Authors.

  20. Mitogen-Activated Protein Kinase Signaling in Plant-Interacting Fungi: Distinct Messages from Conserved Messengers[W

    Science.gov (United States)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Duplessis, Sébastien; Ellis, Brian E.

    2012-01-01

    Mitogen-activated protein kinases (MAPKs) are evolutionarily conserved proteins that function as key signal transduction components in fungi, plants, and mammals. During interaction between phytopathogenic fungi and plants, fungal MAPKs help to promote mechanical and/or enzymatic penetration of host tissues, while plant MAPKs are required for activation of plant immunity. However, new insights suggest that MAPK cascades in both organisms do not operate independently but that they mutually contribute to a highly interconnected molecular dialogue between the plant and the fungus. As a result, some pathogenesis-related processes controlled by fungal MAPKs lead to the activation of plant signaling, including the recruitment of plant MAPK cascades. Conversely, plant MAPKs promote defense mechanisms that threaten the survival of fungal cells, leading to a stress response mediated in part by fungal MAPK cascades. In this review, we make use of the genomic data available following completion of whole-genome sequencing projects to analyze the structure of MAPK protein families in 24 fungal taxa, including both plant pathogens and mycorrhizal symbionts. Based on conserved patterns of sequence diversification, we also propose the adoption of a unified fungal MAPK nomenclature derived from that established for the model species Saccharomyces cerevisiae. Finally, we summarize current knowledge of the functions of MAPK cascades in phytopathogenic fungi and highlight the central role played by MAPK signaling during the molecular dialogue between plants and invading fungal pathogens. PMID:22517321

  1. A Common Substrate Recognition Mode Conserved between Katanin p60 and VPS4 Governs Microtubule Severing and Membrane Skeleton Reorganization*

    Science.gov (United States)

    Iwaya, Naoko; Kuwahara, Yohta; Fujiwara, Yoshie; Goda, Natsuko; Tenno, Takeshi; Akiyama, Kohei; Mase, Shogo; Tochio, Hidehito; Ikegami, Takahisa; Shirakawa, Masahiro; Hiroaki, Hidekazu

    2010-01-01

    Katanin p60 (kp60), a microtubule-severing enzyme, plays a key role in cytoskeletal reorganization during various cellular events in an ATP-dependent manner. We show that a single domain isolated from the N terminus of mouse katanin p60 (kp60-NTD) binds to tubulin. The solution structure of kp60-NTD was determined by NMR. Although their sequence similarities were as low as 20%, the structure of kp60-NTD revealed a striking similarity to those of the microtubule interacting and trafficking (MIT) domains, which adopt anti-parallel three-stranded helix bundle. In particular, the arrangement of helices 2 and 3 is well conserved between kp60-NTD and the MIT domain from Vps4, which is a homologous protein that promotes disassembly of the endosomal sorting complexes required for transport III membrane skeleton complex. Mutation studies revealed that the positively charged surface formed by helices 2 and 3 binds tubulin. This binding mode resembles the interaction between the MIT domain of Vps4 and Vps2/CHMP1a, a component of endosomal sorting complexes required for transport III. Our results show that both the molecular architecture and the binding modes are conserved between two AAA-ATPases, kp60 and Vps4. A common mechanism is evolutionarily conserved between two distinct cellular events, one that drives microtubule severing and the other involving membrane skeletal reorganization. PMID:20339000

  2. SEL-10/Fbw7-dependent negative feedback regulation of LIN-45/Braf signaling in C. elegans via a conserved phosphodegron.

    Science.gov (United States)

    de la Cova, Claire; Greenwald, Iva

    2012-11-15

    The conserved E3 ubiquitin ligase component named SEL-10 in Caenorhabditis elegans and Fbw7 in mammals targets substrates for ubiquitin-mediated degradation through a high-affinity binding site called a Cdc4 phosphodegron (CPD). As many known substrates of Fbw7 are oncoproteins, the identification of new substrates may offer insight into cancer biology as well as aspects of proteome regulation. Here, we evaluated whether the presence of an evolutionarily conserved CPD would be a feasible complement to proteomics-based approaches for identifying new potential substrates. For functional assessments, we focused on LIN-45, a component of the signal transduction pathway underlying vulval induction and the ortholog of human Braf, an effector of Ras in numerous cancers. Our analysis demonstrates that LIN-45 behaves as a bona fide substrate of SEL-10, with mutation of the CPD or loss of sel-10 resulting in increased activity and protein stability in vivo. Furthermore, during vulval induction, the downstream kinase MPK-1/ERK is also required for LIN-45 protein degradation in a negative feedback loop, resulting in degradation of LIN-45 where ERK is highly active. As the CPD consensus sequence is conserved in human Braf, we propose that Fbw7 may also regulate Braf stability in some cell contexts. We discuss the implications of our findings for vulval development in C. elegans, the potential applicability to human Braf, and the value of a CPD-based predictive approach for human Fbw7 substrates.

  3. In silico genome wide mining of conserved and novel miRNAs in the brain and pineal gland of Danio rerio using small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Suyash Agarwal

    2016-03-01

    Full Text Available MicroRNAs (miRNAs are small, non-coding RNA molecules that bind to the mRNA of the target genes and regulate the expression of the gene at the post-transcriptional level. Zebrafish is an economically important freshwater fish species globally considered as a good predictive model for studying human diseases and development. The present study focused on uncovering known as well as novel miRNAs, target prediction of the novel miRNAs and the differential expression of the known miRNA using the small RNA sequencing data of the brain and pineal gland (dark and light treatments obtained from NCBI SRA. A total of 165, 151 and 145 known zebrafish miRNAs were found in the brain, pineal gland (dark treatment and pineal gland (light treatment, respectively. Chromosomes 4 and 5 of zebrafish reference assembly GRCz10 were found to contain maximum number of miR genes. The miR-181a and miR-182 were found to be highly expressed in terms of number of reads in the brain and pineal gland, respectively. Other ncRNAs, such as tRNA, rRNA and snoRNA, were curated against Rfam. Using GRCz10 as reference, the subsequent bioinformatic analyses identified 25, 19 and 9 novel miRNAs from the brain, pineal gland (dark treatment and pineal gland (light treatment, respectively. Targets of the novel miRNAs were identified, based on sequence complementarity between miRNAs and mRNA, by searching for antisense hits in the 3′-UTR of reference RNA sequences of the zebrafish. The discovery of novel miRNAs and their targets in the zebrafish genome can be a valuable scientific resource for further functional studies not only in zebrafish but also in other economically important fishes.

  4. In silico genome wide mining of conserved and novel miRNAs in the brain and pineal gland of Danio rerio using small RNA sequencing data.

    Science.gov (United States)

    Agarwal, Suyash; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kushwaha, Basdeo; Kumar, Ravindra; Pandey, Manmohan; Srivastava, Shreya

    2016-03-01

    MicroRNAs (miRNAs) are small, non-coding RNA molecules that bind to the mRNA of the target genes and regulate the expression of the gene at the post-transcriptional level. Zebrafish is an economically important freshwater fish species globally considered as a good predictive model for studying human diseases and development. The present study focused on uncovering known as well as novel miRNAs, target prediction of the novel miRNAs and the differential expression of the known miRNA using the small RNA sequencing data of the brain and pineal gland (dark and light treatments) obtained from NCBI SRA. A total of 165, 151 and 145 known zebrafish miRNAs were found in the brain, pineal gland (dark treatment) and pineal gland (light treatment), respectively. Chromosomes 4 and 5 of zebrafish reference assembly GRCz10 were found to contain maximum number of miR genes. The miR-181a and miR-182 were found to be highly expressed in terms of number of reads in the brain and pineal gland, respectively. Other ncRNAs, such as tRNA, rRNA and snoRNA, were curated against Rfam. Using GRCz10 as reference, the subsequent bioinformatic analyses identified 25, 19 and 9 novel miRNAs from the brain, pineal gland (dark treatment) and pineal gland (light treatment), respectively. Targets of the novel miRNAs were identified, based on sequence complementarity between miRNAs and mRNA, by searching for antisense hits in the 3'-UTR of reference RNA sequences of the zebrafish. The discovery of novel miRNAs and their targets in the zebrafish genome can be a valuable scientific resource for further functional studies not only in zebrafish but also in other economically important fishes.

  5. NFAT5 regulates HIV-1 in primary monocytes via a highly conserved long terminal repeat site.

    Directory of Open Access Journals (Sweden)

    Shahin Ranjbar

    2006-12-01

    Full Text Available To replicate, HIV-1 capitalizes on endogenous cellular activation pathways resulting in recruitment of key host transcription factors to its viral enhancer. RNA interference has been a powerful tool for blocking key checkpoints in HIV-1 entry into cells. Here we apply RNA interference to HIV-1 transcription in primary macrophages, a major reservoir of the virus, and specifically target the transcription factor NFAT5 (nuclear factor of activated T cells 5, which is the most evolutionarily divergent NFAT protein. By molecularly cloning and sequencing isolates from multiple viral subtypes, and performing DNase I footprinting, electrophoretic mobility shift, and promoter mutagenesis transfection assays, we demonstrate that NFAT5 functionally interacts with a specific enhancer binding site conserved in HIV-1, HIV-2, and multiple simian immunodeficiency viruses. Using small interfering RNA to ablate expression of endogenous NFAT5 protein, we show that the replication of three major HIV-1 viral subtypes (B, C, and E is dependent upon NFAT5 in human primary differentiated macrophages. Our results define a novel host factor-viral enhancer interaction that reveals a new regulatory role for NFAT5 and defines a functional DNA motif conserved across HIV-1 subtypes and representative simian immunodeficiency viruses. Inhibition of the NFAT5-LTR interaction may thus present a novel therapeutic target to suppress HIV-1 replication and progression of AIDS.

  6. Conservation of the Keap1-Nrf2 System: An Evolutionary Journey through Stressful Space and Time

    Directory of Open Access Journals (Sweden)

    Yuji Fuse

    2017-03-01

    Full Text Available The Keap1-Nrf2 system is an evolutionarily conserved defense mechanism against oxidative and xenobiotic stress. Its regulatory mechanisms, e.g., stress-sensing mechanism, proteasome-based regulation of Nrf2 activity and selection of target genes, have been elucidated mainly in mammals. In addition, emerging model animals, such as zebrafish, fruit fly and Caenorhabditis elegans, have been shown to have similar anti-stress systems to mammals, suggesting that analogous defense systems are widely conserved throughout the animal kingdom. Experimental evidence in lower animals provides important information beyond mere laboratory-confined utility, such as regarding how these systems transformed during evolution, which may help characterize the mammalian system in greater detail. Recent advances in genome projects of both model and non-model animals have provided a great deal of useful information toward this end. We herein review the research on Keap1-Nrf2 and its analogous systems in both mammals and lower model animals. In addition, by comparing the amino acid sequences of Nrf2 and Keap1 proteins from various species, we can deduce the evolutionary history of the anti-stress system. This combinatorial approach using both experimental and genetic data will suggest perspectives of approach for researchers studying the stress response.

  7. Conservation of the Keap1-Nrf2 System: An Evolutionary Journey through Stressful Space and Time.

    Science.gov (United States)

    Fuse, Yuji; Kobayashi, Makoto

    2017-03-09

    The Keap1-Nrf2 system is an evolutionarily conserved defense mechanism against oxidative and xenobiotic stress. Its regulatory mechanisms, e.g., stress-sensing mechanism, proteasome-based regulation of Nrf2 activity and selection of target genes, have been elucidated mainly in mammals. In addition, emerging model animals, such as zebrafish, fruit fly and Caenorhabditis elegans , have been shown to have similar anti-stress systems to mammals, suggesting that analogous defense systems are widely conserved throughout the animal kingdom. Experimental evidence in lower animals provides important information beyond mere laboratory-confined utility, such as regarding how these systems transformed during evolution, which may help characterize the mammalian system in greater detail. Recent advances in genome projects of both model and non-model animals have provided a great deal of useful information toward this end. We herein review the research on Keap1-Nrf2 and its analogous systems in both mammals and lower model animals. In addition, by comparing the amino acid sequences of Nrf2 and Keap1 proteins from various species, we can deduce the evolutionary history of the anti-stress system. This combinatorial approach using both experimental and genetic data will suggest perspectives of approach for researchers studying the stress response.

  8. The dinoflagellates Durinskia baltica and Kryptoperidinium foliaceum retain functionally overlapping mitochondria from two evolutionarily distinct lineages

    Directory of Open Access Journals (Sweden)

    Keeling Patrick J

    2007-09-01

    Full Text Available Abtract Background The dinoflagellates Durinskia baltica and Kryptoperidinium foliaceum are distinguished by the presence of a tertiary plastid derived from a diatom endosymbiont. The diatom is fully integrated with the host cell cycle and is so altered in structure as to be difficult to recognize it as a diatom, and yet it retains a number of features normally lost in tertiary and secondary endosymbionts, most notably mitochondria. The dinoflagellate host is also reported to retain mitochondrion-like structures, making these cells unique in retaining two evolutionarily distinct mitochondria. This redundancy raises the question of whether the organelles share any functions in common or have distributed functions between them. Results We show that both host and endosymbiont mitochondrial genomes encode genes for electron transport proteins. We have characterized cytochrome c oxidase 1 (cox1, cytochrome oxidase 2 (cox2, cytochrome oxidase 3 (cox3, cytochrome b (cob, and large subunit of ribosomal RNA (LSUrRNA of endosymbiont mitochondrial ancestry, and cox1 and cob of host mitochondrial ancestry. We show that all genes are transcribed and that those ascribed to the host mitochondrial genome are extensively edited at the RNA level, as expected for a dinoflagellate mitochondrion-encoded gene. We also found evidence for extensive recombination in the host mitochondrial genes and that recombination products are also transcribed, as expected for a dinoflagellate. Conclusion Durinskia baltica and K. foliaceum retain two mitochondria from evolutionarily distinct lineages, and the functions of these organelles are at least partially overlapping, since both express genes for proteins in electron transport.

  9. Genetic mapping of legume orthologs reveals high conservation of synteny between lentil species and the sequenced genomes of Medicago and chickpea

    Science.gov (United States)

    Gujaria-Verma, Neha; Vail, Sally L.; Carrasquilla-Garcia, Noelia; Penmetsa, R. Varma; Cook, Douglas R.; Farmer, Andrew D.; Vandenberg, Albert; Bett, Kirstin E.

