WorldWideScience

Sample records for event-specific prevention addressing

  1. DDT and Malaria Prevention: Addressing the Paradox

    Science.gov (United States)

    Bouwman, Hindrik; van den Berg, Henk; Kylin, Henrik

    2011-01-01

    Background The debate regarding dichlorodiphenyltrichloroethane (DDT) in malaria prevention and human health is polarized and can be classified into three positions: anti-DDT, centrist-DDT, pro-DDT. Objective We attempted to arrive at a synthesis by matching a series of questions on the use of DDT for indoor residual spraying (IRS) with literature and insights, and to identify options and opportunities. Discussion Overall, community health is significantly improved through all available malaria control measures, which include IRS with DDT. Is DDT “good”? Yes, because it has saved many lives. Is DDT safe as used in IRS? Recent publications have increasingly raised concerns about the health implications of DDT. Therefore, an unqualified statement that DDT used in IRS is safe is untenable. Are inhabitants and applicators exposed? Yes, and to high levels. Should DDT be used? The fact that DDT is “good” because it saves lives, and “not safe” because it has health and environmental consequences, raises ethical issues. The evidence of adverse human health effects due to DDT is mounting. However, under certain circumstances, malaria control using DDT cannot yet be halted. Therefore, the continued use of DDT poses a paradox recognized by a centrist-DDT position. At the very least, it is now time to invoke precaution. Precautionary actions could include use and exposure reduction. Conclusions There are situations where DDT will provide the best achievable health benefit, but maintaining that DDT is safe ignores the cumulative indications of many studies. In such situations, addressing the paradox from a centrist-DDT position and invoking precaution will help design choices for healthier lives. PMID:21245017

  2. DDT and Malaria Prevention: Addressing the Paradox

    NARCIS (Netherlands)

    Bouwman, H.; Berg, van den H.; Kylin, H.

    2011-01-01

    Background: The debate regarding dichlorodiphenyltrichloroethane (DDT) in malaria prevention and human health is polarized and can be classified into three positions: anti-DDT, centrist-DDT, pro-DDT. Objective: We attempted to arrive at a synthesis by matching a series of questions on the use of DDT

  3. Interventions addressing general parenting to prevent or treat childhood obesity.

    Science.gov (United States)

    Gerards, Sanne M P L; Sleddens, Ester F C; Dagnelie, Pieter C; de Vries, Nanne K; Kremers, Stef P J

    2011-06-01

    Observational studies increasingly emphasize the impact of general parenting on the development of childhood overweight and obesity. The aim of the current literature review was to provide an overview of interventions addressing general parenting in order to prevent or treat childhood obesity. Electronic literature databases were systematically searched for relevant studies. Seven studies were eligible for inclusion. The studies described four different general parenting programs, which were supplemented with lifestyle components (i.e., physical activity and nutrition). All studies showed significant small to moderate intervention effects on at least one weight-related outcome measure. The current review shows that despite the emerging observational evidence for the role of parenting in children's weight-related outcomes, few interventions have been developed that address general parenting in the prevention of childhood obesity. These interventions provide evidence that the promotion of authoritative parenting is an effective strategy for the prevention and management of childhood obesity.

  4. Anticipating and addressing event-specific alcohol consumption among adolescents

    Directory of Open Access Journals (Sweden)

    Simone Pettigrew

    2016-07-01

    Full Text Available Abstract Background Various specific events and celebrations are associated with excessive alcohol consumption and related harms. End-of-school celebrations such as Schoolies in Australia are of particular concern given high levels of documented harm among underage and young drinkers. The present study investigated high school students’ expectations of their Schoolies celebrations to inform future interventions to reduce adverse outcomes among members of this vulnerable group and other young people involved in similar rites of passage. Methods A link to an online survey was distributed via high schools and Schoolies-related websites. The survey included qualitative questions that invited respondents to discuss (i aspects of Schoolies they were looking forward to most and least and (ii their perceptions of the likely consequences if they refrained from consuming alcohol during the event. In total, 435 students provided responses. Results Respondents discussed the role of Schoolies in marking their transition to adulthood. Their comments revealed a cross-temporal focus indicating that Schoolies is simultaneously symbolic of the past, present, and future. Through its ability to enhance social interaction, alcohol was perceived to have a vital role in realising the potential of this event to signify and facilitate this temporal progression. Conclusions Results suggest interventions that treat Schoolies as an isolated event that occurs in specific locations may fail to appreciate the extent to which these events transcend time for those involved. Instead, harm reduction is likely to involve a reconceptualisation of the event among both participants and authority figures to facilitate the provision of alternative pastimes to drinking during Schoolies that yield similar social benefits.

  5. Anticipating and addressing event-specific alcohol consumption among adolescents.

    Science.gov (United States)

    Pettigrew, Simone; Biagioni, Nicole; Jongenelis, Michelle I

    2016-07-29

    Various specific events and celebrations are associated with excessive alcohol consumption and related harms. End-of-school celebrations such as Schoolies in Australia are of particular concern given high levels of documented harm among underage and young drinkers. The present study investigated high school students' expectations of their Schoolies celebrations to inform future interventions to reduce adverse outcomes among members of this vulnerable group and other young people involved in similar rites of passage. A link to an online survey was distributed via high schools and Schoolies-related websites. The survey included qualitative questions that invited respondents to discuss (i) aspects of Schoolies they were looking forward to most and least and (ii) their perceptions of the likely consequences if they refrained from consuming alcohol during the event. In total, 435 students provided responses. Respondents discussed the role of Schoolies in marking their transition to adulthood. Their comments revealed a cross-temporal focus indicating that Schoolies is simultaneously symbolic of the past, present, and future. Through its ability to enhance social interaction, alcohol was perceived to have a vital role in realising the potential of this event to signify and facilitate this temporal progression. Results suggest interventions that treat Schoolies as an isolated event that occurs in specific locations may fail to appreciate the extent to which these events transcend time for those involved. Instead, harm reduction is likely to involve a reconceptualisation of the event among both participants and authority figures to facilitate the provision of alternative pastimes to drinking during Schoolies that yield similar social benefits.

  6. Preventing Lone Wolf Terrorism: some CT Approaches Addressed

    Directory of Open Access Journals (Sweden)

    Edwin Bakker

    2011-12-01

    Full Text Available After a brief discussion of the epistemological and phenomenological difficulties associated with the concept of lone wolf terrorism, a number of possible counter-terrorist approaches are discussed. Lone operator terrorist acts should be considered ‘black swan’ occurrences that are almost impossible to categorize or systematize, let alone forecast. Thus, not the profile of the perpetrator, but the modus operandi offer clues for a better response to this particular threat. Furthermore, almost all lone operators do display a degree of commitment to, and identification with, extremist movements – providing leads for preventing new rounds of radicalization within this potential group of sympathizers or followers. With the apparent increase of Islamist lone wolf terrorism and fears for right-wing extremists wanting to follow the example of the Norwegian mass murderer A.B. Breivik, new questions need to be posed, addressing the role of virtual communities with which lone operators identify themselves. 

  7. Imperative of preventive measures addressing the life-cycle.

    Science.gov (United States)

    Yajnik, Chittaranjan S

    2009-01-01

    The epidemiological characteristics of chronic non-communicable diseases (NCD) are fast changing. The prevalence has risen to unprecedented levels, and the young and the underprivileged are increasingly affected. The classic view of the etiology of NCD consists of a genetic susceptibility which is precipitated by aging and modern lifestyle. In a virtual absence of any methods to tackle genetic susceptibility, the preventive approach has so far been focused on the control of lifestyle factors in those at high risk (old, and those with positive family history and elevated risk factors). Such an approach might help high risk individuals, but is unlikely to curtail the burgeoning epidemic of obesity and diabetes. Recent research has suggested that susceptibility to NCD originates in early life through non-genetic mechanisms (fetal programming). Tackling these may offer an exciting opportunity to control the NCD epidemic by influencing the susceptibility in a more durable manner than only controlling the lifestyle factors in adult life. The imperative is to address the life cycle rather than concentrate on the end stages. Copyright (c) 2009 S. Karger AG, Basel.

  8. Addresses

    Data.gov (United States)

    Town of Chapel Hill, North Carolina — Point features representing locations of all street addresses in Orange County, NC including Chapel Hill, NC. Data maintained by Orange County, the Town of Chapel...

  9. Preventing and Addressing Challenging Behavior: Common Questions and Practical Strategies

    Science.gov (United States)

    Hemmeter, Mary Louise; Ostrosky, Michaelene M.; Corso, Robert M.

    2012-01-01

    The purpose of this article is to offer preschool teachers strategies for preventing challenging behavior and supporting the development of social skills and emotional competencies. This article is framed in a question and answer format using questions from teachers who the authors have worked with in the past. These questions and strategies are…

  10. Prevention policies addressing packaging and packaging waste: Some emerging trends.

    Science.gov (United States)

    Tencati, Antonio; Pogutz, Stefano; Moda, Beatrice; Brambilla, Matteo; Cacia, Claudia

    2016-10-01

    Packaging waste is a major issue in several countries. Representing in industrialized countries around 30-35% of municipal solid waste yearly generated, this waste stream has steadily grown over the years even if, especially in Europe, specific recycling and recovery targets have been fixed. Therefore, an increasing attention starts to be devoted to prevention measures and interventions. Filling a gap in the current literature, this explorative paper is a first attempt to map the increasingly important phenomenon of prevention policies in the packaging sector. Through a theoretical sampling, 11 countries/states (7 in and 4 outside Europe) have been selected and analyzed by gathering and studying primary and secondary data. Results show evidence of three specific trends in packaging waste prevention policies: fostering the adoption of measures directed at improving packaging design and production through an extensive use of the life cycle assessment; raising the awareness of final consumers by increasing the accountability of firms; promoting collaborative efforts along the packaging supply chains. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Scoping review of health promotion and disease prevention interventions addressed to elderly people.

    Science.gov (United States)

    Duplaga, Mariusz; Grysztar, Marcin; Rodzinka, Marcin; Kopec, Agnieszka

    2016-09-05

    The ageing of modern societies remains one of the greatest challenges for health and social systems. To respond to this challenge, we need effective strategies assuring healthy active life for elderly people. Health promotion and related activities are perceived as a key intervention, which can improve wellbeing in later life. The main aim of this study is the identification and classification of such interventions addressed to older adults and elderly. Therefore, the strategy based on the scoping review as a feasible tool for exploring this domain, summarizing research findings and identifying gaps of evidence, was applied. The scoping review relies on the analysis of previous reviews of interventions aimed at older adults (55-64 years old) and elderly persons (65 years and above) assessed for their effectiveness in the framework of a systematic review and/or meta-analysis. The search strategy was based on the identification of interventions reported as health promotion, primary disease prevention, screening or social support. In the analysis, the reviews published from January 2000 to April 2015 were included. The search strategy yielded 334 systematic reviews and/or meta-analyses addressed to target groups of interest, 182 of them assessed interventions belonging to health promotion, 219 to primary prevention, 34 to screening and 35 to social support. The studies focused on elderly (65 years and above) made up 40.4 % of all retrieved reviews and those addressing population of 55 years and above accounted for 24.0 %. Interventions focused on health maintenance and improvement in elderly and older adults represent frequently combined health promotion and disease prevention actions. Many interventions of this type are not addressed exclusively to elderly populations and/or older adults but are designed for the general population. The most common types of interventions addressed to elderly and older adults in the area of health promotion include health

  12. What evidence and support do state-level public health practitioners need to address obesity prevention.

    Science.gov (United States)

    Leeman, Jennifer; Teal, Randall; Jernigan, Jan; Reed, Jenica Huddleston; Farris, Rosanne; Ammerman, Alice

    2014-01-01

    Obesity has reached epidemic proportions. Public health practitioners are distinctly positioned to promote the environmental changes essential to addressing obesity. The Centers for Disease Control and Prevention (CDC) and other entities provide evidence and technical assistance to support this work, yet little is known about how practitioners use evidence and support as they intervene to prevent obesity. The study's purpose was to describe how practitioners and CDC project officers characterized the obesity prevention task, where practitioners accessed support and evidence, and what approaches to support and evidence they found most useful. APPROACH OR DESIGN: Mixed-methods, cross-sectional interviews, and survey. State-level public health obesity prevention programs. Public health practitioners and CDC project officers. We conducted 10 in-depth interviews with public health practitioners (n = 7) and project officers (n = 3) followed by an online survey completed by 62 practitioners (50% response rate). We applied content analysis to interview data and descriptive statistics to survey data. Practitioners characterized obesity prevention as uncertain and complex, involving interdependence among actors, multiple levels of activity, an excess of information, and a paucity of evidence. Survey findings provide further detail on the types of evidence and support practitioners used and valued. We recommend approaches to tailoring evidence and support to the needs of practitioners working on obesity prevention and other complex health problems.

  13. Lessons Learned From a Community–Academic Partnership Addressing Adolescent Pregnancy Prevention in Filipino American Families

    Science.gov (United States)

    Javier, Joyce R.; Chamberlain, Lisa J.; Rivera, Kahealani K.; Gonzalez, Sarah E.; Mendoza, Fernando S.; Huffman, Lynne C.

    2014-01-01

    Background Filipino Americans have more adolescent pregnancies than other Asian-Pacific Islanders (APIs). Few community–academic collaborations have addressed adolescent pregnancy prevention in this community. Objectives We sought to describe the lessons learned from and impact of a community-based teen pregnancy prevention program for Filipino Americans implemented by a Filipina pediatrics resident. Methods We formed a community–academic partnership between the Filipino Youth Coalition, a community-based organization (CBO) in San Jose, California, and the Stanford School of Medicine’s Pediatric Advocacy Program. We developed a culturally tailored parent–teen conference addressing adolescent pregnancy prevention in Filipino Americans. We qualitatively and quantitatively evaluated this intervention by collecting both pre- and post-conference data using a convenience sample design. Lessons Learned Engaging particular aspects of Filipino culture (i.e., religion and intergenerational differences) helped to make this community–academic partnership successful. For physicians-in-training who are conducting community-based participatory research (CBPR), project challenges may include difficulties in building and maintaining academic–community relationships, struggles to promote sustainability, and conflicting goals of “community insiders” and “academic outsiders.” Authors offer insights and implications for residents interested in practicing CBPR. Conclusion CBPR is a key tool for exploring health issues in understudied populations. CBPR experiences can provide meaningful educational opportunities for physicians-in-training and can build sustained capacity in CBOs. They can also help residents to develop analytic skills, directly affect the health of the communities they serve, and, for minority physicians, give back to the communities they call home. PMID:21169708

  14. Getting sports injury prevention on to public health agendas - addressing the shortfalls in current information sources.

    Science.gov (United States)

    Finch, Caroline F

    2012-01-01

    Public health policy is a successful population-level strategy for injury prevention but it is yet to be widely applied to the sports sector. Such policy is generally coordinated by government health departments concerned with the allocation of limited resources to health service delivery and preventive programs for addressing large community health issues. Prioritisation of sports injury prevention (SIP) requires high-quality evidence about the size of the problem and its public health burden; identification of at-risk vulnerable groups; confirmed effective prevention solutions; evidence of intervention cost-effectiveness; and quantification of both financial and policy implications of inaction. This paper argues that the major reason for a lack of sports injury policy by government departments for health or sport to date is a lack of relevant information available for policy makers to make their decisions. Key information gaps evident in Australia are used to highlight this problem. SIP policy does not yet rank highly because, relative to other health/injury issues, there is very little hard evidence to support: claims for its priority ranking, the existence of solutions that can be implemented and which will work, and potential cost-savings to government agencies. Moreover, policy action needs to be integrated across government portfolios, including sport, health and others. Until sports medicine research generates high-quality population-level information of direct relevance and importance to policy makers, especially intervention costing and implementation cost-benefit estimates, and fully engage in policy-informing partnerships, SIP will continue to be left off the public health agenda.

  15. Infusing Oral Health Care into Nursing Curriculum: Addressing Preventive Health in Aging and Disability

    Directory of Open Access Journals (Sweden)

    Joan Earle Hahn

    2012-01-01

    Full Text Available Access to oral health care is essential for promoting and maintaining overall health and well-being, yet oral health disparities exist among vulnerable and underserved populations. While nurses make up the largest portion of the health care work force, educational preparation to address oral health needs of elders and persons with disabilities is limited across nursing curricula. This descriptive study reports on the interdisciplinary development, implementation, and testing of an oral health module that was included and infused into a graduate nursing curriculum in a three-phase plan. Phase 1 includes evaluation of a lecture presented to eight gerontological nurse practitioner (GNP students. Phase 2 includes evaluation of GNP students’ perceptions of learning, skills, and confidence following a one-time 8-hour practicum infused into 80 required practicum hours. The evaluation data show promise in preparing nurse practitioner students to assess and address preventive oral health needs of persons aging with disabilities such that further infusion and inclusion in a course for nurse practitioners across five specialties will implemented and tested in Phase 3.

  16. Infusing Oral Health Care into Nursing Curriculum: Addressing Preventive Health in Aging and Disability

    Science.gov (United States)

    Hahn, Joan Earle; FitzGerald, Leah; Markham, Young Kee; Glassman, Paul; Guenther, Nancy

    2012-01-01

    Access to oral health care is essential for promoting and maintaining overall health and well-being, yet oral health disparities exist among vulnerable and underserved populations. While nurses make up the largest portion of the health care work force, educational preparation to address oral health needs of elders and persons with disabilities is limited across nursing curricula. This descriptive study reports on the interdisciplinary development, implementation, and testing of an oral health module that was included and infused into a graduate nursing curriculum in a three-phase plan. Phase 1 includes evaluation of a lecture presented to eight gerontological nurse practitioner (GNP) students. Phase 2 includes evaluation of GNP students' perceptions of learning, skills, and confidence following a one-time 8-hour practicum infused into 80 required practicum hours. The evaluation data show promise in preparing nurse practitioner students to assess and address preventive oral health needs of persons aging with disabilities such that further infusion and inclusion in a course for nurse practitioners across five specialties will implemented and tested in Phase 3. PMID:22619708

  17. The Yo me cuido® Program: Addressing Breast Cancer Screening and Prevention Among Hispanic Women.

    Science.gov (United States)

    Davis, Jenna L; Ramos, Roberto; Rivera-Colón, Venessa; Escobar, Myriam; Palencia, Jeannette; Grant, Cathy G; Green, B Lee

    2015-09-01

    Breast cancer is less likely to be diagnosed at the earliest stage in Hispanic/Latino (Hispanic) women compared to non-Hispanic White women, even after accounting for differences in age, socioeconomic status, and method of detection. Moffitt Cancer Center created a comprehensive health education program called Yo me cuido (®) (YMC) to address and reduce breast cancer disparities among Spanish- and English-speaking Hispanic women by providing breast cancer and healthy lifestyles awareness and education, and promoting breast cancer screenings, reminders, and referrals for women 40 years and older. The purpose of this paper is to showcase the innovative approaches and methods to cancer prevention and early detection of the YMC program, and to promote it as an effective tool for improving outcomes in community health education, outreach, and engagement activities with Hispanic populations. Key components of the program include educational workshops, mammogram referrals, and a multimedia campaign. The YMC program is unique because of its approaches in reaching the Hispanic population, such as delivering the program with compassionate services to empower participants to live a healthier lifestyle. Additionally, direct follow-up for mammography screenings is provided by program staff. From 2011 to 2013, YMC has educated 2,226 women and 165 men through 93 workshops. About 684 (52 %) women ages 40 and older have had a screening mammogram within their first year of participating in the program. The YMC program is an innovative cancer education and outreach program that has demonstrated a positive impact on the lives of the Hispanic community in the Tampa Bay region.

  18. Male Circumcision for HIV Prevention in South Africa: Addressing HIV and Gender Relations

    OpenAIRE

    Fischer-Nielsen, Sara; Møller, Sabrah

    2011-01-01

    The thesis scrutinizes how gender relations and women’s and men’s control of sexual health are influenced by the intervention of male circumcision for HIV prevention in South Africa. The analytical framework combines the theory of therapeutic citizenship, post-development theory and gender theory. We argue that the individual man’s choice to circumcise is being challenged by international HIV prevention methods emphasizing men’s responsibility in HIV prevention. In South Africa, current chang...

  19. Social marketing to address attitudes and behaviours related to preventable injuries in British Columbia, Canada.

    Science.gov (United States)

    Smith, Jennifer; Zheng, Xin; Lafreniere, Kevin; Pike, Ian

    2018-06-01

    Social marketing is a tool used in the domain of public health for prevention and public education. Because injury prevention is a priority public health issue in British Columbia, Canada, a 3-year consultation was undertaken to understand public attitudes towards preventable injuries and mount a province-wide social marketing campaign aimed at adults aged 25-55 years. Public response to the campaign was assessed through an online survey administered to a regionally representative sample of adults within the target age group between 1 and 4 times per year on an ongoing basis since campaign launch. A linear regression model was applied to a subset of this data (n=5186 respondents) to test the association between exposure to the Preventable campaign and scores on perceived preventability of injuries as well as conscious forethought applied to injury-related behaviours. Campaign exposure was significant in both models (preventability: β=0.27, 95% CI 0.20 to 0.35; conscious thought: β=0.24, 95% CI 0.13 to 0.35), as was parental status (preventability: β=0.12, 95% CI 0.03 to 0.21; conscious thought: β=0.18, 95% CI 0.06 to 0.30). Exposure to the more recent campaign slogan was predictive of 0.47 higher score on conscious thought (95% CI 0.27 to 0.66). This study provides some evidence that the Preventable approach is having positive effect on attitudes and behaviours related to preventable injuries in the target population. Future work will seek to compare these data to other jurisdictions as the Preventable social marketing campaign expands to other parts of Canada. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  20. Social marketing to address attitudes and behaviours related to preventable injuries in British Columbia, Canada

    Science.gov (United States)

    Smith, Jennifer; Zheng, Xin; Lafreniere, Kevin; Pike, Ian

    2018-01-01

    Background Social marketing is a tool used in the domain of public health for prevention and public education. Because injury prevention is a priority public health issue in British Columbia, Canada, a 3-year consultation was undertaken to understand public attitudes towards preventable injuries and mount a province-wide social marketing campaign aimed at adults aged 25–55 years. Methods Public response to the campaign was assessed through an online survey administered to a regionally representative sample of adults within the target age group between 1 and 4 times per year on an ongoing basis since campaign launch. A linear regression model was applied to a subset of this data (n=5186 respondents) to test the association between exposure to the Preventable campaign and scores on perceived preventability of injuries as well as conscious forethought applied to injury-related behaviours. Results Campaign exposure was significant in both models (preventability: β=0.27, 95% CI 0.20 to 0.35; conscious thought: β=0.24, 95% CI 0.13 to 0.35), as was parental status (preventability: β=0.12, 95% CI 0.03 to 0.21; conscious thought: β=0.18, 95% CI 0.06 to 0.30). Exposure to the more recent campaign slogan was predictive of 0.47 higher score on conscious thought (95% CI 0.27 to 0.66). Discussion This study provides some evidence that the Preventable approach is having positive effect on attitudes and behaviours related to preventable injuries in the target population. Future work will seek to compare these data to other jurisdictions as the Preventable social marketing campaign expands to other parts of Canada. PMID:29549106

  1. Suicide Risk Protocols: Addressing the Needs of High Risk Youths Identified through Suicide Prevention Efforts and in Clinical Settings

    Science.gov (United States)

    Heilbron, Nicole; Goldston, David; Walrath, Christine; Rodi, Michael; McKeon, Richard

    2013-01-01

    Several agencies have emphasized the importance of establishing clear protocols or procedures to address the needs of youths who are identified as suicidal through suicide prevention programs or in emergency department settings. What constitutes optimal guidelines for developing and implementing such protocols, however, is unclear. At the request…

  2. Addressing Adolescent Substance Abuse: An Evaluation of Washington's Prevention and Intervention Services Program. 2001-03 Final Report.

    Science.gov (United States)

    Deck, Dennis D.

    2004-01-01

    To directly address the state of Washington's concerns regarding student alcohol and other drug use, in 1989 the state Legislature passed the Omnibus Alcohol and Controlled Substances Act (ESSHB 1793). One part of this act called for the creation of a school-based alcohol and other dug abuse prevention and early intervention program. The Office of…

  3. Addressing implementation challenges during guideline development - a case study of Swedish national guidelines for methods of preventing disease.

    Science.gov (United States)

    Richter-Sundberg, Linda; Kardakis, Therese; Weinehall, Lars; Garvare, Rickard; Nyström, Monica E

    2015-01-22

    Many of the world's life threatening diseases (e.g. cancer, heart disease, stroke) could be prevented by eliminating life-style habits such as tobacco use, unhealthy diet, physical inactivity and excessive alcohol use. Incorporating evidence-based research on methods to change unhealthy lifestyle habits in clinical practice would be equally valuable. However gaps between guideline development and implementation are well documented, with implications for health care quality, safety and effectiveness. The development phase of guidelines has been shown to be important both for the quality in guideline content and for the success of implementation. There are, however, indications that guidelines related to general disease prevention methods encounter specific barriers compared to guidelines that are diagnosis-specific. In 2011 the Swedish National board for Health and Welfare launched guidelines with a preventive scope. The aim of this study was to investigate how implementation challenges were addressed during the development process of these disease preventive guidelines. Seven semi-structured interviews were conducted with members of the guideline development management group. Archival data detailing the guideline development process were also collected and used in the analysis. Qualitative data were analysed using content analysis as the analytical framework. The study identified several strategies and approaches that were used to address implementation challenges during guideline development. Four themes emerged from the analysis: broad agreements and consensus about scope and purpose; a formalized and structured development procedure; systematic and active involvement of stakeholders; and openness and transparency in the specific guideline development procedure. Additional factors concerning the scope of prevention and the work environment of guideline developers were perceived to influence the possibilities to address implementation issues. This case study

  4. ADDRESSING POLLUTION PREVENTION ISSUES IN THE DESIGN OF A NEW NUCLEAR RESEARCH FACILITY

    International Nuclear Information System (INIS)

    Cournoyer, Michael E.; Corpion, Juan; Nelson, Timothy O.

    2003-01-01

    The Chemistry and Metallurgical Research (CMR) Facility was designed in 1949 and built in 1952 at Los Alamos National Laboratory (LANL) to support analytical chemistry, metallurgical studies, and actinide research and development on samples of plutonium and other nuclear materials for the Atomic Energy Commission's nuclear weapons program. These primary programmatic uses of the CMR Facility have not changed significantly since it was constructed. In 1998, a seismic fault was found to the west of the CMR Facility and projected to extend beneath two wings of the building. As part of the overall Risk Management Strategy for the CMR Facility, the Department of Energy (DOE) proposed to replace it by 2010 with what is called the CMR Facility Replacement (CMRR). In an effort to make this proposed new nuclear research facility environmentally sustainable, several pollution prevention/waste minimization initiatives are being reviewed for potential incorporation during the design phase. A two-phase approach is being adopted; the facility is being designed in a manner that integrates pollution prevention efforts, and programmatic activities are being tailored to minimize waste. Processes and procedures that reduce waste generation compared to current, prevalent processes and procedures are identified. Some of these ''best practices'' include the following: (1) recycling opportunities for spent materials; (2) replacing lithium batteries with alternate current adaptors; (3) using launderable contamination barriers in Radiological Control Areas (RCAs); (4) substituting mercury thermometers and manometers in RCAs with mercury-free devices; (5) puncturing and recycling aerosol cans; (6) using non-hazardous low-mercury fluorescent bulbs where available; (7) characterizing low-level waste as it is being generated; and (8) utilizing lead alternatives for radiological shielding. Each of these pollution prevention initiatives are being assessed for their technical validity, relevancy

  5. Addressing the Needs of Preschool Children in the Context of Disasters and Terrorism: Assessment, Prevention, and Intervention.

    Science.gov (United States)

    Wolmer, Leo; Hamiel, Daniel; Pardo-Aviv, Lee; Laor, Nathaniel

    2017-07-01

    The goal of this paper is to review the research literature regarding the needs of preschoolers in the context of disasters and terrorism with the aim of understanding the existing methods for assessment, prevention, and intervention to provide recommendations and point out required research and development. We differentiate between screening tools that provide initial evaluation and assessment tools for diagnosing preschooler children's pathology and review possible interventions that address the preschool child's needs before, during, and after the incident itself. We also emphasize the lack of dissemination and research of prevention programs and mass interventions for preschoolers. Programs for community mass prevention and intervention for preschoolers should be developed and evaluated and interventions should be adapted for individual and group delivery. Moreover, the increase in the number of children refugees requires cultural adaptations of assessment measures and interventions.

  6. Prevention and Care Programs Addressing the Growing Prevalence of Diabetes in China.

    Science.gov (United States)

    Yin, Junmei; Kong, Alice P S; Chan, Juliana C N

    2016-12-01

    According to a 2010 national survey, 11 % of adults in China have diabetes, affecting 109.6 million individuals. The high prevalence of diabetes has been attributed to the aging of the population, the rapid adoption of energy-dense foods, and a reduction in physical activity. Collectively, these secular changes have created an obesogenic environment that can unmask diabetes in subjects with a genetic predisposition. The growing prevalence of maternal obesity, gestational diabetes, childhood obesity, and early-onset disease can lead to premature morbidity and mortality. Rising to meet these public health challenges, researchers in China have conducted randomized studies to demonstrate the benefits of lifestyle modification in preventing diabetes (the Da Qing Study), as well as that of team-based integrated care, using multiple strategies including peer support and information technology, in order to reduce hospitalizations, cardiovascular-renal complications, and premature deaths. With growing evidence supporting the benefits of these diabetes prevention and management programs, the next challenge is to use policies and systems to scale up the implementation of these programs through raising awareness, building capacity, and providing resources to reduce the human and socioeconomic burden of diabetes.

  7. ABC for AIDS prevention in Guinea: migrant gold mining communities address their risks.

    Science.gov (United States)

    Kis, Adam Daniel

    2010-04-01

    Contrary to expectation when compared with other migrant mining zones of sub-Saharan Africa, the nation of Guinea has a comparatively low and stable HIV rate. In addition, the regions with the largest gold, diamond, and bauxite mining operations report the lowest HIV rates within the country. This research set out to explain practices and beliefs within gold mining communities near Siguiri, Guinea--the highest-producing gold mining zone in the country--that may contribute to this phenomenon, particularly as they relate to the Abstinence, Be faithful, use a Condom approach to AIDS prevention. Structured interviews on a randomly selected sample of 460 adults and regular visitation to 16 pharmacies and health clinics within the mining zone yielded data showing that abstinence and condom use are minimally practiced for AIDS prevention. Instead, faithfulness to partners was overwhelmingly reported as the method of choice for AIDS avoidance. In addition, this research explored ways in which local conceptions of fidelity differed from those generally understood in other contexts, including engagement in short-term marriages at the gold mining sites.

  8. Unintended benefits: the potential economic impact of addressing risk factors to prevent Alzheimer's disease.

    Science.gov (United States)

    Lin, Pei-Jung; Yang, Zhou; Fillit, Howard M; Cohen, Joshua T; Neumann, Peter J

    2014-04-01

    Certain chronic conditions appear to be modifiable risk factors of Alzheimer's disease and related dementias. To understand the potential health and economic impacts of addressing those risk factors, we used data on a Medicare cohort to simulate four scenarios: a 10 percent reduction in the prevalence of diabetes, hypertension, cardiovascular diseases, respectively, and a 10 percent reduction in body mass index among beneficiaries who were overweight or obese. Our simulation demonstrated that reducing the prevalence of these conditions may yield "unintended benefits" by lowering the risk, delaying the onset, reducing the duration, and lowering the costs of dementia. More research is needed to clarify the exact relationship between various other chronic diseases and dementia. However, our findings highlight potential health gains and savings opportunities stemming from the better management of other conditions associated with dementia.

  9. Time to address continued poor vegetable intake in Australia for prevention of chronic disease.

    Science.gov (United States)

    Chapman, Kathryn; Havill, Michelle; Watson, Wendy L; Wellard, Lyndal; Hughes, Clare; Bauman, Adrian; Allman-Farinelli, Margaret

    2016-12-01

    Australian and most international Dietary Guidelines recommend people consume more fruits and vegetables (F&V) to maintain a healthy weight and reduce chronic disease risk. Previous Australian and international surveys have shown sub-optimal consumption of F&V. This study aimed to assess adults' F&V consumption, knowledge of recommended servings, readiness to change, barriers/enabling factors, so that this knowledge might be used for campaigns that support improved consumption. An online survey of a representative sample of adults living in New South Wales, Australia (n = 2474) measuring self-reported F&V consumption; attitudes towards F&V consumption; stage of change for increasing F&V; barriers to consumption; and knowledge of cancer-health benefits. F&V consumption was below recommendations, with vegetable consumption notably low. Only 10% of participants ate at least five servings of vegetables/day (median intake was two daily servings), and 57% consumed two servings fruit/day. There was poor recognition that intake of vegetables was inadequate and this was a barrier to improving vegetable consumption; with preferences for other foods, habit and cost also important barriers. Key barriers to increasing fruit intake were habit, preferences for other foods, perishability, and cost. For vegetable consumption, 49% of participants were in the pre-contemplation stage of change, whereas for fruits 56% were in the action/maintenance stage. Sixty-four percent of respondents believed that eating F&V would protect against cancer, with 56% reporting they thought not eating enough F&V would cause cancer. Understanding what motivates and prevents people from consuming F&V is important for developing effective health promotion programs. Similar to previous surveys, there has been little shift in F&V consumption. Social marketing campaigns have been shown to improve health-related behaviours, and this study may assist in identifying audience segmentation for better targeted

  10. Prevention of parent to child transmission of HIV: Urgent need to be addressed

    Directory of Open Access Journals (Sweden)

    Dhrubajyoti J Debnath

    2013-01-01

    Full Text Available Context: An estimated 430,000 children were newly infected with HIV in 2008, over 90% of them through mother-to-child transmission (MTCT. Without intervention, the risk of MTCT ranges from 20% to 45% as per the World Health Organization (WHO. Aim: To find the uptake of Prevention of Parent to Child Transmission of HIV/AIDS (PPTCT services during pregnancy. Setting and Design: Cross-sectional study. Materials and Methods: Ethical approval and informed consent was taken. Uptake of PPTCT services by the mother was obtained in 222 pregnancies. This was compared with the HIV status of children born to them. Statistical Analysis Used: Percentages. Results: In 25.7% pregnancies, the mothers were tested for HIV. One child was born was to a mother who had tested HIV negative in pregnancy. In 50% of the mother-child pairs, both mother and child received PPTCT. Where both the mother and child received PPTCT, only 13.3% children born were HIV positive as against 40% children who were HIV positive where neither mother nor the child had received PPTCT. Conclusion: Uptake of PPTCT services was low. In countries like India where the chances of parent to child transmission of HIV are likely to be more than in developed countries due to breastfeeding practices, the uptake of PPTCT services should be maximized to decrease the burden of pediatric HIV because even a single pediatric HIV infection counts. All the pregnant women need to be voluntarily tested twice for HIV in pregnancy, in which the second test for HIV may be in late pregnancy.

  11. Developing and testing an intervention to prevent homelessness among individuals discharged from psychiatric wards to shelters and 'No Fixed Address'.

    Science.gov (United States)

    Forchuk, C; MacClure, S K; Van Beers, M; Smith, C; Csiernik, R; Hoch, J; Jensen, E

    2008-09-01

    Shelter data in a recent study revealed discharges from psychiatric facilities to shelters or the street occurred at least 194 times in 2002 in London, Ontario, Canada. This problem must be addressed to reduce the disastrous effects of such discharge, including re-hospitalization and prolonged homelessness. An intervention was developed and tested to prevent homelessness associated with discharge directly to no fixed address. A total of 14 participants at-risk of being discharged without housing were enrolled, with half randomized into the intervention group. The intervention group was provided with immediate assistance in accessing housing and assistance in paying their first and last month's rent. The control group received usual care. Data was collected from participants prior to discharge, at 31 and 6-months post-discharge. All the individuals in the intervention group maintained housing after 3 and 6 months. All but one individual in the control group remained homeless after 3 and 6 months. The exception joined the sex trade to avoid homelessness. The results of this pilot were so dramatic that randomizing to the control group was discontinued. Discussions are underway to routinely implement the intervention. Systemic improvements can prevent homelessness for individuals being discharged from psychiatric wards.

  12. Addressing female genital mutilation in Europe: a scoping review of approaches to participation, prevention, protection, and provision of services.

    Science.gov (United States)

    Baillot, Helen; Murray, Nina; Connelly, Elaine; Howard, Natasha

    2018-02-08

    Public and policy attention to female genital mutilation (FGM) in diaspora communities has increased in Europe, but research remains limited and misinformation abounds. As a first step to addressing these issues, this study explored FGM prevention and response interventions in Europe, using a scoping literature review and key informant interviews. A scoping study design was selected, using Arksey and O'Malley's six-stage scoping framework to review identified sources. Key informant interviews were used to inform and add depth to literature findings. Findings were summarised thematically, guided by the Scottish Government's '4Ps' framework for tackling violence against women (i.e. participation, prevention, protection, providing services). Seventy literature sources, of 1095 screened, plus 16 individual and 3 group interview sources were included. Several countries have developed promising interventions supporting FGM resistance and recovery. However, gaps remain including community participation, professional knowledge and linkages, and evaluation of approaches. This scoping review is an initial attempt to describe available primary evidence on European initiatives responding to FGM. Further research is required to determine whether interventions are effective, while policy and practice development must be shaped and driven by the experiences, needs, and views of affected communities.

  13. Addressing vulnerabilities of female sex workers in an HIV prevention intervention in Mumbai and Thane: experiences from the Aastha project

    Science.gov (United States)

    Ranebennur, Virupax; Gaikwad, Sanjeevsingh; Ramesh, Sowmya; Bhende, Amrita

    2014-01-01

    Background It is important for targeted interventions to consider vulnerabilities of female sex workers (FSWs) such as poverty, work-related mobility, and literacy, for effective human immunodeficiency virus (HIV) prevention. This paper describes and examines the association of the Aastha HIV/sexually transmitted infection (STI) prevention project in Mumbai and Thane, India, on the relationship between vulnerability and behavioral outcomes. Materials and methods Data were drawn from the Behavioural Tracking Survey, a cross-sectional behavioral study conducted in 2010 with 2,431 FSWs recruited in Mumbai and Thane. The key independent measures used were program exposure and “vulnerability index”, a composite index of literacy, factors of dependence (alternative livelihood options, current debt, and children), and aspects of sex work (mobility and duration in sex work). Dependent measures included service uptake, self-confidence, self-identity, and individual agency. Logistic regression analysis was used to examine the study objectives. Results Of the analytical sample of 2,431 FSWs, 1,295 (53.3%) were categorized as highly vulnerable. Highly vulnerable FSWs who were associated with the Aastha program for more than a year were more likely to have accessed crisis-response services in the past 6 months (adjusted odds ratio [AOR] 2.2, 95% confidence interval [CI] 1.4–3.6; P<0.001), to have visited a clinic to get a checkup for STI symptoms (AOR 2.4, 95% CI 1.2–4.8; P<0.015), not to be ashamed to disclose identity as an FSW to health workers (AOR 2.1, 95% CI 1.2–3.5; P<0.008), and to be confident in supporting a fellow FSW in crisis (AOR 1.7, 95% CI 1.0–2.8, P<0.033) compared to those less vulnerable with similar exposure to the Aastha program. Conclusion It is critical for HIV/STI interventions to consider vulnerabilities of FSWs at project inception and address them with focused strategies, including a segmented service-delivery model and community

  14. Weight Gain Prevention among Midlife Women: A Randomized Controlled Trial to Address Needs Related to the Physical and Social Environment

    Directory of Open Access Journals (Sweden)

    Courtney D. Perry

    2016-05-01

    Full Text Available Women tend to gain weight at midlife (40–60 years increasing risk of obesity-related chronic diseases. Within specific eating occasions, needs related to the physical and social environment may result in less healthy eating behavior, which can lead to weight gain over time. The purpose of this study was to determine if a dietitian-delivered nutrition counseling intervention tailored to eating occasion needs could improve diet and prevent weight gain among midlife women over two years. A randomized controlled trial was conducted with healthy midlife women (n = 354 in one U.S. metropolitan area. The intervention group (n = 185 received ten hours of individual nutrition counseling from dietitians over six months, while women in a control group (n = 169 received no counseling. Measured height, weight and waist circumference, and dietary intakes were collected at baseline and every six months over two years. Mixed linear models were used to test for intervention effect on change in outcome variables over time. Dietary intakes of fruit, reduced/low-fat dairy foods and refined grains were significantly improved over time in the intervention compared to control group. However, the intervention had no effect on weight over time (p = 0.48. Nutrition counseling tailored to address eating occasion needs improved self-reported diet but did not significantly affect weight change.

  15. Background Predictors and Event-Specific Characteristics of Sexual Aggression Incidents: The Roles of Alcohol and Other Factors.

    Science.gov (United States)

    Davis, Kelly Cue; Danube, Cinnamon L; Stappenbeck, Cynthia A; Norris, Jeanette; George, William H

    2015-08-01

    Sexual assault in the United States is an important public health concern. Using prospective longitudinal methods and responses from 217 community men, we examined whether background characteristics predicted subsequent sexual aggression (SA) perpetration during a 3-month follow-up period. We also examined event-specific characteristics of reported SA occurrences. Consistent with predictions, SA perpetration history, aggressive and impulsive personality traits, rape myth attitudes, and alcohol expectancies predicted SA (both non- and alcohol-involved) at follow-up. In addition, alcohol-involved assaults occurred more often with casual (vs. steady) partners but were more likely to involve condom use with casual (vs. steady) partners. Results suggest important avenues for future research and SA prevention efforts. © The Author(s) 2015.

  16. Health Belief Model and Labelling Theory in the Analysis of Preventive Behaviors to Address Biopsychosocial Impacts of Sexual Violence Among Street Children in YOGYAKARTA

    OpenAIRE

    Intan Noor Khalifah; Argyo Demartoto; Harsono Salimo

    2017-01-01

    Background: Street children are at high risk of sexual violence. Necessary measures should be undertaken to address deleterious biopsychosocial impacts of sexual violence. This study aimed to analyze the preventive behaviors to address biopsychosocial impacts of sexual violence among street children in Yogyakarta using Health Belief Model and Labelling Theory.Subjects and Method: This study was qualitative descriptive with phenomenology approach. The key informants for this study included Hea...

  17. Chopsticks Don't Make It Culturally Competent: Addressing Larger Issues for HIV Prevention among Gay, Bisexual, and Queer Asian Pacific Islander Men

    Science.gov (United States)

    Han, Chong-suk

    2009-01-01

    According to the Centers for Disease Control and Prevention, men who have sex with men account for the largest proportion of cumulative AIDS cases among Asian Pacific Islanders. Yet little is known about the factors that need to be addressed in developing culturally competent intervention strategies for members of this group. This article explores…

  18. A Social Media mHealth Solution to Address the Needs of Dengue Prevention and Management in Sri Lanka.

    Science.gov (United States)

    Lwin, May O; Vijaykumar, Santosh; Rathnayake, Vajira Sampath; Lim, Gentatsu; Panchapakesan, Chitra; Foo, Schubert; Wijayamuni, Ruwan; Wimalaratne, Prasad; Fernando, Owen Noel Newton

    2016-07-01

    Sri Lanka has witnessed a series of dengue epidemics over the past five years, with the western province, home to the political capital of Colombo, bearing more than half of the dengue burden. Existing dengue monitoring prevention programs are exhausted as public health inspectors (PHIs) cope with increasing workloads and paper-based modes of surveillance and education, characterizing a reactive system unable to cope with the enormity of the problem. On the other hand, the unprecedented proliferation and affordability of mobile phones since 2009 and a supportive political climate have thus far remained unexploited for the use of mobile-based interventions for dengue management. To conduct a needs assessment of PHIs in Colombo with respect to their dengue-related tasks and develop a new mobile-based system to address these needs while strengthening existing systems. One-on-one in-depth interviews were conducted with 29 PHIs to a) gain a nuanced, in-depth understanding of the current state of surveillance practices, b) understand the logistical, technological and social challenges they confront, and c) identify opportunities for mobile-based interventions. Quantitative analysis included simple descriptive statistics while qualitative analysis comprised textual analysis of 209 pages of transcripts (or nearly 600 minutes of conversations) using grounded theory approaches. Current paper-based data collection practices for dengue surveillance involved a circuitous, time consuming process that could take between 7-10 days to officially report and record a single case. PHIs confronted challenges in terms of unreliable, standalone GIS devices, delays in registering mosquito breeding sites and lack of engagement from communities while delivering dengue education. These findings, in concert with a high motivation to use mobile-based systems, informed the development of Mo-Buzz, a mobile-based system that integrates three components - digitized surveillance, dynamic disease

  19. Incorporating primary and secondary prevention approaches to address childhood obesity prevention and treatment in a low-income, ethnically diverse population

    Science.gov (United States)

    There is consensus that development and evaluation of a systems-oriented approach for child obesity prevention and treatment that includes both primary and secondary prevention efforts is needed. This article describes the study design and baseline data from the Texas Childhood Obesity Research Demo...

  20. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  1. Development of a Systems Science Curriculum to Engage Rural African American Teens in Understanding and Addressing Childhood Obesity Prevention

    Science.gov (United States)

    Frerichs, Leah; Lich, Kristen Hassmiller; Young, Tiffany L.; Dave, Gaurav; Stith, Doris; Corbie-Smith, Giselle

    2018-01-01

    Engaging youth from racial and ethnic minority communities as leaders for change is a potential strategy to mobilize support for addressing childhood obesity, but there are limited curricula designed to help youth understand the complex influences on obesity. Our aim was to develop and pilot test a systems science curriculum to elicit rural…

  2. Description of the Design and Implementation of a School-Based Obesity Prevention Program Addressing Needs of Middle School Students

    Science.gov (United States)

    Ward-Begnoche, Wendy L.; Gance-Cleveland, Bonnie; Harris, Margaret M.; Dean, Janice

    2008-01-01

    This article describes the design and implementation of a school-based obesity prevention program, the successes associated with its implementation, and challenges with development and application of the program's curriculum base. The program is described, including purpose and goals, content and structure of the curriculum, type and training of…

  3. The development and implementation of theory-driven programs capable of addressing poverty-impacted children's health, mental health, and prevention needs: CHAMP and CHAMP+, evidence-informed, family-based interventions to address HIV risk and care.