    2014-01-01

    Lentil (Lens culinaris Medik.) is a global food crop with increasing importance for food security in south Asia and other regions. Lens ervoides, a wild relative of cultivated lentil, is an important source of agronomic trait variation. Lens is a member of the galegoid clade of the Papilionoideae family, which includes other important dietary legumes such as chickpea (Cicer arietinum) and pea (Pisum sativum), and the sequenced model legume Medicago truncatula. Understanding the genetic structure of Lens spp. in relation to more fully sequenced legumes would allow leveraging of genomic resources. A set of 1107 TOG-based amplicons were identified in L. ervoides and a subset thereof used to design SNP markers for mapping. A map of L. ervoides consisting of 377 SNP markers spread across seven linkage groups was developed using a GoldenGate genotyping array and single SNP marker assays. Comparison with maps of M. truncatula and L. culinaris documented considerable shared synteny and led to the identification of a few major translocations and a major inversion that distinguish Lens from M. truncatula, as well as a translocation that distinguishes L. culinaris from L. ervoides. The identification of chromosome-level differences among Lens spp. will aid in the understanding of introgression of genes from L. ervoides into cultivated L. culinaris, furthering genetic research and breeding applications in lentil. PMID:25538716

  10. Genetic mapping of legume orthologs reveals high conservation of synteny between lentil species and the sequenced genomes of Medicago and chickpea.

    Directory of Open Access Journals (Sweden)

    Neha eGujaria-Verma

    2014-12-01

    Full Text Available Lentil (Lens culinaris Medik. is a global food crop with increasing importance for food security in south Asia and other regions. Lens ervoides, a wild relative of cultivated lentil, is an important source of agronomic trait variation. Lens is a member of the galegoid clade of the Papilionoideae family, which includes other important dietary legumes such as chickpea (Cicer arietinum and pea (Pisum sativum, and the sequenced model legume Medicago truncatula. Understanding the genetic structure of Lens spp. in relation to more fully sequenced legumes would allow leveraging of genomic resources. A set of 1,107 TOG-based amplicons were identified in L. ervoides and a subset thereof used to design SNP markers for mapping. A map of L. ervoides consisting of 377 SNP markers spread across seven linkage groups was developed using a GoldenGate genotyping array and single SNP marker assays. Comparison with maps of M. truncatula and L. culinaris documented considerable shared synteny and led to the identification of a few major translocations and a major inversion that distinguish Lens from M. truncatula, as well as a translocation that distinguishes L. culinaris from L. ervoides. The identification of chromosome-level differences among Lens spp. will aid in the understanding of introgression of genes from L. ervoides into cultivated L. culinaris, furthering genetic research and breeding applications in lentil.

  11. based conservation

    African Journals Online (AJOL)

    http://dx.doi.org/10.4314/mcd.v10i2.1. Increasing women's par- ticipation in community- based conservation: key to success? Ensuring that both men and women benefit equitably from conservation and development programs is likely to increase the long-term success of both conservation and development goals. However ...

  12. The influence of DNA sequence on epigenome-induced pathologies

    Science.gov (United States)

    2012-01-01

    Clear cause-and-effect relationships are commonly established between genotype and the inherited risk of acquiring human and plant diseases and aberrant phenotypes. By contrast, few such cause-and-effect relationships are established linking a chromatin structure (that is, the epitype) with the transgenerational risk of acquiring a disease or abnormal phenotype. It is not entirely clear how epitypes are inherited from parent to offspring as populations evolve, even though epigenetics is proposed to be fundamental to evolution and the likelihood of acquiring many diseases. This article explores the hypothesis that, for transgenerationally inherited chromatin structures, “genotype predisposes epitype”, and that epitype functions as a modifier of gene expression within the classical central dogma of molecular biology. Evidence for the causal contribution of genotype to inherited epitypes and epigenetic risk comes primarily from two different kinds of studies discussed herein. The first and direct method of research proceeds by the examination of the transgenerational inheritance of epitype and the penetrance of phenotype among genetically related individuals. The second approach identifies epitypes that are duplicated (as DNA sequences are duplicated) and evolutionarily conserved among repeated patterns in the DNA sequence. The body of this article summarizes particularly robust examples of these studies from humans, mice, Arabidopsis, and other organisms. The bulk of the data from both areas of research support the hypothesis that genotypes predispose the likelihood of displaying various epitypes, but for only a few classes of epitype. This analysis suggests that renewed efforts are needed in identifying polymorphic DNA sequences that determine variable nucleosome positioning and DNA methylation as the primary cause of inherited epigenome-induced pathologies. By contrast, there is very little evidence that DNA sequence directly determines the inherited

  13. The influence of DNA sequence on epigenome-induced pathologies

    Directory of Open Access Journals (Sweden)

    Meagher Richard B

    2012-07-01

    Full Text Available Abstract Clear cause-and-effect relationships are commonly established between genotype and the inherited risk of acquiring human and plant diseases and aberrant phenotypes. By contrast, few such cause-and-effect relationships are established linking a chromatin structure (that is, the epitype with the transgenerational risk of acquiring a disease or abnormal phenotype. It is not entirely clear how epitypes are inherited from parent to offspring as populations evolve, even though epigenetics is proposed to be fundamental to evolution and the likelihood of acquiring many diseases. This article explores the hypothesis that, for transgenerationally inherited chromatin structures, “genotype predisposes epitype”, and that epitype functions as a modifier of gene expression within the classical central dogma of molecular biology. Evidence for the causal contribution of genotype to inherited epitypes and epigenetic risk comes primarily from two different kinds of studies discussed herein. The first and direct method of research proceeds by the examination of the transgenerational inheritance of epitype and the penetrance of phenotype among genetically related individuals. The second approach identifies epitypes that are duplicated (as DNA sequences are duplicated and evolutionarily conserved among repeated patterns in the DNA sequence. The body of this article summarizes particularly robust examples of these studies from humans, mice, Arabidopsis, and other organisms. The bulk of the data from both areas of research support the hypothesis that genotypes predispose the likelihood of displaying various epitypes, but for only a few classes of epitype. This analysis suggests that renewed efforts are needed in identifying polymorphic DNA sequences that determine variable nucleosome positioning and DNA methylation as the primary cause of inherited epigenome-induced pathologies. By contrast, there is very little evidence that DNA sequence directly

  14. In silico identification and characterization of conserved miRNAs and their target genes in sweet potato (Ipomoea batatas L.) Expressed Sequence Tags (ESTs)

    Science.gov (United States)

    Dehury, Budheswar; Panda, Debashis; Sahu, Jagajjit; Sahu, Mousumi; Sarma, Kishore; Barooah, Madhumita; Sen, Priyabrata; Modi, Mahendra Kumar

    2013-01-01

    The endogenous small non-coding micro RNAs (miRNAs), which are typically ~21–24 nt nucleotides, play a crucial role in regulating the intrinsic normal growth of cells and development of the plants as well as in maintaining the integrity of genomes. These small non-coding RNAs function as the universal specificity factors in post-transcriptional gene silencing. Discovering miRNAs, identifying their targets, and further inferring miRNA functions is a routine process to understand normal biological processes of miRNAs and their roles in the development of plants. Comparative genomics based approach using expressed sequence tags (EST) and genome survey sequences (GSS) offer a cost-effective platform for identification and characterization of miRNAs and their target genes in plants. Despite the fact that sweet potato (Ipomoea batatas L.) is an important staple food source for poor small farmers throughout the world, the role of miRNA in various developmental processes remains largely unknown. In this paper, we report the computational identification of miRNAs and their target genes in sweet potato from their ESTs. Using comparative genomics-based approach, 8 potential miRNA candidates belonging to miR168, miR2911, and miR156 families were identified from 23 406 ESTs in sweet potato. A total of 42 target genes were predicted and their probable functions were illustrated. Most of the newly identified miRNAs target transcription factors as well as genes involved in plant growth and development, signal transduction, metabolism, defense, and stress response. The identification of miRNAs and their targets is expected to accelerate the pace of miRNA discovery, leading to an improved understanding of the role of miRNA in development and physiology of sweet potato, as well as stress response. PMID:24067297

  15. Deep Sequencing of Distinct Preparations of the Live Attenuated Varicella-Zoster Virus Vaccine Reveals a Conserved Core of Attenuating Single-Nucleotide Polymorphisms.

    Science.gov (United States)

    Depledge, Daniel P; Yamanishi, Koichi; Gomi, Yasuyuki; Gershon, Anne A; Breuer, Judith

    2016-10-01

    The continued success of the live attenuated varicella-zoster virus vaccine in preventing varicella-zoster and herpes zoster is well documented, as are many of the mutations that contribute to the attenuation of the vOka virus for replication in skin. At least three different preparations of vOka are marketed. Here, we show using deep sequencing of seven batches of vOka vaccine (including ZostaVax, VariVax, VarilRix, and the Oka/Biken working seed) from three different manufacturers (VariVax, GSK, and Biken) that 137 single-nucleotide polymorphism (SNP) mutations are present in all vaccine batches. This includes six sites at which the vaccine allele is fixed or near fixation, which we speculate are likely to be important for attenuation. We also show that despite differences in the vaccine populations between preparations, batch-to-batch variation is minimal, as is the number and frequency of mutations unique to individual batches. This suggests that the vaccine manufacturing processes are not introducing new mutations and that, notwithstanding the mixture of variants present, VZV live vaccines are extremely stable. The continued success of vaccinations to prevent chickenpox and shingles, combined with the extremely low incidence of adverse reactions, indicates the quality of these vaccines. The vaccine itself is comprised of a heterogeneous live attenuated virus population and thus requires deep-sequencing technologies to explore the differences and similarities in the virus populations between different preparations and batches of the vaccines. Our data demonstrate minimal variation between batches, an important safety feature, and provide new insights into the extent of the mutations present in this attenuated virus. Copyright © 2016 Depledge et al.

  16. Stem loop sequences specific to transposable element IS605 are found linked to lipoprotein genes in Borrelia plasmids.

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in

  17. A Conserved Tripeptide Sequence at the C Terminus of the Poxvirus DNA Processivity Factor D4 Is Essential for Protein Integrity and Function.

    Science.gov (United States)

    Nuth, Manunya; Guan, Hancheng; Ricciardi, Robert P

    2016-12-30

    Vaccinia virus (VACV) is a poxvirus, and the VACV D4 protein serves both as a uracil-DNA glycosylase and as an essential component required for processive DNA synthesis. The VACV A20 protein has no known catalytic function itself but associates with D4 to form the D4-A20 heterodimer that functions as the poxvirus DNA processivity factor. The heterodimer enables the DNA polymerase to efficiently synthesize extended strands of DNA. Upon characterizing the interaction between D4 and A20, we observed that the C terminus of D4 is susceptible to perturbation. Further analysis demonstrated that a conserved hexapeptide stretch at the extreme C terminus of D4 is essential for maintaining protein integrity, as assessed by its requirement for the production of soluble recombinant protein that is functional in processive DNA synthesis. From the known crystal structures of D4, the C-terminal hexapeptide is shown to make intramolecular contact with residues spanning the inner core of the protein. Our mutational analysis revealed that a tripeptide motif ((215)GFI(217)) within the hexapeptide comprises apparent residues necessary for the contact. Prediction of protein disorder identified the hexapeptide and several regions upstream of Gly(215) that comprise residues of the interface surfaces of the D4-A20 heterodimer. Our study suggests that (215)GFI(217) anchors these potentially dynamic upstream regions of the protein to maintain protein integrity. Unlike uracil-DNA glycosylases from diverse sources, where the C termini are disordered and do not form comparable intramolecular contacts, this feature may be unique to orthopoxviruses. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Genome-Wide Identification and Comparative Analysis of Conserved and Novel MicroRNAs in Grafted Watermelon by High-Throughput Sequencing

    Science.gov (United States)

    Liu, Na; Yang, Jinghua; Guo, Shaogui; Xu, Yong; Zhang, Mingfang

    2013-01-01

    MicroRNAs (miRNAs) are a class of endogenous small non-coding RNAs involved in the post-transcriptional gene regulation and play a critical role in plant growth, development and stresses response. However less is known about miRNAs involvement in grafting behaviors, especially with the watermelon (Citrullus lanatus L.) crop, which is one of the most important agricultural crops worldwide. Grafting method is commonly used in watermelon production in attempts to improve its adaptation to abiotic and biotic stresses, in particular to the soil-borne fusarium wilt disease. In this study, Solexa sequencing has been used to discover small RNA populations and compare miRNAs on genome-wide scale in watermelon grafting system. A total of 11,458,476, 11,614,094 and 9,339,089 raw reads representing 2,957,751, 2,880,328 and 2,964,990 unique sequences were obtained from the scions of self-grafted watermelon and watermelon grafted on-to bottle gourd and squash at two true-leaf stage, respectively. 39 known miRNAs belonging to 30 miRNA families and 80 novel miRNAs were identified in our small RNA dataset. Compared with self-grafted watermelon, 20 (5 known miRNA families and 15 novel miRNAs) and 47 (17 known miRNA families and 30 novel miRNAs) miRNAs were expressed significantly different in watermelon grafted on to bottle gourd and squash, respectively. MiRNAs expressed differentially when watermelon was grafted onto different rootstocks, suggesting that miRNAs might play an important role in diverse biological and metabolic processes in watermelon and grafting may possibly by changing miRNAs expressions to regulate plant growth and development as well as adaptation to stresses. The small RNA transcriptomes obtained in this study provided insights into molecular aspects of miRNA-mediated regulation in grafted watermelon. Obviously, this result would provide a basis for further unravelling the mechanism on how miRNAs information is exchanged between scion and rootstock in grafted

  19. Epitope mapping of a monoclonal antibody against human thrombin by H/D-exchange mass spectrometry reveals selection of a diverse sequence in a highly conserved protein.

    Science.gov (United States)

    Baerga-Ortiz, Abel; Hughes, Carrie A; Mandell, Jeffrey G; Komives, Elizabeth A

    2002-06-01

    The epitope of a monoclonal antibody raised against human thrombin has been determined by hydrogen/deuterium exchange coupled to MALDI mass spectrometry. The antibody epitope was identified as the surface of thrombin that retained deuterium in the presence of the monoclonal antibody compared to control experiments in its absence. Covalent attachment of the antibody to protein G beads and efficient elution of the antigen after deuterium exchange afforded the analysis of all possible epitopes in a single MALDI mass spectrum. The epitope, which was discontinuous, consisting of two peptides close to anion-binding exosite I, was readily identified. The epitope overlapped with, but was not identical to, the thrombomodulin binding site, consistent with inhibition studies. The antibody bound specifically to human thrombin and not to murine or bovine thrombin, although these proteins share 86% identity with the human protein. Interestingly, the epitope turned out to be the more structured of two surface regions in which higher sequence variation between the three species is seen.

  20. Genome Sequence of the Pea Aphid Acyrthosiphon pisum

    Science.gov (United States)

    2010-01-01

    Aphids are important agricultural pests and also biological models for studies of insect-plant interactions, symbiosis, virus vectoring, and the developmental causes of extreme phenotypic plasticity. Here we present the 464 Mb draft genome assembly of the pea aphid Acyrthosiphon pisum. This first published whole genome sequence of a basal hemimetabolous insect provides an outgroup to the multiple published genomes of holometabolous insects. Pea aphids are host-plant specialists, they can reproduce both sexually and asexually, and they have coevolved with an obligate bacterial symbiont. Here we highlight findings from whole genome analysis that may be related to these unusual biological features. These findings include discovery of extensive gene duplication in more than 2000 gene families as well as loss of evolutionarily conserved genes. Gene family expansions relative to other published genomes include genes involved in chromatin modification, miRNA synthesis, and sugar transport. Gene losses include genes central to the IMD immune pathway, selenoprotein utilization, purine salvage, and the entire urea cycle. The pea aphid genome reveals that only a limited number of genes have been acquired from bacteria; thus the reduced gene count of Buchnera does not reflect gene transfer to the host genome. The inventory of metabolic genes in the pea aphid genome suggests that there is extensive metabolite exchange between the aphid and Buchnera, including sharing of amino acid biosynthesis between the aphid and Buchnera. The pea aphid genome provides a foundation for post-genomic studies of fundamental biological questions and applied agricultural problems. PMID:20186266

  1. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  2. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  3. Genetic differentiation and selection against migrants in evolutionarily replicated extreme environments.

    Science.gov (United States)

    Plath, Martin; Pfenninger, Markus; Lerp, Hannes; Riesch, Rüdiger; Eschenbrenner, Christoph; Slattery, Patrick A; Bierbach, David; Herrmann, Nina; Schulte, Matthias; Arias-Rodriguez, Lenin; Rimber Indy, Jeane; Passow, Courtney; Tobler, Michael

    2013-09-01

    We investigated mechanisms of reproductive isolation in livebearing fishes (genus Poecilia) inhabiting sulfidic and nonsulfidic habitats in three replicate river drainages. Although sulfide spring fish convergently evolved divergent phenotypes, it was unclear if mechanisms of reproductive isolation also evolved convergently. Using microsatellites, we found strongly reduced gene flow between adjacent populations from different habitat types, suggesting that local adaptation to sulfidic habitats repeatedly caused the emergence of reproductive isolation. Reciprocal translocation experiments indicate strong selection against immigrants into sulfidic waters, but also variation among drainages in the strength of selection against immigrants into nonsulfidic waters. Mate choice experiments revealed the evolution of assortative mating preferences in females from nonsulfidic but not from sulfidic habitats. The inferred strength of sexual selection against immigrants (RI(s)) was negatively correlated with the strength of natural selection (RI(m)), a pattern that could be attributed to reinforcement, whereby natural selection strengthens behavioral isolation due to reduced hybrid fitness. Overall, reproductive isolation and genetic differentiation appear to be replicated and direct consequences of local adaptation to sulfide spring environments, but the relative contributions of different mechanisms of reproductive isolation vary across these evolutionarily independent replicates, highlighting both convergent and nonconvergent evolutionary trajectories of populations in each drainage. © 2013 The Author(s). Evolution © 2013 The Society for the Study of Evolution.

  4. Honesty and cheating in cleaning symbioses: evolutionarily stable strategies defined by variable pay-offs.

    Science.gov (United States)

    Freckleton, Robert P; Côté, Isabelle M

    2003-01-01

    Game-theory models have indicated that the evolution of mixed strategies of cheating and honesty in many mutualisms is unlikely. Moreover, the mutualistic nature of interspecific interactions has often been difficult to demonstrate empirically. We present a game-theory analysis that addresses these issues using cleaning symbioses among fishes as a model system. We show that the assumption of constant pay-offs in existing models prevents the evolution of evolutionarily stable mixed strategies of cheating and honesty. However, when interaction pay-offs are assumed to be density dependent, mixed strategies of cheating and honesty become possible. In nature, cheating by clients often takes the form of retaliation by clients against cheating cleaners, and we show that mixed strategies of cheating and honesty evolve within the cleaner population when clients retaliate. The dynamics of strategies include both negative and positive effects of interactions, as well as density-dependent interactions. Consequently, the effects of perturbations to the model are nonlinear. In particular, we show that under certain conditions the removal of cleaners may have little impact on client populations. This indicates that the underlying mutualistic nature of some interspecific interactions may be difficult to demonstrate using simple manipulation experiments. PMID:12614580

  5. The effect of travel loss on evolutionarily stable distributions of populations in space.

    Science.gov (United States)

    Deangelis, Donald L; Wolkowicz, Gail S K; Lou, Yuan; Jiang, Yuexin; Novak, Mark; Svanbäck, Richard; Araújo, Márcio S; Jo, Youngseung; Cleary, Erin A

    2011-07-01

    A key assumption of the ideal free distribution (IFD) is that there are no costs in moving between habitat patches. However, because many populations exhibit more or less continuous population movement between patches and traveling cost is a frequent factor, it is important to determine the effects of costs on expected population movement patterns and spatial distributions. We consider a food chain (tritrophic or bitrophic) in which one species moves between patches, with energy cost or mortality risk in movement. In the two-patch case, assuming forced movement in one direction, an evolutionarily stable strategy requires bidirectional movement, even if costs during movement are high. In the N-patch case, assuming that at least one patch is linked bidirectionally to all other patches, optimal movement rates can lead to source-sink dynamics where patches with negative growth rates are maintained by other patches with positive growth rates. As well, dispersal between patches is not balanced (even in the two-patch case), leading to a deviation from the IFD. Our results indicate that cost-associated forced movement can have important consequences for spatial metapopulation dynamics. Relevance to marine reserve design and the study of stream communities subject to drift is discussed.

  6. A comprehensive test of evolutionarily increased competitive ability in a highly invasive plant species

    Science.gov (United States)

    Joshi, Srijana; Gruntman, Michal; Bilton, Mark; Seifan, Merav; Tielbörger, Katja

    2014-01-01

    Background and Aims A common hypothesis to explain plants' invasive success is that release from natural enemies in the introduced range selects for reduced allocation to resistance traits and a subsequent increase in resources available for growth and competitive ability (evolution of increased competitive ability, EICA). However, studies that have investigated this hypothesis have been incomplete as they either did not test for all aspects of competitive ability or did not select appropriate competitors. Methods Here, the prediction of increased competitive ability was examined with the invasive plant Lythrum salicaria (purple loosestrife) in a set of common-garden experiments that addressed these aspects by carefully distinguishing between competitive effect and response of invasive and native plants, and by using both intraspecific and interspecific competition settings with a highly vigorous neighbour, Urtica dioica (stinging nettle), which occurs in both ranges. Key Results While the intraspecific competition results showed no differences in competitive effect or response between native and invasive plants, the interspecific competition experiment revealed greater competitive response and effect of invasive plants in both biomass and seed production. Conclusions The use of both intra- and interspecific competition experiments in this study revealed opposing results. While the first experiment refutes the EICA hypothesis, the second shows strong support for it, suggesting evolutionarily increased competitive ability in invasive populations of L. salicaria. It is suggested that the use of naturally co-occurring heterospecifics, rather than conspecifics, may provide a better evaluation of the possible evolutionary shift towards greater competitive ability. PMID:25301818

  7. Complete genome sequence and comparative genomic analysis of Mycobacterium massiliense JCM 15300 in the Mycobacterium abscessus group reveal a conserved genomic island MmGI-1 related to putative lipid metabolism.

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Sekizuka

    Full Text Available Mycobacterium abscessus group subsp., such as M. massiliense, M. abscessus sensu stricto and M. bolletii, are an environmental organism found in soil, water and other ecological niches, and have been isolated from respiratory tract infection, skin and soft tissue infection, postoperative infection of cosmetic surgery. To determine the unique genetic feature of M. massiliense, we sequenced the complete genome of M. massiliense type strain JCM 15300 (corresponding to CCUG 48898. Comparative genomic analysis was performed among Mycobacterium spp. and among M. abscessus group subspp., showing that additional ß-oxidation-related genes and, notably, the mammalian cell entry (mce operon were located on a genomic island, M. massiliense Genomic Island 1 (MmGI-1, in M. massiliense. In addition, putative anaerobic respiration system-related genes and additional mycolic acid cyclopropane synthetase-related genes were found uniquely in M. massiliense. Japanese isolates of M. massiliense also frequently possess the MmGI-1 (14/44, approximately 32% and three unique conserved regions (26/44; approximately 60%, 34/44; approximately 77% and 40/44; approximately 91%, as well as isolates of other countries (Malaysia, France, United Kingdom and United States. The well-conserved genomic island MmGI-1 may play an important role in high growth potential with additional lipid metabolism, extra factors for survival in the environment or synthesis of complex membrane-associated lipids. ORFs on MmGI-1 showed similarities to ORFs of phylogenetically distant M. avium complex (MAC, suggesting that horizontal gene transfer or genetic recombination events might have occurred within MmGI-1 among M. massiliense and MAC.

  8. Systematic comparison of three genomic enrichment methods for massively parallel DNA sequencing.

    Science.gov (United States)

    Teer, Jamie K; Bonnycastle, Lori L; Chines, Peter S; Hansen, Nancy F; Aoyama, Natsuyo; Swift, Amy J; Abaan, Hatice Ozel; Albert, Thomas J; Margulies, Elliott H; Green, Eric D; Collins, Francis S; Mullikin, James C; Biesecker, Leslie G

    2010-10-01

    Massively parallel DNA sequencing technologies have greatly increased our ability to generate large amounts of sequencing data at a rapid pace. Several methods have been developed to enrich for genomic regions of interest for targeted sequencing. We have compared three of these methods: Molecular Inversion Probes (MIP), Solution Hybrid Selection (SHS), and Microarray-based Genomic Selection (MGS). Using HapMap DNA samples, we compared each of these methods with respect to their ability to capture an identical set of exons and evolutionarily conserved regions associated with 528 genes (2.61 Mb). For sequence analysis, we developed and used a novel Bayesian genotype-assigning algorithm, Most Probable Genotype (MPG). All three capture methods were effective, but sensitivities (percentage of targeted bases associated with high-quality genotypes) varied for an equivalent amount of pass-filtered sequence: for example, 70% (MIP), 84% (SHS), and 91% (MGS) for 400 Mb. In contrast, all methods yielded similar accuracies of >99.84% when compared to Infinium 1M SNP BeadChip-derived genotypes and >99.998% when compared to 30-fold coverage whole-genome shotgun sequencing data. We also observed a low false-positive rate with all three methods; of the heterozygous positions identified by each of the capture methods, >99.57% agreed with 1M SNP BeadChip, and >98.840% agreed with the whole-genome shotgun data. In addition, we successfully piloted the genomic enrichment of a set of 12 pooled samples via the MGS method using molecular bar codes. We find that these three genomic enrichment methods are highly accurate and practical, with sensitivities comparable to that of 30-fold coverage whole-genome shotgun data.

  9. A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

    Science.gov (United States)

    Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

    2017-01-01

    Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

  10. FERM-dependent E3 ligase recognition is a conserved mechanism for targeted degradation of lipoprotein receptors.

    Science.gov (United States)

    Calkin, Anna C; Goult, Benjamin T; Zhang, Li; Fairall, Louise; Hong, Cynthia; Schwabe, John W R; Tontonoz, Peter

    2011-12-13

    The E3 ubiquitin ligase IDOL (inducible degrader of the LDL receptor) regulates LDL receptor (LDLR)-dependent cholesterol uptake, but its mechanism of action, including the molecular basis for its stringent specificity, is poorly understood. Here we show that IDOL uses a singular strategy among E3 ligases for target recognition. The IDOL FERM domain binds directly to a recognition sequence in the cytoplasmic tails of lipoprotein receptors. This physical interaction is independent of IDOL's really interesting new gene (RING) domain E3 ligase activity and its capacity for autoubiquitination. Furthermore, IDOL controls its own stability through autoubiquitination of a unique FERM subdomain fold not present in other FERM proteins. Key residues defining the IDOL-LDLR interaction and IDOL autoubiquitination are functionally conserved in their insect homologs. Finally, we demonstrate that target recognition by IDOL involves a tripartite interaction between the FERM domain, membrane phospholipids, and the lipoprotein receptor tail. Our data identify the IDOL-LDLR interaction as an evolutionarily conserved mechanism for the regulation of lipid uptake and suggest that this interaction could potentially be exploited for the pharmacologic modulation of lipid metabolism.

  11. Reshaping conservation

    DEFF Research Database (Denmark)

    Funder, Mikkel; Danielsen, Finn; Ngaga, Yonika

    2013-01-01

    members strengthen the monitoring practices to their advantage, and to some extent move them beyond the reach of government agencies and conservation and development practitioners. This has led to outcomes that are of greater social and strategic value to communities than the original 'planned' benefits......, although the monitoring scheme has also to some extent become dominated by local 'conservation elites' who negotiate the terrain between the state and other community members. Our findings suggest that we need to move beyond simplistic assumptions of community strategies and incentives in participatory...... conservation and allow for more adaptive and politically explicit governance spaces in protected area management....