    Science.gov (United States)

    McKernan McKay, Mary; Alicea, Stacey; Elwyn, Laura; McClain, Zachary R B; Parker, Gary; Small, Latoya A; Mellins, Claude Ann

    2014-01-01

    This article describes a program of prevention and intervention research conducted by the CHAMP (Collaborative HIV prevention and Adolescent Mental health Project; McKay & Paikoff, 2007 ) investigative team. CHAMP refers to a set of theory-driven, evidence-informed, collaboratively designed, family-based approaches meant to address the prevention, health, and mental health needs of poverty-impacted African American and Latino urban youth who are either at risk for HIV exposure or perinatally infected and at high risk for reinfection and possible transmission. CHAMP approaches are informed by theoretical frameworks that incorporate an understanding of the critical influences of multilevel contextual factors on youth risk taking and engagement in protective health behaviors. Highly influential theories include the triadic theory of influence, social action theory, and ecological developmental perspectives. CHAMP program delivery strategies were developed via a highly collaborative process drawing upon community-based participatory research methods in order to enhance cultural and contextual sensitivity of program content and format. The development and preliminary outcomes associated with a family-based intervention for a new population, perinatally HIV-infected youth and their adult caregivers, referred to as CHAMP+, is described to illustrate the integration of theory, existing evidence, and intensive input from consumers and healthcare providers.

  4. Development and Evaluation of Event-Specific Quantitative PCR Method for Genetically Modified Soybean MON87701.

    Science.gov (United States)

    Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.

  5. Universal prevention efforts should address eating disorder pathology across the weight spectrum: Implications for screening and intervention on college campuses

    Science.gov (United States)

    Kass, Andrea E.; Jones, Megan; Kolko, Rachel P.; Altman, Myra; Fitzsimmons-Craft, Ellen E.; Eichen, Dawn M.; Balantekin, Katherine N.; Trockel, Mickey; Taylor, C. Barr; Wilfley, Denise E.

    2016-01-01

    Purpose Given shared risk and maintaining factors between eating disorders and obesity, it may be important to include both eating disorder intervention and healthy weight management within a universal eating disorder care delivery program. This study evaluated differential eating disorder screening responses by initial weight status among university students, to assess eating disorder risk and pathology among individuals with overweight/obesity versus normal weight or underweight. Methods 1529 individuals were screened and analyzed. Screening was conducted via pilot implementation of the Internet-based Healthy Body Image program on two university campuses. Results Fifteen percent of the sample had overweight/obesity. Over half (58%) of individuals with overweight/obesity screened as high risk for an eating disorder or warranting clinical referral, and 58% of individuals with overweight/obesity endorsed a ≥10-pound weight change over the past year. Compared to individuals with normal weight or underweight, individuals with overweight/obesity were more likely to identify as Black, endorse objective binge eating and fasting, endorse that eating disorder-related concerns impaired their relationships/social life and made them feel badly, and endorse higher weight/shape concerns. Conclusions Results suggest rates of eating disorder pathology and clinical impairment are highest among students with overweight/obesity, and targeted intervention across weight categories and diverse races/ethnicities is warranted within universal eating disorder intervention efforts. Integrating eating disorder intervention and healthy weight management into universal prevention programs could reduce the incidence and prevalence of eating disorders, unhealthy weight control practices, and obesity among university students. PMID:27090854

  6. Universal prevention efforts should address eating disorder pathology across the weight spectrum: Implications for screening and intervention on college campuses.

    Science.gov (United States)

    Kass, Andrea E; Jones, Megan; Kolko, Rachel P; Altman, Myra; Fitzsimmons-Craft, Ellen E; Eichen, Dawn M; Balantekin, Katherine N; Trockel, Mickey; Taylor, C Barr; Wilfley, Denise E

    2017-04-01

    Given shared risk and maintaining factors between eating disorders and obesity, it may be important to include both eating disorder intervention and healthy weight management within a universal eating disorder care delivery program. This study evaluated differential eating disorder screening responses by initial weight status among university students, to assess eating disorder risk and pathology among individuals with overweight/obesity versus normal weight or underweight. 1529 individuals were screened and analyzed. Screening was conducted via pilot implementation of the Internet-based Healthy Body Image program on two university campuses. Fifteen percent of the sample had overweight/obesity. Over half (58%) of individuals with overweight/obesity screened as high risk for an eating disorder or warranting clinical referral, and 58% of individuals with overweight/obesity endorsed a ≥10-pound weight change over the past year. Compared to individuals with normal weight or underweight, individuals with overweight/obesity were more likely to identify as Black, endorse objective binge eating and fasting, endorse that eating disorder-related concerns impaired their relationships/social life and made them feel badly, and endorse higher weight/shape concerns. Results suggest rates of eating disorder pathology and clinical impairment are highest among students with overweight/obesity, and targeted intervention across weight categories and diverse races/ethnicities is warranted within universal eating disorder intervention efforts. Integrating eating disorder intervention and healthy weight management into universal prevention programs could reduce the incidence and prevalence of eating disorders, unhealthy weight control practices, and obesity among university students. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Incorporating Primary and Secondary Prevention Approaches To Address Childhood Obesity Prevention and Treatment in a Low-Income, Ethnically Diverse Population: Study Design and Demographic Data from the Texas Childhood Obesity Research Demonstration (TX CORD) Study

    Science.gov (United States)

    Butte, Nancy F.; Barlow, Sarah; Vandewater, Elizabeth A.; Sharma, Shreela V.; Huang, Terry; Finkelstein, Eric; Pont, Stephen; Sacher, Paul; Byrd-Williams, Courtney; Oluyomi, Abiodun O.; Durand, Casey; Li, Linlin; Kelder, Steven H.

    2015-01-01

    Abstract Background: There is consensus that development and evaluation of a systems-oriented approach for child obesity prevention and treatment that includes both primary and secondary prevention efforts is needed. This article describes the study design and baseline data from the Texas Childhood Obesity Research Demonstration (TX CORD) project, which addresses child obesity among low-income, ethnically diverse overweight and obese children, ages 2–12 years; a two-tiered systems-oriented approach is hypothesized to reduce BMI z-scores, compared to primary prevention alone. Methods: Our study aims are to: (1) implement and evaluate a primary obesity prevention program; (2) implement and evaluate efficacy of a 12-month family-centered secondary obesity prevention program embedded within primary prevention; and (3) quantify the incremental cost-effectiveness of the secondary prevention program. Baseline demographic and behavioral data for the primary prevention community areas are presented. Results: Baseline data from preschool centers, elementary schools, and clinics indicate that most demographic variables are similar between intervention and comparison communities. Most families are low income (≤$25,000) and Hispanic/Latino (73.3–83.8%). The majority of parents were born outside of the United States. Child obesity rates exceed national values, ranging from 19.0% in preschool to 35.2% in fifth-grade children. Most parents report that their children consume sugary beverages, have a television in the bedroom, and do not consume adequate amounts of fruits and vegetables. Conclusions: Interventions to address childhood obesity are warranted in low-income, ethnically diverse communities. Integrating primary and secondary approaches is anticipated to provide sufficient exposure that will lead to significant decreases in childhood obesity. PMID:25555188

  8. Incorporating primary and secondary prevention approaches to address childhood obesity prevention and treatment in a low-income, ethnically diverse population: study design and demographic data from the Texas Childhood Obesity Research Demonstration (TX CORD) study.

    Science.gov (United States)

    Hoelscher, Deanna M; Butte, Nancy F; Barlow, Sarah; Vandewater, Elizabeth A; Sharma, Shreela V; Huang, Terry; Finkelstein, Eric; Pont, Stephen; Sacher, Paul; Byrd-Williams, Courtney; Oluyomi, Abiodun O; Durand, Casey; Li, Linlin; Kelder, Steven H

    2015-02-01

    There is consensus that development and evaluation of a systems-oriented approach for child obesity prevention and treatment that includes both primary and secondary prevention efforts is needed. This article describes the study design and baseline data from the Texas Childhood Obesity Research Demonstration (TX CORD) project, which addresses child obesity among low-income, ethnically diverse overweight and obese children, ages 2-12 years; a two-tiered systems-oriented approach is hypothesized to reduce BMI z-scores, compared to primary prevention alone. Our study aims are to: (1) implement and evaluate a primary obesity prevention program; (2) implement and evaluate efficacy of a 12-month family-centered secondary obesity prevention program embedded within primary prevention; and (3) quantify the incremental cost-effectiveness of the secondary prevention program. Baseline demographic and behavioral data for the primary prevention community areas are presented. Baseline data from preschool centers, elementary schools, and clinics indicate that most demographic variables are similar between intervention and comparison communities. Most families are low income (≤$25,000) and Hispanic/Latino (73.3-83.8%). The majority of parents were born outside of the United States. Child obesity rates exceed national values, ranging from 19.0% in preschool to 35.2% in fifth-grade children. Most parents report that their children consume sugary beverages, have a television in the bedroom, and do not consume adequate amounts of fruits and vegetables. Interventions to address childhood obesity are warranted in low-income, ethnically diverse communities. Integrating primary and secondary approaches is anticipated to provide sufficient exposure that will lead to significant decreases in childhood obesity.

  9. Regulatory approaches to obesity prevention: A systematic overview of current laws addressing diet-related risk factors in the European Union and the United States.

    Science.gov (United States)

    Sisnowski, Jana; Handsley, Elizabeth; Street, Jackie M

    2015-06-01

    High prevalence of overweight and obesity remains a significant international public health problem. Law has been identified as a tool for obesity prevention and selected high-profile measures have been reported. However, the nature and extent of enacted legislation internationally are unclear. This research provides an overview of regulatory approaches enacted in the United States, the European Union, and EU Member States since 2004. To this end, relevant databases of primary and secondary legislation were systematically searched to identify and explore laws addressing dietary risk factors for obesity. Across jurisdictions, current regulatory approaches to obesity prevention are limited in reach and scope. Target groups are rarely the general population, but instead sub-populations in government-supported settings. Consumer information provision is preferred over taxation and marketing restrictions other than the regulation of health and nutrition claims. In the EU in particular, product reformulation with industry consent has also emerged as a popular small-scale measure. While consistent and widespread use of law is lacking, governments have employed a range of regulatory measures in the name of obesity prevention, indicating that there is, in principle, political will. Results from this study may serve as a starting point for future research and policy development. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Concurrently examining unrealistic absolute and comparative optimism: Temporal shifts, individual-difference and event-specific correlates, and behavioural outcomes.

    Science.gov (United States)

    Ruthig, Joelle C; Gamblin, Bradlee W; Jones, Kelly; Vanderzanden, Karen; Kehn, Andre

    2017-02-01

    Researchers have spent considerable effort examining unrealistic absolute optimism and unrealistic comparative optimism, yet there is a lack of research exploring them concurrently. This longitudinal study repeatedly assessed unrealistic absolute and comparative optimism within a performance context over several months to identify the degree to which they shift as a function of proximity to performance and performance feedback, their associations with global individual difference and event-specific factors, and their link to subsequent behavioural outcomes. Results showed similar shifts in unrealistic absolute and comparative optimism based on proximity to performance and performance feedback. Moreover, increases in both types of unrealistic optimism were associated with better subsequent performance beyond the effect of prior performance. However, several differences were found between the two forms of unrealistic optimism in their associations with global individual difference factors and event-specific factors, highlighting the distinctiveness of the two constructs. © 2016 The British Psychological Society.

  11. Associations between social media displays and event-specific alcohol consumption by college students.

    Science.gov (United States)

    Moreno, Megan A; Kacvinsky, Lauren; Pumper, Megan; Wachowski, Leah; Whitehill, Jennifer M

    2013-12-01

    The Mifflin Street Block Party is a yearly Wisconsin event known for high levels of alcohol consumption and previous negative outcomes. This study investigated displayed Mifflin references on Facebook and their association with alcohol consumption at the block party. Participants included first-year college students who were enrolled in a longitudinal study involving Facebook profile assessments and interviews. We identified a subset of participants who were interviewed within 28 days following the Mifflin St Block Party. Participants were categorized as "Mifflin Displayers" or "Non-displayers" based on Facebook profile content. Interviews included the timeline follow-back method to assess alcohol use in the past 28 days. Analysis included logistic and linear regression. Among the 66 participants included in this study, 45 (68.2%) were female and 38 (50%) were Mifflin Displayers on Facebook. Among the Mifflin Displayer participants, 18 (27.2%) displayed prior to Mifflin, 11 displayed the day of Mifflin (16.7%) and 19 (28.8%) displayed after. Some participants displayed in more than 1 time frame. A total of 40 (60.6%) reported alcohol use on the day of the Mifflin Street Block Party. The mean number of drinks reported on the day of Mifflin was 8.8 (SD = 6.1), with a range of 1 to 35. Displayed references to Mifflin on Facebook were positively associated with reporting alcohol use at Mifflin (OR = 20.9, 95% CI 5.6-78.8). Displaying Facebook references to Mifflin was associated with alcohol consumption on the day of the event. Future prevention efforts could consider creating Facebook advertisements with safety messages triggered by Mifflin displays.

  12. Convocation address.

    Science.gov (United States)

    Swaminathan, M S

    1998-07-01

    This address delivered to the 40th convocation of the International Institute for Population Sciences in India in 1998 opens by noting that a shortage of jobs for youth is India's most urgent problem but that the problems that attend the increasing numbers of elderly also require serious attention. The address then notes that the Earth's population is growing at an unsustainable rate while economic inequities among countries are increasing, so that, while intellectual property is becoming the most important asset in developed countries, nutritional anemia among pregnant women causes their offspring to be unable to achieve their full intellectual potential from birth. Next, the address uses a discussion of the 18th-century work on population of the Marquis de Condorcet and of Thomas Malthus to lead into a consideration of estimated increased needs of countries like India and China to import food grains in the near future. Next, the progress of demographic transition in Indian states is covered and applied to Mahbub ul Haq's measure of human deprivation developed for and applied to the region of the South Asian Association for Regional Cooperation (India, Pakistan, Bangladesh, Nepal, Sri Lanka, Bhutan, and the Maldives). The address continues by reiterating some of the major recommendations forwarded by a government of India committee charged in 1995 with drafting a national population policy. Finally, the address suggests specific actions that could be important components of the Hunger-Free India Programme and concludes that all success rests on the successful implementation of appropriate population policies.

  13. Addressing risk factors for child abuse among high risk pregnant women: design of a randomised controlled trial of the nurse family partnership in Dutch preventive health care

    Directory of Open Access Journals (Sweden)

    Mejdoubi Jamila

    2011-10-01

    Full Text Available Abstract Background Low socio-economic status combined with other risk factors affects a person's physical and psychosocial health from childhood to adulthood. The societal impact of these problems is huge, and the consequences carry on into the next generation(s. Although several studies show these consequences, only a few actually intervene on these issues. In the United States, the Nurse Family Partnership focuses on high risk pregnant women and their children. The main goal of this program is primary prevention of child abuse. The Netherlands is the first country outside the United States allowed to translate and culturally adapt the Nurse Family Partnership into VoorZorg. The aim of the present study is to assess whether VoorZorg is as effective in the Netherland as in the United States. Methods The study consists of three partly overlapping phases. Phase 1 was the translation and cultural adaptation of Nurse Family Partnership and the design of a two-stage selection procedure. Phase 2 was a pilot study to examine the conditions for implementation. Phase 3 is the randomized controlled trial of VoorZorg compared to the care as usual. Primary outcome measures were smoking cessation during pregnancy and after birth, birth outcomes, child development, child abuse and domestic violence. The secondary outcome measure was the number of risk factors present. Discussion This study shows that the Nurse Family Partnership was successfully translated and culturally adapted into the Dutch health care system and that this program fulfills the needs of high-risk pregnant women. We hypothesize that this program will be effective in addressing risk factors that operate during pregnancy and childhood and compromise fetal and child development. Trial registration Current Controlled Trials ISRCTN16131117

  14. inaugral address

    African Journals Online (AJOL)

    While political reorientation and economic redress were of immediate concern, ... South African context, where widespread changes have been proposed for education at all ... education at school and other levels and needs to be addressed so as to ..... the major national curriculum intervention in environmental education.

  15. Attachment avoidance, alexithymia, and gender: Examining their associations with distress disclosure tendencies and event-specific disclosure.

    Science.gov (United States)

    O'Loughlin, Julia I; Cox, Daniel W; Kahn, Jeffrey H; Wu, Amery D

    2018-01-01

    Distress disclosure has been linked with reduced psychological distress, increased wellbeing, and successful psychotherapeutic outcome. Because of the importance of distress disclosure, researchers have worked to develop and improve theoretical models of disclosure to facilitate counseling practices that reduce impediments to disclosure. Presently, we conducted a 2-part study to investigate distress disclosure's associations with attachment avoidance, gender, and alexithymia-3 constructs frequently linked with disclosure. In Part 1, we examined the extent to which attachment avoidance, alexithymia, and gender predicted general disclosure tendencies. In Part 2, we examined the extent to which attachment avoidance, alexithymia, and gender predicted event-specific disclosure. Participants were recruited from a crowdsourcing website (N = 178 in Part 1; N = 108 in Part 2). In Part 1, alexithymia partially mediated the association between attachment avoidance and disclosure tendencies, and the link between attachment avoidance and alexithymia was stronger for men than women. In Part 2, the association between distress intensity and event-specific disclosure was weaker for people with high levels of alexithymia. Implications for counseling theory and practice are discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  16. Opening address

    International Nuclear Information System (INIS)

    Ianko, L.

    1993-01-01

    This short talk was the opening remarks to the attendees at this conference, presented by the Scientific Secretary, IWG-LMNPP, of the IAEA. This meeting is an effort to aid research on problems related to the general area of nuclear plant aging and life management. In particular it addresses fracture properties of reactor materials and components, both as installed, and at end of service condition. A major concern is relating measurements made on laboratory samples to properties displayed by actual reactor components

  17. Convocation address.

    Science.gov (United States)

    Zakaria, R

    1996-07-01

    By means of this graduation address at the International Institute for Population Sciences (IIPS) in Bombay, the Chancellor of Urdu University voiced his concerns about overpopulation in India. During the speaker's tenure as Health Minister of Maharashtra, he implemented a sterilization incentive program that resulted in the state's having the best family planning (FP) statistics in India for almost 10 years. The incentive program, however, was misused by overenthusiastic officials in other states, with the result that the FP program was renamed the Family Welfare Programme. Population is growing in India because of improvements in health care, but the population education necessary to change fertility will require more time than the seriousness of the population problem allows. In the longterm, poverty and illiteracy must be addressed to control population. In the meanwhile, the graduate program at the IIPS should be expanded to include an undergraduate program, marriage age laws should be enforced, and misconceptions about religious objections to FP must be addressed. India can not afford to use the measures forwarded by developed countries to control population growth. India must integrate population control efforts with the provision of health care because if population continues to grow in the face of reduced infant mortality and longer life expectancy, future generations will be forced to live in a state of poverty and economic degradation.

  18. Performance-based incentives may be appropriate to address challenges to delivery of prevention of vertical transmission of HIV services in rural Mozambique: a qualitative investigation.

    Science.gov (United States)

    Schuster, Roseanne C; de Sousa, Octávio; Rivera, Jacqueline; Olson, Rebecca; Pinault, Delphine; Young, Sera L

    2016-10-07

    Performance-based incentives (PBIs) have garnered global attention as a promising strategy to improve healthcare delivery to vulnerable populations. However, literature gaps in the context in which an intervention is implemented and how the PBIs were developed exist. Therefore, we (1) characterized the barriers and promoters to prevention of vertical transmission of HIV (PVT) service delivery in rural Mozambique, where the vertical transmission rate is 12 %, and (2) assessed the appropriateness for a PBI's intervention and application to PVT. We conducted 24 semi-structured interviews with nurses, volunteers, community health workers, and traditional birth attendants about the barriers and promoters they experienced delivering PVT services. We then explored emergent themes in subsequent focus group discussions (n = 7, total participants N = 92) and elicited participant perspectives on PBIs. The ecological motivation-opportunity-ability framework guided our iterative data collection and thematic analysis processes. The interviews revealed that while all health worker cadres were motivated intrinsically and by social recognition, they were dissatisfied with low and late remuneration. Facility-based staff were challenged by factors across the rest of the ecological levels, primarily in the opportunity domain, including the following: poor referral and record systems (work mandate), high workload, stock-outs, poor infrastructure (facility environment), and delays in obtaining patient results and donor payment discrepancies (administrative). Community-based cadres' opportunity challenges included lack of supplies, distance (work environment), lack of incorporation into the health system (administration), and ability challenges of incorrect knowledge (health worker). PBIs based on social recognition and that enable action on intrinsic motivation through training, supervision, and collaboration were thought to have the most potential for targeting improvements

  19. Keynote address

    International Nuclear Information System (INIS)

    Herzog, R.

    1985-01-01

    This paper addresses various aspects of the bases underlying the nuclear third party liability regime, and also analyses the distinction between danger and risk and the manner in which damage caused by flood, mass unemployment (economic damage mainly) and certain diseases is dealt with in the absence of liability provisions similar to those applicable to nuclear incidents. It also is suggested that the State because of its duty under the Basic Law to ensure adequate energy supplies, should be co-responsible for liability questions along with the nuclear operator. (NEA) [fr

  20. Do pre-drinkers consume more alcohol than non-pre-drinkers on an event-specific night out?

    DEFF Research Database (Denmark)

    Østergaard, Jeanette; Skov, Peter Rohde

    2014-01-01

    Introduction and Aims Young people drinking heavily before going out to bars and clubs is associated with alcohol-related harm and therefore of great public concern. This study examines whether pre-drinkers consume more alcohol than non-pre-drinkers on an event-specific night out in England...... demographics, socioeconomic status, frequency of intoxication and alcohol unit intake before and during the young people's night out. Results A mixed linear model performed on the panel mobile survey shows that pre-drinkers in England and Denmark consume 9.185 (P ..., respectively, more than the non-pre-drinkers. However, in both countries pre-drinkers consume 3.430 (P alcohol on-premises than the non-pre-drinkers. Discussion and Conclusion Pre-drinking is a widespread phenomenon in England and Denmark, with more than half of young...

  1. Keynote address

    International Nuclear Information System (INIS)

    Farlinger, W.

    1997-01-01

    In this second keynote address of the conference Mr. Farlinger, Chairman of Ontario Hydro, attempted to respond to some of the criticisms levelled at the Corporation in the course of the Macdonald Committee process. He appeared to be particularly vexed by the criticism of IPPSO, saying that in effect, they are' beating up on their only customer', at a time when Hydro is being pulled in several different directions, and was facing pressure from jurisdictional dispute with municipal utilities, (MEUs). Nevertheless, he agreed with the need for restructuring. He defended Hydro by saying that the Macdonald Report in fact represented a vindication of the position Ontario Hydro had taken, particularly on such issues as open competition, customer choice, rationalization of the distribution system, and termination of Hydro's monopoly position. At the same time, he objected to the Report's assertion that dismantling the generation system into smaller units would be in the best interest of the people of Ontario. He suggested that there would be several large US utility companies willing and able to fill the vacuum if there was no large company with its head office in Ontario to stake its claim to the provincial market

  2. Opening address

    International Nuclear Information System (INIS)

    Boening, K.

    2003-01-01

    The program of this 9th Meeting of the International Group on Research Reactors IGORR includes are quite a number of fascinating new research reactor projects in France, Germany, Russia, Canada, China, Thailand, and in Australia. In addition to the session about New Facilities there are interesting sessions on the Upgrades and on the Optimization of Operation and Utilization of existing research reactors, on Secondary Neutron Sources, on Neutron Scattering applications, and on the aspects of Safety, Licensing and Decommissioning. Two particular projects of new research reactors are mentioned specially: the TRR-II project in Taiwan, has unfortunately been terminated last year because of a change to anti-nuclear of the ruling parties in the government - and the new FRM-II in Munich, Germany, which will hopefully survive such a political change and receive its green light for nuclear start up in the very near future. The charter of IGORR and its objectives are part of this address: The International Group on Research Reactors IGORR was formed to facilitate the sharing of knowledge and experience among those institutions and individuals who are actively working to design, build, and promote new research reactors or to make significant upgrades to existing facilities. The main IGORR objectives are to promote contacts between its members, to identify and discuss problems of common interest, to distribute newsletters about once or twice every year and to organize meetings about once every one-and-a-half years

  3. Opening Address

    Science.gov (United States)

    Yamada, T.

    2014-12-01

    Ladies and Gentlemen, it is my great honor and pleasure to present an opening address of the 3rd International Workshop on "State of the Art in Nuclear Cluster Physics"(SOTANCP3). On the behalf of the organizing committee, I certainly welcome all your visits to KGU Kannai Media Center belonging to Kanto Gakuin University, and stay in Yokohama. In particular, to whom come from abroad more than 17 countries, I would appreciate your participations after long long trips from your homeland to Yokohama. The first international workshop on "State of the Art in Nuclear Cluster Physics", called SOTANCP, was held in Strasbourg, France, in 2008, and the second one was held in Brussels, Belgium, in 2010. Then the third workshop is now held in Yokohama. In this period, we had the traditional 10th cluster conference in Debrecen, Hungary, in 2012. Thus we have the traditional cluster conference and SOTANCP, one after another, every two years. This obviously shows our field of nuclear cluster physics is very active and flourishing. It is for the first time in about 10 years to hold the international workshop on nuclear cluster physics in Japan, because the last cluster conference held in Japan was in Nara in 2003, about 10 years ago. The president in Nara conference was Prof. K. Ikeda, and the chairpersons were Prof. H. Horiuchi and Prof. I. Tanihata. I think, quite a lot of persons in this room had participated at the Nara conference. Since then, about ten years passed. So, this workshop has profound significance for our Japanese colleagues. The subjects of this workshop are to discuss "the state of the art in nuclear cluster physics" and also discuss the prospect of this field. In a couple of years, we saw significant progresses of this field both in theory and in experiment, which have brought better and new understandings on the clustering aspects in stable and unstable nuclei. I think, the concept of clustering has been more important than ever. This is true also in the

  4. Keynote address

    International Nuclear Information System (INIS)

    Davis, J.M.

    1991-01-01

    DOE biomass R ampersand D programs have the potential to provide America with both plentiful, clean-burning domestic transportation fuels and cost-competitive industrial and utility fuels, benefiting energy security in the United States. Biofuels developed under our programs will also help improve air quality, reduce greenhouse gases, reduce the large daily quantities of waste we produce, and revitalize rural America. These research motivations have been documented in the National Energy Strategy. DOE looks forward to expanding its biofuels research program and to forging a partnership with private sector for cost-shared commercialization of new fuels and vehicle technologies. Many alternative fuels (e.g., ethanol, methanol, compressed natural gas, propane, or electricity) are candidates for gaining market share. Indeed, there may be significant regional variation in the future fuel mix. Alcohol fuels from biomass, particularly ethanol, have the potential to make a major contribution. Currently, ethanol in the United States is almost entirely made from corn; and the limitations of that process are well known (e.g., costly feedstock, end product requiring subsidy to be competitive, use of fossil fuels in renewable feedstock production and processing, and potential adverse impact of corn ethanol production on the price of food). To address these concerns, the DOE biofuels program is pursuing an ambitious research program to develop the technologies needed to convert these crops into alternative transportation fuels, primarily cellulose-based ethanol and methanol. Program R ampersand D has reduced the estimated cost per gallon of cellulose-based ethanol from $3.60 in 1980 to the current $1.35, with a program goal of $0.60 by the year 2000. DOE is also investigating the thermochemical conversion of biomass to methanol. The program goal is to achieve commercial production of methanol (like ethanol) at the gasoline equivalent of $0.90 per gallon by the year 2000. 4 figs

  5. Prevention

    DEFF Research Database (Denmark)

    Halken, S; Høst, A

    2001-01-01

    , breastfeeding should be encouraged for 4-6 months. In high-risk infants a documented extensively hydrolysed formula is recommended if exclusive breastfeeding is not possible for the first 4 months of life. There is no evidence for preventive dietary intervention neither during pregnancy nor lactation...... populations. These theories remain to be documented in proper, controlled and prospective studies. Breastfeeding and the late introduction of solid foods (>4 months) is associated with a reduced risk of food allergy, atopic dermatitis, and recurrent wheezing and asthma in early childhood. In all infants....... Preventive dietary restrictions after the age of 4-6 months are not scientifically documented....

  6. Welcome Address

    Science.gov (United States)

    Kiku, H.

    2014-12-01

    Ladies and Gentlemen, It is an honor for me to present my welcome address in the 3rd International Workshop on "State of the Art in Nuclear Cluster Physics"(SOTANCP3), as the president of Kanto Gakuin University. Particularly to those from abroad more than 17 countries, I am very grateful for your participation after long long trips from your home to Yokohama. On the behalf of the Kanto Gakuin University, we certainly welcome your visit to our university and stay in Yokohama. First I would like to introduce Kanto Gakuin University briefly. Kanto Gakuin University, which is called KGU, traces its roots back to the Yokohama Baptist Seminary founded in 1884 in Yamate, Yokohama. The seminary's founder was Albert Arnold Bennett, alumnus of Brown University, who came to Japan from the United States to establish a theological seminary for cultivating and training Japanese missionaries. Now KGU is a major member of the Kanto Gakuin School Corporation, which is composed of two kindergartens, two primary schools, two junior high schools, two senior high schools as well as KGU. In this university, we have eight faculties with graduate school including Humanities, Economics, Law, Sciences and Engineering, Architecture and Environmental Design, Human and Environmental Studies, Nursing, and Law School. Over eleven thousands students are currently learning in our university. By the way, my major is the geotechnical engineering, and I belong to the faculty of Sciences and Engineering in my university. Prof. T. Yamada, here, is my colleague in the same faculty. I know that the nuclear physics is one of the most active academic fields in the world. In fact, about half of the participants, namely, more than 50 scientists, come from abroad in this conference. Moreover, I know that the nuclear physics is related to not only the other fundamental physics such as the elementary particle physics and astrophysics but also chemistry, medical sciences, medical cares, and radiation metrology

  7. Addressing Poverty, Unemployment and Gender Inequality in Southern Africa: An Alternative Strategy for HIV/AIDS Prevention with Sex Workers in Botswana

    Science.gov (United States)

    Ntseane, Peggy Gabo

    2004-01-01

    This article presents the results of a study that was conducted as an effort to identify the needs of sex workers as potential beneficiaries of future HIV prevention and empowerment activities. The purpose of this study was to assess the situation and needs of sex workers in the context of HIV/AIDS. Data were collected from one of the small…

  8. Utilizing findings from a gender-based analysis to address chronic disease prevention and management among African-American women in a Michigan community.

    Science.gov (United States)

    Lombard, Wendy; Burke, Jodi; Waddell, Sandra; Franke, Arthur

    2015-08-01

    This research note underscores the importance of including strategies to address gender-based disparities when planning and implementing community health improvement programs. Working in collaboration with the Inkster Partnership for a Healthier Community (IPHC), the National Kidney Foundation of Michigan conducted a gender-based analysis as part of its broader community health needs assessment efforts in Inkster, MI. The findings from these studies revealed significant challenges impacting women that were not being adequately addressed within the community. In response to these findings, the IPHC created a strategic action plan to respond to the highest priority needs by increasing community awareness of and linkages to resources that provide supportive services for low-income African-American women. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. ADDRESSING SEXUAL VIOLENCE IN THE UNIVERSITY: HOW DO WE PREVENT AND PUNISH SEXUAL VIOLENCE AT CAMPUSES? A CASE OF MAKERERE UNIVERSITY.

    OpenAIRE

    Makoboza, Paul

    2016-01-01

    Sexual violence is a common human rights violation among campus students. Students within the university, faculty committees, and members of staff are not only involved in sexual violence, but also in addressing its causes. This thesis describes sexual violence victimization and perpetration awareness, its relationship with human right and punitive measures accorded to it in a sample of 150-university students. A cross sectional survey design was used to contact students through voluntary gat...

  10. Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

    Science.gov (United States)

    Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

    2017-07-01

    One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Development and validation of an event-specific quantitative PCR method for genetically modified maize MIR162.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2014-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.

  12. In the context of both International law and the application of Islamic Sharia Law, how effective have Kuwait and the Kuwaiti legal system been in addressing, preventing and combating human trafficking?

    OpenAIRE

    MEZHI MEJBEL MEZHI BATHAL ALRASHEDI, ALI

    2017-01-01

    This thesis answers the question of how effective Kuwait and the Kuwaiti legal system have been in addressing, preventing, and combating human trafficking in the context of both international law and the application of Islamic Sharia Law (ISL). The thesis is concerned with trafficking in persons with a particular focus on trafficking to exploit labour in Kuwait as compared to the five other Arab countries in the Gulf Cooperation Council (GCC). The GCC countries are parties to the main interna...

  13. Drinking game play among first-year college student drinkers: an event-specific analysis of the risk for alcohol use and problems.

    Science.gov (United States)

    Ray, Anne E; Stapleton, Jerod L; Turrisi, Rob; Mun, Eun-Young

    2014-09-01

    College students who play drinking games (DGs) more frequently report higher levels of alcohol use and experience more alcohol-related harm. However, the extent to which they are at risk for increased consumption and harm as a result of DG play on a given event after accounting for their typical DG participation, and typical and event drinking, is unclear. We examined whether first-year students consumed more alcohol and were more likely to experience consequences on drinking occasions when they played DGs. Participants (n = 336) completed up to six web-based surveys following weekend drinking events in their first semester. Alcohol use, DG play, and consequences were reported for the Friday and Saturday prior to each survey. Typical DG tendencies were controlled in all models. Typical and event alcohol use were controlled in models predicting risk for consequences. Participants consumed more alcohol on DG versus non-DG events. All students were more likely to experience blackout drinking consequences when they played DGs. Women were more likely to experience social-interpersonal consequences when they played DGs. DG play is an event-specific risk factor for increased alcohol use among first-year students, regardless of individual DG play tendencies. Further, event DG play signals increased risk for blackout drinking consequences for all students, and social-interpersonal consequences for women, aside from the amount of alcohol consumed on those occasions as well as typical drinking behaviors. Prevention efforts to reduce high-risk drinking may be strengthened by highlighting both event- and person-specific risks of DG play.

  14. [Pediatrician-parent interaction and early prevention : A review about the limits in addressing psychosocial risks during well-child visits].

    Science.gov (United States)

    Barth, Michael

    2016-10-01

    Pediatricians can be a door opener to early prevention for families at risk. The German well-child program is well-established, but there is a gap between the structural possibilities and the observed placements. The aim of this review is to show how pediatricians and parents talk about psychosocial risks under the very structured conditions of well-child visits. The challenges and traps of the framed interactions will be described and options for early prevention will be shown. The review is primarily based on the work of conversational and ethnomethodological studies reconstructing the pediatrician's discussion with parents about psychosocial issues in the family. Well-child visits are a highly routinized practice. Talking about family issues for both partners is a difficult task. Discussions about psychosocial issues are seldom and vague . Predominantly, they work cooperatively on reciprocal normalization of the child's development. Based on this shared orientation, pediatricians make an early, mostly general, prescription of parental tasks, supporting the child in the next developmental step. This kind of routine anticipatory counselling puts some pressure on the parents. Parents under unknown stress could be overburdened with this advice. In the script of well-child visits, there are no slots that indicate to pediatricians and parents when, which, how and for what purpose psychosocial issues can be discussed and negotiated. For implementing such slots in well-child visits, three steps are necessary: a structured and regular assessment of psychosocial issues, a trained pediatrician in motivational interviewing and a social worker guiding the family in the network of early prevention.

  15. Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

    Science.gov (United States)

    Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

  16. Multi-Sector Participation In The National Response To Prevent And Address The Hiv/Aids Epidemic In The Republic Of Cuba, 2007-2008

    Directory of Open Access Journals (Sweden)

    Isora Ramos Valle

    2010-12-01

    Full Text Available The development of a strong national response involving multiple sectors—including civil society—is an essential aspect of the social management of the HIV/AIDS epidemic. The goals of this response are to control the epidemic and improve the quality of life for people living with HIV/AIDS; this includes combating stigma and discrimination, as well as ensuring due compliance with the law. Cuba has a national program to prevent and control HIV/AIDS. Since 2003 Cuba’s national program has received material and financial support from the Global Fund to Fight AIDS, Tuberculosis and Malaria. Program evaluation is carried out by an independent team at ENSAP (National School of Public Health. This paper reports on results of one part of that evaluation: an assessment of the agencies and sectors who made up the organized social and national response to the HIV/AIDS epidemic. The evaluation primarily used qualitative analyses of the activities and tasks proposed by sectors in their 2006-2008 work plans. Visits were made to the provinces of Ciudad de la Habana, Matanzas, and Holguín. Qualitative techniques included in-depth interviews, semi-structured interviews, observation, and review of documentary evidence of all kinds (videos, reports, minutes, protocols, results of social research, and radio broadcast messages and varied depending on the particular features of each sector. We noted improvements in multi-sector participation in the prevention and response to the national HIV/AIDS epidemic. Conscious of their role, sectors generally carried out their programmed activities and had improved their organization, planning, and systematization; integration among the sectors was also better. These local initiatives provided evidence of a multi-sector response characterized by autonomy, emotional involvement, and an identification with the goals of the project; this went beyond simply meeting targets. Cross-sector work showed a marked increase and a

  17. The effectiveness of inking needle core prostate biopsies for preventing patient specimen identification errors: a technique to address Joint Commission patient safety goals in specialty laboratories.

    Science.gov (United States)

    Raff, Lester J; Engel, George; Beck, Kenneth R; O'Brien, Andrea S; Bauer, Meagan E

    2009-02-01

    The elimination or reduction of medical errors has been a main focus of health care enterprises in the United States since the year 2000. Elimination of errors in patient and specimen identification is a key component of this focus and is the number one goal in the Joint Commission's 2008 National Patient Safety Goals Laboratory Services Program. To evaluate the effectiveness of using permanent inks to maintain specimen identity in sequentially submitted prostate needle biopsies. For a 12-month period, a grossing technician stained each prostate core with permanent ink developed for inking of pathology specimens. A different color was used for each patient, with all the prostate cores from all vials for a particular patient inked with the same color. Five colors were used sequentially: green, blue, yellow, orange, and black. The ink was diluted with distilled water to a consistency that allowed application of a thin, uniform coating of ink along the edges of the prostate core. The time required to ink patient specimens comprising different numbers of vials and prostate biopsies was timed. The number and type of inked specimen discrepancies were evaluated. The identified discrepancy rate for prostate biopsy patients was 0.13%. The discrepancy rate in terms of total number of prostate blocks was 0.014%. Diluted inks adhered to biopsy contours throughout tissue processing. The tissue showed no untoward reactions to the inks. Inking did not affect staining (histochemical or immunohistochemical) or pathologic evaluation. On average, inking prostate needle biopsies increases grossing time by 20%. Inking of all prostate core biopsies with colored inks, in sequential order, is an aid in maintaining specimen identity. It is a simple and effective method of addressing Joint Commission patient safety goals by maintaining specimen identity during processing of similar types of gross specimens. This technique may be applicable in other specialty laboratories and high

  18. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  19. Allegheny County Addressing Landmarks

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — This dataset contains address points which represent physical address locations assigned by the Allegheny County addressing authority. Data is updated by County...

  20. Allegheny County Address Points

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — This dataset contains address points which represent physical address locations assigned by the Allegheny County addressing authority. Data is updated by County...

  1. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  2. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  3. Physical activity prescription: a critical opportunity to address a modifiable risk factor for the prevention and management of chronic disease: a position statement by the Canadian Academy of Sport and Exercise Medicine.

    Science.gov (United States)

    Thornton, Jane S; Frémont, Pierre; Khan, Karim; Poirier, Paul; Fowles, Jonathon; Wells, Greg D; Frankovich, Renata J

    2016-09-01

    Non-communicable disease is a leading threat to global health. Physical inactivity is a large contributor to this problem; in fact, the WHO ranks it as the fourth leading risk factor for overall morbidity and mortality worldwide. In Canada, at least 4 of 5 adults do not meet the Canadian Physical Activity Guidelines of 150 min of moderate-to-vigorous physical activity per week. Physicians play an important role in the dissemination of physical activity (PA) recommendations to a broad segment of the population, as over 80% of Canadians visit their doctors every year and prefer to get health information directly from them. Unfortunately, most physicians do not regularly assess or prescribe PA as part of routine care, and even when discussed, few provide specific recommendations. PA prescription has the potential to be an important therapeutic agent for all ages in primary, secondary and tertiary prevention of chronic disease. Sport and exercise medicine (SEM) physicians are particularly well suited for this role and should collaborate with their primary care colleagues for optimal patient care. The purpose of this Canadian Academy and Sport and Exercise Medicine position statement is to provide an evidence-based, best practices summary to better equip SEM and primary care physicians to prescribe PA and exercise, specifically for the prevention and management of non-communicable disease. This will be achieved by addressing common questions and perceived barriers in the field.Author note This position statement has been endorsed by the following nine sport medicine societies: Australasian College of Sports and Exercise Physicians (ACSEP), American Medical Society for Sports Medicine (AMSSM), British Association of Sports and Exercise Medicine (BASEM), European College of Sport & Exercise Physicians (ECOSEP), Norsk forening for idrettsmedisin og fysisk aktivite (NIMF), South African Sports Medicine Association (SASMA), Schweizerische Gesellschaft für Sportmedizin

  4. License Address List

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Address list generated from National Saltwater Angler Registry. Used in conjunction with an address-based sample as per survey design.

  5. Reach Address Database (RAD)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Reach Address Database (RAD) stores the reach address of each Water Program feature that has been linked to the underlying surface water features (streams,...

  6. Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

    Science.gov (United States)

    Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

    2011-12-28

    For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

  7. Study protocol for the optimisation, feasibility testing and pilot cluster randomised trial of Positive Choices: a school-based social marketing intervention to promote sexual health, prevent unintended teenage pregnancies and address health inequalities in England.

    Science.gov (United States)

    Ponsford, Ruth; Allen, Elizabeth; Campbell, Rona; Elbourne, Diana; Hadley, Alison; Lohan, Maria; Melendez-Torres, G J; Mercer, Catherine H; Morris, Steve; Young, Honor; Bonell, Chris

    2018-01-01

    Since the introduction of the Teenage Pregnancy Strategy (TPS), England's under-18 conception rate has fallen by 55%, but a continued focus on prevention is needed to maintain and accelerate progress. The teenage birth rate remains higher in the UK than comparable Western European countries. Previous trials indicate that school-based social marketing interventions are a promising approach to addressing teenage pregnancy and improving sexual health. Such interventions are yet to be trialled in the UK. This study aims to optimise and establish the feasibility and acceptability of one such intervention: Positive Choices. Design: Optimisation, feasibility testing and pilot cluster randomised trial.Interventions: The Positive Choices intervention comprises a student needs survey, a student/staff led School Health Promotion Council (SHPC), a classroom curriculum for year nine students covering social and emotional skills and sex education, student-led social marketing activities, parent information and a review of school sexual health services.Systematic optimisation of Positive Choices will be carried out with the National Children's Bureau Sex Education Forum (NCB SEF), one state secondary school in England and other youth and policy stakeholders.Feasibility testing will involve the same state secondary school and will assess progression criteria to advance to the pilot cluster RCT.Pilot cluster RCT with integral process evaluation will involve six different state secondary schools (four interventions and two controls) and will assess the feasibility and utility of progressing to a full effectiveness trial.The following outcome measures will be trialled as part of the pilot:Self-reported pregnancy and unintended pregnancy (initiation of pregnancy for boys) and sexually transmitted infections,Age of sexual debut, number of sexual partners, use of contraception at first and last sex and non-volitional sexEducational attainmentThe feasibility of linking administrative

  8. Is 4/20 an Event-Specific Marijuana Holiday? A Daily Diary Investigation of Marijuana Use and Consequences Among College Students.

    Science.gov (United States)

    Bravo, Adrian J; Pearson, Matthew R; Conner, Bradley T; Parnes, Jamie E

    2017-01-01

    Given the popular association between April 20 ("4/20") and marijuana, the present study examined marijuana use and consequences on 4/20 compared with other days in order to test whether 4/20 is a high-risk, event-specific marijuana use holiday among college student marijuana users. Fifty-nine college student marijuana users from three different, large U.S. universities located in Virginia, New Mexico, and Colorado completed daily brief surveys (<10 minutes) over a 12-day (April 15-April 26) period assessing prior-day marijuana use (i.e., percentage of users who consumed marijuana, number of unique marijuana use sessions, subjective high/intoxication while under the influence of marijuana, and number of grams of marijuana consumed) and marijuana-related consequences. Using oneway repeated-measures analyses of variance, we found that (a) 50% of students reported using marijuana on 4/20, which was significantly more than weekdays (28%) and weekend days (37%); (b) students reported a significantly higher number of unique marijuana use sessions on 4/20 (M = 1.47) compared with weekdays (M = 0.91); and (c) students reported a significantly higher number of grams consumed on 4/20 (M = 0.79) compared with weekdays (M = 0.35) and weekend days (M = 0.47). Our study provides preliminary support that 4/20 is a day associated with increased marijuana use but provides little evidence for an association with more problematic use.

  9. Selection of Suitable DNA Extraction Methods for Genetically Modified Maize 3272, and Development and Evaluation of an Event-Specific Quantitative PCR Method for 3272.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.

  10. Addressing Ozone Layer Depletion

    Science.gov (United States)

    Access information on EPA's efforts to address ozone layer depletion through regulations, collaborations with stakeholders, international treaties, partnerships with the private sector, and enforcement actions under Title VI of the Clean Air Act.