  12. A comprehensive test of evolutionarily increased competitive ability in a highly invasive plant species.

    Science.gov (United States)

    Joshi, Srijana; Gruntman, Michal; Bilton, Mark; Seifan, Merav; Tielbörger, Katja

    2014-12-01

    A common hypothesis to explain plants' invasive success is that release from natural enemies in the introduced range selects for reduced allocation to resistance traits and a subsequent increase in resources available for growth and competitive ability (evolution of increased competitive ability, EICA). However, studies that have investigated this hypothesis have been incomplete as they either did not test for all aspects of competitive ability or did not select appropriate competitors. Here, the prediction of increased competitive ability was examined with the invasive plant Lythrum salicaria (purple loosestrife) in a set of common-garden experiments that addressed these aspects by carefully distinguishing between competitive effect and response of invasive and native plants, and by using both intraspecific and interspecific competition settings with a highly vigorous neighbour, Urtica dioica (stinging nettle), which occurs in both ranges. While the intraspecific competition results showed no differences in competitive effect or response between native and invasive plants, the interspecific competition experiment revealed greater competitive response and effect of invasive plants in both biomass and seed production. The use of both intra- and interspecific competition experiments in this study revealed opposing results. While the first experiment refutes the EICA hypothesis, the second shows strong support for it, suggesting evolutionarily increased competitive ability in invasive populations of L. salicaria. It is suggested that the use of naturally co-occurring heterospecifics, rather than conspecifics, may provide a better evaluation of the possible evolutionary shift towards greater competitive ability. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Hearing Conservation

    Science.gov (United States)

    1995-01-01

    the federal standard. Footnote** See Title 29 Code of Federal Regulations (CFR) 1910.95 "Occupational Noise Exposure." (Back to text) | USDOL | CONTACT INFORMATION | DISCLAIMER | 15 of 15 OSHA 3074 - Hearing Conservation

  14. Wildlife Conservation

    OpenAIRE

    Spash, Clive L.; Aldred, Jonathan

    1998-01-01

    In this paper we consider how conservation has arisen as a key aspect of the reaction to human-initiated degradation and disappearance of ecosystems, wild lands. and wildlife. Concern over species extinction is given an historical perspective which shows the way in which pressure on wild and natural aspects of global ecology have changed in recent centuries. The role of conservation in the struggle to protect the environment is then analysed using underlying ethical arguments behind the econo...

  15. Austere conservation

    DEFF Research Database (Denmark)

    Bluwstein, Jevgeniy; Moyo, Francis; Kicheleri, Rose Peter

    2016-01-01

    . Our findings suggest that WMAs foster very limited ownership, participation and collective action at the community level, because WMA governance follows an austere logic of centralized control over key resources. Thus, we suggest that it is difficult to argue that WMAs are community-owned conservation...... initiatives until a genuinely devolved and more flexible conservation model is implemented to give space for popular participation in rule-making....

  16. Genetic diversity and population structure of the pelagic thresher shark (Alopias pelagicus) in the Pacific Ocean: evidence for two evolutionarily significant units.

    Science.gov (United States)

    Cardeñosa, Diego; Hyde, John; Caballero, Susana

    2014-01-01

    There has been an increasing concern about shark overexploitation in the last decade, especially for open ocean shark species, where there is a paucity of data about their life histories and population dynamics. Little is known regarding the population structure of the pelagic thresher shark, Alopias pelagicus. Though an earlier study using mtDNA control region data, showed evidence for differences between eastern and western Pacific populations, the study was hampered by low sample size and sparse geographic coverage, particularly a lack of samples from the central Pacific. Here, we present the population structure of Alopias pelagicus analyzing 351 samples from six different locations across the Pacific Ocean. Using data from mitochondrial DNA COI sequences and seven microsatellite loci we found evidence of strong population differentiation between western and eastern Pacific populations and evidence for reciprocally monophyly for organelle haplotypes and significant divergence of allele frequencies at nuclear loci, suggesting the existence of two Evolutionarily Significant Units (ESU) in the Pacific Ocean. Interestingly, the population in Hawaii appears to be composed of both ESUs in what seems to be clear sympatry with reproductive isolation. These results may indicate the existence of a new cryptic species in the Pacific Ocean. The presence of these distinct ESUs highlights the need for revised management plans for this highly exploited shark throughout its range.

  17. Genetic diversity and population structure of the pelagic thresher shark (Alopias pelagicus in the Pacific Ocean: evidence for two evolutionarily significant units.

    Directory of Open Access Journals (Sweden)

    Diego Cardeñosa

    Full Text Available There has been an increasing concern about shark overexploitation in the last decade, especially for open ocean shark species, where there is a paucity of data about their life histories and population dynamics. Little is known regarding the population structure of the pelagic thresher shark, Alopias pelagicus. Though an earlier study using mtDNA control region data, showed evidence for differences between eastern and western Pacific populations, the study was hampered by low sample size and sparse geographic coverage, particularly a lack of samples from the central Pacific. Here, we present the population structure of Alopias pelagicus analyzing 351 samples from six different locations across the Pacific Ocean. Using data from mitochondrial DNA COI sequences and seven microsatellite loci we found evidence of strong population differentiation between western and eastern Pacific populations and evidence for reciprocally monophyly for organelle haplotypes and significant divergence of allele frequencies at nuclear loci, suggesting the existence of two Evolutionarily Significant Units (ESU in the Pacific Ocean. Interestingly, the population in Hawaii appears to be composed of both ESUs in what seems to be clear sympatry with reproductive isolation. These results may indicate the existence of a new cryptic species in the Pacific Ocean. The presence of these distinct ESUs highlights the need for revised management plans for this highly exploited shark throughout its range.

  18. A C----T substitution at nt--101 in a conserved DNA sequence of the promotor region of the beta-globin gene is associated with "silent" beta-thalassemia.

    Science.gov (United States)

    Gonzalez-Redondo, J M; Stoming, T A; Kutlar, A; Kutlar, F; Lanclos, K D; Howard, E F; Fei, Y J; Aksoy, M; Altay, C; Gurgey, A

    1989-05-01

    Sequence analyses and dot-blot analyses with synthetic oligonucleotide probes have identified eight individuals in three Turkish families and one Bulgarian family with one chromosome having a C----T mutation at nucleotide position--101 relative to the Cap site of the beta-globin gene. This nucleotide is part of one of the conserved blocks of nucleotides within the promoter region; in vitro expression analyses with the chloramphenicol acetyltransferase system showed that this substitution will decrease the effectiveness of transcription. Five subjects had a thalassemia intermedia due to the additional presence of a known classical high hemoglobin (Hb) A2 beta-thalassemia mutation on the second chromosome; their hematologic condition was relatively mild. The three persons with a heterozygosity for the--101 C----T mutation had normal hematologic data without microcytosis but with high-normal levels of Hb A2 and a mild imbalance in chain synthesis. The newly discovered mutation is considered one of the silent types of beta-thalassemia. It is relatively rare because it was absent among several hundred normal and beta-thalassemia chromosomes.

  19. A novel fragile X syndrome mutation reveals a conserved role for the carboxy-terminus in FMRP localization and function.

    Science.gov (United States)

    Okray, Zeynep; de Esch, Celine E F; Van Esch, Hilde; Devriendt, Koen; Claeys, Annelies; Yan, Jiekun; Verbeeck, Jelle; Froyen, Guy; Willemsen, Rob; de Vrij, Femke M S; Hassan, Bassem A

    2015-04-01

    Loss of function of the FMR1 gene leads to fragile X syndrome (FXS), the most common form of intellectual disability. The loss of FMR1 function is usually caused by epigenetic silencing of the FMR1 promoter leading to expansion and subsequent methylation of a CGG repeat in the 5' untranslated region. Very few coding sequence variations have been experimentally characterized and shown to be causal to the disease. Here, we describe a novel FMR1 mutation and reveal an unexpected nuclear export function for the C-terminus of FMRP. We screened a cohort of patients with typical FXS symptoms who tested negative for CGG repeat expansion in the FMR1 locus. In one patient, we identified a guanine insertion in FMR1 exon 15. This mutation alters the open reading frame creating a short novel C-terminal sequence, followed by a stop codon. We find that this novel peptide encodes a functional nuclear localization signal (NLS) targeting the patient FMRP to the nucleolus in human cells. We also reveal an evolutionarily conserved nuclear export function associated with the endogenous C-terminus of FMRP. In vivo analyses in Drosophila demonstrate that a patient-mimetic mutation alters the localization and function of Dfmrp in neurons, leading to neomorphic neuronal phenotypes. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.

  20. Identification of elongation factor G as the conserved cellular target of argyrin B.

    Directory of Open Access Journals (Sweden)

    Beat Nyfeler

    Full Text Available Argyrins, produced by myxobacteria and actinomycetes, are cyclic octapeptides with antibacterial and antitumor activity. Here, we identify elongation factor G (EF-G as the cellular target of argyrin B in bacteria, via resistant mutant selection and whole genome sequencing, biophysical binding studies and crystallography. Argyrin B binds a novel allosteric pocket in EF-G, distinct from the known EF-G inhibitor antibiotic fusidic acid, revealing a new mode of protein synthesis inhibition. In eukaryotic cells, argyrin B was found to target mitochondrial elongation factor G1 (EF-G1, the closest homologue of bacterial EF-G. By blocking mitochondrial translation, argyrin B depletes electron transport components and inhibits the growth of yeast and tumor cells. Further supporting direct inhibition of EF-G1, expression of an argyrin B-binding deficient EF-G1 L693Q variant partially rescued argyrin B-sensitivity in tumor cells. In summary, we show that argyrin B is an antibacterial and cytotoxic agent that inhibits the evolutionarily conserved target EF-G, blocking protein synthesis in bacteria and mitochondrial translation in yeast and mammalian cells.

  1. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements

    KAUST Repository

    Guturu, H.

    2013-11-11

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and \\'through-DNA\\' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex.

  2. Comparison of three targeted enrichment strategies on the SOLiD sequencing platform.

    Science.gov (United States)

    Hedges, Dale J; Guettouche, Toumy; Yang, Shan; Bademci, Guney; Diaz, Ashley; Andersen, Ashley; Hulme, William F; Linker, Sara; Mehta, Arpit; Edwards, Yvonne J K; Beecham, Gary W; Martin, Eden R; Pericak-Vance, Margaret A; Zuchner, Stephan; Vance, Jeffery M; Gilbert, John R

    2011-04-29

    Despite the ever-increasing throughput and steadily decreasing cost of next generation sequencing (NGS), whole genome sequencing of humans is still not a viable option for the majority of genetics laboratories. This is particularly true in the case of complex disease studies, where large sample sets are often required to achieve adequate statistical power. To fully leverage the potential of NGS technology on large sample sets, several methods have been developed to selectively enrich for regions of interest. Enrichment reduces both monetary and computational costs compared to whole genome sequencing, while allowing researchers to take advantage of NGS throughput. Several targeted enrichment approaches are currently available, including molecular inversion probe ligation sequencing (MIPS), oligonucleotide hybridization based approaches, and PCR-based strategies. To assess how these methods performed when used in conjunction with the ABI SOLID3+, we investigated three enrichment techniques: Nimblegen oligonucleotide hybridization array-based capture; Agilent SureSelect oligonucleotide hybridization solution-based capture; and Raindance Technologies' multiplexed PCR-based approach. Target regions were selected from exons and evolutionarily conserved areas throughout the human genome. Probe and primer pair design was carried out for all three methods using their respective informatics pipelines. In all, approximately 0.8 Mb of target space was identical for all 3 methods. SOLiD sequencing results were analyzed for several metrics, including consistency of coverage depth across samples, on-target versus off-target efficiency, allelic bias, and genotype concordance with array-based genotyping data. Agilent SureSelect exhibited superior on-target efficiency and correlation of read depths across samples. Nimblegen performance was similar at read depths at 20× and below. Both Raindance and Nimblegen SeqCap exhibited tighter distributions of read depth around the mean, but

  3. Conservation endocrinology

    Science.gov (United States)

    McCormick, Stephen; Romero, L. Michael

    2017-01-01

    Endocrinologists can make significant contributions to conservation biology by helping to understand the mechanisms by which organisms cope with changing environments. Field endocrine techniques have advanced rapidly in recent years and can provide substantial information on the growth, stress, and reproductive status of individual animals, thereby providing insight into current and future responses of populations to changes in the environment. Environmental stressors and reproductive status can be detected nonlethally by measuring a number of endocrine-related endpoints, including steroids in plasma, living and nonliving tissue, urine, and feces. Information on the environmental or endocrine requirements of individual species for normal growth, development, and reproduction will provide critical information for species and ecosystem conservation. For many taxa, basic information on endocrinology is lacking, and advances in conservation endocrinology will require approaches that are both “basic” and “applied” and include integration of laboratory and field approaches.

  4. Colorful Conservation

    Science.gov (United States)

    Skophammer, Karen

    2011-01-01

    Some people only think about conservation on Earth Day. Being in the "art business" however, this author is always conscious of the many products she thinks get wasted when they could be reused, recycled, and restored--especially in a school building and art room. In this article, she describes an art lesson that allows students to paint…

  5. Creative conservation

    NARCIS (Netherlands)

    Bentham, Roelof J.

    1968-01-01

    The increasing exploitation of our natural resources, the unlimited occupation of ever more new areas, and the intensification of land-use, make it necessary for us to expand the concept of conservation. But we also need to reconsider that concept itself. For the changing conditions in the

  6. [Conservation Units.

    Science.gov (United States)

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  7. Identification of a novel conserved mixed-isoform B56 regulatory subunit and spatiotemporal regulation of protein phosphatase 2A during Xenopus laevis development

    Directory of Open Access Journals (Sweden)

    Seeling Joni M

    2007-12-01

    Full Text Available Abstract Background Wnt signaling is a key regulator of development and tumorigenesis. Protein phosphatase 2A (PP2A, which consists of a catalytic C, a structural A, and a regulatory B subunit, plays diverse roles in Wnt signaling through its B56 subunits. B56 is a multigene family encoding for proteins with a conserved core domain and divergent amino- and carboxy-termini. Ectopic B56α and B56γ reduce β-catenin abundance and B56α reduces Wnt-dependent transcription, suggesting that B56α and B56γ inhibit Wnt signaling. In contrast, B56ε is required for Wnt signaling. Knowledge of where and when B56 subunits are expressed during Xenopus development will aid in our understanding of their roles in Wnt signaling. Results We have undertaken expression analyses of B56α and B56γ in Xenopus laevis. We cloned Xenopus B56α; it is 88% identical to human B56α. Xenopus B56γ is 94% identical with human B56γ, however, a novel evolutionarily conserved mixed-isoform transcript was identified that contains a B56δ-like amino-terminal domain and a B56γ core domain. The B56δ-like variable domain exon is located upstream of the B56γ variable domain exon at the human B56γ locus, suggesting that the mixed-isoform transcript is due to alternative splicing. B56γ transcripts with different 3' ends were identified that lack or possess a 35 base pair sequence, resulting in either a transcript similar to human B56γ1, or an uncharacterized evolutionarily conserved sequence. Real time RT-PCR analyses revealed that B56α is expressed at moderate levels before the midblastula transition (MBT, at reduced levels during gastrulation and neurulation, and at high levels during organogenesis, while B56γ is expressed at low levels until organogenesis. B56α is enriched in the ventral hemisphere pre-MBT, while B56γ is ventrally enriched post-MBT. Aα, Aβ, Cα and Cβ are expressed in early Xenopus development, suggesting the presence of a functional heterotrimer

  8. Domain architecture conservation in orthologs.

    Science.gov (United States)

    Forslund, Kristoffer; Pekkari, Isabella; Sonnhammer, Erik L L

    2011-08-05

    As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence.To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation.The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the notion that orthologs are

  9. Domain architecture conservation in orthologs

    Science.gov (United States)

    2011-01-01

    Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the

  10. Exporting conservation

    OpenAIRE

    LTRA-12

    2012-01-01

    Metadata only record Soil degradation represents a major threat to food security, particularly in mountainous regions of Southeast Asia, where rainfall can wash away inches of topsoil. This article presents conservation agriculture as a potential solution, focusing on the work that North Carolina Agricultural and Technical State University conducts in Southeast Asia in conjunction with regional partners as part of the Sustainable Agriculture and Natural Resource Management (SANREM) collabo...