  11. Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

    Science.gov (United States)

    Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

    2009-08-26

    Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

  12. Addressing the nuclear misconception

    International Nuclear Information System (INIS)

    Taylor, J.J.

    1998-01-01

    There is a perception, fostered and encouraged by the anti-nuclear groups, that the nuclear industry generates large quantities of waste with no idea how to deal with it, that it is unsafe, uneconomic, and environmentally damaging. The task is to change these perceptions, by demonstrating that the industry is not a problem in itself, but in fact provides solutions to problems. This paper, while primarily concerned with waste, addresses all of these issues as each has a bearing on the perception of the industry and therefore must be considered when addressing the issue of waste. The paper concludes that evidence exists to support the industry view, but that the mission of the industry should be to change the perception of the industry, by influencing and working together with its stake holders to address their concerns, rather than merely presenting more and more facts. (author)

  13. Addressing Sexual Harassment

    Science.gov (United States)

    Young, Ellie L.; Ashbaker, Betty Y.

    2008-01-01

    This article discusses ways on how to address the problem of sexual harassment in schools. Sexual harassment--simply defined as any unwanted and unwelcome sexual behavior--is a sensitive topic. Merely providing students, parents, and staff members with information about the school's sexual harassment policy is insufficient; schools must take…

  14. "And Then Break the Cliché": Understanding and Addressing HIV Vulnerability Through Development of an HIV Prevention Telenovela with Men Who Have Sex with Men and Transwomen in Lima, Peru.

    Science.gov (United States)

    Garcia, Jonathan; Perez-Brumer, Amaya G; Cabello, Robinson; Clark, Jesse L

    2018-02-20

    HIV and other sexually transmitted infections (STIs) continue to affect men who have sex with men (MSM) and transgender women (TW) in Peru at disproportionately high rates. The ineffectiveness of traditional prevention strategies may be due to the disconnect between health promotion messages and community-level understandings of sexual cultures. We conducted 15 workshops with MSM and TW to develop a community-based sexual health intervention. Intervention development consisted of focus groups and scenic improvisation to identify sexual scripts for an HIV prevention telenovela, or Spanish soap opera. Workshops were stratified by self-reported socioeconomic status, sexual orientation, and gender identity: (1) low-income MSM (n = 9); (2) middle/high-income MSM (n = 6); and (3) TW (n = 8). Employing a conceptual model based on sexual scripts and critical consciousness theories, this paper reports on three themes identified during the telenovela-development process as participants sought to "rescript" social and sexual stereotypes associated with HIV-related vulnerability: (1) management of MSM and TW social identities at the intersection of socioeconomic status, sexuality, and gender performance; (2) social constructions of gender and/or sexual role and perceived and actual HIV/STI risk(s) within sexual partnership interactions; and (3) idealized and actual sexual scripts in the negotiation of safer sex practices between MSM/TW and their partners. These findings are key to reframing existing prevention strategies that fail to effectively engage poorly defined "high-risk populations." Leveraging community-based expertise, the results provide an alternative to the static transfer of information through expert-patient interactions in didactic sessions commonly used in HIV prevention interventions among MSM and TW.

  15. Promoting Community Conversations About Research to End Suicide: learning and behavioural outcomes of a training-of-trainers model to facilitate grassroots community health education to address Indigenous youth suicide prevention.

    Science.gov (United States)

    Wexler, Lisa; Trout, Lucas; Rataj, Suzanne; Kirk, Tanya; Moto, Roberta; McEachern, Diane

    2017-01-01

    Alaska Native (AN) youth suicide remains a substantial and recalcitrant health disparity, especially in rural/remote communities. Promoting Community Conversations About Research to End Suicide (PC CARES) is a community health intervention that responds to the need for culturally responsive and evidence-supported prevention practice, using a grassroots approach to spark multilevel and community-based efforts for suicide prevention. This paper describes theoretical and practical considerations of the approach, and assesses the feasibility and preliminary learning and behavioural outcomes of the training-of-trainers model. It details the training of a first cohort of intervention facilitators in Northwest Alaska (NWA). Thirty-two people from 11 NWA village communities completed the PC CARES facilitator training, preparing them to implement the intervention in their home communities. Facilitator pre-post surveys focused on readiness to facilitate, a group quiz assessed participants' understanding of relevant research evidence, and practice facilitation exercises demonstrated competency. Curriculum fidelity and accuracy scores were calculated using audio recordings from learning circles conducted by facilitators in their home communities. Facilitator reflections describe the successes of the model and identify several areas for improvement. As of March 2017, 20 of the 32 trained facilitators in 10 of the 11 participating villages have hosted 54 LCs, with a total of 309 unique community members. Coding of these LCs by 2 independent raters indicate acceptable levels of fidelity and accurate dissemination of research evidence by facilitators. Facilitator reflections were positive overall, suggesting PC CARES is feasible, acceptable and potentially impactful as a way to translate research to practice in under-resourced, rural AN communities. PC CARES represents a practical community education and mobilisation approach to Indigenous youth suicide prevention that displays

  16. Pilot Project to Integrate Community and Clinical Level Systems to Address Health Disparities in the Prevention and Treatment of Obesity among Ethnic Minority Inner-City Middle School Students: Lessons Learned

    Directory of Open Access Journals (Sweden)

    Jessica Rieder

    2018-01-01

    Full Text Available Effective obesity prevention and treatment interventions are lacking in the United States, especially for impoverished minority youths at risk for health disparities, and especially in accessible community-based settings. We describe the launch and pilot implementation evaluation of the first year of the B’N Fit POWER initiative as a middle school-based comprehensive wellness program that integrates weight management programming into existing onsite preventive and clinical services. Consistent with the existing implementation science literature, we focused on both the organizational structures that facilitate communication and the development of trust among stakeholders, students, and families and the development of realistic and timely goals to implement and integrate all aspects of the program. New implementation and programming strategies were developed and tested to increase the proportion of students screened, support the linkage of students to care, and streamline the integration of program clinical and afterschool components into routine services already offered at the school. We report on our initial implementation activities using the Standards for Reporting Implementation Studies (StaRI framework using hybrid outcomes combining the Reach element from the RE-AIM framework with a newly conceptualized Wellness Cascade.

  17. Road Map to Address Cognitive Health

    Centers for Disease Control (CDC) Podcasts

    2014-06-09

    In this podcast, CDC’s Dr. Lynda Anderson highlights the important roles that states and communities can play in addressing cognitive health as part of overall health.  Created: 6/9/2014 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 6/9/2014.

  18. Addressing Sexual Violence as Student Affairs Work

    Science.gov (United States)

    Landreman, Lisa M.; Williamsen, Kaaren M.

    2018-01-01

    In this chapter, we outline the challenges campuses face in addressing sexual violence and Title IX compliance. We argue that there are critical roles for student affairs professionals in Title IX work in developing effective campus sexual violence prevention and response strategies.

  19. Addressing the Issue: Bullying and LGBTQ Youth

    Directory of Open Access Journals (Sweden)

    Kimberly Allen

    2014-09-01

    Full Text Available Each day, thousands of youth experience bullying and as many of 70% of all youth report having experienced bullying, either directly or indirectly (Cantor, 2005. For Gay, Lesbian, Bi-sexual, Transgender and Questioning (LGBTQ youth, the chances of experiencing bullying are much higher than for youth in the general population (Russell, Horn, Kosciw, & Saewyc, 2010. Although many youth serving organizations have begun to address the issue of bullying with bullying prevention programs, there is a deficit of information and a lack of inclusion of prevention efforts that specifically address LGBTQ youth. This article address the role of youth organizations in creating safe and inclusive environments for all youth, with specific attention paid to resources and strategies for inclusive environments for LGBTQ youth.

  20. Counting addressing method: Command addressable element and extinguishing module

    Directory of Open Access Journals (Sweden)

    Ristić Jovan D.

    2009-01-01

    Full Text Available The specific requirements that appear in addressable fire detection and alarm systems and the shortcomings of the existing addressing methods were discussed. A new method of addressing of detectors was proposed. The basic principles of addressing and responding of a called element are stated. Extinguishing module is specific subsystem in classic fire detection and alarm systems. Appearing of addressable fire detection and alarm systems didn't caused essential change in the concept of extinguishing module because of long calling period of such systems. Addressable fire security system based on counting addressing method reaches high calling rates and enables integrating of the extinguishing module in addressable system. Solutions for command addressable element and integrated extinguishing module are given in this paper. The counting addressing method was developed for specific requirements in fire detection and alarm systems, yet its speed and reliability justifies its use in the acquisition of data on slowly variable parameters under industrial conditions. .

  1. Addressing a Critical Gap in U.S. National Teen Pregnancy Prevention Programs: The Acceptability and Feasibility of Father-Based Sexual and Reproductive Health Interventions for Latino Adolescent Males.

    Science.gov (United States)

    Guilamo-Ramos, Vincent; Bowman, Alex S; Santa Maria, Diane; Kabemba, Francesca; Geronimo, Yoyce

    2018-03-01

    The purpose of the research was to examine the feasibility and acceptability of a father-based sexual and reproductive health intervention designed to reduce sexual and reproductive (SRH) disparities and increase correct and consistent condom use among Latino adolescent males. The current study conducted in-depth semi-structured interviews with Latino father-son dyads (N=30) designed to elicit perspectives on communication regarding sex and condom use. In addition, the interview protocol included father-son preferences regarding paternal involvement in condom instruction and perceived obstacles and advantages of father direct involvement in education efforts designed to increase correct and consistent condom use among their adolescent sons. Three independent coders conducted both vertical and horizontal analyses of the data to identify emergent themes and reach theoretical saturation. The main findings from this study suggest that Latino fathers can be impactful in shaping Latino adolescent male sexual decision-making and correct and consistent condom use. However, our data highlight that while both feasible and acceptable, Latino fathers identify needing additional support in how best to communicate and seek opportunities to master their own knowledge and skills regarding condom use and effective communication with their adolescent sons about sex. Latino father-based interventions represent an acceptable and feasible option for building upon the recent success of U.S. national efforts to reduce teen pregnancy rates and STI disparities among Latino youth. However, there exists a need for father-based programs that will support Latino fathers in best educating their sons about condom use and better addressing their SRH. Ongoing national efforts to reduce Latino teen SRH disparities warrant the consideration of father-son interventions for Latino adolescent males in the United States. Copyright © 2018. Published by Elsevier Inc.

  2. Forms of address in Isizulu

    OpenAIRE

    2014-01-01

    M.A. (African Studies) The study deals with forms of address in isiZulu. Therefore, the various aspects of speech that play roles when addressing a person, the factors affecting forms of address in isiZulu and the effect of languages such as English, Afrikaans and other African languages on the forms of address in isiZulu are of interest. Research was conducted on forms of address in isiZulu in parts of Soweto and it was discovered that form of address are determined by different factors i...

  3. Preventing distracted driving among college students: Addressing smartphone use.

    Science.gov (United States)

    Hassani, Sahar; Kelly, Erin H; Smith, Jennifer; Thorpe, Sara; Sozzer, Fatima H; Atchley, Paul; Sullivan, Elroy; Larson, Dean; Vogel, Lawrence C

    2017-02-01

    Based on the National Highway Traffic Safety Association's (NHTSA) Report, fatalities due to distracted driving are on the rise and the highest proportion of fatalities by age group is the 20-29 year old category. To date little has been done to educate college students about the dangers of distracted driving and engage these students in promoting a safe driving culture. Intervening among college students has the potential for making real-time behavior change, can foster a lifetime of safe driving habits among these students, and can help contribute to a culture of safe driving that can be created and sustained through positive messages from peers. The goals of this study were to develop, implement and evaluate a distracted driving presentation for college students to change knowledge, attitude and behavior on distracted driving. A 30-min, multi-media presentation on distracted driving was presented to 19 colleges and universities, totaling 444 college students (mean age 23.7±7.0 years of age, 61% females, 39% males). Students completed three surveys: prior to the workshop (interview 1), immediately after the workshop (interview 2), and 3 months following the workshop (interview 3). We assessed changes between interview 1 and interview 2 and found 15 of the 15 attitude-knowledge based questions significantly improved after the course. In addition, we assessed changes from interviews 1 and 3, and found 11 of the 15 attitude-knowledge based questions maintained their significance. Responses to behavior related questions at three months were also compared to baseline, and significant improvements were found for 12 of the 14 questions. While this study was successful in improving the short-term attitude-knowledge and behaviors on distracted driving, work is needed to sustain (and evaluate) long-term effects. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Preventing Lone Wolf Terrorism: some CT Approaches Addressed

    OpenAIRE

    Edwin Bakker; Beatrice de Graaf

    2011-01-01

    After a brief discussion of the epistemological and phenomenological difficulties associated with the concept of lone wolf terrorism, a number of possible counter-terrorist approaches are discussed. Lone operator terrorist acts should be considered ‘black swan’ occurrences that are almost impossible to categorize or systematize, let alone forecast. Thus, not the profile of the perpetrator, but the modus operandi offer clues for a better response to this particular threat. Furtherm...

  5. Reclaiming unused IPv4 addresses

    CERN Multimedia

    IT Department

    2016-01-01

    As many people might know, the number of IPv4 addresses is limited and almost all have been allocated (see here and here for more information).   Although CERN has been allocated some 340,000 addresses, the way these are allocated across the site is not as efficient as we would like. As we face an increasing demand for IPv4 addresses with the growth in virtual machines, the IT Department’s Communication Systems Group will be reorganising address allocation during 2016 to make more efficient use of the IPv4 address ranges that have been allocated to CERN. We aim, wherever possible, to avoid giving out fixed IP addresses, and have all devices connected to the campus network obtain an address dynamically each time they connect. As a first stage, starting in February, IP addresses that have not been used for more than 9 months will be reclaimed. No information about the devices concerned will be deleted from LANDB, but a new IP address will have to be requested if they are ever reconnected to t...

  6. Port virtual addressing for PC

    International Nuclear Information System (INIS)

    Bolanos, L.; Arista, E.; Osorio Deliz, J.F.

    1997-01-01

    Instruments for nuclear signal measurements based on add-on card for a personal computer (PC) are designed often. Then one faces the problem of the addressing of data input/output devices which show an integration level or intelligence that makes the use of several port address indispensable, and these are limited in the PC. The virtual addressing offers the advantage of the occupation of few addresses to accede to many of these devices. The principles of this technique and the appliances of a solution in radiometric in a radiometric card based on programmed logic are discussed in this paper

  7. Youth Suicide Prevention Programs

    Science.gov (United States)

    Kalafat, John

    2006-01-01

    Youth suicide prevention programs are described that promote the identification and referral of at-risk youth, address risk factors, and promote protective factors. Emphasis is on programs that are both effective and sustainable in applied settings.

  8. Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay.

    Science.gov (United States)

    Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-02-18

    In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.

  9. Addressing problems of employee performance.

    Science.gov (United States)

    McConnell, Charles R

    2011-01-01

    Employee performance problems are essentially of 2 kinds: those that are motivational in origin and those resulting from skill deficiencies. Both kinds of problems are the province of the department manager. Performance problems differ from problems of conduct in that traditional disciplinary processes ordinarily do not apply. Rather, performance problems are addressed through educational and remedial processes. The manager has a basic responsibility in ensuring that everything reasonable is done to help each employee succeed. There are a number of steps the manager can take to address employee performance problems.

  10. Zone memories and pseudorandom addressing

    International Nuclear Information System (INIS)

    Marino, D.; Mirizzi, N.; Stella, R.; Visaggio, G.

    1975-01-01

    A quantitative comparison between zone memories, pseudorandom addressed memories and an alternative special purpose memory (spread zone memory) in which the distance between any two transformed descriptors, at first adjacent, is independent of the descriptors pair and results the maximum one is presented. This memory has not been particularly considered at present in spite of its efficiency and its simple implementation

  11. Introduction to IP address management

    CERN Document Server

    Rooney, Tim

    2010-01-01

    "The book begins with a basic overview of IP networking, followed by chapters describing each of the three core IPAM technologies: IPv4 and IPv6 addressing, DHCP, and DNS. The next three chapters describe IPAM management techniques and practice, followed by chapters on IPv4-IPv6 co-existence, security and the IPAM business case"--

  12. Addressing the workforce pipeline challenge

    Energy Technology Data Exchange (ETDEWEB)

    Leonard Bond; Kevin Kostelnik; Richard Holman

    2006-11-01

    A secure and affordable energy supply is essential for achieving U.S. national security, in continuing U.S. prosperity and in laying the foundations to enable future economic growth. To meet this goal the next generation energy workforce in the U.S., in particular those needed to support instrumentation, controls and advanced operations and maintenance, is a critical element. The workforce is aging and a new workforce pipeline, to support both current generation and new build has yet to be established. The paper reviews the challenges and some actions being taken to address this need.

  13. Presidential address: distinction or extinction.

    Science.gov (United States)

    Pressman, Barry D

    2008-10-01

    Despite its continuing scientific successes in imaging, radiology as a specialty is faced with a very difficult and competitive environment. Nonradiologists are more and more interested in vertically integrating imaging into their practices, while teleradiology and picture archiving and communication systems are resulting in the greater isolation of radiologists. Commoditization is a realistic and devastating threat to the survival and professionalism of the specialty. To remain viable as a specialty, radiologists must elevate their practice by subspecializing, becoming more involved with clinical care, and actively interacting with patients and referring clinicians. Distinction will prevent extinction.

  14. Quantitative tools for addressing hospital readmissions

    Directory of Open Access Journals (Sweden)

    Lagoe Ronald J

    2012-11-01

    Full Text Available Abstract Background Increased interest in health care cost containment is focusing attention on reduction of hospital readmissions. Major payors have already developed financial penalties for providers that generate excess readmissions. This subject has benefitted from the development of resources such as the Potentially Preventable Readmissions software. This process has encouraged hospitals to renew efforts to improve these outcomes. The aim of this study was to describe quantitative tools such as definitions, risk estimation, and tracking of patients for reducing hospital readmissions. Findings This study employed the Potentially Preventable Readmissions software to develop quantitative tools for addressing hospital readmissions. These tools included two definitions of readmissions that support identification and management of patients. They also included analytical approaches for estimation of the risk of readmission for individual patients by age, discharge status of the initial admission, and severity of illness. They also included patient specific spreadsheets for tracking of target populations and for evaluation of the impact of interventions. Conclusions The study demonstrated that quantitative tools including the development of definitions of readmissions, estimation of the risk of readmission, and patient specific spreadsheets could contribute to the improvement of patient outcomes in hospitals.

  15. A Life’s Addresses

    DEFF Research Database (Denmark)

    Balle, Søren Hattesen

    According to Jonathan Culler’s essay ”Apostrophe”, ”…post-enlightenment poetry seeks to overcome the alienation of subject from object”, and “apostrophe takes the crucial step of constituting the object as another subject with whom the poetic subject might hope to strike up a harmonious relations......According to Jonathan Culler’s essay ”Apostrophe”, ”…post-enlightenment poetry seeks to overcome the alienation of subject from object”, and “apostrophe takes the crucial step of constituting the object as another subject with whom the poetic subject might hope to strike up a harmonious...... to a number of different aspects of Koch’s own life such as marijuana, the Italian language, World War Two, etc. In this way, the book quite conventionally inscribes itself in the tradition of post-enlightenment apostrophic poetry as characterized by Culler, just as all its poems belong to the favourite......, are literally troped as and addressed in the manner of so many acquaintances, personal connections, relatives, friends, lovers, and family members in Koch’s life. My main claim is that Koch’s poetics in New Addresses is one that slightly dislocates the romantic dichotomy between the world of things...

  16. Actions States and Communities Can Take to Address Cognitive Health

    Centers for Disease Control (CDC) Podcasts

    2014-06-09

    In this podcast, CDC’s Dr. Lynda Anderson highlights the important roles that states and communities can play in addressing cognitive health as part of overall health.  Created: 6/9/2014 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 6/9/2014.

  17. Ronald Reagan's "Star Wars" Address: Mythic Containment of Technical Reasoning.

    Science.gov (United States)

    Rushing, Janice Hocker

    1986-01-01

    Views Reagan's "Star Wars" address as part of the culturally evolving myth of the New Frontier. Discusses how the speech creates the illusion of both preserving and transcending science by (1) subordinating technical reasoning to prevent nuclear holocaust and (2) using technoscience to rescript history and remove temporal and spacial…

  18. Prevention of suicide

    Directory of Open Access Journals (Sweden)

    Rajiv Gupta

    2017-01-01

    Full Text Available Suicide is a major public health problem in India, probably even bigger than in the West. Suicidal behavior is the best conceptualized as a multifaceted complex problem involving social factors and mental illnesses. Broadly, there are two approaches to suicide prevention; population preventive strategies and high-risk preventive strategies. Population preventive strategies include reducing availability of means for suicide, education of primary care physicians, influencing media portrayal of suicidal behavior, education of the public, telephone helplines, and addressing economic issues associated with suicidal behavior. High-risk preventive strategy includes identifying individuals with high risk of committing suicide, intensively treating mental illness if present, and providing psychosocial support. Thus, prevention requires a multipronged effort with collaboration from various sectors including mental health professionals, social justice department, and macroeconomic policy makers.

  19. Industrial pollution prevention handbook

    International Nuclear Information System (INIS)

    Freeman, H.M.

    1995-01-01

    This book presents the techniques, technologies, regulations, and strategies that define pollution prevention. The subject is addressed from many perspectives by prominent experts. In many ways pollution prevention, rather than being a specialty field itself, is actually a convergence of fields drawing upon knowledge in a wide variety of more typical fields of expertise. Individual chapters have been processed separately for inclusion in the appropriate data bases

  20. First keynote address - biological monitoring

    International Nuclear Information System (INIS)

    Turner, J.E.

    1984-01-01

    The author describes the interplay of physical research and the practice of radiation protection. There are both analogies in and differences between the problems of health protection from radiation and chemical pollutants. In formulating research objectives for synfuel technologies, it is important to take what lessons there are to be learned from the radiation experience. The regulation of the exposure of persons to radiation probably rests on a firmer scientific basis than does the regulation of exposure to many toxic chemicals. Some things in radiation protection - in both applied work and in research - should help to guide in approaching chemicals. The second section of this paper gives a brief description of the practice of radiation protection. The next section mentions some fundamental deficiencies that exist in radiation protection. Some physical research avenues illustrate how such deficiencies are being addressed as part of an integrated radiation research program. In the fourth section the author focuses on chemical pollutants, drawing some lessons from the radiation experience

  1. A region addresses patient safety.

    Science.gov (United States)

    Feinstein, Karen Wolk; Grunden, Naida; Harrison, Edward I

    2002-06-01

    The Pittsburgh Regional Healthcare Initiative (PRHI) is a coalition of 35 hospitals, 4 major insurers, more than 30 major and small-business health care purchasers, dozens of corporate and civic leaders, organized labor, and partnerships with state and federal government all working together to deliver perfect patient care throughout Southwestern Pennsylvania. PRHI believes that in pursuing perfection, many of the challenges facing today's health care delivery system (eg, waste and error in the delivery of care, rising costs, frustration and shortage among clinicians and workers, financial distress, overcapacity, and lack of access to care) will be addressed. PRHI has identified patient safety (nosocomial infections and medication errors) and 5 clinical areas (obstetrics, orthopedic surgery, cardiac surgery, depression, and diabetes) as ideal starting points. In each of these areas of work, PRHI partners have assembled multifacility/multidisciplinary groups charged with defining perfection, establishing region-wide reporting systems, and devising and implementing recommended improvement strategies and interventions. Many design and conceptual elements of the PRHI strategy are adapted from the Toyota Production System and its Pittsburgh derivative, the Alcoa Business System. PRHI is in the proof-of-concept phase of development.

  2. Keynote Address from K. Mendelsohn

    International Nuclear Information System (INIS)

    Mendelsohn, K.

    2015-01-01

    The United States believes it is critically important for Member States to support the Secretariat's efforts to continually improve the effectiveness and efficiency of the IAEA safeguards system. We should continue to work with the Agency to provide resources, technology, expertise, and training to strengthen the Secretariat's capabilities to implement safeguards agreements effectively and efficiently. The Secretariat went to extraordinary lengths over the last year to explain how safeguards implementation has evolved, particularly at the level of the state as a whole. The United States, like other member states, found the Secretariat's thorough technical briefings and the Director General's Supplementary Document to be extremely valuable. Now, after discussion of the issue at the September meetings of the Board of Governors and the General Conference, it really is time to let the Secretariat get on with its work. Our task now, especially for the assembled experts here at this Symposium, is to identify options for helping the IAEA as appropriate to find the best possible technologies, procedures, and practices for safeguards implementation. And like all of you, we look forward to further updates from the Secretariat on future lessons learned in implementing strengthened safeguards. I urge you to work together at this Symposium to make real progress on promoting peaceful uses of nuclear energy, strengthening safeguards, and preventing proliferation

  3. Obesity Prevention and Screening.

    Science.gov (United States)

    Mackey, Eleanor R; Olson, Alexandra; DiFazio, Marc; Cassidy, Omni

    2016-03-01

    Obesity is widespread, associated with several physical and psychosocial comorbidities, and is difficult to treat. Prevention of obesity across the lifespan is critical to improving the health of individuals and society. Screening and prevention efforts in primary care are an important step in addressing the obesity epidemic. Each period of human development is associated with unique risks, challenges, and opportunities for prevention and intervention. Screening tools for overweight/obesity, although imperfect, are quick and easy to administer. Screening should be conducted at every primary care visit and tracked longitudinally. Screening tools and cutoffs for overweight and obesity vary by age group. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Realization and Addressing Analysis In Blockchain Bitcoin

    Science.gov (United States)

    Sakti Arief Daulay, Raja; Michrandi Nasution, Surya; Paryasto, Marisa W.

    2017-11-01

    The implementation research and analyze address blockchain on this bitcoin will have the results that refers to making address bitcoin a safe and boost security of address the bitcoin. The working mechanism of blockchain in making address bitcoin which is already in the blockchain system.

  5. Clinical contributions to addressing the social determinants of health.

    Science.gov (United States)

    Patel, Kiran C R; Spilsbury, Peter; Shukla, Rashmi

    2010-04-01

    The drive to address social determinants of health is gaining momentum. Appreciating that health outcomes are only partly affected by healthcare, clinicians and clinical communities can play a significant role in this crusade by action at local, regional, national and global levels. A concerted and systematic focus on integrating and industrialising upstream interventions at every healthcare encounter is essential to prevent future illness, thus enabling a paradigm shift in the healthcare service from being one of illness management to health preservation. The evidence base demonstrates the cost efficacy of upstream interventions. The challenge is how this evidence is utilised to implement these interventions in everyday healthcare. Today, with a global economic crisis and challenged public sector funding, the need to address prevention has never been more pressing. Clinical engagement at all levels, from the front line to the boardroom is vital. Clinicians must address access, communication, strategy and commissioning to fulfil a professional responsibility to become and remain the corporate memory of a health service focused on preventing illness while simultaneously delivering cost-effective healthcare.

  6. 33 CFR 135.9 - Fund address.

    Science.gov (United States)

    2010-07-01

    ... FINANCIAL RESPONSIBILITY AND COMPENSATION OFFSHORE OIL POLLUTION COMPENSATION FUND General § 135.9 Fund address. The address to which correspondence relating to the Coast Guard's administration of the Fund... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Fund address. 135.9 Section 135.9...

  7. Salmonella Prevention

    Science.gov (United States)

    ... and in vegetable and fruit harvesting and packing operations may help prevent salmonellosis caused by contaminated foods. Better education of food industry workers in basic food safety and restaurant inspection procedures may prevent cross-contamination and other ...

  8. Guidelines for prevention in psychology.

    Science.gov (United States)

    2014-04-01

    The effectiveness of prevention to enhance human functioning and reduce psychological distress has been demonstrated. From infancy through adulthood, access to preventive services and interventions is important to improve the quality of life and human functioning and reduce illness and premature death. The importance of prevention is consistent with the Patient Protection and Affordable Care Act of 2010. Even with the increased focus on prevention, psychology training programs rarely require specific courses on prevention. In particular, conceptualizations about best practices in prevention, particularly at the environmental level, are lacking. Therefore, psychologists engaged in prevention can benefit from a set of guidelines that address and inform prevention practices. Accordingly, the Guidelines for Prevention in Psychology are intended to "inform psychologists, the public, and other interested parties regarding desirable professional practices" in prevention. The Prevention Guidelines are recommended based on their potential benefits to the public and the professional practice of psychology. They support prevention as an important area of practice, research, and training for psychologists. The Guidelines give increased attention to prevention within APA, encouraging psychologists to become involved with preventive activities relevant to their area of practice. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  9. Reading handprinted addresses on IRS tax forms

    Science.gov (United States)

    Ramanaprasad, Vemulapati; Shin, Yong-Chul; Srihari, Sargur N.

    1996-03-01

    The hand-printed address recognition system described in this paper is a part of the Name and Address Block Reader (NABR) system developed by the Center of Excellence for Document Analysis and Recognition (CEDAR). NABR is currently being used by the IRS to read address blocks (hand-print as well as machine-print) on fifteen different tax forms. Although machine- print address reading was relatively straightforward, hand-print address recognition has posed some special challenges due to demands on processing speed (with an expected throughput of 8450 forms/hour) and recognition accuracy. We discuss various subsystems involved in hand- printed address recognition, including word segmentation, word recognition, digit segmentation, and digit recognition. We also describe control strategies used to make effective use of these subsystems to maximize recognition accuracy. We present system performance on 931 address blocks in recognizing various fields, such as city, state, ZIP Code, street number and name, and personal names.

  10. Prevention of acute malnutrition

    DEFF Research Database (Denmark)

    de Pee, Saskia; Grais, Rebecca; Fenn, Bridget

    2015-01-01

    of cash or food, enables households to better meet the food, health, and other needs of household members and may increase resilience; water, sanitation, and hygiene (WASH) and health interventions help prevent and address illness and hence reduce wasting risk. The contributions of specific interventions...... "best possible" treatment, can provide evidence about what works, to what extent, at what cost, and under which circumstances. Programs should address the most important causes in given contexts, be feasible to implement at scale, and assess implementation, coverage, and outcomes....

  11. Organization of Control Units with Operational Addressing

    OpenAIRE

    Alexander A. Barkalov; Roman M. Babakov; Larysa A. Titarenko

    2012-01-01

    The using of operational addressing unit as the block of control unit is proposed. The new structure model of Moore finite-state machine with reduced hardware amount is developed. The generalized structure of operational addressing unit is suggested. An example of synthesis process for Moore finite-state machine with operational addressing unit is given. The analytical researches of proposed structure of control unit are executed.

  12. IP Address Management Principles and Practice

    CERN Document Server

    Rooney, Timothy

    2010-01-01

    This book will be the first covering the subject of IP address management (IPAM). The practice of IPAM includes the application of network management disciplines to IP address space and associated network services, namely DHCP (Dynamic Host Configuration Protocol) and DNS (Domain Name System). The consequence of inaccurately configuring DHCP is that end users may not be able to obtain IP addresses to access the network. Without proper DNS configuration, usability of the network will greatly suffer as the name-to-address lookup process may fail. Imagine having to navigate to a website or send a

  13. The Development and Evaluation of a Measure Assessing School Nurses' Perceived Barriers to Addressing Pediatric Obesity

    Science.gov (United States)

    Wu, Yelena P.; Steele, Ric G.

    2011-01-01

    School nurses represent an important resource for addressing pediatric obesity and weight-related health. However, school nurses perceive numerous barriers that prevent them from addressing the weight-related health of students. The current study developed and tested a new, comprehensive measure of nurses' perceptions of 10 types of barriers to…

  14. Prevention: Exercise

    Medline Plus

    Full Text Available ... Steroid Injections Lumbar Zygapophysical (Facet) Joint Injections PREVENTION Lifestyle Choices 10 Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen ...

  15. A New Method of Chinese Address Extraction Based on Address Tree Model

    Directory of Open Access Journals (Sweden)

    KANG Mengjun

    2015-01-01

    Full Text Available Address is a spatial location encoding method of individual geographical area. In China, address planning is relatively backward due to the rapid development of the city, resulting in the presence of large number of non-standard address. The space constrain relationship of standard address model is analyzed in this paper and a new method of standard address extraction based on the tree model is proposed, which regards topological relationship as consistent criteria of space constraints. With this method, standard address can be extracted and errors can be excluded from non-standard address. Results indicate that higher math rate can be obtained with this method.

  16. Generative Street Addresses from Satellite Imagery

    Directory of Open Access Journals (Sweden)

    İlke Demir

    2018-03-01

    Full Text Available We describe our automatic generative algorithm to create street addresses from satellite images by learning and labeling roads, regions, and address cells. Currently, 75% of the world’s roads lack adequate street addressing systems. Recent geocoding initiatives tend to convert pure latitude and longitude information into a memorable form for unknown areas. However, settlements are identified by streets, and such addressing schemes are not coherent with the road topology. Instead, we propose a generative address design that maps the globe in accordance with streets. Our algorithm starts with extracting roads from satellite imagery by utilizing deep learning. Then, it uniquely labels the regions, roads, and structures using some graph- and proximity-based algorithms. We also extend our addressing scheme to (i cover inaccessible areas following similar design principles; (ii be inclusive and flexible for changes on the ground; and (iii lead as a pioneer for a unified street-based global geodatabase. We present our results on an example of a developed city and multiple undeveloped cities. We also compare productivity on the basis of current ad hoc and new complete addresses. We conclude by contrasting our generative addresses to current industrial and open solutions.

  17. Forms of Address in Chilean Spanish

    Science.gov (United States)

    Bishop, Kelley; Michnowicz, Jim

    2010-01-01

    The present investigation examines possible social and linguistic factors that influence forms of address used in Chilean Spanish with various interlocutors. A characteristic of the Spanish of Chile is the use of a variety of forms of address for the second person singular, "tu", "vos", and "usted", with corresponding…

  18. 29 CFR 4245.7 - PBGC address.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false PBGC address. 4245.7 Section 4245.7 Labor Regulations Relating to Labor (Continued) PENSION BENEFIT GUARANTY CORPORATION INSOLVENCY, REORGANIZATION, TERMINATION, AND OTHER RULES APPLICABLE TO MULTIEMPLOYER PLANS NOTICE OF INSOLVENCY § 4245.7 PBGC address. See...

  19. Practical Strategies for Preventing Adolescent Suicide

    Science.gov (United States)

    King, Keith

    2006-01-01

    A comprehensive approach to suicide prevention is needed to effectively address the problem of teen suicide. This article describes three levels of prevention (primary prevention, intervention, and postvention) and provides practical strategies that community, mental, and social health professionals can use within each level to help prevent…

  20. Preventative Maintenance.

    Science.gov (United States)

    Migliorino, James

    Boards of education must be convinced that spending money up front for preventive maintenance will, in the long run, save districts' tax dollars. A good program of preventive maintenance can minimize disruption of service; reduce repair costs, energy consumption, and overtime; improve labor productivity and system equipment reliability; handle…

  1. Local address and emergency contact details

    CERN Multimedia

    2013-01-01

    The HR Department would like to remind members of the personnel that they are responsible for ensuring that their personal data concerning local address and preferred emergency contact details remains valid and up-to-date.   Both are easily accessible via the links below: Local address: https://edh.cern.ch/Document/Personnel/LocalAddressChange   Emergency contacts: https://edh.cern.ch/Document/Personnel/EC   Please take a few minutes to check your details and modify if necessary. Thank you in advance. HR Department Head Office

  2. Prevention of relapsing backache

    Directory of Open Access Journals (Sweden)

    Raspe, Heiner

    2006-05-01

    Full Text Available Background: The condition of non-specific back pain is characterized by high prevalence, non satisfactory therapeutic options and severe socioeconomic consequences. Therefore prevention seems an attractive option to downsize the problem. However, the construction of effective preventive measures is complicated by the obscure aetiology of the condition, the multidimensionality of risk and prognostic factors (bio psychosocial model! and the variability of its natural as well as clinical course. This led to the development of a wide variety of preventive measures: e. g. exercise programs, educational measures (including back school, ergonomic modification of the work environment, mechanical supports (e. g. back belts as well as multidisciplinary interventions. For two reasons the workplace seems to be a suitable setting for prevention. First, because a number of strong risk factors are associated with working conditions and second, because it allows addressing a large proportion of the adult population. Against this background the assessment at hand sets out to answer the following questions: What is the amount and methodological quality of the available scientific literature on the effectiveness of back pain prevention in the workplace environment? What are effective measures for the prevention of back pain and its consequences in the workplace environment and how effective are they? Is back pain prevention in the workplace environment cost-effective? Is there a need for more research? As primary outcomes for effectiveness the assessment will focus on time lost from work and the frequency and duration of episodes with back pain. The preventive measures assessed belong to the following categories: exercise programs, educational and information measures, multidimensional interventions, back belts, lifting teams and ergonomic interventions. Methods: The assessment is based on a systematic review of the published literature according to the

  3. Preventive analgesia

    DEFF Research Database (Denmark)

    Dahl, Jørgen B; Kehlet, Henrik

    2011-01-01

    This paper will discuss the concepts of pre-emptive and preventive analgesia in acute and persistent postsurgical pain, based on the most recent experimental and clinical literature, with a special focus on injury-induced central sensitization and the development from acute to chronic pain. Recent...... of preventive analgesia for persistent postoperative pain are promising. However, clinicians must be aware of the demands for improved design of their clinical studies in order to get more conclusive answers regarding the different avenues for intervention. Summary: The concept of preventive analgesia is still...

  4. Radiation and occupational health: opening address

    International Nuclear Information System (INIS)

    Mohammad Taib Osman

    1995-01-01

    The part of address discusses the following issue: benefits of radiological protection in Malaysia, traceability and accountability as assurance of the validity of radiation measurement, Laboratory Accreditation Scheme, Atomic Energy Licensing Act

  5. VT E911 ESITE geocoder - address points

    Data.gov (United States)

    Vermont Center for Geographic Information — VT E911 ESITE geocoder - address points. VCGI, in collaboration with the VT E911 Board, has created a suite of geocoding services that can be used to batch geocode...

  6. What is an address in South Africa?

    CSIR Research Space (South Africa)

    Coetzee, S

    2007-11-01

    Full Text Available Puccini Street, Constantia Park 546 Puccini Street, Glenstantia, 0181 A recent study in Denmark analysed the qualitative and quantitative impact of address ambiguities. The qualitative analysis confirmed that the ambiguities affect people every day... description consists of a land parcel number together with a registered name and registration division, and is recorded at a Surveyor-General’s office. An address complements a land parcel description with information such as the street name and the street...

  7. Research Note Consumer Addressability and Customized Pricing

    OpenAIRE

    Yuxin Chen; Ganesh Iyer

    2002-01-01

    The increasing availability of customer information is giving many firms the ability to reach and customize price and other marketing efforts to the tastes of the individual consumer. This ability is labeled as consumer addressability. Consumer addressability through sophisticated databases is particularly important for direct-marketing firms, catalog retailers such as L.L Bean and Land's End, credit card-issuing banks, and firms in the long-distance telephone market. We examine the strategic...

  8. Prevention: Exercise

    Medline Plus

    Full Text Available ... Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen Your Core! Stretching/Flexibility Aerobic ... Strength Training for the Elderly Other Back Pack Safety Pregnancy and Back Pain Preventing Osteoporosis Back Pain ...

  9. Preventing Rejection

    Science.gov (United States)

    ... After the transplant Preventing rejection Post-transplant medications Types of immunosuppressants Switching immunosuppressants Side effects Other medications Generic and brand name drugs Post-transplant tests Infections and immunity Lifestyle changes Health concerns Back to work or ...

  10. Prevent Cyberbullying

    Science.gov (United States)

    ... Tips for Teachers Report Cyberbullying Print Share Prevent Cyberbullying Be Aware of What Your Kids are Doing ... Signs a Child is Being Cyberbullied or is Cyberbullying Others Many of the warning signs that cyberbullying ...

  11. Preventing Suicide

    Science.gov (United States)

    ... protective factors listed below: Skills in problem solving, conflict resolution, and nonviolent ways of handling disputes Effective ... 2017 Page last updated: August 9, 2017 Content source: National Center for Injury Prevention and Control, Division ...

  12. Prevention: Exercise

    Medline Plus

    Full Text Available ... A SPECIALIST Prevention Strengthening Exercise Committee Exercise Committee Core Strengthening Many popular forms of exercise focus on ... acute pain, you should stop doing it. Transverse Core Strengthening This strengthens the muscles that cross from ...

  13. Prevention: Exercise

    Medline Plus

    Full Text Available ... Training for the Elderly Other Back Pack Safety Pregnancy and Back Pain Preventing Osteoporosis Back Pain Basics ... increases your back pain after five repetitions, or causes acute pain, you should stop doing it. Transverse ...

  14. Preventing accidents

    Science.gov (United States)

    2005-08-01

    As the most effective strategy for improving safety is to prevent accidents from occurring at all, the Volpe Center applies a broad range of research techniques and capabilities to determine causes and consequences of accidents and to identify, asses...

  15. Prevention: Exercise

    Medline Plus

    Full Text Available ... 10 Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen Your Core! Stretching/Flexibility ... Pain Preventing Osteoporosis Back Pain Basics Book RESOURCES Patient Information Feature Articles Patient Q&A Success Stories ...

  16. Prevention: Exercise

    Medline Plus

    Full Text Available ... Preventing Osteoporosis Back Pain Basics Book RESOURCES Patient Information Feature Articles Patient Q&A Success Stories Definitions Anatomy of the Spine Definitions A-Z Spine Specialists Videos 9 ...

  17. HIV Prevention

    Centers for Disease Control (CDC) Podcasts

    2012-02-01

    Dr. Kevin Fenton, Director of CDC’s National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention, talks about steps people can take to protect their health from HIV.  Created: 2/1/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/1/2012.

  18. South African address standard and initiatives towards an international address standard

    CSIR Research Space (South Africa)

    Cooper, Antony K

    2008-10-01

    Full Text Available ; visiting friends; and providing a reference context for presenting other information. The benefits of an international address standards include: enabling address interoperability across boundaries; reducing service delivery costs; enabling development...

  19. Enter your email-address: how German internet users manage their email addresses

    NARCIS (Netherlands)

    Utz, S.

    2004-01-01

    Writing E-mail is the most popular Internet activity. Meanwhile, many people have more than one E-mail address. The question how people manage their E-mail addresses, more specifically, whether they use them deliberately for different purposes, is the central question of this paper. E-mail addresses

  20. Cancer prevention.

    Science.gov (United States)

    Tubiana, M

    1999-01-01

    Over 70% of human cancers are associated with lifestyle and about half of cancer deaths could be prevented by relatively simple individual actions: no smoking, moderate consumption of alcohol, increased consumption of fruit and vegetables, avoidance of sunbathing, obesity and a too high consumption of saturated lipids. Most of these efforts would also markedly decrease the incidence of cardiovascular and respiratory diseases. However, the concept of prevention is currently neither well accepted nor understood by the medical community and the general public. It is often felt that it restricts freedom, imposes a choice between pleasure and duty, and that passing judgement on lifestyle is a form of intolerance. The case of tobacco illustrates the difficulties encountered by prevention, notably among adolescents. The fight against smoking requires information, a societal approach (ban on advertising, increase in price), and a reduction of the example given by adult smoking (parents, peers, teachers, physicians, TV presenters, movie stars, have a great influence on adolescents), while tobacco cessation programs must be promoted. The various approaches should be integrated into a global program of health prevention, including health education at school from 5 to 12 years of age. The efficacy of each of the global program's components should be evaluated. Misconceptions such as overestimation of the impact of pollution on health should also be corrected. Health is created and experienced by people within the setting of their daily lives, in particular during childhood. Prevention is the responsibility of individual members of the community but also of the community as a whole.

  1. The Latino Migrant Worker HIV Prevention Program

    Science.gov (United States)

    Sánchez, Jesús; Silva-Suarez, Georgina; Serna, Claudia A.; De La Rosa, Mario

    2017-01-01

    There is limited information on the impact of the HIV/AIDS epidemic on Latino migrant workers (LMWs), although available data indicate that this community is being disproportionally affected. The need for prevention programs that address the specific needs of LMWs is becoming well recognized. HIV prevention interventions that train and employ community health workers are a culturally appropriate way to address the issues of community trust and capacity building in this community. This article describes the Latino Migrant Worker HIV Prevention Program and its efforts to train and engage community health workers in the prevention of HIV among LMWs in South Florida. PMID:22367261

  2. Centrally managed unified shared virtual address space

    Science.gov (United States)

    Wilkes, John

    2018-02-13

    Systems, apparatuses, and methods for managing a unified shared virtual address space. A host may execute system software and manage a plurality of nodes coupled to the host. The host may send work tasks to the nodes, and for each node, the host may externally manage the node's view of the system's virtual address space. Each node may have a central processing unit (CPU) style memory management unit (MMU) with an internal translation lookaside buffer (TLB). In one embodiment, the host may be coupled to a given node via an input/output memory management unit (IOMMU) interface, where the IOMMU frontend interface shares the TLB with the given node's MMU. In another embodiment, the host may control the given node's view of virtual address space via memory-mapped control registers.

  3. Address rituals as heuristics of social structure

    Directory of Open Access Journals (Sweden)

    E.F. Kotze

    2013-02-01

    Full Text Available The address form as linguistic variable has more realisation possibilities than any other, because semantic variation is involved and it reflects all the different interpersonal relations in the societal structure. Factors such as religious status, sex, kinship and age differences play a key role in the choice of the address form. It is hypothesised that the way in which address forms vary in a speech community is a linguistic reflection of the social norms determining the hierarchical structure of the community. Die aanspreekvorm as linguistiese veranderlike het meer verwesenlikingsmoontlikhede as enige ander vorm, want semantiese verskeidenheid is betrokke en dit reflekteer die verskillende interpersoonlike verhoudings in die gemeenskapstruktuur. Faktore soos religieuse status, geslag, verwantskap en ouderdomsverskille speel 'n sleutelrol in die aanspreekvorm. Daar word gehipotetiseer dat die wyse waarop aanspreekvorms in 'n spraakgemeenskap wissel, 'n linguistiese refleksie is van die sosiale norme wat die hierargiese struktuur van die gemeenskap bepaal.