  11. Evolutionary conservation and changes in insect TRP channels

    Directory of Open Access Journals (Sweden)

    Tominaga Makoto

    2009-09-01

    Full Text Available Abstract Background TRP (Transient Receptor Potential channels respond to diverse stimuli and thus function as the primary integrators of varied sensory information. They are also activated by various compounds and secondary messengers to mediate cell-cell interactions as well as to detect changes in the local environment. Their physiological roles have been primarily characterized only in mice and fruit flies, and evolutionary studies are limited. To understand the evolution of insect TRP channels and the mechanisms of integrating sensory inputs in insects, we have identified and compared TRP channel genes in Drosophila melanogaster, Bombyx mori, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, and Pediculus humanus genomes as part of genome sequencing efforts. Results All the insects examined have 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML subfamily members, demonstrating that these channels have the ancient origins in insects. The common pattern also suggests that the mechanisms for detecting mechanical and visual stimuli and maintaining lysosomal functions may be evolutionarily well conserved in insects. However, a TRPP channel, the most ancient TRP channel, is missing in B. mori, A. mellifera, and N. vitripennis. Although P. humanus and D. melanogaster contain 4 TRPA subfamily members, the other insects have 5 TRPA subfamily members. T. castaneum, A. mellifera, and N. vitripennis contain TRPA5 channels, which have been specifically retained or gained in Coleoptera and Hymenoptera. Furthermore, TRPA1, which functions for thermotaxis in Drosophila, is missing in A. mellifera and N. vitripennis; however, they have other Hymenoptera-specific TRPA channels (AmHsTRPA and NvHsTRPA. NvHsTRPA expressed in HEK293 cells is activated by temperature increase, demonstrating that HsTRPAs function as novel thermal sensors in Hymenoptera. Conclusion The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP

  12. Phylogeny as a proxy for ecology in seagrass amphipods: which traits are most conserved?

    Directory of Open Access Journals (Sweden)

    Rebecca J Best

    Full Text Available Increasingly, studies of community assembly and ecosystem function combine trait data and phylogenetic relationships to gain novel insight into the ecological and evolutionary constraints on community dynamics. However, the key to interpreting these two types of information is an understanding of the extent to which traits are phylogenetically conserved. In this study, we develop the necessary framework for community phylogenetics approaches in a system of marine crustacean herbivores that play an important role in the ecosystem functioning of seagrass systems worldwide. For 16 species of amphipods and isopods, we (1 reconstructed phylogenetic relationships using COI, 16S, and 18S sequences and Bayesian analyses, (2 measured traits that are potentially important for assembling species between and within habitats, and (3 compared the degree to which each of these traits are evolutionarily conserved. Despite poor phylogenetic resolution for the order Amphipoda as a whole, we resolved almost all of the topology for the species in our system, and used a sampling of ultrametric trees from the posterior distribution to account for remaining uncertainty in topology and branch lengths. We found that traits varied widely in their degree of phylogenetic signal. Body mass, fecundity, and tube building showed very strong phylogenetic signal, and temperature tolerance and feeding traits showed much less. As such, the degree of signal was not predictable based on whether the trait is related to environmental filtering or to resource partitioning. Further, we found that even with strong phylogenetic signal in body size, (which may have large impacts on ecosystem function, the predictive relationship between phylogenetic diversity and ecosystem function is not straightforward. We show that patterns of phylogenetic diversity in communities of seagrass mesograzers could lead to a variety of interpretations and predictions, and that detailed study of trait

  13. Conservation genetics of the Philippine tarsier: cryptic genetic variation restructures conservation priorities for an island archipelago primate.

    Directory of Open Access Journals (Sweden)

    Rafe M Brown

    Full Text Available Establishment of conservation priorities for primates is a particular concern in the island archipelagos of Southeast Asia, where rates of habitat destruction are among the highest in the world. Conservation programs require knowledge of taxonomic diversity to ensure success. The Philippine tarsier is a flagship species that promotes environmental awareness and a thriving ecotourism economy in the Philippines. However, assessment of its conservation status has been impeded by taxonomic uncertainty, a paucity of field studies, and a lack of vouchered specimens and genetic samples available for study in biodiversity repositories. Consequently, conservation priorities are unclear. In this study we use mitochondrial and nuclear DNA to empirically infer geographic partitioning of genetic variation and to identify evolutionarily distinct lineages for conservation action. The distribution of Philippine tarsier genetic diversity is neither congruent with expectations based on biogeographical patterns documented in other Philippine vertebrates, nor does it agree with the most recent Philippine tarsier taxonomic arrangement. We identify three principal evolutionary lineages that do not correspond to the currently recognized subspecies, highlight the discovery of a novel cryptic and range-restricted subcenter of genetic variation in an unanticipated part of the archipelago, and identify additional geographically structured genetic variation that should be the focus of future studies and conservation action. Conservation of this flagship species necessitates establishment of protected areas and targeted conservation programs within the range of each genetically distinct variant of the Philippine tarsier.

  14. Expression and genomic analysis of midasin, a novel and highly conserved AAA protein distantly related to dynein

    Directory of Open Access Journals (Sweden)

    Gibbons I R

    2002-07-01

    Full Text Available Abstract Background The largest open reading frame in the Saccharomyces genome encodes midasin (MDN1p, YLR106p, an AAA ATPase of 560 kDa that is essential for cell viability. Orthologs of midasin have been identified in the genome projects for Drosophila, Arabidopsis, and Schizosaccharomyces pombe. Results Midasin is present as a single-copy gene encoding a well-conserved protein of ~600 kDa in all eukaryotes for which data are available. In humans, the gene maps to 6q15 and encodes a predicted protein of 5596 residues (632 kDa. Sequence alignments of midasin from humans, yeast, Giardia and Encephalitozoon indicate that its domain structure comprises an N-terminal domain (35 kDa, followed by an AAA domain containing six tandem AAA protomers (~30 kDa each, a linker domain (260 kDa, an acidic domain (~70 kDa containing 35–40% aspartate and glutamate, and a carboxy-terminal M-domain (30 kDa that possesses MIDAS sequence motifs and is homologous to the I-domain of integrins. Expression of hemagglutamin-tagged midasin in yeast demonstrates a polypeptide of the anticipated size that is localized principally in the nucleus. Conclusions The highly conserved structure of midasin in eukaryotes, taken in conjunction with its nuclear localization in yeast, suggests that midasin may function as a nuclear chaperone and be involved in the assembly/disassembly of macromolecular complexes in the nucleus. The AAA domain of midasin is evolutionarily related to that of dynein, but it appears to lack a microtubule-binding site.

  15. Diversity of toxic components from the venom of the evolutionarily distinct black whip snake, Demansia vestigiata.

    Science.gov (United States)

    St Pierre, Liam; Birrell, Geoff W; Earl, Stephen T; Wallis, Tristan P; Gorman, Jeffrey J; de Jersey, John; Masci, Paul P; Lavin, Martin F

    2007-08-01

    Included among the more than 300 species of elapid snakes worldwide is the Australian genus Demansia, or whip snakes. Despite evidence to suggest adverse clinical outcomes from envenomation by these snakes, together with confusion on their true phylogenetic relationship to other Australian elapids, not a single toxin sequence has previously been reported from the venom of a Demansia species. We describe here a combined proteomic and transcriptomic approach characterizing the venom from the black whip snake, Demansia vestigiata. A total of 13 distinct toxin families were identified, including homologues of all of the major toxic components previously reported from the venom of other Australian elapids, such as factor X-like prothrombin activators, neurotoxins, phospholipases, cysteine rich secretory proteins, textilinin-like molecules, nerve growth factors, l-amino acid oxidases, vespryns, 5' nucleotidases, metalloproteinases, and C-type lectins as well as a novel dipeptidyl peptidase family. Phylogenetic analysis of these sequences revealed an early evolutionary split of the black whip snake from all other characterized Australian snakes, with a low degree of sequence identity between D. vestigiata and the other snakes, across all toxin families. The results of this study have important implications not only for the further characterization of venom from whip snakes, but also for our understanding of the evolutionary relationship of Australian snake species.

  16. Salt tolerance is evolutionarily labile in a diverse set of angiosperm families.

    Science.gov (United States)

    Moray, Camile; Hua, Xia; Bromham, Lindell

    2015-05-19

    Salt tolerance in plants is rare, yet it is found across a diverse set of taxonomic groups. This suggests that, although salt tolerance often involves a set of complex traits, it has evolved many times independently in different angiosperm lineages. However, the pattern of evolution of salt tolerance can vary dramatically between families. A recent phylogenetic study of the Chenopodiaceae (goosefoot family) concluded that salt tolerance has a conserved evolutionary pattern, being gained early in the evolution of the lineage then retained by most species in the family. Conversely, a phylogenetic study of the Poaceae (grass family) suggested over 70 independent gains of salt tolerance, most giving rise to only one or a few salt tolerant species. Here, we use a phylogenetic approach to explore the macroevolutionary patterns of salt tolerance in a sample of angiosperm families, in order to ask whether either of these two patterns - deep and conserved or shallow and labile - represents a common mode of salt tolerance evolution. We analyze the distribution of halophyte species across the angiosperms and identify families with more or less halophytes than expected under a random model. Then, we explore the phylogenetic distribution of halophytes in 22 families using phylogenetic comparative methods. We find that salt tolerance species have been reported from over one-third of angiosperm families, but that salt tolerant species are not distributed evenly across angiosperm families. We find that salt tolerance has been gained hundreds of times over the history of the angiosperms. In a few families, we find deep and conserved gains of salt tolerance, but in the majority of families analyzed, we find that the pattern of salt tolerant species is best explained by multiple independent gains that occur near the tips of the phylogeny and often give rise to only one or a few halophytes. Our results suggest that the pattern of many independent gains of salt tolerance near the tips

  17. Phylogenetically-Informed Priorities for Amphibian Conservation

    Science.gov (United States)

    Isaac, Nick J. B.; Redding, David W.; Meredith, Helen M.; Safi, Kamran

    2012-01-01

    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species’ threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species’ phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our ‘top 100‘ list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history. PMID:22952807

  18. Resolving interspecific relationships within evolutionarily young lineages using RNA-seq data: An example from Pedicularis section Cyathophora (Orobanchaceae).

    Science.gov (United States)

    Wang, Hong-Juan; Li, Wei-Tao; Liu, Ya-Nan; Yang, Fu-Sheng; Wang, Xiao-Quan

    2017-02-01

    Phylogenomics has shown great potential in resolving evolutionary relationships at different taxonomical levels. However, it remains controversial whether all orthologous genes under different selective pressures can be concatenated for phylogenomic reconstruction. Here we used sect. Cyathophora of Pedicularis, one of the most species-rich genera of angiosperms in the alpine and arctic regions of the Northern Hemisphere, as a model to investigate the efficiency of RNA-seq in resolving relationships of closely related congeneric species. Flower transcriptomes were sequenced for all species of sect. Cyathophora and two outgroup species. Forty-one highly conserved single-/low-copy nuclear genes and 1553 orthologous groups (OGs) were identified and concatenated into five datasets based on gene copy numbers and Ka/Ks values to reconstruct the phylogeny of section Cyathophora. We also tested how many genes minimally can resolve the interspecific relationships, and reconstructed the evolutionary history of some floral characters in sect. Cyathophora. The results showed that the five different datasets consistently resolved the interspecific relationships of sect. Cyathophora, and the interspecific relationships can be robustly reconstructed with maximal support when ⩾20 single-/low-copy nuclear genes or 25 OGs are used. Our study suggests that all OGs under different selective pressures can be concatenated for phylogenomic reconstruction, and provides a successful and efficient use of RNA-seq in reconstructing interspecific relationships of a non-model plant group with recent radiations. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Conserved regulatory modules in the Sox9 testis-specific enhancer predict roles for SOX, TCF/LEF, Forkhead, DMRT, and GATA proteins in vertebrate sex determination.

    Science.gov (United States)

    Bagheri-Fam, Stefan; Sinclair, Andrew H; Koopman, Peter; Harley, Vincent R

    2010-03-01

    While the primary sex determining switch varies between vertebrate species, a key downstream event in testicular development, namely the male-specific up-regulation of Sox9, is conserved. To date, only two sex determining switch genes have been identified, Sry in mammals and the Dmrt1-related gene Dmy (Dmrt1bY) in the medaka fish Oryzias latipes. In mice, Sox9 expression is evidently up-regulated by SRY and maintained by SOX9 both of which directly activate the core 1.3 kb testis-specific enhancer of Sox9 (TESCO). How Sox9 expression is up-regulated and maintained in species without Sry (i.e. non-mammalian species) is not understood. In this study, we have undertaken an in-depth comparative genomics approach and show that TESCO contains an evolutionarily conserved region (ECR) of 180 bp which is present in marsupials, monotremes, birds, reptiles and amphibians. The ECR contains highly conserved modules that predict regulatory roles for SOX, TCF/LEF, Forkhead, DMRT, and GATA proteins in vertebrate sex determination/differentiation. Our data suggest that tetrapods share common aspects of Sox9 regulation in the testis, despite having different sex determining switch mechanisms. They also suggest that Sox9 autoregulation is an ancient mechanism shared by all tetrapods, raising the possibility that in mammals, SRY evolved by mimicking this regulation. The validation of ECR regulatory sequences conserved from human to frogs will provide new insights into vertebrate sex determination. Copyright 2009 Elsevier Ltd. All rights reserved.

  20. Complete genome sequence of the mitochondrial DNA of the river lamprey, Lethenteron japonicum.

    Science.gov (United States)

    Kawai, Yuri L; Yura, Kei; Shindo, Miyuki; Kusakabe, Rie; Hayashi, Keiko; Hata, Kenichiro; Nakabayashi, Kazuhiko; Okamura, Kohji

    2015-01-01

    Lampreys are eel-like jawless fishes evolutionarily positioned between invertebrates and vertebrates, and have been used as model organisms to explore vertebrate evolution. In this study we determined the complete genome sequence of the mitochondrial DNA of the Japanese river lamprey, Lethenteron japonicum, using next-generation sequencers. The sequence was 16,272 bp in length. The gene content and order were identical to those of the sea lamprey, Petromyzon marinus, which has been the reference among lamprey species. However, the sequence similarity was less than 90%, suggesting the need for the whole-genome sequencing of L. japonicum.

  1. Snake alpha-neurotoxin binding site on the Egyptian cobra (Naja haje) nicotinic acetylcholine receptor Is conserved.

    Science.gov (United States)

    Takacs, Z; Wilhelmsen, K C; Sorota, S

    2001-09-01

    Evolutionary success requires that animal venoms are targeted against phylogenetically conserved molecular structures of fundamental physiological processes. Species producing venoms must be resistant to their action. Venoms of Elapidae snakes (e.g., cobras, kraits) contain alpha-neurotoxins, represented by alpha-bungarotoxin (alpha-BTX) targeted against the nicotinic acetylcholine receptor (nAChR) of the neuromuscular junction. The model which presumes that cobras (Naja spp., Elapidae) have lost their binding site for conspecific alpha-neurotoxins because of the unique amino acid substitutions in their nAChR polypeptide backbone per se is incompatible with the evolutionary theory that (1) the molecular motifs forming the alpha-neurotoxin target site on the nAChR are fundamental for receptor structure and/or function, and (2) the alpha-neurotoxin target site is conserved among Chordata lineages. To test the hypothesis that the alpha-neurotoxin binding site is conserved in Elapidae snakes and to identify the mechanism of resistance against conspecific alpha-neurotoxins, we cloned the ligand binding domain of the Egyptian cobra (Naja haje) nAChR alpha subunit. When expressed as part of a functional Naja/mouse chimeric nAChR in Xenopus oocytes, this domain confers resistance against alpha-BTX but does not alter responses induced by the natural ligand acetylcholine. Further mutational analysis of the Naja/mouse nAChR demonstrated that an N-glycosylation signal in the ligand binding domain that is unique to N. haje is responsible for alpha-BTX resistance. However, when the N-glycosylation signal is eliminated, the nAChR containing the N. haje sequence is inhibited by alpha-BTX with a potency that is comparable to that in mammals. We conclude that the binding site for conspecific alpha-neurotoxin in Elapidae snakes is conserved in the nAChR ligand binding domain polypeptide backbone per se. This conclusion supports the hypothesis that animal toxins are targeted against

  2. The complete nucleotide sequence and genomic characterization of grapevine asteroid mosaic associated virus.

    Science.gov (United States)

    Vargas-Asencio, José; Wojciechowska, Klaudia; Baskerville, Maia; Gomez, Annika L; Perry, Keith L; Thompson, Jeremy R

    2017-01-02

    In analyzing grapevine clones infected with grapevine red blotch associated virus, we identified a small number of isometric particles of approximately 30nm in diameter from an enriched fraction of leaf extract. A dominant protein of 25kDa was isolated from this fraction using SDS-PAGE and was identified by mass spectrometry as belonging to grapevine asteroid mosaic associated virus (GAMaV). Using a combination of three methods RNA-Seq, sRNA-Seq, and Sanger sequencing of RT- and RACE-PCR products, we obtained a full-length genome sequence consisting of 6719 nucleotides without the poly(A) tail. The virus possesses all of the typical conserved functional domains concordant with the genus Marafivirus and lies evolutionarily between citrus sudden death associated virus and oat blue dwarf virus. A large shift in RNA-Seq coverage coincided with the predicted location of the subgenomic RNA involved in coat protein (CP) expression. Genus wide sequence alignments confirmed the cleavage motif LxG(G/A) to be dominant between the helicase and RNA dependent RNA polymerase (RdRp), and the RdRp and CP domains. A putative overlapping protein (OP) ORF lacking a canonical translational start codon was identified with a reading frame context more consistent with the putative OPs of tymoviruses and fig fleck associated virus than with those of marafiviruses. BLAST analysis of the predicted GAMaV OP showed a unique relatedness to the OPs of members of the genus Tymovirus. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Sequence coevolution between RNA and protein characterized by mutual information between residue triplets.

    Directory of Open Access Journals (Sweden)

    Relly Brandman

    Full Text Available Coevolving residues in a multiple sequence alignment provide evolutionary clues of biophysical interactions in 3D structure. Despite a rich literature describing amino acid coevolution within or between proteins and nucleic acid coevolution within RNA, to date there has been no direct evidence of coevolution between protein and RNA. The ribosome, a structurally conserved macromolecular machine composed of over 50 interacting protein and RNA chains, provides a natural example of RNA/protein interactions that likely coevolved. We provide the first direct evidence of RNA/protein coevolution by characterizing the mutual information in residue triplets from a multiple sequence alignment of ribosomal protein L22 and neighboring 23S RNA. We define residue triplets as three positions in the multiple sequence alignment, where one position is from the 23S RNA and two positions are from the L22 protein. We show that residue triplets with high mutual information are more likely than residue doublets to be proximal in 3D space. Some high mutual information residue triplets cluster in a connected series across the L22 protein structure, similar to patterns seen in protein coevolution. We also describe RNA nucleotides for which switching from one nucleotide to another (or between purines and pyrimidines results in a change in amino acid distribution for proximal amino acid positions. Multiple crystal structures for evolutionarily distinct ribosome species can provide structural evidence for these differences. For one residue triplet, a pyrimidine in one species is a purine in another, and RNA/protein hydrogen bonds are present in one species but not the other. The results provide the first direct evidence of RNA/protein coevolution by using higher order mutual information, suggesting that biophysical constraints on interacting RNA and protein chains are indeed a driving force in their evolution.

  4. Sequencing Needs for Viral Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Lam, M; Mulakken, N J; Torres, C L; Smith, J R; Slezak, T

    2004-01-26

    We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''near neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.

  5. The therapeutic potential of LNA-modified siRNAs: reduction of off-target effects by chemical modification of the siRNA sequence

    NARCIS (Netherlands)

    Fluiter, Kees; Mook, Olaf R. F.; Baas, Frank

    2009-01-01

    Post-transcriptional gene silencing mediated by double-stranded RNA represents an evolutionarily conserved cellular mechanism. Small dsRNAs, such as microRNAs (miRNAs), are part of the main regulatory mechanisms of gene expression in cells. The possibilities of harnessing this intrinsic natural

  6. Identification and mapping of conserved ortholog set(COS) II sequences of cacao and their conversion to SNP markers for marker-assisted selection in Theobroma cocoa and comparative genomics studies

    Science.gov (United States)

    Theobroma cacao is a tree cultivated in the tropics around the world for its seeds that are the source of both chocolate and cocoa butter. The cacao genome sequencing project initiated as a collaboration between USDA, Mars, Inc. and IBM has generated a great deal of transcriptome and genome sequenc...

  7. Investigating an Evolutionarily Conserved Role for the Tousled-like Kinase in Genome Stability and as a Novel Target for the Treatment of Ovarian Cancer

    Science.gov (United States)

    2013-10-01

    such that the transgenes may be partially targeted by tlk-1-500(RNAi). To circumvent these problems we are exploring the use of Crispr / Cas9 genetic...119 rescued animals . Hence, we   2 switched to biolistic transformation, a method that results in low-copy single integration events and we have...immunostaining with a GFP-specific antibody. For the lines listed in Table 1, GFP was visible in live animals at the 3-fold stage of embryogenesis (just

  8. Characterization of a functionally important and evolutionarily well-conserved epitope mapped to the short consensus repeats of E-selectin and L-selectin.

    Science.gov (United States)

    Jutila, M A; Watts, G; Walcheck, B; Kansas, G S

    1992-06-01

    Selectins represent a new family of adhesion molecules, expressed by leukocytes and endothelial cells, that are involved in the regulation of leukocyte traffic. Here we have characterized a new monoclonal antibody (mAb) (EL-246) that recognizes both human leukocyte L-selectin (previously called LAM-1, LECAM-1, or gp90MEL-14) and endothelial cell E-selectin (previously called ELAM-1). EL-246 recognized a 110-kD protein expressed on cells transfected with E-selectin cDNA and stained many postcapillary venules in inflamed human tonsil. EL-246 also stained human peripheral blood leukocytes and showed identity with anti-L-selectin mAb in two-color flow cytometric analysis. The expression of the leukocyte EL-246 antigen was regulated in the same manner as L-selectin and EL-246 recognized anti-L-selectin mAb affinity-purified antigen in SDS/PAGE Western blot analysis. Further, L-selectin cDNA transfectants were specifically stained by EL-246. EL-246 blocked greater than 95% of lymphocyte adhesion to peripheral lymph node high endothelial venules and greater than 90% of neutrophil adhesion to E-selectin transfectants. In addition to the EL-246 epitope being expressed on two different human selectins, it was detected on L-selectin from a variety of different animals. Interestingly, domain mapping studies localized the EL-246 epitope to the short consensus repeat (SCR) domains of L-selectin. EL-246 is the first mAb that recognizes two different selectins and potentially defines a functional epitope encoded by the SCR domains. Inhibitors of selectin function targeted to this region would be expected to have the added advantage of simultaneously blocking the activity of two distinct adhesion proteins involved in inflammation.

  9. The evolutionarily conserved protein PHOTOSYNTHESIS AFFECTED MUTANT71 is required for efficient manganese uptake at the thylakoid membrane in Arabidopsis

    DEFF Research Database (Denmark)

    Schneider, Anja; Steinberger, Iris; Herdean, Andrei

    2016-01-01

    In plants, algae, and cyanobacteria, photosystem II (PSII) catalyzes the light-driven oxidation of water. The oxygen-evolving complex of PSII is a Mn4CaO5 cluster embedded in a well-defined protein environment in the thylakoid membrane. However, transport of manganese and calcium into the thylakoid...

  10. Evolutionarily conserved IMPACT impairs various stress responses that require GCN1 for activating the eIF2 kinase GCN2

    Energy Technology Data Exchange (ETDEWEB)

    Cambiaghi, Tavane D.; Pereira, Catia M. [Department of Microbiology, Immunology and Parasitology, Escola Paulista de Medicina, Universidade Federal de São Paulo (Brazil); Shanmugam, Renuka; Bolech, Michael [Institute of Natural and Mathematical Sciences, Massey University (New Zealand); Wek, Ronald C. [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine (United States); Sattlegger, Evelyn [Institute of Natural and Mathematical Sciences, Massey University (New Zealand); Castilho, Beatriz A., E-mail: bacastilho@unifesp.br [Department of Microbiology, Immunology and Parasitology, Escola Paulista de Medicina, Universidade Federal de São Paulo (Brazil)

    2014-01-10

    Highlights: •GCN1 is required for mammalian and yeast GCN2 function in a variety of conditions. •Mammalian IMPACT competes with GCN2 for GCN1 binding. •IMPACT and its yeast counterpart YIH1 downregulate GCN1-dependent GCN2 activation. -- Abstract: In response to a range of environmental stresses, phosphorylation of the alpha subunit of the translation initiation factor 2 (eIF2α) represses general protein synthesis coincident with increased translation of specific mRNAs, such as those encoding the transcription activators GCN4 and ATF4. The eIF2α kinase GCN2 is activated by amino acid starvation by a mechanism involving GCN2 binding to an activator protein GCN1, along with association with uncharged tRNA that accumulates during nutrient deprivation. We previously showed that mammalian IMPACT and its yeast ortholog YIH1 bind to GCN1, thereby preventing GCN1 association with GCN2 and stimulation of this eIF2α kinase during amino acid depletion. GCN2 activity is also enhanced by other stresses, including proteasome inhibition, UV irradiation and lack of glucose. Here, we provide evidence that IMPACT affects directly and specifically the activation of GCN2 under these stress conditions in mammalian cells. We show that activation of mammalian GCN2 requires its interaction with GCN1 and that IMPACT promotes the dissolution of the GCN2–GCN1 complex. To a similar extent as the overexpression of YIH1, overexpression of IMPACT in yeast cells inhibited growth under all stress conditions that require GCN2 and GCN1 for cell survival, including exposure to acetic acid, high levels of NaCl, H{sub 2}O{sub 2} or benomyl. This study extends our understanding of the roles played by GCN1 in GCN2 activation induced by a variety of stress arrangements and suggests that IMPACT and YIH1 use similar mechanisms for regulating this eIF2α kinase.

  11. Structural, biochemical, and phylogenetic analyses suggest that indole-3-acetic acid methyltransferase is an evolutionarily ancient member of the SABATH family.