  4. Centrally managed unified shared virtual address space

    Energy Technology Data Exchange (ETDEWEB)

    Wilkes, John

    2018-02-13

    Systems, apparatuses, and methods for managing a unified shared virtual address space. A host may execute system software and manage a plurality of nodes coupled to the host. The host may send work tasks to the nodes, and for each node, the host may externally manage the node's view of the system's virtual address space. Each node may have a central processing unit (CPU) style memory management unit (MMU) with an internal translation lookaside buffer (TLB). In one embodiment, the host may be coupled to a given node via an input/output memory management unit (IOMMU) interface, where the IOMMU frontend interface shares the TLB with the given node's MMU. In another embodiment, the host may control the given node's view of virtual address space via memory-mapped control registers.

  5. Pollution prevention and air quality

    International Nuclear Information System (INIS)

    Fuentes Hector; Tsihrintzis Vassilios

    1997-01-01

    Pollution prevention (P2) results from the combined effect of the public opinion, a new environmental value system, government regulation, but above all, the search for an economic development within the context of environmental protection. The reasons for prevention are fundamental: profit from a new economic frontier; reduced potential for civil and criminal liability; and the effective and economic protection of the environment. This paper addresses, among other relevant issues, the following topics: justification and objective of pollution prevention; strategy and methodology for its implementation; examples of successes and tools; benefits and barriers and some recommendation

  6. Content addressable memories in scientific instruments

    International Nuclear Information System (INIS)

    Lotto, I. de; Golinelli, S.

    1975-01-01

    The content-addressable-memory feature of a new system designed in these laboratories for non-destructive testing of nuclear reactor pressure vessels based on acoustic emission analysis is presented. The content addressable memory is divided into two parts: the first selects the most frequent events among incoming ones (FES: Frequent Event Selection memory), the second stores the frequent events singled out (FEM: Frequent Event Memory). The statistical behaviour of FES is analyzed, and experimental results are compared with theoretical ones; the model presented proved to be a useful tool in dimensioning the instrument store capacity. (Auth.)

  7. ADDRESS SEQUENCES FOR MULTI RUN RAM TESTING

    Directory of Open Access Journals (Sweden)

    V. N. Yarmolik

    2014-01-01

    Full Text Available A universal approach for generation of address sequences with specified properties is proposed and analyzed. A modified version of the Antonov and Saleev algorithm for Sobol sequences genera-tion is chosen as a mathematical description of the proposed method. Within the framework of the proposed universal approach, the Sobol sequences form a subset of the address sequences. Other sub-sets are also formed, which are Gray sequences, anti-Gray sequences, counter sequences and sequenc-es with specified properties.

  8. World Federation of Vascular Societies: presidential address

    DEFF Research Database (Denmark)

    Sillesen, Henrik Hegaard

    2010-01-01

    The presidential address describes briefly the history of the World Federation for Vascular Societies (WFVS) and its objectives. Vascular Surgery today includes interventional procedures (open surgical and endovascular) in addition to risk factor reduction and medical treatment. It is equally imp...... throughout the world. In addition, for introduction of new treatments, training issues and dissemination of science a global organisation like the WFVS is needed.......The presidential address describes briefly the history of the World Federation for Vascular Societies (WFVS) and its objectives. Vascular Surgery today includes interventional procedures (open surgical and endovascular) in addition to risk factor reduction and medical treatment. It is equally...

  9. Addressing techniques of liquid crystal displays

    CERN Document Server

    Ruckmongathan, Temkar N

    2014-01-01

    Unique reference source that can be used from the beginning to end of a design project to aid choosing an appropriate LCD addressing technique for a given application This book will be aimed at design engineers who are likely to embed LCD drivers and controllers in many systems including systems on chip. Such designers face the challenge of making the right choice of an addressing technique that will serve them with best performance at minimal cost and complexity. Readers will be able to learn about various methods available for driving matrix LCDs and the comparisons at the end of each chap

  10. Addressing Parental Vaccine Concerns: Engagement, Balance, and Timing.

    Directory of Open Access Journals (Sweden)

    Jason M Glanz

    2015-08-01

    Full Text Available The recent United States measles epidemic has sparked another contentious national discussion about childhood vaccination. A growing number of parents are expressing concerns about the safety of vaccines, often fueled by misinformation from the internet, books, and other nonmedical sources. Many of these concerned parents are choosing to refuse or delay childhood vaccines, placing their children and surrounding communities at risk for serious diseases that are nearly 100% preventable with vaccination. Between 10% and 15% of parents are asking physicians to space out the timing of vaccines, which often poses an ethical dilemma for physicians. This trend reflects a tension between personal liberty and public health, as parents fight to control the decisions that affect the health of their children and public health officials strive to maintain high immunization rates to prevent outbreaks of vaccine-preventable diseases. Interventions to address this emerging public health issue are needed. We describe a framework by which web-based interventions can be used to help parents make evidence-based decisions about childhood vaccinations.

  11. Preventing Informal Urban Development

    DEFF Research Database (Denmark)

    Enemark, Stig; McLaren, Robin

    2008-01-01

    . This is directly linked to citizen participation in the process of land use control. Decentralisation should aim to combine responsibility for decision making with accountability for financial, social, and environmental consequences. Decentralisation requires access to appropriate quality of land information......, addresses the main issue of how to prevent informal urban development, especially through the use of adequate and sustainable means of land use control and good governance. Three key means are addressed: Decentralisation: There is a need to separate central policy/regulation making and local decision making...... in the decision making process? Legislation in itself is not enough. A cultural change within society may need to be encouraged. Again, access to participation requires access to land information. Comprehensive planning at local level supported by citizen participation should also enable establishment proper...

  12. ADDRESSING THE RISKS OF GLOBAL PRODUCT DEVELOPMENT

    DEFF Research Database (Denmark)

    Hansen, Zaza Nadja Lee; Ahmed-Kristensen, Saeema

    2011-01-01

    to rework, misunderstandings, miscommunication and lower quality. This paper investigates how the organisation can reduce the negative aspects of offshoring by presenting two possible approaches; one which lessens the exposure to situations in which these negative impacts happen and another which addresses...

  13. Addressing Diversity: A Call for Action.

    Science.gov (United States)

    Henderson, Ingeborg

    1991-01-01

    Suggests a series of steps that individuals in the foreign language profession can take to effectively address the issue of demographic changes in the U.S. college student populations and keeping foreign language learning a feasible discipline in the future. (26 references) (GLR)

  14. Addressing food waste reduction in Denmark

    DEFF Research Database (Denmark)

    Halloran, Afton Marina Szasz; Clement, Jesper; Kornum, Niels

    2014-01-01

    , improvements in technology have made it more efficient to utilize food waste for biogas and compost, which improves nutrient cycling through the food system. Major efforts to address food waste in Denmark have mainly been promoted through civil society groups with governmental support, as well as by industry...

  15. 40 CFR 65.14 - Addresses.

    Science.gov (United States)

    2010-07-01

    ... 75202. Region VII (Iowa, Kansas, Missouri, Nebraska), Director, Air and Toxics Division, U.S. Environmental Protection Agency, 726 Minnesota Avenue, Kansas City, Kansas 66101. Region VIII (Colorado, Montana... authority has been delegated under section 112(l) of the Act. The mailing addresses for State agencies are...

  16. Addressing the Global Burden of Breast Cancer

    Science.gov (United States)

    The US National Cancer Institute’s Center for Global Health (CGH) has been a key partner in a multi-institutional expert team that has developed a set of publications to address foundational concerns in breast cancer care across the cancer care continuum and within limited resource settings.

  17. Addressing production stops in the food industry

    DEFF Research Database (Denmark)

    Hansen, Zaza Nadja Lee; Herbert, Luke Thomas; Jacobsen, Peter

    2014-01-01

    This paper investigates the challenges in the food industry which causes the production lines to stop, illustrated by a case study of an SME size company in the baked goods sector in Denmark. The paper proposes key elements this sector needs to be aware of to effectively address production stops......, and gives examples of the unique challenges faced by the SME food industry....

  18. Rational Rhymes for Addressing Common Childhood Issues

    Science.gov (United States)

    Warren, Jeffrey M.

    2011-01-01

    Music-based interventions are valuable tools counselors can use when working with children. Specific types of music-based interventions, such as songs or rhymes, can be especially pertinent in addressing the thoughts, feelings, and behaviors of children. Rational-emotive behavior therapy (REBT) provides a therapeutic framework that encourages…

  19. 76 FR 80903 - Mandatory Declassification Review Addresses

    Science.gov (United States)

    2011-12-27

    ... John J. Kingman Road, Fort Belvoir, VA 22060-6201. (13) Missile Defense Agency. Missile Defense Agency... DEPARTMENT OF DEFENSE Office of the Secretary Mandatory Declassification Review Addresses AGENCY: Department of Defense. ACTION: Notice. SUMMARY: Pursuant to the Information Security Oversight Office's...

  20. Addressing Student Debt in the Classroom

    Science.gov (United States)

    Perkins, David; Johnston, Tim; Lytle, Rick

    2016-01-01

    Student debt is a national concern. The authors address debt in the classroom to enhance students' understanding of the consequences of debt and the need for caution when financing their education. However, student feedback indicates this understanding has a delayed effect on borrowing behavior and underscores the importance of making difficult…

  1. 37 CFR 301.2 - Official addresses.

    Science.gov (United States)

    2010-07-01

    ..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...

  2. Registering Names and Addresses for Information Technology.

    Science.gov (United States)

    Knapp, Arthur A.

    The identification of administrative authorities and the development of associated procedures for registering and accessing names and addresses of communications data systems are considered in this paper. It is noted that, for data communications systems using standards based on the Open Systems Interconnection (OSI) Reference Model specified by…

  3. Addressing Measurement Issues Related to Bullying Involvement

    Science.gov (United States)

    Casper, Deborah M.; Meter, Diana J.; Card, Noel A.

    2015-01-01

    In this article, we address measurement issues related to select aspects of bullying involvement with the goal of moving psychometrically sound measurement practices toward applied bullying research. We first provide a nontechnical introduction to psychometric considerations in measuring bullying involvement, highlighting the importance of…

  4. Volume 1: president's address, CNA committee reports

    International Nuclear Information System (INIS)

    The president's address summarizes the 1974-75 activities of the CNA and reports are given by CNA subcommittees on codes, standards and practices, economic development, education and manpower, international affairs, nuclear insurance, nuclear safety and environment, public relations, and technology. (E.C.B.)

  5. How Sociology Texts Address Gun Control

    Science.gov (United States)

    Tonso, William R.

    2004-01-01

    William R. Tonso has chosen an issue that he knows something about to examine how sociology textbooks address controversy. Appealing for gun control is fashionable, but it is at odds with a fondness that ordinary Americans have for their firearms--one that is supported by a growing body of research on deterrence to crime. There are two sides to…

  6. Transition through Teamwork: Professionals Address Student Access

    Science.gov (United States)

    Bube, Sue Ann; Carrothers, Carol; Johnson, Cinda

    2016-01-01

    Prior to 2013, there was no collaboration around the transition services for deaf and hard of hearing students in Washington State. Washington had numerous agencies providing excellent support, but those agencies were not working together. It was not until January 29, 2013, when pepnet 2 hosted the Building State Capacity to Address Critical…

  7. Programming chemistry in DNA-addressable bioreactors

    DEFF Research Database (Denmark)

    Fellermann, H.; Cardelli, L.

    2014-01-01

    . These markers serve as compartment addresses and allow for their targeted transport and fusion, thereby enabling reactions of previously separated chemicals. The overall system organization allows for the set-up of programmable chemistry in microfluidic or other automated environments. We introduce a simple...

  8. THE ROLE OF NUTRITIONAL INFORMATION IN ADDRESSING ...

    African Journals Online (AJOL)

    The paper discusses the role of nutritional information for addressing under-five child malnutrition in Tanzania. The paper is based on a master's dissertation whose objective was to determine the sources of nutritional information used to provide nutritional information to mothers in Maternal and Child Health (MCH) clinics, ...

  9. Prevent Pneumonia

    Centers for Disease Control (CDC) Podcasts

    2015-08-06

    CDC’s Matthew Westercamp explains what pneumonia is, its symptoms, and how to prevent it.  Created: 8/6/2015 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Bacterial Diseases (DBD), Respiratory Diseases Branch (RDB).   Date Released: 8/6/2015.

  10. Prevention: Exercise

    Medline Plus

    Full Text Available ... Information Feature Articles Patient Q&A Success Stories Definitions Anatomy of the Spine Definitions A-Z Spine Specialists Videos 9 for Spine Epidural Steroid Injections Exercise: The Backbone of Spine Treatment Spondylolisthesis BLOG FIND A SPECIALIST Prevention ...

  11. Suicide Prevention

    Science.gov (United States)

    ... corresponding to World Suicide Prevention Day, to celebrate life, hope, and reasons to live. SAMHSA is committed to ... members, and helping people navigate the struggles of life to find a sustainable sense of hope, meaning, and purpose. For information about how you ...

  12. Bullying Prevention

    Science.gov (United States)

    Kemp, Patrice

    2016-01-01

    The focus of the milestone project is to focus on bridging the gap of bullying and classroom instruction methods. There has to be a defined expectations and level of accountability that has to be defined when supporting and implementing a plan linked to bullying prevention. All individuals involved in the student's learning have to be aware of…

  13. GIS, Pollution Prevention and Public Health

    Science.gov (United States)

    Using examples of preventing pollution and reducing risk of exposure to communities, this guide answers basic interest and start-up questions, addresses benefits and limitations and illustrates the value of GIS for local health departments.

  14. primary prevention of mental, neurological and psychosocial

    African Journals Online (AJOL)

    92-4-. 154516X. This well written book addresses the primary prevention of ... a broad, public health perspective. ... suicide include gun control, gas detoxification and responsible ... It will be most useful for policy makers, and professionals and.

  15. Addressing Tooth Decay in Head Start Children

    Science.gov (United States)

    Knowlden, Adam P.; Hill, Lawrence F.; Alles-White, Monica L.; Cottrell, Randall R.

    2012-01-01

    Tooth decay is the most prevalent chronic disease of childhood. Oral health education and dental services are crucial to reducing the number of children afflicted with dental cavities. Due to limited access to preventative care, Head Start children are particularly vulnerable to tooth decay. This article outlines practical implications of a…

  16. addressing environmental contamination through market regulations

    African Journals Online (AJOL)

    RAYAN_

    Safety Act for the 21st Century provides unique opportunities for preventing ... Toxics. ** A student at Florida A&M College of Law, Juris Doctor candidate, class of 2017. ... evaluates pre-manufacturing notifications (PMNs) for new chemical substances ..... 65 World Health Organization,GLP Guideline Handbook(World Health.

  17. Image Coding Based on Address Vector Quantization.

    Science.gov (United States)

    Feng, Yushu

    Image coding is finding increased application in teleconferencing, archiving, and remote sensing. This thesis investigates the potential of Vector Quantization (VQ), a relatively new source coding technique, for compression of monochromatic and color images. Extensions of the Vector Quantization technique to the Address Vector Quantization method have been investigated. In Vector Quantization, the image data to be encoded are first processed to yield a set of vectors. A codeword from the codebook which best matches the input image vector is then selected. Compression is achieved by replacing the image vector with the index of the code-word which produced the best match, the index is sent to the channel. Reconstruction of the image is done by using a table lookup technique, where the label is simply used as an address for a table containing the representative vectors. A code-book of representative vectors (codewords) is generated using an iterative clustering algorithm such as K-means, or the generalized Lloyd algorithm. A review of different Vector Quantization techniques are given in chapter 1. Chapter 2 gives an overview of codebook design methods including the Kohonen neural network to design codebook. During the encoding process, the correlation of the address is considered and Address Vector Quantization is developed for color image and monochrome image coding. Address VQ which includes static and dynamic processes is introduced in chapter 3. In order to overcome the problems in Hierarchical VQ, Multi-layer Address Vector Quantization is proposed in chapter 4. This approach gives the same performance as that of the normal VQ scheme but the bit rate is about 1/2 to 1/3 as that of the normal VQ method. In chapter 5, a Dynamic Finite State VQ based on a probability transition matrix to select the best subcodebook to encode the image is developed. In chapter 6, a new adaptive vector quantization scheme, suitable for color video coding, called "A Self -Organizing

  18. Forms of Address as Discrete Modal Operators

    Directory of Open Access Journals (Sweden)

    Wojciech Paweł Sosnowski

    2016-12-01

    Full Text Available Forms of Address as Discrete Modal Operators The category of expressions of politeness includes, among others, forms of address. Forms of address express honorification. Honorification can be defined as a special type of meaning that consists of information about the social and interpersonal relations between the speaker and the addressee, the speaker and the hearer, and the speaker and the protagonist of the predication. As far as their place in the syntactic structure is concerned, forms of address can either be integrated with the other elements of a predication or not. However, they are always part of a predication’s semantic structure. Moreover, forms of address convey the speaker’s attitude to the meaning of the predicate that they want to convey, which consequently means that forms of address also carry a modal element. Modality can be defined as a situation in which an individual is in a particular mental state, i.e. exhibits some kind of attitude to a situation or a type of situations. Forms of address can be categorised as modal operators conveying imperatives, requests, suppositions, etc. The term "operator" can be used for a unit of language when it changes the semantic structure of the predication. My research on honorification is mainly based on contemporary corpora, both monolingual and multilingual. In the present study, I analyse forms of address which carry imperative and optative meanings.   Formy adresatywne jako dyskretne operatory modalne W obrębie wyrażeń realizujących funkcje grzecznościowe znajduje się grupa form adresatywnych. Są one częścią kategorii honoryfikatywności rozumianej jako szczególny rodzaj znaczenia zawartego w treści wypowiedzi, informację o towarzysko-społecznej relacji między nadawcą a odbiorcą, nadawcą a słuchaczem oraz nadawcą a bohaterem wypowiedzi. Gramatycznie formy adresatywne mogą być zarówno zintegrowane, jak i niezintegrowane syntaktycznie z resztą wypowiedzi, ale

  19. Addressing mixed waste in plutonium processing

    International Nuclear Information System (INIS)

    Christensen, D.C.; Sohn, C.L.; Reid, R.A.

    1991-01-01

    The overall goal is the minimization of all waste generated in actinide processing facilities. Current emphasis is directed toward reducing and managing mixed waste in plutonium processing facilities. More specifically, the focus is on prioritizing plutonium processing technologies for development that will address major problems in mixed waste management. A five step methodological approach to identify, analyze, solve, and initiate corrective action for mixed waste problems in plutonium processing facilities has been developed

  20. Do pediatric gastroenterology doctors address pediatric obesity?

    OpenAIRE

    Batra, Suruchi; Yee, Caitlin; Diez, Bernadette; Nguyen, Nicholas; Sheridan, Michael J; Tufano, Mark; Sikka, Natalie; Townsend, Stacie; Hourigan, Suchitra

    2017-01-01

    Objectives: To assess how often obesity is acknowledged at pediatric gastroenterology outpatient visits. Methods: A retrospective chart review was performed to identify obese children seen at a gastroenterology subspecialty clinic over a 1-year period of time; 132 children were identified. Demographics, obesity comorbidities, reasons for referral, diagnosis of obesity, and a plan to address obesity were abstracted. Chi-square or Fisher?s exact tests were used to examine statistical associatio...

  1. Forest Policies Addressing Climate Change in China

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    As a developing country with a large population and a fragile ecological environment, China is particularly vulnerable to the adverse effects of climate change. Beginning with the Rio Conference of 1992 China has played a progressively enhanced role in combating climate change. A series of policies and measures to address climate change have been taken in the overall context of national sustainable development strategy, making positive contributions to the mitigation and adaptation to climate change, among ...

  2. Opening address; Allocution d`ouverture

    Energy Technology Data Exchange (ETDEWEB)

    Carle, R

    1996-12-31

    In this opening address the president of WANO underlines the relative isolation of the Kozloduy NPP from the international nuclear community due to the lack of information and contacts. The need for eliminating the isolation is stressed and the following measures are proposed: to make the Kozloduy NPP an active member of the international community; to improve and maintain the safety level; to contribute to the electricity exchange system of Southeastern Europe.

  3. Addressing consumerization of IT risks with nudging

    OpenAIRE

    Iryna Yevseyeva; James Turland; Charles Morisset; Lynne Coventry; Thomas Groß

    2015-01-01

    In this work we address the main issues of Information Technology (IT) consumerisation that are related to security risks, and vulnerabilities of devices used within Bring Your Own Device (BYOD) strategy in particular. We propose a ‘soft’ mitigation strategy for user actions based on nudging, widely applied to health and social behaviour influence. In particular, we propose a complementary, less strict, more flexible Information Security policies, based on risk assessment of device vulnerabil...

  4. Transformed composite sequences for improved qubit addressing

    Science.gov (United States)

    Merrill, J. True; Doret, S. Charles; Vittorini, Grahame; Addison, J. P.; Brown, Kenneth R.

    2014-10-01

    Selective laser addressing of a single atom or atomic ion qubit can be improved using narrow-band composite pulse sequences. We describe a Lie-algebraic technique to generalize known narrow-band sequences and introduce sequences related by dilation and rotation of sequence generators. Our method improves known narrow-band sequences by decreasing both the pulse time and the residual error. Finally, we experimentally demonstrate these composite sequences using 40Ca+ ions trapped in a surface-electrode ion trap.

  5. Activities to Address Challenges in Digital Innovation

    OpenAIRE

    Lund , Jesper

    2014-01-01

    Part 3: Structures and Networks; International audience; Based on a literature review, this paper identifies four socio-technical challenges relating to innovation actor’s interactions in digital innovation. Furthermore, the paper explores how these challenges can be addressed. The challenges are investigated in a case study of digital innovation. The study is based on a two year long research and development project where an e-newspaper concept and a demonstrator based on e-paper technology ...

  6. Community Changes Address Common Health Threat

    Centers for Disease Control (CDC) Podcasts

    2013-09-30

    This podcast helps residents living in multiunit housing, like apartments and condos, understand the threat of secondhand smoke. It also helps residents understand what steps they can take to breathe a little easier if involuntarily exposed to secondhand smoke.  Created: 9/30/2013 by Division of Community Health, National Center for Chronic Disease Prevention and Health Promotion.   Date Released: 9/30/2013.

  7. Addressing the Mental Health Needs of Pregnant and Parenting Adolescents

    Science.gov (United States)

    Beers, Lee; Southammakosane, Cathy; Lewin, Amy

    2014-01-01

    Adolescent parenthood is associated with a range of adverse outcomes for young mothers, including mental health problems such as depression, substance abuse, and posttraumatic stress disorder. Teen mothers are also more likely to be impoverished and reside in communities and families that are socially and economically disadvantaged. These circumstances can adversely affect maternal mental health, parenting, and behavior outcomes for their children. In this report, we provide an overview of the mental health challenges associated with teen parenthood, barriers that often prevent teen mothers from seeking mental health services, and interventions for this vulnerable population that can be integrated into primary care services. Pediatricians in the primary care setting are in a unique position to address the mental health needs of adolescent parents because teens often turn to them first for assistance with emotional and behavioral concerns. Consequently, pediatricians can play a pivotal role in facilitating and encouraging teen parents’ engagement in mental health treatment. PMID:24298010

  8. Ionic liquids for addressing unmet needs in healthcare

    Science.gov (United States)

    Agatemor, Christian; Ibsen, Kelly N.; Tanner, Eden E. L.

    2018-01-01

    Abstract Advances in the field of ionic liquids have opened new applications beyond their traditional use as solvents into other fields especially healthcare. The broad chemical space, rich with structurally diverse ions, and coupled with the flexibility to form complementary ion pairs enables task‐specific optimization at the molecular level to design ionic liquids for envisioned functions. Consequently, ionic liquids now are tailored as innovative solutions to address many problems in medicine. To date, ionic liquids have been designed to promote dissolution of poorly soluble drugs and disrupt physiological barriers to transport drugs to targeted sites. Also, their antimicrobial activity has been demonstrated and could be exploited to prevent and treat infectious diseases. Metal‐containing ionic liquids have also been designed and offer unique features due to incorporation of metals. Here, we review application‐driven investigations of ionic liquids in medicine with respect to current status and future potential. PMID:29376130

  9. Bullying Prevention and the Parent Involvement Model

    Science.gov (United States)

    Kolbert, Jered B.; Schultz, Danielle; Crothers, Laura M.

    2014-01-01

    A recent meta-analysis of bullying prevention programs provides support for social-ecological theory, in which parent involvement addressing child bullying behaviors is seen as important in preventing school-based bullying. The purpose of this manuscript is to suggest how Epstein and colleagues' parent involvement model can be used as a…

  10. Domain 2: Sport Safety and Injury Prevention

    Science.gov (United States)

    Gurchiek, Larry; Mokha, Monique Butcher

    2004-01-01

    Most coaches recognize the importance of creating a safe environment and preventing injuries of their athletes. Domain 2 is dedicated to this important aspect of coaching, and outlines specific areas within safety and injury prevention that coaches should address. Domain 2 sets the standards for facility, equipment, and environmental safety…

  11. Overview of an address and purpose of the workshop [ISO Workshop on address standards: Considering the issues related to an international address standard

    CSIR Research Space (South Africa)

    Cooper, Antony K

    2008-05-01

    Full Text Available ) (ISO 19112) Precision Redirectable Standards Postal address Street delivery address Y N N Y N Y Fine Y UPU S42 PO Box or Private Bag Y N N Y Fine to Coarse Y UPU S42 Post Restante Y N N Y N Y Coarse Y UPU S42 Delivery address... (for goods, etc) Street address Y N N Y N Y Fine N Intersection address Y N N Y N Y Fine N Landmark address Y N N Y N Y Fine to Moderate N Building address Y N N Y N Y Fine N Site address Y N N Y N Y Fine to Coarse N Farm...

  12. MATCHING ALTERNATIVE ADDRESSES: A SEMANTIC WEB APPROACH

    Directory of Open Access Journals (Sweden)

    S. Ariannamazi

    2015-12-01

    Full Text Available Rapid development of crowd-sourcing or volunteered geographic information (VGI provides opportunities for authoritatives that deal with geospatial information. Heterogeneity of multiple data sources and inconsistency of data types is a key characteristics of VGI datasets. The expansion of cities resulted in the growing number of POIs in the OpenStreetMap, a well-known VGI source, which causes the datasets to outdate in short periods of time. These changes made to spatial and aspatial attributes of features such as names and addresses might cause confusion or ambiguity in the processes that require feature’s literal information like addressing and geocoding. VGI sources neither will conform specific vocabularies nor will remain in a specific schema for a long period of time. As a result, the integration of VGI sources is crucial and inevitable in order to avoid duplication and the waste of resources. Information integration can be used to match features and qualify different annotation alternatives for disambiguation. This study enhances the search capabilities of geospatial tools with applications able to understand user terminology to pursuit an efficient way for finding desired results. Semantic web is a capable tool for developing technologies that deal with lexical and numerical calculations and estimations. There are a vast amount of literal-spatial data representing the capability of linguistic information in knowledge modeling, but these resources need to be harmonized based on Semantic Web standards. The process of making addresses homogenous generates a helpful tool based on spatial data integration and lexical annotation matching and disambiguating.

  13. Best Practices in Hiring: Addressing Unconscious Bias

    Science.gov (United States)

    Simpson, Caroline E.

    2012-01-01

    Research has shown that implementing certain hiring practices will increase diversity in the workplace while enhancing academic quality. All of these practices rely on addressing the issue of 'unconscious bias.' A brief overview of unconscious bias--what it is, how it works, and simple measures to counter it--will be presented. Successful strategies, actions, and recommendations for implementing best recruiting and hiring practices, which have been proven to enhance academic excellence by ensuring a deep and diverse applicant pool, will also be presented.

  14. Building technology services that address student needs.

    Science.gov (United States)

    Le Ber, Jeanne M; Lombardo, Nancy T; Wimmer, Erin

    2015-01-01

    A 16-question technology use survey was conducted to assess incoming health sciences students' knowledge of and interest in current technologies, and to identify student device and tool preferences. Survey questions were developed by colleagues at a peer institution and then edited to match this library's student population. Two years of student responses have been compiled, compared, and reviewed as a means for informing library decisions related to technology and resource purchases. Instruction and event programming have been revised to meet student preferences. Based on the number of students using Apple products, librarians are addressing the need to become more proficient with this platform.

  15. HEP technologies to address medical imaging challenges

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    Developments in detector technologies aimed at solving challenges in present and future CERN experiments, particularly at the LHC, have triggered exceptional advances in the performance of medical imaging devices, allowing for a spectacular progress in in-vivo molecular imaging procedures, which are opening the way for tailored therapies of major diseases. This talk will briefly review the recent history of this prime example of technology transfer from HEP experiments to society, will describe the technical challenges being addressed by some ongoing projects, and will present a few new ideas for further developments and their foreseeable impact.

  16. Addressing Circuitous Currents MVDC Power Systems Protection

    Science.gov (United States)

    2017-12-31

    Addressing Circuitous Currents MVDC Power Systems Protection 5b. GRANT NUMBER N00014-16-1-3113 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR($) Sd. PROJECT NUMBER...efficiency. A challenge with DC distribution is electrical protection . Z-source DC breakers alt! an pti n b&i g cvr.sidcrcd and this w rk ~xplores...zonal distribution, electric ship 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF a. REPORT b. ABSTRACT c. THIS PAGE ABSTRACT u u u uu 18. NUMBER

  17. Validation of Housing Standards Addressing Accessibility

    DEFF Research Database (Denmark)

    Helle, Tina

    2013-01-01

    The aim was to explore the use of an activity-based approach to determine the validity of a set of housing standards addressing accessibility. This included examination of the frequency and the extent of accessibility problems among older people with physical functional limitations who used...... participant groups were examined. Performing well-known kitchen activities was associated with accessibility problems for all three participant groups, in particular those using a wheelchair. The overall validity of the housing standards examined was poor. Observing older people interacting with realistic...... environments while performing real everyday activities seems to be an appropriate method for assessing accessibility problems....

  18. Addressing Longevity’ Heterogeneity in Pension Scheme Design

    OpenAIRE

    Ayuso, Mercedes; Bravo, Jorge Miguel; Holzmann, Robert

    2017-01-01

    Ayuso, M., Bravo, J. M., & Holzmann, R. (2017). Addressing Longevity’ Heterogeneity in Pension Scheme Design. Journal of Finance and Economics, 6(1), 1-21. DOI: 10.12735/jfe.v6n1p1 This paper demonstrates that the link between heterogeneity in longevity and lifetime income across countries is mostly high and often increasing; that it translates into an implicit tax/subsidy, with rates reaching 20 percent and higher in some countries; that such rates risk perverting redistributive objective...

  19. Allergy prevention.

    Science.gov (United States)

    Muche-Borowski, Cathleen; Kopp, Matthias; Reese, Imke; Sitter, Helmut; Werfel, Thomas; Schäfer, Torsten

    2010-09-01

    The further increase of allergies in industrialized countries demands evidence-based measures of primary prevention. The recommendations as published in the guideline of 2004 were updated and consented on the basis of a systematic literature search. Evidence from the period February 2003-May 2008 was searched in the electronic databases Cochrane and MEDLINE as well as in reference lists of recent reviews and by contacting experts. The retrieved citations were screened for relevance first by title and abstract and in a second step as full paper. Levels of evidence were assigned to each included study and the methodological quality of the studies was assessed as high or low. Finally the revised recommendations were formally consented (nominal group process) by representatives of relevant societies and organizations including a self-help group. Of originally 4556 hits, 217 studies (4 Cochrane Reviews, 14 meta-analyses, 19 randomized controlled trials, 135 cohort and 45 case-control studies) were included and critically appraised. Grossly unchanged remained the recommendations on avoiding environmental tobacco smoke, breast-feeding over 4 months (alternatively hypoallergenic formulas for children at risk), avoiding a mold-promoting indoor climate, vaccination according to current recommendations, and avoidance of furry pets (especially cats) in children at risk. The recommendation on reducing the house dust mite allergen exposure as a measure of primary prevention was omitted and the impact of a delayed introduction of supplementary food was reduced. New recommendations were adopted concerning fish consumption (during pregnancy / breast-feeding and as supplementary food in the first year), avoidance of overweight, and reducing the exposure to indoor and outdoor air pollutants. The revision of this guideline on a profound evidence basis led to (1) a confirmation of existing recommendations, (2) substantial revisions, and (3) new recommendations. Thereby it is possible

  20. Preventing violence against women and girls

    OpenAIRE

    Flood, Michael

    2014-01-01

    Efforts to prevent and reduce men's violence against women increasingly include an emphasis on engaging men and boys in primary prevention. Boys and men have been addressed as participants in education programs in schools and universities, as community leaders, as activists, and as policy makers. There is a substantial body of evidence that violence prevention interventions focused on men and boys, if done well, can change the attitudes and behaviours associated with perpetration. Efforts to ...

  1. Back to Basics: Preventing Surgical Fires.

    Science.gov (United States)

    Spruce, Lisa

    2016-09-01

    When fires occur in the OR, they are devastating and potentially fatal to both patients and health care workers. Fires can be prevented by understanding the fire triangle and methods of reducing fire risk, conducting fire risk assessments, and knowing how to respond if a fire occurs. This Back to Basics article addresses the basics of fire prevention and the steps that can be taken to prevent fires from occurring. Copyright © 2016 AORN, Inc. Published by Elsevier Inc. All rights reserved.

  2. Addressing firefighter safety around solar PV systems

    Energy Technology Data Exchange (ETDEWEB)

    Harris, B. [Sustainable Energy Technologies, Calgary, AB (Canada)

    2010-11-15

    The article discussed new considerations for installing photovoltaic (PV) systems that address the needs of fire service personnel. The presence of a PV system presents a multitude of dangers for firefighters, including electrical shock, the inhalation of toxic gases from being unable to cut a hole through the roof, falling debris and flying glass, and dead loading on a compromised structure and tripping on conduits. Mapping systems should be modified so that buildings with PV systems are identified for first responders, including firefighters who should learn that solar modules present an electrical hazard during the day but not at night; covering PV modules with foam or salvage covers may not shut the system down to a safe level; it takes a few moments for the power in PV modules to reduce to zero; and PV modules or conduit should never be cut, broke, chopped, or walked upon. The California Department of Forestry and Fire Protection recommends creating pathways and allowing easier access to the roof by setting the modules back from roof edges, creating a structurally sound pathway for firefighters to walk on and space to cut ventilation holes. However, the setback rule makes the economics of solar installation less viable for residential applications. The technological innovations aimed at addressing system safety all focus on limiting firefighter contact with live electrical components to within the extra-low-voltage (ELV) band. Some of the inverters on the market that support ELV system architecture were described. 1 fig.

  3. Intersectionality: An Understudied Framework for Addressing Weight Stigma.

    Science.gov (United States)

    Himmelstein, Mary S; Puhl, Rebecca M; Quinn, Diane M

    2017-10-01

    Obesity is an ongoing public health concern in the U.S. Weight stigma is linked to a number of obesogenic health outcomes, which complicate obesity treatment and prevention. Despite higher rates of obesity in female and minority populations, little research has examined weight stigma in non-white women and men. This study investigated intersectionality in weight stigma and health-related coping responses to stigmatizing experiences across racial groups. In 2015, a total of 2,378 adults completed questionnaires about weight stigma, weight bias internalization, and coping strategies. Analyses were conducted in 2016. No differences in weight stigma emerged as a function of race or gender, but women reported higher weight bias internalization (B=0.19, p=0.004). Further, black men and women reported less weight bias internalization than white men and women (B=-0.43, p=0.009). Compared with white women, black women were less likely to cope with stigma using disordered eating (B=-0.57, p=0.001), whereas Hispanic women were more likely to cope with stigma using disordered eating (B=0.39, p=0.020). Black men were more likely than white men to cope with stigma via eating (B=-0.49, p=0.017). Findings highlight that weight stigma is equally present across racial groups, but that groups internalize and cope with stigma in different ways, which exacerbate health risks. Increased research and policy attention should address stigma as an obstacle in prevention and treatment for obesity to reduce weight-based inequities in underserved populations. Copyright © 2017 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  4. Policy options to stimulate social innovation initiatives addressing food waste prevention and reduction

    NARCIS (Netherlands)

    Vittuari, Matteo; Gaiani, Silvia; Politano, Alessandro; Timmermans, A.J.M.; Bos-Brouwers, H.E.J.

    2016-01-01

    The report builds on the knowledge created by the FUSIONS position paper “Stimulating social innovation through policy measures” that uses as key inputs the range of existing social innovation initiatives catalogued by FUSIONS WP4 in the inventory and draws on the outcomes of the WP3 Social Camp

  5. Contemporary coronary intervention trialconduct : addressing the 4P's: Patency, Perfusion, Performance and Prevention

    NARCIS (Netherlands)

    P. Vranckx (Pascal)

    2012-01-01

    textabstractThe concern about how the effects of pharmacologic as well as device therapies are understood in clinical practice requires attention to the methods of randomized clinical trials, including the selection of meaningful clinical endpoints.

  6. 75 FR 28810 - Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Addressing...

    Science.gov (United States)

    2010-05-24

    ... Diseases and Related Public Health Concerns in India, Funding Opportunity Announcement (FOA) GH10-002... Public Health Concerns in India,'' FOA GH10-002. Contact Person for More Information: Hylan D. Shoob, PhD, M.S.P.H., Scientific Review Officer, CDC, 1600 Clifton Road, NE., Mailstop D72, Atlanta, GA 30333...

  7. Addressing submarine geohazards through scientific drilling

    Science.gov (United States)

    Camerlenghi, A.

    2009-04-01

    Natural submarine geohazards (earthquakes, volcanic eruptions, landslides, volcanic island flank collapses) are geological phenomena originating at or below the seafloor leading to a situation of risk for off-shore and on-shore structures and the coastal population. Addressing submarine geohazards means understanding their spatial and temporal variability, the pre-conditioning factors, their triggers, and the physical processes that control their evolution. Such scientific endeavour is nowadays considered by a large sector of the international scientific community as an obligation in order to contribute to the mitigation of the potentially destructive societal effects of submarine geohazards. The study of submarine geohazards requires a multi-disciplinary scientific approach: geohazards must be studied through their geological record; active processes must be monitored; geohazard evolution must be modelled. Ultimately, the information must be used for the assessment of vulnerability, risk analysis, and development of mitigation strategies. In contrast with the terrestrial environment, the oceanic environment is rather hostile to widespread and fast application of high-resolution remote sensing techniques, accessibility for visual inspection, sampling and installation of monitoring stations. Scientific Drilling through the IODP (including the related pre site-survey investigations, sampling, logging and in situ measurements capability, and as a platform for deployment of long term observatories at the surface and down-hole) can be viewed as the centre of gravity of an international, coordinated, multi-disciplinary scientific approach to address submarine geohazards. The IODP Initial Science Plan expiring in 2013 does not address openly geohazards among the program scientific objectives. Hazards are referred to mainly in relation to earthquakes and initiatives towards the understanding of seismogenesis. Notably, the only drilling initiative presently under way is the

  8. Event generators for address event representation transmitters

    Science.gov (United States)

    Serrano-Gotarredona, Rafael; Serrano-Gotarredona, Teresa; Linares Barranco, Bernabe

    2005-06-01

    Address Event Representation (AER) is an emergent neuromorphic interchip communication protocol that allows for real-time virtual massive connectivity between huge number neurons located on different chips. By exploiting high speed digital communication circuits (with nano-seconds timings), synaptic neural connections can be time multiplexed, while neural activity signals (with mili-seconds timings) are sampled at low frequencies. Also, neurons generate 'events' according to their activity levels. More active neurons generate more events per unit time, and access the interchip communication channel more frequently, while neurons with low activity consume less communication bandwidth. In a typical AER transmitter chip, there is an array of neurons that generate events. They send events to a peripheral circuitry (let's call it "AER Generator") that transforms those events to neurons coordinates (addresses) which are put sequentially on an interchip high speed digital bus. This bus includes a parallel multi-bit address word plus a Rqst (request) and Ack (acknowledge) handshaking signals for asynchronous data exchange. There have been two main approaches published in the literature for implementing such "AER Generator" circuits. They differ on the way of handling event collisions coming from the array of neurons. One approach is based on detecting and discarding collisions, while the other incorporates arbitration for sequencing colliding events . The first approach is supposed to be simpler and faster, while the second is able to handle much higher event traffic. In this article we will concentrate on the second arbiter-based approach. Boahen has been publishing several techniques for implementing and improving the arbiter based approach. Originally, he proposed an arbitration squeme by rows, followed by a column arbitration. In this scheme, while one neuron was selected by the arbiters to transmit his event out of the chip, the rest of neurons in the array were

  9. Addressing health literacy in patient decision aids

    Science.gov (United States)

    2013-01-01

    Background Effective use of a patient decision aid (PtDA) can be affected by the user’s health literacy and the PtDA’s characteristics. Systematic reviews of the relevant literature can guide PtDA developers to attend to the health literacy needs of patients. The reviews reported here aimed to assess: 1. a) the effects of health literacy / numeracy on selected decision-making outcomes, and b) the effects of interventions designed to mitigate the influence of lower health literacy on decision-making outcomes, and 2. the extent to which existing PtDAs a) account for health literacy, and b) are tested in lower health literacy populations. Methods We reviewed literature for evidence relevant to these two aims. When high-quality systematic reviews existed, we summarized their evidence. When reviews were unavailable, we conducted our own systematic reviews. Results Aim 1: In an existing systematic review of PtDA trials, lower health literacy was associated with lower patient health knowledge (14 of 16 eligible studies). Fourteen studies reported practical design strategies to improve knowledge for lower health literacy patients. In our own systematic review, no studies reported on values clarity per se, but in 2 lower health literacy was related to higher decisional uncertainty and regret. Lower health literacy was associated with less desire for involvement in 3 studies, less question-asking in 2, and less patient-centered communication in 4 studies; its effects on other measures of patient involvement were mixed. Only one study assessed the effects of a health literacy intervention on outcomes; it showed that using video to improve the salience of health states reduced decisional uncertainty. Aim 2: In our review of 97 trials, only 3 PtDAs overtly addressed the needs of lower health literacy users. In 90% of trials, user health literacy and readability of the PtDA were not reported. However, increases in knowledge and informed choice were reported in those studies

  10. The Use of Guided Imagery as an Intervention in Addressing Nonsuicidal Self-Injury

    Science.gov (United States)

    Kress, Victoria E.; Adamson, Nicole; DeMarco, Carrie; Paylo, Matthew J.; Zoldan, Chelsey A.

    2013-01-01

    This article presents guided imagery as an intervention that can be used to address clients' nonsuicidal self-injurious behaviors. Guided imagery is a behavioral therapy technique that involves the use of positive thoughts or images to regulate negative emotional experiences, and it can be used to prevent and manage impulses to self-injure.…

  11. Briefly...Unplanned Pregnancy among College Students and Strategies to Address It

    Science.gov (United States)

    National Campaign to Prevent Teen and Unplanned Pregnancy, 2015

    2015-01-01

    As colleges strive to improve student success and completion, helping students delay pregnancy and parenting (or having additional children) means one less factor that can interfere with their college education. However, pregnancy planning and prevention is not something most colleges address, especially at the community college level. There are…

  12. A "Mindful Rational Living" Approach for Addressing HIV in the School Setting

    Science.gov (United States)

    Chenneville, Tiffany; St. John Walsh, Audra

    2016-01-01

    This paper describes a "mindful rational living" approach, which incorporates mindfulness techniques with rational emotive behavioral therapy strategies for addressing HIV in the school setting. The utility of this approach for attending to the physical, mental, and psychosocial aspects of school-based HIV prevention and treatment will…

  13. Adresse inconnue / Address unknown / Suchwiin Bulmyeong

    Directory of Open Access Journals (Sweden)

    Serge Gruzinski

    2005-03-01

    Full Text Available Tous les films asiatiques parlent de métissage, même ceux qui se présentent comme de vastes fresques historiques perdues dans le temps. Les emprunts aux traditions hollywoodiennes et européennes n'ont cessé d'enrichir une cinématographie aussi ancienne que celle du monde occidental. Dans Adresse inconnue (Address unknown le cinéaste coréen Kim Ki-duk explore l'expérience du métissage et le corps du métis à la frontière entre Corée du Nord et Corée du sud. Fils d'un GI américain et noir et d...

  14. Adresse inconnue / Address unknown / Suchwiin Bulmyeong

    OpenAIRE

    Serge Gruzinski

    2005-01-01

    Tous les films asiatiques parlent de métissage, même ceux qui se présentent comme de vastes fresques historiques perdues dans le temps. Les emprunts aux traditions hollywoodiennes et européennes n'ont cessé d'enrichir une cinématographie aussi ancienne que celle du monde occidental. Dans Adresse inconnue (Address unknown) le cinéaste coréen Kim Ki-duk explore l'expérience du métissage et le corps du métis à la frontière entre Corée du Nord et Corée du sud. Fils d'un GI américain et noir et d'...

  15. How is environmental conflict addressed by SIA?

    International Nuclear Information System (INIS)

    Barrow, C.J.

    2010-01-01

    The fields of Environmental Conflict Management (ECM), Environmental Conflict Resolution (ECR), and Peace and Conflict Impact Assessment (PCIA) have become well established; however, as yet there has not been much use of Social Impact Assessment (SIA) to manage environmental conflicts. ECM, ECR and PCIA are mainly undertaken when problems are advanced or, more likely, have run their course (post-conflict). This paper examines how conflict is addressed by SIA and whether there is potential to develop it for more proactive assessment of conflicts (pre-conflict or while things develop). SIA has the potential to identify and clarify the cause(s) of environmental and natural resources conflicts, and could possibly enable some avoidance or early mitigation. A promising approach may be for 'conflict-aware' SIA to watch for critical conflict stages or thresholds and to monitor stakeholders. Effective conflict-aware SIA might also significantly contribute to efforts to achieve sustainable development.