    Science.gov (United States)

    Zhao, Nan; Ferrer, Jean-Luc; Ross, Jeannine; Guan, Ju; Yang, Yue; Pichersky, Eran; Noel, Joseph P; Chen, Feng

    2008-02-01

    The plant SABATH protein family encompasses a group of related small-molecule methyltransferases (MTs) that catalyze the S-adenosyl-L-methionine-dependent methylation of natural chemicals encompassing widely divergent structures. Indole-3-acetic acid (IAA) methyltransferase (IAMT) is a member of the SABATH family that modulates IAA homeostasis in plant tissues through methylation of IAA's free carboxyl group. The crystal structure of Arabidopsis (Arabidopsis thaliana) IAMT (AtIAMT1) was determined and refined to 2.75 A resolution. The overall tertiary and quaternary structures closely resemble the two-domain bilobed monomer and the dimeric arrangement, respectively, previously observed for the related salicylic acid carboxyl methyltransferase from Clarkia breweri (CbSAMT). To further our understanding of the biological function and evolution of SABATHs, especially of IAMT, we analyzed the SABATH gene family in the rice (Oryza sativa) genome. Forty-one OsSABATH genes were identified. Expression analysis showed that more than one-half of the OsSABATH genes were transcribed in one or multiple organs. The OsSABATH gene most similar to AtIAMT1 is OsSABATH4. Escherichia coli-expressed OsSABATH4 protein displayed the highest level of catalytic activity toward IAA and was therefore named OsIAMT1. OsIAMT1 exhibited kinetic properties similar to AtIAMT1 and poplar IAMT (PtIAMT1). Structural modeling of OsIAMT1 and PtIAMT1 using the experimentally determined structure of AtIAMT1 reported here as a template revealed conserved structural features of IAMTs within the active-site cavity that are divergent from functionally distinct members of the SABATH family, such as CbSAMT. Phylogenetic analysis revealed that IAMTs from Arabidopsis, rice, and poplar (Populus spp.) form a monophyletic group. Thus, structural, biochemical, and phylogenetic evidence supports the hypothesis that IAMT is an evolutionarily ancient member of the SABATH family likely to play a critical role in IAA

  12. Clustering metagenomic sequences with interpolated Markov models

    Science.gov (United States)

    2010-01-01

    Background Sequencing of environmental DNA (often called metagenomics) has shown tremendous potential to uncover the vast number of unknown microbes that cannot be cultured and sequenced by traditional methods. Because the output from metagenomic sequencing is a large set of reads of unknown origin, clustering reads together that were sequenced from the same species is a crucial analysis step. Many effective approaches to this task rely on sequenced genomes in public databases, but these genomes are a highly biased sample that is not necessarily representative of environments interesting to many metagenomics projects. Results We present SCIMM (Sequence Clustering with Interpolated Markov Models), an unsupervised sequence clustering method. SCIMM achieves greater clustering accuracy than previous unsupervised approaches. We examine the limitations of unsupervised learning on complex datasets, and suggest a hybrid of SCIMM and supervised learning method Phymm called PHYSCIMM that performs better when evolutionarily close training genomes are available. Conclusions SCIMM and PHYSCIMM are highly accurate methods to cluster metagenomic sequences. SCIMM operates entirely unsupervised, making it ideal for environments containing mostly novel microbes. PHYSCIMM uses supervised learning to improve clustering in environments containing microbial strains from well-characterized genera. SCIMM and PHYSCIMM are available open source from http://www.cbcb.umd.edu/software/scimm. PMID:21044341

  13. Clustering metagenomic sequences with interpolated Markov models.

    Science.gov (United States)

    Kelley, David R; Salzberg, Steven L

    2010-11-02

    Sequencing of environmental DNA (often called metagenomics) has shown tremendous potential to uncover the vast number of unknown microbes that cannot be cultured and sequenced by traditional methods. Because the output from metagenomic sequencing is a large set of reads of unknown origin, clustering reads together that were sequenced from the same species is a crucial analysis step. Many effective approaches to this task rely on sequenced genomes in public databases, but these genomes are a highly biased sample that is not necessarily representative of environments interesting to many metagenomics projects. We present SCIMM (Sequence Clustering with Interpolated Markov Models), an unsupervised sequence clustering method. SCIMM achieves greater clustering accuracy than previous unsupervised approaches. We examine the limitations of unsupervised learning on complex datasets, and suggest a hybrid of SCIMM and supervised learning method Phymm called PHYSCIMM that performs better when evolutionarily close training genomes are available. SCIMM and PHYSCIMM are highly accurate methods to cluster metagenomic sequences. SCIMM operates entirely unsupervised, making it ideal for environments containing mostly novel microbes. PHYSCIMM uses supervised learning to improve clustering in environments containing microbial strains from well-characterized genera. SCIMM and PHYSCIMM are available open source from http://www.cbcb.umd.edu/software/scimm.

  14. Clustering metagenomic sequences with interpolated Markov models

    Directory of Open Access Journals (Sweden)

    Kelley David R

    2010-11-01

    Full Text Available Abstract Background Sequencing of environmental DNA (often called metagenomics has shown tremendous potential to uncover the vast number of unknown microbes that cannot be cultured and sequenced by traditional methods. Because the output from metagenomic sequencing is a large set of reads of unknown origin, clustering reads together that were sequenced from the same species is a crucial analysis step. Many effective approaches to this task rely on sequenced genomes in public databases, but these genomes are a highly biased sample that is not necessarily representative of environments interesting to many metagenomics projects. Results We present SCIMM (Sequence Clustering with Interpolated Markov Models, an unsupervised sequence clustering method. SCIMM achieves greater clustering accuracy than previous unsupervised approaches. We examine the limitations of unsupervised learning on complex datasets, and suggest a hybrid of SCIMM and supervised learning method Phymm called PHYSCIMM that performs better when evolutionarily close training genomes are available. Conclusions SCIMM and PHYSCIMM are highly accurate methods to cluster metagenomic sequences. SCIMM operates entirely unsupervised, making it ideal for environments containing mostly novel microbes. PHYSCIMM uses supervised learning to improve clustering in environments containing microbial strains from well-characterized genera. SCIMM and PHYSCIMM are available open source from http://www.cbcb.umd.edu/software/scimm.

  15. How conserved are the conserved 16S-rRNA regions?

    Directory of Open Access Journals (Sweden)

    Marcel Martinez-Porchas

    2017-02-01

    Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.

  16. H2B ubiquitination: Conserved molecular mechanism, diverse physiologic functions of the E3 ligase during meiosis.

    Science.gov (United States)

    Wang, Liying; Cao, Chunwei; Wang, Fang; Zhao, Jianguo; Li, Wei

    2017-09-03

    RNF20/Bre1 mediated H2B ubiquitination (H2Bub) has various physiologic functions. Recently, we found that H2Bub participates in meiotic recombination by promoting chromatin relaxation during meiosis. We then analyzed the phylogenetic relationships among the E3 ligase for H2Bub, its E2 Rad6 and their partner WW domain-containing adaptor with a coiled-coil (WAC) or Lge1, and found that the molecular mechanism underlying H2Bub is evolutionarily conserved from yeast to mammals. However, RNF20 has diverse physiologic functions in different organisms, which might be caused by the evolutionary divergency of their domain/motif architectures. In the current extra view, we not only elucidate the evolutionarily conserved molecular mechanism underlying H2Bub, but also discuss the diverse physiologic functions of RNF20 during meiosis.

  17. The Tetraspanin-Associated Uroplakins Family (UPK2/3 Is Evolutionarily Related to PTPRQ, a Phosphotyrosine Phosphatase Receptor.

    Directory of Open Access Journals (Sweden)

    Javier U Chicote

    Full Text Available Uroplakins are a widespread group of vertebrate integral membrane proteins that belong to two different families: UPK1a and UPK1b belong to the large tetraspanin (TSPAN gene family, and UPK3a, UPK3b, UPK3c, UPK3d, UPK2a and UPK2b form a family of their own, the UPK2/3 tetraspanin-associated family. In a previous study, we reported that uroplakins first appeared in vertebrates, and that uroplakin tetraspanins (UPK1a and UPK1b should have originated by duplication of an ancestor tetraspanin gene. However, the evolutionary origin of the UPK2/3 family remains unclear. In this study, we provide evidence that the UPK2/3 family originated by gene duplication and domain loss from a protoPTPRQ-like basal deuterostome gene. PTPRQs are members of the subtype R3 tyrosine phosphatase receptor (R3 PTPR family, which are characterized by having a unique modular composition of extracellular fibronectin (FN3 repeats, a transmembrane helix, and a single intra-cytoplasmic phosphotyrosine phophatase (PTP domain. Our assumption of a deuterostome protoPTPRQ-like gene as an ancestor of the UPK2/3 family by gene duplication and loss of its PTP and fibronectin (FN3 domains, excluding the one closest to the transmembrane helix, is based on the following: (i phylogenetic analyses, (ii the existence of an identical intron/exon gene pattern between UPK2/3 and the corresponding genetic region in R3 PTPRs, (iii the conservation of cysteine patterns and protein motifs between UPK2/3 and PTPRQ proteins and, (iv the existence in tunicates, the closest organisms to vertebrates, of two sequences related to PTPRQ; one with the full subtype R3 modular characteristic and another without the PTP domain but with a short cytoplasmic tail with some sequence similarity to that of UPK3a. This finding will facilitate further studies on the structure and function of these important proteins with implications in human diseases.

  18. Elucidation of clathrin-mediated endocytosis in tetrahymena reveals an evolutionarily convergent recruitment of dynamin.

    Directory of Open Access Journals (Sweden)

    Nels C Elde

    2005-11-01

    Full Text Available Ciliates, although single-celled organisms, contain numerous subcellular structures and pathways usually associated with metazoans. How this cell biological complexity relates to the evolution of molecular elements is unclear, because features in these cells have been defined mainly at the morphological level. Among these ciliate features are structures resembling clathrin-coated, endocytic pits associated with plasma membrane invaginations called parasomal sacs. The combination of genome-wide sequencing in Tetrahymena thermophila with tools for gene expression and replacement has allowed us to examine this pathway in detail. Here we demonstrate that parasomal sacs are sites of clathrin-dependent endocytosis and that AP-2 localizes to these sites. Unexpectedly, endocytosis in Tetrahymena also involves a protein in the dynamin family, Drp1p (Dynamin-related protein 1. While phylogenetic analysis of AP subunits indicates a primitive origin for clathrin-mediated endocytosis, similar analysis of dynamin-related proteins suggests, strikingly, that the recruitment of dynamin-family proteins to the endocytic pathway occurred independently during the course of the ciliate and metazoan radiations. Consistent with this, our functional analysis suggests that the precise roles of dynamins in endocytosis, as well as the mechanisms of targeting, differ in metazoans and ciliates.

  19. Elucidation of Clathrin-Mediated Endocytosis in Tetrahymena Reveals an Evolutionarily Convergent Recruitment of Dynamin.

    Directory of Open Access Journals (Sweden)

    2005-11-01

    Full Text Available Ciliates, although single-celled organisms, contain numerous subcellular structures and pathways usually associated with metazoans. How this cell biological complexity relates to the evolution of molecular elements is unclear, because features in these cells have been defined mainly at the morphological level. Among these ciliate features are structures resembling clathrin-coated, endocytic pits associated with plasma membrane invaginations called parasomal sacs. The combination of genome-wide sequencing in Tetrahymena thermophila with tools for gene expression and replacement has allowed us to examine this pathway in detail. Here we demonstrate that parasomal sacs are sites of clathrin-dependent endocytosis and that AP-2 localizes to these sites. Unexpectedly, endocytosis in Tetrahymena also involves a protein in the dynamin family, Drp1p (Dynamin-related protein 1. While phylogenetic analysis of AP subunits indicates a primitive origin for clathrin-mediated endocytosis, similar analysis of dynamin-related proteins suggests, strikingly, that the recruitment of dynamin-family proteins to the endocytic pathway occurred independently during the course of the ciliate and metazoan radiations. Consistent with this, our functional analysis suggests that the precise roles of dynamins in endocytosis, as well as the mechanisms of targeting, differ in metazoans and ciliates.

  20. Cartography of neurexin alternative splicing mapped by single-molecule long-read mRNA sequencing.

    Science.gov (United States)

    Treutlein, Barbara; Gokce, Ozgun; Quake, Stephen R; Südhof, Thomas C

    2014-04-01

    Neurexins are evolutionarily conserved presynaptic cell-adhesion molecules that are essential for normal synapse formation and synaptic transmission. Indirect evidence has indicated that extensive alternative splicing of neurexin mRNAs may produce hundreds if not thousands of neurexin isoforms, but no direct evidence for such diversity has been available. Here we use unbiased long-read sequencing of full-length neurexin (Nrxn)1α, Nrxn1β, Nrxn2β, Nrxn3α, and Nrxn3β mRNAs to systematically assess how many sites of alternative splicing are used in neurexins with a significant frequency, and whether alternative splicing events at these sites are independent of each other. In sequencing more than 25,000 full-length mRNAs, we identified a novel, abundantly used alternatively spliced exon of Nrxn1α and Nrxn3α (referred to as alternatively spliced sequence 6) that encodes a 9-residue insertion in the flexible hinge region between the fifth LNS (laminin-α, neurexin, sex hormone-binding globulin) domain and the third EGF-like sequence. In addition, we observed several larger-scale events of alternative splicing that deleted multiple domains and were much less frequent than the canonical six sites of alternative splicing in neurexins. All of the six canonical events of alternative splicing appear to be independent of each other, suggesting that neurexins may exhibit an even larger isoform diversity than previously envisioned and comprise thousands of variants. Our data are consistent with the notion that α-neurexins represent extracellular protein-interaction scaffolds in which different LNS and EGF domains mediate distinct interactions that affect diverse functions and are independently regulated by independent events of alternative splicing.

  1. Conservation genetics of Iberian raptors

    Directory of Open Access Journals (Sweden)

    Martinez–Cruz, B.

    2011-12-01

    Full Text Available In this paper I provide an overview of conservation genetics and describe the management actions in the wild that can benefit from conservation genetic studies. I describe the genetic factors of risk for the survival of wild species, the consequences of loss of genetic diversity, inbreeding and outbreeding depression, and the use of genetic tools to delimitate units of conservation. Then I introduce the most common applications of conservation genetics in the management of wild populations. In a second part of the paper I review the conservation genetic studies carried on the Iberian raptors. I introduce several studies on the Spanish imperial eagle, the bearded vulture, the black vulture and the red kite that were carried out using autosomal microsatellite markers and mitochondrial DNA (mtDNA sequencing. I describe studies on the lesser kestrel and Egyptian vulture that additionally applied major histocompatibility complex (MHC markers, with the purpose of incorporating the study of non–neutral variation. For every species I explain how these studies can be and/or are applied in the strategy of conservation in the wild.

  2. Automatic sequences

    CERN Document Server

    Haeseler, Friedrich

    2003-01-01

    Automatic sequences are sequences which are produced by a finite automaton. Although they are not random they may look as being random. They are complicated, in the sense of not being not ultimately periodic, they may look rather complicated, in the sense that it may not be easy to name the rule by which the sequence is generated, however there exists a rule which generates the sequence. The concept automatic sequences has special applications in algebra, number theory, finite automata and formal languages, combinatorics on words. The text deals with different aspects of automatic sequences, in particular:· a general introduction to automatic sequences· the basic (combinatorial) properties of automatic sequences· the algebraic approach to automatic sequences· geometric objects related to automatic sequences.