  16. Applying evolutionary biology to address global challenges

    Science.gov (United States)

    Carroll, Scott P.; Jørgensen, Peter Søgaard; Kinnison, Michael T.; Bergstrom, Carl T.; Denison, R. Ford; Gluckman, Peter; Smith, Thomas B.; Strauss, Sharon Y.; Tabashnik, Bruce E.

    2014-01-01

    Two categories of evolutionary challenges result from escalating human impacts on the planet. The first arises from cancers, pathogens and pests that evolve too quickly, and the second from the inability of many valued species to adapt quickly enough. Applied evolutionary biology provides a suite of strategies to address these global challenges that threaten human health, food security, and biodiversity. This review highlights both progress and gaps in genetic, developmental and environmental manipulations across the life sciences that either target the rate and direction of evolution, or reduce the mismatch between organisms and human-altered environments. Increased development and application of these underused tools will be vital in meeting current and future targets for sustainable development. PMID:25213376

  17. Addressing Safeguards Challenges for the Future

    Energy Technology Data Exchange (ETDEWEB)

    Majali, Raed; Yim, Man-Sung [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of)

    2015-10-15

    IAEA safeguard system is considered the corner stone of the international nuclear nonproliferation regime. Effective implementation of this legal instrument enables the IAEA to draw a conclusion with a high degree of confidence on the peaceful use of nuclear material and activities in the state. This paper aims to provide an opportunity to address various challenges encountered by IAEA. Strengthening safeguards system for verification is one of the most urgent challenges facing the IAEA. The IAEA should be able to provide credible assurance not only about declared use of nuclear material and facilities but also about the absence of undeclared material and activities. Implementation of IAEA safeguards continue to play a vital role within the nuclear non-proliferation regime. IAEA must move towards more enhanced safeguards system that is driven by the full use of all the safeguards available relevant information. Safeguards system must be responsive to evolving challenges and continue innovation through efficient implementations of more effective safeguards.

  18. Addressing Complexity in Environmental Management and Governance

    Directory of Open Access Journals (Sweden)

    Sabrina Kirschke

    2017-06-01

    Full Text Available Governance for complex problem solving has been increasingly discussed in environmental sustainability research. Above all, researchers continuously observe that sustainability problems are complex or “wicked”, and suggest participatory models to address these problems in practice. In order to add to this debate, this study suggests a more differentiated theoretical approach to define governance for complex environmental problem solving than in previous studies. The approach consists of two vital steps: First, we operationalize complexity and define management strategies for solving environmental sustainability problems based on findings from psychology research. Second, we identify governance strategies that facilitate these management strategies. Linking those strategies suggests that the role of diverse institutions, actors, and interactions differs for five key dimensions of complexity: goals, variables, dynamics, interconnections, and informational uncertainty. The results strengthen systematic analyses of environmental sustainability problems in both theory and practice.

  19. Selected international efforts to address climate change

    Energy Technology Data Exchange (ETDEWEB)

    Seki, M.; Christ, R. [Atmosphere Unit, United Nations Environment Programme UNEP, Nairobi (Kenya)

    1995-12-31

    Over the past two decades, concern about human-induced climate change has become an increasingly important item on the environmental and political agenda. The signing of the United Nations Framework Convention on Climate Change and the adoption of Agenda 21 at the United Nations Conference on Environment and Development in Rio de Janeiro in 1992 provided international organizations and the nations of the world with a new focus for climate-related activities. Although there remains considerable scientific uncertainty about the extent, magnitude, and rate of climate change and the impacts of such change, actions to address climate change have been initiated both internationally and nationally. Major international activities include the World Climate Programme, the Intergovernmental Panel on Climate Change, the United Nations Framework Convention on Climate Change. and the United Nations Environment Program me. 16 refs.

  20. Battling with breast cancer - addressing the issues

    Energy Technology Data Exchange (ETDEWEB)

    Amin, S; Wahid, N; Wasim, B; Tabassum, S [Patel Hospital Gulshan-e-Iqbal, Karachi (Pakistan)

    2011-06-15

    In the background of the current situation of breast cancer in Pakistan, with its rising incidence and mortality, non afford ability and inaccessibility to screening, diagnosis and treatment, Patel Hospital took up the task of addressing these issues at a local level, by initiating an annual free breast camp in the year 2006. In 2008 an inclusion criteria was defined to focus on high risk women for breast cancer. A comparative analysis over a period of three years was done. In the focused camps, in which 28% patients were found to have a positive family history. Most women were symptomatic. Total 11 patients were diagnosed to have cancer after evaluation. Six patients underwent definitive treatment. A problem with lack of awareness, regarding screening and treatment protocols was identified. Family history seems to be an important risk factor in our set up signifying the need to introduce extensive screening programmes. (author)

  1. Battling with breast cancer - addressing the issues

    International Nuclear Information System (INIS)

    Amin, S.; Wahid, N.; Wasim, B.; Tabassum, S.

    2011-01-01

    In the background of the current situation of breast cancer in Pakistan, with its rising incidence and mortality, non afford ability and inaccessibility to screening, diagnosis and treatment, Patel Hospital took up the task of addressing these issues at a local level, by initiating an annual free breast camp in the year 2006. In 2008 an inclusion criteria was defined to focus on high risk women for breast cancer. A comparative analysis over a period of three years was done. In the focused camps, in which 28% patients were found to have a positive family history. Most women were symptomatic. Total 11 patients were diagnosed to have cancer after evaluation. Six patients underwent definitive treatment. A problem with lack of awareness, regarding screening and treatment protocols was identified. Family history seems to be an important risk factor in our set up signifying the need to introduce extensive screening programmes. (author)

  2. Hybrid content addressable memory MSD arithmetic

    Science.gov (United States)

    Li, Yao; Kim, Dai Hyun; Kostrzewski, Andrew A.; Eichmann, George

    1990-07-01

    The modified signed-digit (MSD) number system, because of its inherent weak interdigit dependance, has been suggested as a useful means for a fast and parallel digital arithmetic. To maintain a fast processing speed, a single-stage holographic optical content-addressable memory (CAM) based MSD algorithm was suggested. In this paper, a novel non-holographic opto-electronic CAM based fast MSD addition processing architecture is proposed. The proposed concept has been verified with our first-order proof-of-principle experiments. A figure of merit comparison of this and other existing approaches is also presented. Based on this key opto-electronic CAM element, implementation of more sophisticated I'VISD arithmetic, such as optical MSD subtraction and multiplication operations, are proposed.

  3. Addressing consumerization of IT risks with nudging

    Directory of Open Access Journals (Sweden)

    Iryna Yevseyeva

    2015-01-01

    Full Text Available In this work we address the main issues of Information Technology (IT consumerization that are related to security risks, and vulnerabilities of devices used within Bring Your Own Device (BYOD strategy in particular. We propose a ‘soft’ mitigation strategy for user actions based on nudging, widely applied to health and social behavior influence. In particular, we propose a complementary, less strict, more flexible Information Security policies, based on risk assessment of device vulnerabilities and threats to corporate data and devices, combined with a strategy of influencing security behavior by nudging. We argue that nudging, by taking into account the context of the decision-making environment, and the fact that the employee may be in better position to make a more appropriate decision, may be more suitable than strict policies in situations of uncertainty of security-related decisions. Several examples of nudging are considered for different tested and potential scenarios in security context.

  4. Rotating preventers

    International Nuclear Information System (INIS)

    Tangedahl, M.J.; Stone, C.R.

    1992-01-01

    This paper reports that recent changes in the oil and gas industry and ongoing developments in horizontal and underbalanced drilling necessitated development of a better rotating head. A new device called the rotating blowout preventer (RBOP) was developed by Seal-Tech. It is designed to replace the conventional rotating control head on top of BOP stacks and allows drilling operations to continue even on live (underbalanced) wells. Its low wear characteristics and high working pressure (1,500 psi) allow drilling rig crews to drill safely in slightly underbalanced conditions or handle severe well control problems during the time required to actuate other BOPs in the stack. Drilling with a RBOP allows wellbores to be completely closed in tat the drill floor rather than open as with conventional BOPs

  5. Nanomedicines: addressing the scientific and regulatory gap.

    Science.gov (United States)

    Tinkle, Sally; McNeil, Scott E; Mühlebach, Stefan; Bawa, Raj; Borchard, Gerrit; Barenholz, Yechezkel Chezy; Tamarkin, Lawrence; Desai, Neil

    2014-04-01

    Nanomedicine is the application of nanotechnology to the discipline of medicine: the use of nanoscale materials for the diagnosis, monitoring, control, prevention, and treatment of disease. Nanomedicine holds tremendous promise to revolutionize medicine across disciplines and specialties, but this promise has yet to be fully realized. Beyond the typical complications associated with drug development, the fundamentally different and novel physical and chemical properties of some nanomaterials compared to materials on a larger scale (i.e., their bulk counterparts) can create a unique set of opportunities as well as safety concerns, which have only begun to be explored. As the research community continues to investigate nanomedicines, their efficacy, and the associated safety issues, it is critical to work to close the scientific and regulatory gaps to assure that nanomedicine drives the next generation of biomedical innovation. © 2014 New York Academy of Sciences.

  6. School-based interventions to address bullying

    Directory of Open Access Journals (Sweden)

    Peter K. Smith

    2016-10-01

    Full Text Available Following some background studies on the nature of school bullying, its prevalence, and the negative consequences it can have, this article reviews the history of anti-bullying interventions over the last 30 years. It considers several major programmes in detail, such as the Olweus Bullying Prevention Program, KiVa, Steps to Respect, and Friendly Schools. The nature and evaluation of the interventions is discussed, followed by a review of meta-analyses of the programmes effectiveness. Issues considered are the effect at different ages; components of interventions; work with peers; disciplinary methods, non-punitive and restorative approaches; challenges regarding cyberbullying; the role of parents; the role of teachers and teacher training; set menu versus à la carte approaches; sustainability of interventions and societal context. Conclusions show that interventions have had some success, with traditional bullying. However, further progress is needed in strengthening theoretical underpinnings to interventions, and in tackling cyberbullying.

  7. Preventive psychiatry in clinical practice

    Directory of Open Access Journals (Sweden)

    Mamta Sood

    2017-01-01

    Full Text Available In the last two and a half decades, there have been series of global burden of disease studies which have highlighted significant disability attributable to mental and behavioral disorders with a huge treatment gap. Integration of the preventive strategies in the clinical practice has the potential to reduce the disability due to mental illnesses. The patients come to the clinic with an intention to get treated and investigated for the symptoms they have. At this point, they may also be amenable to the advice related to prevention. Therefore, the clinical encounter can be seen as an opportunity to implement preventive strategies. Preventive efforts in clinical practice must be guided by knowledge about the epidemiological data related to specific mental illnesses and about the evidence-based preventive strategies available for specific mental illnesses. These should be directed toward all those persons (patients, caregivers accompanying and at home, teachers, employers, etc. who are present and also toward those who are not present during the clinical encounter and must be age, gender, and culture sensitive. Sociodemographic characteristics of a person seeking relief from a problem in the clinical encounter help in directing the preventive efforts. The preventive efforts are also driven by the fact that the patient has the first episode or established or treatment refractory mental illness and the short or long duration of illness. For prevention-minded clinical practice, it helps to have a template so that the assessments and interventions relevant for prevention can be carried out as per that scheme; it also helps in orienting the practicing mental health professionals. While making various assessments, making a list of the likely issues to be addressed by preventive efforts during clinical encounter ( first and subsequent is also helpful.

  8. Sunburn: Treatment and Prevention

    Science.gov (United States)

    ... Healthy Living Healthy Living Healthy Living Nutrition Fitness Sports Oral Health Emotional Wellness Growing Healthy Sleep Safety & Prevention Safety & Prevention Safety and Prevention Immunizations ...

  9. Implementation of a Network Address Translation Mechanism Over IPv6

    National Research Council Canada - National Science Library

    Baumgartner, Trevor

    2004-01-01

    ...; however, NAT provides several other benefits. NAT can be used to mask the internal IP addresses of an Intranet - IPv6, the emerging standard for Internet addressing, provides three times the number of bits for IP addressing...

  10. 75 FR 41790 - Address Management Services-Elimination of the Manual Card Option for Address Sequencing Services

    Science.gov (United States)

    2010-07-19

    .... The authority citation for 39 CFR Part 111 continues to read as follows: Authority: 5 U.S.C. 552(a... addresses (including rural address conversions to city-style addressing). For each 5-digit ZIP Code grouping... customer includes a rural-style address (RR/box number) in an address file submitted for sequencing, and a...

  11. Global Governance Mechanisms to Address Antimicrobial Resistance.

    Science.gov (United States)

    Padiyara, Ponnu; Inoue, Hajime; Sprenger, Marc

    2018-01-01

    Since their discovery, antibiotics, and more broadly, antimicrobials, have been a cornerstone of modern medicine. But the overuse and misuse of these drugs have led to rising rates of antimicrobial resistance, which occurs when bacteria adapt in ways that render antibiotics ineffective. A world without effective antibiotics can have drastic impacts on population health, global development, and the global economy. As a global common good, antibiotic effectiveness is vulnerable to the tragedy of the commons, where a shared limited resource is overused by a community when each individual exploits the finite resource for their own benefit. A borderless threat like antimicrobial resistance requires global governance mechanisms to mitigate its emergence and spread, and it is the responsibility of all countries and relevant multilateral organizations. These mechanisms can be in the form of legally binding global governance mechanisms such as treaties and regulatory standards or nonbinding mechanisms such as political declarations, resolutions, or guidelines. In this article, we argue that while both are effective methods, the strong, swift, and coordinated action needed to address rising rates of antimicrobial resistance will be better served through legally binding governance mechanisms.

  12. Addressing uncertainty in atomistic machine learning

    DEFF Research Database (Denmark)

    Peterson, Andrew A.; Christensen, Rune; Khorshidi, Alireza

    2017-01-01

    Machine-learning regression has been demonstrated to precisely emulate the potential energy and forces that are output from more expensive electronic-structure calculations. However, to predict new regions of the potential energy surface, an assessment must be made of the credibility of the predi......Machine-learning regression has been demonstrated to precisely emulate the potential energy and forces that are output from more expensive electronic-structure calculations. However, to predict new regions of the potential energy surface, an assessment must be made of the credibility...... of the predictions. In this perspective, we address the types of errors that might arise in atomistic machine learning, the unique aspects of atomistic simulations that make machine-learning challenging, and highlight how uncertainty analysis can be used to assess the validity of machine-learning predictions. We...... suggest this will allow researchers to more fully use machine learning for the routine acceleration of large, high-accuracy, or extended-time simulations. In our demonstrations, we use a bootstrap ensemble of neural network-based calculators, and show that the width of the ensemble can provide an estimate...

  13. Addressing terrain masking in orbital reconnaissance

    Science.gov (United States)

    Mehta, Sharad; Cico, Luke

    2012-06-01

    During aerial orbital reconnaissance, a sensor system is mounted on an airborne platform for imaging a region on the ground. The latency between the image acquisition and delivery of information to the end-user is critical and must be minimized. Due to fine ground pixel resolution and a large field-of-view for wide-area surveillance applications, a massive volume of data is gathered and imagery products are formed using a real-time multi-processor system. The images are taken at oblique angles, stabilized and ortho-rectified. The line-of-sight of the sensor to the ground is often interrupted by terrain features such as mountains or tall structures as depicted in Figure1. The ortho-rectification process renders the areas hidden from the line-of sight of the sensor with spurious information. This paper discusses an approach for addressing terrain masking in size, weight, and power (SWaP) and memory-restricted onboard processing systems.

  14. Addressing Underrepresentation: Physics Teaching for All

    Science.gov (United States)

    Rifkin, Moses

    2016-02-01

    Every physics teacher wants to give his or her students the opportunity to learn physics well. Despite these intentions, certain groups of students—including women and underrepresented minorities (URMs)—are not taking and not remaining in physics. In many cases, these disturbing trends are more significant in physics than in any other science. This is a missed opportunity for our discipline because demographic diversity strengthens science. The question is what we can do about these trends in our classrooms, as very few physics teachers have been explicitly prepared to address them. In this article, I will share some steps that I've taken in my classroom that have moved my class in the right direction. In the words of Nobel Prize-winning physicist Carl Wieman and psychologists Lauren Aguilar and Gregory Walton: "By investing a small amount of class time in carefully designed and implemented interventions, physics teachers can promote greater success among students from diverse backgrounds. Ultimately, we hope such efforts will indeed improve the diversity and health of the physics profession."

  15. Understanding and addressing the Schoolies phenomenon.

    Science.gov (United States)

    Pettigrew, Simone; Biagioni, Nicole; Daube, Mike; Jones, Sandra C; Chikritzhs, Tanya; Kirby, Gary

    2015-04-01

    This study qualitatively explored Western Australian school leavers' alcohol-related experiences during the Schoolies period to generate insights for the purpose of intervention design. This is in the context of an impending change in the age of Western Australian students completing secondary school which, for the first time, will see around half being of legal age to purchase alcohol. Fifty-four 18-21-year-olds provided reflections via an emailed introspection on their experiences in the immediate post-school period. This provided access to the views of those who chose to attend events and consume large amounts of alcohol, those who attended events but refrained from excessive alcohol consumption, and those who elected to either avoid Schoolies events or engage in alternative celebrations. The data were coded and analysed using NVivo10. Three primary themes were identified that related to the perceived role of alcohol during Schoolies, the range of associated rite-of-passage rituals, and the strategies used by some Leavers to avoid alcohol and its consequences during the Schoolies period. Students and parents constitute important target groups for interventions designed to address alcohol-related harms during Schoolies. In the WA context, legislation on secondary supply and controlled purchase, as recommended by health and police authorities, could reduce harms that are likely to result from the change in the age of school leavers. Suggestions for alternative pastimes to promote to school leavers are provided. © 2015 Public Health Association of Australia.

  16. Assessing what to address in science communication.

    Science.gov (United States)

    Bruine de Bruin, Wändi; Bostrom, Ann

    2013-08-20

    As members of a democratic society, individuals face complex decisions about whether to support climate change mitigation, vaccinations, genetically modified food, nanotechnology, geoengineering, and so on. To inform people's decisions and public debate, scientific experts at government agencies, nongovernmental organizations, and other organizations aim to provide understandable and scientifically accurate communication materials. Such communications aim to improve people's understanding of the decision-relevant issues, and if needed, promote behavior change. Unfortunately, existing communications sometimes fail when scientific experts lack information about what people need to know to make more informed decisions or what wording people use to describe relevant concepts. We provide an introduction for scientific experts about how to use mental models research with intended audience members to inform their communication efforts. Specifically, we describe how to conduct interviews to characterize people's decision-relevant beliefs or mental models of the topic under consideration, identify gaps and misconceptions in their knowledge, and reveal their preferred wording. We also describe methods for designing follow-up surveys with larger samples to examine the prevalence of beliefs as well as the relationships of beliefs with behaviors. Finally, we discuss how findings from these interviews and surveys can be used to design communications that effectively address gaps and misconceptions in people's mental models in wording that they understand. We present applications to different scientific domains, showing that this approach leads to communications that improve recipients' understanding and ability to make informed decisions.

  17. Addressing Issues for Land Change Science

    Science.gov (United States)

    Braimoh, Ademola; Huang, He Qing

    2009-09-01

    Workshop on Vulnerability and Resilience of Land Systems in Asia; Beijing, China, 15-17 June 2009; There is a growing international community of scholars who work within the interdisciplinary field of land change science, a scientific domain that seeks to understand the dynamics of the land system as a coupled human-environment system. A coupled human-environment system is one in which the social and biophysical subsystems are intertwined so that the system's condition and responses to external forcing are based on the synergy of the two subsystems. Research on land system vulnerability, defined as a function of exposure and sensitivity to natural and anthropogenic perturbations, such as climate variability and sudden changes in macroeconomic conditions and the ability to cope with the impacts of those perturbations, is a fundamental component of land change science. To address issues related to land system vulnerability, the Global Land Project (GLP; http://www.glp-beijing.org.cn/index.php and http://www.glp.hokudai.ac.jp) brought together an interdisciplinary group of researchers with backgrounds ranging from environmental to social sciences. Participants came from both developed and developing countries. The workshop sought to (1) improve knowledge of the causal processes that affect a system's vulnerability and capacity to cope with different perturbations and (2) identify factors that hinder the integration of vulnerability assessment into policies and decision making.

  18. Convolving optically addressed VLSI liquid crystal SLM

    Science.gov (United States)

    Jared, David A.; Stirk, Charles W.

    1994-03-01

    We designed, fabricated, and tested an optically addressed spatial light modulator (SLM) that performs a 3 X 3 kernel image convolution using ferroelectric liquid crystal on VLSI technology. The chip contains a 16 X 16 array of current-mirror-based convolvers with a fixed kernel for finding edges. The pixels are located on 75 micron centers, and the modulators are 20 microns on a side. The array successfully enhanced edges in illumination patterns. We developed a high-level simulation tool (CON) for analyzing the performance of convolving SLM designs. CON has a graphical interface and simulates SLM functions using SPICE-like device models. The user specifies the pixel function along with the device parameters and nonuniformities. We discovered through analysis, simulation and experiment that the operation of current-mirror-based convolver pixels is degraded at low light levels by the variation of transistor threshold voltages inherent to CMOS chips. To function acceptable, the test SLM required the input image to have an minimum irradiance of 10 (mu) W/cm2. The minimum required irradiance can be further reduced by adding a photodarlington near the photodetector or by increasing the size of the transistors used to calculate the convolution.

  19. Prevention of choking among children.

    Science.gov (United States)

    2010-03-01

    Choking is a leading cause of morbidity and mortality among children, especially those aged 3 years or younger. Food, coins, and toys are the primary causes of choking-related injury and death. Certain characteristics, including shape, size, and consistency, of certain toys and foods increase their potential to cause choking among children. Childhood choking hazards should be addressed through comprehensive and coordinated prevention activities. The US Consumer Product Safety Commission (CPSC) should increase efforts to ensure that toys that are sold in retail store bins, vending machines, or on the Internet have appropriate choking-hazard warnings; work with manufacturers to improve the effectiveness of recalls of products that pose a choking risk to children; and increase efforts to prevent the resale of these recalled products via online auction sites. Current gaps in choking-prevention standards for children's toys should be reevaluated and addressed, as appropriate, via revisions to the standards established under the Child Safety Protection Act, the Consumer Product Safety Improvement Act, or regulation by the CPSC. Prevention of food-related choking among children in the United States has been inadequately addressed at the federal level. The US Food and Drug Administration should establish a systematic, institutionalized process for examining and addressing the hazards of food-related choking. This process should include the establishment of the necessary surveillance, hazard evaluation, enforcement, and public education activities to prevent food-related choking among children. While maintaining its highly cooperative arrangements with the CPSC and the US Department of Agriculture, the Food and Drug Administration should have the authority to address choking-related risks of all food products, including meat products that fall under the jurisdiction of the US Department of Agriculture. The existing National Electronic Injury Surveillance System-All Injury

  20. New safety valve addresses environmental concerns

    International Nuclear Information System (INIS)

    Taylor, J.; Austin, R.

    1992-01-01

    This paper reports that Conoco Pipeline is using a unique relief valve to reduce costs while improving environmental protection at its facilities. Conoco Pipeline Co. Inc. began testing new relief valves in 1987 to present over-pressuring its pipelines while enhancing the safety, environmental integrity and profitability of its pipelines. Conoco worked jointly with Rupture Pin Technology Inc., Oklahoma City, to seek a solution to a series of safety, environmental, and operational risks in the transportation of crude oil and refined products through pipelines. Several of the identified problems were traced to a single equipment source: the reliability of rupture discs used at pipeline stations to relieve pressure by diverting flow to tanks during over-pressure conditions. Conoco's corporate safety and environmental policies requires solving problems that deal with exposure to hydrocarbon vapors, chemical spills or the atmospheric release of fugitive emissions, such as during rupture disc maintenance. The company had used rupture pin valves as vent relief devices in conjunction with development by Rick Austin of inert gas methods to protect the inner casing wall and outer carrier pipeline wall in pipeline road crossings. The design relies on rupture pin valves set at 5 psi to isolate vent openings from the atmosphere prior to purging the annular space between the pipeline and casing with inert gas to prevent corrosion. Speciality Pipeline Inspection and Engineering Inc., Houston, is licensed to distribute the equipment for the new cased-crossing procedure

  1. Diabetes Prevention Program (DPP)

    Science.gov (United States)

    ... Recruiting Patients & Families Consortia, Networks & Centers Reports & Planning Diabetes Prevention Program (DPP) The NIDDK-sponsored Diabetes Prevention ... Diabetes Prevention Program for those who are eligible. Diabetes Prevention Program (DPP) DPP Goal The DPP looked ...

  2. Cholera Prevention and Control

    Science.gov (United States)

    ... name=”commit” type=”submit” value=”Submit” /> Prevention & Control Recommend on Facebook Tweet Share Compartir Prevention of ... of cholera and other diarrheal disease prevention. Prevention & Control Topics Ending Cholera: The Global Roadmap to 2030 ...

  3. Address Points - COUNTY_ADDRESS_POINTS_IDHS_IN: Address Points Maintained by County Agencies in Indiana (Indiana Department of Homeland Security, Point feature class)

    Data.gov (United States)

    NSGIC State | GIS Inventory — COUNTY_ADDRESS_POINTS_IDHS_IN is an ESRI Geodatabase point feature class that contains address points maintained by county agencies in Indiana, provided by personnel...

  4. Final Report on Internet Addressable Lightswitch; TOPICAL

    International Nuclear Information System (INIS)

    Rubinstein, Francis; Pettler, Peter

    2001-01-01

    This report describes the work performed to develop and test a new switching system and communications network that is useful for economically switching lighting circuits in existing commercial buildings. The first section of the report provides the general background of the IBECS (Integrated Building Environmental Communications System) research and development work as well as the context for the development of the new switching system. The research and development effort that went into producing the first proof-of-concept (the IBECS Addressable Power Switch or APS) and the physical prototype of that concept is detailed in the second section. In the third section of the report, we detail the refined Powerline Carrier Based IBECS Title 24 Wall Switch system that evolved from the APS prototype. The refined system provided a path for installing IBECS switching technology in existing buildings that may not be already wired for light level switching control. The final section of the report describes the performance of the IBECS Title 24 Switch system as applied to a small demonstration in two offices at LBNL's Building 90. We learned that the new Powerline Carrier control systems (A-10 technology) that have evolved from the early X-10 systems have solved most of the noise problems that dogged the successful application of X-10 technologies in commercial buildings. We found that the new A-10 powerline carrier control technology can be reliable and effective for switching lighting circuits even in electrically noisy office environments like LBNL. Thus we successfully completed the task objectives by designing, building and demonstrating a new switching system that can provide multiple levels of light which can be triggered either from specially designed wall switches or from a digital communications network. By applying commercially available powerline carrier based technologies that communicate over the in-place lighting wiring system, this type of control can be

  5. Nuclear techniques to address HAB concerns

    International Nuclear Information System (INIS)

    Vu Nhu Ngoc; Phan Son; Nguyen Ngoc Lam and Chu Van Thuoc

    2004-01-01

    In December, 1998, The Project Formulation meeting on application of Nuclear Techniques to address red tide (Harmful Algal Bloom concerns) was held in Manila Philippines. This is an IAEA/RCA project with the participation of Australia, China, Indonesia, Malaysia, Pakistan, The Philippines, Thailand and Vietnam. The main objectives of this project (RAS/8/076) included: - Conduct of segmentation studies to gain information on the natural histories of sediments and to correlated these with Red Tide occurrences. - Development of descriptive and predictive of the behaviour of Algal Bloom as affected by the interplay of the causative organism with the environment parameters in the water column and sediments. - Development and field testing of a rapid assay technique based on tritium - labeled saxitoxin for toxin determination. The first phase has been completed in 2002 and the second phase will be completed in 2004. In the two years of 2001 - 2002 Ted Tide occurred in very larger area in Vietnam, for example, in the coast of Binh Thuan Province with the density of 39.10 9 cells/litre. The Ministry of science - technology environment of Vietnam has support 5.000 USD each years for sediment and algal sampling in Cam Ranh Bay (Nha Trang, 11 o 45N and 10 o 15E) and Ha Long Bay in the North - East of Vietnam (21 o 15 and 107 o 3E) and in 2003 in Tuy Phong Bay (Binh Thuan province) (10 o 15N, 108 o 45E). Three sediment core has been taken from Cam Ranh Bay, Ha Long Bay and Tuy Phong Bay. The volume of sediment core is Φ = 8 cm and h = 60 cm. The algal samples have been collected by Bongo nets in Cam Ranh, Ha Long Bay and Tuy Phong Bay. (author)

  6. Building partnerships to address the HIV epidemic.

    Science.gov (United States)

    Chua, A C; Leo, Y S; Lee, C C

    2008-05-01

    Batam is one of the islands comprising the Riau Province in Indonesia, and is closest to Singapore. It is a popular destination of many Singaporeans. Surveillance reports among commercial sex workers conducted in Batam showed the prevalence rate of human immunodeficiency virus (HIV) is 16.2 percent. At the end of 2006, the total number of HIV-infected Singaporeans was 3,060, the majority being infected via heterosexual transmission. The aim of the Indonesian government is to rapidly scale up HIV treatment to those needing it. One of the factors critical to the rapid scale-up is healthcare worker training. An intersectoral collaboration addressing the issue of HIV care and treatment with a hospital in Batam was created. The first activity of the collaboration was a two-day HIV training course conducted in February 2007. The aim of the course was to provide a basic understanding of HIV, as well as knowledge on common opportunistic infections that may present to a general hospital or clinical setting. 34 doctors from 23 institutions in Batam and three doctors from two hospitals in the Riau Islands attended the two-day HIV training course. The participants found the training very useful and highly relevant. This first HIV training provided a foundation to build on further HIV education. It is our belief that through the HIV training programme, there will be more awareness of HIV among the various medical institutions in Batam. As the HIV epidemic knows no borders, working with neighbouring countries is one strategy that deserves attention.

  7. State of the Union Address, 1997. Remarks by the President in State of the Union Address.

    Science.gov (United States)

    Executive Office of the President, Washington, DC.

    This document contains the text of President Clinton's State of the Union Address, delivered on February 4, 1997. The President issues a call to action to work together to prepare America for the twenty-first century. The United States must attend to the unfinished business of balancing the budget, enacting bipartisan campaign-finance reform, and…

  8. Primary Prevention of Cardiovascular Disease

    Directory of Open Access Journals (Sweden)

    Danny J. Eapen, MD

    2016-09-01

    Full Text Available Cardiovascular disease (CVD is the leading cause of death worldwide. This article focuses on current guidelines for the primary prevention of CVD and addresses management of key risk factors. Dietary modification, weight loss, exercise, and tobacco use cessation are specific areas where focused efforts can successfully reduce CVD risk on both an individual and a societal level. Specific areas requiring management include dyslipidemia, hypertension, physical activity, diabetes, aspirin use, and alcohol intake. These preventive efforts have major public health implications. As the global population continues to grow, health care expenditures will also rise, with the potential to eventually overwhelm the health care system. Therefore it is imperative to apply our collective efforts on CVD prevention to improve the cardiovascular health of individuals, communities, and nations.

  9. Addressing contrasting cognitive models in scientific collaboration

    Science.gov (United States)

    Diviacco, P.

    2012-04-01

    If the social aspects of scientific communities and their internal dynamics is starting to be recognized and acknowledged in the everyday lives of scientists, it is rather difficult for them to find tools that could support their activities consistently with this perspective. Issues span from gathering researchers to mutual awareness, from information sharing to building meaning, with the last one being particularly critical in research fields as the geo-sciences, that deal with the reconstruction of unique, often non-reproducible, and contingent processes. Reasoning here is, in fact, mainly abductive, allowing multiple and concurrent explanations for the same phenomenon to coexist. Scientists bias one hypothesis over another not only on strictly logical but also on sociological motivations. Following a vision, scientists tend to evolve and isolate themselves from other scientists creating communities characterized by different cognitive models, so that after some time these become incompatible and scientists stop understanding each other. We address these problems as a communication issue so that the classic distinction into three levels (syntactic, semantic and pragmatic) can be used. At the syntactic level, we highlight non-technical obstacles that condition interoperability and data availability and transparency. At the semantic level, possible incompatibilities of cognitive models are particularly evident, so that using ontologies, cross-domain reconciliation should be applied. This is a very difficult task to perform since the projection of knowledge by scientists, in the designated community, is political and thus can create a lot of tension. The strategy we propose to overcome these issues pertains to pragmatics, in the sense that it is intended to acknowledge the cultural and personal factors each partner brings into the collaboration and is based on the idea that meaning should remain a flexible and contingent representation of possibly divergent views

  10. Evaluating Judicial Performance and Addressing Gender Bias

    Directory of Open Access Journals (Sweden)

    Angela Melville

    2014-12-01

    Full Text Available Elek and Rottman argue that judicial evaluation is often biased against women and minority judges. The need to address bias is important, however often the desire for diversity seems so self-evident as to belie deeper analysis. This paper examines the two main rationales for gender equality on the bench. First, female judges are often considered necessary in order to bring a gendered perspective to judging, however it is argued that this rationale is flawed. Second, an alternative rationale based on equality and legitimacy is offered which avoids gender essentialism. While debates typically focus on these two rationales, a third rationale embraces both difference and equality/legitimacy. The presence of female judges has an important symbolic value which destabilises existing fraternal legal norms. Finally, increasing the number of female judges may not necessarily change judging, and this paper also analyses how the transformative potential offered by judicial diversity can work in practice. Elek y Rottman defienden que la evaluación judicial suele estar sesgada en contra de las mujeres y los jueces pertenecientes a minorías. La necesidad de abordar el sesgo es importante, sin embargo a menudo el deseo de diversidad parece tan evidente como para contradecir un análisis más profundo. Este artículo examina los dos motivos principales para la igualdad de género en el banquillo. En primer lugar, las mujeres jueces a menudo se consideran necesarias para aportar una perspectiva de género al hecho de juzgar, sin embargo, se defiende que este razonamiento es erróneo. En segundo lugar, se ofrece una alternativa lógica basada en la igualdad y la legitimidad que evita el esencialismo de género. Mientras que los debates suelen centrarse en estas dos razones, una tercera justificación abarca tanto la diferencia como la igualdad/legitimidad. La presencia de mujeres en la judicatura tiene un importante valor simbólico que desestabiliza las normas

  11. Moving to world's best uranium address

    International Nuclear Information System (INIS)

    Noakes, Frank

    2006-01-01

    Most exploration dollars spent in South Australia are focused on exploiting uranium. This is for good reason as South Australia is the world's best address for uranium. Pressure to cut CO 2 emissions and the ballistic growth of the Chinese and Indian economies has heightened expectations that the worldwide use of uranium for power generation will mushroom beyond its current 17% market share. The recent Australia-China deal only seems to confirm this; hence uranium's growing popularity among miners and explorers. Such is the attractiveness of uranium-related floats, when Toro Energy sought $18m in March it was swamped with more than three times share application volume. In the north west, Southern Gold and Hindmarsh Resources are expectantly drilling for commercial uranium deposits all around the acreage that hosts the Challenger gold mine in the Gawler Craton. The first exploration drilling for uranium in quaternary-age river channels will take place in South Australia's far north in May. Red Metal says while older and deeper tertiary river channels in the area that host the Beverley uranium mine were explored for uranium, the younger near-surface channel has not had a single hole drilled for uranium. This is despite the area being one of the 'hottest radiogenic terrains in South Australia'. The company will target calcrete-style uranium mineralisation similar to the Yerrlirrie deposit in Western Australia (52,000t U308). Tasman Resources will start drilling to test seven uranium targets within 30km of Olympic Dam, the world's largest known uranium deposit, later this year. Tasman also holds tenements adjoining the Warrior uranium deposit near Tarcoola that contains known radiometric anomalies within the 40km-long Wynbring paleochannels. They are the fourth largest uranium explorer in South Australia. Alliance Resources and its JV partner Quasar Resources are exploring the Beverley 4 Mile uranium prospect at Arkaroola. Quasar is an affiliate of Heathgate Resources

  12. The 2016 Ferno Award Address: Three Things.

    Science.gov (United States)

    Baker, Timothy B

    2017-08-01

    Researchers may optimize smoking treatment by addressing three research topics that have been relatively neglected. First, researchers have neglected to intensively explore how counseling contents affect smoking cessation success. Worldwide, millions of smokers are exposed to different smoking cessation contents and messages, yet existing research evidence does not permit strong inference about the value of particular counseling contents or strategies. Research in this area could enhance smoking outcomes and yield new insights into smoking motivation. Second, researchers have focused great attention on inducing smokers to make quit attempts when they contact healthcare systems; the success of such efforts may have plateaued. Also, the vast majority of quit attempts are self-quit attempts, largely unsuccessful, that occur outside such contacts. Researchers should explore strategies for using healthcare systems as conduits for digital- and other population-based interventions independent of healthcare visits. Such resources should be used to graft timely access to evidence-based intervention onto self-quitting, yielding evidence-based, patient-managed quit attempts. Third, most smoking treatments are assembled via selection of components based on informal synthesis of empirical and impressionistic evidence and are evaluated as a package. However, recent factorial experiments show that components of smoking treatments often interact meaningfully; for example, some components may interfere with the effectiveness of other components. Many extant treatments likely comprise suboptimal sets of components; future treatment development should routinely use factorial experiments to permit the assembly of components that yield additive or synergistic effects.Research in the above three areas should significantly advance our understanding of tobacco use and its treatment. A lack of relevant research, and the likely prospect of significant clinical and public health benefit

  13. Multi Sensor Approach to Address Sustainable Development

    Science.gov (United States)

    Habib, Shahid

    2007-01-01

    The main objectives of Earth Science research are many folds: to understand how does this planet operates, can we model her operation and eventually develop the capability to predict such changes. However, the underlying goals of this work are to eventually serve the humanity in providing societal benefits. This requires continuous, and detailed observations from many sources in situ, airborne and space. By and large, the space observations are the way to comprehend the global phenomena across continental boundaries and provide credible boundary conditions for the mesoscale studies. This requires a multiple sensors, look angles and measurements over the same spot in accurately solving many problems that may be related to air quality, multi hazard disasters, public health, hydrology and more. Therefore, there are many ways to address these issues and develop joint implementation, data sharing and operating strategies for the benefit of the world community. This is because for large geographical areas or regions and a diverse population, some sound observations, scientific facts and analytical models must support the decision making. This is crucial for the sustainability of vital resources of the world and at the same time to protect the inhabitants, endangered species and the ecology. Needless to say, there is no single sensor, which can answer all such questions effectively. Due to multi sensor approach, it puts a tremendous burden on any single implementing entity in terms of information, knowledge, budget, technology readiness and computational power. And, more importantly, the health of planet Earth and its ability to sustain life is not governed by a single country, but in reality, is everyone's business on this planet. Therefore, with this notion, it is becoming an impractical problem by any single organization/country to bear this colossal responsibility. So far, each developed country within their means has proceeded along satisfactorily in implementing

  14. French people addressing environmental hazards (Eser 2013)

    International Nuclear Information System (INIS)

    Pautard, Eric; Moreau, Sylvain; Bottin, Anne; Kraszewski, Marlene; Fretin, David; Carriere, Celine; Bird, Geoffrey

    2015-07-01

    hazard (37% awareness) than metropolitan respondents (28%). Conversely, the latter seem to be better informed as to industrial hazards close to where they live. In addition to the results described here, the document gives a detailed analysis of the main factors determining the responses to each of the survey questions. By also featuring comparison between different territorial situations and investigating the specific aspects of each hazard studied, the publication gives a broad view of the way in which the French perceive environmental hazards (part 1), notably in accordance with their own experience of hazards (part 2), and of the way in which they view hazard prevention policies (part 3)

  15. 21 CFR 1321.01 - DEA mailing addresses.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false DEA mailing addresses. 1321.01 Section 1321.01 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE DEA MAILING ADDRESSES § 1321.01 DEA mailing addresses. The following table provides information regarding mailing addresses to be used...

  16. Addressing severe accidents in the CANDU 9 design

    International Nuclear Information System (INIS)

    Nijhawan, S.M.; Wight, A.L.; Snell, V.G.

    1998-01-01

    CANDU 9 is a single-unit evolutionary heavy-water reactor based on the Bruce/Darlington plants. Severe accident issues are being systematically addressed in CANDU 9, which includes a number of unique features for prevention and mitigation of severe accidents. A comprehensive severe accident program has been formulated with feedback from potential clients and the Canadian regulatory agency. Preliminary Probabilistic Safety Analyses have identified the sequences and frequency of system and human failures that may potentially lead to initial conditions indicating onset of severe core damage. Severe accident consequence analyses have used these sequences as a guide to assess passive heat sinks for the core, and containment performance. Estimates of the containment response to mass and energy injections typical of postulated severe accidents have been made and the results are presented. We find that inherent CANDU severe accident mitigation features, such as the presence of large water volumes near the fuel (moderator and shield tank), permit a relatively slow severe accident progression under most plant damage states, facilitate debris coolability and allow ample time for the operator to arrest the progression within, progressively, the fuel channels, calandria vessel or shield tank. The large-volume CANDU 9 containment design complements these features because of the long times to reach failure

  17. Statistical Considerations of Food Allergy Prevention Studies.

    Science.gov (United States)

    Bahnson, Henry T; du Toit, George; Lack, Gideon

    Clinical studies to prevent the development of food allergy have recently helped reshape public policy recommendations on the early introduction of allergenic foods. These trials are also prompting new research, and it is therefore important to address the unique design and analysis challenges of prevention trials. We highlight statistical concepts and give recommendations that clinical researchers may wish to adopt when designing future study protocols and analysis plans for prevention studies. Topics include selecting a study sample, addressing internal and external validity, improving statistical power, choosing alpha and beta, analysis innovations to address dilution effects, and analysis methods to deal with poor compliance, dropout, and missing data. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Injury prevention in Australian Indigenous communities.

    Science.gov (United States)

    Ivers, Rebecca; Clapham, Kathleen; Senserrick, Teresa; Lyford, Marilyn; Stevenson, Mark

    2008-12-01

    Injury prevention in Indigenous communities in Australia is a continuing national challenge, with Indigenous fatality rates due to injury three times higher than the general population. Suicide and transport are the leading causes of injury mortality, and assault, transport and falls the primary causes of injury morbidity. Addressing the complex range of injury problems in disadvantaged Indigenous communities requires considerable work in building or enhancing existing capacity of communities to address local safety issues. Poor data, lack of funding and absence of targeted programs are some of the issues that impede injury prevention activities. Traditional approaches to injury prevention can be used to highlight key areas of need, however adaptations are needed in keeping with Indigenous peoples' holistic approach to health, linked to land and linked to community in order to address the complex spiritual, emotional and social determinants of Indigenous injury.

  19. Exploring the Role of Faith-Based Organizations in Addressing Adolescent Relationship Abuse.

    Science.gov (United States)

    Li, Erica; Freedman, Lori R; Fernandez Y Garcia, Erik; Miller, Elizabeth

    2016-04-01

    Adolescent relationship abuse (ARA) is prevalent with significant health and social consequences. Faith-based organizations could play an important role in ARA prevention and intervention. Studies on the role of faith-based organizations in interpersonal violence have focused on adult survivor perspectives rather than adolescents. Focus groups and interviews were conducted with faith-based organization leaders, parents, and youth. Findings highlight that church leaders, parents, and youth all expect that faith-based organizations can play a role in educating teens about healthy relationships. Divergent perspectives about how faith-based organizations should address adolescent sexuality and privacy need to be addressed. © The Author(s) 2015.

  20. Global challenges keynote address in memoriam to colleagues lost in the Malaysia airlines 17 crash.

    Science.gov (United States)

    Hankins, Catherine A

    2016-01-01

    Six colleagues working in the HIV field were killed when their flight en route to Kuala Lumpur was shot down over the Ukraine. This report is drawn from the in memoriam keynote opening address given at the 12th International AIDS Impact conference in Amsterdam in 2015. It highlights their tangible and valued roles in the HIV response and looks forward to the road ahead. It describes the ways in which we can build on their legacy to address current global challenges in HIV prevention and treatment and to mobilise the intensified, focused resources that are needed to turn the HIV epidemic on its head.

  1. Environmental evaluation of municipal waste prevention

    International Nuclear Information System (INIS)

    Gentil, Emmanuel C.; Gallo, Daniele; Christensen, Thomas H.

    2011-01-01

    Highlights: → Influence of prevention on waste management systems, excluding avoided production, is relatively minor. → Influence of prevention on overall supply chain, including avoided production is very significant. → Higher relative benefits of prevention are observed in waste management systems relying mainly on landfills. - Abstract: Waste prevention has been addressed in the literature in terms of the social and behavioural aspects, but very little quantitative assessment exists of the environmental benefits. Our study evaluates the environmental consequences of waste prevention on waste management systems and on the wider society, using life-cycle thinking. The partial prevention of unsolicited mail, beverage packaging and food waste is tested for a 'High-tech' waste management system relying on high energy and material recovery and for a 'Low-tech' waste management system with less recycling and relying on landfilling. Prevention of 13% of the waste mass entering the waste management system generates a reduction of loads and savings in the waste management system for the different impacts categories; 45% net reduction for nutrient enrichment and 12% reduction for global warming potential. When expanding our system and including avoided production incurred by the prevention measures, large savings are observed (15-fold improvement for nutrient enrichment and 2-fold for global warming potential). Prevention of food waste has the highest environmental impact saving. Prevention generates relatively higher overall relative benefit for 'Low-tech' systems depending on landfilling. The paper provides clear evidence of the environmental benefits of waste prevention and has specific relevance in climate change mitigation.

  2. Addressing barriers to low carbon energy

    International Nuclear Information System (INIS)

    Berry, Fiona; Dunstan, Chris

    2012-01-01

    Full text: Two energy solutions gaining attention are cogeneration and trigeneration, mostly fuelled by natural gas, although other renewable sources can be used, such as sewage, agricultural waste and municipal waste. Trigeneration has become increasingly popular in Australia's urban centres as a relatively cost-effective means to cut the carbon-intensity of energy supply by more than half compared to traditional coal- fired electricity. Some examples of trigeneration projects include the City of Sydney's planned 360 megawatt trigeneration networks by 2030, the University of Technology Sydney's campus master plan and the six star Green Star Commonwealth Bank Place building in Sydney. Trigeneration and cogeneration can present opportunities such as addressing the issue of rising peak demand, which is a major driver for the current $9 billion per annum of network infrastructure spending. They can also face barriers. For example, depending on the current state of the network, additional network costs can be required to accommodate trigeneration. Furthermore, under the current National Electricity Market regulations and conventions, challenges do exist to timely and financially viable connection to the grid. Here we present two examples of barriers to trigeneration and cogeneration and solutions being considered and implemented. The University of Technology Sydney campus master plan is underway, with approximately 100,000sq.m of floor area being built by 2019 and includes plans for trigeneration. During the master planning phase of development, the university considered small trigeneration units in individual buildings in order to reduce the carbon intensity of electricity supply and deliver high ratings under Green Star ratings. When considering connecting trigeneration with the grid at multiple buildings on an individual basis, a number of barriers were encountered by UTS. The largest barrier was appropriate charging for connecting to and using the grid. However

  3. Core Competencies for Injury and Violence Prevention

    Science.gov (United States)

    Stephens-Stidham, Shelli; Peek-Asa, Corinne; Bou-Saada, Ingrid; Hunter, Wanda; Lindemer, Kristen; Runyan, Carol

    2009-01-01

    Efforts to reduce the burden of injury and violence require a workforce that is knowledgeable and skilled in prevention. However, there has been no systematic process to ensure that professionals possess the necessary competencies. To address this deficiency, we developed a set of core competencies for public health practitioners in injury and violence prevention programs. The core competencies address domains including public health significance, data, the design and implementation of prevention activities, evaluation, program management, communication, stimulating change, and continuing education. Specific learning objectives establish goals for training in each domain. The competencies assist in efforts to reduce the burden of injury and violence and can provide benchmarks against which to assess progress in professional capacity for injury and violence prevention. PMID:19197083

  4. Improving the delivery of preventive care services.

    Science.gov (United States)

    Hung, Dorothy Y

    2007-05-01

    Performance of preventive services is an important indicator of high-quality health care, but many recommended services are not regularly offered in primary care practices. Health risk assessments, counseling, and referral to community-based programs help address risk behaviors, many of which are leading causes of preventable death and disability in the United States. This study examined various influences on the delivery of preventive services designed to address smoking, excessive consumption of alcohol, unhealthy diets, and sedentary lifestyles. More than 300 health care providers in 52 practices nationwide have contributed data to this study. Staff participation in quality improvement enhanced work relationships and also diminished the effect of practice size on the performance of preventive care. The use of nurse practitioners, allied health professionals, clinician reminders, and patient registries were positively associated with care delivery.

  5. Selenium for preventing cancer

    Directory of Open Access Journals (Sweden)

    Gabriele Dennert

    Full Text Available BACKGROUND: Selenium is a trace element essential to humans. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancers. OBJECTIVE: Two research questions were addressed in this review: What is the evidence for: 1. an aetiological relationship between selenium exposure and cancer risk in women and men?; 2. the efficacy of selenium supplementation for cancer prevention in women and men? SEARCH STRATEGY: We searched electronic databases and bibliographies of reviews and included publications. SELECTION CRITERIA: We included prospective observational studies to answer research question (a and randomised controlled trials (RCTs to answer research question (b. DATA COLLECTION AND ANALYSIS: We conducted random effects meta-analyses of epidemiological data when five or more studies were retrieved for a specific outcome. We made a narrative summary of data from RCTs. MAIN RESULTS: We included 49 prospective observational studies and six RCTs. In epidemiologic data, we found a reduced cancer incidence (summary odds ratio, OR, 0.69; 95% confidence interval, CI, 0.53 to 0.91 and mortality (OR 0.55, 95% CI 0.36 to 0.83 with higher selenium exposure. Cancer risk was more pronouncedly reduced in men (incidence: OR 0.66, 95% CI 0.42 to 1.05 than in women (incidence: OR 0.90, 95% CI 0.45 to 1.77. These findings have potential limitations due to study design, quality and heterogeneity of the data, which complicated the interpretation of the summary statistics. The RCTs found no protective efficacy of selenium yeast supplementation against non-melanoma skin cancer or L-selenomethionine supplementation against prostate cancer. Study results for the prevention of liver cancer with selenium supplements were inconsistent and studies had an unclear risk of bias. The results of the Nutritional Prevention of Cancer Trial (NPCT and SELECT raised concerns about possible harmful effects of selenium supplements. AUTHORS

  6. Prevention strategies in child maltreatment.

    Science.gov (United States)

    Scribano, Philip V

    2010-10-01

    Child maltreatment remains a prevalent problem for which notable best practices such as home visitation can be effective; however, most eligible families do not receive these beneficial services. Additionally, there are other promising prevention interventions to effectively address child maltreatment. This review focuses on the recent advances and strategies for child maltreatment prevention. Although home visiting does not have a single clearly defined methodology of providing service to children and families, the general supportive framework to improve maternal, child, and family factors makes this intervention the most widely studied and accepted prevention strategy. However, there has been limited effectiveness for most models. The Nurse-Family Partnership (NFP) has provided consistently positive results by targeting families with many risk factors by using highly trained professionals when implementing a research-based intervention. A promising public health approach to parent training (Triple P) may reduce maltreatment and out-of-home placement. Parent-child interaction therapy (PCIT), while a treatment model, is becoming an increasingly important approach to child maltreatment prevention. There may be an opportunity to reduce child maltreatment by enhancing care in the pediatric medical home setting. Effective child maltreatment prevention efforts exist; however, not all programs provide the same effectiveness, or target the same maltreatment issues. Pediatricians are in a key position to offer support to families in their own practice, as well as to direct families to the appropriate resources available.

  7. Global status report on violence prevention, 2014

    OpenAIRE

    Butchart, A.; Mikton, C.

    2014-01-01

    The Global status report on violence prevention 2014, which reflects data from 133 countries, is the first report of its kind to assess national efforts to address interpersonal violence, namely child maltreatment, youth violence, intimate partner and sexual violence, and elder abuse.\\ud \\ud Jointly published by WHO, the United Nations Development Programme, and the United Nations Office on Drugs and Crime, the report reviews the current status of violence prevention efforts in countries, and...

  8. Addressing Risk Assessment for Patient Safety in Hospitals through Information Extraction in Medical Reports

    Science.gov (United States)

    Proux, Denys; Segond, Frédérique; Gerbier, Solweig; Metzger, Marie Hélène

    Hospital Acquired Infections (HAI) is a real burden for doctors and risk surveillance experts. The impact on patients' health and related healthcare cost is very significant and a major concern even for rich countries. Furthermore required data to evaluate the threat is generally not available to experts and that prevents from fast reaction. However, recent advances in Computational Intelligence Techniques such as Information Extraction, Risk Patterns Detection in documents and Decision Support Systems allow now to address this problem.

  9. [AIDS prevention in Germany].

    Science.gov (United States)

    Pott, E

    2007-04-01

    infection must be addressed and motivated to adopt protective behaviour more intensely. The campaign thus must comprise closely related and mutually reinforcing elements: mass communication and individual communication measures, aimed at the public at large and at individual subgroups, national and international cooperation, especially the cooperation and task sharing with the DAH aimed at prevention in the epidemiologically most significant target groups, evaluation and quality assurance. The key element in this respect is the BZgA's annual representative survey of information levels, attitudes, motivation and behaviour in the more than 16- year-old population. In addition to the model of the special partnership between the BZgA and the DAH, a range of public-public partnerships, due to the German federalistic system, and public-private partnerships, which support public efforts, are necessary. It is shown that an increasing number of private partners are necessary to reinforce the program in a situation where Germany has to face new challenges. The new challenges are for instance high mobility in a globalizing society. In a world wide spreading epidemic no country will be excluded from the international development; the increase of other sexually transmitted diseases (STDs); a tendency to decreasing protective behaviour caused by the optimism that a definitive cure may soon be available. The conception of evaluation of the campaign comprises an annual monitoring of knowledge, attitude and behaviour in the whole population and in specific target groups. It includes pretests of specific prevention instruments and evaluation of different activities. An indicator system is developed to measure the results of the campaign. By continuous feedback of the evaluation results into the further development of the campaign the steering of the campaign at a high level of quality is ensured.

  10. Polio and Prevention

    Science.gov (United States)

    ... Essays Photo Collections Videos Polio Today → Polio + Prevention Polio + Prevention Polio and prevention Polio is a crippling ... for poliovirus within 48 hours of onset. Bulbar polio More extensive paralysis, involving the trunk and muscles ...

  11. Prevent Child Abuse America

    Science.gov (United States)

    ... the Week Parenting Tip of the Week – Preventing Child Sexual Abuse Parenting Tip of the Week Parenting Tip of the Week – Talking to Teens about Healthy Relationships ... of child abuse prevention through our Pinwheels for Prevention campaign. ...

  12. National Suicide Prevention Lifeline

    Science.gov (United States)

    ... Initiatives Best Practices Our Network Media Resources National Suicide Prevention Lifeline We can all help prevent suicide. The ... Call The Lifeline Everyone Plays A Role In Suicide Prevention Here are some helpful links: GET HELP NOW ...

  13. Prevention Research Matters

    Centers for Disease Control (CDC) Podcasts

    Prevention Research Matters is a series of one-on-one interviews with researchers from 26 university prevention research centers across the country. Their work focuses on preventing and controlling chronic diseases like obesity, cancer, and heart disease.

  14. Is prophetic discourse adequate to address global economic justice?

    African Journals Online (AJOL)

    Test

    2011-02-15

    Feb 15, 2011 ... of moral discourse adequately addresses issues of economic injustice. ... plays an indispensable role in addressing issues of global economic justice, but ...... governance in their business practices, to provide a tool for a.

  15. Using ICTs to Address Water Challenges in Uganda | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Using ICTs to Address Water Challenges in Uganda ... the adaptive capacity of communities to address the issue of climate-induced water stress. ... It will do so by testing the electronic dissemination of seasonal forecasts, early warning ...

  16. Using ICTs to Address Water Challenges in Uganda | CRDI - Centre ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    15 janv. 2012 ... Using ICTs to Address Water Challenges in Uganda ... adaptive capacity of communities to address the issue of climate-induced water stress. ... It will do so by testing the electronic dissemination of seasonal forecasts, early ...

  17. Vocatives and Other Direct Address Forms: A Contrastive Study

    OpenAIRE

    Lilli Parrott

    2010-01-01

    In this paper I analyze Russian direct address forms, both the distinct truncated vocative and nominative-case direct address forms. I contrast the formal and functional restrictions on the truncated vocative with vocatives in other languages (e.g. Czech and Polish), and I compare the interpolation of Russian direct address forms in an utterance to the situation in English. While similarities are found both in the form and the usage of Russian direct address forms with those in other language...

  18. Scabies: Prevention and Control

    Science.gov (United States)

    ... Information Scabies FAQs Workplace FAQs Epidemiology & Risk Factors Biology Disease Diagnosis Treatment Prevention & Control Resources for Health Professionals Medications Institutional Settings Prevention ...

  19. Analyzing the Messages of the State of the Union Address

    Science.gov (United States)

    Kissling, Mark T.; Martell, Christopher C.

    2014-01-01

    In the era of smartphones and 24-hour news networks, the State of the Union address is a major event. All national media outlets--in print, on television, on the Internet--report on the address, some almost exclusively in the days leading up to and after the speech. In this article, considering their experiences teaching about the address, and…

  20. Research of future network with multi-layer IP address

    Science.gov (United States)

    Li, Guoling; Long, Zhaohua; Wei, Ziqiang

    2018-04-01

    The shortage of IP addresses and the scalability of routing systems [1] are challenges for the Internet. The idea of dividing existing IP addresses between identities and locations is one of the important research directions. This paper proposed a new decimal network architecture based on IPv9 [11], and decimal network IP address from E.164 principle of traditional telecommunication network, the IP address level, which helps to achieve separation and identification and location of IP address, IP address form a multilayer network structure, routing scalability problem in remission at the same time, to solve the problem of IPv4 address depletion. On the basis of IPv9, a new decimal network architecture is proposed, and the IP address of the decimal network draws on the E.164 principle of the traditional telecommunication network, and the IP addresses are hierarchically divided, which helps to realize the identification and location separation of IP addresses, the formation of multi-layer IP address network structure, while easing the scalability of the routing system to find a way out of IPv4 address exhausted. In addition to modifying DNS [10] simply and adding the function of digital domain, a DDNS [12] is formed. At the same time, a gateway device is added, that is, IPV9 gateway. The original backbone network and user network are unchanged.

  1. Addressing cultural diversity: the hepatitis B clinical specialist perspective.

    Science.gov (United States)

    Wallace, Jack; Smith, Elizabeth; Hajarizadeh, Behzad; Richmond, Jacqueline; Lucke, Jayne

    2017-08-31

    Hepatitis B is a viral infection primarily affecting people from culturally diverse communities in Australia. While vaccination prevents infection, there is increasing mortality resulting from liver damage associated with chronic infection. Deficits in the national policy and clinical response to hepatitis B result in a low diagnosis rate, inadequate testing and diagnosis processes, and poor access to hepatitis B treatment services. While research identifies inadequate hepatitis B knowledge among people with the virus and primary health care workers, this project sought to identify how specialist clinicians in Australia negotiate cultural diversity, and provide often complex clinical information to people with hepatitis B. A vignette was developed and presented to thirteen viral hepatitis specialist clinicians prior to an electronically recorded interview. Recruitment continued until saturation of themes was reached. Data were thematically coded into themes outlined in the interview schedule. Ethical approval for the research was provided by the La Trobe University Human Research Ethics Committee. Key messages provided to patients with hepatitis B by clinical specialists were identified. These messages were not consistently provided to all patients with hepatitis B, but were determined on perceptions of patient knowledge, age and highest educational level. While the vignette stated that English was not an issue for the patient, most specialists identified the need for an interpreter. Combating stigma related to hepatitis B was seen as important by the specialists and this was done through normalising the virus. Having an awareness of different cultural understandings about hepatitis B specifically, and health and well-being generally, was noted as a communication strategy. Key core competencies need to be developed to deliver educational messages to people with hepatitis B within clinical encounters. The provision of adequate resources to specialist clinics will

  2. Suicide Prevention Strategies for Improving Population Health.

    Science.gov (United States)

    Wilcox, Holly C; Wyman, Peter A

    2016-04-01

    Suicide is a public health problem that accounts for more than 1 million deaths annually worldwide. This article addresses evidence-based and promising youth suicide prevention approaches at the primary, secondary, and tertiary levels. Coordinated, developmentally timed, evidence-based suicide prevention approaches at all intervention levels are likely to reduce youth suicide. For most youth who die by suicide, there are opportunities for intervention before imminent risk develops. Current research in suicide prevention points to the value of investing in "upstream" universal interventions that build skills and resilience as well as policies that enable access to care and protection from lethal means. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Guide for health professionals addressing oral care for individuals in oncological treatment based on scientific evidence.

    Science.gov (United States)

    Carvalho, Caroline Gomes; Medeiros-Filho, João Batista; Ferreira, Meire Coelho

    2018-02-22

    Oncological treatment can cause changes in the oral cavity compromising oral functions. The aim of the study was, based on a systematic review, to draft a guide directed at the team of health professionals involved in the oral care of oncological patients. A systematic search of the literature was performed for articles published between 2000 and April 2017. Searches were made of electronic databases and hand search. The inclusion criteria were systematic reviews of randomized clinical trials (RCTs) and RCTs published in English, involving pediatric and adult oncological patients and focused on the prevention and treatment of oral complications as well as studies addressing the maintenance of oral health. Among the 1237 studies identified, 129 were pre-selected and 54 were selected to form the basis for the clinical guide. The studies analyzed stress the need for oral assessments as well as preventive and curative actions prior to oncological treatment. To minimize the severity of oral problems, the studies emphasize daily oral care, the treatment of xerostomia with saliva substitute and hydration, and low-level laser therapy, nystatin, acyclovir, respectively, for the prevention and treatment of oral mucositis, oral candidiasis, and infection by herpes simplex virus. Thus, the guide produced addresses oral assessments and professional and home care before, during, and after oncological treatment. The guide drafted has the function of assisting health professionals involved in the oral care of patients with cancer, enabling the prevention or treatment of oral complications stemming from oncological treatment.

  4. Human Capital: Additional Actions Needed to Enhance DOD’s Efforts to Address Mental Health Care Stigma

    Science.gov (United States)

    2016-04-01

    Civilians (n=21) 6 5 8 2 h) Substance abuse (alcohol or drugs ) Servicemembers (n= 186) 43 53 82 8 Civilians (n=22) 9 8 4 1 Source: GAO | GAO...Efforts to Address Mental Health Care Stigma Why GAO Did This Study A 2010 DOD task force on suicide prevention concluded that stigma—the negative...Representatives A 2010 Department of Defense (DOD) Task Force on the Prevention of Suicide by Members of the Armed Forces concluded that

  5. Key issues in the prevention of obesity.

    Science.gov (United States)

    Gill, T P

    1997-01-01

    Obesity is a serious, chronic medical condition which is associated with a wide range of debilitating and life-threatening conditions. It imposes huge financial burdens on health care systems and the community at large. Obesity develops over time and once it has done so, is difficult to treat. Therefore, the prevention of weight gain offers the only truly effective means of controlling obesity. Very little research has directly addressed the issue of obesity prevention and previous efforts to prevent obesity amongst individuals, groups or whole communities have had very limited success. However, we have learned sufficient from past preventive activities to realise that the management of obesity will require a comprehensive range of strategies with actions that target those with existing weight problems, those at high risk of developing obesity as well as the community as a whole. The prevention and management of obesity in children should be considered a priority as there is a high risk of persistence into adulthood.

  6. Pollution prevention: The new environmental ethic

    International Nuclear Information System (INIS)

    Breen, J.J.; Dellarco, M.J.

    1991-01-01

    EPA is embarking on a new major environmental policy initiative: pollution prevention. It obviates the short-comings of end-of-pipe regulations and fosters efforts for industry to modify production practices to prevent pollution. For its part, the Agency has adopted this initiative in research and development, regulatory program development, and technology transfer activities. Research and Development programs are being established to address chemical substitution, reductions in chemical usage, product life cycles, and recycling. Regulatory programs are incorporating pollution prevention in major strategies of product stewardship and hazardous waste management. Technology transfer activities are designed to inform and educate industry and the public through Agency sponsored programs with the Pollution Prevention Information Center and the American Pollution Prevention Institute

  7. Management and Prevention of Dystocia.

    Science.gov (United States)

    Funnell, Bethany J; Hilton, W Mark

    2016-07-01

    Dystocia is an inevitable challenge in the livestock industries, particularly with primiparous female animals. Prevention and appropriate management will decrease cow and calf morbidity and mortality, which will improve the economic status of the beef or dairy operation. Early identification and proper intervention improves outcomes, and the use of selection tools to decrease the potential for dystocia will have positive returns. Assisted reproductive technologies present a unique set of challenges to the calving process that both the producer and practitioner should be prepared to address. Published by Elsevier Inc.

  8. The plutonium mountain: preventing diversion

    International Nuclear Information System (INIS)

    Pohling-Brown, Pamela.

    1997-01-01

    With continued arms-reduction between the USA and the former Soviet Union, surplus nuclear materials, from dismantled weapons, requires handling. A number of risks are identified including occupational safety for workers involved with handling nuclear materials, and environmental protection. Perhaps the most sinister is the extra security needed to ensure that these materials are not diverted to rogue states or terrorist groups, as materials are handled in a larger number of countries. In particular, the author addresses the problem of plutonium reserves, and discusses the role of reprocessing in preventing diversion. (UK)

  9. Teacher Burnout: Causes, Cures and Prevention

    Science.gov (United States)

    Bousquet, Sarah

    2012-01-01

    In a review of the literature, this study defines teacher burnout, explains the physiological and environmental causes of teacher burnout, and provides suggestions regarding how educators can prevent and recover from teacher burnout. The essay addresses the uniquely stressful experience of teaching and the psychological effects of the profession.

  10. School Law Update...Preventive School Law.

    Science.gov (United States)

    Jones, Thomas N., Ed.; Semler, Darel P., Ed.

    A wide variety of contemporary legal issues are addressed in the 15 separate papers that make up this volume. The introductory chapter by William C. Bednar, Jr. provides a broad-based rationale for "Preventive School Law." Chapters 2 and 3, both by Gerald A. Caplan, review "Current Issues in Reduction-in-Force" and "First Amendment Claims by…

  11. Molecular Cancer Prevention: Current Status & Future Directions

    Science.gov (United States)

    Maresso, Karen Colbert; Tsai, Kenneth Y.; Brown, Powel H.; Szabo, Eva; Lippman, Scott; Hawk, Ernest

    2016-01-01

    The heterogeneity and complexity of advanced cancers strongly supports the rationale for an enhanced focus on molecular prevention as a priority strategy to reduce the burden of cancer. Molecular prevention encompasses traditional chemopreventive agents as well as vaccinations and therapeutic approaches to cancer-predisposing conditions. Despite challenges to the field, we now have refined insights into cancer etiology and early pathogenesis; successful risk assessment and new risk models; agents with broad preventive efficacy (e.g., aspirin) in common chronic diseases, including cancer; and a successful track record of more than 10 agents approved by the FDA for the treatment of precancerous lesions or cancer risk reduction. The development of molecular preventive agents does not differ significantly from the development of therapies for advanced cancers, yet has unique challenges and special considerations given that it most often involves healthy or asymptomatic individuals. Agents, biomarkers, cohorts, overall design, and endpoints are key determinants of molecular preventive trials, as with therapeutic trials, although distinctions exist for each within the preventive setting. Progress in the development and evolution of molecular preventive agents has been steadier in some organ systems, such as breast and skin, than in others. In order for molecular prevention to be fully realized as an effective strategy, a number of challenges to the field must be addressed. Here we provide a brief overview of the context for and special considerations of molecular prevention along with a discussion of the results of major randomized controlled trials. PMID:26284997

  12. Name-Based Address Mapping for Virtual Private Networks

    Science.gov (United States)

    Surányi, Péter; Shinjo, Yasushi; Kato, Kazuhiko

    IPv4 private addresses are commonly used in local area networks (LANs). With the increasing popularity of virtual private networks (VPNs), it has become common that a user connects to multiple LANs at the same time. However, private address ranges for LANs frequently overlap. In such cases, existing systems do not allow the user to access the resources on all LANs at the same time. In this paper, we propose name-based address mapping for VPNs, a novel method that allows connecting to hosts through multiple VPNs at the same time, even when the address ranges of the VPNs overlap. In name-based address mapping, rather than using the IP addresses used on the LANs (the real addresses), we assign a unique virtual address to each remote host based on its domain name. The local host uses the virtual addresses to communicate with remote hosts. We have implemented name-based address mapping for layer 3 OpenVPN connections on Linux and measured its performance. The communication overhead of our system is less than 1.5% for throughput and less than 0.2ms for each name resolution.

  13. Employee assistance programs: a workplace resource to address intimate partner violence.

    Science.gov (United States)

    Pollack, Keshia M; Austin, Whitney; Grisso, Jeane Ann

    2010-04-01

    Intimate partner violence (IPV) is a major public health problem with significant impact on the workplace. Employee assistance programs (EAPs) are a confidential benefit to assist employees and their families with a variety of problems that may negatively affect their job performance. The purpose of this systematic review is to study the extant literature to identify articles that have explored the role of EAPs in addressing IPV. We searched Medline, PsychINFO, and Cumulative Index of Nursing and Allied Health Literature (CINAHL) for English-language papers that have explored how EAPs can address IPV. Articles published through 2008 were included. Our review yielded nine articles, mostly from EAP-centered journals. Nearly all of the studies were published before the year 2000 and primarily describe the need for EAPs to be more engaged in preventing violence against women. Most of the studies were commentaries, often using case reports to support recommendations on how EAPs could address IPV. Results from the two intervention studies revealed close connections between EAP clients being treated for alcoholism and IPV perpetration and the effectiveness of a standardized tool to identify EAP clients experiencing IPV. Research in this area is in its infancy, and more studies are needed to inform the formulation of evidence-based policies and programs that guide the role of EAPs in addressing IPV. The lack of research on how EAPs address IPV is alarming, as many employers state that they often refer employees affected by IPV to the EAP for assistance.

  14. Discovery of IPV6 Router Interface Addresses via Heuristic Methods

    Science.gov (United States)

    2015-09-01

    NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS DISCOVERY OF IPV6 ROUTER INTERFACE ADDRESSES VIA HEURISTIC METHODS by Matthew D. Gray September...AND SUBTITLE DISCOVERY OF IPV6 ROUTER INTERFACE ADDRESSES VIA HEURISTIC METHODS 5. FUNDING NUMBERS CNS-1111445 6. AUTHOR(S) Matthew D. Gray 7...Internet Assigned Numbers Authority, there is continued pressure for widespread IPv6 adoption. Because the IPv6 address space is orders of magnitude

  15. Identifying risk factors for healthcare-associated infections from electronic medical record home address data

    Directory of Open Access Journals (Sweden)

    Rosenman Marc B

    2010-09-01

    Full Text Available Abstract Background Residential address is a common element in patient electronic medical records. Guidelines from the U.S. Centers for Disease Control and Prevention specify that residence in a nursing home, skilled nursing facility, or hospice within a year prior to a positive culture date is among the criteria for differentiating healthcare-acquired from community-acquired methicillin-resistant Staphylococcus aureus (MRSA infections. Residential addresses may be useful for identifying patients residing in healthcare-associated settings, but methods for categorizing residence type based on electronic medical records have not been widely documented. The aim of this study was to develop a process to assist in differentiating healthcare-associated from community-associated MRSA infections by analyzing patient addresses to determine if residence reported at the time of positive culture was associated with a healthcare facility or other institutional location. Results We identified 1,232 of the patients (8.24% of the sample with positive cultures as probable cases of healthcare-associated MRSA based on residential addresses contained in electronic medical records. Combining manual review with linking to institutional address databases improved geocoding rates from 11,870 records (79.37% to 12,549 records (83.91%. Standardization of patient home address through geocoding increased the number of matches to institutional facilities from 545 (3.64% to 1,379 (9.22%. Conclusions Linking patient home address data from electronic medical records to institutional residential databases provides useful information for epidemiologic researchers, infection control practitioners, and clinicians. This information, coupled with other clinical and laboratory data, can be used to inform differentiation of healthcare-acquired from community-acquired infections. The process presented should be extensible with little or no added data costs.

  16. Navigating Institutions and Institutional Leadership to Address Sexual Violence

    Science.gov (United States)

    Sisneros, Kathy; Rivera, Monica

    2018-01-01

    Using an institutional example, this chapter offers strategies to effectively navigate institutional culture, processes, and structures to engage the entire campus community in addressing sexual violence.

  17. THE OPPORTUNITY TO ADDRESS THE SUSTAINABLE INDUSTRIAL DEVELOPMENT IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Duduială Popescu Lorena

    2015-06-01

    Full Text Available Its economy experienced a sharp decline, coupled with a process of deindustrialization, projected on a phase of the property. In these circumstances, to discuss the sustainable development may seem inappropriate; therefore, be taken in steps such as halting the decline of the economy and industry; the industry revitalization and growth; the development that takes place according to the criteria of sustainable development. To this must be stopped declining industrial output and output stabilization. It must be found and made the necessary conditions leading to full use of the potential of the country, to stimulate those structural changes that allow the country to fall market economy conditions. To address the main criteria for sustainable industrial development since this time of economic downturn may be several reasons such as the need to respect the provisions of international treaties to which Romania is a party. Some of them may be mentioned as: putting control of Earth's greenhouse effect, preventing damage to the ozone layer (waiving of manufacture and use of chlorofluorocarbons, transboundary pollution and protection of large water basins of the border. Each of these treaties contain provisions that are converging concept of sustainable development. The entry into the European Union implies aligning Romanian legislation in the EU The EU Council adopted a common position, relative to a plan of action intended to give a new political impetus of the fifth environmental action program. The main objective of this program is the promotion of sustainable development throughout the economy. The Action Plan identifies priority areas for action, namely: • better integration of environmental issues into policies as those of agriculture, transport, energy, industry and tourism; • further development of basic tools acting on the market and, in particular, horizontal instruments; • improving enforcement and implementation of environmental

  18. Reflections on preventive medicine.

    Science.gov (United States)

    Miettinen, Olli S

    2014-10-01

    Having thought much about medicine in my career-long effort to understand it and the research for its advancement, I have come to views rather different form the now-prevailing ones in respect to what preventive medicine is about; what epidemiology is in relation to preventive medicine; what distinguishes preventive medicine in preventive healthcare at large; the relation of preventive medicine to public health; the concept of health promotion; and also the core principles of preventive medicine. All of these views I set forth in this article, for the readers' critical reflection. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Designing a community-based lay health advisor training curriculum to address cancer health disparities.

    Science.gov (United States)

    Gwede, Clement K; Ashley, Atalie A; McGinnis, Kara; Montiel-Ishino, F Alejandro; Standifer, Maisha; Baldwin, Julie; Williams, Coni; Sneed, Kevin B; Wathington, Deanna; Dash-Pitts, Lolita; Green, B Lee

    2013-05-01

    Racial and ethnic minorities have disproportionately higher cancer incidence and mortality than their White counterparts. In response to this inequity in cancer prevention and care, community-based lay health advisors (LHAs) may be suited to deliver effective, culturally relevant, quality cancer education, prevention/screening, and early detection services for underserved populations. APPROACH AND STRATEGIES: Consistent with key tenets of community-based participatory research (CBPR), this project engaged community partners to develop and implement a unique LHA training curriculum to address cancer health disparities among medically underserved communities in a tricounty area. Seven phases of curriculum development went into designing a final seven-module LHA curriculum. In keeping with principles of CBPR and community engagement, academic-community partners and LHAs themselves were involved at all phases to ensure the needs of academic and community partners were mutually addressed in development and implementation of the LHA program. Community-based LHA programs for outreach, education, and promotion of cancer screening and early detection, are ideal for addressing cancer health disparities in access and quality care. When community-based LHAs are appropriately recruited, trained, and located in communities, they provide unique opportunities to link, bridge, and facilitate quality cancer education, services, and research.

  20. Urban upgrading for violence prevention in South Africa: Does it ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The Violence Prevention through Urban Upgrading (VPUU) project, funded jointly by the German Development Bank and the City of Cape Town in South Africa, is a prime example of an evidence-based intervention for violence prevention that was designed to address all urban violence determining factors. The VPUU ...

  1. Infection prevention and control practices in children's hospitals.

    Science.gov (United States)

    Bender, Jeffrey M; Virgallito, Mary; Newland, Jason G; Sammons, Julia S; Thorell, Emily A; Coffin, Susan E; Pavia, Andrew T; Sandora, Thomas J; Hersh, Adam L

    2015-05-01

    We surveyed hospital epidemiologists at 28 Children's Hospital Association member hospitals regarding their infection prevention and control programs. We found substantial variability between children's hospitals in both the structure and the practice of these programs. Research and the development of evidence-based guidelines addressing infection prevention in pediatrics are needed.

  2. A global consensus on the prevention and management of ...

    African Journals Online (AJOL)

    pertain only to the prevention and treatment of nutritional rickets and do not attempt to address other possible clinical effects of a poor vitamin D status. It is not possible in this editorial to highlight all the recommendations made by the group, but there are a number of recommendations that are central to the global prevention ...

  3. Violence Prevention in United States Society of Jesus Secondary Schools

    Science.gov (United States)

    Simonds, Thomas Andrew

    2009-01-01

    Using data from a representative number of Society of Jesus secondary schools, the researcher reports what these schools are doing to prevent violence, and tests an explanatory model of school violence he created. The researcher proposes that this model can be used to explain and prevent school violence by identifying and addressing the…

  4. 76 FR 24402 - Federal Motor Vehicle Theft Prevention Standard

    Science.gov (United States)

    2011-05-02

    ... [Docket No. NHTSA-2009-0069] RIN 2127-AK81 Federal Motor Vehicle Theft Prevention Standard AGENCY... address for submission, and the procedure to submit designation of target areas on high theft major parts... the Theft Prevention Standard, manufacturers of high theft passenger motor vehicle lines subject to...

  5. Factors Related to Teenage Dating Violence Prevention Programming in Schools

    Science.gov (United States)

    Black, Beverly M.; Hawley, Alicia; Hoefer, Richard; Barnett, Tracey M.

    2017-01-01

    The Children's Safety Network has identified teenage dating violence (TDV) as a public health problem and called for effective prevention programs to address the issue. This study used resource dependence theory to examine factors that relate to domestic violence shelters' in-school efforts to prevent TDV. A national survey was sent to domestic…

  6. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... NEWSLETTER Your email address * This iframe contains the logic required to handle AJAX powered Gravity Forms. FacingDisability. ... NEWSLETTER Your email address * This iframe contains the logic required to handle AJAX powered Gravity Forms. Site ...

  7. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... 2525 info@facingdisability.com SIGN UP FOR OUR NEWSLETTER Your email address * This iframe contains the logic ... 2525 info@facingdisability.com SIGN UP FOR OUR NEWSLETTER Your email address * This iframe contains the logic ...

  8. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... facingdisability.com SIGN UP FOR OUR NEWSLETTER Your email address * This iframe contains the logic required to ... facingdisability.com SIGN UP FOR OUR NEWSLETTER Your email address * This iframe contains the logic required to ...

  9. President's Inaugural Address: We Call It School Nursing

    Science.gov (United States)

    Mattey, Beth

    2015-01-01

    The incoming President of the National Association of School Nurses (NASN) traditionally outlines the theme for their presidency during their inaugural address. This address is given by incoming President of the NASN, Beth Mattey, who discusses previous themes that supported the mission of NASN, but changed every two years with each new president.…

  10. Terms of Address in the Chinese Business Enterprise

    Science.gov (United States)

    Huang, Xiaoyan; Sultan, Robert

    2014-01-01

    This study examines terms of address currently used by employees of Chinese business enterprises. The authors find that a speaker's address selections are related significantly to the gender of the speaker, the location of the enterprise in Eastern or Western China, and the ownership type of the enterprise; that is, whether the enterprise is…

  11. CIRM Alpha Stem Cell Clinics: Collaboratively Addressing Regenerative Medicine Challenges.

    Science.gov (United States)

    Jamieson, Catriona H M; Millan, Maria T; Creasey, Abla A; Lomax, Geoff; Donohoe, Mary E; Walters, Mark C; Abedi, Mehrdad; Bota, Daniela A; Zaia, John A; Adams, John S

    2018-06-01

    The California Institute for Regenerative Medicine (CIRM) Alpha Stem Cell Clinic (ASCC) Network was launched in 2015 to address a compelling unmet medical need for rigorous, FDA-regulated, stem cell-related clinical trials for patients with challenging, incurable diseases. Here, we describe our multi-center experiences addressing current and future challenges. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. The 2012 NCTE Presidential Address: Literacy, Rhetoric, Education, Democracy

    Science.gov (United States)

    Gilyard, Keith

    2013-01-01

    This article presents the text of Keith Gilyard's presidential address, delivered at the National Council of Teachers of English (NCTE) Annual Convention in Las Vegas, Nevada, on November 18, 2012. In his address he proposes several core elements that he believes will instrumentally improve the education system in the United States: a rich…

  13. 75 FR 11610 - Notice Announcing Addresses for Service of Process

    Science.gov (United States)

    2010-03-11

    ... SOCIAL SECURITY ADMINISTRATION [Docket No. SSA-2009-0076] Notice Announcing Addresses for Service of Process AGENCY: Social Security Administration. ACTION: Notice announcing addresses for summonses and complaints. SUMMARY: The Office of the General Counsel (OGC) is responsible for processing and...

  14. Design and Implementation of High Performance Content-Addressable Memories.

    Science.gov (United States)

    1985-12-01

    content addressability and two basic implementations of content addressing. The need and application of hardware CAM is presented to motivate the " topic...3r Pass 4th Ps4 Pass Figure 2.15 Maximum SearchUsing All-Parallel CAM - left-most position (the most significant bit) and the other IF bits are zeros

  15. 15 CFR 748.2 - Obtaining forms; mailing addresses.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Obtaining forms; mailing addresses... APPLICATIONS (CLASSIFICATION, ADVISORY, AND LICENSE) AND DOCUMENTATION § 748.2 Obtaining forms; mailing addresses. (a) You may obtain the forms required by the EAR from any U.S. Department of Commerce District...

  16. Chair's Address: Voices of the Company We Keep

    Science.gov (United States)

    Anokye, Akua Duku

    2007-01-01

    This article presents a written version of the address Akua Duku Anokye, chairwoman of the Conference on College Composition and Communication (CCCC), gave at the CCCC meeting in New York on March 24, 2007. In her address, Anokye talked about the importance of how an entity or an individual is known by the company they keep. To learn with whom has…

  17. The "Depreciation" and "Appreciation" of Some Address Terms in China.

    Science.gov (United States)

    Zhucheng, Ju

    1991-01-01

    Examines how the cultural revolution in China has changed, to some extent, the rules governing the use of address terms, discussing the close interrelation between the use of address terms and cultural values and how the change in mental outlook has led to the depreciation or appreciation of certain terms. (Author/CB)

  18. Student Perceptions of Peer Credibility Based on Email Addresses

    Science.gov (United States)

    Livermore, Jeffrey A.; Scafe, Marla G.; Wiechowski, Linda S.; Maier, David J.

    2013-01-01

    The purpose of this study was to evaluate students' perceptions of their peer's credibility based on email addresses. The survey was conducted at a community college in Michigan where all students were registered and actively taking at least one course. The survey results show that a student's selection of an email address does influence other…

  19. Faculty Perceptions of Student Credibility Based on Email Addresses

    Science.gov (United States)

    Livermore, Jeffrey A.; Wiechowski, Linda S.; Scafe, Marla G.

    2011-01-01

    The purpose of this study was to evaluate faculty perceptions of student credibility based on email addresses. The survey was conducted at an upper division business school in Michigan where all students have completed at least two years of college courses. The survey results show that a student's selection of an email address does influence the…

  20. Student Perceptions of Faculty Credibility Based on Email Addresses

    Science.gov (United States)

    Livermore, Jeffrey A.; Scafe, Marla G.; Wiechowski, Linda S.

    2010-01-01

    The purpose of this study was to evaluate students' perceptions of faculty credibility based on email addresses. The survey was conducted at an upper division business school in Michigan where all students have completed at least two years of college courses. The survey results show that a faculty member's selection of an email address does…

  1. 27 CFR 4.35 - Name and address.

    Science.gov (United States)

    2010-04-01

    ... named winery: (A) Fermented not less than 75% of such wine at the stated address, or (B) Changed the.... (iv) Blended means that the named winery mixed the wine with other wines of the same class and type at the stated address. (v) Cellared, Vinted or Prepared means that the named winery, at the stated...

  2. 75 FR 3977 - Addressing Tax Delinquency by Government Contractors

    Science.gov (United States)

    2010-01-25

    ... Part II The President Memorandum of January 20, 2010--Addressing Tax Delinquency by Government... of January 20, 2010 Addressing Tax Delinquency by Government Contractors Memorandum for the Heads of... contracts are awarded to tens of thousands of companies with serious tax delinquencies. The total amount in...

  3. 17 CFR 12.3 - Business address; hours.

    Science.gov (United States)

    2010-04-01

    ... REPARATIONS General Information and Preliminary Consideration of Pleadings § 12.3 Business address; hours. The... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Business address; hours. 12.3..., DC 20581. It is open each day, except Saturdays, Sundays, and legal public holidays, from 8:15 a.m...

  4. JEREMIAD FRAMES IN REAGAN’S INAUGURAL ADDRESSES

    Directory of Open Access Journals (Sweden)

    Mister Gidion Maru

    2013-04-01

    Full Text Available This research attempts to examine the existence of frames from jeremiad tradition as part of American values in an American president’s inaugural address. The function and context of the frames are also investigated. These aims are achieved by applying Goffman’s Frame Analysis on the text of Reagan’s inaugural addresses. This inaugural addresses is chosen because Reagan’s presidency is regarded to set the tone for the following presidencies; his presidency faced crises which other presidents following him have also faced; and he is viewed as one of the best orators among American presidents. The results show that Ronald Reagan’s inaugural addresses use the jeremiad frames which are categorized into three forms, namely, the lamentation of the present, the evocation of the past and the calling for renewal. By using these frames in combination with the context of the inaugural address, Reagan presents American perspective and hopes for their situation and future.

  5. Memory Compression Techniques for Network Address Management in MPI

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Yanfei; Archer, Charles J.; Blocksome, Michael; Parker, Scott; Bland, Wesley; Raffenetti, Ken; Balaji, Pavan

    2017-05-29

    MPI allows applications to treat processes as a logical collection of integer ranks for each MPI communicator, while internally translating these logical ranks into actual network addresses. In current MPI implementations the management and lookup of such network addresses use memory sizes that are proportional to the number of processes in each communicator. In this paper, we propose a new mechanism, called AV-Rankmap, for managing such translation. AV-Rankmap takes advantage of logical patterns in rank-address mapping that most applications naturally tend to have, and it exploits the fact that some parts of network address structures are naturally more performance critical than others. It uses this information to compress the memory used for network address management. We demonstrate that AV-Rankmap can achieve performance similar to or better than that of other MPI implementations while using significantly less memory.

  6. Traditional preventive treatment options

    DEFF Research Database (Denmark)

    Longbottom, C; Ekstrand, K; Zero, D

    2009-01-01

    Preventive treatment options can be divided into primary, secondary and tertiary prevention techniques, which can involve patient- or professionally applied methods. These include: oral hygiene (instruction), pit and fissure sealants ('temporary' or 'permanent'), fluoride applications (patient...... options....

  7. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... L Sarah Harrison, OT Anne Bryden, OT The Role of the Social Worker after Spinal Cord Injury ... do to prevent pressure sores? play_arrow What role does diet and hydration play in preventing pressure ...

  8. Colorectal Cancer Prevention

    Science.gov (United States)

    ... Genetics of Colorectal Cancer Colorectal Cancer Screening Research Colorectal Cancer Prevention (PDQ®)–Patient Version What is prevention? Go ... to keep cancer from starting. General Information About Colorectal Cancer Key Points Colorectal cancer is a disease in ...

  9. Cancer treatment - preventing infection

    Science.gov (United States)

    ... Radiation - preventing infection; Bone marrow transplant - preventing infection; Cancer treatment - immunosuppression ... this is a short-lived side effect of cancer treatment. Your provider may give you medicines to help ...

  10. Research Areas: Prevention

    Science.gov (United States)

    NCI’s prevention research has a broad focus, from identifying environmental and lifestyle factors that influence cancer risk to studying the biology of how cancer develops and studying ways to disseminate prevention interventions.

  11. Preventing Type 2 Diabetes

    Science.gov (United States)

    ... Sexual, & Bladder Problems Clinical Trials Preventing Type 2 Diabetes Perhaps you have learned that you have a ... I lower my chances of developing type 2 diabetes? Research such as the Diabetes Prevention Program shows ...

  12. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to Home ...

  13. Prevention of gravitational collapse

    International Nuclear Information System (INIS)

    Moffat, J.W.; Taylor, J.G.

    1981-01-01

    We apply a new theory of gravitation to the question of gravitational collapse to show that collapse is prevented in this theory under very reasonable conditions. This result also extends to prevent ultimate collapse of the Universe. (orig.)

  14. Marine Pollution Prevention Act

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Marine Pollution Prevention Act of 2008 implements the International Convention for the Prevention of Pollution from Ships, including related Protocols (MARPOL)...

  15. Risk Factors and Prevention

    Science.gov (United States)

    ... Resources Risk Factors & Prevention Back to Patient Resources Risk Factors & Prevention Even people who look healthy and ... Blood Pressure , high cholesterol, diabetes, and thyroid disease. Risk Factors For Arrhythmias and Heart Disease The following ...

  16. Preventing Weight Gain

    Science.gov (United States)

    ... Local Programs Related Topics Diabetes Nutrition Preventing Weight Gain Language: English (US) Español (Spanish) Recommend on Facebook ... cancer. Choosing an Eating Plan to Prevent Weight Gain So, how do you choose a healthful eating ...

  17. Breast Cancer Prevention

    Science.gov (United States)

    ... of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Cancer Prevention (PDQ®)–Patient Version What is prevention? Go ... from starting. Risk-reducing surgery . General Information About Breast Cancer Key Points Breast cancer is a disease in ...

  18. Settings for Suicide Prevention

    Science.gov (United States)

    ... Suicide Populations Racial/Ethnic Groups Older Adults Adolescents LGBT Military/Veterans Men Effective Prevention Comprehensive Approach Identify ... Based Prevention Settings American Indian/Alaska Native Settings Schools Colleges and Universities Primary Care Emergency Departments Behavioral ...

  19. Prevent Cervical Cancer

    Science.gov (United States)

    ... professional printing [PDF-1.5MB] Cancer Home “Prevent Cervical Cancer” Infographic Language: English Español (Spanish) Recommend on Facebook Tweet Share Compartir Prevent Cervical Cancer with the Right Test at the Right Time ...