  3. Conserved intron positions in ancient protein modules

    Directory of Open Access Journals (Sweden)

    de Roos Albert DG

    2007-02-01

    Full Text Available Abstract Background The timing of the origin of introns is of crucial importance for an understanding of early genome architecture. The Exon theory of genes proposed a role for introns in the formation of multi-exon proteins by exon shuffling and predicts the presence of conserved splice sites in ancient genes. In this study, large-scale analysis of potential conserved splice sites was performed using an intron-exon database (ExInt derived from GenBank. Results A set of conserved intron positions was found by matching identical splice sites sequences from distantly-related eukaryotic kingdoms. Most amino acid sequences with conserved introns were homologous to consensus sequences of functional domains from conserved proteins including kinases, phosphatases, small GTPases, transporters and matrix proteins. These included ancient proteins that originated before the eukaryote-prokaryote split, for instance the catalytic domain of protein phosphatase 2A where a total of eleven conserved introns were found. Using an experimental setup in which the relation between a splice site and the ancientness of its surrounding sequence could be studied, it was found that the presence of an intron was positively correlated to the ancientness of its surrounding sequence. Intron phase conservation was linked to the conservation of the gene sequence and not to the splice site sequence itself. However, no apparent differences in phase distribution were found between introns in conserved versus non-conserved sequences. Conclusion The data confirm an origin of introns deep in the eukaryotic branch and is in concordance with the presence of introns in the first functional protein modules in an 'Exon theory of genes' scenario. A model is proposed in which shuffling of primordial short exonic sequences led to the formation of the first functional protein modules, in line with hypotheses that see the formation of introns integral to the origins of genome evolution

  4. Polymorphic human (CTAT)n microsatellite provides a conserved linkage marker for mouse mutants causing cleft palate, vestibular defects, obesity and ataxia

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, A.J.; Burgess, D.L.; Kohrman, D. [Univ. of MIchigan, Ann Arbor, MI (United States)] [and others

    1994-09-01

    The Twirler mutation (Tw) causing cleft palate {plus_minus} cleft lip, vestibular defects and obesity is located within 0.5 cM of an ataxia locus (ax) on mouse chromosome 18. We identified a transgene-induced insertional mutation with vestibular and craniofacial defects that appears to be a new allele of Twirler. Mouse DNA flanking the transgene insertion site was isolated from a cosmid library. An evolutionarily conserved, zoo blot positive cosmid subclone was used to probe a human {lambda} genomic library. From the sequence of a highly homologous human {lambda} clone, we designed STS primers and screened a human P1 library. DNA from two positive P1 clones was hybridized with simple sequence probes, and a (CTAT){sub 12} repeat was detected. Analysis of 62 CEPH parents with primers flanking the repeat identified six alleles containing 9 to 14 copies of the repeat, at frequencies of 0.17, 0.17, 0.17, 0.27, 0.15 and 0.07, respectively. The observed heterozygosity was 49/62 with a calculated PIC value of 0.76. This polymorphic microsatellite marker, designated Umi3, was mapped to the predicted conserved human linkage group by analysis of somatic cell hybrid panels. The anticipated short distance between Umi3 and the disease genes will facilitate detection of linkage in small families. We would like to type appropriate human pedigrees with Umi3 in order to identify patients with inherited disorders homologous to the mouse mutations Twirler and ataxia.

  5. Mapping and exome sequencing identifies a mutation in the IARS gene as the cause of hereditary perinatal weak calf syndrome.

    Directory of Open Access Journals (Sweden)

    Takashi Hirano

    Full Text Available We identified an IARS (isoleucyl-tRNA synthetase c.235G>C (p.Val79Leu substitution as the causative mutation for neonatal weakness with intrauterine growth retardation (perinatal weak calf syndrome. In Japanese Black cattle, the syndrome was frequently found in calves sired by Bull A. Hence, we employed homozygosity mapping and linkage analysis. In order to identify the perinatal weak calf syndrome locus in a 4.04-Mb region of BTA 8, we analysed a paternal half-sibling family with a BovineSNP50 BeadChip and microsatellites. In this critical region, we performed exome sequencing to identify a causative mutation. Three variants were detected as possible candidates for causative mutations that were predicted to disrupt the protein function, including a G>C (p.Val79Leu mutation in IARS c.235. The IARS c.235G>C mutation was not a homozygous risk allele in the 36 healthy offspring of Bull A. Moreover, the IARS Val79 residue and its flanking regions were evolutionarily and highly conserved. The IARS mutant (Leu79 had decreased aminoacylation activity. Additionally, the homozygous mutation was not found in any of 1526 healthy cattle. Therefore, we concluded that the IARS c.235G>C mutation was the cause of hereditary perinatal weak calf syndrome.

  6. Allelic barley MLA immune receptors recognize sequence-unrelated avirulence effectors of the powdery mildew pathogen.

    Science.gov (United States)

    Lu, Xunli; Kracher, Barbara; Saur, Isabel M L; Bauer, Saskia; Ellwood, Simon R; Wise, Roger; Yaeno, Takashi; Maekawa, Takaki; Schulze-Lefert, Paul

    2016-10-18

    Disease-resistance genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLR genes define the fastest-evolving gene family of flowering plants and are often arranged in gene clusters containing multiple paralogs, contributing to copy number and allele-specific NLR variation within a host species. Barley mildew resistance locus a (Mla) has been subject to extensive functional diversification, resulting in allelic resistance specificities each recognizing a cognate, but largely unidentified, AVRa gene of the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). We applied a transcriptome-wide association study among 17 Bgh isolates containing different AVRa genes and identified AVRa1 and AVRa13, encoding candidate-secreted effectors recognized by Mla1 and Mla13 alleles, respectively. Transient expression of the effector genes in barley leaves or protoplasts was sufficient to trigger Mla1 or Mla13 allele-specific cell death, a hallmark of NLR receptor-mediated immunity. AVRa1 and AVRa13 are phylogenetically unrelated, demonstrating that certain allelic MLA receptors evolved to recognize sequence-unrelated effectors. They are ancient effectors because corresponding loci are present in wheat powdery mildew. AVRA1 recognition by barley MLA1 is retained in transgenic Arabidopsis, indicating that AVRA1 directly binds MLA1 or that its recognition involves an evolutionarily conserved host target of AVRA1 Furthermore, analysis of transcriptome-wide sequence variation among the Bgh isolates provides evidence for Bgh population structure that is partially linked to geographic isolation.

  7. Functional role of phenylacetic acid from metapleural gland secretions in controlling fungal pathogens in evolutionarily derived leaf-cutting ants

    Science.gov (United States)

    Fernández-Marín, Hermógenes; Nash, David R.; Higginbotham, Sarah; Estrada, Catalina; van Zweden, Jelle S.; d'Ettorre, Patrizia; Wcislo, William T.; Boomsma, Jacobus J.

    2015-01-01

    Fungus-farming ant colonies vary four to five orders of magnitude in size. They employ compounds from actinomycete bacteria and exocrine glands as antimicrobial agents. Atta colonies have millions of ants and are particularly relevant for understanding hygienic strategies as they have abandoned their ancestors' prime dependence on antibiotic-based biological control in favour of using metapleural gland (MG) chemical secretions. Atta MGs are unique in synthesizing large quantities of phenylacetic acid (PAA), a known but little investigated antimicrobial agent. We show that particularly the smallest workers greatly reduce germination rates of Escovopsis and Metarhizium spores after actively applying PAA to experimental infection targets in garden fragments and transferring the spores to the ants' infrabuccal cavities. In vitro assays further indicated that Escovopsis strains isolated from evolutionarily derived leaf-cutting ants are less sensitive to PAA than strains from phylogenetically more basal fungus-farming ants, consistent with the dynamics of an evolutionary arms race between virulence and control for Escovopsis, but not Metarhizium. Atta ants form larger colonies with more extreme caste differentiation relative to other attines, in societies characterized by an almost complete absence of reproductive conflicts. We hypothesize that these changes are associated with unique evolutionary innovations in chemical pest management that appear robust against selection pressure for resistance by specialized mycopathogens. PMID:25925100

  8. Identification and sequence analysis of metazoan tRNA 3'-end processing enzymes tRNase Zs.

    Directory of Open Access Journals (Sweden)

    Zhikang Wang

    Full Text Available tRNase Z is the endonuclease responsible for removing the 3'-trailer sequences from precursor tRNAs, a prerequisite for the addition of the CCA sequence. It occurs in the short (tRNase Z(S and long (tRNase Z(L forms. Here we report the identification and sequence analysis of candidate tRNase Zs from 81 metazoan species. We found that the vast majority of deuterostomes, lophotrochozoans and lower metazoans have one tRNase Z(S and one tRNase Z(L genes, whereas ecdysozoans possess only a single tRNase Z(L gene. Sequence analysis revealed that in metazoans, a single nuclear tRNase Z(L gene is likely to encode both the nuclear and mitochondrial forms of tRNA 3'-end processing enzyme through mechanisms that include alternative translation initiation from two in-frame start codons and alternative splicing. Sequence conservation analysis revealed a variant PxKxRN motif, PxPxRG, which is located in the N-terminal region of tRNase Z(Ss. We also identified a previously unappreciated motif, AxDx, present in the C-terminal region of both tRNase Z(Ss and tRNase Z(Ls. The AxDx motif consisting mainly of a very short loop is potentially close enough to form hydrogen bonds with the loop containing the PxKxRN or PxPxRG motif. Through complementation analysis, we demonstrated the likely functional importance of the AxDx motif. In conclusion, our analysis supports the notion that in metazoans a single tRNase Z(L has evolved to participate in both nuclear and mitochondrial tRNA 3'-end processing, whereas tRNase Z(S may have evolved new functions. Our analysis also unveils new evolutionarily conserved motifs in tRNase Zs, including the C-terminal AxDx motif, which may have functional significance.

  9. 7 CFR 12.23 - Conservation plans and conservation systems.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Conservation plans and conservation systems. 12.23... CONSERVATION Highly Erodible Land Conservation § 12.23 Conservation plans and conservation systems. (a) Use of field office technical guide. A conservation plan or conservation system developed for the purposes of...

  10. Is altruism evolutionarily stable ?

    NARCIS (Netherlands)

    Bester, H.; Güth, W.

    1994-01-01

    We develop an evolutionary approach to explain altruistic preferences. Given their preferences, individuals interact rationally with each other. By comparing the success of players with different preferences, we investigate whether evolution favors altruistic or selfish attitudes. The outcome

  11. Multiple sequence alignments of partially coding nucleic acid sequences

    Directory of Open Access Journals (Sweden)

    Fried Claudia

    2005-06-01

    Full Text Available Abstract Background High quality sequence alignments of RNA and DNA sequences are an important prerequisite for the comparative analysis of genomic sequence data. Nucleic acid sequences, however, exhibit a much larger sequence heterogeneity compared to their encoded protein sequences due to the redundancy of the genetic code. It is desirable, therefore, to make use of the amino acid sequence when aligning coding nucleic acid sequences. In many cases, however, only a part of the sequence of interest is translated. On the other hand, overlapping reading frames may encode multiple alternative proteins, possibly with intermittent non-coding parts. Examples are, in particular, RNA virus genomes. Results The standard scoring scheme for nucleic acid alignments can be extended to incorporate simultaneously information on translation products in one or more reading frames. Here we present a multiple alignment tool, codaln, that implements a combined nucleic acid plus amino acid scoring model for pairwise and progressive multiple alignments that allows arbitrary weighting for almost all scoring parameters. Resource requirements of codaln are comparable with those of standard tools such as ClustalW. Conclusion We demonstrate the applicability of codaln to various biologically relevant types of sequences (bacteriophage Levivirus and Vertebrate Hox clusters and show that the combination of nucleic acid and amino acid sequence information leads to improved alignments. These, in turn, increase the performance of analysis tools that depend strictly on good input alignments such as methods for detecting conserved RNA secondary structure elements.

  12. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies...... and plays an important role in processing the information generated by these methods. Here, we provide a comprehensive overview of the current publicly available sequence assembly programs. We describe the basic principles of computational assembly along with the main concerns, such as repetitive sequences...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  13. Applying molecular genetic tools to tiger conservation.

    Science.gov (United States)

    Luo, Shu-Jin; Johnson, Warren E; O'Brien, Stephen J

    2010-12-01

    The utility of molecular genetic approaches in conservation of endangered taxa is now commonly recognized. Over the past decade, conservation genetic analyses based on mitochondrial DNA sequencing and microsatellite genotyping have provided powerful tools to resolve taxonomy uncertainty of tiger subspecies, to define conservation units, to reconstruct phylogeography and demographic history, to examine the genetic ancestry of extinct subspecies, to assess population genetic status non-invasively, and to verify genetic background of captive tigers worldwide. The genetic status of tiger subspecies and populations and implications for developing strategies for the survival of this charismatic species both in situ and ex situ are discussed. © 2010 ISZS, Blackwell Publishing and IOZ/CAS.

  14. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...... on transcriptional evidence. Analysis of repetitive sequences suggests that they are underrepresented in the reference assembly, reflecting an enrichment of gene-rich regions in the current assembly. Characterization of Lotus natural variation by resequencing of L. japonicus accessions and diploid Lotus species...... is currently ongoing, facilitated by the MG20 reference sequence...

  15. Conservation implications of anthropogenic impacts on visual communication and camouflage.

    Science.gov (United States)

    Delhey, Kaspar; Peters, Anne

    2017-02-01

    Anthropogenic environmental impacts can disrupt the sensory environment of animals and affect important processes from mate choice to predator avoidance. Currently, these effects are best understood for auditory and chemosensory modalities, and recent reviews highlight their importance for conservation. We examined how anthropogenic changes to the visual environment (ambient light, transmission, and backgrounds) affect visual communication and camouflage and considered the implications of these effects for conservation. Human changes to the visual environment can increase predation risk by affecting camouflage effectiveness, lead to maladaptive patterns of mate choice, and disrupt mutualistic interactions between pollinators and plants. Implications for conservation are particularly evident for disrupted camouflage due to its tight links with survival. The conservation importance of impaired visual communication is less documented. The effects of anthropogenic changes on visual communication and camouflage may be severe when they affect critical processes such as pollination or species recognition. However, when impaired mate choice does not lead to hybridization, the conservation consequences are less clear. We suggest that the demographic effects of human impacts on visual communication and camouflage will be particularly strong when human-induced modifications to the visual environment are evolutionarily novel (i.e., very different from natural variation); affected species and po