  20. A systematic review of recent smartphone, Internet and Web 2.0 interventions to address the HIV continuum of care.

    Science.gov (United States)

    Muessig, Kathryn E; Nekkanti, Manali; Bauermeister, Jose; Bull, Sheana; Hightow-Weidman, Lisa B

    2015-03-01

    eHealth, mHealth and "Web 2.0" social media strategies can effectively reach and engage key populations in HIV prevention across the testing, treatment, and care continuum. To assess how these tools are currently being used within the field of HIV prevention and care, we systematically reviewed recent (2013-2014) published literature, conference abstracts, and funded research. Our searches identified 23 published intervention studies and 32 funded projects underway. In this synthesis we describe the technology modes applied and the stages of the HIV care cascade addressed, including both primary and secondary prevention activities. Overall trends include use of new tools including social networking sites, provision of real-time assessment and feedback, gamification and virtual reality. While there has been increasing attention to use of technology to address the care continuum, gaps remain around linkage to care, retention in care, and initiation of antiretroviral therapy.

  1. [Childhood obesity prevention from a community view].

    Science.gov (United States)

    Ariza, Carles; Ortega-Rodríguez, Eduard; Sánchez-Martínez, Francesca; Valmayor, Sara; Juárez, Olga; Pasarín, M Isabel

    2015-04-01

    The percentage of failure and relapse in the treatment of obesity is high. Where possible, the preferred strategy for preventing obesity is to modify eating habits and lifestyles. This article aims to provide a framework for evidence on the most effective interventions for addressing childhood obesity, both from a prevention point of view, as well as reducing it, when it is already established. After a review of the scientific literature, the issues that must be considered both in the universal and selective prevention of childhood obesity are presented. Also, in light of the controversy over the tools for measuring and controlling the problem, some clarification is provided on the criteria. Finally, the approach to the prevention of overweight and obesity with a community perspective is separated, with two short protocols being offered with diagrams of the basic procedure to follow. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

  2. Environmental evaluation of municipal waste prevention

    DEFF Research Database (Denmark)

    Gentil, Emmanuel; Gallo, Daniele; Christensen, Thomas Højlund

    2011-01-01

    society, using life-cycle thinking. The partial prevention of unsolicited mail, beverage packaging and food waste is tested for a “High-tech” waste management system relying on high energy and material recovery and for a “Low-tech” waste management system with less recycling and relying on landfilling......Waste prevention has been addressed in the literature in terms of the social and behavioural aspects, but very little quantitative assessment exists of the environmental benefits. Our study evaluates the environmental consequences of waste prevention on waste management systems and on the wider....... Prevention of 13% of the waste mass entering the waste management system generates a reduction of loads and savings in the waste management system for the different impacts categories; 45% net reduction for nutrient enrichment and 12% reduction for global warming potential. When expanding our system...

  3. Obesogenic environments: environmental approaches to obesity prevention.

    Science.gov (United States)

    Lipek, Tobias; Igel, Ulrike; Gausche, Ruth; Kiess, Wieland; Grande, Gesine

    2015-05-01

    Childhood obesity is a major concern for public health. There are multiple factors (e.g., genetic, social, and environmental) that contribute to unhealthy weight gain. Drawing from findings on "obesogenic environments" and core principles of preventive strategies to reduce health inequalities, this paper gives an overview of recent childhood prevention programs that target aspects of the physical environment ("environmental changes"). Out of the ten reviews we screened (including more than 300 studies), we identified very few that addressed aspects of the environment. We focus here on 14 programs that follow different approaches to environmental changes (e.g., access to/quality of playgrounds, changes in school cafeterias). Altering the environment offers opportunities for healthier behaviors and seems to be an effective strategy to prevent childhood obesity. However, the evaluation of those (mostly) multidimensional interventions does not allow drawing firm conclusions about the single effect of environmental changes. We conclude that obesity prevention programs should combine person-based and environmental approaches.

  4. Fall Prevention: Simple Tips to Prevent Falls

    Science.gov (United States)

    ... a gentle exercise that involves slow and graceful dance-like movements. Such activities reduce the risk of ... healthy-lifestyle/healthy-aging/in-depth/fall-prevention/art-20047358 . Mayo Clinic Footer Legal Conditions and Terms ...

  5. Programmes for change: Addressing sexual and intimate partner ...

    African Journals Online (AJOL)

    South Africa has a number of locally evaluated interventions that have been designed to prevent sexual and intimate partner violence before it occurs. This article describes such programmes that have been evaluated and found to be promising or effective. Seven locally evaluated primary prevention interventions are ...

  6. Teen pregnancy prevention: current perspectives.

    Science.gov (United States)

    Lavin, Claudia; Cox, Joanne E

    2012-08-01

    Teen pregnancy has been subject of public concern for many years. In the United States, despite nearly 2 decades of declining teen pregnancy and birth rates, the problem persists, with significant disparities present across racial groups and in state-specific rates. This review examines recent trends, pregnancy prevention initiatives and family planning policies that address the special needs of vulnerable youth. Unintended teen pregnancies impose potentially serious social and health burdens on teen parents and their children, as well as costs to society. Trends in teen pregnancy and birth rates show continued decline, but state and racial disparities have widened. Demographic factors and policy changes have contributed to these disparities. Research supports comprehensive pregnancy prevention initiatives that are multifaceted and promote consistent and correct use of effective methods of contraception for youth at risk of becoming pregnant. There is strong consensus that effective teen pregnancy prevention strategies should be multifaceted, focusing on delay of sexual activity especially in younger teens while promoting consistent and correct use of effective methods of contraception for those youth who are or plan to be sexually active. There is a need for further research to identify effective interventions for vulnerable populations.

  7. Reclaiming Gender and Power in Sexual Violence Prevention in Adolescence.

    Science.gov (United States)

    Miller, Elizabeth

    2018-03-01

    The Mentors in Violence Prevention (MVP) model seeks to address the root causes of gender violence using a bystander approach and leadership training to challenge structures of patriarchy. Emerging research on adolescent relationship abuse and sexual violence points to key modifiable targets-transforming gender norms, addressing homophobia, integrating with comprehensive sexuality education, and acknowledging the needs of youth already exposed to violence. A social justice-based bystander approach such as the MVP model should be part of a multi-level approach to sexual violence prevention that addresses gender and power, encourages healthy sexuality conversations, and provides safety and support for survivors.

  8. Cancer risks and prevention

    International Nuclear Information System (INIS)

    Vessey, M.P.; Gray, M.

    1985-01-01

    A series of essays in honour of Sir Richard Doll is presented. Chapters cover the preventability of cancer, geography, smoking, diet, occupation, radiation, infections and immune impairment, exogenous and endogenous hormones, other drugs, prevention through legislation and by education and cancer risks and prevention in the Third World. The chapter on radiation has been indexed separately. (UK)

  9. Statewide Suicide Prevention Council

    Science.gov (United States)

    State Employees Statewide Suicide Prevention Council DHSS State of Alaska Home Divisions and Agencies National Suicide Prevention Lifeline Alaska Community Mental Health Centers National Survivors of Suicide Meetings Presentations 2010 Alaska Statewide Suicide Prevention Summit: Mending the Net Connect with us on

  10. Prevention IS Care

    Centers for Disease Control (CDC) Podcasts

    2009-03-26

    This podcast provides an overview of the Prevention IS Care campaign, which provides HIV prevention tools for medical care providers to use on a daily basis with patients who are living with HIV.  Created: 3/26/2009 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/26/2009.

  11. Falling short: how state laws can address health information exchange barriers and enablers.

    Science.gov (United States)

    Schmit, Cason D; Wetter, Sarah A; Kash, Bita A

    2018-06-01

    Research on the implementation of health information exchange (HIE) organizations has identified both positive and negative effects of laws relating to governance, incentives, mandates, sustainability, stakeholder participation, patient engagement, privacy, confidentiality, and security. We fill a substantial research gap by describing whether comprehensive state and territorial HIE legal frameworks address identified legal facilitators and barriers. We used the Westlaw database to identify state and territorial laws relating to HIEs in effect on June 7, 2016 (53 jurisdictions). We blind-coded all laws and addressed coding discrepancies in peer-review meetings. We recorded a consensus code for each law in a master database. We compared 20 HIE legal attributes with identified barriers to and enablers of HIE activity in the literature. Forty-two states, the District of Columbia, and 2 territories have laws relating to HIEs. On average, jurisdictions address 8.32 of the 20 criteria selected in statutes and regulations. Twenty jurisdictions unambiguously address ≤5 criteria in statutes and regulations. None of the significant legal criteria are unambiguously addressed in >60% of the 53 jurisdictions. Laws can be barriers to or enablers of HIEs. However, jurisdictions are not addressing many significant issues identified by researchers. Consequently, there is a substantial risk that existing legal frameworks are not adequately supporting HIEs. The current evidence base is insufficient for comparative assessments or impact rankings of the various factors. However, the detailed Centers for Disease Control and Prevention dataset of HIE laws could enable investigations into the types of laws that promote or impede HIEs.

  12. Duplicate Address Detection Table in IPv6 Mobile Networks

    Science.gov (United States)

    Alisherov, Farkhod; Kim, Taihoon

    In IP networks, each computer or communication equipment needs an IP address. To supply enough IP addresses, the new Internet protocol IPv6 is used in next generatoion mobile communication. Although IPv6 improves the existing IPv4 Internet protocol, Duplicate Address Detection (DAD) mechanism may consume resources and suffer from long delay. DAD is used to ensure whether the IP address is unique or not. When a mobile node performs an inter-domain handoff, it will first generate a new IP and perform a DAD procedure. The DAD procedure not only wastes time but also increases the signaling load on Internet. In this paper, the author proposes a new DAD mechanism to speed up the DAD procedure. A DAD table is created in access or mobility routers in IP networks and record all IP addresses of the area. When a new IP address needs to perform DAD, it can just search in the DAD table to confirm the uniqueness of the address.

  13. Primary Prevention Is? A Global Perspective on How Organizations Engaging Men in Preventing Gender-Based Violence Conceptualize and Operationalize Their Work.

    Science.gov (United States)

    Storer, Heather L; Casey, Erin A; Carlson, Juliana; Edleson, Jeffrey L; Tolman, Richard M

    2016-02-01

    Engaging men in addressing violence against women (VAW) has become a strategy in the global prevention of gender-based violence. Concurrently, Western public health frameworks have been utilized to guide prevention agendas worldwide. Using qualitative methods, this study describes how global anti-violence organizations that partner with men conceptualize primary prevention in their work. Findings suggest that "primary prevention" is not a fixed term in the context of VAW and that front-line prevention work challenges rigidly delineated distinctions between levels of prevention. Much can be learned from global organizations' unique and contextualized approaches to the prevention of VAW. © The Author(s) 2015.

  14. [Prevention of mental disorders].

    Science.gov (United States)

    Riedel-Heller, Steffi; Gühne, Uta

    2013-12-01

    Investment in prevention is a major public health requirement. Mental disorders are common and are associated with severe consequences. They are a major target for prevention. Based on vulnerabilitiy-stress-models the theoretical background for prevention in mental disorders is outlined. Effective strategies for children, adolescents, adults and individuals in old age do exist. Results regarding the prevention of depres-sion and psychoses are outlined and risk groups which require current actions are determined. Current activities towards a national prevention strategy in Germany are discussed. © Georg Thieme Verlag KG Stuttgart · New York.

  15. IPv6 Addressing Proxy: Mapping Native Addressing from Legacy Technologies and Devices to the Internet of Things (IPv6

    Directory of Open Access Journals (Sweden)

    Peter Kirstein

    2013-05-01

    Full Text Available Sensors utilize a large number of heterogeneous technologies for a varied set of application environments. The sheer number of devices involved requires that this Internet be the Future Internet, with a core network based on IPv6 and a higher scalability in order to be able to address all the devices, sensors and things located around us. This capability to connect through IPv6 devices, sensors and things is what is defining the so-called Internet of Things (IoT. IPv6 provides addressing space to reach this ubiquitous set of sensors, but legacy technologies, such as X10, European Installation Bus (EIB, Controller Area Network (CAN and radio frequency ID (RFID from the industrial, home automation and logistic application areas, do not support the IPv6 protocol. For that reason, a technique must be devised to map the sensor and identification technologies to IPv6, thus allowing homogeneous access via IPv6 features in the context of the IoT. This paper proposes a mapping between the native addressing of each technology and an IPv6 address following a set of rules that are discussed and proposed in this work. Specifically, the paper presents a technology-dependent IPv6 addressing proxy, which maps each device to the different subnetworks built under the IPv6 prefix addresses provided by the internet service provider for each home, building or user. The IPv6 addressing proxy offers a common addressing environment based on IPv6 for all the devices, regardless of the device technology. Thereby, this offers a scalable and homogeneous solution to interact with devices that do not support IPv6 addressing. The IPv6 addressing proxy has been implemented in a multi-protocol Sensors 2013, 13 6688 card and evaluated successfully its performance, scalability and interoperability through a protocol built over IPv6.

  16. IPv6 Addressing Proxy: Mapping Native Addressing from Legacy Technologies and Devices to the Internet of Things (IPv6)

    Science.gov (United States)

    Jara, Antonio J.; Moreno-Sanchez, Pedro; Skarmeta, Antonio F.; Varakliotis, Socrates; Kirstein, Peter

    2013-01-01

    Sensors utilize a large number of heterogeneous technologies for a varied set of application environments. The sheer number of devices involved requires that this Internet be the Future Internet, with a core network based on IPv6 and a higher scalability in order to be able to address all the devices, sensors and things located around us. This capability to connect through IPv6 devices, sensors and things is what is defining the so-called Internet of Things (IoT). IPv6 provides addressing space to reach this ubiquitous set of sensors, but legacy technologies, such as X10, European Installation Bus (EIB), Controller Area Network (CAN) and radio frequency ID (RFID) from the industrial, home automation and logistic application areas, do not support the IPv6 protocol. For that reason, a technique must be devised to map the sensor and identification technologies to IPv6, thus allowing homogeneous access via IPv6 features in the context of the IoT. This paper proposes a mapping between the native addressing of each technology and an IPv6 address following a set of rules that are discussed and proposed in this work. Specifically, the paper presents a technology-dependent IPv6 addressing proxy, which maps each device to the different subnetworks built under the IPv6 prefix addresses provided by the internet service provider for each home, building or user. The IPv6 addressing proxy offers a common addressing environment based on IPv6 for all the devices, regardless of the device technology. Thereby, this offers a scalable and homogeneous solution to interact with devices that do not support IPv6 addressing. The IPv6 addressing proxy has been implemented in a multi-protocol card and evaluated successfully its performance, scalability and interoperability through a protocol built over IPv6. PMID:23686145

  17. IPv6 addressing proxy: mapping native addressing from legacy technologies and devices to the Internet of Things (IPv6).

    Science.gov (United States)

    Jara, Antonio J; Moreno-Sanchez, Pedro; Skarmeta, Antonio F; Varakliotis, Socrates; Kirstein, Peter

    2013-05-17

    Sensors utilize a large number of heterogeneous technologies for a varied set of application environments. The sheer number of devices involved requires that this Internet be the Future Internet, with a core network based on IPv6 and a higher scalability in order to be able to address all the devices, sensors and things located around us. This capability to connect through IPv6 devices, sensors and things is what is defining the so-called Internet of Things (IoT). IPv6 provides addressing space to reach this ubiquitous set of sensors, but legacy technologies, such as X10, European Installation Bus (EIB), Controller Area Network (CAN) and radio frequency ID (RFID) from the industrial, home automation and logistic application areas, do not support the IPv6 protocol. For that reason, a technique must be devised to map the sensor and identification technologies to IPv6, thus allowing homogeneous access via IPv6 features in the context of the IoT. This paper proposes a mapping between the native addressing of each technology and an IPv6 address following a set of rules that are discussed and proposed in this work. Specifically, the paper presents a technology-dependent IPv6 addressing proxy, which maps each device to the different subnetworks built under the IPv6 prefix addresses provided by the internet service provider for each home, building or user. The IPv6 addressing proxy offers a common addressing environment based on IPv6 for all the devices, regardless of the device technology. Thereby, this offers a scalable and homogeneous solution to interact with devices that do not support IPv6 addressing. The IPv6 addressing proxy has been implemented in a multi-protocol Sensors 2013, 13 6688 card and evaluated successfully its performance, scalability and interoperability through a protocol built over IPv6.

  18. Address Points, The Address Point layer contains an address point for almost every structure over 200 square feet and for some vacant properties. Attributes include addresses, sub-units, address use, LAT/LONG, 10-digit SDAT taxpins, political areas and more., Published in 2013, 1:2400 (1in=200ft) scale, Baltimore County Government.

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — Address Points dataset current as of 2013. The Address Point layer contains an address point for almost every structure over 200 square feet and for some vacant...

  19. SOMOS: Evaluation of an HIV Prevention Intervention for Latino Gay Men

    Science.gov (United States)

    Vega, Miriam Y.; Spieldenner, Andrew R.; DeLeon, Dennis; Nieto, Bolivar X.; Stroman, Carolyn A.

    2011-01-01

    Latino gay men face multiple barriers to human immunodeficiency virus (HIV) prevention, in particular a lack of intervention programs that integrate prevention messages with cultural norms and address issues of social marginalization from multiple communities (gay community and Latino community), homophobia and racism. In order to address these…

  20. Gender Issues in STIs/HIV/AIDS Prevention and Control: The Case ...

    African Journals Online (AJOL)

    Commercial sex workers are the second target group benefiting from special programmes designed to address their particular needs in STIs/HIV/AIDS prevention and control. By targeting male workers and commercial sex workers, the agencies have failed to address married women's issues in STIs/HIV/AIDS prevention ...

  1. The importance of addressing gender inequality in efforts to end vertical transmission of HIV

    Science.gov (United States)

    Ghanotakis, Elena; Peacock, Dean; Wilcher, Rose

    2012-01-01

    Issues The recently launched “Global Plan towards the Elimination of New HIV Infections among Children by 2015 and Keeping their Mothers Alive” sets forth ambitious targets that will require more widespread implementation of comprehensive prevention of vertical HIV transmission (PMTCT) programmes. As PMTCT policymakers and implementers work toward these new goals, increased attention must be paid to the role that gender inequality plays in limiting PMTCT programmatic progress. Description A growing body of evidence suggests that gender inequality, including gender-based violence, is a key obstacle to better outcomes related to all four components of a comprehensive PMTCT programme. Gender inequality affects the ability of women and girls to protect themselves from HIV, prevent unintended pregnancies and access and continue to use HIV prevention, care and treatment services. Lessons Learned In light of this evidence, global health donors and international bodies increasingly recognize that it is critical to address the gender disparities that put women and children at increased risk of HIV and impede their access to care. The current policy environment provides unprecedented opportunities for PMTCT implementers to integrate efforts to address gender inequality with efforts to expand access to clinical interventions for preventing vertical HIV transmission. Effective community- and facility-based strategies to transform harmful gender norms and mitigate the impacts of gender inequality on HIV-related outcomes are emerging. PMTCT programmes must embrace these strategies and expand beyond the traditional focus of delivering ARV prophylaxis to pregnant women living with HIV. Without greater implementation of comprehensive, gender transformative PMTCT programmes, elimination of vertical transmission of HIV will remain elusive. PMID:22789642

  2. The importance of addressing gender inequality in efforts to end vertical transmission of HIV.

    Science.gov (United States)

    Ghanotakis, Elena; Peacock, Dean; Wilcher, Rose

    2012-07-11

    The recently launched "Global Plan towards the Elimination of New HIV Infections among Children by 2015 and Keeping their Mothers Alive" sets forth ambitious targets that will require more widespread implementation of comprehensive prevention of vertical HIV transmission (PMTCT) programmes. As PMTCT policymakers and implementers work toward these new goals, increased attention must be paid to the role that gender inequality plays in limiting PMTCT programmatic progress. A growing body of evidence suggests that gender inequality, including gender-based violence, is a key obstacle to better outcomes related to all four components of a comprehensive PMTCT programme. Gender inequality affects the ability of women and girls to protect themselves from HIV, prevent unintended pregnancies and access and continue to use HIV prevention, care and treatment services. In light of this evidence, global health donors and international bodies increasingly recognize that it is critical to address the gender disparities that put women and children at increased risk of HIV and impede their access to care. The current policy environment provides unprecedented opportunities for PMTCT implementers to integrate efforts to address gender inequality with efforts to expand access to clinical interventions for preventing vertical HIV transmission. Effective community- and facility-based strategies to transform harmful gender norms and mitigate the impacts of gender inequality on HIV-related outcomes are emerging. PMTCT programmes must embrace these strategies and expand beyond the traditional focus of delivering ARV prophylaxis to pregnant women living with HIV. Without greater implementation of comprehensive, gender transformative PMTCT programmes, elimination of vertical transmission of HIV will remain elusive.

  3. Addressing the Social Determinants of Health to Reduce Tobacco-Related Disparities.

    Science.gov (United States)

    Garrett, Bridgette E; Dube, Shanta R; Babb, Stephen; McAfee, Tim

    2015-08-01

    Comprehensive tobacco prevention and control efforts that include implementing smoke-free air laws, increasing tobacco prices, conducting hard-hitting mass media campaigns, and making evidence-based cessation treatments available are effective in reducing tobacco use in the general population. However, if these interventions are not implemented in an equitable manner, certain population groups may be left out causing or exacerbating disparities in tobacco use. Disparities in tobacco use have, in part, stemmed from inequities in the way tobacco control policies and programs have been adopted and implemented to reach and impact the most vulnerable segments of the population that have the highest rates of smokings (e.g., those with lower education and incomes). Education and income are the 2 main social determinants of health that negatively impact health. However, there are other social determinants of health that must be considered for tobacco control policies to be effective in reducing tobacco-related disparities. This article will provide an overview of how tobacco control policies and programs can address key social determinants of health in order to achieve equity and eliminate disparities in tobacco prevention and control. Tobacco control policy interventions can be effective in addressing the social determinants of health in tobacco prevention and control to achieve equity and eliminate tobacco-related disparities when they are implemented consistently and equitably across all population groups. Taking a social determinants of health approach in tobacco prevention and control will be necessary to achieve equity and eliminate tobacco-related disparities. © The Author 2014. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Prevention Of Stroke

    Directory of Open Access Journals (Sweden)

    Nagaraja D

    2005-01-01

    Full Text Available Stroke is an important cause for neurological morbidity and mortality. Prevention of ischemic stroke involves identification and prevention of risk factors and optimal use of pharmacotherapy. Risk factors have been classified as modifiable and non-modifiable; control of modifiable factors should prevent stroke occurrence. Stroke prevention has been described at three levels: primary, secondary and tertiary. Prolonged hypertension increases an individual′s risk for developing fatal or nonfatal stroke by three times and its control has been shown to prevent stroke. Diabetes mellitus is an important cause for microangiopathy and predisposes to stroke. Statin trials have shown significant reduction in stroke in those who were treated with statins. Stroke risk can be reduced by avoiding tobacco use, control of obesity and avoiding sedentary life style. Anti platelet medications are effective for secondary prevention of stroke. Educating society regarding modifiable risk factors and optimal use of pharmacotherapy form the cornerstone for the prevention of stroke.

  5. Youth empowerment solutions for violence prevention.

    Science.gov (United States)

    Reischl, Thomas M; Zimmerman, Marc A; Morrel-Samuels, Susan; Franzen, Susan P; Faulk, Monique; Eisman, Andria B; Roberts, Everett

    2011-12-01

    The limited success of youth violence prevention interventions suggests that effective prevention needs to address causes at multiple levels of analysis and empower youth in developing and implementing prevention programs. In this article, we review published studies of youth violence prevention efforts that engage youth in developing or implementing violence prevention activities. The reviewed studies suggest the promise of youth empowerment strategies and the need for systematic outcome studies of empowerment programs. After reviewing empowerment theory applied to youth violence prevention programs, we present a case study of the Youth Empowerment Solutions (YES) for Peaceful Communities program. YES engages middle-school youth in an after-school and summer program that includes a culturally tailored character development curriculum and empowers the youth to plan and implement community improvement projects with assistance from adult neighborhood advocates. The case study focuses on outcome evaluation results and presents evidence of the YES program effects on community-level outcomes (eg, property improvements, violent crime incidents) and on individual-level outcomes (eg, conflict avoidance, victimization). The literature review and the case study suggest the promise of engaging and empowering youth to plan and implement youth violence prevention programs.

  6. Probiotics and prevention of Clostridium difficile infection.

    Science.gov (United States)

    Goldstein, E J C; Johnson, S J; Maziade, P-J; Evans, C T; Sniffen, J C; Millette, M; McFarland, L V

    2017-06-01

    The role of probiotics as adjunctive measures in the prevention of Clostridium difficile infection (CDI) has been controversial. However, a growing body of evidence has suggested that they have a role in primary prevention of CDI. Elements of this controversy are reviewed and the proposed mechanisms of action, the value and cost effectiveness of probiotics are addressed with a focus on three agents, Saccharomyces boulardii, Lactobacillus rhamnosus GG and the combination of Lactobacillus acidophilus CL1285, Lactobacillus casei LBC80R, Lactobacillus rhamnosus CLR2 (Bio-K+). Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Occupational Stress: Preventing Suffering, Enhancing Wellbeing.

    Science.gov (United States)

    Quick, James Campbell; Henderson, Demetria F

    2016-04-29

    Occupational stress is a known health risk for a range of psychological, behavioral, and medical disorders and diseases. Organizations and individuals can mitigate these disorders through preventive stress management and enhanced wellbeing. This article addresses, first, the known health risk evidence related to occupational stress; second, the use of preventive stress management in organizations as the framework for intervention; and third, the emerging domain of enhancing wellbeing, which strengthens the individual. Premature death and disability along with chronic suffering from occupational stress are not inevitable, despite being known outcome risks.

  8. 27 CFR 7.25 - Name and address.

    Science.gov (United States)

    2010-04-01

    ... false or misleading impression as to the geographic origin of the beer. (2) If malt beverages are... address in connection with the particular malt beverage. (Approved by the Office of Management and Budget...

  9. Addressing obesity in South Africa through taxation | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-11-17

    Nov 17, 2016 ... The same tax can reduce diabetes prevalence in adults by 4%, and incident ... are only one component of a multi-pronged strategy to address obesity. ... and regulating food labelling, advertising, and marketing to reduce ...

  10. Police and Community-partnered Delivery System to Address ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... Delivery System to Address Violence Against Women in the Punjab (India) ... Education, Scheduled Castes and Other Back Classes, and Land Rural Development. ... IWRA/IDRC webinar on climate change and adaptive water management.

  11. Son Preference in China and India : Policy Interventions to address ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... form, at its most extreme shifting from female infanticide to sex-selective abortion. Both countries have enacted laws to combat gender-based discrimination in ... in China and India that have attempted to address discrimination against girls.

  12. Addressing Software Engineering Issues in Real-Time Software ...

    African Journals Online (AJOL)

    Addressing Software Engineering Issues in Real-Time Software ... systems, manufacturing process, process control, military, space exploration, and ... but also physical properties such as timeliness, Quality of Service and reliability.

  13. Toward Addressing Skills Development and Employment Crisis in ...

    African Journals Online (AJOL)

    Toward Addressing Skills Development and Employment Crisis in Uganda: ... women and youth - both educated and uneducated - and key informants, ... skills development are explored from countries like, Singapore, Malaysia, and Mauritius.

  14. The potential of capstone learning experiences in addressing ...

    African Journals Online (AJOL)

    The potential of capstone learning experiences in addressing perceived shortcomings in LLB training in South Africa. ... A literature review on capstone courses and learning experiences (collectively referred to ... AJOL African Journals Online.

  15. BCB polymer based row-column addressed CMUT

    DEFF Research Database (Denmark)

    Havreland, Andreas Spandet; Ommen, Martin Lind; Silvestre, Chantal

    2017-01-01

    This paper presents an inexpensive, low temperature and rapid fabrication method for capacitive micromachined ultrasonic transducers (CMUT). The fabrication utilizes the bonding and dielectric properties of the photosensitive polymer Benzocyclobutene (BCB). A BCB based row-column addressed CMUT w...

  16. Find Shortage Areas: HPSA & MUA/P by Address

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Find Shortage Areas: Health Professional Shortage Area (HPSA) and Medically Underserved Area/Population (MUA/P) by Address tool helps you determine if a specific...

  17. Framework for supporting countries to address the food crisis and ...

    African Journals Online (AJOL)

    Framework for supporting countries to address the food crisis and malnutrition in the African region. ... African Journal of Food, Agriculture, Nutrition and Development ... Protection of vulnerable groups; and Evidence- based interventions.

  18. Addressable droplet microarrays for single cell protein analysis.

    Science.gov (United States)

    Salehi-Reyhani, Ali; Burgin, Edward; Ces, Oscar; Willison, Keith R; Klug, David R

    2014-11-07

    Addressable droplet microarrays are potentially attractive as a way to achieve miniaturised, reduced volume, high sensitivity analyses without the need to fabricate microfluidic devices or small volume chambers. We report a practical method for producing oil-encapsulated addressable droplet microarrays which can be used for such analyses. To demonstrate their utility, we undertake a series of single cell analyses, to determine the variation in copy number of p53 proteins in cells of a human cancer cell line.

  19. Positional error in automated geocoding of residential addresses

    Directory of Open Access Journals (Sweden)

    Talbot Thomas O

    2003-12-01

    Full Text Available Abstract Background Public health applications using geographic information system (GIS technology are steadily increasing. Many of these rely on the ability to locate where people live with respect to areas of exposure from environmental contaminants. Automated geocoding is a method used to assign geographic coordinates to an individual based on their street address. This method often relies on street centerline files as a geographic reference. Such a process introduces positional error in the geocoded point. Our study evaluated the positional error caused during automated geocoding of residential addresses and how this error varies between population densities. We also evaluated an alternative method of geocoding using residential property parcel data. Results Positional error was determined for 3,000 residential addresses using the distance between each geocoded point and its true location as determined with aerial imagery. Error was found to increase as population density decreased. In rural areas of an upstate New York study area, 95 percent of the addresses geocoded to within 2,872 m of their true location. Suburban areas revealed less error where 95 percent of the addresses geocoded to within 421 m. Urban areas demonstrated the least error where 95 percent of the addresses geocoded to within 152 m of their true location. As an alternative to using street centerline files for geocoding, we used residential property parcel points to locate the addresses. In the rural areas, 95 percent of the parcel points were within 195 m of the true location. In suburban areas, this distance was 39 m while in urban areas 95 percent of the parcel points were within 21 m of the true location. Conclusion Researchers need to determine if the level of error caused by a chosen method of geocoding may affect the results of their project. As an alternative method, property data can be used for geocoding addresses if the error caused by traditional methods is

  20. Addressable-Matrix Integrated-Circuit Test Structure

    Science.gov (United States)

    Sayah, Hoshyar R.; Buehler, Martin G.

    1991-01-01

    Method of quality control based on use of row- and column-addressable test structure speeds collection of data on widths of resistor lines and coverage of steps in integrated circuits. By use of straightforward mathematical model, line widths and step coverages deduced from measurements of electrical resistances in each of various combinations of lines, steps, and bridges addressable in test structure. Intended for use in evaluating processes and equipment used in manufacture of application-specific integrated circuits.

  1. 27 CFR 46.126 - Change in name or address.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Change in name or address... (occupational) Tax Stamps § 46.126 Change in name or address. (a) Change in name. If there is a change in the corporate or firm name, or in the trade name, as shown on TTB Form 5630.5t, the taxpayer must file an...

  2. HIV Prevention Among Transgender Populations: Knowledge Gaps and Evidence for Action.

    Science.gov (United States)

    Poteat, Tonia; Malik, Mannat; Scheim, Ayden; Elliott, Ayana

    2017-08-01

    The purpose of this review is to summarize the available evidence-based HIV prevention interventions tailored for transgender people. A limited number of evidence-based HIV prevention interventions have been tested with transgender populations. Most existing interventions target behavior change among transgender women, with only one HIV prevention program evaluated for transgender men. Studies addressing biomedical interventions for transgender women are ongoing. Few interventions address social and structural barriers to HIV prevention, such as stigma, discrimination, and poverty. Evidence-based multi-level interventions that address the structural, biomedical, and behavioral risks for HIV among transgender populations, including transgender men, are needed to address disparities in HIV prevalence. Future research should address not only pre-exposure prophylaxis uptake and condom use but also structural barriers that limit access to these prevention strategies.

  3. Best Practices to Address (or Reduce) Bullying in Schools

    Science.gov (United States)

    Ansary, Nadia S.; Elias, Maurice J.; Greene, Michael B.; Green, Stuart

    2015-01-01

    The authors quantify and unpack the prevalence and effects of bullying on children and adolescents before prescribing provisos for schools to consider when planning preventive and responsive approaches to bullying.

  4. THE PRAGMATIC MEANINGS OF ADDRESS TERMS SAMPEYAN AND ANDA

    Directory of Open Access Journals (Sweden)

    Djoko Susanto

    2014-07-01

    Full Text Available Abstract: This research investigates the use of sampeyan and anda by the students from Pasuruan and Probolinggo. Address terms is one of important tools in communication in Javanese society as it is used, for example, to designate the person they are talking to or to show the possession of formal and informal manners. However, the use of this address terms may have different interpretation across regions. This research is undertaken to find out (1 factors that influence the choice of address terms sampeyan and anda in Pasuruan and Probolinggo and (2 situations in which the interlocutors use the address terms sampeyan and anda. Several theories are used to help analyze the data, which include address terms (Wardhaugh, 2002, sampeyan and anda (Wolf & Poedjosoedarmo, 1982, Politeness theory (Brown & Levinson, 1987, and Power and Solidarity (Brown & Gilman, 1960. The data were obtained from the results of observations, questionnaires and interviews with the participants. The results of the study show that both sampeyan and anda were found to be commonly used by the participants to address their lecturer, instead of using Bapak. This is, of course, uncommon from either the perspective of standard usage of Javanese or Indonesian language. This study also indicates that the participants used sampeyan to lecturer/teacher, kyai, parent, and older sibling because they wanted to express (1 express politeness and (2 to indicate informality. Concerning to the use of anda, this study reveals that the participants use this address term because of (1 more formal and appropriate manners in environmental education, (2 respecting person of higher social status and older person, (3 more polite and more appropriate than sampeyan, and (4 the use of Indonesian as a formal language. In some respect, however, the participants use anda to lecturer/teacher, which is not appropriate because they were not socially equal to the lecturer/teacher.  This study provide

  5. 77 FR 22805 - Meeting of the Compact Council for the National Crime Prevention and Privacy Compact; Correction

    Science.gov (United States)

    2012-04-17

    ... Compact Council (Council) created by the National Crime Prevention and Privacy Compact Act of 1998..., correct the hotel address line in ADDRESSES to read: 300 East Travis. Dated: April 10, 2012. Gary S...

  6. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Disabilities Photography by Rona Talcott Website by Mobile Marketing LLC Understanding Spinal Cord Injury About ... Your email address * This iframe contains the logic required to ...

  7. Preventive Ethics Through Expanding Education.

    Science.gov (United States)

    Ho, Anita; MacDonald, Lisa Mei-Hwa; Unger, David

    2016-03-01

    Healthcare institutions have been making increasing efforts to standardize consultation methodology and to accredit both bioethics training programs and the consultants accordingly. The focus has traditionally been on the ethics consultation as the relevant unit of ethics intervention. Outcome measures are studied in relation to consultations, and the hidden assumption is that consultations are the preferred or best way to address day-to-day ethical dilemmas. Reflecting on the data from an internal quality improvement survey and the literature, we argue that having general ethics education as a key function of ethics services may be more important in meeting the contemporaneous needs of acute care settings. An expanded and varied ethics education, with attention to the time constraints of healthcare workers' schedules, was a key recommendation brought forward by survey respondents. Promoting ethical reflection and creating a culture of ethics may serve to prevent ethical dilemmas or mitigate their effects.

  8. Prevent Infections During Chemotherapy

    Centers for Disease Control (CDC) Podcasts

    2011-10-24

    This podcast discusses the importance of preventing infections in cancer patients who are undergoing chemotherapy. Dr. Lisa Richardson, CDC oncologist, talks about a new Web site for cancer patients and their caregivers.  Created: 10/24/2011 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP), Division of Cancer Prevention and Control (DCPC).   Date Released: 10/24/2011.

  9. CSI cardiac prevent 2015

    OpenAIRE

    S Ramakrishnan; Manisha Kaushik

    2015-01-01

    The CSI Cardiac Prevent 2015 was held at Hotel Taj Palace, New Delhi, on September 25-27, 2015. The major challenge was to create interest among cardiologists and physicians on preventive cardiology, a neglected area. The theme of the conference was "Innovations in Heart Disease Prevention.′′ This conference included "CSI at WHF Roadmap Workshop, Inauguration Ceremony, scientific program, plenary sessions, Nursing/Dietician track, Industry Exhibition, Social Events," Great India blood pressur...

  10. Prevention of Prosthetic Dentistry

    Directory of Open Access Journals (Sweden)

    Eremin O.V.

    2011-03-01

    Full Text Available Prevention in prosthetic dentistry is not just a regular oral hygiene and the prevention of caries in the early stages of its development. The initial goal of orthopedic and dental should be the ability to convey to the patient's sense of pros-thetics that proteziruya one saved more. An example is included prosthetic dental arch defects with bridges or single artificial crowns on implants that will prevent movement of teeth and the continuity of the dentition

  11. Selenium for preventing cancer

    Science.gov (United States)

    Vinceti, Marco; Dennert, Gabriele; Crespi, Catherine M; Zwahlen, Marcel; Brinkman, Maree; Zeegers, Maurice PA; Horneber, Markus; D'Amico, Roberto; Del Giovane, Cinzia

    2015-01-01

    Background This review is an update of the first Cochrane publication on selenium for preventing cancer (Dennert 2011). Selenium is a metalloid with both nutritional and toxicological properties. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancers. Objectives Two research questions were addressed in this review: What is the evidence for: an aetiological relation between selenium exposure and cancer risk in humans? andthe efficacy of selenium supplementation for cancer prevention in humans? Search methods We conducted electronic searches of the Cochrane Central Register of Controlled Trials (CENTRAL, 2013, Issue 1), MEDLINE (Ovid, 1966 to February 2013 week 1), EMBASE (1980 to 2013 week 6), CancerLit (February 2004) and CCMed (February 2011). As MEDLINE now includes the journals indexed in CancerLit, no further searches were conducted in this database after 2004. Selection criteria We included prospective observational studies (cohort studies including sub-cohort controlled studies and nested case-control studies) and randomised controlled trials (RCTs) with healthy adult participants (18 years of age and older). Data collection and analysis For observational studies, we conducted random effects meta-analyses when five or more studies were retrieved for a specific outcome. For RCTs, we performed random effects meta-analyses when two or more studies were available. The risk of bias in observational studies was assessed using forms adapted from the Newcastle-Ottawa Quality Assessment Scale for cohort and case-control studies; the criteria specified in the Cochrane Handbook for Systematic Reviews of Interventions were used to evaluate the risk of bias in RCTs. Main results We included 55 prospective observational studies (including more than 1,100,000 participants) and eight RCTs (with a total of 44,743 participants). For the observational studies, we found lower cancer incidence (summary odds ratio (OR) 0

  12. Prevention, Preemption, and the Bush Doctrine

    Science.gov (United States)

    2012-01-30

    Just War theorist, Immanuel Kant , addressed directly the issues of preemption and preventive war. Immanuel Kant (1724-1804), while clearly within...51-303, it is not copyrighted, but is the property of the United States government. Biography Chaplain, Lieutenant Colonel Timothy A...understand Kant as being descriptive rather than permissive. This is because he believed that international relations were not exercised in a simple “state

  13. Sepsis is a preventable public health problem.

    Science.gov (United States)

    Kempker, Jordan A; Wang, Henry E; Martin, Greg S

    2018-05-06

    There is a paradigm shift happening for sepsis. Sepsis is no longer solely conceptualized as problem of individual patients treated in emergency departments and intensive care units but also as one that is addressed as public health issue with population- and systems-based solutions. We offer a conceptual framework for sepsis as a public health problem by adapting the traditional model of primary, secondary, and tertiary prevention.

  14. Addressing diabetes at the crossroads of global pandemic and regional culture: Comment on "The curse of wealth - Middle Eastern countries need to address the rapidly rising burden of diabetes".

    Science.gov (United States)

    Hsu, William C; Gabbay, Robert A

    2014-07-01

    As diabetes and obesity rates continue to climb at astronomical rates in the Middle East, future generations are at an even greater risk for diabetes and the associated complications. Many factors are at play and it is clear that creative solutions are needed to retool provider resources in the Middle East towards prevention of diabetes and its complications while leveraging technology to maximize outreach within the accepted cultural norms. Only by building the capacity to address the current diabetes burden as well focusing on prevention for the future, can Middle East countries create a strong infrastructure for a successful future.

  15. Addressing Adverse Childhood Experiences Through the Affordable Care Act: Promising Advances and Missed Opportunities.

    Science.gov (United States)

    Srivastav, Aditi; Fairbrother, Gerry; Simpson, Lisa A

    Adverse childhood experiences (ACEs) occur when children are exposed to trauma and/or toxic stress and may have a lifelong effect. Studies have shown that ACEs are linked with poor adult health outcomes and could eventually raise already high health care costs. National policy interest in ACEs has recently increased, as many key players are engaged in community-, state-, and hospital-based efforts to reduce factors that contribute to childhood trauma and/or toxic stress in children. The Affordable Care Act (ACA) has provided a promising foundation for advancing the prevention, diagnosis, and management of ACEs and their consequences. Although the ACA's future is unclear and it does not adequately address the needs of the pediatric population, many of the changes it spurred will continue regardless of legislative action (or inaction), and it therefore remains an important component of our health care system and national strategy to reduce ACEs. We review ways in which some of the current health care policy initiatives launched as part of the implementation of the ACA could accelerate progress in addressing ACEs by fully engaging and aligning various health care stakeholders while recognizing limitations in the law that may cause challenges in our attempts to improve child health and well-being. Specifically, we discuss coverage expansion, investments in the health workforce, a family-centered care approach, increased access to care, emphasis on preventive services, new population models, and improved provider payment models. Copyright © 2017 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

  16. Prevention, not just treatment.

    Science.gov (United States)

    Connors, G L; Hilling, L

    1998-03-01

    A tragic burden of disease, disability, and death has resulted from smoking. The role of pulmonary rehabilitation is not only in treatment and rehabilitation of lung disease but in the prevention of lung disease. The skills of the pulmonary rehabilitation specialist should be used in the earlier detection and prevention of lung disease through primary and secondary prevention. The spirometer must gain acceptance in the medical community as the early tool to evaluate lung health, not the chest radiograph or the stethoscope. The lung age formula and sputum pap smears are just a few of the evaluation tools used to detect and motivate susceptible individuals. Prevention is the key to enhancing lung health.

  17. Crime-prevention

    DEFF Research Database (Denmark)

    Brønsted, Lone

    In Denmark, crime prevention is embedded in state professional practices in kindergartens, schools and youth clubs. These welfare institutions are conceived as safe places that safeguard children and young people through inclusive learning environments, warm and empathic relationships between......-sectional cooperation called “SSP”. SSP is a locally anchored cooperation of the school (S), the social services (S) and the police (P) and its aim is to create a coordinated system of prevention, e.g., to prevent crime or school drop outs. In continuation of this, crime preventive work is understood as a practice...

  18. Work hazard prevention plans

    International Nuclear Information System (INIS)

    Albertos Campos, F.

    2009-01-01

    The prevention of industrial risks is a constantly evolving discipline that has changed considerable in the last 25 years. The Cofrentes Nuclear Power Plants has always been operated with a clear policy favoring prevention by supporting the principle of its integration, i. e., that the hierarchical functional organization of the company make sure that industrial risk prevention is effective and that health and safety standards are met. The historical evolution of occupational safety in the Cofrentes Nuclear Power Plant shows a a clear trend towards improvement and is the results of many years of hard work and effort by the plants own and contractor personnel in the field of industrial risk prevention. (Author)

  19. Speech disorder prevention

    Directory of Open Access Journals (Sweden)

    Miladis Fornaris-Méndez

    2017-04-01

    Full Text Available Language therapy has trafficked from a medical focus until a preventive focus. However, difficulties are evidenced in the development of this last task, because he is devoted bigger space to the correction of the disorders of the language. Because the speech disorders is the dysfunction with more frequently appearance, acquires special importance the preventive work that is developed to avoid its appearance. Speech education since early age of the childhood makes work easier for prevent the appearance of speech disorders in the children. The present work has as objective to offer different activities for the prevention of the speech disorders.

  20. Toxoplasmosis: Prevention and Control

    Science.gov (United States)

    ... Toxoplasmosis FAQs Toxoplasmosis & Pregnancy FAQs Epidemiology & Risk Factors Biology Disease Diagnosis Treatment Prevention & Control Resources for Health Professionals Publications Printable Resources Additional ...

  1. Falls prevention for the elderly

    Directory of Open Access Journals (Sweden)

    Dagmar Lühmann

    2012-04-01

    Full Text Available Background: An ageing population, a growing prevalence of chronic diseases and limited financial resources for health care underpin the importance of prevention of disabling health disorders and care dependency in the elderly. A wide variety of measures is generally available for the prevention of falls and fall-related injuries. The spectrum ranges from diagnostic procedures for identifying individuals at risk of falling to complex interventions for the removal or reduction of identified risk factors. However, the clinical and economic effectiveness of the majority of recommended strategies for fall prevention is unclear. Against this background, the literature analyses in this HTA report aim to support decision-making for effective and efficient fall prevention.Research questions: The pivotal research question addresses the effectiveness of single interventions and complex programmes for the prevention of falls and fall-related injuries. The target population are the elderly (> 60 years, living in their own housing or in long term care facilities. Further research questions refer to the cost-effectiveness of fall prevention measures, and their ethical, social and legal implications. Methods: Systematic literature searches were performed in 31 databases covering the publication period from January 2003 to January 2010. While the effectiveness of interventions is solely assessed on the basis of randomised controlled trials (RCT, the assessment of the effectiveness of diagnostic procedures also considers prospective accuracy studies. In order to clarify social, ethical and legal aspects all studies deemed relevant with regard to content were taken into consideration, irrespective of their study design. Study selection and critical appraisal were conducted by two independent assessors. Due to clinical heterogeneity of the studies no meta-analyses were performed.Results: Out of 12,000 references retrieved by literature searches, 184 meet the

  2. Addressing obesity in the management of knee and hip osteoarthritis - weighing in from an economic perspective.

    Science.gov (United States)

    Flego, Anna; Dowsey, Michelle M; Choong, Peter F M; Moodie, Marj

    2016-05-26

    Obesity is one of the only modifiable risk factors for both incidence and progression of Osteoarthritis (OA). So there is increasing interest from a public health perspective in addressing obesity in the management of OA. While evidence of the efficacy of intereventions designed to address obesity in OA populations continues to grow, little is known about their economic credentials. The aim of this study is to conduct a scoping review of: (i) the published economic evidence assessing the economic impact of obesity in OA populations; (ii) economic evaluations of interventions designed to explicitly address obesity in the prevention and management of OA in order to determine which represent value for money. Besides describing the current state of the literature, the study highlights research gaps and identifies future research priorities. In July 2014, a search of the peer reviewed literature, published in English, was undertaken for the period January 1975 - July 2014 using Medline Complete (Ebscohost), Embase, Econlit, Global Health, Health Economics Evaluation Database (HEED), all Cochrane Library databases as well as the grey literature using Google and reference lists of relevant studies. A combination of key search terms was used to identify papers assessing the economic impact of obesity in OA or economic evaluations conducted to assess the efficiency of obesity interventions for the prevention or management of OA. 14 studes were identified; 13 were cost burden studies assessing the impact of obesity as a predictor for higher costs in Total Joint Arthroplasty (TJA) patients and one a cost-effectiveness study of an intervention designed to address obesity in the managment of mild to moderate OA patients. The majority of the economic studies conducted are cost burden studies. While there is some evidence of the association between severe obesity and excess hospital costs for TJA patients, heterogeneity in studies precludes definitive statements about the

  3. Prevention in the Twenty-First Century: Promoting Health and Well-Being in Education and Psychology

    Science.gov (United States)

    Romano, John L.

    2014-01-01

    This paper explores the science of prevention, with special attention to prevention research and applications in education and psychology, and the importance of prevention in Asian countries. One example that will be highlighted is the recently adopted Korean government policy on Internet addiction which addresses the problem from prevention to…

  4. A diagonal address generator for a Josephson memory circuit

    International Nuclear Information System (INIS)

    Suzuki, H.; Hasuo, S.

    1987-01-01

    The authors propose that a diagonal D address generator, which is useful for a single flux quantum (SFQ) memory cell in the triple coincidence scheme, can be performed by a full adder circuit. For the purpose of evaluating the D address generator for a 16-kbit memory circuit, a 6-bit full adder circuit, using a current-steering flip-flop circuit, has been designed and fabricated with the lead-alloy process. Operating times for the address latch, carry generator, and sum generator were 150 ps, 250 ps/stage, and 1.4 ns, respectively. From these results, they estimate that the time necessary for the diagonal signal generation is 2.8 ns

  5. Wind versus Biofuels for Addressing Climate, Health, and Energy

    International Nuclear Information System (INIS)

    Jacobson, Mark Z.

    2007-01-01

    The favored approach today for addressing global warming is to promote a variety of options: biofuels, wind, solar thermal, solar photovoltaic, geothermal, hydroelectric, and nuclear energy and to improve efficiency. However, by far, most emphasis has been on biofuels. It is shown here, though, that current-technology biofuels cannot address global warming and may slightly increase death and illness due to ozone-related air pollution. Future biofuels may theoretically slow global warming, but only temporarily and with the cost of increased air pollution mortality. In both cases, the land required renders biofuels an impractical solution. Recent measurements and statistical analyses of U.S. and world wind power carried out at Stanford University suggest that wind combined with other options can substantially address global warming, air pollution mortality, and energy needs simultaneously.

  6. Chemically Addressable Perovskite Nanocrystals for Light-Emitting Applications

    KAUST Repository

    Sun, Haizhu

    2017-07-10

    Whereas organic–inorganic hybrid perovskite nanocrystals (PNCs) have remarkable potential in the development of optoelectronic materials, their relatively poor chemical and colloidal stability undermines their performance in optoelectronic devices. Herein, this issue is addressed by passivating PNCs with a class of chemically addressable ligands. The robust ligands effectively protect the PNC surfaces, enhance PNC solution processability, and can be chemically addressed by thermally induced crosslinking or radical-induced polymerization. This thin polymer shield further enhances the photoluminescence quantum yields by removing surface trap states. Crosslinked methylammonium lead bromide (MAPbBr3) PNCs are applied as active materials to build light-emitting diodes that have low turn-on voltages and achieve a record luminance of over 7000 cd m−2, around threefold better than previous reported MA-based PNC devices. These results indicate the great potential of this ligand passivation approach for long lifespan, highly efficient PNC light emitters.

  7. Firewall for Dynamic IP Address in Mobile IPv6

    Science.gov (United States)

    Qiu, Ying; Bao, Feng; Zhou, Jianying

    Mobile communication is becoming the mainstream with the rapid growth of mobile devices penetrating our daily life. More and more mobile devices such as mobile phones, personal digital assistants, notebooks etc, are capable of Internet access. Mobile devices frequently change their communication IP addresses in mobile IPv6 network following its current attached domain. This raises a big challenge for building firewall for mobile devices. The conventional firewalls are primarily based on IPv4 networks where the security criteria are specified only to the fixed IP addresses or subnets, which apparently do not apply to mobile IPv6. In this paper we propose three solutions for mobile IPv6 firewall. Our approaches make the firewall adaptive to dynamic IP addresses in mobile IPv6 network. They have different expense and weight corresponding to different degree of universality. The paper focuses the study more from practical aspect.

  8. Raising Awareness of Cybercrime--The Use of Education as a Means of Prevention and Protection

    Science.gov (United States)

    Bele, Julija Lapuh; Dimc, Maja; Rozman, David; Jemec, Andreja Sladoje

    2014-01-01

    The widespread use of mobile devices that enable Internet access increases the exposure of both individuals and organizations to cybercrime. This article addresses the issue of strategic prevention of cybercrime with the key focus on the measures to prevent cybercrime related to children and teenagers. The primary tool for such prevention is…

  9. Big data, little security: Addressing security issues in your platform

    Science.gov (United States)

    Macklin, Thomas; Mathews, Joseph

    2017-05-01

    This paper describes some patterns for information security problems that consistently emerge among traditional enterprise networks and applications, both with respect to cyber threats and data sensitivity. We draw upon cases from qualitative studies and interviews of system developers, network operators, and certifiers of military applications. Specifically, the problems discussed involve sensitivity of data aggregates, training efficacy, and security decision support in the human machine interface. While proven techniques can address many enterprise security challenges, we provide additional recommendations on how to further improve overall security posture, and suggest additional research thrusts to address areas where known gaps remain.

  10. Addressing resistance to antibiotics in systematic reviews of antibiotic interventions

    DEFF Research Database (Denmark)

    Leibovici, Leonard; Paul, Mical; Garner, Paul

    2016-01-01

    Antibiotics are among the most important interventions in healthcare. Resistance of bacteria to antibiotics threatens the effectiveness of treatment. Systematic reviews of antibiotic treatments often do not address resistance to antibiotics even when data are available in the original studies....... This omission creates a skewed view, which emphasizes short-term efficacy and ignores the long-term consequences to the patient and other people. We offer a framework for addressing antibiotic resistance in systematic reviews. We suggest that the data on background resistance in the original trials should...... controlled trials or systematic reviews....

  11. Addressing chronic operational issues at the W. M. Keck Observatory

    Science.gov (United States)

    Nordin, Tom; Matsuda, Richard

    2016-07-01

    The W. M. Keck Observatory (WMKO) has a good track record at addressing large critical faults which impact observing. Our performance tracking and correcting chronic minor faults has been mixed, yet this class of problems has a significant negative impact on scientific productivity and staff effectiveness. We have taken steps to address this shortcoming. This paper outlines the creation of a program to identify, categorize and rank these chronic operational issues, track them over time, and develop management options for their resolution. The success of the program at identifying these chronic operational issues and the advantages of dedicating observatory resources to this endeavor are presented.

  12. A Novel Smart Meter Controlling System with Dynamic IP Addresses

    DEFF Research Database (Denmark)

    Manembu, Pinrolinvic; Welang, Brammy; Kalua Lapu, Aditya

    2017-01-01

    Smart meters are the electronic devices for measuring energy consumption in real time. Usually, static public IP addresses are allocated to realize the point-to-point (P2P) communication and remote controlling for smart metering systems. This, however, restricts the wide deployment of smart meters......, due to the deficiency of public IP resources. This paper proposes a novel subscription-based communication architecture for the support of dynamic IP addresses and group controlling of smart meters. The paper evaluates the proposed architecture by comparing the traditional P2P architecture...

  13. Mapping of MAC Address with Moving WiFi Scanner

    Directory of Open Access Journals (Sweden)

    Arief Hidayat

    2017-10-01

    Full Text Available Recently, Wifi is one of the most useful technologies that can be used for detecting and counting MAC Address. This paper described using of WiFi scanner which carried out seven times circulated the bus. The method used WiFi and GPS are to counting MAC address as raw data from the pedestrian smartphone, bus passenger or WiFi devices near from the bus as long as the bus going around the route. There are seven processes to make map WiFi data.

  14. Residualization is not the answer: Rethinking how to address multicollinearity.

    Science.gov (United States)

    York, Richard

    2012-11-01

    Here I show that a commonly used procedure to address problems stemming from collinearity and multicollinearity among independent variables in regression analysis, "residualization", leads to biased coefficient and standard error estimates and does not address the fundamental problem of collinearity, which is a lack of information. I demonstrate this using visual representations of collinearity, hypothetical experimental designs, and analyses of both artificial and real world data. I conclude by noting the importance of examining methodological practices to ensure that their validity can be established based on rational criteria. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Addressing Climate Change and the Role of Technological Solutions

    Directory of Open Access Journals (Sweden)

    Stephen Axon

    2010-05-01

    Full Text Available As far as sustainability is concerned, the role of technology has always been contested. With regard to environmental degradation, technology is either perceived to be part of the problem or part of the solution. To combat the complex issues of the present time, technological solutions are expected to play a key role towards mitigating and adapting to the negative impacts of climate change. The paper also discusses the role of the 2009 Copenhagen Conference towards addressing climate change. Although the Copenhagen Accord is not a legally binding agreement, it is seen as a necessary first step towards a protocol that will effectively address the issue of climate change.

  16. Preventing social isolation in older people.

    Science.gov (United States)

    Cotterell, Natalie; Buffel, Tine; Phillipson, Christopher

    2018-07-01

    The extent of social isolation amongst older people has emerged as a major concern for health and social policy. Although the social and health outcomes of social isolation are well documented, evidence regarding the prevention of isolation in later life remains scarce. This article addresses this by presenting the findings from a literature review focusing on the identification, assessment, prevention, and intervention strategies relevant to social isolation in older age. The paper first addresses the issues of identification and assessment, using an ecological framework to identify the risk factors for social isolation at four levels: individual, relationship, community, and societal. It then reviews different types of interventions to reduce or prevent social isolation in later life, including one-to-one, group, service provision, technology-based, neighbourhood, and structural interventions. The paper discusses both the opportunities and the constraints associated with these different approaches. The discussion highlights future directions for research, emphasising the need for a cultural change from 'cure' to 'prevention' of social isolation across the life-course, and the importance of acknowledging greater diversity within the ageing population. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. HIV Risk and Prevention

    Science.gov (United States)

    ... Prevention VIH En Español Get Tested Find an HIV testing site near you. Enter ZIP code or city Follow HIV/AIDS CDC HIV CDC HIV/AIDS See RSS | ... Email Updates on HIV Syndicated Content Website Feedback HIV Risk and Prevention Recommend on Facebook Tweet Share ...

  18. Can I Prevent Acne?

    Science.gov (United States)

    ... for Educators Search English Español Can I Prevent Acne? KidsHealth / For Teens / Can I Prevent Acne? Print en español ¿Puedo prevenir el acné? What Causes Acne? Contrary to what you may have heard, acne ...

  19. [Prevention of psychosocial risks].

    Science.gov (United States)

    Dalle, Édouard; Trichard-Salembier, Alexandra; Sobaszek, Annie

    2018-02-01

    The theme of psychosocial risks remains in the workplace. It is therefore essential that all members of a company are made aware of the terminology and specific prevention actions in this field. Distinguishing between the manifestations of these risks and their causes and consequences helps to improve prevention. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. Prevention of Graves' ophthalmopathy.

    Science.gov (United States)

    Bartalena, Luigi

    2012-06-01

    Smoking is the most important risk factor for the occurrence/progression of Graves' ophthalmopathy (GO), as well as for its lower/slower response to immunosuppression. Accordingly, refrain from smoking should be urged, both as primary prevention (removal of risk factors in Graves' patients without GO), secondary prevention (early detection and treatment of asymptomatic/very mild GO) and tertiary prevention (reduction of complications/disability of overt GO). A 6-month course of 200 μg/day sodium selenite can prevent progression of mild GO to more severe GO and is, therefore, a form of secondary prevention and, probably, primary prevention. Correction of thyroid dysfunction and stable maintenance of euthyroidism are important preventive measures. The optimal treatment for hyperthyroidism in patients with GO is uncertain, because evidence demonstrating the superiority of antithyroid drugs over thyroid ablation (radioiodine, thyroidectomy, or both) is lacking. If radioiodine is used, low-dose steroid prophylaxis is recommended, particularly in smokers, to prevent radioiodine-associated GO progression. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Prevent Cervical Cancer!

    Centers for Disease Control (CDC) Podcasts

    2015-01-08

    Cervical cancer can be prevented. Listen as two friends—one a doctor—talk about screening tests and early detection. Learn what test you might need.  Created: 1/8/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 1/8/2015.

  2. Poison Prevention Program

    Science.gov (United States)

    Office of Substance Misuse and Addiction Prevention Finance & Management Services Health Care , Technology: For more info about the national Poison Help program and to request materials visit: http Seniors & Disabilities Services Substance Misuse and Addiction Prevention State of Alaska myAlaska My

  3. Waste minimization and pollution prevention awareness plan

    Energy Technology Data Exchange (ETDEWEB)

    1991-05-31

    The purpose of this plan is to document the Lawrence Livermore National Laboratory (LLNL) Waste Minimization and Pollution Prevention Awareness Program. The plan specifies those activities and methods that are or will be employed to reduce the quantity and toxicity of wastes generated at the site. The intent of this plan is to respond to and comply with (DOE's) policy and guidelines concerning the need for pollution prevention. The Plan is composed of a LLNL Waste Minimization and Pollution Prevention Awareness Program Plan and, as attachments, Program- and Department-specific waste minimization plans. This format reflects the fact that waste minimization is considered a line management responsibility and is to be addressed by each of the Programs and Departments. 14 refs.

  4. Waste minimization and pollution prevention awareness plan

    International Nuclear Information System (INIS)

    1991-01-01

    The purpose of this plan is to document the Lawrence Livermore National Laboratory (LLNL) Waste Minimization and Pollution Prevention Awareness Program. The plan specifies those activities and methods that are or will be employed to reduce the quantity and toxicity of wastes generated at the site. The intent of this plan is to respond to and comply with (DOE's) policy and guidelines concerning the need for pollution prevention. The Plan is composed of a LLNL Waste Minimization and Pollution Prevention Awareness Program Plan and, as attachments, Program- and Department-specific waste minimization plans. This format reflects the fact that waste minimization is considered a line management responsibility and is to be addressed by each of the Programs and Departments. 14 refs

  5. Prevention of preterm birth.

    LENUS (Irish Health Repository)

    Flood, Karen

    2012-02-01

    Preterm birth (delivery before 37 completed weeks of gestation) is common and rates are increasing. In the past, medical efforts focused on ameliorating the consequences of prematurity rather than preventing its occurrence. This approach resulted in improved neonatal outcomes, but it remains costly in terms of both the suffering of infants and their families and the economic burden on society. Increased understanding of the pathophysiology of preterm labor has altered the approach to this problem, with increased focus on preventive strategies. Primary prevention is a limited strategy which involves public education, smoking cessation, improved nutritional status and avoidance of late preterm births. Secondary prevention focuses on recurrent preterm birth which is the most recognisable risk factor. Widely accepted strategies include cervical cerclage, progesterone and dedicated clinics. However, more research is needed to explore the role of antibiotics and anti-inflammatory treatments in the prevention of this complex problem.

  6. Measuring waste prevention.

    Science.gov (United States)

    Zorpas, Antonis A; Lasaridi, Katia

    2013-05-01

    The Waste Framework Directive (WFD-2008/98/EC) has set clear waste prevention procedures, including reporting, reviewing, monitoring and evaluating. Based on the WFD, the European Commission and will offer support to Member States on how to develop waste prevention programmes through guidelines and information sharing on best practices. Monitoring and evaluating waste prevention activities are critical, as they constitute the main tools to enable policy makers, at the national and local level, to build their strategic plans and ensure that waste prevention initiatives are effective and deliver behaviour change. However, how one can measure something that is not there, remains an important and unresolved research question. The paper reviews and attempts to evaluate the methods that are being used for measuring waste prevention and the impact of relevant implemented activities at the household level, as the available data is still limited. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. California Breast Cancer Prevention Initiatives: Setting a research agenda for prevention.

    Science.gov (United States)

    Sutton, P; Kavanaugh-Lynch, M H E; Plumb, M; Yen, I H; Sarantis, H; Thomsen, C L; Campleman, S; Galpern, E; Dickenson, C; Woodruff, T J

    2015-07-01

    The environment is an underutilized pathway to breast cancer prevention. Current research approaches and funding streams related to breast cancer and the environment are unequal to the task at hand. We undertook the California Breast Cancer Prevention Initiatives, a four-year comprehensive effort to set a research agenda related to breast cancer, the environment, disparities and prevention. We identified 20 topics for Concept Proposals reflecting a life-course approach and the complex etiology of breast cancer; considering the environment as chemical, physical and socially constructed exposures that are experienced concurrently: at home, in the community and at work; and addressing how we should be modifying the world around us to promote a less carcinogenic environment. Redirecting breast cancer research toward prevention-oriented discovery could significantly reduce the incidence and associated disparities of the disease among future generations. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Pollution Prevention Program: Technology summary

    International Nuclear Information System (INIS)

    1994-02-01

    The Department of Energy (DOE) has established a national Research, Development, Demonstration, Testing, and Evaluation (RDDT ampersand E) Program for pollution prevention and waste minimization at its production plants During FY89/90 the Office of Environmental Restoration and Waste Management (EM), through the Office of Technology Development (OTD), established comprehensive, pollution prevention technical support programs to demonstrate new, environmentally-conscious technology for production processes. The RDDT ampersand E program now entails collaborative efforts across DOE. The Pollution Prevention Program is currently supporting three major activities: The DOE/US Air Force Memorandum of Understanding Program is a collaborative effort to utilize the combined resources of DOE and the Department of Defense, eliminate duplication of effort in developing technologies, and to facilitate technology solutions aimed at reducing waste through process modification, material substitution or recycling. The Waste Component Recycle, Treatment and Disposal Integrated Demonstration (WeDID) will develop recycle, treatment, and disposal processes and associated technologies for use in the dismantlement of non-nuclear weapons components, to support US arms treaties and policies. This program will focus on meeting all security and regulatory requirements (with additional benefit to the commercial electronics industry). The Environmentally Conscious Manufacturing Integrated Demonstration (ECMID) will effectively implement ECM technologies that address both the needs of the DOE Complex and US electronics industry, and encourage strong interaction between DOE and US industry. The ECMID will also develop life cycle analysis tools that will aid decisionmakers in selecting the optimum process based on the tradeoffs between cost an environmental impact

  9. [Current Guidelines to Prevent Obesity in Childhood and Adolescence].

    Science.gov (United States)

    Blüher, S; Kromeyer-Hauschild, K; Graf, C; Grünewald-Funk, D; Widhalm, K; Korsten-Reck, U; Markert, J; Güssfeld, C; Müller, M J; Moss, A; Wabitsch, M; Wiegand, S

    2016-01-01

    Current guidelines for the prevention of obesity in childhood and adolescence are presented. A literature search was performed in Medline via PubMed, and appropriate studies were analysed. Programs to prevent childhood obesity were to date mainly school-based. Effects were limited to date. Analyses tailored to different age groups show that prevention programs have the best effects in younger children (adolescence, school-based interventions were most effective when adolescents were directly addressed. To date, obesity prevention programs have mainly focused on behavior oriented prevention. Recommendations for condition oriented prevention have been suggested by the German Alliance of Non-communicable Diseases and include one hour of physical activity at school, promotion of healthy food choices by taxing unhealthy foods, mandatory quality standards for meals at kindergarten and schools as well as a ban on unhealthy food advertisement addressing children. Behavior oriented prevention programs showed hardly any or only limited effects in the long term. Certain risk groups for the development of obesity are not reached effectively by available programs. Due to the heterogeneity of available studies, universally valid conclusions cannot be drawn. The combination with condition oriented prevention, which has to counteract on an obesogenic environment, is crucial for sustainable success of future obesity prevention programs. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Addressing diabetes at the crossroads of global pandemic and regional culture: Comment on "The curse of wealth – Middle Eastern countries need to address the rapidly rising burden of diabetes"

    OpenAIRE

    Hsu, William C.; Gabbay, Robert A.

    2014-01-01

    As diabetes and obesity rates continue to climb at astronomical rates in the Middle East, future generations are at an even greater risk for diabetes and the associated complications. Many factors are at play and it is clear that creative solutions are needed to retool provider resources in the Middle East towards prevention of diabetes and its complications while leveraging technology to maximize outreach within the accepted cultural norms. Only by building the capacity to address the curren...

  11. Family Resiliency: A Neglected Perspective in Addressing Obesity in Young Children.

    Science.gov (United States)

    Sigman-Grant, Madeleine; Hayes, Jenna; VanBrackle, Angela; Fiese, Barbara

    2015-12-01

    Traditional research primarily details child obesity from a risk perspective. Risk factors are disproportionately higher in children raised in poverty, thus negatively influencing the weight status of low-income children. Borrowing from the field of family studies, the concept of family resiliency might provide a unique perspective for discussions regarding childhood obesity, by helping to identify mediating or moderating protective mechanisms that are present within the family context. A thorough literature review focusing on (1) components of family resiliency that could be related to childhood obesity and (2) factors implicated in childhood obesity beyond those related to energy balance was conducted. We then conceptualized our perspective that understanding resiliency within an obesogenic environment is warranted. Both family resiliency and childhood obesity prevention rely on the assumptions that (1) no one single answer can address the multifactorial nature involved with adopting healthy lifestyle behaviors and (2) the pieces in this complex puzzle will differ between families. Yet, there are limited holistic studies connecting family resiliency measures and childhood obesity prevention. Combining mixed methodology using traditional measures (such as general parenting styles, feeding styles, and parent feeding behaviors) with potential family resiliency measures (such as family routines, family stress, family functioning, and family structure) might serve to broaden understanding of protective strategies. The key to future success in child obesity prevention and treatment may be found in the application of the resiliency framework to the exploration of childhood obesity from a protective perspective focusing on the family context.

  12. Application of the Pareto principle to identify and address drug-therapy safety issues.

    Science.gov (United States)

    Müller, Fabian; Dormann, Harald; Pfistermeister, Barbara; Sonst, Anja; Patapovas, Andrius; Vogler, Renate; Hartmann, Nina; Plank-Kiegele, Bettina; Kirchner, Melanie; Bürkle, Thomas; Maas, Renke

    2014-06-01

    Adverse drug events (ADE) and medication errors (ME) are common causes of morbidity in patients presenting at emergency departments (ED). Recognition of ADE as being drug related and prevention of ME are key to enhancing pharmacotherapy safety in ED. We assessed the applicability of the Pareto principle (~80 % of effects result from 20 % of causes) to address locally relevant problems of drug therapy. In 752 cases consecutively admitted to the nontraumatic ED of a major regional hospital, ADE, ME, contributing drugs, preventability, and detection rates of ADE by ED staff were investigated. Symptoms, errors, and drugs were sorted by frequency in order to apply the Pareto principle. In total, 242 ADE were observed, and 148 (61.2 %) were assessed as preventable. ADE contributed to 110 inpatient hospitalizations. The ten most frequent symptoms were causally involved in 88 (80.0 %) inpatient hospitalizations. Only 45 (18.6 %) ADE were recognized as drug-related problems until discharge from the ED. A limited set of 33 drugs accounted for 184 (76.0 %) ADE; ME contributed to 57 ADE. Frequency-based listing of ADE, ME, and drugs involved allowed identification of the most relevant problems and development of easily to implement safety measures, such as wall and pocket charts. The Pareto principle provides a method for identifying the locally most relevant ADE, ME, and involved drugs. This permits subsequent development of interventions to increase patient safety in the ED admission process that best suit local needs.

  13. PRIMARY PREVENTION IS? A GLOBAL PERSPECTIVE ON HOW ORGANIZATIONS ENGAGING MEN IN PREVENTING GENDER-BASED VIOLENCE CONCEPTUALIZE AND OPERATIONALIZE THEIR WORK

    Science.gov (United States)

    Storer, Heather L.; Casey, Erin A.; Carlson, Juliana; Edleson, Jeffrey L.; Tolman, Richard M.

    2014-01-01

    Engaging men in addressing violence against women (VAW) has become a strategy in the global prevention of gender-based violence. Concurrently, Western public health frameworks have been utilized to guide prevention agendas worldwide. Using qualitative methods, this study describes how global anti-violence organizations that partner with men conceptualize primary prevention in their work. Findings suggest that ‘primary prevention’ is not a fixed term in the context of VAW and that front-line prevention work challenges rigidly delineated distinctions between levels of prevention. Much can be learned from global organizations’ unique and contextualized approaches to the prevention of VAW. PMID:26333283

  14. Identifying and Addressing Themes of Job Dissatisfaction for Secondary Principals

    Science.gov (United States)

    De Jong, David; Grundmeyer, Trent; Yankey, Julie

    2017-01-01

    Secondary principals serve in important roles that are complex, high-stress, and include demanding job responsibilities. Key stakeholders such as superintendents, school board members, and legislators must understand the challenges facing secondary principals in order to address the current themes of job dissatisfaction. Using new survey data…

  15. Addressing sampling bias in counting forest birds: a West African ...

    African Journals Online (AJOL)

    Addressing sampling bias in counting forest birds: a West African case study. ... result may occur because of the noise they may introduce into the analysis. ... used at all; and for all transects to reach their mid-point at the same time each day, ...

  16. The role of health education in addressing the health divide

    DEFF Research Database (Denmark)

    Simovska, Venka

    2013-01-01

    The aim of this chapter is to argue that an approach to health education, consistent with critical education theory echoing Freire’s ideas, has the potential to play a significant role in addressing determinants of health by, first and foremost, providing children and young people with opportunit...

  17. 76 FR 22681 - Defense Logistics Agency (DLA) Address Directory

    Science.gov (United States)

    2011-04-22

    ... DEPARTMENT OF DEFENSE Office of the Secretary Defense Logistics Agency (DLA) Address Directory AGENCY: Department of Defense. ACTION: Notice. SUMMARY: The Defense Logistics Agency (DLA) is updating... Directory: Defense Logistics Agency Headquarters, Andrew T. McNamara Building, 8725 John J. Kingman Road...

  18. Addressing resistance to antibiotics in systematic reviews of antibiotic interventions

    NARCIS (Netherlands)

    Leibovici, Leonard; Paul, Mical; Garner, Paul; Sinclair, David J; Afshari, Arash; Pace, Nathan Leon; Cullum, Nicky; Williams, Hywel C; Smyth, Alan; Skoetz, Nicole; Del Mar, Chris; Schilder, Anne G M; Yahav, Dafna; Tovey, David

    Antibiotics are among the most important interventions in healthcare. Resistance of bacteria to antibiotics threatens the effectiveness of treatment. Systematic reviews of antibiotic treatments often do not address resistance to antibiotics even when data are available in the original studies. This

  19. Addressing Anger Using Sensorimotor Psychotherapy and Cognitive Behaviour Therapy

    Science.gov (United States)

    Flynn, Sarah M.

    2010-01-01

    A young woman initiated counselling services at a community agency to address her explosive anger that was a remnant of childhood physical and emotional abuse. Sensorimotor psychotherapy was used to help this client learn how to monitor and regulate her sensorimotor processes. In conjunction with this approach, Cognitive behavioural therapy was…

  20. Are Teacher and Principal Candidates Prepared to Address Student Cyberbullying?

    Science.gov (United States)

    Styron, Ronald A., Jr.; Bonner, Jessica L.; Styron, Jennifer L.; Bridgeforth, James; Martin, Cecelia

    2016-01-01

    The purpose of this study was to examine the preparation of teacher and principal candidates to address problems created in K-12 settings as a result of cyberbullying. Participants included teacher and principal preparation students. Findings indicated that respondents were familiar with the most common forms of cyberbullying and its impact on…

  1. Addressing Nature Deficit Disorder through Primitive Camping Experiences

    Science.gov (United States)

    Allen, Kevin; Varner, Keegan; Sallee, Jeff

    2011-01-01

    Today's youth suffer from Nature Deficit Disorder, a condition that has been connected to ADHD, shortage of creativity, and general lack of knowledge about the outdoors. A team of educators and specialists are addressing this issue with primitive camping. County educators were trained using experiential learning and train-the-trainer techniques.…

  2. Understanding and Addressing Homophobia in Schools: A View from Teachers

    Science.gov (United States)

    Bhana, Deevia

    2012-01-01

    South African schools have been found to be homophobic. Teachers can play an important role in offering a critique of homophobia grounded in South Africa's legal claim to equality on the basis of sexual orientation. Currently there is a dearth of educational research about how teachers understand and address homophobia. By drawing upon focus-group…

  3. Organizing for Flexibility: Addressing Dynamic Capabilities and Organization Design

    OpenAIRE

    van der Weerdt, Niels; Volberda, Henk; Verwaal, Ernst; Stienstra, Marten

    2014-01-01

    The increasingly dynamic nature of organizational environments has led the research community to study organizational flexibility. Although the research literature stresses the complexity of the organizational flexibility construct, it lacks a comprehensive empirical study addressing the relationships among various dimensions of organizational flexibility. This chapter develops a theoretical framework specifying the linkages between types of flexibility and organization design characteristics...

  4. Addressing the "Epidemic" of Overweight Children by Using the Internet

    Science.gov (United States)

    Coleman, Mick; Wallinga, Charlotte; Bales, Diane

    2009-01-01

    The Internet can be of great assistance to early childhood teachers in planning educational activities for the classroom and with families. This article explores how early childhood teachers can use resources online to address what has been called an "epidemic" of overweight children. Guidelines for using online resources are presented. (Contains…

  5. Secondary Data Analysis: An Important Tool for Addressing Developmental Questions

    Science.gov (United States)

    Greenhoot, Andrea Follmer; Dowsett, Chantelle J.

    2012-01-01

    Existing data sets can be an efficient, powerful, and readily available resource for addressing questions about developmental science. Many of the available databases contain hundreds of variables of interest to developmental psychologists, track participants longitudinally, and have representative samples. In this article, the authors discuss the…

  6. Communicating one's local address and emergency contact details

    CERN Multimedia

    Information Technology Department, AIS (Administrative Information Services) Group; Human Resources Department, SPS (Services, Procedures and Social) Group

    2007-01-01

    As part of the ongoing simplification of procedures and rationalisation of administrative processes, the IT, PH (Users Office) and HR Departments have developed two new EDH forms for communicating or updating one's local address and emergency contact details. This is the first time that the forms relating to an official HR procedure can be accessed on a self-service basis and directly updated by the members of personnel themselves. The information recorded remains confidential and may only be accessed by the authorised administrative services and the emergency services. Local address: Members of the personnel must declare any change in their local address (Art. R V 1.38 of the Staff Regulations). This declaration is henceforth made by directly filling out the EDH document indicated below, and without requiring any other spontaneous formality vis-à-vis the department secretariat or the Users Office. It is also possible for any member of the personnel to check whether the local address in the Organizati...

  7. Balancing Act: Addressing Culture and Gender in ESL Classrooms

    Science.gov (United States)

    Johnson, Michelle A.; Chang, Debbie

    2012-01-01

    ESL educators find themselves teaching a diverse group of students in today's classroom. This study investigated how ESL instructors address diversity in their teaching. The literature review revealed research on the experiences of teachers using culturally responsive teaching strategies. Using qualitative research methods, this study explores the…

  8. Reframing "The Italian": Questions of Audience Address in Early Cinema.

    Science.gov (United States)

    Keil, Charlie

    1990-01-01

    Analyzes "The Italian" (1915), an early "immigrant" film, examining its problematic relation to questions of working-class and middle-class audience composition. Shows how this film reveals that the creation of narratives suitable for diverse audiences requires continuous readjustment of an adequate mode of address. (MM)

  9. Responsibility for radical change in addressing climate change

    NARCIS (Netherlands)

    Bouvrie, des N.; Karlsson-Vinkhuyzen, S.I.S.E.; Jollands, N.

    2015-01-01

    To radically address the problem of climate change, it is not enough to modify specific attitudes and behaviors while upholding the present paradigms. This article aims to show why modifications will never bring about radical carbon emission reductions. We discuss what it implies to desire radical

  10. Catholic Social Teaching: Addressing Globalization in Catholic Business Education

    Science.gov (United States)

    Ball, James B.; Martinez, Zaida; Toyne, Brian

    2009-01-01

    Although business schools are increasingly aware of the importance of globalization in educating future business leaders, their business programs have addressed globalization from a limited perspective that fails to provide students with a broader understanding of its impact on societies and its moral consequences. The conventional approach to the…

  11. Maryland's Model Policy to Address Bullying, Harassment, or Intimidation

    Science.gov (United States)

    Maryland State Department of Education, 2016

    2016-01-01

    In accordance with the provisions of Section 7-424.1 of the Education Article of the Annotated Code of Maryland, the Maryland State Board of Education has developed and adopted a Model Policy to address bullying, harassment, or intimidation. This report presents the Model Policy, which is organized into the following eight points: (1) Prohibition…

  12. Bulimia: Issues a University Counseling Center Needs To Address.

    Science.gov (United States)

    Whitner, Phillip A.; Shetterly, Arminta

    The eating disorder known as bulimia is a relatively new and baffling phenomenon. This paper raises questions that college and university counseling center professionals need to address regarding this phenomenon. The first section focuses on defining the term "bulimia" and its evolution. The second section identifies numerous symptoms that need to…

  13. The non addressed mail; Le courrier non adresse

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    In 1999, the non addressed mail aggregated i million tons. Today there is no selective collection of these wastes. The ADEME (french agency for the environment and the energy mastership) drove a study to propose and evaluate the cost of a selective collection. This document presents the results of the study. (A.L.B.)

  14. A Breath of Fresh Air: Addressing Indoor Air Quality

    Science.gov (United States)

    Palliser, Janna

    2011-01-01

    Indoor air pollution refers to "chemical, biological, and physical contamination of indoor air," which may result in adverse health effects (OECD 2003). The causes, sources, and types of indoor air pollutants will be addressed in this article, as well as health effects and how to reduce exposure. Learning more about potential pollutants in home…

  15. How Teacher Educators Can Address Our Nation's Financial Crisis

    Science.gov (United States)

    Dowdell, John; McElfresh, Dwight; Sikula, John

    2009-01-01

    This article from Ashland University reports on what one university, well known for its Teacher Education programs, is doing in an economically depressed state to address our country's financial crisis. Ohio has mandated that financial literacy be taught in high schools by 2010. Reported herein is what is being done to prepare teachers for this…

  16. Some diagnostic and therapeutic controversies in glaucoma addressed

    NARCIS (Netherlands)

    Müskens, Rogier Peter Hendrik Maria

    2008-01-01

    In the five studies contained in this thesis, several controversies on the diagnosis of and therapy for glaucoma have been addressed. The first part of this thesis consisted of three studies that aimed tot improve existing technologies for diagnosing glaucoma. The latter part consisted of two

  17. Addressing Physical and Emotional Issues in Children's Literature

    Science.gov (United States)

    Johnson, Jonathon

    2010-01-01

    The purpose of this paper is to examine how physical and mental disabilities are addressed in children's literature. Many authors are able to integrate the issues into their work in a way that enhances the story and benefits the reader. As young readers learn about the issues and struggles faced by children with mental and physical disabilities,…

  18. State Legislation to Address Childhood Obesity. Program Results Brief

    Science.gov (United States)

    Fiester, Leila

    2012-01-01

    An estimated 12.5 million American children and teens are obese. Over time, the diseases and disabilities associated with obesity may undermine this population's health and result in substantial social and economic costs. Policies that address children's nutrition and physical activity are an important tool in reversing the obesity epidemic. More…

  19. 32 CFR Appendix B to Part 286 - Addressing FOIA Requests

    Science.gov (United States)

    2010-07-01

    ... Ballistic Missile Defense Organization Defense Systems Management College National Defense University Armed... 32 National Defense 2 2010-07-01 2010-07-01 false Addressing FOIA Requests B Appendix B to Part 286 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED...

  20. Second-Person Address Forms in Contemporary Uruguayan Children's Literature

    Science.gov (United States)

    Rosales Lagos, María José; Moyna, María Irene

    2016-01-01

    In this study, we analyze the representations of singular address ("voseo," "tuteo," and "ustedeo") in contemporary Uruguayan children's literature from 1997 to 2011 as part of a broader analysis of variation and change in Uruguayan Spanish (Behares 1981; Bertolotti 2011; Bertolotti and Coll 2003; Elizaincín and Díaz…

  1. Challenging structures through addressing gender-based violence

    African Journals Online (AJOL)

    Getting the past right in West Africa and beyond: Addressing gender-based ... 2 See Convention on the Elimination of All Forms of Discrimination against Women .... 6 The Protocol to the African Charter on Human and People's Rights on the ...

  2. 10 Translanguaging as an approach to address language inequality ...

    African Journals Online (AJOL)

    To address this social injustice issue, academic literacy practitioners have a critical ... media of communication, instruction and assessment in education. .... Childs (2016, citing Garcia 2014: 3) argues this point by noting that translanguaging is ..... their cognitive skills because the activities that required them to move across ...

  3. Assessing Competency to Address Ethical Issues in Medicine.

    Science.gov (United States)

    Cohen, Robert; And Others

    1991-01-01

    A study evaluated the feasibility of an objective structured clinical examination to assess the competence of foreign medical school graduates, clinical clerks, and interns to address clinical ethical situations. The University of Toronto's experience with the measure found it useful but in need of improvement. (MSE)

  4. New Simulation Models for Addressing Like X–Aircraft Responses ...

    African Journals Online (AJOL)

    New Simulation Models for Addressing Like X–Aircraft Responses. AS Mohammed, SO Abdulkareem. Abstract. The original Monte Carlo model was previously modified for use in simulating data that conform to certain resource flow constraints. Recent encounters in communication and controls render these data absolute ...

  5. Addressing domestic violence in primary care: what the physician ...

    African Journals Online (AJOL)

    Domestic violence (DV) is quite prevalent and negatively impacts the health and mental wellbeing of those affected. Victims of DV are frequent users of health service, yet they are infrequently recognized. Physicians tend to treat the presenting complaints without addressing the root cause of the problem. Lack of knowledge ...

  6. Teaching Digital Natives: Promoting Information Literacy and Addressing Instructional Challenges

    Science.gov (United States)

    Neumann, Crystal

    2016-01-01

    Technology must be used as a teaching and learning tool to help students succeed. However, educators must be proactive in identifying some of the pitfalls of technology, such as information illiteracy. The phenomenological study covers how English instructors from Indianapolis, who teach first year students, address information literacy and the…

  7. Imaginative Thinking: Addressing Social Justice Issues through MovieMaker

    Science.gov (United States)

    Boske, Christa A.

    2009-01-01

    Purpose: The purpose of this paper is to examine the experiences of aspiring school leaders who utilized artmaking in this case, photography, poetry, music, collage, and short films through Microsoft MovieMaker as a means for addressing injustices within surrounding school communities. The paper aims to explore how aspiring school leaders…

  8. "Back-Stage" Dissent: Student Twitter Use Addressing Instructor Ideology

    Science.gov (United States)

    Linvill, Darren L.; Boatwright, Brandon C.; Grant, Will J.

    2018-01-01

    In this content analysis, we explored how students address instructor ideology in the university classroom through the social media platform Twitter. We employed Boolean search operators through Salesforce Marketing Cloud Radian6 software to gather tweets and identified English language tweets by how students referenced their instructor's…

  9. Addressing Maslow’s deficiency needs in smart homes

    NARCIS (Netherlands)

    Brink, M.; Bronswijk, van J.E.M.H.

    2013-01-01

    Modern smart homes contain elements from different technical disciplines, such as home automation, robotics, and tele-heath. We investigated to which extent smart-home systems address the different levels of deficiency needs of Maslow, and the corresponding level of integration of smart-home

  10. Utilizing Motivational Interviewing to Address Resistant Behaviors in Clinical Supervision

    Science.gov (United States)

    Wahesh, Edward

    2016-01-01

    Motivational interviewing is presented as an approach to address resistant behaviors in clinical supervision. A case example is used to illustrate the process in which the relational and technical elements of motivational interviewing can be applied to supervisee resistance. Implications for supervisors and researchers are discussed.

  11. Can Innovation Save Gifted Education? 2010 NAGC Presidential Address

    Science.gov (United States)

    Robinson, Ann

    2012-01-01

    Connecting innovation with gifted education is a necessity not only in the current political climate but also because it is a field with deeply held beliefs about the importance of problem solving, creativity, imagination, and invention--all critical components of innovation. In this address, the author focuses on three key ideas. First, she…

  12. Addressing the Need for Management Processes for Higher Education Accreditation.

    Science.gov (United States)

    Brennan, Linda L.; Austin, Walter W.

    2003-01-01

    The accreditation standards of the Association to Advance Collegiate Schools of Business (AACSB International) ask business schools to describe consistent processes that provide for operational consistency and continuous improvement in support of the schools' stated missions. This article addresses the identification of requisite quality…

  13. Cultural and Social Interpretation of Chinese Addressing Strategies

    Science.gov (United States)

    Yin, Yahui

    2010-01-01

    This paper examines the influence of Chinese cultural factors on the addressing terms, together with the history of their use, the social dynamics involved in their use. Through the examination of exact terms, the author demonstrates to the reader, the deeply rooted cultural factors behind it and different ways that these terms can be used,…

  14. Do Faith Communities Have a Role in Addressing Childhood Obesity?

    Science.gov (United States)

    Opalinski, Andra; Dyess, Susan; Grooper, Sareen

    2015-01-01

    Pediatric obesity is a multifaceted phenomenon. A partnership with faith-based communities to address the issue has been suggested. The purpose of this study was to describe the cultural beliefs of faith community leaders regarding childhood obesity and to examine attitudes about their role in addressing the issue. A qualitative descriptive design informed by ethnographic methods and triangulation of multiple data sources was utilized to assess the cultural beliefs of faith community leaders. A purposive sample of 13 leaders (nine females, four males) from seven multicultural and multigenerational local faith communities participated in the study. No more than three participants from any one faith community were enrolled in the study. Twenty-first century lifestyle challenges, accountability of behaviors (a dichotomy that fluctuated between individual responsibility to community and/or social responsibility), and the need for intentionality emerged as themes from the data. Faith community leaders envisioned a role for faith communities in addressing childhood obesity. Findings support the ongoing development of population based health promotion programs through faith community engagement. The findings provide a foundation for nurses partnering with faith communities on health promotion programs targeting childhood obesity to address family health issues in a holistic way. © 2015 Wiley Periodicals, Inc.

  15. 27 CFR 19.645 - Name and address of bottler.

    Science.gov (United States)

    2010-04-01

    ... of such other plants. However: (a) Where distilled spirits are bottled by or for the distiller... trade name) under which the particular spirits were distilled, or any trade name shown on the distiller... addresses) of the distiller; (b) Where “straight whiskies” of the same type which have been produced in the...

  16. Addressing legal and policy barriers to male circumcision for ...

    African Journals Online (AJOL)

    guidelines, which address medical male circumcision performed under local anaesthetic. ... we identify ambiguities and tensions that exist between the Children's Act, regulations and national guidelines. We recommend reform to ..... 474. http://dx.doi.org/10.1136/medethics-2012-101229. 6. South Africa. Children's Act No.

  17. EEASA 2003 Keynote Address - The Earth Charter: Possibilities for ...

    African Journals Online (AJOL)

    EEASA 2003 Keynote Address - The Earth Charter: Possibilities for Ethical Policy in Practice. PB Corcoran. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · Creative Commons License This work is licensed under a Creative Commons ...

  18. Effective Organizational Structures and Processes: Addressing Issues of Change

    Science.gov (United States)

    Andrade, Maureen Snow

    2016-01-01

    This chapter describes organizational structures and processes at the institutional and project levels for the development and support of distance learning initiatives. It addresses environmental and stakeholder issues and explores principles and strategies of effective leadership for change creation and management.

  19. 27 CFR 5.36 - Name and address.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Name and address. 5.36 Section 5.36 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS LABELING AND ADVERTISING OF DISTILLED SPIRITS Labeling Requirements for...

  20. Can the South African address standard (SANS 1883) work for small local municipalities?

    CSIR Research Space (South Africa)

    Coetzee, S

    2008-10-01

    Full Text Available addresses for only two of the address types in SANS-1883, namely Street Address and Site Address. As an example, of the 34 attributes in the above-mentioned 'tblAddress' table, 15 do not apply to the Street Address and Site Address types and are irrelevant...